Gene expression regulation optimization technology based on target DNA recognition ultra-small molecular module

Abstract

The present invention relates to a gene expression regulation optimization technology based on a target DNA recognition ultra-small molecular module, and relates to an ultra-small eCWCas12f-VPR system optimized through engineering of a CRISPR-Cas module, linking of activation domains, and various combinations of linkers and NLS sequences. It has been identified that effective and target-specific gene expression regulation superior to that of a conventional CRISPRa system can be achieved and the accuracy of the gene expression regulation is remarkably excellent. In particular, unlike a conventional CRISPR gene scissors technology, the system of the present invention can accurately regulate the expression of a target gene without cutting or damaging DNA, and thus is relatively safe and optimized for application in a gene therapy method, thereby exerting a great impact, and, due to the characteristics of ultra-small size, enables all genes to be loaded in a single vector (all-in-one), and thus can be effectively used as an excellent novel gene editing technology that compensates for the disadvantages of a conventional gene editing technology.

Description

Optimized gene expression control technology based on target DNA recognition ultra-small molecular modules

[0001] The present invention relates to a vector for regulating expression of an ultra-small target gene and its application, i.e., a technology for optimizing gene expression regulation based on a target DNA-recognizing ultra-small molecular module.

[0002] This invention claims priority to Republic of Korea Patent Application No. 10-2024-0073984, filed June 5, 2024, the entire contents of which are incorporated herein by reference.

[0003] Since the advent of genome editing technology in the 1970s, various gene editing tools have been developed. The CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) system, currently being actively researched as a genome editing tool, is a type of adaptive immune system in which surviving microorganisms infected with bacteriophages store portions of the infected DNA sequence (approximately 20 bases) in the form of spacers. Upon reinfection, these spacers are recognized and induce double-strand breaks in the invading DNA.

[0004] Among them, the CRISPR / Cas9 (CRISPR-associated 9) system requires only a single polypeptide to cause a double-stranded break at the target base site, and its functions are divided into guide RNA, which acts as a guide to the target base site, and Cas9 nuclease, which causes a double-stranded break at the target site. Therefore, it has the advantages of simple principles and low design costs compared to previous-generation genome editing tools such as ZFN and TALEN, making it the most widely used.

[0005] For the CRISPR system to induce double-strand breaks at the target site, in addition to complementary matches between the guide RNA and the target base, interaction between the Cas9 nuclease and the protospacer adjacent motif (PAM) located next to the target site is required. A PAM is a short sequence immediately adjacent to the target site and serves as a key marker for distinguishing between foreign and self-DNA in the CRISPR system. The CRISPR / Cas9 system has a 5'-NGG PAM sequence, which limits the range of sites that can be targeted in the genome. Therefore, CRISPR / Cas systems with different PAM sequences have been studied to expand the targetable range.

[0006] Meanwhile, the recently developed CRISPR activator (CRISPRa) system, utilizing a CRISPR-Cas effector-based transcription activator, is being actively researched due to its potential to effectively control target gene expression levels without inducing DNA damage. This system allows for precise control of specific gene expression through a CRISPR regulator, which links a transcriptional regulator to a CRISPR-Cas effector that does not induce double-strand breaks.

[0007] An object of the present invention is to provide a vector for regulating expression of a target gene, comprising a polynucleotide sequence encoding Cas12f with eliminated cleavage activity and a transcriptional regulator VP64-p65-Rta (VPR).

[0008] Another object of the present invention is to provide an ultra-small composition for regulating target gene expression, comprising the above vector as an active ingredient.

[0009] Another object of the present invention is to provide an ultra-small target gene expression control system comprising the above vector.

[0010] Another object of the present invention is to provide a miniature kit for regulating target gene expression, comprising the vector and instructions.

[0011] Another object of the present invention is to provide a method for regulating target gene expression comprising the following steps:

[0012] a) adding a polynucleotide sequence encoding a target gene to the 3' end of the polynucleotide sequence representing the above vector; and

[0013] b) A step of introducing the above vector into a host cell and culturing it.

[0014]

[0015] However, the technical problems to be solved by the present invention are not limited to the problems mentioned above, and other problems not mentioned can be clearly understood by a person having ordinary skill in the technical field to which the present invention belongs from the description below.

[0016] The present invention provides a small vector for regulating target gene expression, comprising a polynucleotide sequence encoding Cas12f with eliminated cleavage activity and a transcriptional regulator VP64-p65-Rta (VPR).

[0017] In one embodiment of the present invention, the polynucleotide sequence encoding Cas12f with the cleavage activity removed may have one or more mutations selected from the group consisting of D171R, T175R, E179A, D354A, K358R, and E556R based on the 5' end of the polynucleotide sequence represented by SEQ ID NO: 21, but is not limited thereto.

[0018] In one embodiment of the present invention, the polynucleotide sequence encoding Cas12f with the cleavage activity removed may include, but is not limited to, one or more polynucleotide sequences selected from the group consisting of SEQ ID NO: 25 to SEQ ID NO: 27.

[0019] In one embodiment of the present invention, the vector may additionally include, but is not limited to, a polynucleotide sequence encoding at least one selected from the group consisting of SV40 NLS (Nuclear localization sequence), linker, nucleoplasmin NLS, and FUS IDR.

[0020] In one embodiment of the present invention, the vector may be at least one selected from the group consisting of vectors comprising a polynucleotide sequence in which a polynucleotide sequence encoding the following structure is sequentially linked, but is not limited thereto:

[0021] a) SV40 NLS, Cas12f, linker, VPR, nucleoplasmin NLS; and

[0022] b) SV40 NLS, Cas12f, linker, VPR, nucleoplasmin NLS, and FUS IDR.

[0023] In one embodiment of the present invention, the vector may include, but is not limited to, one or more selected from the group consisting of polynucleotide sequences represented by SEQ ID NO: 3 and SEQ ID NOs: 7 to 10.

[0024] In one embodiment of the present invention, the vector may be any one selected from the group consisting of vectors comprising a polynucleotide sequence in which a polynucleotide sequence encoding the following structure is sequentially linked, but is not limited thereto:

[0025] a) CMV, SV40 NLS, Cas12f, linker, VPR, Nucleoplasmin NLS, T2A, EGFP, and U6; and

[0026] b) CMV, SV40 NLS, Cas12f, linker, VPR, Nucleoplasmin NLS, FUS IDR, T2A, EGFP, and U6.

