Characterization of viruses associated with the zoonotic fish-borne oncogenic liver flukes and applications thereof

Abstract

The invention relates to the discovery of the virus consisting of Opisthorhabdovirus (ORV), Opisthorphenuilivirus (OPLV), Opisthorsivirus (OSV),Clonorsivirus (CSV), Clonorhabdovirus (CRV), Clonorphenuilivirus (CPLV), Schistohaemavirus (ShV), Schistohaematogalivirus (ShTLV), Schistohaemendornavirus (ShMV) and Schistorhabovirus (ShRV) from the Class I carcinogen trematodes Schistosoma haematobium, Opisthorchis viverrini and Clonorchis sinensis and provide evidence of fluke-borne infection of parasitized vertebrate hosts.. The invention provides viruses, nucleic acids, proteins, peptides, and antibodies useful for diagnosis, treatment, and prevention of viral infection and associated diseases.

Description

CHARACTERIZATION OF VIRUSES ASSOCIATED WITH THE ZOONOTIC FISH- BORNE ONCOGENIC LIVER FLUKES AND APPLICATIONS THEREOF BACKGROUND OF THE INVENTION

[0001] Infectious diseases are responsible for > 20% of cancers in the developing world (1). While the pathogens responsible are mostly viruses, infection with a handful of eukaryotic parasitic worms can also cause cancer (1–3). The International Agency for Research on Cancer (IARC) has categorized only three eukaryotic parasites as group 1 carcinogens: the blood fluke Schistosoma haematobium for its role in the development of squamous cell carcinoma of the urinary bladder, and the liver flukes Opisthorchis viverrini and Clonorchis sinensis for their role in cholangiocarcinoma (CCA) - a bile duct cancer that is usually diagnosed at an advanced stage, when the primary cancer is refractory to surgical resection (6–8). Both CCA and SCC have dismal prognosis.

[0002] Liver flukes are a major global health concern with more than 40 million cases of O. viverrini and C. sinensis infections in East Asia and Eurasia (4,6,9–11), whereas Urogenital Schistosomiasis affects 112 Million people in 54 countries throughout sub-Saharan Africa, the Middle East, the Arabic peninsula, and France since 2013 (55, 56, 57). The closely related liver fluke Opisthorchis felineus is also a cause for concern in Europe and large parts of the Russian Federation (12–16), especially since a recent case-control study confirmed that O. felineus infection is also a risk factor for Cholangiocarcinoma (17). Liver fluke infection may persist for up to 25-30 years and remain often asymptomatic. A subset of infected individuals will display a pro- inflammatory phenotype, with increased levels of Interleukin-6 and develop advanced periductal fibrosis and an elevated risk of CCA (4,5). This pro-inflammatory profile and persistent fibrosis may persist even after the anti-helminth treatment Praziquantel removed the fluke infection (18–21). Likewise, in absence of treatment, the asymptomatic excretion of S. haematobium eggs in the urogenital tract can persist for 3 to 5 years, causing haematuria and chronic inflammation that in turn increase the risk of SCC (58-60). To date, the eradication of these flukes through Praziquantel treatment remain the most efficient and least expensive way to prevent the devastating consequences of these cancer (61-62).

[0003] The characterization of viruses that infect parasitic organisms, is driving a paradigm shift in parasitology. Recent studies have shown how parasite-associated viruses contribute actively to modulating host inflammation, and drive parasite pathogenicity (22–24). It has recently been shown that viruses are ubiquitous in platyhelminthes, including liver flukes, which means that parasitized individuals are in fact co-infected by the fluke and all of the viruses that the parasite carries with it (25– 30). Trematodes are infected preferentially by viruses belonging to the orders Mononegavirales, Bunyavirales and Martellivirales, and to a lesser extent to viruses of the order Jingchuvirales and Picornavirales (26,30). Regarding Bunyavirales, the continued and accelerated discovery of bunyavirales highlighted that an order would not suffice to depict the evolutionary relationships of these viruses. Thus, in April 2024, the order was promoted to class Bunyaviricetes. This class currently includes two major orders, Elliovirales (Cruliviridae, Fimoviridae, Hantaviridae, Peribunyaviridae, Phasmaviridae, Tospoviridae, and Tulasviridae) and Hareavirales (Arenaviridae, Discoviridae, Konkoviridae, Leishbuviridae, Mypoviridae, Nairoviridae, Phenuiviridae, and Wupedeviridae), for hundreds of viruses, many of which are pathogenic for humans and other animals, plants, and fungi (68).

[0004] Of note, several novel families and genera of viruses of trematodes are closely related to or have an ancestral position to viruses of vertebrates. Moreover, both experimental and phylogenetic evidence demonstrate that rhabodviruses of trematodes and cestodes are excreted by parasites, have shifted host often over the course of evolution, can infect parasitized vertebrate hosts, and have an ancestral position to most other viruses within the family (26,30).

[0005] Understanding, diagnosing, and treating liver fluke-associated cancer is an important unmet need. The present invention fulfills this need. BRIEF SUMMARY OF THE INVENTION

[0006] The invention encompasses an isolated virus selected from the group consisting of Opisthorhabdovirus (ORV), Opisthorphenuilivirus (OPLV), Opisthorsivirus (OSV), Clonorsivirus (CSV), Clonorhabdovirus (CRV), Clonorphenuilivirus (CPLV), Schistohaemavirus (ShV), Schistohaematogalivirus (ShTLV), Schistohaemendornavirus (ShMV) and Schistorhabovirus (ShRV) or a virus with at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% nucleic acid identity with one of these viruses.

[0007] The invention encompasses a cultured cell comprising an isolated virus selected from the group consisting of Opisthorhabdovirus (ORV), Opisthorphenuilivirus (OPLV), Opisthorsivirus (OSV), Clonorsivirus (CSV), Clonorhabdovirus (CRV), Clonorphenuilivirus (CPLV), Schistohaemavirus (ShV), Schistohaematogalivirus (ShTLV), Schistohaemendornavirus (ShMV) and Schistorhabovirus (ShRV) or a virus with at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% nucleic acid identity with one of these viruses. In some embodiments, the cell is a cholangiocyte cell or urothelial cell, preferably a human cholangiocyte cell or urothelial cell.

[0008] The invention encompasses a recombinant nucleic acid comprising a nucleotide sequence of a virus selected from the group consisting of ORV, OPLV, OSV, CSV, CRV, CPLV, ShV, ShTLV, ShMV and ShRV.

[0009] In some embodiments, the nucleotide sequence is a nucleotide sequence of any of sequences of SEQ ID NO: 1 to SEQ ID NO: 13, SEQ ID NO: 271 to SEQ ID NO: 278, SEQ ID NO: 265 to SEQ ID NO: 270, or the RNA version thereof. In some embodiments, the nucleotide sequence comprises a fragment of at least 10 sequential nucleotides of any of sequences of SEQ ID NO: 1 to SEQ ID NO: 13, SEQ ID NO: 271 to SEQ ID NO: 278, SEQ ID NO: 265 to SEQ ID NO: 270or the RNA version thereof.

[0010] In some embodiments, the nucleotide sequence is a nucleotide sequence of any of sequences of SEQ ID NO: 1 to SEQ ID NO: 13, SEQ ID NO: 271 to SEQ ID NO: 278, SEQ ID NO: 265 to SEQ ID NO: 270 or the complementary sequences thereof. In some embodiments, the nucleotide sequence comprises a fragment of at least 10 sequential nucleotides of any of sequences of SEQ ID NO: 1 to SEQ ID NO: 13, SEQ ID NO: 271 to SEQ ID NO: 278 SEQ ID NO: 265 to SEQ ID NO: 270 or the complementary sequences thereof.

[0011] In some embodiments, the nucleotide sequence is a nucleotide sequence of any of sequences of SEQ ID NO: 1 to SEQ ID NO: 13, SEQ ID NO: 271 to SEQ ID NO: 278, SEQ ID NO: 265 to SEQ ID NO: 270. In some embodiments, the nucleotide sequence comprises a fragment of at least 10 sequential nucleotides of any of sequences of SEQ ID NO: 1 to SEQ ID NO: 13, SEQ ID NO: 271 to SEQ ID NO: 278, SEQ ID NO: 265 to SEQ ID NO: 270.

[0012] In some embodiments, the nucleotide sequence encodes a protein with at least 70%, 80%, 90%, 93%, 95%, 97%, 98%, 99% or 100% identity any of the sequences of SEQ ID NO: 14 to SEQ ID NO: 56, SEQ ID NO: 279 to SEQ ID NO: 303.In some embodiments, the nucleotide sequence comprises or consists of a nucleotide sequence selected from the group consisting of SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 304, SEQ ID NO: 306 and SEQ ID NO: 308.

[0013] The invention encompasses an isolated nucleic acid of a virus selected from the group consisting of ORV, OPLV, OSV, CSV, CRV, CPLV, ShV, ShTLV, ShMV and ShRV for use as a diagnostic reagent.

[0014] The invention encompasses a primer or probe comprising at least 10 sequential nucleotides of any of sequences of SEQ ID NO: 1 to SEQ ID NO: 13, SEQ ID NO: 271 to SEQ ID NO: 278, SEQ ID NO: 265 to SEQ ID NO: 270 or of the complementary sequence thereof. In some embodiments, the primer or probe is labeled with a fluorescent, radioactive, or enzymatic label.

[0015] The invention encompasses a primer or probe comprising or consisting a nucleic acid sequence selected from the group consisting of SEQ ID NO: 57 to SEQ ID NO: 68, SEQ ID NO: 69 to SEQ ID NO: 80, SEQ ID NO: 87 to SEQ ID NO: 156, SEQ ID NO: 157 to SEQ ID NO: 198, SEQ ID NO: 199 to SEQ ID NO: 204, SEQ ID NO: 205 to SEQ ID NO: 264.

[0016] The invention encompasses a pair of primers able to produce the amplicons comprised in or consisting of the nucleic acid sequence selected from the group consisting of SEQ ID NO: 1-13, SEQ ID NO: 271 to 278, SEQ ID NO: 265 to 270.

[0017] The invention encompasses a kit comprising a primer or probe of the invention and amplification and / or hybridization reagents.

[0018] The invention encompasses the use of the recombinant nucleic acid of the invention or the primer or probe of the invention in a diagnostic assay.

[0019] The invention encompasses a method of detecting a virus selected from the group consisting of Opisthorhabdovirus (ORV), Opisthorphenuilivirus (OPLV), Opisthorsivirus (OSV), Clonorsivirus (CSV), Clonorhabdovirus (CRV), Clonorphenuilivirus (CPLV), Schistohaemavirus (ShV), Schistohaematogalivirus (ShTLV), Schistohaemendornavirus (ShMV) and Schistorhabovirus (ShRV) or a virus with at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% nucleic acid identity with one of these viruses comprising contacting a primer or probe of the invention with a biological sample and detecting the presence or absence of the viral nucleic acid in the sample.

[0020] The invention encompasses isolated protein or peptide of a virus selected from the group consisting of Opisthorhabdovirus (ORV), Opisthorphenuilivirus (OPLV),Opisthorsivirus (OSV), Clonorsivirus (CSV), Clonorhabdovirus (CRV), Clonorphenuilivirus (CPLV), Schistohaemavirus (ShV), Schistohaematogalivirus (ShTLV), Schistohaemendornavirus (ShMV) and Schistorhabovirus (ShRV) or a virus with at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% nucleic acid identity with one of these viruses for use as a diagnostic reagent.

[0021] The invention encompasses a protein or peptide of the invention for use as a vaccine.

[0022] The invention encompasses an isolated protein or peptide comprising at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, or 50 consecutive amino acids of any of the amino sequences of SEQ ID NO: 14 to SEQ ID NO: 56, SEQ ID NO: 279 to SEQ ID NO: 303.

[0023] The invention encompasses an isolated protein of the invention for use as a diagnostic agent or as a vaccine.

[0024] The invention encompasses an isolated antibody that binds specifically to an isolated protein of the invention.

[0025] The invention encompasses the use of the protein or peptide of the invention as an antigen in a diagnostic assay or in a vaccine.

[0026] The invention encompasses a method of detecting a virus selected from the group consisting of Opisthorhabdovirus (ORV), Opisthorphenuilivirus (OPLV), Opisthorsivirus (OSV), Clonorsivirus (CSV), Clonorhabdovirus (CRV), Clonorphenuilivirus (CPLV), Schistohaemavirus (ShV), Schistohaematogalivirus (ShTLV), Schistohaemendornavirus (ShMV) and Schistorhabovirus (ShRV) or a virus with at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% nucleic acid identity with one of these viruses comprising contacting a protein or peptide of the invention or the isolated antibody of the invention with a biological sample and detecting the protein-antibody complexes formed.

[0027] The invention encompasses an immunogenic composition or vaccine composition comprising the protein or peptide of the invention.

[0028] The invention encompasses a method comprising administering the immunogenic composition or vaccine composition of the invention to a human, cat, dog, or other animal. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 Genome composition of complete sequences of RNA viruses associated with the liver flukes O. viverrini and C. sinensis and with the urinary blood fluke S. haematobium. Open reading frames were predicted using ORF finder and Conserved domains were predicted using NCBI conserved domain search.

[0030] Figure 2 Phylogenetic trees of the RNA-directed RNA polymerases (RdRPs) of RNA viruses of the family Rhabdoviridae and orders Bunyavirales and Martellivirales. Viruses of O. viverrini are indicated with an arrow, or in bold. The ORV belongs to a novel genus of liver-fluke associated rhabdoviruses tentatively named “Antebetarhabdovirus”. The OPLV belongs to a novel family of flatworm-associated bunyaviruses tentatively named “Phenuiliviridae”. The OSV belongs to a novel family of liver-fluke associated martelliviruses tentatively named “Prenviridae”. The trees were inferred in PhyML.

[0031] Figure 3 Phylogenetic of the RNA-directed RNA polymerases RdRPs of RNA viruses of the order Martellivirales. Viruses of O. viverrini, C. sinensis and S. haematobium are highlighted. The phylogenetic tree was inferred after MAFFT alignment of the RNA-directed RNA polymerases of RNA viruses with all ICTV-classified viruses and up to 20 unclassified viruses that are more closely related to the newly discovered viruses. The trees were obtained using PhyML with the LG substitution model. Branch points indicate that results of Shimodaira-Hasgawa branch test > 0.9.

[0032] Figure 4 Phylogenetic trees of the RNA-directed RNA polymerases RdRPs of RNA viruses of the family Rhabdoviridae. Viruses of O. viverrini, C. sinensis and S. haematobium are indicated in bold. The phylogenetic trees were obtained as in Figure 3.

[0033] Figure 5 Phylogenetic trees of the RNA-directed RNA polymerases RdRPs of RNA viruses of the order Hareavirales. Viruses of O. viverrini, C. sinensis and S. haematobium are indicated in bold. The phylogenetic trees were obtained as in Figure 3.

[0034] Figure 6 Validation on agarose gels of the detection of ORV, OSV and OPLV through RT-qPCR.

[0035] Figure 7 Detection of ORV, OSV and OPLV through RT-qPCR in 1000 cercariae of O. viverrini.

[0036] Figure 8 Detection of ORV, OSV and OPLV through RT-qPCR in 3 pools of 3000 newly excited juveniles (NEJ) of O. viverrini.

[0037] Figure 9 Detection of ORV, OSV and OPLV through RT-qPCR in individual adult worms of O. viverrini.

[0038] Figure 10 Prevalence of the detection ORV, OSV and OPLV in individual adult worms of O. viverrini.

[0039] Figure 11 Size distribution, polarity and the 5-terminal nucleotide of total vsiRNA from the exosome libraries. Results were reproducible across sequencing libraries and biological replicates. The plots show the cumulated values of 2 biological replicates. The relative abundance of the different-size sense (top) and antisense (bottom) vsiRNAs is shown.

[0040] Figure 12 Representative images of multiplex imaging of (+) RNA and (- ) RNA of ORV within two adult worms of O. viverrini. Nuclei are stained with DAPI. A) the image shows two individuals highly infected by OSV. B) virus replication is observed in the parasite tegument.

[0041] Figure 13 Representative images of multiplex imaging of (+) RNA and (- ) RNA of OPLV within two adult worms of O. viverrini. Nuclei are stained with DAPI. A) the image shows two individuals highly infected by ORV. B) virus replication is observed in the parasite tegument.

[0042] Figure 14 Representative images of multiplex imaging of (+) RNA and (- ) RNA of OSV within two adult worms of O. viverrini. Nuclei are stained with DAPI. A) the image shows two individuals highly infected by OPLV. B) virus replication is observed in the parasite tegument.

[0043] Figure 15 Detection of fluke-borne viruses in tissues and feces of hamsters parasitized by O. viverrini. ORV, OSV and OPLV were detected within the liver, kidney and stool pellets of hamsters experimentally parasitized by O. viverrini.

[0044] Figure 16 Seroconversion of O. viverrini infected hosts measured by LuLISA. All five hamsters experimentally infected by O. viverrini developed antibodies against ORV, OSV and OPLV as well as against the parasite antigen TSP-2.

[0045] Figure 17 Measure of the IgG titer in hamster. The Antibody Titer was determined as the last dilution in which the ratio of signal between the positive sample and the negative sample was superior to or equal to 2.0.

[0046] Figure 18 Representative images of multiplex imaging of (+) RNA and (- ) RNA of ORV and OPLV in cholangiocytes cells of hamsters experimentally parasitized by O. viverrini. Nuclei are stained with DAPI.

[0047] Figure 19 Observation of cytopathic effects after a blind passage of viruses on Human cholangiocyte cells. A) Protocol B) Observation of cytopathic effects in cells exposed to OvEV viruses after 3- and 7-days post inoculation. C) Detection of the ORV nucleic acid using PCR on cells exposed to OvEV viruses after 3- and 7-days post inoculation.

[0048] Figure 20 Quantification of total IgG antibodies targeting TSP2 is displayed as A) histograms of the distribution of IgG titers in serum of French non- endemic patients (light grey) and in O. viverrini parasitized patients from Thailand (dark grey). B) Results were further analyzed by receiver-operator characteristics (ROC) curve analysis to assess the accuracy of the test and calculate specificity and sensitivity values.

[0049] Figure 21 Quantification of total IgG antibodies targeting ORV is displayed as A) histograms of the distribution of IgG titers in serum of French non- endemic patients (light grey) and in O. viverrini parasitized patients from Thailand (dark grey). B) Results were further analyzed by receiver-operator characteristics (ROC) curve analysis to assess the accuracy of the test and calculate specificity and sensitivity values.

[0050] Figure 22 Quantification of total IgG antibodies targeting OSV is displayed as A) histograms of the distribution of IgG titers in serum of French non- endemic patients (light grey) and in O. viverrini parasitized patients from Thailand (dark grey). B) Results were further analyzed by receiver-operator characteristics (ROC) curve analysis to assess the accuracy of the test and calculate specificity and sensitivity values.

[0051] Figure 23 Quantification of total IgG antibodies targeting OPLV is displayed as A) histograms of the distribution of IgG titers in serum of French non- endemic patients (light grey) and in O. viverrini parasitized patients from Thailand (dark grey). B) Results were further analyzed by receiver-operator characteristics (ROC) curve analysis to assess the accuracy of the test and calculate specificity and sensitivity values.

[0052] Figure 24 Distribution of IgG targeting TSP2 titers in French non- endemic patients (very light grey), Thai O. viverrini patients without APF (middle light grey), Thai O. viverrini parasitized patients with APF (middle dark grey), and Thai O. viverrini parasitized patients with CCA (dark grey).

[0053] Figure 25 Distribution of IgG targeting ORV titers A) in French non- endemic patients (very light grey), Thai O. viverrini patients without APF (middle light grey), Thai O. viverrini parasitized patients with APF (middle dark grey), and Thai O. viverrini parasitized patients with CCA (dark grey). B) Results were further analyzed by receiver-operator characteristics (ROC) curve analysis to assess the accuracy of the test for the detection of advanced periductal fibrosis and calculate specificity and sensitivity values.

[0054] Figure 26 Distribution of IgG targeting OSV titers A) in French non- endemic patients (very light grey), Thai O. viverrini patients without APF (middle light grey), Thai O. viverrini parasitized patients with APF (middle dark grey), and Thai O. viverrini parasitized patients with CCA (dark grey). B) Results were further analyzed by receiver-operator characteristics (ROC) curve analysis to assess the accuracy of the test for the detection of advanced periductal fibrosis and calculate specificity and sensitivity values.

[0055] Figure 27 A) Distribution of IgG targeting OPLV titers in French non- endemic patients (very light grey), Thai O. viverrini patients without APF (middle light grey), Thai O. viverrini parasitized patients with APF (middle dark grey), and Thai O. viverrini parasitized patients with CCA (dark grey). B) Results were further analyzed by receiver-operator characteristics (ROC) curve analysis to assess the accuracy of the test for the detection of advanced periductal fibrosis and calculate specificity and sensitivity values.

[0056] Figure 28 LuLISA standard curves. The figure represents the increase in Bioluminescence signal (RLU / s) related to the antibody concentration in well (in ng / ul) for OPLV (middle light grey), OSV (light grey), ORV (middle dark grey) and TSP2 (dark grey) antigens. Theses standard curves are used to transform RLU / s in RU (Relative Unit for LuLISA).

[0057] Figure 29 Avidity index of IgG against TSP2 antigen. Thai O. viverrini patients without APF (middle light grey), Thai O. viverrini parasitized patients with APF (middle dark grey), and Thai O. viverrini parasitized patients with CCA (dark grey).

[0058] Figure 30 Avidity index of IgG against ORV Nucleoprotein antigen. Thai O. viverrini patients without APF (middle light grey), Thai O. viverrini parasitized patients with APF (middle dark grey), and Thai O. viverrini parasitized patients with CCA (dark grey).

[0059] Figure 31 Avidity index of IgG against OSV antigen. Thai O. viverrini patients without APF (middle light grey), Thai O. viverrini parasitized patients with APF (middle dark grey), and Thai O. viverrini parasitized patients with CCA (dark grey).

[0060] Figure 32 Avidity index of IgG against OPLV antigen. Thai O. viverrini patients without APF (middle light grey), Thai O. viverrini parasitized patients with APF (middle dark grey), and Thai O. viverrini parasitized patients with CCA (dark grey).

[0061] Figure 33 SDS-PAGE of nucleoproteins and VHH-JAZ. A) Fractions of NP (ORV) separated from lysate using His-tag-affinity chromatography in imidazole concentration gradient. B) NP (ORV lane 1, OPLV as dimer lane 2) after size-exclusion chromatography, and anti-human IgG VHH-JAZ (3), anti-human IgA VHH-JAZ (4), anti- human IgM VHH-JAZ (5), anti-mouse / hamster kappa VHH-JAZ (6) used as quantification reagents in the serologic LuLISA. Molecular weight scale ladders are shown on the left of the stain-free 4-15% acrylamide-bisacrylamide electrophoresis gels in SDS 10%. DETAILED DESCRIPTION OF THE INVENTION

[0062] The invention relates to the discovery of viruses from the Class I carcinogens trematodes Schistosoma haematobium, Opisthorchis viverrini and Clonorchisis sinensis and provide characterization of their genome composition, phylogeny and relationship to viruses of C. sinensis. It is also provided evidence of O. viverrini fluke-borne infection of parasitized vertebrate hosts. Moreover, it was demonstrated that antibody titers against the Opisthorhabdovirus are significantly increased in O. viverrini infected individuals with advanced periductal fibrosis, a precursor of cholangiocarcinoma. These results indicate that fluke-borne viruses may actively contribute to the development of fluke-associated hepatobiliary diseases, including cholangiocarcinoma.

[0063] Until now, E / S proteins of liver flukes have been found to modulate angiogenesis, proliferation and pro-inflammatory response, that should rather be defined as exacerbating causes that compromise hosts restraints on cancer. In the search for the causal factors of CCA, this discovery is a departure from the status-quo by shifting focus towards viruses of liver flukes. It is widely known that viruses are responsible for 10-15% of the world cancer burden (2). Oncogenic viruses establish long-term persistent infection, and it is the cell-cycle manipulations used to promotereplication and transmission that disrupt the cellular barriers to cancer and eventually promote carcinogenesis (25,44).

