Mutated KRAS peptide-specific compositions and methods
Antigen-binding domains targeting KRAS G12V mutations in HLA complexes enhance the efficacy of immunotherapies by improving specificity and affinity, addressing the challenges of treating solid tumors with engineered T cell therapies.
Patent Information
- Application Number
- PCT/US2024/061475
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-06-07
- Filing Date
- 2024-12-20
- Publication Date
- 2025-12-11
AI Technical Summary
Current engineered T cell immunotherapies face challenges in treating solid tumors due to increased tumor burden, immunosuppressive tumor microenvironments, and limited accessibility of intracellular oncogenic driver mutations like KRAS G12X, leading to therapeutic failure and off-target toxicity.
Development of antigen-binding domains targeting the KRAS G12V mutation presented in the context of HLA complexes, including specific VH and VL regions, and their application in bispecific antibodies, T-cell engagers, and chimeric antigen receptors (CARs) to enhance targeted immunotherapy.
The described compositions and methods improve the efficacy of immunotherapies by increasing specificity and affinity for KRAS neo-antigens, expanding the therapeutic window, and reducing off-target effects, effectively targeting solid tumors.
Smart Images

Figure US2024061475_11122025_PF_FP_ABST
Abstract
Description
[0001] MUTATED KRAS PEPTIDE-SPECIFIC COMPOSITIONS AND METHODS
[0002] CROSS-REFERENCE TO RELATED APPLICATION
[0003] The present application is entitled to priority under 35 U.S.C. § 119(e) to U.S. Provisional Patent Application No. 63 / 657,596 filed on June 7, 2024, which is herein incorporated by reference in its entirety.
[0004] REFERENCE TO AN ELECTRONIC SEQUENCE LISTING
[0005] The Sequence Listing submitted herewith as an XML file named "046483- 7462W01.xml," created on December 20, 2024 and having a size of 258,238 bytes, is herein incorporated by reference in its entirety .
[0006] BACKGROUND
[0007] Engineered T cell immunotherapies have successfully treated cancers, especially hematological malignancies. However, successful treatment of solid tumors using these therapies have encountered significant roadblocks. Therapeutic failure is common due to increased tumor burden or the lack of immune cell trafficking into an immunosuppressive tumor microenvironment. In cases where clinical activity7has been observed, unregulated T cell activation, or on-target / off-tumor antigen recognition has resulted in life-threatening toxi cities, indicating a significantly smaller therapeutic window for cellular immunotherapies in tumors, including solid tumors.
[0008] The limited presence of homogenously expressed tumor-specific surface antigens has hindered the treatment of solid tumors, resulting in antigen negative relapse and cytotoxicity in healthy tissues. Oncogenic driver mutations are theoretically ideal targets for cell therapies. However, most of these candidates are intracellular proteins that are only visible on the cell surface as peptide-MHC (pMHC) neo-antigens, limiting their accessibility to conventional CARs. While tumor infiltrating lymphocytes (TILs) commonly recognize neo-antigens, a small subset of neo-epitopes elicit immunogenicity by endogenous T cell receptors (TCRs), and fewer are publicly shared by large patient populations.
[0009] One exception is mutant KRAS (mKRAS) which is present in -20% of all solid tumors with >75% of activating mutations occurring at codon G12. Processing and presentation of KRAS G12X mutations in the most globally prevalent HLA types indicates that mKRAS neo-antigen targeted therapies could be utilized in large patient populations if binders with sufficient affinity and specificity are developed. Additionally, it has been postulated that CAR based therapies could further expand patient access via engineered breaking of HL A restriction. Even if binders are developed, the low abundance of neoantigens on the tumor cell surface can limit the efficacy of CAR and TCR based therapies.
[0010] Thus, there is a need in the art for novel and effective compositions and methods for targeted KRAS neoepitope-specific immunotherapies. The invention of the present disclosure addresses this need.
[0011] SUMMARY
[0012] In one aspect, the present invention provides an antigen-binding domain targeting an epitope of mutant KRAS (rnKRAS) comprising a G12V mutation (or rnKRAS G12V) which is presented in the context of an HLA complex, wherein the antigen-binding domain comprises a VH region comprising three heavy chain complementarity' determining regions (HCDRs) and a VL region comprising three light chain complementarity determining regions (LCDRs), and wherein the antigen-binding domain comprises 90%, 95%, 96%, 96%, 97%, 98%, 99%, or 100% identity' to an antigen-binding domain selected from the group consisting of: a) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 32. an HCDR2 comprising the amino acid sequence of SEQ ID NO: 33, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 34: and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 35, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 36, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 37; b) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 32, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 33, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 38; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 39, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 41; c) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 32, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 33, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 38; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 42, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 43; d) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 32, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 33, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 38; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 42, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 44; e) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 32, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 33, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 45; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 42, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 46;
[0013] I a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 32, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 33, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 45; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 42, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 47; g) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 32, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 33, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 48; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 42, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 49; h) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 32, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 33, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 50; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 42, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 51; i) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 78, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 79, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 38; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 80, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 81; j) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 86, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 87, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 38; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 88, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 89; k) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 78, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 79, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 94; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 95, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 96; l) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 78, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 79, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 100; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 95, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 96; m) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 78, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 79, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 104; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 95, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 96; n) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 78, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 79, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 108; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 95, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 96; o) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 78, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 79, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 112; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 95, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 96; p) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 1 17, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 118, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 38; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 119, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 120; q) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 117, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 118, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 108; and a VL region comprising an LCDR1 comprising the ammo acid sequence of SEQ ID NO: 125, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 126; r) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 78. an HCDR2 comprising the amino acid sequence of SEQ ID NO: 79, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 129; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 95, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 96; s) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 1 17, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 133, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 134; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 119. an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 120; t) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 219, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 220, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 221; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 222, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 223, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 224; u) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 1 17, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 118, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 142; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 95, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 143; and v) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 117, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 133, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 108; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 119, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 120; and w) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 1 17, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 118, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 94; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 80, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 151. x) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 32, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 33, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 38; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 39, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 215.
[0014] In an embodiment, the present invent on provides an antigen-binding domain (e.g., scFv), a bispecific antibody, a bispecific T-cell engager (BiTE) antibody, or a chimeric antigen receptor (CAR) targeting the epitope of mutant KRAS (mKRAS), wherein the antigen-binding domain comprises: a) a heavy chain variable (VH) region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 27-31, 76, 84, 92. 99. 103, 107, 11 1, 115, 123, 128, 132, 137, 140, 146, 149, and 213; and b) a light chain variable (VL) region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 19-26, 77, 85, 93, 93, 93, 93, 93, 116, 124, 93, 116, 93, 141, 116, 150, and 214.
[0015] In an embodiment, the antigen-binding domain, bispecific antibody, bispecific T-cell engager (BiTE) antibody, or chimeric antigen receptor (CAR) comprises: a) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 27 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 19; b) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 28 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 20; c) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 28 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 21; d) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 28 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 22; e) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 29 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 23; f) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 29 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 24; g) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 30 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 25; h) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 31 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 26; i) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 76 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 77; j) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 84 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 85; k) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 92 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 93; l) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 99 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 93; m) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 103 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 93; n) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 107 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 93; o) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 111 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 93; p) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 115 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 116; q) a Vn region comprising the amino acid sequence set forth in SEQ ID NO: 123 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 124; r) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 128 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 93; s) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 132 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 116; t) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 137 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 93; u) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 140 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 141; v) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 146 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 116; w) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 149 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 150, and x) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 28 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 214.
[0016] In an embodiment, the antigen binding domain comprises a single-chain variable fragment (scFv). In an embodiment, the antigen binding domain comprises an amino acid sequence set forth in any one of SEQ ID NOs: 11-18, 75, 83, 91, 98, 102. 106, 110, 114, 122, 231, 131. 136, 139, 145. 148, or 216.
[0017] In an embodiment, the antigen binding domain comprises a bispecific antibody. In an embodiment, the bispecific antibody is a bispecific immune-cell engager antibody. In certain embodiments, the bispecific immune cell engager is a bispecific T cell engager (BiTE) antibody. In some embodiments, the bispecific T cell engager targets mutant KRAS and CD3 epsilon (CD3e). In another embodiment, the bispecific T cell engager comprises an amino acid sequence set forth in any one of SEQ ID NOs: 82, 90, 97, 101, 105, 109, 113, 121, 127, 130, 135, 138, 144, 147, and 152-157.
[0018] In an embodiment, the epitope of mutant KRAS (mKRAS) comprising the G12V mutation is presented in the context of an HLA A*11 complex. In another embodiment, the epitope of mutant KRAS (mKRAS) is presented in the context of an HLA A*2 complex.
[0019] In another aspect, the present invention provides a bispecific antibody comprises an antigen-binding domains described herein. In an embodiment, the bispecific antibody is a bispecific immune-cell engaging (BiTE) antibody. In some embodiments, the bispecific immune cell engager is a bispecific T-cell engager antibody. In one embodiment, the BiTE antibody targets mKRAS / HLA complex and CD3. In some embodiments, the BiTE antibody comprises an amino acid sequence set forth in any one of SEQ ID NOs: 82, 90, 97. 101, 105, 109, 113. 121, 127, 130, 135, 138. 144, 147, and 152-157. In another aspect, the present invention provide a chimeric antigen receptor (CAR) comprising an anti-mKRAS antigen-binding domain described herein, a transmembrane domain, and an intracellular domain. In certain embodiments, the transmembrane domain is a CD8 transmembrane domain. In one embodiment, the CD8 transmembrane domain comprises an amino acid sequence set forth in SEQ ID NO: 54. In certain embodiments, the intracellular domain comprises a costimulatory signaling domain and an intracellular signaling domain. In one embodiment, the costimulatory signaling domain is a 4- IBB costimulatory domain or a CD28 costimulatory domain. In another embodiment, the costimulatory domain comprises an amino acid sequence set forth in SEQ ID NO: 55 or SEQ ID NO: 56. In some embodiments, the intracellular signaling domain is a CD3 zeta (CD3z) intracellular signaling domain. In one embodiment, the CD3z intracellular signaling domain comprises an amino acid sequence set forth in SEQ ID NO: 57. In some embodiments, the mKRAS CAR comprises an amino acid sequence set forth in any one of SEQ ID NOs: 59-66.
[0020] In another aspect, the present invention provides an isolated nucleic acid comprising a polynucleotide encoding an anti-mKRAS antigen-binding domain comprised of VH and VL amino acid sequences as described herein. In some embodiments, the antigen binding domain comprises an amino acid sequence set forth in any one of SEQ ID NOs: 11-18, 75, 83, 91, 98, 102, 106, 110, 114, 122, 231, 131, 136, 139, 145, 148, or 216, or is encoded by a nucleotide sequence set forth in any one of SEQ ID NOs: 3-10.
[0021] In another embodiment, the nucleic acid encodes a bispecific T-cell engager (BiTE) antibody comprising an anti-mKRAS antigen-binding domain as described herein. In some embodiments, the BiTE antibody comprises an amino acid sequence set forth in any one of SEQ ID NOs: 82, 90, 97, 101, 105, 109, 113, 121. 127, 130, 135, 138, 144, 147, and 152-157.