[0027] In one embodiment of the present invention, the vector may include, but is not limited to, one or more polynucleotide sequences selected from the group consisting of SEQ ID NO: 42 and SEQ ID NOs: 46 to 49.

[0028] In one embodiment of the present invention, the Cas12f may be derived from, but is not limited to, Candidatus Woesearchaeota.

[0029] The present invention provides an ultra-small composition for regulating target gene expression, comprising the above vector as an active ingredient.

[0030] The present invention provides an ultra-small target gene expression control system comprising the above vector.

[0031] The present invention provides a miniature kit for regulating target gene expression, comprising the above vector and instructions.

[0032] The present invention provides a method for regulating target gene expression comprising the following steps:

[0033] a) adding a polynucleotide sequence encoding a target gene to the 3' end of the polynucleotide sequence representing the above vector; and

[0034] b) A step of introducing the above vector into a host cell and culturing it.

[0035] In addition, the present invention provides a use for regulating expression of one or more target genes selected from the group consisting of the vector; a composition comprising the vector as an active ingredient; and a system comprising the vector.

[0036] In addition, the present invention provides a use of at least one selected from the group consisting of the vector for producing a preparation for regulating target gene expression; a composition comprising the vector as an active ingredient; and a system comprising the vector.

[0037] According to the technology for optimizing gene expression regulation based on a target DNA recognition ultra-small molecule module, the present invention relates to an ultra-small eCWCas12f-VPR system optimized through engineering of CRISPR-Cas modules, connection of activation domains, and various combinations of linker and NLS sequences, and it has been confirmed that it is capable of effective and target-specific gene expression regulation compared to the existing CRISPRa system, and the accuracy of such gene expression regulation is significantly superior. In particular, the system of the present invention is relatively safe because it can precisely regulate the expression of a target gene without cutting or damaging DNA, unlike the existing CRISPR gene scissors technology, and is optimized for application to gene therapy methods, so it is not only very effective but also has the advantage of being able to load all genes into a single vector (all-in-one) due to its ultra-small size, so it can be usefully utilized as a significantly superior new gene editing technology that complements the shortcomings of existing gene editing technologies.

[0038] Figure 1a is a schematic diagram of the structure of various versions of the ultra-small CRISPR activation system (dCWCas12f-VPR) manufactured according to various linker lengths and NLS types, which is a design of a system for constructing an optimized ultra-small CRISPR transcriptional activation system.

[0039] Figure 1b shows the results of confirming the difference in fluorescence expression when operating various versions of the ultra-miniature CRISPR activation system (dCWCas12f-VPR) using a fluorescent protein expression reporter containing the target base sequence of CWCas12f.

[0040] Figure 2a shows the optimized miniature CRISPR activation system (dCWCas12f-VPR), which was used to activate transcription of intracellular genes. In other words, it is a schematic diagram of additional versions of the miniature CRISPR activation system (dCWCas12f-VPR) that were produced by linking an RNA binding protein that promotes mutation introduction and transcription to the region where the CWCas12f protein recognizes the target DNA.

[0041] Figure 2b shows the SOX10 target location for comparative analysis of transcriptional activity of intracellular genes using various ultra-small CRISPR activation systems (dCWCas12f-VPR).

[0042] Figure 2c shows the results of comparing the transcriptional activity of intracellular genes using various ultra-small CRISPR activation systems (dCWCas12f-VPR).

[0043] Figures 3a to 3g compare the efficiency of the existing CRISPR activation system (dLbCas12a-VPR) and the optimized ultra-small CRISPR activation system (eCWCas12f-VPR) for various genes within a cell.

[0044] Figures 3a to 3f illustrate the target locations of various genes within a cell by the CRISPR activation system.

[0045] Figure 3g shows the results of intracellular transcriptional activation efficiency of the conventional CRISPR activation system (dLbCas12a-VPR) and the optimized ultra-small CRISPR activation system (eCWCas12f-VPR) for targets at various locations.

[0046] Figures 4a to 4c compare the specificity of an optimized ultra-miniature CRISPR activation system (eCWCas12f-VPR) and a conventional CRISPR activation system (dLbCas12a-VPR). The comparison shows the difference in expression levels due to transcriptional regulation for off-target genes within a cell.

[0047] Figures 5a to 5f show DNA sequence information (sequence numbers 1 to 6) of V1 to V6.

[0048] Figures 6a to 6d show DNA sequence information (SEQ ID NOs 7 to 10) of V3.1 to V3.4.

[0049] Figures 7a to 7f show amino acid sequence information (SEQ ID NOs: 11 to 16) of V1 to V6.

[0050] Figures 8a to 8d show amino acid sequence information (SEQ ID NOs: 17 to 20) of V3.1 to V3.4.

[0051] The recently developed CRISPR activator (CRISPRa) system utilizes a CRISPR-Cas effector-based transcription activator to effectively control target gene expression levels without causing DNA damage. Based on the CRISPR system, CRISPR activators (CRISPRa) and inhibitors (CRISPRi) have recently been developed. CRISPR regulators, which link transcriptional regulators to a CRISPR-Cas effector that does not induce double-strand breaks, enable precise control of specific gene expression.

[0052] However, existing Cas9 / Cas12a-based CRISPRa systems have room for improvement in efficiency, transferability, and accuracy due to limitations inherent in the CRISPR-Cas module itself. The ability to recognize target DNA sequences via guide RNA allows for specific regulation of gene expression while preventing DNA cleavage, which can cause serious errors in living organisms. Therefore, it offers safer and more efficient gene expression control, holding significant potential for controlling gene transcription in living organisms and is expected to serve as a foundation for future gene therapy and biological research. The new developments in the present invention are as follows.

[0053] Existing CRISPR-Cas module-based technologies have limitations in delivery and efficiency due to size limitations, but an ultra-small transcription control system has been developed using Cas12f (CWCas12f) derived from the small-sized Candidatus Woesearchaeota.