[0064] Moreover, evidence of the transmission of fluke viruses to the vertebrate host and stimulation of the host immune response was generated. These data demonstrate that parasitized hosts are chronically exposed and infected by fluke viruses. Thus, all experimental and epidemiological data that supported the classification of O. viverrini and C. sinensis as group 1 carcinogens should be re-analyzed in light of the discovery of fluke-borne viruses, the covert stow-aways of liver fluke infection. This knowledge has the potential to inform early detection of cancer, therapeutic development, and improved prognosis. Isolated viruses

[0065] The invention encompasses an isolated Opisthorchis viverrini virus. In some embodiments, the Opisthorchis viverrini virus is selected from the group consisting of Opisthorhabdovirus (ORV) Opisthorphenuilivirus (OPLV), and Opisthorsivirus (OSV).

[0066] Table 1 Parasite: Opisthorchis viverrini Virus Nucleotide sequence comprised in Amino acid sequence comprised in the viruses the viruses Opisthorhabdovirus Opsithorhabdovirus var ORV_ORF1 var (SEQ ID NO: 281) (ORV) (SEQ ID NO:274) ORV_ORF2 var (SEQ ID NO: 282) Opsithorhabdovirus ORV_ORF3 var (SEQ ID NO: 283) (SEQ ID NO: 6) ORV_ORF4 var (SEQ ID NO: 284) ORV_ORF5 var (SEQ ID NO: 285) ORV_ORF6 var (SEQ ID NO: 286) Opsithorhabdovirus_orf1 (SEQ ID NO: 41) Opsithorhabdovirus_orf2 (SEQ ID NO: 44) opsithorhabdovirus_orf3(SEQ ID NO: 47) opsithorhabdovirus_orf4 (SEQ ID NO: 50) opsithorhabdovirus_orf5 (SEQ ID NO: 53) opsithorhabdovirus_orf6 (SEQ ID NO: 56) Opisthorphenuilivirus Opisthorphenuilivirus_seg1 var OPLV_Seg1_orf var (OPLV) (SEQ ID NO: 272) (SEQ ID NO: 279) Opisthorphenuilivirus_seg2 var OPLV_Seg2_orf var (SEQ ID NO: 273) (SEQ ID NO: 280) Opisthorphenuilivirus_seg1_major Opisthorphenuilivirus_seg1_major_orf1 (SEQ ID NO: 2) (SEQ ID NO: 15) Opisthorphenuilivirus_seg1_minor Opisthorphenuilivirus_seg1_minor_orf1 (SEQ ID NO: 3) (SEQ ID NO: 16) Opisthorphenuilivirus_seg2_major Opisthorphenuilivirus_seg2_major_orf1 (SEQ ID NO: 4) (SEQ ID NO: 18) Opisthorphenuilivirus_seg2_minor Opisthorphenuilivirus_seg2_minor_orf1 (SEQ ID NO: 5) (SEQ ID NO: 19) Opisthorphenuilivirus_seg2_major_orfC1 (SEQ ID NO: 21) Opisthorphenuilivirus_seg2_minor_orfC1 (SEQ ID NO: 33)Opisthorsivirus (OSV) Opisthorsivirus var OSV_ORF1 var (SEQ ID NO: 287) (SEQ ID NO: 271) OSV_ORF2 var (SEQ ID NO: 288) Opisthorsivirus (SEQ ID NO: 1) OSV_ORF3 var (SEQ ID NO: 289) OSV_ORF4 var (SEQ ID NO: 290) OSV_ORF4b var (SEQ ID NO: 291) Opisthorsivirus_orf1 (SEQ ID NO: 25) Opisthorsivirus_orf2 (SEQ ID NO: 29) Opisthorsivirus_orf4 (SEQ ID NO: 37) Opisthorsivirus_orf3 (SEQ ID NO: 38)

[0067] The invention also encompasses an isolated Clonorchis sinensis virus. In some embodiments, the Clonorchis sinensis virus is selected from the group consisting of Clonorsivirus (CSV), Clonorhabdovirus (CRV), and Clonorphenuilivirus (CPLV).

[0068] Table 2 Parasite: Clonorchis sinensisVirus Nucleotide sequence comprised in Amino acid sequence comprised in the viruses the viruses Clonorsivirus (CSV) Clonorsivirus1 (SEQ ID NO: 7) Clonorsivirus2partial (SEQ ID NO: 8) Clonorsivirus1_orf1 (SEQ ID NO: 22) Clonorsivirus3 (SEQ ID NO: 9) Clonorsivirus2_orf1 (SEQ ID NO: 23) Clonorsivirus3_orf1 (SEQ ID NO: 24) Clonorsivirus1_orf2 (SEQ ID NO: 26) Clonorsivirus2_orf2 (SEQ ID NO: 27) Clonorsivirus3_orf2 (SEQ ID NO: 28) Clonorsivirus1_orf3 (SEQ ID NO: 30) Clonorsivirus2_orf3 (SEQ ID NO: 31) Clonorsivirus3_orf3 (SEQ ID NO: 32) Clonorsivirus1_orf4 (SEQ ID NO: 34) Clonorsivirus2_orf4 (SEQ ID NO: 35) Clonorsivirus3_orf4 (SEQ ID NO: 36) Clonorhabdovirus Clonorhabdovirus1 (SEQ ID NO: 12) Clonorhabdovirus1_orf1 (CRV) Clonorhabdovirus2 (SEQ ID NO: 13) (SEQ ID NO: 39) Clonorhabdovirus2_orf1 (SEQ ID NO: 40) Clonorhabdovirus1_orf2 (SEQ ID NO: 42) Clonorhabdovirus2_orf2 (SEQ ID NO: 43) Clonorhabdovirus1_orf3 (SEQ ID NO: 45) Clonorhabdovirus2_orf3 (SEQ ID NO: 46) Clonorhabdovirus1_orf4 (SEQ ID NO: 48) Clonorhabdovirus2_orf4 (SEQ ID NO: 49) Clonorhabdovirus1_orf5 (SEQ ID NO: 51) Clonorhabdovirus2_orf5 (SEQ ID NO: 52) Clonorhabdovirus1_orf6 (SEQ ID NO: 54) Clonorhabdovirus2_orf6 (SEQ ID NO: 55)Clonorphenuilivirus ClonorchiPhenuilivirusseg1 ClonorchiPhenuilivirusseg1_orf1 (SEQ (CPLV) (SEQ ID NO: 10) ID NO: 14) Clonorchiphenuilivirusseg2 Clonorchiphenuilivirusseg2_orf1 (SEQ (SEQ ID NO: 11) ID NO: 17) Clonorchiphenuilivirusseg2_orfC1 (SEQ ID NO: 20)

[0069] The invention also encompasses an isolated Schistosoma haematobium virus. In some embodiments, the Schistosoma haematobium virus is selected from the group consisting of Schistohaemavirus (ShV), Schistohaematogalivirus (ShTLV), Schistohaemendornavirus (ShMV) and Schistorhabovirus (ShRV).

[0070] Table 3 Parasite: Schistosoma haematobium Virus Nucleotide sequence comprised in Amino acid sequence comprised the viruses in the viruses Schistohaemavirus (ShV), Schistohaemavirus (SEQ ID NO: 275) ShV_ORF1 (SEQ ID NO: 301) ShV_ORF2 (SEQ ID NO: 302) ShV_ORF3 (SEQ ID NO: 303) Schistohaematogalivirus Schistohaematogalivirus ShTLV_ORF1 var (ShTLV), (SEQ ID NO: 276) (SEQ ID NO: 298) ShTLV_ORF2 var (SEQ ID NO: 299) Schistohaemendornavirus Schistohaemendorna virus ShMV_ORF var (SEQ ID NO: 300) (ShMV) (SEQ ID NO: 278) Schistorhabovirus (ShRV) Schistohaemarhabdovirus ShRV_ORF1 var (SEQ ID NO: 292) (SEQ ID NO: 277) ShRV_ORF2 var (SEQ ID NO: 293) ShRV_ORF3 var (SEQ ID NO: 294) ShRV_ORF4 var (SEQ ID NO: 295) ShRV_ORF5 var (SEQ ID NO: 296) ShRV_ORF6 var (SEQ ID NO: 297)

[0071] The above viruses can be isolated from excretory / secretory products of adult flukes as set forth in the Examples.

[0072] The isolation of fluke-borne viruses from adult flukes, extracellular products, parasitized host tissues, and / or purified / enriched OptiPrep fractions can beaccomplished using in vitro culture systems. For example, Vero cells (primate epithelial kidney cells), H69 cells (human cholangiocytes), or BHK-21 cells (baby hamster kidney fibroblast cells) can be used for virus isolation (45,46).

[0073] Cells can be inoculated with parasite lysates, extracellular products secreted by the flukes, or viral fractions at several dilutions according to viral genome copy quantification, and viral infection analyzed by observation of cytopathic effects and viral RNA detection in cell pellet and supernatant for up to 7 days post-inoculation. Several passages on cells may be conducted to increase virus adaptation to the in vitro system.

[0074] If several viruses are co-isolated, these can be cloned by the limiting dilution approach to subculture a single viral particle with a single cell (Multiplicity of Infection MOI=1). The infectious titer of viral stocks can be assessed by standard PFU or TCID50 titration methods. The genome of viral stocks can be sequenced and compared to the wild-type viral strain using amplicon-based sequencing.

[0075] The invention encompasses isolated viruses and cloned virus stocks.

[0076] In some embodiments, the isolated virus is a fluke-borne virus.

[0077] In some embodiments, the isolated viruses are vectored by liver flukes or blood flukes. In some embodiments this includes O. viverrini, O. felineus, C. siniensis and S. haematobium. In some embodiments, the isolated virus is from a fluke that can infect humans, but does not cause cancer, such as those from Metorchis orientalis, Fasciola hepatica, Fasciola gigantica and Schistosoma sp..

[0078] In some embodiments, the isolated virus is a rhabdovirus of the order Mononegavirales, preferably within the proposed Antebetarhabdovirus genus or the proposed Amalivirus.

[0079] In some embodiments, the isolated virus is within the order hareavirales, preferably within the proposed Phenuiliviridae (Phenuiviridae-like virus family).

[0080] In some embodiments, the isolated virus is within the order Martellivirales, preferably in the proposed Prenviridae family, the proposed Togaliviridae or the genus Alphaendornavirus.

[0081] Preferably, the isolated virus is the Opisthorhabdovirus (ORV), Opisthorphenuilivirus (OPLV), or Opisthorsivirus (OSV) identified herein, or a virus with at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% nucleic acid identity with one of these viruses.

[0082] In some embodiments, the nucleic acid is from a virus from a liver fluke including Opisthorchis viverrini, Clonorchis sinensis, Opisthorchis felineus, Metorchis orientalis, Fasciola hepatica and Fasciola gigantica or from a blood fluke such as Schistosoma haematobium.

[0083] In some embodiments, the isolated virus comprises a nucleotide sequence of at least 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or all nucleotides of any of the following sequences: >Opisthorsivirus var (SEQ ID NO: 271) >Opisthorphenuilivirus_seg1 var (SEQ ID NO: 272) >Opisthorphenuilivirus_seg2 var (SEQ ID NO: 273) >Opsithorhabdovirus var (SEQ ID NO:274) >Opisthorsivirus (SEQ ID NO: 1) >Opisthorphenuilivirus_seg1_major (SEQ ID NO: 2) >Opisthorphenuilivirus_seg1_minor (SEQ ID NO: 3) >Opisthorphenuilivirus_seg2_major (SEQ ID NO: 4) >Opisthorphenuilivirus_seg2_minor (SEQ ID NO: 5) >opsithorhabdovirus (SEQ ID NO: 6)

[0084] Unless otherwise specified, the nucleotide sequence of the viral genome sequences are disclosed as DNA sequences corresponding to RNA+ strand of said virus.

[0085] In some embodiments, the isolated virus comprises a nucleotide sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity with at least 10, 15, 20, 30, 40, 50, 60, 7080, 90, 100, 150, 200, 250, 300, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or all nucleotides of any of SEQ ID NO: 1-6, SEQ ID NO: 271-274or the RNA version thereof. The RNA version may be the positive and negative strand nucleotide sequences.

[0086] In some embodiments, the isolated virus comprises a nucleotide sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity with at least 10, 15, 20, 30, 40, 50, 60, 7080, 90, 100, 150, 200, 250, 300, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or all nucleotides of any of SEQ ID NO: 1-6, SEQ ID NO: 271-274 or the complementary sequences thereof.

[0087] In some embodiments, the isolated virus comprises a nucleotide sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity with at least 10, 15, 20, 30, 40, 50, 60, 7080, 90, 100, 150, 200, 250, 300, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or all nucleotides of any of SEQ ID NO: 1-6, SEQ ID NO: 271-274.

[0088] In some embodiments, the isolated virus comprises a nucleotide sequence of at least 10, 15, 20, 30, 40, 50, 60, 7080, 90, 100, 150, 200, 250, 300, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or all nucleotides of any of the following sequences: >Clonorsivirus1 (SEQ ID NO: 7) >Clonorsivirus2partial (SEQ ID NO: 8) >Clonorsivirus3 (SEQ ID NO: 9) >ClonorchiPhenuilivirusseg1 (SEQ ID NO: 10) >Clonorchiphenuilivirusseg2 (SEQ ID NO: 11) >Clonorhabdovirus1 (SEQ ID NO: 12) >Clonorhabdovirus2 (SEQ ID NO: 13)

[0089] In some embodiments, the isolated virus comprises a nucleotide sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity with at least 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or all nucleotides of any of SEQ ID NO: 7-13, or the RNA version thereof. The RNA version may be of the positive and negative strand nucleotide sequences.

[0090] In some embodiments, the isolated virus comprises a nucleotide sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity with at least 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or all nucleotides of any of SEQ ID NO: 7-13 or the complementary sequences thereof.

[0091] In some embodiments, the isolated virus comprises a nucleotide sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity with at least 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or all nucleotides of any of SEQ ID NO: 7-13.

[0092] In some embodiments, the isolated virus comprises a nucleotide sequence of at least 10, 15, 20, 30, 40, 50, 60, 7080, 90, 100, 150, 200, 250, 300, 500,1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or all nucleotides of any of the following sequences: >Schistohaemavirus (SEQ ID NO: 275) >Schistohaematogalivirus (SEQ ID NO: 276) >Schistohaemarhabdovirus (SEQ ID NO: 277) >Schistohaemendorna virus (SEQ ID NO: 278)

[0093] In some embodiments, the isolated virus comprises a nucleotide sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity with at least 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or all nucleotides of any of SEQ ID NO: 275-278 or the RNA version thereof. The RNA version may be of the positive and negative strand nucleotide sequences.

[0094] In some embodiments, the isolated virus comprises a nucleotide sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity with at least 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or all nucleotides of any of SEQ ID NO: 275-278 or the complementary sequences thereof.

[0095] In some embodiments, the isolated virus comprises a nucleotide sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity with at least 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or all nucleotides of any of SEQ ID NO: 275-278.

[0096] In some embodiments, the isolated virus comprises a nucleotide sequence encoding at least 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 500, 1000, 2000, or all amino acids of any of the following sequences: >OPLV_Seg1_orf var (SEQ ID NO: 279) >OPLV_Seg2_orf var (SEQ ID NO: 280) >ORV_ORF1 var (SEQ ID NO: 281) >ORV_ORF2 var (SEQ ID NO: 282) >ORV_ORF3 var (SEQ ID NO: 283) >ORV_ORF4 var (SEQ ID NO: 284) >ORV_ORF5 var (SEQ ID NO: 285)>ORV_ORF6 var (SEQ ID NO: 286) >OSV_ORF1 var (SEQ ID NO: 287) >OSV_ORF2 var (SEQ ID NO: 288) >OSV_ORF3 var (SEQ ID NO: 289) >OSV_ORF4 var (SEQ ID NO: 290) >OSV_ORF4b var (SEQ ID NO: 291) >ShRV_ORF1 var (SEQ ID NO: 292) >ShRV_ORF2 var (SEQ ID NO: 293) >ShRV_ORF3 var (SEQ ID NO: 294) >ShRV_ORF4 var (SEQ ID NO: 295) >ShRV_ORF5 var (SEQ ID NO: 296) >ShRV_ORF6 var (SEQ ID NO: 297) >ShTLV_ORF1 var (SEQ ID NO: 298) >ShTLV_ORF2 var (SEQ ID NO: 299) >ShMV_ORF var (SEQ ID NO: 300) >ShV_ORF1 (SEQ ID NO: 301) >ShV_ORF2 (SEQ ID NO: 302) >ShV_ORF3 (SEQ ID NO: 303) >ClonorchiPhenuilivirusseg1_orf1 (SEQ ID NO: 14) >Opisthorphenuilivirus_seg1_major_orf1 (SEQ ID NO: 15) >Opisthorphenuilivirus_seg1_minor_orf1 (SEQ ID NO: 16) >Clonorchiphenuilivirusseg2_orf1 (SEQ ID NO: 17) >Opisthorphenuilivirus_seg2_major_orf1 (SEQ ID NO: 18) >Opisthorphenuilivirus_seg2_minor_orf1 (SEQ ID NO: 19) >Clonorchiphenuilivirusseg2_orfC1 (SEQ ID NO: 20) >Opisthorphenuilivirus_seg2_major_orfC1 (SEQ ID NO: 21) >Clonorsivirus1_orf1 (SEQ ID NO: 22) >Clonorsivirus2_orf1 (SEQ ID NO: 23) >Clonorsivirus3_orf1 (SEQ ID NO: 24) >Opisthorsivirus_orf1 (SEQ ID NO: 25) >Clonorsivirus1_orf2 (SEQ ID NO: 26) >Clonorsivirus2_orf2 (SEQ ID NO: 27)>Clonorsivirus3_orf2 (SEQ ID NO: 28) >Opisthorsivirus_orf2 (SEQ ID NO: 29) >Clonorsivirus1_orf3 (SEQ ID NO: 30) >Clonorsivirus2_orf3 (SEQ ID NO: 31) >Clonorsivirus3_orf3 (SEQ ID NO: 32) >Opisthorphenuilivirus_seg2_minor_orfC1 (SEQ ID NO: 33) >Clonorsivirus1_orf4 (SEQ ID NO: 34) >Clonorsivirus2_orf4 (SEQ ID NO: 35) >Clonorsivirus3_orf4 (SEQ ID NO: 36) >Opisthorsivirus_orf4 (SEQ ID NO: 37) >Opisthorsivirus_orf3 (SEQ ID NO: 38) >Clonorhabdovirus1_orf1 (SEQ ID NO: 39) >Clonorhabdovirus2_orf1 (SEQ ID NO: 40) >Opsithorhabdovirus_orf1 (SEQ ID NO: 41) >Clonorhabdovirus1_orf2 (SEQ ID NO: 42) >Clonorhabdovirus2_orf2 (SEQ ID NO: 43) >Opsithorhabdovirus_orf2 (SEQ ID NO: 44) >Clonorhabdovirus1_orf3 (SEQ ID NO: 45) >Clonorhabdovirus2_orf3 (SEQ ID NO: 46) >opsithorhabdovirus_orf3 (SEQ ID NO: 47) >Clonorhabdovirus1_orf4 (SEQ ID NO: 48) >Clonorhabdovirus2_orf4 (SEQ ID NO: 49) >opsithorhabdovirus_orf4 (SEQ ID NO: 50) >Clonorhabdovirus1_orf5 (SEQ ID NO: 51) >Clonorhabdovirus2_orf5 (SEQ ID NO: 52) >opsithorhabdovirus_orf5 (SEQ ID NO: 53) >Clonorhabdovirus1_orf6 (SEQ ID NO: 54) >Clonorhabdovirus2_orf6 (SEQ ID NO: 55) >opsithorhabdovirus_orf6 (SEQ ID NO: 56)

[0097] In some embodiments, the isolated virus comprises a nucleotide sequence encoding an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity with at least 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 500, 1000, 2000, or all amino acids of any of SEQ ID NO: 14 to 56, SEQ ID NO: 279 to 303.

[0098] The invention encompasses recombinant viruses of the invention containing a heterologous DNA. Infected cells

[0099] The invention encompassed cultured cells infected with any of the isolated viruses of the invention.

[0100] In some embodiments, the cells are Vero cells (primate epithelial kidney cells), H69 cells (human cholangiocytes), or BHK-21 cells (baby hamster kidney fibroblast cells). Preferably the cells are human cholangiocytes.

[0101] The cultured cells can comprise at least 103, 104, 105, 106or 107infected cells. Nucleic acids and vectors

[0102] The invention encompasses isolated and recombinant nucleic acids and vectors comprising them. The nucleic acid can be a DNA or an RNA.

[0103] In some embodiments, the isolated or recombinant nucleic acid or vector comprises a sequence of at least 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or all nucleotides of any of SEQ ID NO: 1 to SEQ ID NO: 13, SEQ ID NO: 271 to SEQ ID NO: 278, SEQ ID NO: 265 to SEQ ID NO: 270 or the RNA version thereof. The RNA version may be of the positive and negative strand nucleotide sequences.

[0104] In some embodiments, the isolated or recombinant nucleic acid or vector comprises a sequence of at least 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or all nucleotides of any of SEQ ID NO: 1 to SEQ ID NO: 13, SEQ ID NO: 271 to SEQ ID NO: 278, SEQ ID NO: 265 to SEQ ID NO: 270 or the complementary sequence thereof.

[0105] In some embodiments, the isolated or recombinant nucleic acid or vector comprises a sequence of at least 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or all nucleotides of any of SEQ ID NO: 1 to SEQ ID NO: 13, SEQ ID NO: 271 to SEQ ID NO: 278, SEQ ID NO: 265 to SEQ ID NO: 270.

[0106] In some embodiments, the nucleic acid is from a virus from a liver fluke including Opisthorchis viverrini, Clonorchis sinensis, Opisthorchis felineus, Metorchis orientalis, Fasciola hepatica and Fasciola gigantica or a blood fluke including Schistosoma haematobium.

[0107] In some embodiments, the isolated or recombinant nucleic acid or vector comprises a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity with at least 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or all nucleotides of any of SEQ ID NO: 1 to SEQ ID NO: 13, SEQ ID NO: 271 to SEQ ID NO: 278, SEQ ID NO: 265 to SEQ ID NO: 270 or the RNA version thereof. The RNA version thereof may be of the positive and negative strand nucleotide sequences.

[0108] In some embodiments, the isolated or recombinant nucleic acid or vector comprises a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity with at least 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or all nucleotides of any of SEQ ID NO: 1 to SEQ ID NO: 13, SEQ ID NO: 271 to SEQ ID NO: 278, SEQ ID NO: 265 to SEQ ID NO: 270 or the complementary sequences thereof.

[0109] In some embodiments, the isolated or recombinant nucleic acid or vector comprises a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity with at least 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or all nucleotides of any of SEQ ID NO: 1 to SEQ ID NO: 13, SEQ ID NO: 271 to SEQ ID NO: 278, SEQ ID NO: 265 to SEQ ID NO: 270.

[0110] In some embodiments, the isolated or recombinant nucleic acid or vector comprises a sequence encoding at least 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 500, 1000, 2000, or all amino acids of any of SEQ ID NO: 14 to SEQ ID NO: 56, SEQ ID NO: 279 to SEQ ID NO: 303, or the RNA version thereof. The RNA version may be of the positive and negative strand nucleotide sequences.

[0111] In some embodiments, the isolated or recombinant nucleic acid or vector comprises a sequence encoding at least 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 500, 1000, 2000, or all amino acids of any of SEQ ID NO: 14 to SEQ ID NO: 56, SEQ ID NO: 279 to SEQ ID NO: 303 or the complementary sequences thereof.

[0112] In some embodiments, the isolated or recombinant nucleic acid or vector comprises a sequence encoding at least 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 500, 1000, 2000, or all amino acids of any of SEQ ID NO: 14 to SEQ ID NO: 56, SEQ ID NO: 279 to SEQ ID NO: 303.

[0113] In some embodiments, the isolated or recombinant nucleic acid or vector comprises a sequence encoding an amino acid sequence having at least 75%, 80%,85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity with at least 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 500, 1000, 2000, or all amino acids of any of SEQ ID NO: 14 to SEQ ID NO: 56, SEQ ID NO: 279 to SEQ ID NO: 303, or the RNA version thereof. The RNA version may be of the positive and negative strand nucleotide sequences.

[0114] In some embodiments, the isolated or recombinant nucleic acid or vector comprises a sequence encoding an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity with at least 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 500, 1000, 2000, or all amino acids of any of SEQ ID NO: 14 to SEQ ID NO: 56, SEQ ID NO: 279 to SEQ ID NO: 303 or the complementary sequence thereof.

[0115] In some embodiments, the isolated or recombinant nucleic acid or vector comprises a sequence encoding an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity with at least 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 500, 1000, 2000, or all amino acids of any of SEQ ID NO: 14 to SEQ ID NO: 56, SEQ ID NO: 279 to SEQ ID NO: 303.