[0022] In another embodiment, the nucleic acid encodes a CAR comprising an mKRAS antigen-binding domain as described herein (“mKRAS CAR’’), a transmembrane domain, and an intracellular domain. In some embodiments, the mKRAS antigen-binding domain comprises an scFv comprising an amino acid sequence set forth in any one of SEQ ID NOs: 11-18, 75, 83, 91, 98, 102, 106, 110. 114, 122, 231, 131, 136, 139, 145. 148, or 216.
[0023] In some embodiments, the intracellular domain comprises a costimulatory signaling domain and an intracellular signaling domain. In some embodiments, the costimulatory domain comprises a 4- IBB costimulatory domain or a CD28 costimulatory domain. In some embodiments, the costimulatory signaling domain encodes an amino acid sequence set forth in SEQ ID NO: 55 or SEQ ID NO: 56. In some embodiments, the intracellular signaling domain is a CD3 zeta signaling domain. In some embodiments, the CD3zeta signaling domain encodes an amino acid sequence comprising the sequence set forth in SEQ ID NO: 57. In some embodiments, the CAR comprises an amino acid sequence set forth in any one of SEQ ID NOs: 59-66 or is encoded by a nucleic acid sequence set forth in any one of SEQ ID NOs: 67-74.
[0024] In another aspect, the present invention provides a vector comprising any of the nucleic acids described herein. In some embodiments, the vector is an expression vector. In some embodiments, the expression vector further comprises a nucleic acid comprising a promoter operably linked to an immune-modulating agent. In some embodiments, the immune-modulating agent is a cytokine. In some embodiments, the cytokine is IL-12. In some embodiments, IL- 12 is expressed as a single chain comprising the amino acid sequence of SEQ ID NO: 174 or 229, or is expressed from a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 173. In some embodiments, the promoter is an inducible promoter. In some embodiments, the inducible promoter is activated by NF AT signaling. In some embodiments, an NF AT inducible promoter comprises the nucleotide sequence set forth in SEQ ID NO: 171. In some embodiments, vector comprising the inducible promoter further includes a minimal promoter, such as one compnsing the nucleotide sequence set forth in SEQ ID NO: 172. In one embodiment, the nucleic acid comprises an NFAT-inducible IL-12 expression cassette comprising the nucleotide sequence set forth in SEQ ID NO: 175. In some embodiments, the vector is selected from the group consisting of a DNA vector, an RNA vector, a plasmid, a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, and a retroviral vector.
[0025] In another aspect, the present invention provides a modified immune cell comprising an mKRAS CAR and mKRAS CAR-encoding nucleic acid as described herein. In some embodiments, expression of endogenous TCR chains is reduced or eliminated in the modified immune cell or precursor thereof. In some embodiments, the modified cell is an autologous cell. In some embodiments, the modified cell is an allogeneic cell. In some embodiments, the modified cell is a cell isolated from a human subject. In some embodiments, the modified cell is a modified T cell.
[0026] In another aspect, the present invention provides a method for generating a modified immune cell, comprising introducing into the immune cell an isolated nucleic acid encoding an mKRAS CAR as described herein. In some embodiments, the modified immune cell is a T cell. In some embodiments, the method further comprises modifying the immune cell to express an immune modifying agent. In some embodiments, the immune modifying agent is IL-12 or IL-18. In another aspect, the present invention provides of treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of a modified immune cell described herein or a modified immune cell generated by the method described herein. In some embodiments, the subject is a human. In some embodiments, the cancer is a solid cancer. In some embodiments, the cancer is associated with the expression of the G12V mutant of KRAS (mKRAS). In some embodiments, the mKRAS is expressed by tumor cells.
[0027] In some embodiments, the cancer is selected from the group consisting of pancreatic ductal adenocarcinoma (PDA), colon cancer, colorectal adenocarcinoma, myeloma, multiple myeloma, lung adenocarcinoma, melanoma, uterine cancer, thyroid cancer, acute myelogenous leukemia (AML), urothelial cancer, gastric adenocarcinoma and cervical adenocarcinoma, head and neck squamous cell carcinoma (SCC). Diffuse large B-cell lymphoma (DLBCL), esophageal adenocarcinoma, Chronic lymphocytic leukemia (CLL), lung SCC, small cell lung cancer (SCLC), renal papillary cancer, Hepatocellular carcinoma (HCC), breast cancer, cervical SCC, ovarian adenocarcinoma, adrenal cancer, prostate cancer, neuroblastoma, glioblastoma multiforme (GBM), medulloblastoma, Renal cell carcinoma (RCC), esophageal SCC. osteosarcoma, sarcoma, and small intestine neuroendocrine tumor (NET).
[0028] BRIEF DESCRIPTION OF THE DRAWINGS
[0029] The following detailed description of embodiments of the present disclosure will be better understood when read in conjunction with the appended drawings. For the purpose of illustrating the present disclosure, there are shown in the drawings embodiments which are presently preferred. It should be understood, however, that the present disclosure is not limited to the precise arrangements and instrumentalities of the embodiments shown in the drawings.
[0030] FIGs. 1 A-1D illustrate the isolation and characterization of anti-mKRAS pMHC scFvs (FIG. 1 A) The Retained Display (ReD) library7is comprised of scFvs displayed on the capsid of a lambdoid phage. ScFvs were initially panned against magnetic beads coated with the pMHC of interest. The display modality was then transferred to the cell wall of a permeabilized bacterial cell. The target pMHC was labelled with one fluorophore (shown here in light grey) while counter- target pMHCs were labelled with a different fluorophore (shown in dark grey). Labelled permeabilized cells were then sorted for clean target binding by FACS to identify scFvs. (FIG. IB) Kinetic traces of anti-KRAS G12V A*11:01 binders against both G12V and WT complex. G12V or WT KRAS pMHC were associated with probe-loaded biotinylated scFv. Measurement of association / dissociation was measured by BLI. (FIG. 1C) X-scan analysis. Each position of the KRAS G12V (7-16) epitope, aside from the anchor residues the second and terminal positions, were substituted for every amino acid other than cysteine and refolded as pMHC. Binding by scFvs was assessed as a percentage relative to the KRAS G12V 10-mer pMHC complex. (FIG. ID) In vitro T cell engager (TCE) bispecific killing. K562 cells expressing HLA-A*11 :01 were loaded with exogenous rnKRAS peptide or WT peptide at 1 pM. Tandem scFv TCE bispecific was titrated against target cell killing (n=3) (2 -way ANNOVA vs. KRAS G12V). ****;p<0.0001. All data with error bars are presented as mean ± SD. All data are representative of two or more experiments.
[0031] FIGs. 2A-2H illustrate the design and validation of rnKRAS NeoCARs targeting G12V presented by HLA A* l l :01 (FIG. 2A) Schematic comparison of a NeoCAR and a tumor reactive T cells. (FIG. 2B) Second generation Neo-antigen CARs with 4- IBB and CD3ij costimulatory domains were generated with alternate orientations preceded by the variable heavy (VH) or light (VL) chain. (FIG. 2C) IL -2 secretion by Jurkat cells transduced with lentiviral vectors containing the indicated CAR, co-cultured with the peptide loaded target cells for 24h (n=3). K562 cells expressing HLA A* 11 :01 were incubated in luM mutant (VVVGAVGVGK) (SEQ ID NO: 1) or WT (VVVGAGGVGK) (SEQ ID NO: 2) peptides for 90 minutes. Media was refreshed for the pulsed conditions. (FIG. 2D) IFN-y secretion by primary NeoCARs after 24h of co-culture with K562 cells expressing HLA A* 11:01 and titered additions of mutant or WT peptides (n=3). (FIG. 2E) Lysis of the G12V mutant cell line COR-L23 transduced with HLA A*1 1 :01 / GFP / Luciferase (COR-L Al 1 ) by NeoCARs. A NeoCAR binding HLA A*02:01 was used as a non-targeting control (n = 4) (2- way ANOVA vs UTD). (FIG. 2F) In vivo study design. CAR-T cells were injected i.v. at 2.5e6 CAR+ cells per mouse in NSG mice with established COR-L Al 1 tumors expressing (n=7 mice per group). (FIG. 2G) Percentage survival in each NeoCAR in vivo group (logrank Mantel-Cox test vs A2 Binder). (FIG. 2H) Quantified tumor luciferase activity (2 -w ay ANOVA vs. A2 binder). NS; not significant, **;p<0.01, ***;p<0.001, ****;p<0.0001. All data with error bars are presented as mean ± SD. All data are representative of two or more experiments.
[0032] FIGs. 3A-3H illustrate that inducible IL- 12 enhances antitumor activity of rnKRAS NeoCARS (FIG. 3A) The iIL-12 UniVect construct with a rnKRAS NeoCAR w / schematic showing a modified activation pathw ay after transduction. (FIG. 3B) IFN-y secretion by ilL- 12 armored NeoCARs after 24h co-culture with COR-L Al 1 and YAPC Al 1 target cell lines (n=4) (Student’s T-test). (FIG. 3C) Supernatants from (FIG. 3B) were added to freshly plated tumor cells. Total HLA expression was measured by flow cytometry after 24h (n=4) (Student’s T-test). (FIG. 3D) Representative confocal microscopy showing co-culture of COR-L Al 1 spheroids (light grey) and T cells (dark grey). (FIG. 3E) Killing of COR-L Al 1 (left) and YAPC Al l (Right) target cell spheroids by iIL-12 NeoCARs over 48h (n=4) (2- way ANOVA vs NeoCAR). (FIG. 3F) / « vivo study design. CAR-T cells were injected i.v. at 2.5e6 CAR+ cells per mouse in NSG mice with established COR-L Al 1 tumors expressing (n=5 mice per group). (FIG. 3G) Quantified tumor luciferase activity (2-way ANOVA vs NeoCAR). (FIG. 3H) Percentage survival in each in vivo group (log-rank Mantel-Cox test vs NeoCAR). MFI; mean fluorescent intensity. *;p<0.05, **;p<0.01, ***;p<0.001, ****;p<0.0001. All data with error bars are presented as mean ± SD. All data are representative of two or more experiments.
[0033] FIGs. 4A-4H illustrate that TCR Knockout expands therapeutic window of iIL-12 NeoCARs (FIG. 4A) Schematic representation of compared constructs / experimental groups. (FIG. 4B) IFN-y secretion induced by 24 h stimulation with plate bound anti-CD3, target COR-L Al 1. or control CORL WT cells in TCR+ and TCR knockout T cells (n=4) (student’s T tests). (FIG. 4C) In vivo study design. CAR-T cells were injected i.v. at 2.5e6 CAR+ cells per mouse in NSG mice with established COR- L Al 1 tumors expressing (n=7-8 mice per group). (FIG. 4D) Quantified tumor luciferase activity7compared (2-way ANOVA vs NeoCAR). (FIG. 4E) Percentage survival in each in vivo group (log-rank Mantel-Cox test vs NeoCAR). (FIG. 4F) CD4 / 8+ T cell counts in peripheral blood at day 18 and day 25 (paired T tests). (FIG. 4G) Serum levels of hIL-12 at day 18 and day 25 (paired T tests). (FIG. 4H) Serum levels of IFN-y at day 18 and day 25 (paired T tests), ns; not significant *;p<0.05, **;p<0.01, ***;p<0.001, ****;p<0.0001. All data with error bars are presented as mean ± SD. All data are representative of two or more experiments.