[0054] The optimized eCWCas12f-VPR system, through engineering of CRISPR-Cas modules, activation domain connections, and various combinations of linker and NLS sequences, enabled more effective and target-specific gene expression control compared to the conventional CRISPRa system.

[0055] We developed a CRISPR regulator that links a transcriptional regulatory factor to a CRISPR-Cas effector that does not induce DNA double-strand breaks, thereby precisely controlling the expression of specific genes.

[0056] Unlike the existing CRISPR gene scissors technology, it is relatively safe because it can precisely control the expression of target genes without cutting or damaging DNA, and is optimized for application to gene therapy methods, so its ripple effect is very large.

[0057] A compact CRISPR-Cas-based genome expression control system can effectively regulate transcription of target genes, which can serve as a cornerstone for the development of useful technologies for future gene therapy purposes as well as for research on gene functions.

[0058] Since the optimized ultra-small CRISPR activation system (eCWCas12f-VPR) expression gene size is within the maximum limit of the AAV system's external gene loading range, loading of all genes into a single vector (all-in-one) is possible.

[0059] That is, because the study of the present invention uses Cas12f, which does not cut the DNA double helix, it is possible to precisely control gene expression, and because it uses ultra-small Cas12f, the efficiency of delivery and gene expression control is significantly increased.

[0060] Accordingly, the present invention provides a vector for regulating expression of a target gene, comprising a polynucleotide sequence encoding Cas12f with eliminated cleavage activity and a transcriptional regulator VP64-p65-Rta (VPR).

[0061] In the present invention, "regulation" encompasses both increasing and decreasing the expression of a target gene. The level of regulation is not limited to quantitative values. Therefore, the target gene expression level can be arbitrarily controlled using methods commonly practiced in the art, using the gene expression regulation vector of the present invention or a gene expression regulation system comprising the same.

[0062] The present invention relates to a CRISPR / Cas12f1 system.

[0063] Various types of CRISPR / Cas systems exist in nature, and new ones are continuously being discovered. Among these, the CRISPR / Cas12f1 system provided in this specification specifically belongs to the Class 2, Type V classification, and is a CRISPR / Cas system belonging to the Cas14 family (Harrington et al., Programmed DNA destruction by miniature CRISPR-Cas14 enzymes, Science 362, 839-842 (2018)). The classification of the CRISPR / Cas12f1 system provided in this specification is explained below.

[0064] Class 2 CRISPR / Cas systems:

[0065] CRISPR / Cas systems are broadly divided into Class 1 and Class 2. Class 2 CRISPR / Cas systems are characterized by their effector complexes comprising a large, single protein with multiple domains. A representative Class 2 CRISPR / Cas system is the Type II CRISPR / Cas9 system, while CRISPR / Cas systems actively being studied for gene editing, such as the CRISPR / Cpf1 system, generally fall into Class 2.

[0066] Type V CRISPR / Cas system:

[0067] Class 2 CRISPR / Cas systems are divided into Type II, V, and VI. Among these, the CRISPR / Cas12f1 system provided in this specification belongs to the Type V CRISPR / Cas system. The effector protein of the Type V CRISPR / Cas system is named Cas12, and is further classified into Cas12a, Cas12b, etc. The Cas12 protein has one nuclease domain (RuvC-like nuclease), which is a distinguishing feature from Type II effector proteins (e.g., Cas9 protein) that have two nuclease domains (HNH and RuvC domains). As of now, the Type V CRISPR / Cas system is divided into 11 subtypes.

[0068] CRISPR / Cas12f system:

[0069] The CRISPR / Cas12f system belongs to the VF subtype among the type V CRISPR / Cas systems, which are further divided into variants V-F1 to V-F3. The CRISPR / Cas12f system may include a CRISPR / Cas14 system including Cas14a, Cas14b, and Cas14c variants among the effector proteins named Cas14 in a previous study (Harrington et al., Programmed DNA destruction by miniature CRISPR-Cas14 enzymes, Science 362, 839-842 (2018)). Therefore, the term “CRISPR / Cas12f1 system” in this specification is a concept encompassing both the CRISPR / Cas14a system and the CRISPR / c2c10 system, unless otherwise stated. The above terms have a meaning that can be appropriately interpreted by a person skilled in the art depending on the context.

[0070] Provided herein are engineered Cas12f1 and / or CRISPR / Cas12f1 complexes. The engineered Cas12f1 and / or CRISPR / Cas12f1 complexes essentially comprise an engineered Cas12f1 protein in which DNA double-strand cleavage activity is eliminated.

[0071] Because the vector of the present invention and the system using the same are ultra-small, gene therapy can benefit from the small CRISPR system that is suitable for the small adeno-associated virus (AAV) genome and has high cleavage activity and specificity in eukaryotic cells.

[0072] In the present invention, "Cas12f with eliminated cleavage activity" refers to Cas12f engineered to have its DNA double helix cleavage function inactivated. In this case, techniques commonly employed in the art for "inactivation" may be applied, such as genetic mutations or the addition of functional components for double helix cleavage. There are no specific limitations on the techniques employed, and any Cas12f with its cleavage activity eliminated by techniques commonly employed in the art is encompassed.

[0073] In one embodiment of the present invention, the Cas12f may have one or more mutations selected from the group consisting of D171R, T175R, E179A, D354A, K358R, and E556R based on the 5' end of the polynucleotide sequence represented by SEQ ID NO: 21, but is not limited thereto.

[0074] In the present invention, "Cas12f with eliminated cleavage activity" may have one or more mutations in the known Cas12f base sequence. In one embodiment of the present invention, it was confirmed that the cleavage activity of Cas12f was eliminated with D354A alone. Furthermore, it was demonstrated that optimal gene regulation activity was exhibited when one or more additional mutations, including D354A, were added, and base sequences encoding other components were added.

[0075] Therefore, in the present invention, the combination of mutations for Cas12f may include, but is not limited to, D171R, T175R, and E179A; D171R, T175R, K358R, and E556R; or each of the above combinations may additionally include D354A.

[0076] In one embodiment of the present invention, the polynucleotide sequence encoding Cas12f with the cleavage activity removed may include, but is not limited to, one or more polynucleotide sequences selected from the group consisting of SEQ ID NO: 25 to SEQ ID NO: 27.