[0116] The recombinant nucleic acid can comprise a nucleic acid of the invention linked to a heterologous DNA or RNA sequence.

[0117] The invention encompasses a recombinant vector for expression of a viral protein of the invention, such as those of SEQ ID NO: 14 through SEQ ID NO: 56 and / or SEQ ID NO: 279 through SEQ ID NO: 303. The recombinant vector can be a vector for eukaryotic or prokaryotic expression, such as a plasmid or bacterial artificial chromosome (BAC), a phage for bacterium introduction, a yeast artificial chromosome (YAC) able to transform yeast, a viral vector and especially a retroviral vector, or any expression vector.

[0118] In some embodiments, an expression vector as defined herein is chosen to enable the production of the viral protein, either in vitro or in vivo.

[0119] The expression vector can comprise an inducible or constitutive promoter operably linked to a sequence encoding the viral protein. In one embodiment, promoter is the T7 promoter.

[0120] In one embodiment, the expression vector encodes a protein purification tag. In one embodiment, the expression vector encodes a protein purification tag, such as poly-His tag. In one embodiment, a protease cleavage site is positioned to remove the His tag, for example, after purification.

[0121] The expression vector can comprise transcription regulation regions (including promoter, enhancer, ribosome binding site (RBS), poly-A signal), a termination signal, a prokaryotic or eukaryotic origin of replication and / or a selection gene. The features of the promoter can be easily determined by the person skilled in the art in view of the expression needed, i.e., constitutive, transitory or inducible (e.g. IPTG), strong or weak, tissue-specific and / or developmental stage-specific promoter. The vector can also comprise sequence enabling conditional expression, such as sequences of the Cre / Lox system or analogue systems.

[0122] The nucleic acid molecules according to the invention can be obtained by conventional methods, known per se, following standard protocols such as those described in Current Protocols in Molecular Biology (Frederick M. AUSUBEL, 2000, Wiley and son Inc., Library of Congress, USA). For example, they may be obtained by amplification of a nucleic sequence by PCR or RT-PCR or alternatively by total or partial chemical synthesis.

[0123] The vectors are constructed and introduced into host cells by conventional recombinant DNA and genetic engineering methods which are known. Numerous vectors into which a nucleic acid molecule of interest may be inserted in order to introduce it and to maintain it in a host cell are known; the choice of an appropriate vector depends on the use envisaged for this vector (for example replication of the sequence of interest, expression of this sequence, maintenance of the sequence in extrachromosomal form or alternatively integration into the chromosomal material of the host), and on the nature of the host cell.

[0124] In some embodiments, the nucleic acid is a variant of any of the nucleic acids of SEQ ID NO: 1 to SEQ ID NO: 13, SEQ ID NO: 271 to SEQ ID NO: 278, SEQ ID NO: 265, SEQ ID NO: 270. A “variant” of a nucleic acids of SEQ ID NO: 1 to SEQ ID NO: 13, SEQ ID NO: 271 to SEQ ID NO: 278, SEQ ID NO: 265 to SEQ ID NO: 270 has at least one nucleic acid different than the nucleic acid sequence of a nucleic acid of SEQ ID NO: 1 to SEQ ID NO: 13, SEQ ID NO: 271 to SEQ ID NO: 278, SEQ ID NO: 265 to SEQ ID NO: 270. A variant can contain at least 1, 2, 3, 4, 5, 6, 7, 8, 9 ,10, 11, 12, 13, 14, 15, 20, 25, 30, 40, or 50, 100, 150, 200, 300, 400, 500, 600, 700, or 800, etc., nucleic acids different than the nucleic acid sequence of a nucleic acid of SEQ ID NO: 1 to SEQ ID NO: 13, SEQ ID NO: 271 to SEQ ID NO: 278, SEQ ID NO: 265 to SEQ ID NO:270. Preferably, the differences are conservative amino acid changes. A variant can contain an nucleic acid sequence that has at least 100, 120, 130, 140, 150, 160, 170,180, 190, 200, 25, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, etc. nucleic acids identical to the nucleic acid sequence of a nucleic acid of SEQ ID NO: 1 to SEQ ID NO:13, SEQ ID NO: 271 to SEQ ID NO:278, SEQ ID NO: 265 to SEQ ID NO:270.

[0125] In one embodiment, the variant is a nucleic acid from a virus from a fluke including Opisthorchis viverrini, Clonorchis sinensis, Opisthorchis felineus, Metorchis orientalis, Fasciola hepatica and Fasciola gigantica or a blood fluke including Schistosoma haematobium. Host Cells

[0126] The invention encompasses host cells comprising the vectors of the invention. In some embodiments, the host cells are recombinant cells.

[0127] Suitable host cells for cloning or expressing DNAs encoding the viral proteins in the vectors herein include prokaryotic cells, yeast cells, and insect cells. These cells can be bacterial cells, such as E. coli cells. In some embodiments, the cell is a eukaryotic cell.

[0128] In some embodiments, the expression vectors are expressed in a yeast cell, such as a S. cerevisiae cells.

[0129] In some embodiments, the expression vectors are expressed in an insect cell, such as a Drosophila cell, a Drosophila melanogaster cell (e.g., a cell of the S2 cell line), a Spodoptera frugiperda cell (e.g., a cell of the Sf9 cell line), a mosquito cell, an Aedes cell, an Aedes albopictus cell (e.g., a cell of the C6 / 36 cell line [ATCC® CRL- 1660™]).

[0130] High protein levels of the protein can be obtained using recombinant expression in Escherichia coli (E. coli) (Jana & Deb. Appl. Microbiol. Biotechnol., 2005, vol.67(3), 289-298). The most commonly used production strategies are intracellular (in the periplasm or cytoplasm).

[0131] Lactic Acid Bacteria can also be used as hosts for recombinant expression of proteins in vitro, for example using the techniques in U.S. Pat. No. 5,559,007. Proteins produced in these Gram-positive bacterial hosts can easily be secreted into the medium, thus facilitating their purification as well as their direct delivery to subjects. Proteins and peptides

[0132] The invention encompasses the proteins and peptides of the invention, such as those of SEQ ID NO: 14 through SEQ ID NO: 56 or of SEQ ID NO: 279 through SEQ ID NO: 303.

[0133] In some embodiments, the protein or peptide comprises at least 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 500, 1000, 2000, or all amino acids of any of SEQ ID NO: 14 to SEQ ID NO: 56, SEQ ID NO: 279 to SEQ ID NO: 303.

[0134] In some embodiments, the protein or peptide comprises at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity with at least 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 500, 1000, 2000, or all amino acids of any of SEQ ID NO: 14 to SEQ ID NO: 56, SEQ ID NO: 279 to SEQ ID NO: 303.

[0135] In some embodiments, the protein is a variant of any of the proteins of SEQ ID NO: 14 to SEQ ID NO: 56, SEQ ID NO: 279 to SEQ ID NO: 303. A “variant” of a protein of SEQ ID NO: 14 to SEQ ID NO: 56, SEQ ID NO: 279 to SEQ ID NO: 303has at least one amino acid different than the amino acid sequence of a protein of SEQ ID NO: 14 to SEQ ID NO: 56, SEQ ID NO: 279 to SEQ ID NO: 303. A variant can contain at least 1, 2, 3, 4, 5, 6, 7, 8, 9 ,10, 11, 12, 13, 14, 15, 20, 25, 30, 40, or 50, 100, 150, 200, etc., amino acids different than the amino acid sequence of a protein of SEQ ID NO: 14 to SEQ ID NO: 56, SEQ ID NO: 279 to SEQ ID NO: 303. Preferably, the differences are conservative amino acid changes. A variant can contain an amino acid sequence that has at least 100, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, etc. amino acids identical to the amino acid sequence of a protein of SEQ ID NO: 14 to SEQ ID NO: 56, SEQ ID NO: 279 to SEQ ID NO: 303. In one embodiment, the variant is a protein from a virus of Opisthorchis felineus. Antibodies

[0136] In some embodiments, a protein or peptide comprising at least 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 500, 1000, 2000, or all amino acids of any of SEQ ID NO: 14 to SEQ ID NO: 56, SEQ ID NO: 279 to SEQ ID NO: 303 is used to produce antibodies by conventional techniques. In some embodiments, recombinant or variant or synthetic proteins or peptides of the invention are used to produce antibodies by conventional techniques.

[0137] Antibodies can be synthetic, semi-synthetic, monoclonal, or polyclonal and can be made by techniques well known in the art. Such antibodies specifically bindto proteins and polypeptides of the invention via the antigen-binding sites of the antibody (as opposed to non-specific binding). Purified or synthetic proteins and peptides can be employed as immunogens in producing antibodies immunoreactive therewith. The proteins and peptides contain antigenic determinants or epitopes that elicit the formation of antibodies.

[0138] These antigenic determinants or epitopes can be either linear or conformational (discontinuous). Linear epitopes are composed of a single section of amino acids of the polypeptide, while conformational or discontinuous epitopes are composed of amino acids sections from different regions of the polypeptide chain that are brought into close proximity upon protein folding (C. A. Janeway, Jr. and P. Travers, Immuno Biology 3:9 (Garland Publishing Inc., 2nd ed.1996)). Because folded proteins have complex surfaces, the number of epitopes available is quite numerous; however, due to the conformation of the protein and steric hinderances, the number of antibodies that actually bind to the epitopes is less than the number of available epitopes (C. A. Janeway, Jr. and P. Travers, Immuno Biology 2:14 (Garland Publishing Inc., 2nd ed. 1996)). Epitopes can be identified by any of the methods known in the art. Such epitopes or variants thereof can be produced using techniques well known in the art such as solid- phase synthesis, chemical or enzymatic cleavage of a polypeptide, or using recombinant DNA technology.

[0139] Antibodies are defined to be specifically binding if they bind proteins or polypeptides of the invention with a Ka of greater than or equal to about 107M-1. Affinities of binding partners or antibodies can be readily determined using conventional techniques, for example those described by Scatchard et al., Ann. N.Y. Acad. Sci., 51:660 (1949). Friguet et al., J. Immunol. Methods, 77:305 (1985) and Karlsson et al., J. Immunol. Methods, 145:229 (1991).

[0140] Polyclonal antibodies can be readily generated from a variety of sources, for example, horses, cows, goats, sheep, dogs, chickens, alpaca, camels, rabbits, mice, or rats, using procedures that are well known in the art. In general, a purified protein or polypeptide of the invention that is appropriately conjugated is administered to the host animal typically through parenteral injection. The immunogenicity can be enhanced through the use of an adjuvant, for example, Freund's complete or incomplete adjuvant. Following booster immunizations, small samples of serum are collected and tested for reactivity to proteins or polypeptides. Examples of various assays useful for such determination include those described in Antibodies: A Laboratory Manual, Harlow andLane (eds.), Cold Spring Harbor Laboratory Press, 1988; as well as procedures, such as countercurrent immuno-electrophoresis (CIEP), radioimmunoassay, radio- immunoprecipitation, enzyme-linked immunosorbent assays (ELISA), dot blot assays, and sandwich assays. See U.S. Pat. Nos.4,376,110 and 4,486,530.

[0141] Monoclonal antibodies can be readily prepared using well known procedures. See, for example, the procedures described in U.S. Pat. Nos. RE 32,011, 4,902,614, 4,543,439, and 4,411,993; Monoclonal Antibodies, Hybridomas: A New Dimension in Biological Analyses, Plenum Press, Kennett, McKeam, and Bechtol (eds.), 1980.

[0142] For example, the host animals, such as mice, can be injected intraperitoneally at least once and preferably at least twice at about 3 weeks intervals with isolated and purified proteins or conjugated polypeptides of the invention, for example a peptide comprising or consisting of the specific amino acids set forth above. Mouse sera are then assayed by conventional dot blot technique or antibody capture (ABC) to determine which animal is best to fuse. Approximately two to three weeks later, the mice are given an intravenous boost of the protein or polypeptide. Mice are later sacrificed, and spleen cells fused with commercially available myeloma cells, such as Ag8.653 (ATCC), following established protocols. Briefly, the myeloma cells are washed several times in media and fused to mouse spleen cells at a ratio of about three spleen cells to one myeloma cell. The fusing agent can be any suitable agent used in the art, for example, polyethylene glycol (PEG). Fusion is plated out into plates containing media that allows for the selective growth of the fused cells. The fused cells can then be allowed to grow for approximately eight days. Supernatants from resultant hybridomas are collected and added to a plate that is first coated with goat anti-mouse Ig. Following washes, a label, such as a labeled protein or polypeptide, is added to each well followed by incubation. Positive wells can be subsequently detected. Positive clones can be grown in bulk culture and supernatants are subsequently purified over a Protein A column (Pharmacia).

[0143] The monoclonal antibodies of the invention can be produced using alternative techniques, such as those described by Alting-Mees et al., “Monoclonal Antibody Expression Libraries: A Rapid Alternative to Hybridomas”, Strategies in Molecular Biology 3:1-9 (1990), which is incorporated herein by reference. Similarly, binding partners can be constructed using recombinant DNA techniques to incorporatethe variable regions of a gene that encodes a specific binding antibody. Such a technique is described in Larrick et al., Biotechnology, 7:394 (1989).

[0144] Antigen-binding fragments of such antibodies, which can be produced by conventional techniques, are also encompassed by the present invention. Examples of such fragments include, but are not limited to, Fab and F(ab’)2 fragments. Antibody fragments and derivatives produced by genetic engineering techniques are also provided.

[0145] The monoclonal antibodies of the present invention include chimeric antibodies, e.g., humanized versions of murine monoclonal antibodies. Such humanized antibodies can be prepared by known techniques, and offer the advantage of reduced immunogenicity when the antibodies are administered to humans. In one embodiment, a humanized monoclonal antibody comprises the variable region of a murine antibody (or just the antigen binding site thereof) and a constant region derived from a human antibody. Alternatively, a humanized antibody fragment can comprise the antigen binding site of a murine monoclonal antibody and a variable region fragment (lacking the antigen-binding site) derived from a human antibody. Procedures for the production of chimeric and further engineered monoclonal antibodies include those described in Riechmann et al. (Nature 332:323, 1988), Liu et al. (PNAS 84:3439, 1987), Larrick et al. (Bio / Technology 7:934, 1989), and Winter and Harris (TIPS 14:139, May, 1993). Procedures to generate antibodies transgenically can be found in GB 2,272,440, U.S. Pat. Nos.5,569,825 and 5,545,806.

[0146] Antibodies produced by genetic engineering methods, such as chimeric and humanized monoclonal antibodies, comprising both human and non-human portions, which can be made using standard recombinant DNA techniques, can be used. Such chimeric and humanized monoclonal antibodies can be produced by genetic engineering using standard DNA techniques known in the art, for example using methods described in Robinson et al. International Publication No. WO 87 / 02671; Akira, et al. European Patent Application 0184187; Taniguchi, M., European Patent Application 0171496; Morrison et al. European Patent Application 0173494; Neuberger et al. PCT International Publication No. WO 86 / 01533; Cabilly et al. U.S. Pat. No. 4,816,567; Cabilly et al. European Patent Application 0125023; Better et al., Science 240:1041 1043, 1988; Liu et al., PNAS 84:34393443, 1987; Liu et al., J. Immunol.139:35213526, 1987; Sun et al. PNAS 84:214218, 1987; Nishimura et al., Canc. Res. 47:9991005, 1987; Wood et al., Nature 314:446449, 1985; and Shaw et al., J. Natl. Cancer Inst.80:1553 1559, 1988); Morrison, S. L., Science 229:1202 1207, 1985; Oi et al., BioTechniques 4:214, 1986; Winter U.S. Pat. No. 5,225,539; Jones et al., Nature 321:552525, 1986; Verhoeyan et al., Science 239:1534, 1988; and Beidler et al., J. Immunol.141:40534060, 1988.

[0147] In connection with synthetic and semi-synthetic antibodies, such terms are intended to cover but are not limited to antibody fragments, isotype switched antibodies, humanized antibodies (e.g., mouse-human, human-mouse), hybrids, antibodies having plural specificities, and fully synthetic antibody-like molecules.

[0148] In one embodiment, the invention encompasses single-domain antibodies (sdAb), also known as nanobodies. A sdAb is a fragment consisting of a single monomeric variable antibody domain that can bind selectively to a specific antigen.

[0149] In one embodiment, the sdAbs are from heavy-chain antibodies found in camelids (VHH fragments), or cartilaginous fishes (VNAR fragments), or are obtained by splitting dimeric variable domains into monomers.

[0150] Preferably, the antibody is labelled. In one embodiment, the antibody is labelled with a visualizing molecule, such as a radioactive atom, a dye, a fluorescent molecule, a fluorophore, an enzyme, colloidal gold, a magnetic particle, or a latex bead.

[0151] The antibodies of the invention can be used for affinity purification of a protein of SEQ ID NO: 14 to SEQ ID NO: 56, SEQ ID NO: 279 to SEQ ID NO: 303or variants thereof. They can also be used for immunoprecipitation, flow cytometry, western blot, ELISA, ELISPOT, antibodies microarrays, or tissue microarrays coupled to immunohistochemistry. Other suitable techniques include FRET or BRET, single cell microscopic or histochemistry methods. Methods of making proteins and peptides

[0152] In various embodiments, vectors coding for expression of a protein or peptide comprising at least 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 500, 1000, 2000, or all amino acids of any of SEQ ID NO: 14 to SEQ ID NO: 56, SEQ ID NO: 279 to SEQ ID NO: 303 or variants thereof are transfected or transduced into host cells under conditions that allow expression of the proteins from the vectors. In some embodiments, the vector is a plasmid or bacterial artificial chromosome (BAC), a phage for bacterium introduction, a yeast artificial chromosome (YAC) able to transform yeast, a viral vector and especially a retroviral vector, or any expression vector.

[0153] Different types of vectors can be used for expression a protein of SEQ ID NO: 14 to SEQ ID NO: 56, SEQ ID NO: 279 to SEQ ID NO: 303 or variants thereof, for example, vectors of the pET22 type (ex: pET22b) for large-scale expression and purification of the system (expression of N-terminally 6xHis-tagged proteins facilitating the purification) or for expression and purification of the system. The presence of the His-tag allows the purification of the proteins on affinity columns.

[0154] The invention also encompasses a method of preparing a protein of SEQ ID NO: 14 to SEQ ID NO: 56, SEQ ID NO: 279 to SEQ ID NO: 303 or variants thereof comprising culturing cells comprising an expression vector of the invention and recovering the expressed protein.

[0155] The invention further encompasses the proteins produced by these methods from the nucleic acids of the invention. Methods of detection of proteins and antibodies

[0156] The invention encompasses methods for detection of a protein or peptide comprising at least 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 500, 1000, 2000, or all amino acids of any of SEQ ID NO: 14 to SEQ ID NO: 56, SEQ ID NO: 279 to SEQ ID NO: 303 or variants thereof in a biological sample. The method can comprise providing an antibody(s), preferably a VHH(s), that binds to a protein or peptide comprising at least 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 500, 1000, 2000, or all amino acids of any of SEQ ID NO: 14 to SEQ ID NO: 56, SEQ ID NO: 279 to SEQ ID NO: 303 or variants thereof; providing a biological sample; contacting the antibody with the biological sample; and visualizing the antigen-antibody complexes formed. In some embodiments the methods comprise an ELISA, LuLISA, lateral flow immunoassay, bead-based immunoassay, or multiplex bead-based immunoassay.

[0157] In some embodiments, the method utilizes an antibody, preferably a VHH, that further comprises a label. In some embodiments the method utilizes an antibody, preferably a VHH, that is covalently attached to a substrate.

[0158] In some embodiments, the method for detection of the protein in a biological sample comprise providing an antibody, preferably a VHH, attached to a solid support; providing a biological sample from a subject; contacting the solid support with the biological sample under conditions sufficient to allow formation of first antigen- antibody complexes between the protein in the biological sample and the antibody attached to the solid support to form first antigen-antibody complexes; contacting thesolid support with a second antibody, preferably a VHH, under conditions sufficient to allow formation of second antigen-antibody complexes between the protein and the second single domain VHH antibody; and visualizing the second antigen-antibody complexes. In some embodiments, the second antibody is labeled and visualizing the second antigen-antibody complexes comprises visualizing the label.

[0159] The invention also encompasses methods for detection of an antibody binding to a protein or peptide comprising at least 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 500, 1000, 2000, or all amino acids of any of SEQ ID NO: 14 to SEQ ID NO: 56, SEQ ID NO: 279 to SEQ ID NO: 303 or variants thereof in a biological sample. The method can comprise providing a protein or peptide comprising at least 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 500, 1000, 2000, or all amino acids of any of SEQ ID NO: 14-56, 279-303 or variants thereof; providing a biological sample; contacting the protein or peptide with the biological sample; and visualizing the antigen-antibody complexes formed. In some embodiments the methods comprise an ELISA, LuLISA, LIPS, lateral flow immunoassay, bead-based immunoassay, or multiplex bead-based immunoassay.

[0160] In some embodiments, the method utilizes an antibody that further comprises a label. In some embodiments, the method utilizes an antibody that is covalently attached to a substrate.

[0161] The invention encompasses a composition comprising an antibody for detection of a protein or peptide comprising at least 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 500, 1000, 2000, or all amino acids of any of SEQ ID NO: 14 to SEQ ID NO: 56, SEQ ID NO: 279 to SEQ ID NO: 303 or variants thereof in a biological sample. The composition is useful for the direct detection of the protein or peptide; the detection of the protein or peptide can be carried out by an appropriate technique, in particular EIA, ELISA, RIA, immunofluorescence, luminescence in a biological sample.

[0162] Preferably, the antibody, peptide, or protein comprises a label selected from a chemiluminescent label, an enzyme label, a fluorescence label, and a radioactive (e.g., iodine) label. Preferred labels include a fluorescent label, such as FITC, a chromophore label, an affinity-ligand label, an enzyme label, such as alkaline phosphatase or a luciferase, horseradish peroxidase, or β galactosidase, an enzyme cofactor label, a hapten conjugate label, such as digoxigenin or dinitrophenyl, a Raman signal generating label, a magnetic label, a spin label, an epitope label, such as theFLAG or HA epitope, a luminescent label, a heavy atom label, a nanoparticle label, an electrochemical label, a light scattering label, a spherical shell label, semiconductor nanocrystal label, wherein the label can allow visualization with or without a secondary detection molecule.

[0163] Preferred labels include suitable enzymes such as horseradish peroxidase, alkaline phosphatase, beta-galactosidase, luciferase or acetylcholinesterase; members of a binding pair that are capable of forming complexes such as streptavidin / biotin, avidin / biotin or an antigen / antibody complex including, for example, rabbit IgG and anti-rabbit IgG; fluorophores such as umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, tetramethyl rhodamine, eosin, green fluorescent protein, erythrosin, coumarin, methyl coumarin, pyrene, malachite green, stilbene, lucifer yellow, Cascade Blue, Texas Red, dichlorotriazinylamine fluorescein, dansyl chloride, phycoerythrin, fluorescent lanthanide complexes such as those including Europium and Terbium, cyanine dye family members, such as Cy3 and Cy5, molecular beacons and fluorescent derivatives thereof, as well as others known in the art; a luminescent material such as luminol; light scattering or plasmon resonant materials such as gold or silver particles or quantum dots; or radioactive material include14C,123I,124I,125I,32P,33P,35S, or3H.

[0164] Preferably, the method comprises comparing the results obtained with a positive and / or negative control.

[0165] The invention encompasses the use of one or more proteins or peptides comprising at least 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 500, 1000, 2000, or all amino acids of any of SEQ ID NO: 14 to SEQ ID NO: 56, SEQ ID NO: 279 to SEQ ID NO: 303 or variants thereof for the detection of antibodies binding to a virus selected from the group consisting of Opisthorhabdovirus (ORV), Opisthorphenuilivirus (OPLV), Opisthorsivirus (OSV), Clonorsivirus (CSV), Clonorhabdovirus (CRV), Clonorphenuilivirus (CPLV), Schistohaemavirus (ShV), Schistohaematogalivirus (ShTLV), Schistohaemendornavirus (ShMV) and Schistorhabovirus (ShRV) or a virus with at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% nucleic acid identity with one of these viruses.

[0166] The invention encompasses the use of one or more antibodies specifically binding to an amino acid of any of SEQ ID NO: 14 to SEQ ID NO: 56, SEQ ID NO: 279 to SEQ ID NO: 303 or variants thereof for the detection of a virus selected from the group consisting of Opisthorhabdovirus (ORV), Opisthorphenuilivirus (OPLV),Opisthorsivirus (OSV), Clonorsivirus (CSV), Clonorhabdovirus (CRV), Clonorphenuilivirus (CPLV), Schistohaemavirus (ShV), Schistohaematogalivirus (ShTLV), Schistohaemendornavirus (ShMV) and Schistorhabovirus (ShRV) or a virus with at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% nucleic acid identity with one of these viruses.