[0034] FIGs. 5A-5B are related to FIG. 1. (FIG. 5A) Specificity assays for all clones. 96 unrelated A* 11 :01 pMHC complexes from 10-mer peptides known to be presented by the immunopeptidome were tested for binding to clones, along with the target KRAS G12V pMHC (red). Relative binding is shown as a percentage of KRAS G12V binding. (FIG. 5B) Sequence-related off-target binding by RU96-14. Sequences with homology to the KRAS peptide that are known to be presented by the immunopeptidome were refolded as pMHC and assessed for binding to RU96-14. Relative binding is show n as a percentage of KRAS G12V binding (n=2) (ordinary' ANNOVA). ****; pO.OOOl. All data with error bars are presented as mean ± SD. All data are representative of two or more experiments.
[0035] FIGs. 6A-6E are related to FIG. 2. (FIG. 6A) Histograms of primary T cells transduced G12V HLA A* 11 :01 NeoCARs stained with target MHC dextramers or a-human Fc. (FIG. 6B) Flow cytometry plots of NeoCARs sequentially stained with a-CD8 and the target pMHC dextramer. (FIG. 6C) Z-Movi avidity data for high affinity (RU96-14), low affinity (RU61-02), and non-targeting NeoCARs on a monolayer of COR-L Al 1 targets cells or COR-L WT control cells (n=4) (ordinary ANOVA). (FIG. 6D) Lysis of COR-L WT control cells transduced with GFP / Luciferase by NeoCARs (n = 4) (2 -way ANOVA vs UTD). (FIG. 6E) IFN-g and TNF-a secretion at the 3: 1 E:T from co-cultures in FIG. 2E (n=4) (2 -way ANOVA). NS; not significant, **;p<0.01, ***;p<0.001, ****;p<0.0001. All data with error bars are presented as mean ± SD. All data are representative of two or more experiments.
[0036] FIGs. 7A-7I are related to FIG. 3. (FIG. 7A) hIL-12 secretion by the UniVect NeoCAR (pABL2) after 24h of co-culture with K562 cells expressing HLA A* 1 1:01 and titrated additions of mutant or WT peptides (n=3). (FIG. 7B) IFN-y secretion by pABL2 (left) and NeoCAR alone (right) after 24h of co-culture with K562 cells expressing HLA A*11:01 and titrated additions of mutant or WT peptides (n=3). (FIG. 7C) IFN-y secretion by iIL-12 armored NeoCARs after 24h co-culture with COR-L WT and YAPC WT control cell lines (n=4) (Student’s T-test). (FIG. 7D) Supernatants from (FIG. 7C) were added to freshly plated tumor cells. Total HLA expression was measured by flow cytometry after 24h (n=4) (Student's T-test). (FIG. 7E) Supernatants from (FIG. 2B) were added to freshly plated tumor cells. HLA A*11:01 expression was measured by flow cytometry after 24h (n=4) (Student’s T-test). (FIG. 7F) Killing of COR-L WT (left) and YAPC WT (right) control cell spheroids by iIL-12 NeoCARs over 48h (n=4) (2-way ANOVA vs NeoCAR). (FIG. 7G) In vivo study design. CAR-T cells were injected i.v. at 0.8e6 CAR+ cells per mouse in NSG mice with established COR-L Al 1 tumors expressing (n=5 mice per group). (FIG. 7H) Quantified tumor luciferase activity compared to the non-targeting control group (2-way ANOVA vs NeoCAR). (FIG. 71) Percentage survival in each in vivo group (log-rank Mantel-Cox test vs NeoCAR). MFI; mean fluorescent intensity, ns; not significant, *;p<0.05, **;p<0.01, ***;p<0.001, ****;p<0.0001. All data with error bars are presented as mean ± SD. All data are representative of two or more experiments.
[0037] FIGs. 8A-8D are related to FIG. 4. (FIG. 8A) Flow cytometry analysis of seven conditions tested in (FIG. 4) following CAR enrichment and / or TCR negative selection by FACS sorting. (FIG. 8B) hIL-12 secretion induced by 24 h stimulation with cell stimulation cocktail (CSC), plate bound anti-CD3. target COR-L Al 1, or control CORL WT cells in TCR+ and TCR knockout T cells (n=4) (student’s T tests). (FIG. 8C) Killing of COR-L Al l (left) and CORL WT (right) control cell spheroids by iIL-12 and TCK knockout NeoCARs over 48h (n=4) (2-way ANOVA). (FIG. 8D) Plot of mouse weight versus time by group from (FIG. 4) (n = 7). ns; not significant, *;p<0.05, **;p<0.01, ***;p<0.001, ****;p<0.0001. All data with error bars are presented as mean ± SD. All data are representative of two or more experiments.
[0038] FIG. 9 illustrates an assessment of VH and VL chain orientation in the function of mKRAS CAR functionality. FIG. 9, left is a diagram illustrating candidate mKRAS binders incorporated into second generation NeoCAR-T cells capable of recognizing target pMHC independent of canonical TCR and CD8 recognition. (FIG. 9, center) As a screen for CAR activity Jurkat cells were transduced with NeoCARs targeting KRAS G12V presented by A* 11 or A*02. After co-culture with A* 11 (FIG. 9, center) or A*02 (FIG. 9, right) expressing target cells as measured by IL-2 secretion.
[0039] FIG. 10 illustrates that expression of exogenous IL- 12 by the Uni-Vect system increases MHC class I expression on CAR T cells, (top) A diagram of the workflow of these studies, (bottom) A graph illustrating that MHC class I expression is significantly higher in T cells which express the Uni-Vect inducible IL- 12 construct.
[0040] FIGs. 11A-11C illustrate that Uni-Vect IL-12 expressing CAR T cells demonstrate more effective killing of target cells in vitro. FIG. 11 A, a diagram of the workflow of these studies. CORL cells were used as targets. FIG. 1 IB is a graph illustrating an in vitro killing assay demonstrating that Uni-Vect expressing T cells have the greatest cytotoxicity. FIG. 1 1 C is a fluorescence image of co-cultures. Dark red: CD45 PE (T-Cells). Light red: GFP in CORL cells.
[0041] FIGs. 12A-12B illustrate the function of Uni-Vect IL-12 expressing CAR T cells in vivo. Luciferase expressing tumors were established in mice followed by the adoptive transfer a high or low dose of CAR T cells comprising either 4- IBB or CD28 costimulatory domains. FIG. 12A illustrates luminescence of established tumors following adoptive transfer of CAR T cells as measured by intravital imaging. FIG. 12B, left is a survival graph of each experimental group. FIG. 12B, right depicts the cause of death of the mice in each experimental group.
[0042] FIGs. 13A-13T: Kinetic analysis of clones. The figures depict the association and dissociation of soluble HLA-A* 11:01 KRAS G12V complex (HLA-A*l l:01 complexed with either KRAS G12V (VVVGAVGVGK (SEQ ID NO: 1)) with scFv clones (A) RU61-02, (B) RU61-75, (C) RU96-1, (D) RU96-07, (E) RU96-14, (F) MA018-2063, (G) MA018-2105, (H) MA018-2109, (I) MA018-2170, (J) MA018-2172, (K) MA018-2181, (L) MA018-3010, (M) MA018-3021, (N) MA018-3029, (O) MA018-3033, (P) MA018-3043, (Q) MA018-3044, (R) MA018-3051, (S) MA018-3063, and (T) MA018-3067 as measured by bio-layer interferometry (BLI) using a BLItz® instrument or Gator Prime instrument. The binding of HLA-A* 11:01 KRAS G12V complex (200 nM) was overlaid with HLA-A* 11 :01 KRAS wild-type peptide complex (Counter) control demonstrates specific binding only to the HLA- A* 11 :01 KRAS G12V complex. Arrow labelled ‘"Target" shows scFv binding to the HLA- A* 11:01 KRAS G12V complex. Arrow labelled “Control"’ shows scFv binding to HLA- A* 11:01 pMHC complexed with wild-type KRAS peptide.
[0043] FIGs. 14A-14T: Binding footprint. The figures depict binding of scFv to complexes loaded with alanine alone or alanine, glycine or threonine substituted peptides of KRAS G12V peptide (VVVGAVGVGK (SEQ ID NO: 1) binding to HLA-A*11 :01 MHC complexes using a bead-based binding assay. Panel identities of the scFvs are (A) RU61-02,
[0044] (B) RU61-75, (C) RU96-1, (D) RU96-07, (E) RU96-14, (F) MA018-2063, (G) MA018-2105, (H) MA018-2109, (I) MA018-2170, (J) MA018-2172, (K) MA018-2181, (L) MA018-3010, (M) MA018-3021, (N) MA018-3029, (O) MA018-3033, (P) MA018-3043. (Q) MA018- 3044, (R) MA018-305 L (S) MA018-3063, and (T) MA018-3067.
[0045] FIGs. 15A-15T: Specificity array analysis of clones. The figures depict bead-based binding assays demonstrating the pMHC -specificity of target HLA-A* 11:01 KRAS G12V complex vs. 96 unrelated complexes for each of the scFv clones (A) RU61-02, (B) RU61-75,
[0046] (C) RU96-1, (D) RU96-07, (E) RU96-14, (F) MA018-2063, (G) MA018-2105. (H) MA018- 2109, (I) MA018-2170, (J) MA018-2172, (K) MA018-2181, (L) MA018-3010, (M) MA018- 3021, (N) MA018-3029, (O) MA018-3033, (P) MA018-3043, (Q) MA018-3044, (R) MA018-3051, (S) MA018-3063, and (T) MA018-3067. The binding is normalized to the target complex (shown by arrow).
[0047] FIGs. 16A-16T: Binding of cross-reactive peptides to clones. The figures depict beadbased assays demonstrating the binding to complexes loaded with cross-reactive peptides of the HLA-A* l l:01 KRAS G12V peptide for each of the scFv clones (A) RU61-02, (B) RU61- 75, (C) RU96-1, (D) RU96-07, (E) RU96-14, (F) MA018-2063, (G) MA018-2105. (H) MA018-2109, (I) MA018-2170. (J) MA018-2172, (K) MA018-218L (L) MA018-3010, (M) MA018-3021, (N) MA018-3029, (O) MA018-3033, (P) MA018-3043, (Q) MA018-3044, (R) MA018-3051, (S) MA018-3063, and (T) MA018-3067. The binding is normalized to the target and a control complex.
[0048] FIGs. 17A-17T: KRAS G12V-specific bispecific T-cell engager (BiTE) antibody- mediated cytotoxicity of HLA-A* 11 :01 expressing cell lines in vitro. The figures show specific killing by T-cell engaging bispecific antibodies of K562 HLA-A*11:01 stably transfected cells treated with exogenous KRAS G12V peptide (RASG12V. triangles), but not wild- type peptide (Off-target peptide, square), DMSO negative control (solvent, circle), or irrelevant bispecific (unrelated bispecific, open circle), treated conditions. The BiTE antibodies additionally include antigen binding specificity for CD3 and were derived from the following scFv clones (A) RU61-02, (B) RU61-75, (C) RU96-1, (D) RU96-07. (E) RU96-14, (F) MA018-2063, (G) MA018-2105, (H) MA018-2109. (I) MA018-2170, (J) MA018-2172, (K) MA018-2181, (L) MA018-3010, (M) MA018-3021, (N) MA018-3029, (O) MA018- 3033, (P) MA018-3043, (Q) MA018-3044, (R) MA018-3051, (S) MA018-3063, and (T) MA018-3067. Cytotoxicity' was quantitated by loss of GFP-expressing target cells.