[0077] The present invention confirmed that the DNA double-strand cleavage activity of Cas12f is inactivated according to the mutations described above. However, when a specific type of mutation combination is applied, it was confirmed that gene expression regulation is achieved with remarkable precision and high efficiency depending on the combination with other configurations. The present invention demonstrated this to be V3.0 to V3.4, and in particular, V3.3 was confirmed to exhibit the most excellent gene regulation effect.

[0078] In one embodiment of the present invention, the vector may additionally include, but is not limited to, a polynucleotide sequence encoding at least one selected from the group consisting of SV40 NLS (Nuclear localization sequence), linker, nucleoplasmin NLS, and FUS IDR.

[0079] The ultra-small target gene expression control vector of the present invention additionally comprises one or more nuclear localization signals (NLS), and the NLS may be located at the N-terminus, the C-terminus, or both termini.

[0080] In the present invention, “NLS (Nuclear Localization Sequence, or Signal)” refers to a peptide of a certain length, or its sequence, that acts as a kind of “tag” by attaching to a protein that is a target of transport when transporting a substance outside the cell nucleus into the nucleus through nuclear transport. Specifically, the NLS may be, but is not limited to, SV40 NLS or nucleoplasmin NLS. For example, the SV40 NLS may be represented by the amino acid sequence represented by SEQ ID NO: 32, or may be encoded by a polynucleotide sequence including a polynucleotide sequence encoding the amino acid sequence (e.g., SEQ ID NO: 24), but is not limited thereto. In addition, the nucleoplasmin NLS may be represented by the amino acid sequence represented by SEQ ID NO: 38, or may be encoded by a polynucleotide sequence including a polynucleotide sequence encoding the amino acid sequence (e.g., SEQ ID NO: 30), but is not limited thereto. The term NLS as used herein has all meanings that can be recognized by a person of ordinary skill in the art and may be interpreted appropriately depending on the context.

[0081] In the present invention, one or more components of the vector of the present invention may be connected by a “linker” of the present invention. The linker of the present invention is optimized in length to optimize the efficiency of Cas12f-VPR in eCWCas12f-VPR, which is an optimized ultra-small CRISPR activation system (CRISPRa, CRISPR activator) of the present invention, and the linker of the present invention may include, but is not limited to, an SV40 NLS therein.

[0082] In one embodiment of the present invention, the vector may be at least one selected from the group consisting of vectors comprising a polynucleotide sequence in which a polynucleotide sequence encoding the following structure is sequentially linked, but is not limited thereto:

[0083] a) SV40 NLS, Cas12f, linker, VPR, nucleoplasmin NLS; and

[0084] b) SV40 NLS, Cas12f, linker, VPR, nucleoplasmin NLS, and FUS IDR.

[0085] In one embodiment of the present invention, the vector may include, but is not limited to, one or more selected from the group consisting of polynucleotide sequences represented by SEQ ID NO: 3 and SEQ ID NOs: 7 to 10.

[0086] In one embodiment of the present invention, the vector may be any one selected from the group consisting of vectors comprising a polynucleotide sequence in which a polynucleotide sequence encoding the following structure is sequentially linked, but is not limited thereto:

[0087] a) CMV, SV40 NLS, Cas12f, linker, VPR, Nucleoplasmin NLS, T2A, EGFP, and U6; and

[0088] b) CMV, SV40 NLS, Cas12f, linker, VPR, Nucleoplasmin NLS, FUS IDR, T2A, EGFP, and U6.

[0089] In one embodiment of the present invention, the vector may include, but is not limited to, one or more selected from the group consisting of polynucleotide sequences selected from the group consisting of SEQ ID NO: 42 and SEQ ID NOs: 46 to 49.

[0090] In one embodiment of the present invention, the Cas12f may be derived from, but is not limited to, Candidatus Woesearchaeota.

[0091] The present invention provides an ultra-small composition for regulating target gene expression, comprising the above vector as an active ingredient.

[0092] The vector of the present invention; an ultra-small composition for regulating target gene expression comprising the vector as an active ingredient; or an ultra-small system for regulating target gene expression comprising the vector; can be delivered according to a method generally used in the art.

[0093] In order to use the CRISPR / Cas system for gene editing, a method is widely used in which a vector having a sequence encoding each component of the CRISPR / Cas system is introduced into a cell so that each component of the CRISPR / Cas system is expressed in the cell.

[0094] Accordingly, the present invention provides an ultra-small target gene expression control system comprising the above vector.

[0095] In addition, the present invention provides a method for regulating target gene expression comprising the following steps:

[0096] a) adding a polynucleotide sequence encoding a target gene to the 3' end of the polynucleotide sequence representing the above vector; and

[0097] b) A step of introducing the above vector into a host cell and culturing it.

[0098] That is, in the present invention, a system for regulating the expression of a target gene by the above method can be defined as an “ultra-small target gene expression regulating system,” and a method for regulating the expression of a target gene using the above system is provided.

[0099] Below, the components of the vector that enable the CRISPR / Cas system to be expressed in cells are described.

[0100] Nucleic acids encoding CRISPR / Cas system components:

[0101] Since the purpose of the above vector is to express each component of the CRISPR / Cas system within a cell, the sequence of the vector must necessarily include at least one nucleic acid sequence encoding each component of the CRISPR / Cas system. Specifically, the sequence of the vector includes a nucleic acid sequence encoding a guide RNA and / or a Cas protein included in the CRISPR / Cas system to be expressed. At this time, the sequence of the vector may include not only a nucleic acid sequence encoding a wild-type guide RNA and a wild-type Cas protein, but also a nucleic acid sequence encoding a guide RNA and a codon-optimized Cas protein or a nucleic acid sequence encoding an engineered Cas protein, depending on the purpose.

[0102] Regulatory / Control Components:

[0103] In order to express the above vector in a cell, it must include one or more regulatory / control elements. Specifically, the regulatory / control elements may include, but are not limited to, a promoter, an enhancer, an intron, a polyadenylation signal, a Kozak consensus sequence, an internal ribosome entry site (IRES), a splice acceptor, a 2A sequence, and / or a replication origin. In this case, the replication origin may be, but is not limited to, an f1 replication origin, an SV40 replication origin, a pMB1 replication origin, an adeno replication origin, an AAV replication origin, and / or a BBV replication origin.