[0167] The invention encompasses use of a protein or peptide of the invention as an antigen in a diagnostic assay. The invention encompasses use of an antibody of the invention as an antibody in a diagnostic assay.

[0168] The invention encompasses a method of detecting a virus selected from the group consisting of Opisthorhabdovirus (ORV), Opisthorphenuilivirus (OPLV), Opisthorsivirus (OSV), Clonorsivirus (CSV), Clonorhabdovirus (CRV), Clonorphenuilivirus (CPLV), Schistohaemavirus (ShV), Schistohaematogalivirus (ShTLV), Schistohaemendornavirus (ShMV) and Schistorhabovirus (ShRV) or a virus with at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% nucleic acid identity with one of these viruses comprising contacting an antibody of the invention with a biological sample and detecting the antigen-antibody complexes formed.

[0169] The invention further encompasses the use of an anti-viral treatment step when a subject is shown to be infected with virus selected from the group consisting of Opisthorhabdovirus (ORV), Opisthorphenuilivirus (OPLV), Opisthorsivirus (OSV), Clonorsivirus (CSV), Clonorhabdovirus (CRV), Clonorphenuilivirus (CPLV), Schistohaemavirus (ShV), Schistohaematogalivirus (ShTLV), Schistohaemendornavirus (ShMV) and Schistorhabovirus (ShRV) or a virus with at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% nucleic acid identity with one of these viruses. Serodiagnostic Test Kits

[0170] The invention comprises serodiagnostic test kits. The test kits can contain one or more proteins or peptides comprising at least 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 500, 1000, 2000, or all amino acids of any of SEQ ID NO: 14 to SEQ ID NO: 56, SEQ ID NO: 279 to SEQ ID NO: 303 or variants thereof. The test kits can further contain reagents for the detection of antigen-antibody complexes between the proteins or peptides and antibodies in a biological sample. The kits can further contain positive and / or negative controls. In various embodiments, the antibodies detected are IgM, IgG, or IgA.Antigen Test Kits

[0171] The invention comprises antigen test kits. The test kits can contain one or more antibodies that bind to a protein or peptide comprising at least 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 500, 1000, 2000, or all amino acids of any of SEQ ID NO: 14 to SEQ ID NO: 56, SEQ ID NO: 279 to SEQ ID NO: 303 or variants thereof. The test kits can further contain reagents for the detection of antigen- antibody complexes between the antibodies and proteins or peptides in a biological sample. The kits can further contain positive and / or negative controls.

[0172] In various embodiments, the antibodies are VHH. Preferably, the kit contains a VHH pair, one for capture and the other one for detection in a LuLISA. Molecular diagnostic test kits and methods

[0173] The invention encompasses nucleic acid diagnostic assays utilizing a probe and / or primer of the invention.

[0174] The invention encompasses methods for specific detection of viruses using a probe and / or primer comprising a sequence of at least 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or all nucleotides of any of SEQ ID NO: 1-13, 271-278, 265-270.

[0175] The invention encompasses methods for specific detection of viruses using a probe and / or primer comprising a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity with at least 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or all nucleotides of any of SEQ ID NO: 1-13, 271-278, 265-270.

[0176] In one embodiment, the method comprises providing a sample, contacting the sample with a probe of the invention and detecting the presence or absence of a nucleic acid in the sample by routine techniques in the art.

[0177] In one embodiment, the sample can be subject to an amplification reaction to increase the amount of target nucleic acid in the sample for detection.

[0178] In one embodiment, the method comprises providing a sample containing a virus comprising a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity with at least 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or all nucleotides of any of SEQ ID NO: 1-13, 271-278, 265-270, optionally subjecting the sample to a reverse transcription reaction to generate a cDNA copy of viral RNA in thesample using a “reverse primer” specific for viral RNA, amplifying viral DNA with a “reverse primer” and a “forward primer,” and detecting any amplified product. In one embodiment, the amplified product is detected with a probe. The method can be used for the determination of whether or not the virus is present in the sample.

[0179] The invention encompasses kits containing primers and probes of the invention. The kits can contain reagents for reverse transcription of amplification, such a s buffer nucleotides, reverse transcriptase and polymerase.

[0180] In some embodiments, the kits contain sets of primers: a reverse and a forward primers. Preferably, the probes and primers are designed to detect specific viral species or strains. In some embodiments, probes and primers target conserved regions to can detect nucleic acids from different viral species or strains of viruses.

[0181] In some embodiments, the probe and / or primer consists of or comprise at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 consecutive nucleotides of any of SEQ ID NO: 1-13, 271-278, 265-270.

[0182] In some embodiments, at least one of the primers has at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity with a primer in Tables 4, 5, 6, 11, 12, 13 and 14.

[0183] Preferred primer sets for the amplification of viral nucleic acid are those in Tables 4, 5, 6, 11, 12, 13 and 14.

[0184] In preferred embodiments, the sample is a biological sample, for example, stool, saliva, blood, plasma, serum, urine, cerebrospinal fluid, or tissue, preferably liver, sample. In some embodiments, the sample is a human or animal clinical sample (i.e., a sample from living or dead individual (human or animal) suspected of having a liver fluke infection, including infection with O. viverrini, C. sinensis, O. felineus, M. orientalis, F. hepatica, or F. gigantica or from a blood fluke including Schistosoma haematobium.

[0185] The sample can be subjected to well-known isolation and purification protocols or used directly. For example, the sample can be subjected to a treatment to release / extract the nucleic acids of the sample and / or to remove proteins and other non- nucleic acid components of the sample using conventional techniques.

[0186] Amplification of viral genomic DNA can be performed with two primers, a “forward” and a “reverse” primer, both of which are specific for a virus comprising a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100%identity with at least 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or all nucleotides of any of SEQ ID NO: 1-13, 271-278, 265-270.

[0187] In some embodiments, the probe and / or primer consists of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides of any of SEQ ID NO: 1-13, 271-278, 265-270.

[0188] Reverse transcription of the RNA of a virus comprising a sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity with at least 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or all nucleotides of the RNA version of any of SEQ ID NO: 1-13, 271-278, 265-270 can be performed with a “reverse primer” specific for these sequences. The “reverse primer” is an anti-sense primer.

[0189] A “reverse primer” is one that, based on its 5’-3’ orientation, can bind to a single-stranded RNA and serve to initiate generation of a complementary DNA (cDNA) copy of the RNA. Preferably, the primer consists of or comprises at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 consecutive nucleotides of any of SEQ ID NO: 1-13, 271- 278, 265-270.

[0190] The reverse transcription can be accomplished using well known and routine methods. The reaction mix for reverse transcription contains the reagents for the reaction, for example, a reverse primer, dNTPs (dATP, dCTP, dGTP and dTTP), a buffer, and a reverse transcriptase. Exemplary reaction conditions are set forth in the examples.

[0191] Amplification of the cDNA copy of the viral nucleic acid generated by reverse transcription can be performed with a “forward primer” specific for the virus. The “forward primer” is a sense primer.

[0192] A “forward primer” is one that, based on its 5’-3’ orientation, can bind to a single-stranded antisense cDNA copy of an RNA generated by reverse transcription and serve to initiate generation of a double-stranded DNA copy of the RNA. Preferably, the primer consists of or comprises at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 consecutive nucleotides of any of SEQ ID NO: 1-13, 271-278, 265-270.

[0193] The amplification can be accomplished using well known and routine methods. The reagent mix for amplification contains the reagents for the reaction, for example a forward primer, a reverse primer, dNTPs, a buffer, and a DNA polymerase.

[0194] In one embodiment, the method of the invention is performed using a single RT-PCR reagent mix containing the reagents for the reverse transcription and amplification reactions. Preferably, the reverse primer used for the reverse transcription reaction is also used for the amplification reaction.

[0195] Preferably, the reverse transcription and amplification reactions are performed in a plastic or glass container, most preferably in the same container.

[0196] Amplification methods known in the art include RCA, MDA, NASBA, TMA, SDA, LCR, b-DNA, PCR (all forms including RT-PCR), RAM, LAMP, ICAN, SPIA, QB-replicase, or Invader. A preferred amplification method is the polymerase chain reaction (PCR) amplification. See, e.g., PCR Technology: Principles and Applications for DNA Amplification (Ed. H. A. Erlich, Freeman Press, NY, N.Y., 1992); PCR Protocols: A Guide to Methods and Applications (Eds. Iinis, et al., Academic Press, San Diego, Calif., 1990); Mattila et al., Nucleic Acids Res. 19, 4967 (1991); Eckert et al., PCR Methods and Applications 1, 17 (1991); PCR (Eds. McPherson et al., IRL Press, Oxford); and U.S. Pat. Nos. 4,683,202, 4,683,195, 4,800,159 4,965,188, and 5,333,675. More preferred PCR methods is real-time PCR, PCR-HRM (High-Resolution DNA Melting) (see Andriantsoanirina et al. Journal of Microbiological Methods, 78: 165 (2009)) and PCR coupled to ligase detection reaction based on fluorescent microsphere (Luminex® microspheres).

[0197] Amplification techniques include in particular isothermal methods and PCR-based techniques. Isothermal techniques include such methods as nucleic acid sequence-based amplification (NASBA), loop-mediated isothermal amplification (LAMP), helicase-dependent amplification (HDA), rolling circle amplification (RCA), and strand displacement amplification (SDA), exponential amplification reaction (EXPAR), isothermal and chimeric primer-initiated amplification of nucleic acids (ICANs), signal- mediated amplification of RNA technology (SMART) and others (see e.g. Asiello and Baeumner, Lab Chip; 11(8): 1420-1430, 2011).

[0198] Preferably, the PCR technique quantitatively measures starting amounts of DNA, cDNA, or RNA. Examples of PCR-based techniques according to the invention include techniques such as, but not limited to, quantitative PCR (Q-PCR), reverse- transcriptase polymerase chain reaction (RT-PCR), quantitative reverse-transcriptase PCR (QRT-PCR), or digital PCR. These techniques are well known and easily available technologies for those skilled in the art. Preferably, the Q-PCR is performed with the primers set forth in the examples, preferably as set forth in the examples herein.

[0199] Preferably, the method is a one-step real-time RT-PCR assay. Preferably, a probe is used to detect the amplified product. The probe can be labeled with a fluorescent, radioactive, or enzymatic label. The amplified product can be detected with a specific detection chemistry such as fluorescence resonance energy transfer (FRET) probes, TAQMAN probes, molecular beacons, scorpion probes, fluorescently labeled (or other labeled) primers, lightup probes or a dye-based chemistry, DNA, PNA, LNA, or RNA including modified bases that bind to the amplified product to detect the sequence of interest.

[0200] Detection of the amplified products can be real-time (during the amplification process) or endpoint (after the amplification process). The invention allows for detection of the amplification products in the same vessel as amplification occurs.

[0201] Preferably, a DNA internal control is used to monitor the amplification reaction.

[0202] Preferably, an RNA internal control is used to monitor the reverse transcription and amplification reactions.

[0203] The primers of the invention are useful for both reverse transcription of the viral RNA and amplification of the viral DNA. The primer sequences are preferably selective to the amplification of the nucleic acids of any of SEQ ID Nos 1-13, 271-278, 265-270.

[0204] The invention encompasses a set of primers, i.e., at least two primers of different orientations. Preferably, the primers are in a set of one forward primer and one reverse primer. All of the primers referred to herein can be specifically included in this set of primers.

[0205] In one embodiment, RNA sequences of the virus can be detected, preferably in cells, for example by ISH. In one embodiment, cocktails of bDNA probes can be designed to target genes of the virus. In one embodiment, the ViewRNA ISH Tissue Assay Kit 2-plex (Thermo Fisher Scientific) can be used.

[0206] Preferably, the Rt-qPCR system using the Sybr green. In some embodiments, virus-specific RT-qPCR systems using TAQMAN probes are used, which specific and sensitive quantification of the viral genomes.

[0207] In some embodiments, the viral genomes are detected within fluids collected from parasitized subjects, such as urine and supernatant from feces samples. In some embodiments, the viral genomes are detected within extracellularsecretory / excretory products of O. viverrini, and within exosome-like and microvesicular extracellular vesicles secreted by adult flukes.

[0208] The invention encompasses the use of the primers and / or probes of the invention for the detection of virus selected from the group consisting of Opisthorhabdovirus (ORV), Opisthorphenuilivirus (OPLV), Opisthorsivirus (OSV), Clonorsivirus (CSV), Clonorhabdovirus (CRV), Clonorphenuilivirus (CPLV), Schistohaemavirus (ShV), Schistohaematogalivirus (ShTLV), Schistohaemendornavirus (ShMV) and Schistorhabovirus (ShRV) or a virus with at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% nucleic acid identity with one of these viruses (SEQ ID NO: 1-13, SEQ ID NO: 271-278).

[0209] In one embodiment, a probe of the invention is contacted with a biological sample and hybridization of the probe to a virus selected from the group consisting of Opisthorhabdovirus (ORV), Opisthorphenuilivirus (OPLV), Opisthorsivirus (OSV), Clonorsivirus (CSV), Clonorhabdovirus (CRV), Clonorphenuilivirus (CPLV), Schistohaemavirus (ShV), Schistohaematogalivirus (ShTLV), Schistohaemendornavirus (ShMV) and Schistorhabovirus (ShRV) or a virus with at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% nucleic acid identity with one of these viruses is detected.

[0210] The invention encompasses kit comprising a primer and / or probe of the invention and amplification and / or hybridization reagents.

[0211] The invention encompasses the use of a primer and / or probe of the invention in a diagnostic assay.

[0212] The invention further encompasses the use of an anti-viral treatment step when a subject is shown to be infected with a virus selected from the group consisting of Opisthorhabdovirus (ORV), Opisthorphenuilivirus (OPLV), Opisthorsivirus (OSV), Clonorsivirus (CSV), Clonorhabdovirus (CRV), Clonorphenuilivirus (CPLV), Schistohaemavirus (ShV), Schistohaematogalivirus (ShTLV), Schistohaemendornavirus (ShMV) and Schistorhabovirus (ShRV) or a virus with at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% nucleic acid identity with one of these viruses. USE FOR DIAGNOSIS

[0213] The nucleic acids, peptides, proteins and antibodies of the invention can be used for diagnosis of a viral infection by subjecting a biological sample taken from asubject to a diagnostic assay of the invention. A sample taken from the subject showing the presence of viral nucleic acid or protein can be concluded as being infected with the virus. Any virus in the sample can be amplified by passage in a cultured cell prior to the diagnostic assay.

[0214] In preferred embodiments, the sample is a biological sample, for example, stool, saliva, blood, plasma, serum, urine, cerebrospinal fluid, or tissue, preferably liver, sample. In some embodiments, the sample is a human or animal clinical sample (i.e., a sample from living or dead individual (human or animal) suspected of having an on-going or past liver fluke infection, including infection with O. viverrini, C. sinensis, O. felineus, M. orientalis, F. hepatica, or F. gigantica or with blood fluke including S. haematobium

[0215] In preferred embodiments, the reagents of the invention can be used to detect an on-going or past O. viverrini infection and to predict the risk of developing a cholangiocarcinoma.

[0216] In an embodiment, the present invention encompasses of the primer or probe as disclosed above or the protein or peptide as disclosed above or the antibody as disclosed above, to detect an on-going or past infection by a parasite selected from the group consisting of O. viverrini, C. sinensis and S. haematobium.

[0217] In an embodiment, the present invention encompasses the use of the primer or probe as disclosed above or the protein or peptide as disclosed above or the antibody as disclosed above, to predict the risk of developing a pathology associated with a parasite selected from the group consisting of O. viverrini, C. sinensis and S. haematobium.

[0218] Based on the teaching of the present disclosure, the person skilled in the art will easily determine which primer, probe, protein or peptide or antibody as disclosed above corresponds to which virus and thus to which corresponding parasite among O. viverrini, C. sinensis and S. haematobium.

[0219] The pathology associated with O. viverrini or C. sinensis may be a periductal fibrosis or a cholangiocarcinoma.

[0220] The pathology associated with S. haematobium may be a bladder adenocarcinoma. IMMUNOGENIC AND VACCINE COMPOSITIONS

[0221] The present invention also relates to an immunogenic composition or vaccine composition comprising a peptide or protein according to the invention.

[0222] In some embodiments, the composition or vaccine composition comprises a protein comprising an amino acid sequence of at least 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 500, 1000, 2000, or all amino acids of any of SEQ ID NO: 14-56, 279-303.

[0223] In some embodiments, the immunogenic composition or vaccine composition comprises a protein or peptide comprising at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity with at least 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 500, 1000, 2000, or all amino acids of any of SEQ ID NO: 14-56, 279-303.

[0224] In some embodiments, the immunogenic composition or vaccine composition comprises a nucleotide sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity with at least 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or all nucleotides of any of SEQ ID NO: 1-13, 271-278, or the RNA version thereof. The RNA version may be of the positive and negative strand nucleotide sequences.

[0225] In some embodiments, the immunogenic composition or vaccine composition comprises a nucleotide sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity with at least 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or all nucleotides of any of SEQ ID NO: 1-13, 271-278 or the complementary sequence thereof.

[0226] In some embodiments, the immunogenic composition or vaccine composition comprises a nucleotide sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity with at least 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or all nucleotides of any of SEQ ID NO: 1-13, 271-278.

[0227] In some embodiments, the immunogenic composition or vaccine composition comprises a sequence of at least 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or all nucleotides of any of SEQ ID NO: 1-13, 271-278 or the RNA version thereof. The RNA version may be of the positive and negative strand nucleotide sequences.

[0228] . In some embodiments, the immunogenic composition or vaccine composition comprises a sequence of at least 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or all nucleotides of any of SEQ ID NO: 1-13, 271-278 or the complementary sequence thereof.

[0229] In some embodiments, the immunogenic composition or vaccine composition comprises a sequence of at least 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or all nucleotides of any of SEQ ID NO: 1-13, 271-278.

[0230] In a particular embodiment of the invention, the immunogenic composition further comprises an adjuvant and / or a pharmaceutically acceptable vehicle. In some embodiments, the immunogenic composition further comprises a pharmaceutically acceptable excipient, diluent or carrier. Suitable carriers may be large, slowly metabolized macromolecules such as proteins, polypeptides, liposomes, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids, amino acid copolymers and inactive virus particles or viral vectors, such as lentiviral and AAV vectors.

[0231] As defined herein, a pharmaceutically acceptable vehicle encompasses any substance that enables the formulation of the polyepitope, the polynucleotide, the vector according to the invention within a composition. A vehicle is any substance or combination of substances physiologically acceptable i.e., appropriate for its use in a composition in contact with a host, especially a human, and thus non-toxic. Examples of such vehicles are phosphate buffered saline solutions, distilled water, emulsions such as oil / water emulsions, various types of wetting agents sterile solutions and the like.

[0232] As defined herein, an adjuvant includes, for example, liposomes, oily phases, such as Freund type adjuvants, generally used in the form of an emulsion with an aqueous phase or can comprise water-insoluble inorganic salts, such as aluminum hydroxide, zinc sulphate, colloidal iron hydroxide, calcium phosphate or calcium chloride.

[0233] In another particular embodiment of the invention, the immunogenic composition is formulated for an administration through parenteral route such as subcutaneous (s.c.), intradermal (i.d.), intramuscular (i.m.), intraperitoneal (i.p.) or intravenous (i.v.) injection.

[0234] In another particular embodiment of the invention, the immunogenic composition is administered in one or multiple administration dose(s), in particular in a prime-boost administration regime.

[0235] The quantity to be administered (dosage) depends on the subject to be treated, including the condition of the patient, the state of the individual's immune system, the route of administration and the size of the host. Suitable dosages range from 103TCID50 to 107TCID50 for a viral vector or 25, 50, 100, 150, 200, or 400 micrograms of plasmid DNA or RNA, and can be modified by one skilled in the art, depending on circumstances.

[0236] In a preferred embodiment of the invention, the immunogenic or vaccine composition is for use in the prevention of an infection with a virus selected from the group consisting of Opisthorhabdovirus (ORV), Opisthorphenuilivirus (OPLV), Opisthorsivirus (OSV), Clonorsivirus (CSV), Clonorhabdovirus (CRV), Clonorphenuilivirus (CPLV), Schistohaemavirus (ShV), Schistohaematogalivirus (ShTLV), Schistohaemendornavirus (ShMV) and Schistorhabovirus (ShRV) or a virus with at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% nucleic acid identity with one of these viruses in a human or animal subject. In some embodiments, the animal subject is domestic animals such as cats and dogs; livestock and farm animals such as horses, cows, sheep, pigs, chickens, etc.)

[0237] In some embodiments, the immunogenic composition or vaccine composition of the invention is administered to a human, cat, dog, or other animal.EXAMPLES

[0238] The virome of carcinogenic flukes Next Generation sequencing technologies was used to detect and assemble the genomes of viruses from O. viverrini and S. haematobium that were compared to the previously reported genomes of viruses of C. sinensis (26) (Figure 1). Polymerase-chain reactions combined with sanger sequencing was initially used to fill gaps in sequencing data and obtain complete genome sequences of the Rhabodvirus of O. viverrini. Next, AmpliSeq Panels were developed to confirm the genome composition of all three viruses of O. viverrini (Table 6).