[0049] FIGs. 18A-18P: KRAS G12V / CD3-mediated cytotoxicity of HLA-A*11:01+ tumour cells in vitro with varying concentrations of peptide. The BiTE antibodies induced killing of GFP+HLA-A*11:01+ K562 cells treated with exogenous KRAS G12V target peptide diluted in a pool of negative control counter peptides (length-matched and HLA-A*11 :01 -restricted) in the presence of T cells isolated from donor PBMC (at 3: 1 E:T ratio). Different ratios of target peptide to counter peptide mix were tested (1 :200, shown in squares; 1:50 shown in diamonds and 1: 10 shown in triangles) and compared to killing in response to peptide solvent alone (closed circles) and killing by an irrelevant BiTE antibody (open circle). The BiTEs tested additionally include antigen binding specificity for CD3 and were derived from the following scFv clones (A) RU96-14, (B) MA018-2063. (C) MA018-2105, (D) MA018-2109, (E) MAO 18-2170, (F) MA018-2172, (G) MA018-2181 , (H) MAO 18-3010, (1) MA018-3021 , (J) MA018-3029, (K) MA018-3033, (L) MA018-3043, (M) MA018-3044, (N) MA018-3051, (O) MA018-3063, and (P) MA018-3067.
[0050] FIG. 19: MA018-3033 scFv serial kinetics. The figure depicts the association and dissociation of soluble HLA-A*11:01 KRAS G12V complex (HLA-A*11:01 complexed with KRAS G12V (VVVGAVGVGK (SEQ ID NO: 1)), with the MA018-3033 scFv as measured by the Gator Prime instrument. The binding w as performed at several dilutions of scFv to achieve an average KD value of 3.7 x 10'9M.
[0051] FIG. 20: MA018-3033 X-scan binding analysis. The figure depicts the binding of MAO 18-3033 scFv to complexes loaded with substituted peptides of KRAS G12V peptide (VVVGAVGVGK (SEQ ID NO: 1) with each position substituted for other natural amino acids, relative to the KRAS G12V peptide (VVVGAVGVGK (SEQ ID NO: 1). The binding was measured using a bead-based binding assay described herein. The Figure shows the extensive footprint of the MA018-3033 scFv across the KRAS G12V peptide in the A*l l :01 complex.
[0052] FIGs. 21A-21N: mKRAS TCR-CAR demonstrates anti-tumor activities in vitro with reduced cytokine release. The figures show lysis of target cell lines expressing mKRAS G12V in conjunction with HLA-A* 11:01. YAPC (A, D), SW-620 (B, E), and COR-L (C, F) endogenously express mKRAS G12V and were transduced with HLA-A*11:01. PANC-1 (G, K). HCC-827 (H, L). and CAKi-2 (I, M) (naturally express HLA-A* 11:01 and were transduced with a KRAS tandem minigene to express G12V. BxPC-3 (J, N) expresses wildtype KRAS and was used as a control cell line, with and without HLA-A* 11 :01 engineering. All cell lines were transduced with a GFP / luciferase construct and selected for the GFP positive population with FACS. Primary human CD4+ and CD8+ T cells were combined at a 1 : 1 ratio and transduced with constructs targeting mKRAS G12V. TruC-RU96-14 is comprised of the RU96-14 binder along with CD3e. RU96-14 and RU61-75 are CAR constructs with the RU binders coupled with CD8a hinge / transmembrane and BBZ intracellular domains. Effector and target cells were co-cultured at indicated effector-to-target ratio (E:T) for 24 hours before accessing for luminescence-based viability (n=3) (2-way ANOVA vs UTD).
[0053] FIGs. 22A-22H: mKRAS TCR-CAR demonstrates reduced secretion of cytotoxic proteins and cytokines. Secretion of genzyme A (A), IFN-y (B), perforin (C). TNF-a (D), IL- 5 (E), IL-13 (F), IL-2 (G), or IL-4 (H) following 24 hour co-culture at 1: 1 E:T ratio (n=3) (one-way ANOVA) with effector cells further described in Example 14 as shown in FIGs. 21A-N. n.s.; not significant, *;p<0.05, **;p<0.01, ***;p<0.001, ****;p<0.0001. All data with error bars are presented as means + / - SD. All data are representative of two or more experiments.
[0054] FIG. 23 is a multiple sequence alignment of anti-mKRAS VL sequences (top portion) and anti-mKRAS VH sequences (bottom portion).
[0055] DETAILED DESCRIPTION
[0056] This disclosure provides novel chimeric antigen receptors (CARs) and CAR constructs targeting isoforms of human KRAS possessing mutated codon G12. The disclosed CARs exhibit high binding affinity and high specificity against and can be used in various immunotherapies for treating KRAS-related diseases, including cancers.
[0057] Definitions In the detailed description, certain specific details are set forth in order to provide a thorough understanding of various embodiments. However, one skilled in the art will understand that the embodiments provided can be practiced without these details. Unless the context requires otherwise, throughout the specification and claims which follow, the word “comprise” and variations thereof, such as, “comprises” and “comprising” are to be construed in an open, inclusive sense, that is, as “including, but not limited to.” As used in this specification and the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the content clearly dictates otherwise. It should also be noted that the term “or” is generally employed in its sense including “and / or” unless the content clearly dictates otherwise. Further, headings provided herein are for convenience only and do not interpret the scope or meaning of the claimed embodiments.
[0058] The articles “a” and “an” are used herein to refer to one or to more than one (z.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element.
[0059] As used herein the term “about” refers to an amount that is near the stated amount by 10% or less.
[0060] As used herein the term “individual,” “patient,” or “subject” refers to individuals diagnosed with, suspected of being afflicted with, or at- risk of developing at least one disease for which the described compositions and method are useful for treating. In certain embodiments, the individual is a mammal. In certain embodiments, the mammal is a human.
[0061] The term “antibody,” as used herein, refers to an immunoglobulin molecule which specifically binds with an antigen. Antibodies can be intact immunoglobulins derived from natural sources or from recombinant sources and can be immunoreactive portions of intact immunoglobulins. Antibodies are typically tetramers of immunoglobulin molecules comprising two heavy chain and two light chain polypeptides. Each polypeptide chain contains three complementarity-determining regions (CDRs), which bind to the antigen and defines the antibody's antigen specificity'.
[0062] As used herein, the term “antibody” and “antibodies” can also include polypeptides or polypeptide complexes derived from full-length antibodies. These polypeptide complexes can be naturally occurring or constructed from single chain antibodies or antibody fragments and retain an antigen-specific binding ability . The antibodies of the present disclosure can exist in a variety of forms including, for example, polyclonal antibodies, monoclonal antibodies, Fv, Fab and F(ab')2, as well as single chain antibodies, scFv, humanized antibodies, and human antibodies (Harlow et al., 1999, In: Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY; Harlow et al., 1989, In: Antibodies: A Laboratory Manual, Cold Spring Harbor, New York; Houston et al., 1988. Proc. Natl. Acad. Sci. USA 85:5879- 5883; Bird et al., 1988, Science 242:423-426). For preparation of suitable antibodies, e.g., recombinant, monoclonal, or polyclonal antibodies, many techniques known in the art can be used (see, e.g., Kohler & Milstein, Nature 256:495-497 (1975); Kozbor et al., Immunology Today 4: 72 (1983); Cole et al., pp. 77-96 in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss. Inc. (1985); Coligan, Current Protocols in Immunology (1991): Harlow & Lane, Antibodies, A Laboratory Manual (1988); and Goding, Monoclonal Antibodies: Principles and Practice (2d ed. 1986)). The genes encoding the heavy and light chains of an antibody of interest can be cloned from a cell, e.g., the genes encoding a monoclonal antibody can be cloned from ahybridoma and used to produce a recombinant monoclonal antibody. Gene libraries encoding heavy and light chains of monoclonal antibodies can also be made from hybridoma or plasma cells. Random combinations of the heavy and light chain gene products generate a large pool of antibodies with different antigenic specificity (see, e.g., Kuby, Immunology (3rd ed. 1997)). Techniques for the production of single chain antibodies or recombinant antibodies (U.S. Pat. Nos. 4,946.778, 4,816.567) can be adapted to produce antibodies of this disclosure. Also, transgenic mice, or other organisms such as other mammals, can be used to express humanized or human antibodies (see, e.g., U.S. Pat. Nos. 5,545,807; 5.545,806; 5,569,825; 5,625,126; 5,633,425; 5,661,016, Marks et al., Bio / Technology 10:779-783 (1992); Lonberg et al.. Nature 368:856-859 (1994); Morrison, Nature 368:812-13 (1994); Fishwild et al . Nature Biotechnology 14:845-51 (1996);
[0063] Neuberger, Nature Biotechnology 14:826 (1996); and Lonberg & Huszar, Intern. Rev. Immunol. 13:65-93 (1995)). Alternatively, phage display technology can be used to identify antibodies and heteromeric Fab fragments that specifically bind to selected antigens (see, e.g., McCafferty et al., Nature 348:552-554 (1990); Marks et al.. Biotechnology 10:779-783 (1992)). Antibodies can also be made bispecific, i.e., able to recognize two different antigens (see, e.g., WO 93 / 08829, Traunecker et al., EMBO J. 10:3655-3659 (1991); and Suresh et al., Methods in Enzymology 121 :210 (1986)). Antibodies can also be heteroconjugates, e.g.. two covalently joined antibodies, or immunotoxins (see. e.g., U.S. Pat. No. 4.676,980, WO 91 / 00360; WO 92 / 200373; and EP 03089).
[0064] The term “antibody fragment” refers to at least one portion of an antibody that retains the ability to specifically interact with (e.g., by binding, steric hinderance, stabilizing / destabilizing. spatial distribution) an epitope of an antigen. Examples of antibody fragments include, but are not limited to. Fab, Fab', F(ab')2, Fv fragments, scFv antibody fragments, disulfide-linked Fvs (sdFv), a Fd fragment consisting of the VH and CHI domains, linear antibodies, single domain antibodies such as sdAb (either VL or VH), camelid VHH domains, multi-specific antibodies formed from antibody fragments such as a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region, and an isolated CDR or other epitope binding fragments of an antibody. An antigen binding fragment can also be incorporated into single domain antibodies, maxibodies, minibodies, nanobodies, intrabodies, diabodies. triabodies, tetrabodies. v-NAR and bis-scFv (see, e.g., Hollinger and Hudson, Nature Biotechnology 23: 1126-1136, 2005). Antigen binding fragments can also be grafted into scaffolds based on polypeptides such as a fibronectin type III (Fn3) (see U.S. Pat. No. 6,703,199, which describes fibronectin polypeptide minibodies)
[0065] Herein a molecule, peptide, polypeptide, antibody, or antibody fragment can be referred to as “bispecific” or “dual-specific” including grammatical equivalents. A bispecific molecule possesses the ability to specifically bind to at least two structurally distinct targets. The specific binding can be the result of two distinct binding moieties that are structurally distinct at the molecular level, including but not limited to distinct non-identical amino acid sequences; or a single binding moiety that is able to specifically bind to two structurally distinct targets with high affinity (e.g., with a KD less than about IxlO'6). A molecule, peptide, polypeptide, antibody, or antibody fragment referred to as “multi-specific” refers to a molecule that possesses the ability to specifically bind to at least three structurally distinct targets. A “bispecific antibody” including grammatical equivalents refers to a bispecific molecule that preserves at least one fragment of an antibody able to specifically bind a target, for example, a variable region, heavy or light chain, or one or more complementarity determining regions from an antibody molecule. A “multi-specific antibody” including grammatical equivalents refers to a multi-specific molecule that preserves at least one fragment of an antibody able to specifically bind with a target, for example, a variable region, heavy or light chain, or complementarity' determining region from an antibody molecule.