[0104] Promoter:

[0105] To express the expression target of the above vector within a cell, a promoter sequence must be operably linked to the sequence encoding each component so that an RNA transcription factor can be activated within the cell. The promoter sequence may be designed differently depending on the corresponding RNA transcription factor or the expression environment, and is not limited as long as it can appropriately express the components of the CRISPR / Cas system within the cell. The promoter sequence may be a promoter that promotes transcription of an RNA polymerase (e.g., RNA Pol I, Pol II, or Pol III). For example, the promoter may be, but is not limited to, one of the SV40 early promoter, the mouse mammary tumor virus long terminal repeat (LTR) promoter, the adenovirus major late promoter (AdMLP), the herpes simplex virus (HSV) promoter, the cytomegalovirus (CMV) promoter such as the CMV immediate early promoter region (CMVIE), the rous sarcoma virus (RSV) promoter, the human U6 small nuclear promoter (U6) (Miyagishi et al., Nature Biotechnology 20, 497-500 (2002)), the enhanced U6 promoter (e.g., Xia et al., Nucleic Acids Res. 2003 Sep 1;31(17)), and the human H1 promoter (H1).

[0106] Termination signal:

[0107] When the above vector sequence includes the above promoter sequence, transcription of the sequence operably linked to the promoter is induced by an RNA transcription factor, and the sequence that induces the termination of transcription of such an RNA transcription factor is referred to as a termination signal. The termination signal may vary depending on the type of the promoter sequence. For example, when the promoter is a U6 or H1 promoter, the promoter recognizes a thymidine continuous sequence (e.g., a TTTTTT (T6) sequence) as a termination signal.

[0108] Additional expression factors:

[0109] The vector may contain a nucleic acid sequence encoding an engineered Cas protein, a CRISPR / Cas system, or an additional expression element that a person skilled in the art desires to express as needed. For example, the additional expression element may be, but is not limited to, one of the tags. For example, the additional expression element may be, but is not limited to, a herbicide resistance gene such as glyphosate, glufosinate ammonium, or phosphinothricin, or an antibiotic resistance gene such as ampicillin, kanamycin, G418, bleomycin, hygromycin, or chloramphenicol.

[0110] Format of expression vector:

[0111] The above expression vector can be designed in the form of a linear or circular vector.

[0112] The present invention provides a miniature kit for regulating target gene expression, comprising the above vector and instructions.

[0113] In the present invention, "kit" refers to a tool that can control the expression of a target gene, including the vector of the present invention. In addition to the above-mentioned materials, the kit of the present invention may include other components, compositions, solutions, devices, etc. that are typically required for the storage and processing methods thereof. As a specific example, each component may be applied at least once without limitation in the number of times, there is no restriction on the order in which each material is applied, and the application of each material may be performed simultaneously or in microseconds.

[0114] In the present invention, the kit may include a container; instructions; and the like. The container may serve to package the substance, and may also serve to store and fix the substance. The material of the container may take the form of, for example, a bottle, a tub, a sachet, an envelope, a tube, an ampoule, and the like, and these may be formed partially or wholly from plastic, glass, paper, foil, wax, and the like. The container may be initially equipped with a completely or partially detachable stopper, which may be part of the container or may be attached to the container by mechanical, adhesive, or other means, and may also be equipped with a stopper for allowing access to the contents by means of a syringe needle. The kit may include an outer package, and the outer package may include instructions for the use of the components.

[0115] In the present invention, when the term "comprising" is used, it does not exclude other components unless specifically stated otherwise, but rather means that other components can be included. As used throughout the present invention, the terms "step of ~" or "step of ~" do not mean "step for ~."

[0116] The polynucleotide sequence of each component of the vector of the present invention, the amino acid encoded therefrom, the expression cassette including the same, the recombinant vector including the same, etc. may be indicated by, include, or be encoded by each sequence number designated in the present invention, but are not limited thereto, and variants of the base sequence are included within the scope of the present invention.

[0117] The nucleic acid molecule of the polynucleotide sequence of the present invention (used interchangeably with the base sequence) is a concept that includes functional equivalents of the nucleic acid molecules constituting it, for example, variants in which some base sequences of the nucleic acid molecule have been modified by deletion, substitution, or insertion, but which can perform the same function functionally as the nucleic acid molecule. That is, it may include a base sequence having a sequence homology of 70% or more, more preferably 80% or more, still more preferably 90% or more, and most preferably 95% or more to the base sequence of the present invention. For example, it includes polynucleotides having sequence homology of 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%.

[0118] The “% sequence identity” for a polynucleotide is determined by comparing two optimally aligned sequences over a comparison region, where portions of the polynucleotide sequence in the comparison region may contain additions or deletions (i.e., gaps) compared to the reference sequence for the optimal alignment of the two sequences (which does not contain additions or deletions).

[0119] In addition, the amino acid sequence of the present invention may be applied with the same concept as the polynucleotide sequence. That is, the amino acid sequence may include a variant that can perform a functionally identical action, that is, it may include a base sequence having a sequence homology of 70% or more, more preferably 80% or more, even more preferably 90% or more, and most preferably 95% or more with the amino acid sequence represented by the sequence number described above in the present invention. For example, it includes amino acid sequences having sequence homology of 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%.

[0120] In addition, the present invention provides a use for regulating expression of one or more target genes selected from the group consisting of the vector; a composition comprising the vector as an active ingredient; and a system comprising the vector.

[0121] In addition, the present invention provides a use of at least one selected from the group consisting of the vector for producing a preparation for regulating target gene expression; a composition comprising the vector as an active ingredient; and a system comprising the vector.

[0122] Hereinafter, preferred examples are presented to aid in understanding the present invention. However, the following examples are provided solely to facilitate a better understanding of the present invention, and the scope of the present invention is not limited by the following examples.