[0239] Phylogenetic analyses using the conserved RNA-dependent RNA polymerase RdRP positioned these novel viruses within three orders (Figures 2-5). Three viruses of S. haematobium, one virus of O. viverrini and one virus of C. sinensis belong to the order Martellivirales. The Opisthorsivirus (OSV), Clonorsivirus (CSV) and Schistohaemavirus (ShV) belong to a novel proposed family, the “Prenviridae” that encloses only viruses of trematodes (26). The Schistohaema togalivirus (ShTLV) belongs to a small clade of parasite-associated viruses that constitute the closest ancestors of the zoonotic mosquito-borne Togaviridae. The Schistohaemendornavirus (ShMV) and its closed relatives discovered in other trematodes fall within the Alphaendornavirus genus. All three flukes host viruses that belong to the family Rhabdoviridae, order Mononegavirales. The Opisthorhabdovirus (ORV) and Clonorhabdovirus (CSV) belongs to the genera tentatively named “Antebetarhabdovirus” that encloses only viruses of liver flukes (26). The Schistohaemarhabdovirus (ShRV) belongs to another genera tentatively named “Amalivirus“. Finally, the liver flukes O. viverrini and C. sinensis also harbor the Opithorphenuilivirus (OPLV) and the Clonorchi phenuilivirus respectively, which belong to a novel family tentatively named “Phenuiliviridae”, due to its close phylogenetic position to the family Phenuiviridae of arthropod-borne vertebrate viruses within the order Hareavirales (previously Bunyavirales, Figure 2). All viruses were closely related to other viruses detected in parasitic flatworms which confirms the close association of the newly discovered viruses with the flukes (Figures 1-5). Order Mononegavirales, Familiy Rhabdoviridae

[0240] The Rhabdoviridae is an ecologically diverse family of negative-sense single stranded RNA viruses, with members infecting a wide range of hosts includingplacental mammals, marsupials, fish, birds, reptiles, insects and plants (31,32). Most family members are vector-borne pathogens able to infect hosts from diverse taxa or kingdoms. Phylogenies of the conserved RdRP of viruses within the Rhabdoviridae indicates that flatworm rhabdoviruses constitute up to 6 novel genera with an ancestral position within the family (26). The Opisthorhabdovirus (ORV) and Clonorhabdovirus (CRV) belong to the genera tentatively named “Antebetarhabdovirus” that encloses only viruses of the liver flukes O. viverrini, C. siniensis and Metorchis orientalis (Figures 2 and 4). The Schistohaemarhabdovirus (ShRV) belongs to another genera tentatively named “Amalivirus“ together with the Schistorhabdovirus and Sphaeridiorhabdovirus (Figure 4). All three viral genome encode the five canonical protein genes shared by all rhabodviruses (Nucleoprotein N, Phosphoprotein P, Matrix protein M, Glycoprotein G and viral polymerase L) (Figure 1). An additional accessory gene of unknown function is positioned between the G and L encloses a Nuclear Localisation Signal (NLS prediction). The position of this accessory gene is shared with other vertebrate-infecting viruses of the genera Tibrovirus, Ephemerovirus, Novirhabdovirus, and the conserved ψ pseudogene (remnant of an ancestral gene) of Lyssavirus (including rabies virus) (33– 35). In contrast, the fluke viruses lack common accessory genes of plant-associated rhabdoviruses positioned between P and M (33–35). The 3’ leader and 5’ trailer sequences are 39 and 65 nt long respectively. All identified ORF were flanked by conserved transcription initiation and transcription termination / polyadenylation sequences with short gene junction consensus sequence. Order Martellivirales

[0241] Martellivirales is a poorly characterized and rapidly diversifying order of viruses that infect many invertebrates and plants. A single family, the Togaviridae infect vertebrates. Liver fluke martelliviruses discovered in Fasciola hepatica, Fasciola gigantica, M. orientalis, O. viverrini and C. siniensis cluster together and constitute a novel proposed family, tentatively named “Prenviridae” (Figure 2 and 3) (26). The genome composition of Opisthorsivirus (OSV), Clonorsivirus (CSV) and other prenviruses are highly similar to mosquito-infecting negeviruses, including conserved domains for Alphavirus Methyltransferase, VMethyltransf, FtsJ, Helicase, Ribosomal RNAm and RdRp in ORF1, a putative glycoprotein (with signal peptide (signal P REF), transmembrane domain (TMHMM REF) and putative glycosylation sites -NetNGlyc 1.0 REF and NetOGlyc 4.0 REF)) in ORF2, and SP24 in ORF3 (Figure 1). The additionalORF4 encoding a protein of unknown function is found in both OSV and CSV but it has not been identified in viruses of Fascioliidae. Three viruses belonging to the Martellivirales order were identified within the urinary blood fluke S. haematobium. All were closely related to viruses found previously in the liver fluke Didrocoelium lanceatum (63). The Schistohaemavirus (ShV) is closely related to Prenviruses (Figure 3) and its genome is composed of three ORFs homologous to ORFs 1 to ORF3 of prenviruses that encode a polyprotein of non-structural proteins, a putative glycoprotein and SP24 (Figure 1). The Schistohaema togalivirus (ShTLV) belong to a small clade of parasite- associated viruses that constitute the most closely related known ancestors of the vertebrate-infecting family Togaviridae (Figure 3). The genome encodes a non- structural polyprotein and a structural polyprotein. The schistohaemendornavirus (ShMV), and its close relatives the Schistomendornavirus and Didorcoelium alphaendornavirus fall within the Endornaviridae family, and the Alphaendornavirus genus of vertically transmitted naked viruses (Figure 3). Order Hareavirales, family “Phenuiliviridae”

[0242] The previously known order of bunyaviruses was promoted to the class of Bunyaviricetes. The new class of Bunyaviricetes comprises notably the new order of Hareavirales (68). Hareavirales is a diverse order of arthropod-borne, negative-sense single stranded RNA viruses that are arthropod-borne (36–38). Typical hareavirus genomes are negative-sense and tri-segmented, and with a few exceptions containing just two segments. The three segments are named according to their size: small (S) encoding the Nucleoprotein, medium (M) encoding the glycoproteins (sometime missing) and non-structural proteins, and large (L) encoding the RdRP. All the known flatworm-associated hareaviruses, including the Opisthorphenuilivirus (OPLV) and Clonorphenuilivirus (CPLV), have a bi-segmented genome with only the S and L segments (Figure 1). We previously found that all viruses of flatworms cluster closely on the phylogenetic tree and display co-diversification with their parasitic hosts (26). Together, they constitute a putative novel family, tentatively named “Phenuiliviridae”, due to its close phylogenetic position to the family Phenuiviridae of arthropod-borne vertebrate viruses (Figures 2 and 5). Accordingly with previous findings, the OPLV clusters closely to viruses of other liver flukes C. siniensis and M. orientalis (Figure 2). Characterization of the viruses of O. viverrini

[0243] Based on the viral genome sequences, we have developed specific RT- qPCR diagnostic tools with primers covering regions that are conserved within the genome of O. viverrini and C. sinensis viruses (Table 4). The primers design aimed at allowing the detection of viral RNA from viruses throughout the species complex of the two carcinogenic liver flukes O. viverrini and C. siniensis. The specificity of the system was confirmed by migrating all RT-qPCR amplicons on agarose gels and Sanger sequencing of representative examples (Figure 6).

[0244] Table 4 Primer sequences used for RT-qPCR detection and quantification of fluke viruses Primer name Sequence System and amplicon length ParaRhabdo-N_F GCCATTCAGTCYGTGTGGATG qPCR pan-ORV / CRV fluke-borne viruses (SEQ ID NO: 57) Target : nucleoprotein ParaRhabdo-N_R TTRCAGAGTGCGTCGATAGTCG Tm 60°C - 146 bp (SEQ ID NO: 58) ParaRhabdo-G_F TGAAGCTGTGACCATCTGGATG qPCR pan-ORV / CRV fluke-borne viruses (SEQ ID NO: 59) Target: glycoprotein ParaRhabdo-G_R TYTTAGCAAATCTAAGACATATTGCAG (SEQ ID NO: 60) Tm 60°C - 187 bp ParaRhabdo-L_F CATCATCRTGGTATAAGTGGATGG qPCR pan-ORV / CRV fluke-borne viruses (SEQ ID NO: 61) Target: RNA dependent RNA ParaRhabdo-L_R ACYCTACGTTTACTTGGGTCTG polymerase (SEQ ID NO: 62) Tm 60°C - 142 bp ParaBunya-L_F GTYATAAAYACTCATGCAGTCACATC qPCR pan-OPLV / CPLV fluke- borne viruses – (SEQ ID NO: 63) Target : RNA dependent RNA ParaBunya-L_R CTAACWATCTCCTTTCTATCCATCCA polymerase (SEQ ID NO: 64) Tm 60°C - 230 bp ParaBunya-S_F CGTGATTACATCACAAATGAATAATCC qPCR pan-OPLV / CPLV fluke-borne viruses (SEQ ID NO: 65) Target: nucleoprotein ParaBunya-S_R CAAARCCTTCRTATCTGTACAGGTCTm 60°C - 212 bp(SEQ ID NO: 66) ParaMartelli-M_L GTKCTTGTRCTYGTGGCCG qPCR pan-OSV / CSV fluke-borne viruses (SEQ ID NO: 67) Target: SP24 ParaMartelli-M_R GGRRYRAAHAYAACCATACCTGC Tm 58°C - 152 bp(SEQ ID NO: 68)

[0245] RT-qPCR were performed on O. viverrini extracts from cercariae, newly- excised juveniles and adults confirming virus persistence throughout the parasite life- cycle (Figure 7 and 8). We observed that the viruses have variable prevalence in adult worms with 86% individuals infected by ORV, 13% infected by OPLV and 55% infected by OSV (Figure 9 and 10). Notably, some individual worms showed high viral load (as indicated by low Ct values). When considering only indivduals with Ct values below 30 for at least one viral gene, the prevalence of “high infection” reaches 14.5% for ORV, 14.5% for OPLV, and 22% for OSV (Figure 9). Only one individual worm was negative for all PCR systems suggesting no viral infection (Figure 10). Most worms were co- infected by ORV and OSV (Figure 10). Total RNA and small RNA profiles of purified exosomes excreted by adult worms

[0246] To further characterize these viruses, we analyze the total RNA and small RNA profiles of purified exosomes excreted by adult worms. The role of the RNAi pathway in antiviral defense has never been assessed in trematodes, but its viability was validated when siRNA was used to knock down gene expression in several species, including O. viverrini 42–47. We examined the size distribution and the 5’-terminal nucleotide of the total 17 – 29 nt sense and antisense small RNAs mapped to ORV, OSV and OPLV. We observed a predominance of 20-21 nt long viral short interfering RNAs (vsiRNAs) in the size range of Dicer products mapping in equal abundance to the ORV and OSV genomes and antigenomes with a slight bias against G at the 5’ position (Figure 11). In contrast, for OPLV, a smaller proportion of 20-21 nt long vsiRNA mapped against either the Seg1 and Seg2 of the viral genomes. Moreover, we observed a bias toward G at the 5’ position in Seg 2 and a majority of 17nt long small RNA molecules suggesting that these are likely processed through a different pathway. These results demonstrate that the viral infections are active in O. viverrini and provide the first indication that small RNAs contribute to the antiviral defense system of trematodes.

[0247] To determine ORV, OSV and OPLV tissue tropism in adult worms, we used the RNAscope in-situ hybridization (ISH) assay to detect O. viverrini viruses RNA in paraffin-embedded adult O. viverrini flukes (Figures 12-14, Table 5). For each virus, we used two sets of ZZ probes binding to the positive-sense RNA (S) and to the negative-sense RNA (AS) (Table 5). ORV and OPLV are negative strand RNA viruses,which means that AS probes bind the viral genome whereas S probes bind the replication intermediate and transcripts. The ORV abundant (+) RNA and less abundant (-) RNA colocalization indicates that ORV replicates actively in tegument cells and in epithelial cells of the worm gut (Figure 12). The stronger signal was localized in the oral and ventral suckers. The colocalization of the OPLV abundant (+) RNA and less abundant (-) RNA indicates active virus replication in eggs, vittelaria (vitelline gland), the testis and to a lesser extent the tegument cells of flukes (Figure 13). The OSV is a positive strand RNA virus which means that S probes bind the viral genome and viral transcripts whereas AS probes bind the replication intermediate (antigenome) that serves as template to synthesize progeny genomic RNA. OSV (-) RNA and (+) RNA colocalization indicates that OSV replicates in tegument cells, in gut epithelial cells, but also in parenchymal cells embedding all other organs of adult flukes (Figure 14).

[0248] Table 5 RNAscope probes position ordered to biotechne ® Target Region on customer's provided NPR Catalog # Probe Name sequence NPR-0053382 809-1727 (SEQ ID NO: 265)NPR-0053383 157302* V-OSV-ORF1-O1 1198-2107 (SEQ ID NO: 266)Fluke virus transmission to parasitized

[0249] Next, we investigated the fluke viruses transmission to parasitized hosts. We collected tissues and fluids from five individual hamsters that had been infected by O. viverrini for one year. RT-qPCR were employed to investigate the presence of fluke viruses in organs and fluids from hamsters that had been infected by O. viverrini for one year. Of significance, all three viruses were detected within the liver and kidney of parasitized hamsters (Figure 15). The detection of the fluke viruses in hamster liver isindicative of virus excretion and transmission to the parasitized host, whereas fluke virus detection in kidney indicates virus dissemination within the host body. These results suggest that fluke-borne viruses could contribute to the diseases associated with liver fluke infections by directly interacting with host cells. Moreover, virus detection in feces, where fluke eggs are excreted, indicates that these molecular tests may be used for diagnosis of O. viverrini infection

[0250] A Limit of Detection (LOD) of about 1 copy genome per PCR reaction was determined for each Rt-qPCR system, as calculated in genome copy number using synthetic RNA (Table 5) whereas the Limit of Quantification reached 15 genome copies for the pan-rhabdo fluke-borne viruses systems, between 15 genome copies for the pan- bunya fluke-borne viruses systems, and 20 genome copies for the pan-martelli fluke- borne viruses system.

[0251] Table 6 Primers used to generate synthetic RNA for copy genome quantification of fluke viruses OligoName Sequence Tm - amplicon length TAATACGACTCACTATAGGGCAGAACTG Oviv-Rhabdo-N_T7-F ATCCAGTCTAC (SEQ ID NO: 69)Tm 58°C - 271 bp (+18 pb T7promotor) AGGCCGAGTAGATGCCTCC Oviv-Rhabdo-N_T7-R (SEQ ID NO: 70) TAATACGACTCACTATAGGGATTCCTGA Oviv-Rhabdo-G_T7-F GAGCACTCGT (SEQ ID NO: 71)Tm 58°C - 332 bp (+18 bp T7promotor) ACACTGGATTTGTCGAACTGCT Oviv-Rhabdo-G_T7-R (SEQ ID NO: 72) TAATACGACTCACTATAGGGACAGTCCA Oviv-Rhabdo-L_T7-F CGACCACTC (SEQ ID NO: 73)Tm 58°C - 229 bp (+18 bp T7promotor) TCTGTATCGACTCCATATGGTC Oviv-Rhabdo-L_T7-R (SEQ ID NO: 74) TAATACGACTCACTATAGGGATATGAAG Oviv-Bunya-L_T7-F CTTTGTTGAAAGA (SEQ ID NO: 75)Tm 58°C - 396 bp (+17 bp T7promotor) GTGAAATTATCTTGTTGCTCCATG Oviv-Bunya-L_T7-R (SEQ ID NO: 76)TAATACGACTCACTATAGGGACACACAG Oviv-Bunya-S_T7-F ACACCCATAC (SEQ ID NO: 77)Tm 58°C - 279 bp (+18 bp T7promotor) TTCTAGCCTTCATCACCAAGTAC Oviv-Bunya-S_T7-R (SEQ ID NO: 78) TAATACGACTCACTATAGGGCTTCAAGA Oviv-Martelli-M_T7-F TATAGCCGATACC (SEQ ID NO: 79)Tm 58°C - 295 bp (+19 bp T7promotor) CCAGATTTCCATTGGTGGCAG Oviv-Martelli-M_T7-R (SEQ ID NO: 80)

[0252] To test hamster infection by fluke viruses we investigated hamster seroconversion using Luciferase-linked Immunosorbent assays LuLISA (39). Immunoglobulin G targeting the nucleoprotein of the ORV and OPLV, and the SP24 of OSV were quantified in sera of the five parasitized hamsters. A LuLISA assay quantifying IgG against the fluke antigen TSP2 was used as positive control. The sera of each hamster were taken at the first day of infection (negative sample) and after three months (positive sample) of infection by fifty fluke metacercarias. The Antibody Titer was determined as the last dilution in which the ratio of signal between the positive sample and the negative sample was superior to or equal to 2.0 (Figure 17). Strikingly, we demonstrated the presence of IgG against all tested fluke viruses and the O. viverrini antigen in the serum of parasitized hamsters (Figure 16).

[0253] We used the RNAscope in-situ hybridization (ISH) assay to detect O. viverrini viruses RNA in paraffin-embedded liver tissues of two parasitized hamsters (Figure 17, Table 5). Adult flukes were not extracted from the biliary tract before sample processing and imaging, which allow us to visualize the adult flukes within the bile duct. We observed (+) RNA of OSV along and within cholangiocytes suggesting virus excretion by the fluke and transmission to the parasitized host. Remarkably, both (+) RNA and (-) RNA of ORV were observed in cholangiocytes indicating active transmission.

[0254] To assess whether fluke-borne viruses could be isolated from O. viverrini extracellular vesicles (EV), we exposed human cholangiocytes (H69 cells) to purified EVs for 24h before washing the cells and replacing the medium. Seven days later, the culture medium was harvested from the cell supernatant and used to inoculate naïve H69 cells (blind passage). Three and seven days later, the presence of the ORV nucleicacid was confirmed in H69 cells and cytopathic effects (CPE) were observed, suggesting the establishment of a productive viral infection (Figure 19). Seroconversion of O. viverrini-infected people from a high endemic Thailand region

[0255] The establishment of a causative link between a novel virus and disease relies on case-control studies and demonstration of seroconversion in patients and infected animals. Immunoglobulin G targeting the nucleocapsid of the ORV, the nucleocapsid of OPLV and the SP24 of OSV were quantified in sera of parasitized hamsters using a Luciferase-linked Immunosorbent assay (LuLISA) (39). We demonstrated the presence of virus-directed IgG against all three fluke viruses in the serum of hamsters (Figure 7 A).

[0256] A seroconversion of O. viverrini-infected hosts study has been carried out on human cohort. A total of 556 serums were tested: 456 from O. viverrini-infected people from Thailand and 100 from non-endemic French people. We found that O. viverrini-infected individuals from Thailand had significantly higher titers in TSP2 (p<0.0001), ORV (p<0.0001), OPLV (p<0.0001) and OSV (p<0.0001) than French non- endemic controls (Figures 22-24), confirming that O. viverrini infection is positively associated with ORV, OPLV and OSV seroconversion. Results were further analyzed by receiver-operator characteristics (ROC) curve analysis. The accuracy of the test calculated by the area under the curve (AUC) yielded a 0.84 value for TSP2 (Figure 19), 0.829 for ORV (Figure 20), 0.824 for OPLV (Figure 22) and 0.642 for OSV (Figure 21). The results indicated that the serology of ORV and OPLV could be used to detect O. viverrini infection. Most interestingly, the TSP2 serology for O. viverrini infection diagnostic has a high specificity (0.969), but a moderate sensitivity (0.693), which is lower than the sensitivity for ORV (0.79) and OPLV (0.82) serology. Moreover, the specificity of ORV (0.765) and OPLV (0.748) serology, though lower than of TSP2 serology, are still relatively high. To be noted, the OSV serology displays a low sensitivity (0.331), but the specificity is high (0.948). A combination of these different serologies could be of interest for the development of a diagnostic procedure with both high sensibility and specificity. These results indicate that serological test targeting fluke viruses can be suitable for diagnostic purposes.Elevated antibodies to ORV, OPLV and OSV is associated with increased risk of advanced periductal fibrosis

[0257] As shown previously in both human and animal models, periductal fibrosis is a precursor of liver-fluke induced cholangiocarcinoma (4,40,41). Thus, we sought to determine if titer in antibodies against ORV was elevated in O. viverrini infected individuals with hepatobiliary pathologies. A case-control study was designed to investigate the association between serum antibodies to ORV and advanced periductal fibrosis in serum samples collected from a community-based opisthorchiasis control in Northeast Thailand (42). Sera from 184 patients were retrieved from the biobank of the Tropical Disease Research Center (TDRC, Faculty of Medicine, Khon Kaen University, Thailand; KKU Human ethics #HE480528), 93 O. viverrini positive patients without advanced periductal fibrosis (APF) and 91 O. viverrini positive patients with APF. As negative controls, serum from 84 non-endemic (French) patients were used. Antibody titers in sera of O. viverrini parasitized individuals with APF were higher than in sera of O. viverrini parasitized individuals with APF (p<0.0001), that were also higher than in sera non-endemic (French) individuals (p<0.0001), confirming that O. viverrini infection is positively associated with ORV seroconversion (Figure 7B).

[0258] A multiple logistic regression model was utilized to analyze the association between the levels of anti-ORV IgG and APF within O. viverrini infected individuals. The results revealed that higher serum concentrations of anti-ORV IgG titer significantly increased the risk of APF (Figure 7B). Specifically, for every 1 unit increase in lnRLU / s (equivalent to 2.72 actual RUL / s) of anti-ORV IgG, there was a 739% increase in the risk of APF (OR = 7.39; 95% CI: 3.56 to 15.36, p < 0.001) after adjusting for age, sex, and infection intensity (measured in eggs per gram of feces (EPG)) (Table 7). Increasing serum concentration in IgG was associated with a significantly increased risk of APF. As shown in Table 8, the risk increased with increasing quartile concentration in ORV IgG: A strong and significant trend for increasing concentration of ORV IgG and increasing risk of APF was found (p<0.001).

[0259] Table 7 Association between levels of antibody to ORV IgG (lnRUL / s) and advanced periductal fibrosis (APF) in Opisthorchis viverrini infected individuals in Northeast Thailand using multiple logistic regression analysis adjusted for age, sex, and EPG.APF Crude 95%CI p- Adj.O 95%CI p- OR value R value Negative Positive (n) (n) lnRUL / s 93 91 6.84 3.42-13.66 <0.001 7.39 3.56- <0.001 15.36 Age 93 91 1.02 0.99-1.06 0.229 1.06 1.00-1.10 0.017 Sex 11 30 3.67 1.70-7.89 0.001 7.12 2.60- <0.001 (female) 19.52 EPG 93 91 1 0.99-1.01 0.816 1 0.99-1.01 0.398

[0260] Table 8 Odds ratio for ORV IgG titers for O. viverrini infected individuals with and without APF

[0261] Interestingly, previous studies showed that interleukin-6 is similarly elevated in a dose-dependent manner in individuals with advanced periductal fibrosis, and a risk factor for cholangiocarcinoma, whereas intensity of O. viverrini infection or antibodies to O. viverrini were not (42,43). In fact, IL-6 levels has been proposed as a mean to detect the risk for O. viverrini associated hepatobiliary pathologies. Further studies are necessary to investigate the correlation and putative causation between fluke viruses infection and IL-6 plasma levels.

[0262] Moreover, sera from 456 patients and collected from a community-based opisthorchiasis control in Northeast Thailand. (42) were retrieved from the biobank of the Tropical Disease Research Center (TDRC, Faculty of Medicine, Khon Kaen University, Thailand; KKU Human ethics #HE480528). We measured serum antibodylevels to TSP2, ORV, OPLV, and OSV in three groups of individuals: those with Opisthorchis viverrini infection and advanced periductal fibrosis (APF) confirmed by ultrasound (OV+APF + ; n = 184), those with O. viverrini infection without APF (OV+APF- ; n = 184), and histologically confirmed cholangiocarcinoma (CCA) cases (CCA; n = 88) The mean antibody levels for each group are summarized in Table 9.

[0263] Table 9 Antibody levels to TSP2, ORV, OPLV, and OSV among OV+APF–, OV+APF+, and CCA groups (Values are mean ± SD; ANOVA test) Antigen OV+APF+ (n = 184) OV+APF– (n = 184) CCA (n = 88) p-value TSP2 6.52 ± 2.66 6.73 ± 4.57 6.52 ± 3.23 0.8329 ORV 7.24 ± 2.30 4.46 ± 2.45 5.42 ± 2.19 <0.001 OPLV 9.19 ± 2.79 6.83 ± 2.59 7.86 ± 2.53 <0.001 OSV 9.06 ± 3.62 7.29 ± 3.08 7.83 ± 2.52 <0.001

[0264] Antibody titers against TSP2 in sera of O. viverrini parasitized patients did not differ among patients APF-, APF+ and CCA indicating the absence of TSP2 IgG association with hepatobiliary diseases (Table 10, Figure 24). In contrast, our analysis revealed that antibody levels to ORV, OPLV, and OSV were significantly higher in the APF+ group compared to the APF– indicating that ORV, OPLV and OSV infections are positively associated with advanced periductal fibrosis (Figures 25-27, Table 10). Antibody titers to ORV and OPLV were also significantly higher in CCA group compared to OPF- but remained significantly lower compared to the APF+ group (Figures 25 and 27, Table 10). No significant differences in OSV levels were observed between APF– and CCA groups (Figure 26, Table 10).

[0265] Table 10 Post-hoc comparisons of antibody levels using the Bonferroni method Antigen Group Comparison Mean Difference p-value TSP2 APF+ vs. APF– –0.21 >0.999Antigen Group Comparison Mean Difference p-value APF+ vs. CCA –0.004 >0.999 APF– vs. CCA 0.21 >0.999 ORV APF+ vs. APF– 2.78 <0.001 APF+ vs. CCA 1.82 <0.001 APF– vs. CCA –0.96 0.005 OPLV APF+ vs. APF– 2.36 <0.001 APF+ vs. CCA 1.33 <0.001 APF– vs. CCA –1.03 0.009 OSV APF+ vs. APF– 1.77 <0.001 APF+ vs. CCA 1.23 0.010 APF– vs. CCA –0.54 0.580

[0266] To determine whether antibody responses were associated with APF, we performed multivariable logistic regression analysis adjusting for age, sex, and O. viverrini egg count (EPG). Antibodies to ORV (adjusted OR = 2.05, 95% CI: 1.66–2.52), OPLV (OR = 1.70, 95% CI: 1.43–2.00), and OSV (OR = 1.19, 95% CI: 1.07–1.32) were significantly associated with increased odds of APF (all p < 0.001). Conversely, antibody levels to TSP2 were negatively associated with APF (OR = 0.79, 95% CI: 0.71–0.89; p < 0.001) (Table 11). These results indicate that patients with high ORV IgG titers have more than two times the odds to display APF (a 205% increase in odds).

[0267] Table 11 Association between antibody levels and APF by multivariable logistic regression (Adjusted for age, sex, and EPG) Antigen Adjusted Odds Ratio 95% CI p-value TSP2 0.79 0.71 – 0.89 <0.001 ORV 2.05 1.66 – 2.52 <0.001Antigen Adjusted Odds Ratio 95% CI p-value OPLV 1.70 1.43 – 2.00 <0.001 OSV 1.19 1.07 – 1.320.001

[0268] Results were further analyzed by receiver-operator characteristics (ROC) curve analysis to determine the sensitivity and specificity of the test for the detection of APF. The accuracy of the test calculated by the area under the curve (AUC) yielded a 0.792 value for ORV (Figure 24), 0.661 for OSV (Figure 25) and 0.744 for OPLV (Figure 26). The results indicated that the serology of ORV and OPLV could be used to detect APF. Most interestingly, the ORV serology APF diagnostic has a high sensitivity (0.804), but a moderate specificity (0.636), whereas the OSV and OPLV serologies show low sensitivity (0.418 for OSV and 0.587 for OPLV) but high specificity (0.821 for OPLV and 0.777 for OSV) suggesting that the combination of these tests could inform on the risk of APF.