[0066] A “linker” herein is also referred to as “linker sequence.” “spacer,” “tethering sequence,” or grammatical equivalents thereof. A “linker” as referred herein connects two distinct molecules that by themselves possess target binding, catalytic activity, or are naturally expressed and assembled as separate polypeptides, or comprise separate domains of the same polypeptide. For example, two distinct binding moieties or a heavy-chain / light- chain pair. A number of strategies can be used to covalently link molecules together. Linkers described herein can be utilized to join a light chain variable region and a heavy chain variable region in an scFv molecule; or can be used to tether an scFv or other antigen binding fragment on the N- or C- terminus of an antibody heavy chain; or the N- or C- terminus of a light chain to create a bispecific or multi-specific binding molecule. These include but are not limited to polypeptide linkages between N- and C-termini of proteins or protein domains, linkage via disulfide bonds, and linkage via chemical cross-linking reagents. In one aspect of this embodiment, the linker is a peptide bond, generated by recombinant techniques or peptide synthesis. The linker peptide can predominantly include the following amino acid residues: Gly, Ser, Ala, or Thr. The linker peptide should have a length that is adequate to link two molecules in such a way that they assume the correct conformation relative to one another so that they retain the desired activity. In one embodiment, the linker is from about 1 to 50 amino acids in length or about 1 to 30 amino acids in length. In one embodiment, linkers of 1 to 20 amino acids in length can be used. Useful linkers include glycine-serine polymers, including for example (GS)n, (GSGGS)n (SEQ ID NO: 166), (GGGGS)n (SEQ ID NO: 167), and (GGGS)n (SEQ ID NO: 168), where n is an integer of at least one, glycinealanine polymers, alanine-serine polymers, and other flexible linkers. Exemplary, linkers for linking antibody fragments or single chain variable fragments can include AAEPKSS (SEQ ID NO: 199), AAEPKSSDKTHTCPPCP (SEQ ID NO: 200), GGGG (SEQ ID NO: 201), or GGGGDKTHTCPPCP (SEQ ID NO: 202). Alternatively, a variety of non-proteinaceous polymers, including but not limited to polyethylene glycol (PEG), polypropylene glycol, polyoxyalkylenes, or copolymers of polyethylene glycol and polypropylene glycol, can find use as linkers.
[0067] The terms “complementarity determining region,” and “CDR,” which are synonymous with “hypervariable region” or “HVR,” are known in the art to refer to noncontiguous sequences of amino acids within antibody variable regions, which confer antigen specificity and / or binding affinity. In general, there are three CDRs in each heavy chain variable region (HCDR1, HCDR2, HCDR3) and three CDRs in each light chain variable region (LCDR1, LCDR2, LCDR3). “Framework regions” and “FR” are know n in the art to refer to the non-CDR portions of the variable regions of the heavy and light chains. In general, there are four FRs in each full-length heavy chain variable region (HFR1, HFR2, HFR3, and HFR4), and four FRs in each full-length light chain variable region (LFR1, LFR2, LFR3, and LFR4). The precise amino acid sequence boundaries of a given CDR or FR can be readily determined using any of a number of well-known schemes, including those described by Kabat et al. (1991), “Sequences of Proteins of Immunological Interest,” 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD (“Kabat” numbering scheme). Al-Lazikani et al., (1997) JMB 273,927-948 ("Chothia'' numbering scheme); MacCallum et al., J. Mol. Biol. 262:732-745 (1996), “Antibody-antigen interactions: Contact analysis and binding site topography,” J. Mol. Biol. 262, 732-745.” (“Contact” numbering scheme); Lefranc MP et al., “IMGT unique numbering for immunoglobulin and T cell receptor variable domains and Ig superfamily V-like domains,” Dev Comp Immunol, 2003 Jan;27(l):55-77 (“IMGT” numbering scheme); Honegger A and Pluckthun A, “Yet another numbering scheme for immunoglobulin variable domains: an automatic modeling and analysis tool,” J Mol Biol, 2001 Jun 8;309(3):657-70, (“Aho” numbering scheme); and Whitelegg NR and Rees AR, “WAM: an improved algorithm for modelling antibodies on the WEB,” Protein Eng. 2000 Dec;13(12):819-24 (“AbM” numbering scheme. In certain embodiments, the CDRs of the antibodies described herein can be defined by a method selected from Kabat, Chothia, IMGT, Aho, AbM, or combinations thereof.
[0068] The boundaries of a given CDR or FR can vary depending on the scheme used for identification. For example, the Kabat scheme is based on structural alignments, while the Chothia scheme is based on structural information. Numbering for both the Kabat and Chothia schemes is based upon the most common antibody region sequence lengths, with insertions accommodated by insertion letters, for example, “30a,” and deletions appearing in some antibodies. The two schemes place certain insertions and deletions (“indels”) at different positions, resulting in differential numbering. The Contact scheme is based on analysis of complex crystal structures and is similar in many respects to the Chothia numbering scheme. In certain embodiments, the CDRs of the antibodies described herein can be defined by IMGT method.
[0069] The term “variable region” or “variable domain” refers to the domain of an antibody heavy or light chain that is involved in binding the antibody to antigen. The variable domains of the heavy chain and light chain (VH and VL, respectively) of a native antibody generally have similar structures, with each domain comprising four conserved framework regions (FRs) and three CDRs (See e.g., Kindt et al. Kuby Immunology, 6th ed., W.H. Freeman and Co., page 91(2007)). A single VH or VL domain can be sufficient to confer antigen-binding specificity. Furthermore, antibodies that bind a particular antigen can be isolated using a VH or VL domain from an antibody that binds the antigen to screen a library of complementary VL or VH domains, respectively (See e.g., Portolano et al., J. Immunol. 150:880-887 (1993); Clarkson et al., Nature 352:624-628 (1991)).
[0070] Specific binding or binding of antibody molecules described herein refers to binding mediated by one or more CDR portions of the antibody. Not all CDRs may be required for specific binding. Specific binding can be demonstrated for example by an ELISA against a specific recited target or antigen that shows significant increase in binding compared to an isotype control antibody.
[0071] An “epitope” refers to the binding determinant of an antibody or fragment described herein minimally necessary' for specific binding of the antibody or fragment thereof to a target antigen. When the target antigen is a polypeptide, the epitope will be a continuous or discontinuous epitope. A continuous epitope is formed by one region of the target antigen, while a discontinuous epitope can be formed from two or more separate regions. A discontinuous epitope, for example, can form when a target antigen adopts a tertian- structure that brings tw o amino acid sequences together and forms a three-dimensional structure bound by the antibody. When the target antigen is a polypeptide, the epitope will generally be a plurality of amino acids linked into a polypeptide chain. A continuous epitope can comprise 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous amino acids. While an epitope can comprise a contiguous polymer of amino acids, not every amino acid of the polymer can be contacted by an amino acid residue of the antibody. Such non-contacted amino acids will still comprise part of the epitope as they can be important for the structure and linkage of the contacted amino acids. The skilled artisan can determine if any given antibody binds an epitope of a reference antibody, for example, by cross-blocking experiments with a reference antibody. In certain embodiments, described herein, are antibodies that bind the same epitope of the described antibodies. In certain embodiments, described herein, are antibodies that are competitively blocked by the described antibodies. In certain embodiments, described herein, are antibodies that compete for binding with the described antibodies.
[0072] The term “antibody fragment” refers to a polypeptide comprising or derived from a portion of an intact antibody and comprises the antigen-binding determining variable regions of an intact antibody. Examples of antibody fragments include, but are not limited to, Fab, Fab', F(ab')2, and Fv fragments, linear antibodies, scFv antibodies, single-domain antibodies, such as camelid antibodies (Riechmann, 1999, Journal of Immunological Methods 231:25- 38), composed of either a VL or a VH domain which exhibit sufficient affinity for the target, and multi-specific antibodies formed from antibody fragments. Antibody fragments can be made by various techniques, including but not limited to proteolytic digestion of an intact antibody as well as production by recombinant host cells. In some embodiments, the antibodies are recombinantly produced fragments, such as fragments comprising arrangements that do not occur naturally, such as those with two or more antibody regions or chains joined by synthetic linkers, e.g., polypeptide linkers, and / or those that are not produced by enzyme digestion of a naturally occurring intact antibody. In some aspects, the antibody fragments are scFvs.
[0073] A Fab or Fab fragment contains the constant domain of the light chain and the first constant domain (CHI) of the heavy chain. Fab' or Fab' fragments differ from Fab fragments by the addition of a few residues at the carboxyl terminus of the heavy chain CHI domain including one or more cysteines from the antibody hinge region. Fab' fragments are produced by cleavage of the disulfide bond at the hinge cysteines of the F(ab')2 pepsin digestion product. Additional chemical couplings of antibody fragments are known to those of ordinary skill in the art. Fab and F(ab')2 fragments lack the Fragment crystallizable (Fc) region of an intact antibody, clear more rapidly from the circulation of animals, and can have less nonspecific tissue binding than an intact antibody. “Fv” fragment is the minimum fragment of an antibody that contains a complete target recognition and binding site. This region consists of a dimer of one heavy and one light chain variable domain in a tight, non-covalent association (VH-VL dimer). It is in this configuration that the three CDRs of each variable domain interact to define a target binding site on the surface of the VH-VL dimer. In some cases, the six CDRs confer target binding specificity to the antibody. However, in some cases, even a single variable domain (or half of an Fv comprising only three CDRs specific for a target) can have the ability to recognize and bind target. Single domain antibodies (sdAb) / single-chain fragments are composed of a single VH or VL domain which exhibit exhibits sufficient affinity to an antigen. A scFv (single-chain Fv) refers to antibody binding fragments that comprise the Vn and VL domains of an antibody, where these domains are present in a single polypeptide chain. Generally, the scFv polypeptide further comprises a polypeptide linker between the VH and VL domains which enables the scFv to form a structure favorable for target binding.
[0074] The term “diabodies” refers to small antibody fragments prepared by constructing scFv fragments with short linkers (about 5-10 residues) between the VH and VL domains such that inter-chain but not intra-chain pairing of the variable domains is achieved, resulting in a bivalent fragment, i.e.. fragment having two antigen-binding sites. Bispecific diabodies are heterodimers of tw o ’‘crossover” scFv fragments in which the VH and VL domains of the tw o antibodies are present on different polypeptide chains.
[0075] The term “linear antibodies” generally refers to the antibodies comprise comprising a pair of tandem Fd segments (VH-CH1-VH-CH1) which, together with complementary light chain polypeptides, form a pair of antigen binding regions. Linear antibodies can be bispecific or monospecific.
[0076] An '‘antibody heavy chain,’’ as used herein, refers to the larger of the two types of polypeptide chains present in all antibody molecules in their naturally occurring conformations.
[0077] An “antibody light chain,” as used herein, refers to the smaller of the two types of polypeptide chains present in some antibody molecules in their naturally occurring conformations, K and A, light chains refer to the two major antibody light chain isotypes.