[0123]

[0124] [Example]

[0125]

[0126] Example 1. Design and Engineering of an Optimized Ultra-Compact CRISPR Activation System (eCWCas12f-VPR)

[0127] The optimized miniature CRISPR activation system (hereinafter, eCWCas12f-VPR) (V3.3) of the present invention was constructed by first producing various versions (V1 to V6, V3.0 to V3.4) of the miniature CRISPR activation system (hereinafter, dCWCas12f-VPR), then selecting one by confirming its operational efficiency, and then constructing it based on the selected system. First, a cytomegalovirus (CMV) promoter-based expression vector for the CRISPRa system expression vector was used to promote target gene expression activation in a human cell line.

[0128] dCWCas12f-VPR was designed in various versions with different linker lengths and additional nuclear localization signals (NLS) to optimize efficiency, as shown in Fig. 1A and Fig. 2A. The base sequences (SEQ ID NOs: 1 to 6) from SNV40NLS to VPR or Nucloplasmin NLS of V1 to V6 in Fig. 1A are shown in Fig. 5A to 5F. The base sequences (SEQ ID NOs: 7 to 10) from SNV40NLS to VPR or Nucloplasmin NLS of V3.1 to V3.4 are shown in Fig. 6A to 6D. In addition, the amino acid sequences (SEQ ID NOs: 11 to 16) from SNV40NLS to VPR or Nucloplasmin NLS of V1 to V6 in Fig. 1A are shown in Fig. 7A to 7F. The amino acid sequences (SEQ ID NOs: 17 to 20) of SNV40NLS to VPR or Nucloplasmin NLS of V3.1 to V3.4 are shown in Figures 8a to 8d.

[0129] The entire base sequence of vectors V1 to V6 of Fig. 1a is as shown in SEQ ID NOs: 40 to 45. The entire base sequence of vectors V3.1 to V3.4 of Fig. 2a is as shown in SEQ ID NOs: 46 to 49.

[0130] Additionally, the entire amino acid sequences of the V1 to V6 vectors are as shown in SEQ ID NOs: 50 to 55. The entire amino acid sequences of the V3.1 to V3.4 vectors are as shown in SEQ ID NOs: 56 to 59.

[0131] At this time, the sequences of sequence numbers 40 to 59 do not include the target gene gene4.0 or gene4.1.

[0132]

[0133] The entire base sequence of the V1 to V6 vectors of Figure 1a including the target gene gene4.0 or gene4.1 additionally includes the following sequence: ACCGCTTCACCAAAAGCTGTCCCTTAGGGGATTAGAACTTGAGTGAAGGTGGGCTGCTTGCATCAGCCTAATGTCGAGAAGTGCTTTCTTCGGAAAGTAACCCTCGAAACAAAGAAAGGAATGCAAC (ge4.0) orACCGCTTCACTTAGAGTGAAGGTGGGCTGCTTGCATCAGCCTAATGTCGAGAAGTGCTTTCTTCGGAAAGTAACCCTCGAAACAAAGAAAGGAATGCAAC (ge4.1) N20 TTTTATTTTTTGTTTTAGAGCTAGAAATAGTAAGTTAAAATAAGGCTAGTCCGTT

[0134] Additionally, the entire base sequence of the V3.1 to V3.4 vectors of Fig. 2a including the target gene gene4.1 additionally includes the following sequences:

[0135] ACCGCTTCACTTAGAGTGAAGGTGGGCTGCTTGCATCAGCCTAATGTCGAGAAGTGCTTTCTTCGGAAAGTAACCCTCGAAACAAAGAAAGGAATGCAAC (ge4.1) N20 TTTTATTTTTTGTTTTAGAGCTAGAAATAGTAAGTTAAAATAAGGCTAGTCCGTT

[0136]

[0137]

[0138]

[0139]

[0140]

[0141]

[0142]

[0143]

[0144]

[0145] To select the most superior dCWCas12f-VPR version among the ultra-miniature CRISPR activation systems (dCWCas12f-VPR) with improved activity through protein engineering, activation tests were conducted using a fluorescent reporter targeting human-derived cell lines. In particular, eCWCas12f(D171R / T175R / E179A)-VPR V3.3 was developed based on dCWCas12f(D354A)-VPR v3.

[0146]

[0147] To induce strong expression of target genes using the dCWCas12f-VPR system, various guide RNAs were designed to target binding sites near the target gene promoter. Based on these, optimized binding sites were selected through a tiling assay (Fig. 1c). Targets at various locations were selected for targeted gene activation, and sgRNAs were designed to match these target locations. These were selected at various distances from the transcription start site (TSS). Target gene expression levels were confirmed using these various sgRNAs (Table 2, Target gene sequence information for verifying the operation of the CRISPR activation system). (The PAM sequence (TTTR) within the target gene used in the study is indicated in bold and italics.)

[0148]

[0149]

[0150]

[0151] Example 2. Method for comparing gene expression activity operation efficiency and target specificity for target base sequences.

[0152] Human-derived cell line (HEK293FT) was purchased from Invitrogen (R70007) and cultured in Dulbecco's modified Eagle's medium (DMEM) containing 10% FBS (Gibco) at 37°C in the presence of 5% CO2. The cells were subcultured every 48 h at 37°C and 5% CO2 to maintain 70% confluency, and 2 × 10 were seeded in 24-well plates for targeted gene regulation. 5 After 24 hours of seeding the cells, guide RNA expression plasmid (240 pmol), transcription activator expression plasmid (60 pmol), and reporter plasmid (if necessary) (40.7 fmol) were transferred to the cells when the cells were 60% confluent, together with 1.5 μl Lipofectamine 3000 reagent and 1 μl p3000 reagent (Thermo Fisher Scientific). In the present invention, ATCC-certified cell lines were used.

[0153] RNA extraction or fluorescence analysis was performed 24 to 48 hours after transfection. To confirm changes in target gene expression within cells, total RNA was extracted from cultured cells 48 hours after transfection using the RNeasy Mini Kit (Qiagen). Subsequently, cDNA was synthesized using 1 μg of RNA from each sample using the iScript cDNA Synthesis Kit (BioRad) and used in each qPCR reaction. Quantification of specific gene expression was performed using the THUNDERBIRD™ Next SYBR ®qPCR was performed using qPCR Mix (TOYOBO). qPCR was performed and analyzed using a CFX96 Real-Time PCR Detection System (BIORAD). To assess transcriptional activation, cDNA was amplified using the qPCR primers listed in Table 3 below.