[0269] The IgG Avidity Index is the strength of the binding between, multivalent antigens and the igG antibodies. The avidity index increases with maturation of the immune response and depends on the initial infectious dose or rate of re-infection (Nurmi et al., Int.J.Infectious Diseases 2021, 110:479) . The IgG avidity index in sera of O. viverrini parasitized individuals with APF are higher than in sera of O. viverrini parasitized individuals APF-, ORV (p<0.001) (Figure 29), OPLV (p<0.0001) (Figure 30) and OSV (p<0.0001) (Figure 32), but not for TSP2 (Figure 29). The IgG avidity against fluke-borne viruses further increases in CCA patients. Indeed, the IgG avidity index in sera of O. viverrini parasitized individuals with CAA are higher than in sera of O. viverrini parasitized individuals with and without APF for TSP2 (p<0.0001) (Figure 29), ORV (p<0.0001) (Figure 30), OPLV (p<0.0001) (Figure 31) and OSV (p<0.0001) (Figure 32) Discussion

[0270] Since Koch postulates were introduced in 1884, the criteria determining causality of a newly identified pathogen in disease development have evolved with our increasing understanding of microbial infection (53–56). Herein, we faced a newchallenge as we attempt to decipher the potential pathogenic role of viruses nested within parasites that are themselves classified as Class I carcinogen.

[0271] The three trematodes O. viverrini, C. sinensis and S. haematobium are classified as Class 1 carcinogens because there is sufficient evidence that these parasitic infections are carcinogenic to humans. Herein, we report that all three parasites are associated with several viruses, including viruses related to alphaviruses (i.e. Chikungunya virus, Venezuelan equine encephalitis virus), alpharhabdoviruses (Rabies virus, Mokola virus) and phenuiviruses (i.e. Rift Valley Fever virus, Heartland virus), which are all zoonotic viruses highly pathogenic to humans. All reported viruses are very closely related to other viruses previously discovered in trematodes confirming host specificity (1,33). Moreover, we showed that ORV and OSV are processed by O. viverrini RNAi pathway confirming that these viral infections are active, but also under control by the fluke. This is in fact the first report that this pathway is involved in antiviral defense in a trematode. By screening individual worms, we found that 99% of fluke individuals were infected by at least one virus. Yet most individuals showed low viral load as estimated by the high Ct values. O. viverrini fluke viruses had a prevalence of “high infection” ranging from 14.5% to 22 %. Given that estimation of worm burden in O. viverrini infected individuals range from 1 to 3000 worms, with a mean of about 75 worms per infected individuals (57), we can infer that, all O. viverriniinfected individuals are exposed to fluke-borne viruses, and that the probability of fluke-viruses infection increases with worm burden and the prevalence of “high infection” individual worms. Our findings suggest that all experimental and epidemiological data that supported the classification of trematodes as group 1 carcinogens should be re-analyzed in light of the discovery of fluke-borne viruses, the covert stow-aways of liver fluke infection. For instance, there is a strong positive relationship between the intensity of liver fluke infection and the likelihood of hepatobiliary diseases and cholangiocarcinoma (58), but to which extent is this association caused by greater exposure to fluke viruses?

[0272] For fluke viruses to actively contribute to cancer, they would have to be excreted by parasite and meet human cells. Moreover, active viral infection of the mammalian host cells would increase chances that the viruses contribute actively to the disease. In-situ hybridization showed that all three viruses replicate the tegument cells at the surface of the parasite. Through experimental infections of hamsters, and a combination of PCR and in-situ hybridization, we collected additional evidence that all three viruses are excreted and transmitted to parasitized hosts. Confirming the fluke-viruses transmission, we found that both O. viverrini infected hamsters and O. viverrini infected Thai people developed antibodies against the three fluke-borne viruses (ORV, OPLV and OSV). In fact, our results showed that ORV and OPLV serologies can be used to detect individuals with O. viverrini infections with moderate to high sensitivity and specificity, comparable in some extent to the performance of TSP2 serology. The validation of this second postulate prompted us to investigate further the association between fluke-borne viruses’ infection and disease development.

[0273] Periductal fibrosis is among the most prominent histological feature in chronic O. viverrini infection, associated with proliferation of epithelial cells (59). Advanced periductal fibrosis of the segmental and main bile ducts is significantly associated with CCA and is used as a screening marker for CCA using hepatobiliary ultrasonongraphy (60). Previous studies showed that levels of antibodies to O. viverrini excretory secretory products did not associate with APF (52). In contrast, plasma levels of the pro-inflammatory cytokine IL-6 is significantly associated with the development of APF (52). A case-control study focusing on O. viverrini infected individuals only confirmed this finding, revealing that increasing levels of IL-6 was associated with an increasing risk of APF and CCA in a dose-dependent manner (61).IL-6 is well known for its role in chronic inflammation and fibrotic lesions and is considered one the key factor leading to hepatobiliary diseases following O. viverrini infection. Using the same cohort of samples where APF(-) are matched by APF(+) by age, sex, infection and nearest- neighbor status, we showed that the IgG titers against ORV, OPLV and OSV are significantly elevated in patients with periductal fibrosis. with an odds ratio of 1.19 for OSV, 1.70 for OPLV and 2.05 for ORV. These results suggest that O. viverrini infected patients with periductal fibrosis were subject to a more acute infection by fluke-borne viruses than patients without periductal fibrosis. Further analyses using a complementary cohort of 88 CCA patients showed a reduction in IgG titers compared to APF+. Yet, the antibody avidity index of these patients is higher for both the TSP2 antigen and the three viral antigens than in O. viverrini infected patients with and without APF. These results suggest a key role of viral persistence or re-infection by O. viverrini, ORV, OPLV and OSV in the risk of developing CCA. These results suggest that IL-6 increase in patients could be associated to fluke-viruses infection. While IL-6 is known to play an essential role in antiviral immune responses, upregulation of IL-6 can promote virus survival and exacerbate clinical disease, which means that further studies arenecessary to determine the respective role of IL-6 and fluke-borne viruses in disease development. Conclusion

[0274] Until now, E / S proteins of liver flukes have been found to modulate angiogenesis, proliferation and pro-inflammatory response, that should rather be defined as exacerbating causes that compromise hosts restraints on cancer. In the search for the causal factors of CCA, the discovery that fluke-borne viruses are transmitted to the vertebrate host, stimulate the host immune response and are associated with greater pathogenesis is a major departure from the status-quo by shifting focus towards viruses of liver flukes. These data demonstrate that parasitized individuals are chronically exposed to fluke viruses that are excreted by the long-lived parasite. Material and methods Animals

[0275] Male golden Syrian hamsters (from the Animal Unit, Faculty of Medicine, Khon Kaen University), aged 6 to 8 weeks at the commencement of the study, are used throughout the experiments. The hamsters were kept 5 to a cage, housed under conventional conditions, and fed a stock diet and water ad libitum. The maintenance and care of the animals complies to the guidelines of the National Laboratory Animal Center. O. viverrini metacercariae and adult worms

[0276] The metacercariae of O. viverrini are obtained from naturally infected cyprinoid fish captured from endemic area in Khon Kaen province, Northeast Thailand. The fish were washed with tap water, minced by electric blender and digested with artificial gastric juice, a solution of 0.25% pepsin A and 1.5% HCl, at 37°C in a shaking water bath for one hour. The digested mixture was strained through a set of three sieves with the mesh size of 1000, 300 and 106 µm, respectively. Then the pellet on the last sieve (106 µm) was sedimented in normal saline solution (0.85% NaCl, NSS) in a sedimentation jar until the supernatant was clear. O. viverrini metacercariae were identified, collected under a dissecting microscope, and stored in NSS at 4°C until used for animal infection. Newly excysted juveniles (NEJs) of O. viverrini were obtained asprocedures detailed previously (https: / / doi.org / 10.3389 / fcimb.2022.827521). Metacercariae were excysted by incubation in 0.25% trypsin, supplemented with 400 U / ml each of penicillin and streptomycin (2X antibiotics), for 5 minutes at 37°C. The NEJs were subsequently separated from the cyst walls by rinsing with 1X PBS containing 2X antibiotics. Finally, NEJs were added Trizol for RNA extraction. Fifty viable metacercariae were fed to the hamsters by intragastric intubation. Adult worms were obtained by linear teasing after 2–3 months post-infection. The fresh worms were washed several times in cold NSS containing penicillin (200 U / ml) and streptomycin (200 µg / ml) to remove any debris and residual blood. Sera from parasitized hamsters were collected at day 0, 7, 14 and 28 after O. viverrini infection. We also collected tissues and fluids from five hamsters that had been infected by O. viverrini for one year. Urine, feces, serum, liver, gall bladder and kidney were collected and stored at -80°C for further processing. An additional two parasitized hamsters parasitized for a year were sacrificed to collect liver tissue. RNA extraction, NGS library preparation and sequencing

[0277] Total RNA from six pools of 5 adult worms was extracted using the RNeasy plus mini kit (Qiagen, Valencia, CA, USA) following the manufacturer’s recommendation. RNA was eluted in 30µl of water and 15µl of each sample was used to constitute the sequenced pool. RNA quality was evaluated using the RNA pico chip (Agilent, Waldbronn, Germany) and an Agilent 2100 Bioanalyzer. The NGS library was constructed using the SMARTer Stranded Total RNA-seq kit v3-Pico input mammalian kit (Clontech, Takara Bio, San Jose, CA, USA) according to the manufacturer’s instructions and validated using the dsDNA pico chip (Agilent, Waldbronn, Germany) and the Agilent Bioanalyzer. DNA output of the library preparation was quantified with the dsDNA high-sensitivity kit (Invitrogen, Waltham, MA, USA) onto a Qubit 2.0 Fluotometer (Invitrogen, Waltham, MA, USA). Sequencing was carried out on an Illumina NextSeq 2000 sequencer in a paired-end 2 × 100 bp format to achieve approximately 50 million paired reads per library. Data mining

[0278] S. haematobium Illumina RNA sequencing raw data were downloaded from Bioprojects PRJEB32839 “The stage and sex specific transcriptome of the human parasite Schistosoma mansoni”, PRJEB37529 “Low input approaches to generate highquality reference genomes for parasitic faltworms” and PRJNA78265 “Schistosoma haematobium Genome Sequencing and assembly” Virus discovery

[0279] Raw sequencing reads were processed with Microseek, an in-house bioinformatics pipeline (45) that includes quality check and trimming, read normalization, de novo assembly, open reading frames (ORFs) prediction, and taxonomic assignation of contigs and singletons using (i) an exhaustive and curated viral sequence database RVDB-prot (46), itself derived from the nucleic Reference Virus DataBase (RVDB) (47), and (ii) generalist (NCBI / nr / nt) databases. Viral genome completion

[0280] Quality-filtered reads and contig sequences associated with each of the viruses were retrieved by comparing sequences through BLASTn to a database containing all newly identified contig sequences and closely related sequences to confirm and improve genome completion.

[0281] RNA extracts from the pool of adult worms were used for PCR to close genome gaps in the Opisthorhabdovirus. Briefly, RNA extract from the pool of adult worms was retrotranscribed using random hexamers and the SuperScript IV Reverse Transcription system (Invitrogen) according to the manufacturer’s instructions. Primers flanking the gaps in the genome were designed, PCR were conducted with the Phusion high fidelity Taq polymerase (NEB) according to the manufacturer’s instructions, and gel electrophoresis was performed to confirm the amplification. All PCR products were finally Sanger sequenced by Eurofins company. For the 5’ and 3’ non-coding regions of the genome of the three viruses, primers targeting these regions and the 5′ / 3′ RACE Kit (Roche) were used according to the manufacturer’s instructions. PCR products were Sanger sequenced as described above. Isolation and purification of extracellular vesicles

[0282] Hamsters were necropsied at 8 weeks post-infection and adult worms collected, washed in PBS and cultured in RPMI 1640 containing 1% glucose, 100 units / ml Penicillin, 100 units / ml Streptomycin (Life Technologies, Grand Island, NY) and 1 nM E64 (Thermo scientific, USA) at 37°C, 5% CO2 for 7 days. For the isolation and purification of O. viverrini EVs (OvEVs), a previously published method was followed (66). Briefly, O. viverrini ES products (OvES) were collected every day, centrifuged at500 g for 10 min to remove eggs and large debris, and subsequently centrifuged at 2,000 g for 30 min, 4,000 g for 30 min and 15,000 g for 45 min to remove smaller debris and MVs. MVs were washed twice with PBS, centrifuged at 12,000 g and stored at −80°C until use. Following removal of MVs, supernatant was concentrated using a 10 kDa cut- off Amicon filter (Merck Millipore, USA) and ultracentrifuged at 120,000 g for 3 hours to pellet smaller (120k) vesicles. The pellet was resuspended in 70 μl of PBS, laid on a discontinuous gradient (40%, 20%, 10%, 5%) built with OptiPrepTM Density Gradient (Millipore Sigma, USA) as described previously (64) and centrifuged for 18 h at 4°C. EVs isolated from grapes (termed “grape Evs”) were isolated from Vitis vinifera Thompson seedless grapes as described elsewhere (65) . The size and concentrations of all Evs were analysed using a qNano instrument (Izon Science, New Zealand) and protein content was determined using a BCA kit (Bio-Rad). Small RNA Sequencing of EV

[0283] As described in S. Chaiyadet et al. (66), smallRNA were extracted using the mirVanaTM miRNA isolation Kit (ThermoFisher) and stored at -80°C until use. The RNA quality, yield and size of total and small RNAs were analysed using capillary electrophoresis (Agilent 2100 Bioanalyzer, Agilent Technologies, Santa Clara, CA, USA). The TruSeq Small RNA-seq preparation kit (Illumina) was used for miRNA sequencing according to the manufacturer’s instructions. The smallRNA sequences were trimmed and mapped against ORV, OSV and OPLV using Bowtie2. AmpliSeq complete genome sequencing

[0284] Primer panels for multiple PCR were selected using PrimalScheme (PrimalScheme.com) using the genomes of ORV, OPLV and OSV as reference and an estimated amplicon length of 400bp. cDNA were obtained using the RT SuperScript IV first strand cDNA synthesis. The PCR was conducted separately using pool 1 and pool2 primers sets using the Q5 High Fidelity DNA Polymerase with a 30s denaturation step at 98°C, 35 amplification cycles (10sec at 95°C, 20sec at 58°C and 20sec at 72°C) and a final extension step of 3 min at 72°C. After clean up using AmpPure XP beads, the amplicons were quantified using Qubit kit DNA high sensitivity, and deposited on an agarose gel. Libraries were prepared using the Illumina TruSeq DNA PCR-free low throughput library prep kit following the manufacturer’s instruction and sequenced on NextSeq 2000600 cycles (2x300bp).

[0286] Table 12 Primers used for sequencing of segment 1 of OPLV Name Pool Sequence Size (bp) %GC Tm (°C) OPLV_seg1_1_L 1 TGAGAAATCAGGTTGTATTGTTACATCG (SEQ ID NO : 157)28 35.71 60.70OPLV_seg1_1_R 1GGATGTTAGGAACTATATCAGACATGGC(SEQ ID NO : 158) 28 42.86 61.80OPLV_seg1_2_L 2CACCACAA(GSEAQTGIDTTNCOTA:A15A9A)TTTCCTCA28 35.71 61.02OPLV_seg1_2_R 2 AGGGTTCTTCCTTCTCAATTCATCC (SEQ ID NO : 160)25 44.00 60.96OPLV_seg1_3_L 1GTTCTCAACATTTGCCATTGATGAAG(SEQ ID NO : 161) 26 38.46 60.34OPLV_seg1_3_R 1CCATAAGAG(GSTEGQGIDGTNAOTA:1A6T2T)AAAGGAAAC30 36.67 60.88OPLV_seg1_4_L 2AACAAGCACTCAACAAGCAGAC(SEQ ID NO : 163) 22 45.45 60.08OPLV_seg1_4_R 2ACTGCG(STETQTAIDAANTOTT:C16T4T)GCCCC23 43.48 60.81OPLV_seg1_5_L 1 CCTGTTGAATTTGTTTCATCCTTGC (SEQ ID NO : 165)25 40.00 60.20OPLV_seg1_5_R 1TGCAGAACAAGCAATTTCTCTAGTC(SEQ ID NO : 166) 25 40.00 60.20OPLV_seg1_6_L 2CATTGAGAA(SAETQTCIDATNTOG:A1A6A7C)TTTCCCAG29 34.48 60.92OPLV_seg1_6_R 2 GACTTAAAGCTGTACATTCTGATGTTGT (SEQ ID NO : 168)28 35.71 60.86OPLV_seg1_7_L 1AAACCCACCAAATCTCATCAGCA(SEQ ID NO : 169) 23 43.48 61.01OPLV_seg1_7_R 1TTCTTG(SAECQCTIDGGNOGA:C17A0T)GATGG22 50.00 60.21OPLV_seg1_8_L 2 GGGATTCTTCTAGCCCTGGACA (SEQ ID NO : 171)22 54.55 61.41OPLV_seg1_8_R 2GTTTGATATTCCAACTCAGGTGCAG(SEQ ID NO : 172) 25 44.00 60.77OPLV_seg1_9_L 1AGGAAGTC(CSTECQAICDANTOTA:A17T3G)TATACAGG28 39.29 60.98OPLV_seg1_9_R 1 GCACTCCTTTAAAACAAGCAGAAC (SEQ ID NO : 174)24 41.67 59.57OPLV_seg1_10_L 2GCTAGTAATGTTGATCTTGAGGAAGC(SEQ ID NO : 175) 26 42.31 60.45 OPLV_seg1_10_R 2TCTGATC(STEAQGGIDANCOTT:G1A76C)CTCCTG24 50.00 60.96 OPLV_seg1_11_L 1 ATGACCCACCCAGAAGTCAAAC (SEQ ID NO : 177)22 50.00 60.67OPLV_seg1_11_R 1ATCCTTGCATCATGCCTGAGTC(SEQ ID NO : 178) 22 50.00 60.93OPLV_seg1_12_L 2TGGATGC(STECQAAIDGANAOA:T1A7G9)TTCATGG25 40.00 59.79OPLV_seg1_12_R 2 TCTTTACTGCTGATGATCCCAAGC (SEQ ID NO : 180)24 45.83 61.25OPLV_seg1_13_L 1TCATATCAAATGCCCCTATACAATACGT(SEQ ID NO : 181) 28 35.71 61.08OPLV_seg1_13_R 1TGGGGT(SCEAQGGIDANAOCT:C1T8T2)AGAAGT23 47.83 60.70OPLV_seg1_14_L 2 GGTTTGTATTTCTATAGAATGGCAGGC (SEQ ID NO : 183)27 40.74 61.01OPLV_seg1_14_R 2TTCATGGCGATGTGAACCTCA(SEQ ID NO : 184) 21 47.62 60.10OPLV_seg1_15_L 1ACAAATGTC(SAEGQAIADANAOTA:C1A85A)GGAACTCA28 32.14 60.50OPLV_seg1_15_R 1 ACTGCTCATGAAGAGGGAAAAACA (SEQ ID NO : 186)24 41.67 61.01OPLV_seg1_16_L 2GGATGAGCAAGAGCCCTTTATCA(SEQ ID NO : 187) 23 47.83 60.69 OPLV_seg1_16_R 2TTTCCC(SCETQTCIDTTNGOG:T1G88G)TCCTA22 50.00 60.89OPLV_seg1_17_L 1CCCTTTCTGAGAGACACGTTCTAC(SEQ ID NO : 189) 24 50.00 60.93OPLV_seg1_17_R 1ACCTCT(STGEQTCIDACNAOA:G1A9G0)CTTTGT23 43.48 60.63OPLV_seg1_18_L 2 CTTTTCTGACAAGCGCAAGGC (SEQ ID NO : 191)21 52.38 61.03OPLV_seg1_18_R 2TGGATTCTATAACTGGTTCCACTTTCC(SEQ ID NO : 192) 27 40.74 61.30 OPLV_seg1_19_L 1CAGACA(ASCETQTAIDGNAOAG:T1G93T)TGCAGC24 45.83 60.87 OPLV_seg1_19_R 1 GCTCAGGCAAGTTCTCTGACAT (SEQ ID NO : 194)22 50.00 60.80OPLV_seg1_20_L 2AGACTTGGTTGCAGAGTGTGAAA(SEQ ID NO : 195) 23 43.48 60.88 OPLV_seg1_20_R 2GAGGAG(STETQGAIDCANGOT:T1G9G6)AAAGCA23 47.83 61.25 OPLV_seg1_21_L 1 GCACTGATGGAACCACTAGATCC (SEQ ID NO : 197)23 52.17 61.00OPLV_seg1_21_R 1ACTTCTTTTCTTCAGACGAGGTGG(SEQ ID NO : 198) 24 45.83 61.06

[0287] Table 13 Primers used for sequencing of segment 2 of OPLV Name Pool Sequence Size (bp) %GC (%) Tm (°C) OPSV_seg2_1_L 1 GGACACACAGACACCCATACAAA (SEQ ID NO : 199)23 47.83 61.00OPSV_seg2_1_R 1TGTTCTCAGGCGTGACAGTCTA(SEQ ID NO : 200) 22 50.00 61.26 OPSV_seg2_2_L 2ATGTC(TSGETQGIGDTNCOTT:C2C01T)CCTGA22 50.00 60.68 OPSV_seg2_2_R 2 ATCCTGGGCTGCTTTCACAAAT (SEQ ID NO : 202)22 45.45 61.01OPSV_seg2_3_L 1TGTATGCAGTTGCCTTGGGTG(SEQ ID NO : 203) 21 52.38 61.26 OPSV_seg2_3_R 1TCTGGT(SCECQTAIDCTNCOT:T2C0A4C)TCTGG23 52.17 60.82

[0288] Table 14 Primers used for complete genome sequencing of OSV Name Pool Sequence Size (bp) %GC (%) Tm (°C)Opisthorsi_1_L 1GGCTGGGAAACACGATCATACA(SEQ ID NO : 205) 22 50.00 60.86Opisthorsi_1_R 1GGAAA(CSGECQTICDTNCOAC:2C0A6A)CTTCT22 50.00 60.99Opisthorsi_2_L 2 CTAAGCGTCGGGTTAGTAGTGATC (SEQ ID NO : 207)24 50.00 60.87Opisthorsi_2_R 2ATCTGACAACTTCCTGCATGCC(SEQ ID NO : 208) 22 50.00 61.39 Opisthorsi_3_L 1CGTTCAA(SGEAQCIGDCNTOAA:T2C09G)AAATGC24 45.83 61.60 Opisthorsi_3_R 1 TCCGAAGCTCATGACAATAGTGC (SEQ ID NO : 210)23 47.83 61.24Opisthorsi_4_L 2CCGGAAGTATCATCGTGATGGG(SEQ ID NO : 211) 22 54.55 60.79 Opisthorsi_4_R 2GCACAC(TSCEGQAITDTNCOTT:T2T1A2)AGTCGG24 45.83 60.74 Opisthorsi_5_L 1 GGTTGTGCCAAAGAAACTATGGG (SEQ ID NO : 213)23 47.83 60.56Opisthorsi_5_R 1TTCTTCGCCATCTTCACTGACC(SEQ ID NO : 214) 22 50.00 60.79Opisthorsi_6_L 2GAAACA(SGEAQCTIDTGNGOC:G21G5A)AGAGA22 50.00 60.73Opisthorsi_6_R 2 CCACTAGGATCGTGCGCAAT (SEQ ID NO : 216)20 55.00 60.55Opisthorsi_7_L 1GAATTGTGAAGATTCGCTGCGC(SEQ ID NO : 217) 22 50.00 61.52Opisthorsi_25_R 1AGCACCTTCACGTCTTTCACC(SEQ ID NO : 254) 21 52.38 60.91 Opisthorsi_26_L 2CCACT(GSCETQTIGDANGOTT:G25C5T)TTTGG22 50.00 60.98Opisthorsi_26_R 2 ATCGGCTATATCTTGAAGCGCG (SEQ ID NO : 256)22 50.00 61.16Opisthorsi_27_L 1AAGGGGCCTGATATTGTGCG(SEQ ID NO : 257) 20 55.00 60.48 Opisthorsi_27_R 1GCGACGT(SGEAQAGIDTNAAOG:T2A5T8G)TAATGC25 44.00 60.92 Opisthorsi_28_L 2 TTTGGGTGCGATTTTTCTTCTGC (SEQ ID NO : 259)23 43.48 61.05Opisthorsi_28_R 2ACATCGTCATAGAGAGAAAAGTAGTCAG(SEQ ID NO : 260) 28 39.29 60.96 Opisthorsi_29_L 1TACCG(TSTEAQTCIDAANCOC:A2C61C)ACACC22 50.00 60.47 Opisthorsi_29_R 1 AGGGCCAGTTAGATGAGACGAT (SEQ ID NO : 262)22 50.00 60.88Opisthorsi_30_L 2CCTGCGGAATGGAAAGTTGAATTT(SEQ ID NO : 263) 24 41.67 60.88 Opisthorsi_30_R 2TGAAAAT(ASAEAQAIGDTNCOCG:2A6T4A)GCAGCG25 40.00 60.59 Viral genome characterization and phylogenetic analyses

[0289] Open reading frame (ORF) prediction was performed using Translate on ExPASy. Annotation of domains was deduced from comparisons against the Conserved Domain Database as implemented by BLASTp against the nr protein database. Initial supergroup assignments were determined from best BLAST matches. Predicted RNA dependent RNA polymerase (RdRP) sequences from S. solidus-associated viruses, and representative sequences from related viral families and genera ratified by the ICTV and from recent metatranscriptomic studies, were aligned using the E-INS-I algorithm implemented in the program MAFFT (version 7) (48). Next, all ambiguously aligned regions were removed using TrimAl (version 1.2) (49). For each dataset, the best-fit model of aa substitution was determined using Smart Model Selection (50). Phylogenetic trees were inferred using the maximum likelihood method implemented in PhyML (version 3.0) (51) using the best-fit model and best of NNI and Subtree Pruning and Regrafting branch swapping. Support for nodes on the trees were assessed using an approximate likelihood ratio test with the Shimodaira–Hasegawa-like procedure. PCR assays to assess virus presence

[0290] Primers were designed in order to detect either C. sinensis or O. viverrini genomes through RT-qPCR. Primers are provided in Table 4. To assess the presence of the virus throughout the life cycle of O. viverrini, samples were collected from different developmental stages of the parasite. Cercariae were shed from Bithynia snails obtained from endemic areas in two biological replicates. The newly excysted juveniles (NEJs),representing the infective stage, were collected in three biological replicates, with 1,000 NEJs per replicate. Adult worms were recovered from three hamsters, a total of 27 adult worms. RNA extraction was performed for all parasite stages using Trizol reagent according to the manufacturer's instructions (Invitrogen, USA). Total RNA (500 ng) from each sample was reverse transcribed to cDNA using the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, USA). Quantitative real-time PCR (qRT-PCR) was carried out using LightCycler 480 (Roche Diagnostics, Germany) and SYBR Green I (Roche) as the fluorophore. The primer sequences are listed in Table 4. Each qRT-PCR reaction, performed in triplicate, contained 10 µl of Maxima SYBR Taq (2×), 0.6 µl of each 10 mM primer, 2 µl of first-strand cDNA, and sterile water to a final volume of 20 µl. The PCR cycling conditions were: initial denaturation at 95°C, followed by 40 cycles of 95°C for 5 seconds, 60°C for 30 seconds, and 72°C for 1 second. The O. viverrini actin gene was used as the internal control.