[0078] The term “synthetic antibody” as used herein, is means an antibody which is generated using recombinant DNA technology, such as. for example, an antibody expressed by a bacteriophage as described herein. The term should also be construed to mean an antibody which has been generated by the synthesis of a DNA molecule encoding the antibody and which DNA molecule expresses an antibody protein, or an amino acid sequence specifying the antibody, wherein the DNA or amino acid sequence has been obtained using synthetic DNA or amino acid sequence technology which is available and well known in the art.
[0079] The term “antigen” or “Ag” as used herein is defined as a molecule that provokes an immune response. This immune response can involve either antibody production, or the activation of specific immunologically competent cells, or both. The skilled artisan will understand that any macromolecule, including virtually all proteins or peptides, can serve as an antigen. Furthermore, antigens can be derived from recombinant or genomic DNA. A skilled artisan will understand that any DNA, which comprises a nucleotide sequence or a partial nucleotide sequence encoding a protein that elicits an immune response therefore encodes an “antigen” as that term is used herein. Furthermore, one skilled in the art will understand that an antigen need not be encoded solely by a full-length nucleotide sequence of a gene. Moreover, a skilled artisan will understand that an antigen need not be encoded by a “gene” at all. It is readily apparent that an antigen can be generated synthesized or can be derived from a biological sample. Such a biological sample can include, but is not limited to a tissue sample, a tumor sample, a cell or a biological fluid.
[0080] The term “antigen presenting cell” or “APC” refers to an immune system cell such as an accessory cell (e.g., a B-cell, a dendritic cell, and the like) that displays a foreign antigen complexed with major histocompatibility complexes (MHCs) on its surface. T-cells may recognize these complexes using their T-cell receptors (TCRs). APCs process antigens and present them to T-cells.
[0081] The term '‘anti-tumor effect” as used herein, refers to a biological effect which can be manifested by a decrease in tumor volume, a decrease in the number of tumor cells, a decrease in the number of metastases, an increase in life expectancy, or amelioration of various physiological symptoms associated with the cancerous condition. An “anti-tumor effect” can also be manifested by the ability of the peptides, polynucleotides, cells and antibodies of the present disclosure in prevention of the occurrence of tumor in the first place.
[0082] As used herein, the term “autologous” is meant to refer to any material derived from the same individual to which it is later to be re-introduced into the individual.
[0083] “Allogeneic” refers to a graft derived from a different animal of the same species. “Xenogeneic” refers to a graft derived from an animal of a different species.
[0084] As used herein, the term “binding domain” to a protein, e.g.. an immunoglobulin chain or fragment thereof, comprising at least one immunoglobulin variable domain sequence. The term “binding domain” encompasses antibodies and antibody fragments. In an embodiment, an antibody molecule is a multispecific antibody molecule, e.g., it comprises a plurality of immunoglobulin variable domain sequences, wherein a first immunoglobulin variable domain sequence of the plurality has binding specificity for a first epitope and a second immunoglobulin variable domain sequence of the plurality has binding specificity for a second epitope. A bispecific antibody has specificity for no more than two antigens.
[0085] As used herein, the term “bispecific antibody” refers to an antibody having binding specificities for at least two different antigenic epitopes. A bispecific antibody molecule is characterized by a first immunoglobulin variable domain sequence which has binding specificity for a first epitope and a second immunoglobulin variable domain sequence that has binding specificity for a second epitope. In one embodiment, the epitopes are from the same antigen. A bispecific antibody has specificity for no more than two antigens. Methods for making bispecific antibodies are known in the art. For example, bispecific antibodies can be produced recombinantly using the co-expression of two immunoglobulin heavy chain / light chain pairs. Alternatively, bispecific antibodies can be prepared using chemical linkage. Bispecific antibodies further include bispecific antibody fragments.
[0086] The term “cancer” as used herein is defined as a disease characterized by the rapid and uncontrolled growth of aberrant cells. Cancer cells can spread locally or through the bloodstream and lymphatic system to other parts of the body. Examples of various cancers include but are not limited to, breast cancer, prostate cancer, ovarian cancer, cervical cancer, skin cancer, pancreatic cancer, colorectal cancer, renal cancer, liver cancer, brain cancer, lymphoma, leukemia, lung cancer and the like.
[0087] As used herein, the term '‘conservative sequence modifications’’ is intended to refer to amino acid modifications that do not significantly affect or alter the binding characteristics of the antibody or scFv containing the amino acid sequence. Such conservative modifications include amino acid substitutions, additions and deletions. Modifications can be introduced into an scFv or CAR of the present disclosure by standard techniques known in the art. such as site-directed mutagenesis and PCR-mediated mutagenesis. Conservative amino acid substitutions are ones in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g, lysine, arginine, histidine), acidic side chains (e.g, aspartic acid, glutamic acid), uncharged polar side chains (e.g, glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), beta-branched side chains (e.g, threonine, valine, isoleucine) and aromatic side chains (e.g. tyrosine, phenylalanine, tryptophan, histidine). Thus, one or more amino acid residues within the CDR regions of an scFv or CAR of the present disclosure can be replaced with other amino acid residues from the same side chain family and the altered antibody can be tested for the ability to bind an epitope of mKRAS using the functional assays described herein.
[0088] ■‘Co-stimulatory ligand,” as the term is used herein, includes a molecule expressed by an antigen presenting cell (e.g, an aAPC, dendritic cell, B cell, and the like) that specifically binds a cognate co-stimulatory molecule on a T cell, thereby providing a signal which, in addition to the primary signal provided by, for instance, binding of a TCR / CD3 complex with an MHC molecule loaded with peptide, mediates a T cell response, including, but not limited to, proliferation, activation, differentiation, and the like. A co-stimulatory ligand can include, but is not limited to, CD7, B7-1 (CD80), B7-2 (CD86), PD-L1, PD-L2, 4-1BBL, OX40L, inducible costimulatory ligand (ICOS-L), intercellular adhesion molecule (ICAM). CD30L, CD40, CD70, CD83. HLA-G, MICA. MICB. HVEM, lymphotoxin beta receptor, 3 / TR6, ILT3, ILT4, HVEM, an agonist or antibody that binds Toll ligand receptor and a ligand that specifically binds with B7-H3. A co-stimulatory ligand also encompasses, inter alia, an antibody that specifically binds with a co-stimulatory molecule present on a T cell, such as, but not limited to, CD27, CD28. 4-1BB. 0X40, CD30, CD40L. PD-1, ICOS. lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C. B7-H3, and a ligand that specifically binds with CD83.
[0089] A “co-stimulatory molecule” refers to cell-surface molecules expressed by T cells that specifically bind with co-stimulatory ligands expressed by antigen-presenting cells (APCs), thereby providing a “secondary signal” which, in combination with the “primary signal” delivered through MHC / HLA-antigen interactions with the T Cell Receptor (TCR) results in optimal T cell activation including, but not limited to. cytokine production and proliferation. Co-stimulatory molecules include, but are not limited to CD27, CD28, 4-1BB, 0X40, CD30, CD40L, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, and a ligand that specifically binds with CD83.
[0090] “Derived from” as that term is used herein, indicates a relationship between a first and a second molecule. It generally refers to structural similarity between the first molecule and a second molecule and does not connotate or include a process or source limitation on a first molecule that is derived from a second molecule. For example, in the case of an intracellular signaling domain that is derived from a CD3zeta molecule, the intracellular signaling domain retains sufficient CD3zeta structure such that is has the required function, namely, the abi 1 i ty to generate a signal under the appropriate conditions. It does not connotate or include a limitation to a particular process of producing the intracellular signaling domain, e.g., it does not mean that, to provide the intracellular signaling domain, one must start with a CD3zeta sequence and delete unwanted sequence, or impose mutations, to arrive at the intracellular signaling domain.
[0091] “Encoding” refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, to sen e as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (z.e., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom. Thus, a gene encodes a protein if transcription and translation of mRNA corresponding to that gene produces the protein in a cell or other biological system. Both the coding strand, the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings, and the non-coding strand, used as the template for transcription of a gene or cDNA, can be referred to as encoding the protein or other product of that gene or cDNA.
[0092] Unless otherwise specified, a “nucleotide sequence encoding an amino acid sequence” includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. Nucleotide sequences that encode proteins and RNA can include introns.
[0093] ■‘Effective amount’’ or "therapeutically effective amount” are used interchangeably herein, and refer to an amount of a compound, formulation, material, or composition, as described herein effective to achieve a particular biological result. Such results can include, but are not limited to, the inhibition of virus infection as determined by any means suitable in the art.
[0094] As used herein “endogenous” refers to any material from or produced inside an organism, cell, tissue or system.
[0095] As used herein, the term “exogenous” refers to any material introduced from or produced outside an organism, cell, tissue or system.
[0096] The term “expression” as used herein is defined as the transcription and / or translation of a particular nucleotide sequence driven by its promoter.
[0097] “Expression vector” refers to a vector comprising a recombinant polynucleotide comprising expression control sequences operatively linked to a nucleotide sequence to be expressed. An expression vector comprises sufficient cis-acting elements for expression; other elements for expression can be supplied by the host cell or in an in vitro expression system. Expression vectors include all those known in the art, such as cosmids, plasmids (e.g, naked or contained in liposomes) and viruses (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) that incorporate the recombinant polynucleotide.
[0098] “Elomologous” as used herein, refers to the subunit sequence identity between two polymeric molecules, e.g., between two nucleic acid molecules, such as, two DNA molecules or two RNA molecules, or between two polypepride molecules. When a subunit position in both of the two molecules is occupied by the same monomeric subunit; e.g., if a position in each of two DNA molecules is occupied by adenine, then they are homologous at that position. The homology between two sequences is a direct function of the number of matching or homologous positions; e.g., if half (e.g., five positions in a polymer ten subunits in length) of the positions in two sequences are homologous, the two sequences are 50% homologous; if 90% of the positions (e.g.. 9 of 10). are matched or homologous, the two sequences are 90% homologous.
[0099] “Humanized” and “chimeric” forms of non-human antibodies are immunoglobulins, immunoglobulin chains or fragments thereof (such as scFv, Fv, Fab, Fab', F(ab')2 or other antigen-binding subsequences of antibodies) which contain minimal sequences derived from non-human immunoglobulin. For the most part, humanized and chimeric antibodies are human immunoglobulins (recipient antibody) in which residues from a complementary - determining region (CDR) of the recipient are replaced by residues from a CDR of a nonhuman species (donor antibody) such as mouse, rat, canine or rabbit having the desired specificity, affinity, and capacity. In some instances, Fv framework region (FR) residues of the human immunoglobulin are replaced by corresponding non-human residues. Furthermore, humanized, and chimeric antibodies can comprise residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences. These modifications are made to further refine and optimize antibody performance. In general, the humanized and chimeric antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non- human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin sequence. The chimeric antibody optimally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin.
[0100] As used herein, an “instructional materiaf’ includes a publication, a recording, a diagram, or any other medium of expression which can be used to communicate the usefulness of the compositions and methods of the present disclosure. The instructional material of the kit of the present disclosure can, for example, be affixed to a container which contains the nucleic acid, peptide, and / or composition of the present disclosure or be shipped together with a container which contains the nucleic acid, peptide, and / or composition. Alternatively, the instructional material can be shipped separately from the container with the intention that the instructional material and the compound be used cooperatively by the recipient.