[0154]

[0155]

[0156]

[0157]

[0158] The expression level of each target gene was normalized to the cycle threshold (Ct) of the housekeeping gene GAPDH to obtain the ΔCt value. ΔCt and ΔΔCt were calculated using the following equations.

[0159]

[0160] - ΔCt = Ct(target gene) - Ct(housekeeping gene (GAPDH))

[0161] - ΔΔCt = ΔCt(experimental sample) - ΔCt(control sample)

[0162]

[0163] In the non-target experiment, the sample used as a control was used. All reactions were performed in triplicate, and the relative expression calculation formula for each sample was as follows: 2^(-ΔCt) or 2^(-ΔΔCt).

[0164] Potential off-target site candidates were selected and identified using Cas-OFFinder to identify off-target sites throughout the genome (Table 4, Sequence information for off-target gene candidates predicted in silico to confirm the target specificity of the CRISPR activation system) (Sequence information of the target sequence and off-target gene candidates are shown along with the chromosomal location and mismatched position. Mismatched bases between guide RNA and DNA are underlined, and the PAM sequence (TTTR) within the target sequence is indicated in bold and italics.)

[0165]

[0166]

[0167]

[0168] Each off-target locus gene candidate was selected as a high-probability candidate, and an off-target locus located within a coding gene was selected. To verify off-target gene activation by the CRISPR activation system, qPCR was performed on these samples to analyze changes in gene expression using cDNA synthesized from extracted intracellular RNA.

[0169]

[0170] Example 3. Method for confirming the expression activity of a target fluorescent protein in a human-derived cell line.

[0171] Reporter assays were performed by targeting various versions of dCas12f-VPR (v1, v2, v3, v4, v5, and v6) to a mimi-CMV-based dTomato expression reporter system to induce expression of a fluorescent reporter. The reporter system was constructed to optimize the most effective version of the dCWCas12f-based activator. dTomato can be expressed upstream of dTomato using an appropriate target and PAM sequence that dCWCas12f can recognize. The binding sequences for dCWCas12f-VPR are listed in Table 2. Transfected cells were observed using a fluorescence microscope 24 to 48 hours after transfection. The mean fluorescence intensity was quantified using the Image J program and calculated based on the region of interest (ROI) definition.

[0172]

[0173] Experimental Example 1. Selection of ultra-small CRISPRa (dCWCas12f-VPR)

[0174] As in Example 1, an ultra-small CRISPR activation system (dCWCas12f-VPR) was constructed for the purpose of regulating human-derived cell line gene expression. The expression vector of each ultra-small CRISPR activation system was designed to be expressed based on the CMV promoter, the guide RNA was designed to be expressed based on the U6 promoter, and was designed to enable simultaneous expression of GFP for intracellular expression control.

[0175] Specifically, to improve the properties of the ultra-small CRISPR activation system (dCWCas12f-VPR) for regulating the expression of specific genes by introducing the CRISPR activation system (CRISPRa), vectors expressing various CRISPR-activated proteins were produced through a mixing method of linker length, type, and NLS type (Fig. 1a).

[0176] A fluorescent reporter was constructed and verified to select the optimized ultra-small CRISPR activation system (dCWCas12f-VPR) in Fig. 1a, and through this, a highly efficient ultra-small CRISPR activation system was selected.

[0177]

[0178] As a result, the difference in expression level for the target base sequence of V1 to V6 was confirmed as shown in Fig. 1b. When the fluorescent protein expression activation ability was compared through the difference in the amount of fluorescent protein expression using a reporter system that can confirm the difference in expression activation for each version, the average fluorescence expression level was observed to be 29.08 for V1, 20.51 for V2, 29.45 for V3, 23.40 for V4, 19.04 for V5, and 21.62 for V6. Accordingly, it was confirmed that the version with the best gene expression regulation activity among V1 to V6 was V3.

[0179]

[0180] Experimental Example 2. Construction of an optimized ultra-small CRISPRa system (dCWCas12f-VPR) based on operational efficiency verification.

[0181] Based on the results of Experimental Example 1, various versions of the miniature CRISPR activation system (dCWCas12f-VPR) V3.1 to V3.4 were designed to produce an optimized miniature CRISPRa system as in Example 1 based on V3. Specifically, for high intracellular operation efficiency of each system, various vectors were designed to improve the properties of the CWCas12f protein and to link the FUS IDR domain, an RNA-binding protein that induces transcription promotion, to screen for dCWCas12f-VPR proteins with improved activity (Fig. 2a). In addition, to confirm the efficient intracellular operation of the miniature CRISPR activation system (dCWCas12f-VPR) using the various vectors of Fig. 1b, targets were selected at various positions from the transcription start site (TSS) for a specific gene (SOX10) (Fig. 2b).

[0182]

[0183] As a result, it was confirmed that all of the ultra-small CRISPR activation systems (dCWCas12f-VPR) V3.0 to V3.4 showed remarkably excellent effects in inducing intracellular gene activation. For V3.0, transcription was activated by an average of 1.59 times, V3.1 by an average of 4.52 times, V3.2 by an average of 3.93 times, V3.3 by an average of 6.35 times, and V3.4 by an average of 4.21 times. In particular, among them, V3.3 showed the best gene expression regulation activity, and thus V3.3 was finally established as the optimized ultra-small CRISPR activation system (eCWCas12f-VPR) (Fig. 2c).

[0184]

[0185] Experimental Example 3. Verification of the Operational Efficiency of an Optimized Miniature CRISPRa System (eCWCas12f-VPR) for Various Genes

[0186] In Experimental Example 2, among the ultra-small CRISPR activation systems (dCWCas12f-VPR), V3.3 was selected as the optimized ultra-small CRISPR activation system (eCWCas12f-VPR). To re-verify the excellent gene expression regulatory activity of eCWCas12f-VPR, activation of various genes within cells was confirmed. First, several targets were selected from the transcription start site (TSS) (Figs. 3a to 3f). The ultra-small CRISPR activation system (eCWCas12f-VPR) was introduced into cells for the selected targets, effectively inducing gene activation for various targets. At this time, the existing CRISPR activation system (dLbCas12a-VPR) was used as a control.