[0291] To determine the limit of detection (LOD) and the limit of quantification (LOQ) of the different RT-qPCR systems, we generated synthetic RNAs based on the sequences of ORV, OPLV and OSV viruses. Briefly, primers flanking the region of the qPCR were designed, and the sequence of the T7 promotor was added in 5’ of the forward primer to allow in vitro transcription of PCR products (Table 6). Amplifications of portions of viral genomes was obtained from the pool of adult worms, purified with the PCR & Gel cleanup kit (Macherey-Nagel), and in vitro transcribed using the Ambion™ MEGAshortscript™ T7 Transcription Kit (Invitrogen), according to the manufacturer’s recommendations. After purification, the number of genome copies was assessed by quantifying the concentration of RNA with the following formula: N = [C (µg / mL ARN).10-3x (6,023.1023molecules / mol)] / [length x (330g / mol).106]. Synthetic RNAs were retrotranscribed as described above, and 10-fold serial dilutions were used to determine the LOD and LOQ of each PCR system. The LOQ was determined as the last positive dilution that belongs to the linear phase of the standard curve while the LOD was determined as the last dilution that can be detected by the machine (here: the LightCyclerTM, Roche).To assess virus presence and viral load (expressed in genome copies) in parasitized hamsters, we used the RT-qPCR systems described above and the synthetic RNAs as standards. Briefly, total RNA from hamster tissues were extracted using the Maxwell RCS Tissue kit (Promega) and retrotranscribed with random hexamers as described previously. SYBR Green qPCR assay (FastStart Essential DNAGreen Mastermix, Roche) was performed in duplicates, and virus titer was determined by converting the mean Ct value into the mean genome copy / PCR reaction. RNAscope In-situ hybridization to localize viral RNA

[0292] RNAscope® ISH was used to localize the ORV, OSV and OPLV viral transcripts in hamster liver samples. For each virus, a panel of Sense and Antisense probes were developed and manufactured by Bio-Techne (https: / / www.bio-techne.com / ; Minneapolis, Minnesota, USA) (Table 5). Five µm sections of formalin-fixed, paraffin- embedded (FFPE) liver tissue samples were mounted on positively charged SuperFrost plus slides (Fischer Scientific). The RNAscope® ISH assay was performed using an RNAscope ™ Multiplex Fluorescent Reagent Kit v2 (323100-USM, ACD®; Bio-Techne). Details of the optimized protocol can be found here: https: / / acdbio.com / system / files_force / UM%20323100%20Multiplex%20Fluorescent%2 0v2%20User%20Manual_0.pdf?download=1. The samples were subjected to a protease-based pretreatment. The slides were then incubated with different RNAscope® 2-plex probes: a negative control probe (#320871), a positive control probe (Mau-Ppib- C1, #890851-C1), and target O. viverrini virus probes (Table 5). After three amplification steps, fluorophores were added: TSA Vivid 570 (# 323272) to probe C1 and TSA Vivid 650 (# 323273) to probe C2. Then, a counterstain with DAPI was performed. After mounting, slides were evaluated with a ZEISS AxioScan 7 digital slide scanner and Zen software (version 3.9.101) (Zeiss®, Oberkochen, Germany). Preparation of recombinant viral proteins

[0293] The ORV, OSV and OPLV target genes and the O. viverrini TSP2 have been synthesized with a carboxy-terminal His6-tag with Nco I and Xho I restriction site at each of the both ends respectively (GeneArtTM, Thermofisher). The synthetic genes were subcloned by cleavage of pET-23 plasmid and expression gene by Nco I and Xho I restriction enzymes (NEB) then ligated using a T4 ligase (NEB). Gene sequences were validated by Eurofins using T7 and T7 terminator. T7 Express LysY / Iq E. coli strains were chemically transformed then plated on Petri dishes (LB, carbenicillin 100 µg / mL). Plastic Erlen-Mayer containing 300 mL of NZY medium (NZ-Biotech) and carbenicillin 100 µg / mL were seeded from the Petri dish and bacteria were grown, orbitally agitated at 180 RPM overnight at room temperature (RT). The cultures were centrifugated 10 min at 4000 RPM (4-16KS, Sigma) in 50 mL conical tubes (Thermofisher). Supernatants were discarded and pellets were resuspended in PBS 2X, 20mM phosphate, 20 mMimidazole, 300 mM NaCl, lysozyme 30 mg / mL, Triton 0.1%, EDTA-free protease inhibitor 1x (Roche). B-PER™ II Bacterial Protein Extraction Reagent 1X (ThermoScientific). The suspensions were homogenized and left 15 minutes at RT for lysis by the reagent. The lysates were placed on ice and we added 50 µL of RNAse and DNase I at 10 mg / mL (Roche), MgCl2 at 2 mM final (Sigma-Aldrich). The lysates were clarified by centrifugation, 30 min 4 °C, 13300 g (5427R, Eppendorf). For each nucleoprotein, a 5 mL His-Trap column (Cytiva) was preequilibrated with 25 mL PBS 2x, imidazole 20 mM using an AKTA pure liquid chromatographic system (Cytiva). The supernatant was loaded on the column 4 mL / min, then washed with 65 mL of PBS 2x, imidazole 20 mM,. Proteins were eluted with PBS 2x, imidazole 500 mM. The 280 nm-absorption was recorded in real-time and samples were collected in 1 mL fractions. High absorption fractions were controlled using electrophoresis on stain-free 4-15% acrylamide- bisacrylamide gels (BioRad) in SDS 10% (Sigma-Aldrich). High absorption fractions were pooled together and concentrated until 0.5 mL by centrifugation using 30 kDa- cutoff filtration tubes (Ultra 30k, Amicon). A Superdex 200 column (Cytiva) was preequilibrated using 50mL PBS 1x at 0.8 mL / min (Akta pure, Cytiva). The 0.5 mL fraction was loaded on the Superdex 200 at 0.8 mL / min for a size-exclusion separation in 0.5 mL fractions collected in tubes. High absorption fractions were controlled using electrophoresis on stain-free 4-15% acrylamide-bisacrylamide gels (BioRad) in SDS 10% (Sigma-Aldrich) as shown in Figure 26. Best fractions were pooled, EDTA-free protease inhibitor 1x (Roche) was added for storage at 4°C and -80°C. Protein concentrations were measured at 280 nm. Protein Expression

[0294] Expression of ORV (NP), OPLV (NP), and OSV (SP24) were achieved by generating constructs.

[0295] Sequences of genes and corresponding proteins used in the serologic assays are given below. Nucleic sequence of ORV (NP)with SBP-tag (SEQ ID NO: 81) Nucleic sequence of ORV (NP) without SBP-tag (SEQ ID NO: 304) Amino acid sequence ORV (NP) with SBP-tag (SEQ ID NO: 82) Amino acid sequence ORV (NP) without SBP-tag (SEQ ID NO: 305) Nucleic sequence of OPLV (NP) with SBP-tag (SEQ ID NO: 83) Nucleic sequence of OPLV (NP) without SBP-tag (SEQ ID NO: 306)Amino acid sequence OPLV (NP) with SBP-tag (SEQ ID NO: 84) Amino acid sequence OPLV (NP) without SBP-tag (SEQ ID NO: 307) Nucleic sequence of OSV (SP24) with SBP-tag (SEQ ID NO: 85) Nucleic sequence of OSV (SP24) without SBP-tag (SEQ ID NO: 304) Amino acid sequence OSV (SP24) with SBP-tag (SEQ ID NO: 86) Amino acid sequence OSV (SP24) without SBP-tag (SEQ ID NO: 309) Serologic Luciferase-Linked Immuno-Sorbent Assay (LuLISA) of IgG specific to ORV, OSV and OPLV proteins.

[0296] White 96-well plate (MaxiSorpTM, Nunc, Thermofisher) were coated with Streptavidin at 5 µg / mL in carbonate buffer pH = 9.3, 50 µL / well, overnight at 4°C. The plate was washed 6 times with 100 µL of PBS Tween 0.1% per well using a plate washer (Zoom, Berthold). The ORV, OSV and OPLV nucleoproteins were coated at 1 µg / mL in PBS, 50 µL / well, was the coated during a 1hr-incubation at room temperature then washed 6 times with 100 µL of PBS Tween 0.1% per well. Dilution series of hamster sera were done in PBS Tween 0.2%. Human sera were diluted 1 µL / 50 µL of PBS Tween 0.2%. Diluted sera were loaded, 50 µL / well for a 1 hr-incubation at room temperature then washed 6 times with 100 µL of PBS Tween 0.1% per well. An anti-kappa IgG- specific VHH or a human IgG Fc-specific VHH, expressed as a chimera with the luciferase JAZ (described in the patents Rose et al., Luciferase linked immunosorbent assay, EP4143306A1, US20230145894A1, CA3176386A1), was added to wells: 50 µL / well, 100 pg / mL of VHH-JAZ in PBS Tween 0.2% incubated 30 min at room temperature. The plate was washed 6 times with 100 mL of PBS Tween 0.1% per well. The luciferase substrate, Hikarazine Q108 (52) was loaded, 50 µL / well, Q10813.5 mM in PBS. The bioluminescence was measured extemporaneously using a luminometer (Mithras 2, Berthold), 0.5 s / well (39).

[0297] White 96-well plate (FluoroNunc C96 MaxiSorp™, Thermofisher) were coated with the recombinant antigen proteins at 1 µg / mL in carbonate buffer pH = 9.3, 50 µL / well, overnight at 4°C. The plate was washed 3 times with 100 µL of PBS Tween 0.1% per well using the portable aspiration system Vacusip (Integra). Serum plasma were diluted 5 times in Glycine-HCl buffer pH 1.8 for acid immun-complex dissociation (ICD) at RT for 1h30. ICD were neutralized with Tris-HCl buffer pH 9.0 to reach a finalpH of 7.5. Immediate dilution were performed in PBS 0.1% Tween20 buffer to reach a final serum plasma dilution of 1:150. Diluted sera were loaded, 50 µL / well for a 1 hr- incubation at room temperature then washed 3 times with 100 µL of PBS Tween 0.1% per well. An anti-hamster IgG Fc-specific VHH or an anti-human IgG Fc-specific VHH, expressed as a chimera with the luciferase JAZ (described in the patent applications Rose et al., Luciferase linked immunosorbent assay, EP4143306A1, US20230145894A1, CA3176386A1), was added to wells: 50 µL / well, 1 ng / mL of VHH- JAZ in PBS Tween 0.1% incubated 1 hour at room temperature. The plate was washed 3 times with 100 µL of PBS Tween 0.1% per well. The luciferase substrate, Hikarazine Q108 (52) was loaded, 50 µL / well, Q10813.5 mM in PBS. The bioluminescence was measured extemporaneously using a luminometer (Centro, Berthold Technologies), 0.5 s / well (39).

[0298] Avidity Index determination was performed on 86 samples of each group of patients (APF negative, APF positive, CCA). Each sample were assayed in LuLISA with two replicates on the same plate. After the serum incubation test at dilution 1:300 (ICD was performed), the plates were washed once with PBST 0.1% and then one replicate was incubated with PBST 0.1% and the other with PBST 0.1% + urea 6M during 10 minutes at RT. After this step, the plates were washed two times in PBST 0.1% and the following steps were the same as for the LuLISA described before. The Avidity Index (AI) was determined as follow: AI (%) = RLU (urea) / RLU (PBST) *100. Statistics analysis

[0299] The antibody titer was quantified as RLU / s (Relative Light Unit per second) and expressed as RLU / s or RU (Relative Unit). The RU was determined through a LuLISA standard curve in which a serial dilution of a known concentration of specific IgG was performed (Figure 28). Each standard curves was approximated with a 4- parameters Hill model using the package minpack.lm of RStudio (R version 4.3.0). To normalize the data, the same two positives samples were assayed in each plate and used as calibration. The usefulness of serological tests fir diagnosis of opisthorchiases in terms of sensitivity, specificity, and positive predicted values and negative predicted values was estimated by Receiver Operating Curve (ROC) analysis.Statistical analysis and graphics generation were performed on RStudio (R version 4.3.0). Separate one- way ANOVAs were conducted for each antibody response (TSP2, ORV nucleoprotein, OPLV nucleoprotein, OSV capsid-core protein), with the patient group (APF negative,APF positive, CCA) as the independent variable and the antibody response as the dependent variable. Post hoc pairwise comparisons were performed using Tukey's Honest Significant Difference (HSD) test, which controls the family-wise error rate and adjusts p-values to account for multiple comparisons. This allowed the assessment of whether individual antibody levels varied significantly across patient groups. A significance level of p < 0.05 was used throughout. For graphical readability, p-values are shown in graphics with the following code: “ns” if p-value>0.05, “*” if p-value<0.05, “**” if p-value<0.01, “***” if p-value<0.001, “****” if p-value<0.0001.

[0300] The percent distribution of selected demographic characteristics was calculated for (1, n=93) parasitized by O. viverrini and APF negative and (2, n=91), parasitized by O. viverrini and APF positive. The estimated sample size for the unmatched case-control study was 85, providing 80% power at a 95% confidence level (2-sided) with a significance level of p < 0.05 with a Bonferroni correction for multiple testing. Adjusted odds ratios and 95% confidence intervals for log transformed antibody titers (lnRLU / s) and their association with APF were determined using age, sex and Eggs per gram of feces (EPG) adjusted multiple logistic regression analyses. Confidence intervals for quartiles of lnRLU / s and their association with APF were determined using age and sex adjusted logistic regression analyses. A Chi-square test for trend was also used to test the effect of increasing quartile level of IgG on increasing risk of APF. Extracellular vesicules purification

[0301] Extracellular vesicles (EVs) were extracted from the excretory / secretory (ES) products of adult O. viverrini (OvES) utilizing a protocol previously established (53). Briefly, adult O. viverrini were cultured in RPMI-1640 supplemented with 1% glucose, antibiotics (Penicillin-Streptomycin at 100 μg, Invitrogen, USA), and 1 μM of the protease inhibitor E64 (Thermo Scientific, USA). The cultures were maintained at 37°C in vitro, and the OvES were harvested twice a day for 7 days. Subsequent to collection, the supernatants were centrifuged at 2,090 g for 10 minutes to separate the eggs. The OvES was then concentrated and underwent buffer exchange to 1x PBS via a 10 kDa cut-off Amicon filter (Amicon, Merk Millipore, USA). To eliminate cellular debris, 1 mL of the concentrated OvES was subjected to a stepwise centrifugation at 500 g, 2,000 g, 4,000 g, and 12,000 g, each for 30 minutes. The clarified supernatant was filtered through a0.22 μm filter (Sartorius, Germany) and the EVs were then consolidated by ultracentrifugation at 110,000 g for 3 hours.

[0302] For density gradient separation, an OptiPrepTMdensity gradient ultracentrifugation (ODG) was constructed. A 60% Iodixanol solution (Sigma Aldrich, USA) was diluted with 0.25 M sucrose in 10 mM Tris-HCl, pH 7.2, creating layers of 40%, 20%, 10%, and 5% iodixanol, which were sequentially poured into an ultracentrifuge tube in descending order of density. The harvested O. viverrini EVs (OvEVs) were layered on top this gradient and centrifuged at 110,000 g for 18 hours at 4°C. Fractions with densities ranging from 1.12 to 1.24 g / mL were combined and subjected to buffer exchange to PBS using 100 kDa cut-off purification columns (Amicon, Merk Millipore, USA), and the EVs were finally resuspended in 200 μl of 1xPBS. The EV was kept in -80°C for further investigation. O.viverrni extracellular vesicles exposure human cholangiocyte cell for viral infection

[0303] Human cholangiocyte H69 cell line were growth and maintained in Dulbecco’s modified Eagle’s medium (DMEM) / Ham-F12 (Gibco, USA) supplemented with 10% fetal bovine serum (FBS), 100 Units / ml Penicillin and 100 Units / ml Streptomycin (Life Technologies, Carlsbad, CA, USA), insulin, adenine, epinephrine, T3- T, epidermal growth factors (EGF) and hydrocortisone (54). The cells were grown at 37ºC in 5% CO2 environment.