[0101] “Identity” as used herein refers to the percent (%) sequence identity with respect to a reference polypeptide sequence is the percentage of amino acid residues in a candidate sequence that are identical with the amino acid residues in the reference polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conserv ative substitutions as part of the sequence identity. Alignment for purposes of determining percent amino acid sequence identity' can be achieved in various ways that are known for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. Appropriate parameters for aligning sequences are able to be determined, including algorithms needed to achieve maximal alignment over the full length of the sequences being compared. For purposes herein, how ever, % amino acid sequence identity values are generated using the sequence comparison computer program ALIGN-2. The ALIGN-2 sequence comparison computer program was authored by Genentech, Inc., and the source code has been filed with user documentation in the U.S. Copyright Office, Washington D.C., 20559, where it is registered under U.S. Copyright Registration No. TXU510087. The ALIGN-2 program is publicly available from Genentech, Inc., South San Francisco, Calif, or can be compiled from the source code. The ALIGN-2 program should be compiled for use on a UNIX operating system, including digital UNIX V4.0D. All sequence comparison parameters are set by the ALIGN-2 program and do not vary.
[0102] In situations where ALIGN-2 is employed for amino acid sequence comparisons, the % amino acid sequence identity of a given amino acid sequence A to. with, or against a given amino acid sequence B (which can alternatively be phrased as a given amino acid sequence A that has or comprises a certain % amino acid sequence identity to, with, or against a given amino acid sequence B) is calculated as follows: 100 times the fraction X / Y. where X is the number of amino acid residues scored as identical matches by the sequence alignment program ALIGN-2 in that program's alignment of A and B, and where Y is the total number of amino acid residues in B. It will be appreciated that where the length of amino acid sequence A is not equal to the length of amino acid sequence B, the % amino acid sequence identity7of A to B will not equal the % amino acid sequence identity7of B to A. Unless specifically stated otherwise, all % amino acid sequence identity values used herein are obtained as described in the immediately preceding paragraph using the ALIGN-2 computer program.
[0103] “Isolated'’ means altered or removed from the natural state. For example, a nucleic acid or a peptide naturally present in a living animal is not “isolated,” but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its natural state is “isolated.” An isolated nucleic acid or protein can exist in substantially purified form, or can exist in a non-native environment such as, for example, a host cell.
[0104] In the context of the present disclosure, the following abbreviations for the commonly occurring nucleic acid bases are used. “A” refers to adenosine, “C” refers to cytosine, “G” refers to guanosine, “T” refers to thymidine, and “U” refers to uridine.
[0105] Unless otherwise specified, a “nucleotide sequence encoding an amino acid sequence” includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. The phrase nucleotide sequence that encodes a protein or an RNA can also include introns to the extent that the nucleotide sequence encoding the protein can in some version contain an intron(s). The term “operably linked'’ refers to functional linkage between a regulatory sequence and a heterologous nucleic acid sequence resulting in expression of the latter. For example, a first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For instance, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. Generally, operably linked DNA sequences are contiguous and, where necessary to join two protein coding regions, in the same reading frame.
[0106] “Parenteral” administration of an immunogenic composition includes, e.g., subcutaneous (s.c.), intravenous (i.v ), intramuscular (i.m.), or intrastemal injection, or infusion techniques.
[0107] The term “polynucleotide” as used herein is defined as a chain of nucleotides. Furthermore, nucleic acids are polymers of nucleotides. Thus, nucleic acids and polynucleotides as used herein are interchangeable. One skilled in the art has the general knowledge that nucleic acids are polynucleotides, which can be hydrolyzed into the monomeric “nucleotides.” The monomenc nucleotides can be hydrolyzed into nucleosides. As used herein polynucleotides include, but are not limited to, all nucleic acid sequences which are obtained by any means available in the art, including, without limitation, recombinant means, i.e., the cloning of nucleic acid sequences from a recombinant library or a cell genome, using ordinary cloning technology and PCR™, and the like, and by synthetic means.
[0108] As used herein, the terms “peptide,” “polypeptide,” and “protein” are used interchangeably, and refer to a compound comprised of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids that can comprise a protein’s or peptide’s sequence. Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds. As used herein, the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types. “Polypeptides” include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, among others. The polypeptides include natural peptides, recombinant peptides, synthetic peptides, or a combination thereof. The term “promoter’" as used herein is defined as a DNA sequence recognized by the synthetic machinery of the cell, or introduced synthetic machinery, required to initiate the specific transcription of a polynucleotide sequence.
[0109] As used herein, the term “promoter / regulatory sequence” means a nucleic acid sequence which is required for expression of a gene product operably linked to the promoter / regulatory sequence. In some instances, this sequence can be the core promoter sequence and in other instances, this sequence can also include an enhancer sequence and other regulatory elements which are required for expression of the gene product. The promoter / regulatory sequence can, for example, be one which expresses the gene product in a tissue specific manner.
[0110] A “constitutive” promoter is a nucleotide sequence which, when operably linked with a polynucleotide which encodes or specifies a gene product, causes the gene product to be produced in a cell under most or all physiological conditions of the cell.
[0111] An “inducible” promoter is a nucleotide sequence which, when operably linked with a polynucleotide which encodes or specifies a gene product, causes the gene product to be produced in a cell substantially only when an inducer which corresponds to the promoter is present in the cell.
[0112] A “tissue-specific” promoter is a nucleotide sequence which, when operably linked with a polynucleotide encodes or specified by a gene, causes the gene product to be produced in a cell substantially only if the cell is a cell of the tissue type corresponding to the promoter.
[0113] A “signal transduction pathway" refers to the biochemical relationship between a variety of signal transduction molecules that play a role in the transmission of a signal from one portion of a cell to another portion of a cell. The phrase “cell surface receptor” includes molecules and complexes of molecules capable of receiving a signal and transmitting signal across the plasma membrane of a cell. An example of a "‘cell surface receptor” is human GFRa4.
[0114] The term “signaling domain” refers to the functional portion of a protein which acts by transmitting information within the cell to regulate cellular activity via defined signaling pathways by generating second messengers or functioning as effectors by responding to such messengers.
[0115] “Single chain antibodies'’ refer to antibodies formed by recombinant DNA techniques in which immunoglobulin heavy and light chain fragments are linked to each other using an engineered span of amino acids to recapitulate the Fv region of an antibody as a single polypeptide. Various methods of generating single chain antibodies are known, including those described in U.S. Pat. No. 4,694,778; Bird (1988) Science 242:423-442; Huston et al. (1988) Proc. Natl. Acad. Sci. USA 85:5879-5883; Ward et al. (1989) Nature 334:54454; Skerra et al. (1988) Science 242: 1038-1041.
[0116] The term “subject” is intended to include living organisms in which an immune response can be elicited (e.g., mammals). A “subject” or “patient,” as used therein, can be a human or non-human mammal. Non-human mammals include, for example, livestock and pets, such as ovine, bovine, porcine, canine, feline and murine mammals. In some embodiments, the subject is human.
[0117] As used herein, a “substantially purified” cell is a cell that is essentially free of other cell t pes. A substantially purified cell also refers to a cell which has been separated from other cell types with which it is normally associated in its naturally occurring state. In some instances, a population of substantially purified cells refers to a homogenous population of cells. In other instances, this term refers simply to cell that have been separated from the cells with which they are naturally associated in their natural state. In some embodiments, the cells are cultured in vitro. In other embodiments, the cells are not cultured in vitro.
[0118] The term “therapeutic” as used herein means a treatment and / or prophylaxis. A therapeutic effect is obtained by suppression, remission, or eradication of a disease state.
[0119] The term “transfected” or “transformed” or “transduced” as used herein refers to a process by which exogenous nucleic acid is transferred or introduced into the host cell. A “transfected” or “transformed” or “transduced” cell is one which has been transfected, transformed or transduced with exogenous nucleic acid. The cell includes the primary subject cell and its progeny.
[0120] The phrase “under transcriptional control” or “operatively linked” as used herein means that the promoter is in the correct location and orientation in relation to a polynucleotide to control the initiation of transcription by RNA polymerase and expression of the polynucleotide.
[0121] A “vector” is a composition of matter which comprises an isolated nucleic acid and which can be used to deliver the isolated nucleic acid to the interior of a cell. Numerous vectors are known in the art including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses. Thus, the term “vector” includes an autonomously replicating plasmid or a virus. The term should also be construed to include non-plasmid and non- viral compounds which facilitate transfer of nucleic acid into cells, such as, for example, polylysine compounds, liposomes. and the like. Examples of viral vectors include, but are not limited to, adenoviral vectors, adeno-associated virus vectors, retroviral vectors, lentiviral vectors, and the like.
[0122] The term '‘specifically binds,” as used herein, is means an antibody, or a ligand, which recognizes and binds with a cognate binding partner (e.g., a stimulatory and / or costimulatory molecule present on a T cell) protein present in a sample, but which antibody or ligand does not substantially recognize or bind other molecules in the sample.
[0123] The term “stimulation” refers to a primary response induced by binding of a stimulatory molecule (e g., a TCR / CD3 complex) with its cognate ligand thereby mediating a signal transduction event, such as, but not limited to, signal transduction via the TCR / CD3 complex. Stimulation can mediate altered expression of certain molecules, such as downregulation of TGF-[3. and / or reorganization of cytoskeletal structures, and the like.
[0124] A “stimulatory molecule,” as the term is used herein, means a molecule on a T cell that specifically binds with a cognate stimulatory ligand present on an antigen presenting cell and / or on a tumor cell.
[0125] A “stimulatory ligand,” as used herein, means a ligand that when present on an antigen presenting cell (e.g.. an aAPC. a dendritic cell, a B-celL and the like) or a tumor cell, can specifically bind with a cognate binding partner (referred to herein as a “stimulatory molecule”) on a T cell, thereby mediating a primary' response by the T cell, including, but not limited to, activation, initiation of an immune response, proliferation, and the like. Stimulatory ligands are well-known in the art and encompass, inter aha, an MHC Class I molecule loaded with a peptide, an anti-CD3 antibody, a super-agonist anti-CD28 antibody, and a super-agonist anti-CD2 antibody.
[0126] Ranges: throughout this present disclosure, various aspects of the present disclosure can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the present disclosure. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.
[0127] Mutant KRAS Targeting Ras, named for its discovery as a driver of rat sarcoma, is a small guanine nucleotide- binding (GNB) protein and is involved in cellular signal transduction that controls proliferation, differentiation, and apoptosis. In its normal state, Ras protein cycles between two main states, the inactive GDP-bound state and the active GTP-bound state. Only in complex with GTP, it can bind downstream effector proteins with high affinity'-. Mutations to Ras, particularly in amino acid positions 12. 13, or 61 are found in more than 30% of all human cancers, where it acts as an oncogene capable of transforming mammalian cells. Mutated forms of Ras stay permanently activated due to inefficient hydrolysis of GTP. Ras proteins exist as a family of three forms: Ha-Ras (HRAS), Ki-Ras (KRAS), and N-Ras (NRAS), each of which is capable of oncogenic function when mutated. Kirsten rat sarcoma viral oncogene homologue (KRAS) is the best-known member of the family with the highest mutation rate among all cancers and is associated with a series of highly fatal cancers, including pancreatic ductal adenocarcinoma (PDAC), non-small-cell lung cancer (NSCLC), and colorectal cancer (CRC).