[0187]

[0188] As a result, the optimized ultra-small CRISPR activation system (eCWCas12f-VPR) showed high activation efficiency in all genes when compared to the existing CRISPR activation system (dLbCas12a-VPR). Specifically, compared to the existing CRISPR activation system (dLbCas12a-VPR), it was confirmed that the efficiency was 29.61, 1.46, 5.08, 1.99, 3.95, and 242.90 times higher on average for the CD2, CXCR4, HBB, IL1RN, ASCL1, and HBG genes, respectively. In particular, for the HBB, ASCL1, and HBG genes, it was confirmed that the existing CRISPR activation system (dLbCas12a-VPR) effectively induced expression activation even for genes that the existing CRISPR activation system (dLbCas12a-VPR) failed to induce expression activation. This was shown to be statistically significant, reconfirming that the operating efficiency of the optimized ultra-small CRIPSPRa system of the present invention is remarkably superior (Fig. 3g).

[0189]

[0190] Experimental Example 4. Stability Verification of an Optimized Ultra-Small CRISPRa (dCWCas12f-VPR)

[0191] To confirm the stability of the optimized ultra-small CRISPR activation system (eCWCas12f-VPR) of the present invention, off-targets with similar sequences that mismatch the target sequence were selected in silico, and the specificity of the optimized ultra-small CRISPR activation system (eCWCas12f-VPR) was compared with that of existing CRISPR activation systems. In addition, the expression regulation effect of the optimized ultra-small CRISPR activation system (eCWCas12f-VPR) on non-target sequences was confirmed to verify the absence of malfunction.

[0192]

[0193] As a result, it was confirmed that the optimized ultra-small CRISPR activation system (eCWCas12f-VPR) efficiently and accurately operated on the intracellular target base sequence (Figs. 4a to 4c).

[0194]

[0195] The foregoing description of the present invention is provided for illustrative purposes only. Those skilled in the art will readily appreciate that the present invention can be readily modified into other specific forms without altering the technical spirit or essential characteristics of the present invention. Therefore, the embodiments described above should be understood as illustrative in all respects and not restrictive.

[0196] According to the technology for optimizing gene expression regulation based on a target DNA recognition ultra-small molecule module, the present invention relates to an ultra-small eCWCas12f-VPR system optimized through engineering of CRISPR-Cas modules, connection of activation domains, and various combinations of linker and NLS sequences, and it has been confirmed that it is capable of effective and target-specific gene expression regulation compared to the existing CRISPRa system, and the accuracy of such gene expression regulation is significantly superior. In particular, the system of the present invention is relatively safe because it can precisely regulate the expression of a target gene without cutting or damaging DNA, unlike the existing CRISPR gene scissors technology, and is optimized for application to gene therapy methods, so it is not only very effective but also has the advantage of being able to load all genes into a single vector (all-in-one) due to its ultra-small size, so it can be usefully utilized as a significantly superior new gene editing technology that complements the shortcomings of existing gene editing technologies, and thus has potential for industrial application.

Claims

1. A vector for regulating expression of a target gene, comprising a polynucleotide sequence encoding Cas12f with eliminated cleavage activity and a transcriptional regulator VP64-p65-Rta (VPR).

2. In paragraph 1, A vector having a polynucleotide sequence encoding Cas12f with the above cleavage activity removed, wherein the polynucleotide sequence has at least one mutation selected from the group consisting of D171R, T175R, E179A, D354A, K358R, and E556R based on the 5' end of the polynucleotide sequence represented by SEQ ID NO:

21.

3. In paragraph 2, A vector comprising a polynucleotide sequence encoding Cas12f from which the cleavage activity has been removed, wherein the polynucleotide sequence comprises at least one polynucleotide sequence selected from the group consisting of SEQ ID NO: 25 to SEQ ID NO:

27.

4. In paragraph 1, A vector further comprising a polynucleotide sequence encoding at least one selected from the group consisting of SV40 NLS (Nuclear localization sequence), linker, nucleoplasmin NLS, and FUS IDR.

5. In paragraph 1, The above vector is at least one selected from the group consisting of vectors comprising a polynucleotide sequence in which a polynucleotide sequence encoding the following structure is sequentially linked: a) SV40 NLS, Cas12f, linker, VPR, nucleoplasmin NLS; and b) SV40 NLS, Cas12f, linker, VPR, nucleoplasmin NLS, and FUS IDR.

6. In paragraph 5, A vector comprising at least one selected from the group consisting of polynucleotide sequences represented by SEQ ID NO: 3 and SEQ ID NOs: 7 to 10.

7. In paragraph 1, The above vector is any one selected from the group consisting of vectors comprising a polynucleotide sequence in which a polynucleotide sequence encoding the following structure is sequentially linked: a) CMV, SV40 NLS, Cas12f, linker, VPR, Nucleoplasmin NLS, T2A, EGFP, and U6; and b) CMV, SV40 NLS, Cas12f, linker, VPR, Nucleoplasmin NLS, FUS IDR, T2A, EGFP, and U6.

8. In paragraph 7, A vector comprising at least one polynucleotide sequence selected from the group consisting of SEQ ID NO: 42 and SEQ ID NOs: 46 to 49.

9. In paragraph 1, The above Cas12f is a vector derived from Candidatus Woesearchaeota.

10. A composition for regulating expression of a target gene, comprising the vector of paragraph 1 as an active ingredient.

11. An ultra-small target gene expression control system comprising the vector of paragraph 1.

12. A kit for regulating expression of a target gene, comprising the vector of paragraph 1 and an instruction manual.

13. A method for regulating target gene expression comprising the following steps: a) adding a polynucleotide sequence encoding a target gene to the 3' end of the polynucleotide sequence representing the vector of claim 1; and b) A step of introducing the above vector into a host cell and culturing it.

14. A use for regulating expression of at least one target gene selected from the group consisting of the vector of paragraph 1; a composition comprising the vector as an active ingredient; and a system comprising the vector.

15. The use of at least one selected from the group consisting of the vector of claim 1 for producing a preparation for regulating target gene expression; a composition comprising the vector as an active ingredient; and a system comprising the vector.

Images