[0304] Ten thousand H69 cells were seeded into a 24 well plate (SPL Life Sciences, Korea) and incubated overnight. The cells were then replaced with 0.5% FBS in complete H69 culture media for 3 hours before EVs exposure. The cells were co- cultured with 1.25 ug of O. viverini EVs for 24 hours before removal and continuous culturing with 0.5% FBS in complete H69 culture media for 7 days. The culture media from 7-days culturing were harvested and use to inoculate H69 cell seeded in 24-well plate. The cytopathic effect was observed under a microscope after 3 days of exposure to the inoculate. The cells were collected for viral detection using real-time PCR.References 1. de Martel C, Ferlay J, Franceschi S, Vignat J, Bray F, Forman D, Plummer M. Global burden of cancers attributable to infections in 2008: a review and synthetic analysis. Lancet Oncol.2012 Jun;13(6):607–615. PMID: 22575588 2. IARC Working Group on the Evaluation of Carcinogenic Risks to Humans. Biological agents. IARC Monogr Eval Carcinog Risks Hum. 2012;100(Pt B):1– 441. PMCID: PMC4781184 3. Pagano JS, Blaser M, Buendia MA, Damania B, Khalili K, Raab-Traub N, Roizman B. Infectious agents and cancer: criteria for a causal relation. Semin Cancer Biol. 2004 Dec;14(6):453–471. PMID: 15489139 4. Sripa B, Kaewkes S, Sithithaworn P, Mairiang E, Laha T, Smout M, Pairojkul C, Bhudhisawasdi V, Tesana S, Thinkamrop B, Bethony JM, Loukas A, Brindley PJ. Liver fluke induces cholangiocarcinoma. PLoS Med.2007 Jul;4(7):e201. PMCID: PMC1913093 5. Brindley PJ, da Costa JMC, Sripa B. Why does infection with some helminths cause cancer? Trends Cancer.2015 Nov 1;1(3):174–182. PMCID: PMC4657143 6. Khuntikeo N, Thinkhamrop B, Bundhamcharoen K, Andrews RH, Grundy-Warr C, Yongvanit P, Loilome W, Chamadol N, Kosuwan W, Sithithaworn P, Petney TN. The Socioeconomic Burden of Cholangiocarcinoma Associated With Opisthorchis viverrini Sensu Lato Infection in Northeast Thailand: A Preliminary Analysis. Adv Parasitol.2018;102:141–163. PMID: 30442308 7. Rizvi S, Khan SA, Hallemeier CL, Kelley RK, Gores GJ. Cholangiocarcinoma - evolving concepts and therapeutic strategies. Nat Rev Clin Oncol. 2018 Feb;15(2):95–111. PMCID: PMC5819599 8. Mairiang E. Ultrasonographic features of hepatobiliary pathology in opisthorchiasis and opisthorchiasis-associated cholangiocarcinoma. Parasitol Int. 2017 Aug;66(4):378–382. PMID: 27956092 9. Jongsuksuntigul P, Imsomboon T. Opisthorchiasis control in Thailand. Acta Trop. 2003 Nov;88(3):229–232. PMID: 14611877 10. Brindley PJ, Bachini M, Ilyas SI, Khan SA, Loukas A, Sirica AE, Teh BT, Wongkham S, Gores GJ. Cholangiocarcinoma. Nat Rev Dis Primers. 2021 Sep 9;7(1):65. PMCID: PMC9246479 11. Havelaar AH, Kirk MD, Torgerson PR, Gibb HJ, Hald T, Lake RJ, Praet N, Bellinger DC, de Silva NR, Gargouri N, Speybroeck N, Cawthorne A, Mathers C, Stein C, Angulo FJ, Devleesschauwer B, World Health Organization Foodborne Disease Burden Epidemiology Reference Group. World Health Organization Global Estimates and Regional Comparisons of the Burden of Foodborne Disease in 2010. PLoS Med.2015 Dec;12(12):e1001923. PMCID: PMC4668832 12. Fedorova OS, Fedotova MM, Zvonareva OI, Mazeina SV, Kovshirina YV, Sokolova TS, Golovach EA, Kovshirina AE, Konovalova UV, Kolomeets IL, GutorSS, Petrov VA, Hattendorf J, Ogorodova LM, Odermatt P. Opisthorchis felineus infection, risks, and morbidity in rural Western Siberia, Russian Federation. PLoS Negl Trop Dis. 2020 Jun;14(6):e0008421. PMCID: PMC7351239 De Liberato C, Scaramozzino P, Brozzi A, Lorenzetti R, Di Cave D, Martini E, Lucangeli C, Pozio E, Berrilli F, Bossù T. Investigation on Opisthorchis felineus occurrence and life cycle in Italy. Vet Parasitol. 2011 Apr 19;177(1–2):67–71. PMID: 21168274 Pozio E, Armignacco O, Ferri F, Gomez Morales MA. Opisthorchis felineus, an emerging infection in Italy and its implication for the European Union. Acta Trop. 2013 Apr;126(1):54–62. PMID: 23337391 Traverso A, Repetto E, Magnani S, Meloni T, Natrella M, Marchisio P, Giacomazzi C, Bernardi P, Gatti S, Gomez Morales MA, Pozio E. A large outbreak of Opisthorchis felineus in Italy suggests that opisthorchiasis develops as a febrile eosinophilic syndrome with cholestasis rather than a hepatitis-like syndrome. Eur J Clin Microbiol Infect Dis.2012 Jun;31(6):1089–1093. PMID: 21938537 Mangano VD, Campani D, Cacciato Insilla A, Coco B, Gomez Morales MA, Brunetto M, La Rosa G, Ludovisi A, De Simone P, Bruschi F. An Unexpected Case of Opisthorchis felineus Infection Revealed during Liver Transplantation. Pathogens.2023 Jul 31;12(8):1003. PMCID: PMC10459204 Fedorova OS, Kovshirina AE, Kovshirina YV, Hattendorf J, Onishchenko SV, Katanakhova LL, Taslicki SS, Chizhikov AV, Tataurov IA, Vtorushin SV, Sripa B, Ogorodova LM, Odermatt P. Opisthorchis Felineus Infection is a Risk Factor for Cholangiocarcinoma in Western Siberia: A Hospital-based Case-control Study. Clin Infect Dis.2023 Feb 8;76(3):e1392–e1398. PMID: 35723279 Boonmars T, Srirach P, Kaewsamut B, Srisawangwong T, Pinlaor S, Pinlaor P, Yongvanit P, Sithithaworn P. Apoptosis-related gene expression in hamster opisthorchiasis post praziquantel treatment. Parasitol Res.2008 Feb;102(3):447– 455. PMID: 18058134 Pinlaor S, Prakobwong S, Hiraku Y, Kaewsamut B, Dechakhamphu S, Boonmars T, Sithithaworn P, Pinlaor P, Ma N, Yongvanit P, Kawanishi S. Oxidative and nitrative stress in Opisthorchis viverrini-infected hamsters: an indirect effect after praziquantel treatment. Am J Trop Med Hyg. 2008 Apr;78(4):564–573. PMID: 18385350 Pinlaor S, Hiraku Y, Yongvanit P, Tada-Oikawa S, Ma N, Pinlaor P, Sithithaworn P, Sripa B, Murata M, Oikawa S, Kawanishi S. iNOS-dependent DNA damage via NF-kappaB expression in hamsters infected with Opisthorchis viverrini and its suppression by the antihelminthic drug praziquantel. Int J Cancer. 2006 Sep 1;119(5):1067–1072. PMID: 16570287 Pungpak S, Viravan C, Radomyos B, Chalermrut K, Yemput C, Plooksawasdi W, Ho M, Harinasuta T, Bunnag D. Opisthorchis viverrini infection in Thailand: studieson the morbidity of the infection and resolution following praziquantel treatment. Am J Trop Med Hyg.1997 Mar;56(3):311–314. PMID: 9129534 de Carvalho RVH, Lima-Junior DS, da Silva MVG, Dilucca M, Rodrigues TS, Horta CV, Silva ALN, da Silva PF, Frantz FG, Lorenzon LB, Souza MM, Almeida F, Cantanhêde LM, Ferreira R de GM, Cruz AK, Zamboni DS. Leishmania RNA virus exacerbates Leishmaniasis by subverting innate immunity via TLR3-mediated NLRP3 inflammasome inhibition. Nat Commun.2019 Nov 21;10(1):5273. PMCID: PMC6872735 Deng S, He W, Gong AY, Li M, Wang Y, Xia Z, Zhang XT, Huang Pacheco AS, Naqib A, Jenkins M, Swanson PC, Drescher KM, Strauss-Soukup JK, Belshan M, Chen XM. Cryptosporidium uses CSpV1 to activate host type I interferon and attenuate antiparasitic defenses. Nat Commun.2023 Mar 16;14(1):1456. PMCID: PMC10020566 Fichorova RN, Lee Y, Yamamoto HS, Takagi Y, Hayes GR, Goodman RP, Chepa- Lotrea X, Buck OR, Murray R, Kula T, Beach DH, Singh BN, Nibert ML. Endobiont viruses sensed by the human host - beyond conventional antiparasitic therapy. PLoS One.2012;7(11):e48418. PMCID: PMC3492353 Dheilly NM, Ewald PW, Brindley PJ, Fichorova RN, Thomas F. Parasite-microbe- host interactions and cancer risk. PLoS Pathog. 2019 Aug;15(8):e1007912. PMCID: PMC6695093 Dheilly NM, Lucas P, Blanchard Y, Rosario K. A World of Viruses Nested within Parasites: Unraveling Viral Diversity within Parasitic Flatworms (Platyhelminthes). Microbiol Spectr.2022 Jun 29;10(3):e0013822. PMCID: PMC9241645 Dheilly NM. Holobiont-Holobiont interactions: redefining host-parasite interactions. PLoS Pathog.2014 Jul;10(7):e1004093. PMCID: PMC4081813 Dheilly NM, Martínez Martínez J, Rosario K, Brindley PJ, Fichorova RN, Kaye JZ, Kohl KD, Knoll LJ, Lukeš J, Perkins SL, Poulin R, Schriml L, Thompson LR. Parasite microbiome project: Grand challenges. PLoS Pathog. 2019 Oct;15(10):e1008028. PMCID: PMC6786532 Hahn MA, Piecyk A, Jorge F, Cerrato R, Kalbe M, Dheilly NM. Host phenotype and microbiome vary with infection status, parasite genotype, and parasite microbiome composition. Molecular Ecology. John Wiley & Sons, Ltd; 2022 Mar 1;31(5):1577–1594. Hahn MA, Rosario K, Lucas P, Dheilly NM. Characterization of viruses in a tapeworm: phylogenetic position, vertical transmission, and transmission to the parasitized host. ISME J.2020 Jul;14(7):1755–1767. PMCID: PMC7305300 Shepherd JG, Davis C, Streicker DG, Thomson EC. Emerging Rhabdoviruses and Human Infection. Biology (Basel).2023 Jun 17;12(6):878. PMCID: PMC10294888 Longdon B, Murray GGR, Palmer WJ, Day JP, Parker DJ, Welch JJ, Obbard DJ, Jiggins FM. The evolution, diversity, and host associations of rhabdoviruses. Virus Evol.2015;1(1):vev014. PMCID: PMC5014481Dietzgen RG, Kondo H, Goodin MM, Kurath G, Vasilakis N. The family Rhabdoviridae: mono- and bipartite negative-sense RNA viruses with diverse genome organization and common evolutionary origins. Virus Res. 2017 Jan 2;227:158–170. PMCID: PMC5124403 Walker PJ, Firth C, Widen SG, Blasdell KR, Guzman H, Wood TG, Paradkar PN, Holmes EC, Tesh RB, Vasilakis N. Evolution of genome size and complexity in the rhabdoviridae. PLoS Pathog.2015 Feb;11(2):e1004664. PMCID: PMC4334499 Walker PJ, Dietzgen RG, Joubert DA, Blasdell KR. Rhabdovirus accessory genes. Virus Res.2011 Dec;162(1–2):110–125. PMCID: PMC7114375 Abudurexiti A, Adkins S, Alioto D, Alkhovsky SV, Avšič-Županc T, Ballinger MJ, Bente DA, Beer M, Bergeron É, Blair CD, Briese T, Buchmeier MJ, Burt FJ, Calisher CH, Cháng C, Charrel RN, Choi IR, Clegg JCS, de la Torre JC, de Lamballerie X, Dèng F, Di Serio F, Digiaro M, Drebot MA, Duàn X, Ebihara H, Elbeaino T, Ergünay K, Fulhorst CF, Garrison AR, Gāo GF, Gonzalez JPJ, Groschup MH, Günther S, Haenni AL, Hall RA, Hepojoki J, Hewson R, Hú Z, Hughes HR, Jonson MG, Junglen S, Klempa B, Klingström J, Kòu C, Laenen L, Lambert AJ, Langevin SA, Liu D, Lukashevich IS, Luò T, Lǚ C, Maes P, de Souza WM, Marklewitz M, Martelli GP, Matsuno K, Mielke-Ehret N, Minutolo M, Mirazimi A, Moming A, Mühlbach HP, Naidu R, Navarro B, Nunes MRT, Palacios G, Papa A, Pauvolid-Corrêa A, Pawęska JT, Qiáo J, Radoshitzky SR, Resende RO, Romanowski V, Sall AA, Salvato MS, Sasaya T, Shěn S, Shí X, Shirako Y, Simmonds P, Sironi M, Song JW, Spengler JR, Stenglein MD, Sū Z, Sūn S, Táng S, Turina M, Wáng B, Wáng C, Wáng H, Wáng J, Wèi T, Whitfield AE, Zerbini FM, Zhāng J, Zhāng L, Zhāng Y, Zhang YZ, Zhāng Y, Zhou X, Zhū L, Kuhn JH. Taxonomy of the order Bunyavirales: update 2019. Arch Virol. 2019 Jul;164(7):1949–1965. PMCID: PMC6641860 Herath V, Romay G, Urrutia CD, Verchot J. Family Level Phylogenies Reveal Relationships of Plant Viruses within the Order Bunyavirales. Viruses.2020 Sep 10;12(9):1010. PMCID: PMC7551631 Leventhal SS, Wilson D, Feldmann H, Hawman DW. A Look into Bunyavirales Genomes: Functions of Non-Structural (NS) Proteins. Viruses. 2021 Feb 18;13(2):314. PMCID: PMC7922539 Anna F, Goyard S, Lalanne AI, Nevo F, Gransagne M, Souque P, Louis D, Gillon V, Turbiez I, Bidard FC, Gobillion A, Savignoni A, Guillot-Delost M, Dejardin F, Dufour E, Petres S, Richard-Le Goff O, Choucha Z, Helynck O, Janin YL, Escriou N, Charneau P, Perez F, Rose T, Lantz O. High seroprevalence but short-lived immune response to SARS-CoV-2 infection in Paris. Eur J Immunol. 2021 Jan;51(1):180–190. PMCID: PMC7753614 Thamavit W, Pairojkul C, Tiwawech D, Itoh M, Shirai T, Ito N. Promotion of cholangiocarcinogenesis in the hamster liver by bile duct ligation after dimethylnitrosamine initiation. Carcinogenesis. 1993 Nov;14(11):2415–2417. PMID: 8242874Sithithaworn P, Haswell-Elkins MR, Mairiang P, Satarug S, Mairiang E, Vatanasapt V, Elkins DB. Parasite-associated morbidity: liver fluke infection and bile duct cancer in northeast Thailand. Int J Parasitol. 1994 Sep;24(6):833–843. PMID: 7982745 Sripa B, Mairiang E, Thinkhamrop B, Laha T, Kaewkes S, Sithithaworn P, Tessana S, Loukas A, Brindley PJ, Bethony JM. Advanced periductal fibrosis from infection with the carcinogenic human liver fluke Opisthorchis viverrini correlates with elevated levels of interleukin-6. Hepatology.2009 Oct;50(4):1273–1281. PMCID: PMC3682769 Sripa B, Thinkhamrop B, Mairiang E, Laha T, Kaewkes S, Sithithaworn P, Periago MV, Bhudhisawasdi V, Yonglitthipagon P, Mulvenna J, Brindley PJ, Loukas A, Bethony JM. Elevated plasma IL-6 associates with increased risk of advanced fibrosis and cholangiocarcinoma in individuals infected by Opisthorchis viverrini. PLoS Negl Trop Dis.2012;6(5):e1654. PMCID: PMC3358341 Ewald PW, Swain Ewald HA. Toward a general evolutionary theory of oncogenesis. Evol Appl.2013 Jan;6(1):70–81. PMCID: PMC3567472 Pérot P, Bigot T, Temmam S, Regnault B, Eloit M. Microseek: A Protein-Based Metagenomic Pipeline for Virus Diagnostic and Discovery. Viruses. 2022 Sep 8;14(9):1990. PMCID: PMC9500916 Bigot T, Temmam S, Pérot P, Eloit M. RVDB-prot, a reference viral protein database and its HMM profiles. F1000Res.2019;8:530. PMCID: PMC7492780 Goodacre N, Aljanahi A, Nandakumar S, Mikailov M, Khan AS. A Reference Viral Database (RVDB) To Enhance Bioinformatics Analysis of High-Throughput Sequencing for Novel Virus Detection. mSphere. 2018;3(2):e00069-18. PMCID: PMC5853486 Katoh K, Standley DM. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol Biol Evol. 2013 Apr;30(4):772– 780. PMCID: PMC3603318 Capella-Gutiérrez S, Silla-Martínez JM, Gabaldón T. trimAl: a tool for automated alignment trimming in large-scale phylogenetic analyses. Bioinformatics. 2009 Aug 1;25(15):1972–1973. PMCID: PMC2712344 Lefort V, Longueville JE, Gascuel O. SMS: Smart Model Selection in PhyML. Mol Biol Evol.2017 Sep 1;34(9):2422–2424. PMCID: PMC5850602 Guindon S, Delsuc F, Dufayard JF, Gascuel O. Estimating maximum likelihood phylogenies with PhyML. Methods Mol Biol.2009;537:113–137. PMID: 19378142 Coutant EP, Goyard S, Hervin V, Gagnot G, Baatallah R, Jacob Y, Rose T, Janin YL. Gram-scale synthesis of luciferins derived from coelenterazine and original insights into their bioluminescence properties. Org Biomol Chem. 2019 Apr 10;17(15):3709–3713. PMID: 30882838Chaiyadet S, Sotillo J, Krueajampa W, Thongsen S, Smout M, Brindley PJ, Laha T, Loukas A. Silencing of Opisthorchis viverrini Tetraspanin Gene Expression Results in Reduced Secretion of Extracellular Vesicles. Front Cell Infect Microbiol. 2022;12:827521. PMCID: PMC8875506 Ninlawan K, O’Hara SP, Splinter PL, Yongvanit P, Kaewkes S, Surapaitoon A, LaRusso NF, Sripa B. Opisthorchis viverrini excretory / secretory products induce toll-like receptor 4 upregulation and production of interleukin 6 and 8 in cholangiocyte. Parasitol Int.2010 Dec;59(4):616–621. PMCID: PMC3319364 Holtfreter MC, Moné H, Müller-Stöver I, Mouahid G, Richter J. Schistosoma haematobium infections acquired in Corsica, France, August 2013. Euro Surveill. 2014 Jun 5;19(22):20821. PMID: 24925456 Wellinghausen N, Moné H, Mouahid G, Nebel A, Tappe D, Gabriel M. A family cluster of schistosomiasis acquired in Solenzara River, Corsica (France) - Solenzara River is clearly a transmission site for schistosomiasis in Corsica. Parasitol Res.2022 Aug;121(8):2449–2452. PMCID: PMC9279187 World Health Organization (WHO). Schistosomiasis. Fact sheet N°115. Available from: http: / / www.who.int / mediacentre / factsheets / fs115 / en / [Internet]. 2025. Available from: http: / / www.who.int / mediacentre / factsheets / fs115 / en / Ghoneim MA, el-Mekresh MM, el-Baz MA, el-Attar IA, Ashamallah A. Radical cystectomy for carcinoma of the bladder: critical evaluation of the results in 1,026 cases. J Urol.1997 Aug;158(2):393–399. PMID: 9224310 Ghoneim MA, Abdel-Latif M, el-Mekresh M, Abol-Enein H, Mosbah A, Ashamallah A, el-Baz MA. Radical cystectomy for carcinoma of the bladder: 2,720 consecutive cases 5 years later. J Urol.2008 Jul;180(1):121–127. PMID: 18485392 Felix AS, Soliman AS, Khaled H, Zaghloul MS, Banerjee M, El-Baradie M, El- Kalawy M, Abd-Elsayed AA, Ismail K, Hablas A, Seifeldin IA, Ramadan M, Wilson ML. The changing patterns of bladder cancer in Egypt over the past 26 years. Cancer Causes Control.2008 May;19(4):421–429. PMCID: PMC4274945 Sripa B, Tangkawattana S, Sangnikul T. The Lawa model: A sustainable, integrated opisthorchiasis control program using the EcoHealth approach in the Lawa Lake region of Thailand. Parasitol Int. 2017 Aug;66(4):346–354. PMCID: PMC5443708 Botelho MC, Alves H, Richter J. Halting Schistosoma haematobium - associated bladder cancer. Int J Cancer Manag.2017;10(9):e9430. PMCID: PMC5771257 Zhang P, Zhang Y, Cao L, Li J, Wu C, Tian M, Zhang Z, Zhang C, Zhang W, Li Y. A Diverse Virome Is Identified in Parasitic Flatworms of Domestic Animals in Xinjiang, China. Microbiol Spectr. 2023 Jun 15;11(3):e0070223. PMCID: PMC10269781 Sotillo J, Pearson M, Potriquet J, Becker L, Pickering D, Mulvenna J, et al. Extracellular vesicles secreted by Schistosoma mansoni contain protein vaccine candidates. Int J Parasitol.2016;46(1):1–5.65. Eichenberger RM, Ryan S, Jones L, Buitrago G, Polster R, Montes de Oca M, et al. Hookworm Secreted Extracellular Vesicles Interact With Host Cells and Prevent Inducible Colitis in Mice. Front Immunol.2018;9:850. 66. Sujittra Chaiyadet, Javier Sotillo, Michael Smout, Martha Cooper, Denise L Doolan, Ashley Waardenberg, Ramon M Eichenberger, Matt Field, Paul J Brindley, Thewarach Laha, Alex Loukas, Small extracellular vesicles but not microvesicles from Opisthorchis viverrini promote cell proliferation in human cholangiocytes bioRxiv [Preprint].2023 May 22:2023.05.22.540805. 67. Ninlawan K, O’Hara SP, Splinter PL, Yongvanit P, Kaewkes S, Surapaitoon A, LaRusso NF, Sripa B. Opisthorchis viverrini excretory / secretory products induce toll- like receptor 4 upregulation and production of interleukin 6 and 8 in cholangiocyte. Parasitol Int.2010 Dec;59(4):616–621. PMCID: PMC3319364. 68. Kuhn JH, Brown K, Adkins S, de la Torre JC, Digiaro M, Ergünay K, Firth AE, Hughes HR, Junglen S, Lambert AJ, Maes P, Marklewitz M, Palacios G, Sasaya (笹M, Zhang (张永振) Y, Wolf YI, Turina M.2024.Promotion of order Bunyavirales to class Bunyaviricetes to accommodate a rapidly increasing number of related polyploviricotine viruses. J Virol98:e01069-24. https: / / doi.org / 10.1128 / jvi.01069-24

Claims

Claims 1. An isolated virus selected from the group consisting of Opisthorhabdovirus (ORV), Opisthorphenuilivirus (OPLV), Opisthorsivirus (OSV), Clonorsivirus (CSV), Clonorhabdovirus (CRV), Clonorphenuilivirus (CPLV),Schistohaemavirus (ShV), Schistohaematogalivirus (ShTLV), Schistohaemendornavirus (ShMV) and Schistorhabovirus (ShRV) or a virus with at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% nucleic acid identity with one of these viruses.

2. A cultured cell comprising the virus of claim 1.

3. The cell of claim 2, wherein the cell is a cholangiocyte cell or urothelial cell, preferably a human cholangiocyte cell or urothelial cell.

4. A recombinant nucleic acid comprising a nucleotide sequence of a virus selected from the group consisting of ORV, OPLV, OSV, CSV, CRV, CPLV, ShV, ShTLV, ShMV and ShRV.

5. The recombinant nucleic acid of claim 4, wherein the nucleotide sequence is nucleotide sequence of any of sequences of SEQ ID NO: 1 to SEQ ID NO: 13, SEQ ID NO: 271 to SEQ ID NO: 278, SEQ ID NO: 265 to SEQ ID NO: 270, or the RNA version thereof.

6. The recombinant nucleic acid of claim 4 or 5, wherein the nucleotide sequence comprises a fragment of at least 10 sequential nucleotides of any of sequences of SEQ ID NO: 1 to SEQ ID NO: 13, SEQ ID NO: 271 to SEQ ID NO: 278, SEQ ID NO: 265 to SEQ ID NO: 270, or the RNA version thereof .

7. The recombinant nucleic acid of any of claims 4 to 6, wherein the nucleotide sequence encodes a protein with at least 70%, 80%, 90%, 93%, 95%, 97%, 98%, 99% or 100% identity any of the sequences of SEQ ID NO: 14 to SEQ ID NO:56, SEQ ID NO: 279 to SEQ ID NO:

303.

8. An isolated nucleic acid of a virus selected from the group consisting of ORV, OPLV, OSV, CSV, CRV, CPLV, ShV, ShTLV, ShMV and ShRV for use as a diagnostic reagent.

9. A primer or probe comprising at least 10 sequential nucleotides of any of sequences selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 13, SEQ ID NO:271 to 278, SEQ ID NO: 265 to 270 or of the complementary sequence thereof.

10. A primer or probe comprising or consisting a nucleic acid sequence selected from the group consisting of SEQ ID NO: 57 to 68, SEQ ID NO: 69-80, SEQ ID NO: 87-156, SEQ ID NO: 157-198, SEQ ID NO: 199-204, SEQ ID NO: 205-264.

11. A pair of primers able to produce the amplicons comprised in or consisting of the nucleic acid sequence selected from the group consisting of SEQ ID NO: 1-13, SEQ ID NO: 271 to 278, SEQ ID NO: 265 to 270 or of the complementary sequence thereof.

12. The primer or probe according to any one of claims 9 to 11, which is labeled with a fluorescent, radioactive, or enzymatic label.

13. A kit comprising the primer or probe according to any one of claims 9 to 12 and amplification and / or hybridization reagents.

14. Use of the recombinant nucleic acid of any of claims 4-8 or the primer or probe of any of claims 9-12 in a diagnostic assay.

15. A method of detecting virus selected from the group consisting of Opisthorhabdovirus (ORV), Opisthorphenuilivirus (OPLV), Opisthorsivirus (OSV), Clonorsivirus (CSV), Clonorhabdovirus (CRV), Clonorphenuilivirus (CPLV), Schistohaemavirus (ShV), Schistohaematogalivirus (ShTLV), Schistohaemendornavirus (ShMV) and Schistorhabovirus (ShRV) or a virus with at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% nucleic acid identity with one of these viruses comprising contacting the primer or probe of any of claims 9- 12 with a biological sample and detecting the presence or absence of the viral nucleic acid in the sample.

16. An isolated protein or peptide of a virus selected from the group consisting of Opisthorhabdovirus (ORV), Opisthorphenuilivirus (OPLV), Opisthorsivirus (OSV), Clonorsivirus (CSV), Clonorhabdovirus (CRV), Clonorphenuilivirus (CPLV), Schistohaemavirus (ShV), Schistohaematogalivirus (ShTLV), Schistohaemendornavirus (ShMV) and Schistorhabovirus (ShRV) or a virus with at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% nucleic acid identity with one of these viruses for use as a diagnostic reagent.

17. An isolated protein or peptide comprising at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, or 50 consecutive amino acids of any of the amino sequences of SEQ ID NO: 14 to SEQ ID NO: 56, SEQ ID NO: 279 to SEQ ID NO: 303.

18. The isolated protein or peptide of claim 16 or 17 for use as a diagnostic agent or as a vaccine.

19. An isolated antibody that binds specifically to the isolated protein of claim 16.

20. Use of the protein or peptide of claim 17 as an antigen in a diagnostic assay or in a vaccine.

21. A method of detecting a virus selected from the group consisting of Opisthorhabdovirus (ORV), Opisthorphenuilivirus (OPLV), Opisthorsivirus (OSV), Clonorsivirus (CSV), Clonorhabdovirus (CRV), Clonorphenuilivirus (CPLV), Schistohaemavirus (ShV), Schistohaematogalivirus (ShTLV), Schistohaemendornavirus (ShMV) and Schistorhabovirus (ShRV) or a virus with at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% nucleic acid identity with one of these viruses comprising contacting the protein or peptide of any of claims 16-17 or the isolated antibody of any of claim 19 with a biological sample and detecting the protein-antibody complexes formed.

22. An immunogenic composition or vaccine composition comprising the protein or peptide of any of claims 16-17.

23. A method comprising administering the immunogenic composition or vaccine composition of claim 22 to a human, cat, dog, or other animal.

24. Use of the primer or probe of any of claims 9-12 or the protein or peptide of any of claims 16-17 or the isolated antibody of any of claim 19, to detect an on-going or past infection by a parasite selected from the group consisting of O. viverrini, C. sinensis and S. haematobium.

25. Use of the primer or probe of any of claims 9-12 or the protein or peptide of any of claims 16-17 or the isolated antibody of any of claim 19, to predict the risk of developing a pathology associated with a parasite selected from the group consisting of O. viverrini, C. sinensis and S. haematobium.

Images