[0128] In some aspects, the present invention provides mutant KRAS (mKRAS) antigenbinding polypeptides that can bind to epitopes derived from human mutant KRAS, especially KRAS proteins comprising the G12V mutation. The mKRAS-specific antigen-binding fragments (e.g., scFvs), bispecific antibodies, and CAR constructs comprising such antigenbinding fragments which are disclosed herein can be used to target any cell expressing mutant KRAS (e.g., G12V or G12D) in the context of an HLA complex to provide an mKRAS targeting immunotherapy. Also provided are bispecific molecules, CARs, immunoconjugates, nucleic acids, vectors, host cells, kits, compositions for mKRAS targeting as described herein, and methods of producing and using the same for the treatment of cancers in subjects.
[0129] Mutant KRAS-Targeting Polypeptides
[0130] In one aspect, the present invention provides a mutant KRAS (mKRAS) antigenbinding domain specifically binding to an epitope (e.g., KRAS G12V) of which is presented in the context of an HLA complex, comprising e.g., HLA A*11 or HLA A*2.
[0131] In one embodiment, the antigen-binding domain comprises a VH region comprising three heavy chain complementarity determining regions (HCDRs) and a VL region comprising three light chain complementarity determining regions (LCDRs), wherein the antigen-binding domain comprises 90%, 95%, 96%, 96%, 97%, 98%, 99%, or 100% identity to an antigen-binding domain selected from the group consisting of: a) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 32, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 33, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 34: and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 35, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 36, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 37; b) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 32, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 33, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 38; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 39, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 45, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 41; c) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 32, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 33, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 38; and a VL region comprising an LCDR1 comprising the ammo acid sequence of SEQ ID NO: 42, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 43; d) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 32. an HCDR2 comprising the amino acid sequence of SEQ ID NO: 33, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 38; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 42, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 44; e) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 32, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 33, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 45; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 42, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 46; f) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 32, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 33, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 45; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 42, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 70; g) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 32, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 33, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 48; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 42, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 49; h) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 32, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 33, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 50; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 42, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 1; i) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 78, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 79, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 38; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 80, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 81; j) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 86, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 87, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 38; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 88, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 89; k) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 78, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 79, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 94; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 95, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 96; l) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 78, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 79, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 100; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 95, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 96; m) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 78, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 79, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 104; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 95, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 96; n) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 78, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 79, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 108; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 95, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 96; o) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 78, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 79, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 112; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 95, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 96; p) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 117, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 118, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 38; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 119, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 120; q) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 1 17, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 118, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 108; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 125, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 126; r) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 78, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 79, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 129; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 95, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 96; s) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 1 17, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 133, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 134; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 119, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 120; t) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 78, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 79, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 38; and a VL region comprising an LCDR1 comprising the ammo acid sequence of SEQ ID NO: 95, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 96; u) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 117, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 118, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 142; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 95, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 143; v) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 1 17, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 133, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 108; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 119. an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 120; w) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 117, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 118, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 94; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 80, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 151; and x) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 32, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 33, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 38; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 39, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 215.
[0132] In an embodiment, the present invention provides an antigen-binding domain, bispecific antibody, bispecific T-cell engager (BiTE) antibody, or chimeric antigen receptor (CAR) targeting mKRAS, wherein the antigen-binding domain comprises: a) a heavy chain variable (VH) region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 27-31, 76, 84, 92, 99, 103, 107, 111, 115, 123, 128, 132, 137, 140, 146, 149, and 28; and b) a light chain variable (VL) region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 19-26, 77, 85, 93, 93, 93, 116, 124, 141, 150, and 213.
[0133] In another embodiment, the present invention provides an antigen-binding domain, bispecific antibody, bispecific T-cell engager (BiTE) antibody, or chimeric antigen receptor (CAR) comprising: a) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 27 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 19; b) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 28 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 20; c) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 28 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 21; d) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 28 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 22; e) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 29 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 23;
[0134] I a VH region comprising the amino acid sequence set forth in SEQ ID NO: 29 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 24; g) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 30 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 25; h) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 31 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 26; i) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 76 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 77; j) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 84 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 85; k) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 92 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 93; l) a Vn region comprising the amino acid sequence set forth in SEQ ID NO: 99 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 93; m) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 103 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 93; n) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 107 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 93; o) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 111 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 93; p) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 115 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 116; q) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 123 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 124; r) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 128 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 93; s) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 132 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 116; t) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 137 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 93; u) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 140 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 141; v) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 146 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 116; w) a Vn region comprising the amino acid sequence set forth in SEQ ID NO: 149 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 150, and x) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 28 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 214.
[0135] Single-Chain Variable Fragments (scFvs)
[0136] In certain embodiments, the antigen-binding domain comprises a single-chain variable fragment (scFv). As used herein, the term “single-chain variable fragment” or “scFv” is a fusion protein of the VH and VL regions of an immunoglobulin covalently linked to form a VH:VL heterodimer. The VH and VL regions are either joined directly or joined by a peptide- encoding linker, which connects the N-terminus of the VH with the C-terminus of the VL, or the C-terminus of the VH with the N-terminus of the VL.
[0137] In some embodiments, the scFv comprising the mKRAS binding domain has the configuration from N-terminus to C-terminus, VH - linker - VL. In some embodiments, the antigen binding domain comprises an scFv having the configuration from N-terminus to C- terminus. VL - linker - VH. Those of skill in the art would be able to select the appropriate configuration for use in the present disclosure. In an embodiment, the antigen binding domain comprises an scFv comprising an amino acid sequence set forth in any one of SEQ ID NOs: 11-18, 75, 83, 91, 98, 102, 106, 110, 114, 122, 231, 131, 136, 139, 145, 148, or 216.
[0138] In some embodiments, the scFv is engineered for increased binding affinity by modifying one or more amino acids within one or both variable regions (z.e., VH and / or VL), for example within one or more CDR regions and / or within one or more framework regions as further described herein.
[0139] Antibody affinity maturation can be performed by adding sequence diversity to the CDRs of either the VL or the VH domain in any order. By way of example, the CDRs of the VL are first diversified, using tailored oligonucleotides or synthesised DNA to create DNA libraries of the antibody, and the variants are produced and competed or compared against the properties of the parental antibody. Those variants with improved affinity, but which maintain target selectivity, are then used as the basis for diversification of the VH CDRS in a similar manner, and further improvements may be discovered. Changes to the sequence in CDRs of either domain from independent clones that result in gains in affinity may also be combined to achieve additive gains. Affinity maturation results in multiple variants, where positions that are influential to the affinity may also act in concert with changes in residues at other positions, and the gains discovered may be independent of equal gains discovered at other sites. Thus, a family of related variants can be aligned to produce a consensus such as shown in FIG 23, and by SEQ ID NOs:229 and 230 which may have 90%, or higher, identity between all related sequences.
[0140] The linker is usually rich in glycine for flexibility, as well as serine or threonine for solubility. The linker can link the heavy chain variable region and the light chain variable region of the extracellular antigen-binding domain. Non-limiting examples of linkers are disclosed in Shen et al., Anal. Chem. 80(6): 1910-1917 (2008) and WO 2014 / 087010, the contents of which are hereby incorporated by reference in their entireties. Various linker sequences are known in the art, including, without limitation, glycine serine (GS) linkers such as (GS)n, (GSGGS)n (SEQ ID NO: 176), (GGGGS)n (SEQ ID NO: 177), and (GGGS)n (SEQ ID NO: 178), and, where n represents an integer of at least 1. Other linker sequences comprise amino acid sequences including, without limitation. GGSG (SEQ ID NO: 179), GGSGG (SEQ ID NO: 180), GSGSG (SEQ ID NO: 181), GSGGG (SEQ ID NO: 182), GGGSG (SEQ ID NO: 183), GSSSG (SEQ ID NO: 184), GGGGS (SEQ ID NO: 185), GGGGSGGGGSGGGGS (SEQ ID NO: 186), GGGSSRSSSSGGGGSGGGG (SEQ ID NO: 187), SGGGGSGGGGS (SEQ ID NO: 188) and the like. Those of skill in the art would be able to select the appropriate linker sequence for use in the present disclosure. In one embodiment, an scFv of the present disclosure comprises a VH and VL regions connected by the linker sequence having the amino acid sequence GGGSSRSSSSGGGGSGGGG (SEQ ID NO: 187), which can be encoded by the nucleic acid sequence GGCGGTGGTTCCTCTAGATCTTCCTCCTCTGGTGG CGGTGGCTCGGGCGGTGGTGGG (SEQ ID NO: 189) in which an arginine residue, R, is present as a result of including a nucleotide sequence for the restriction endonuclease Xba I. The presence of restriction sites in the linker along with those flanking an scFv construct will be recognized by those skilled in the art to be useful for performing heavy chain / light chain “swapping” experiments for antibody optimization, if desired.
[0141] Despite removal of the constant regions and the introduction of a linker, scFv proteins retain the specificity7of the original immunoglobulin. Single chain Fv polypeptide antibodies can be expressed from a nucleic acid comprising VH- and V -encoded sequences as described by Huston et al. (Proc. Nat. Acad. Sci. USA, 85:5879-5883, 1988). See also U.S. Patent Nos. 5,091,513, 5, 132,405 and 4,956,778; and U.S. Patent Publication Nos. 20050196754 and 20050196754. Antagonistic scFvs having inhibitory activity have been described (see, e.g., Zhao et al., Hybridoma (Larchmt) 2008 27(6):455-51; Peter et al., J Cachexia Sarcopenia Muscle 2012 August 12; Shieh et al., J Imunol 2009 183(4):2277-85; Giomarelli et al.. Thromb Haemost 2007 97(6):955-63; Fife eta., J Clin Invst 2006 116(8):2252-61 ; Brocks et al., Immunotechnology' 1997 3(3):173-84; Moosmayer et al., Ther Immunol 1995 2(10:31- 40). Agonistic scFvs having stimulatory activity have been described (see, e.g, Peter et al., J Biol Chem 2003 25278(38):36740-7; Xie et al., Nat Biotech 1997 15(8): 768-71 ; Ledbetter et al.. Crit Rev Immunol 1997 17(5-6):427-55; Ho et al.. BioChim Biophys Acta 2003 1638(3):257-66). the VH region and the VL region are connected by a linker.
[0142] In an exemplary embodiment, the present invention provides an scFv comprising a VH region comprising an HCDR1 (GFTFSSYA, SEQ ID NO: 32), HCDR2 (SGSGGS. SEQ ID NO: 33), and HCDR3 (MQPAGIWRPAFDI, SEQ ID NO: 34); and a VL region comprising an LCDR1 (DKLGDKYA, SEQ ID NO: 35), LCDR2 (QDSKRPS, SEQ ID NO: 36), and LCDR3 (QAWDSHGAPIVV, SEQ ID NO: 37). In one embodiment, the scFv comprises a VH region comprising the comprising the amino acid sequence set forth in SEQ ID NO: 27 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 19. In another embodiment, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 11 or is encoded by a nucleic acid comprising the nucleotide sequence set forth in SEQ ID NO: 3.
[0143] In another exemplary embodiment, the scFv comprises a VH region comprising an HCDR1 (GFTFSSYA, SEQ ID NO: 32), HCDR2 (SGSGGS, SEQ ID NO: 33), and HCDR3 (GAWVYSYGELSAFDI, SEQ ID NO: 38); and a VL region comprising an LCDR1 (SSGSIASNYV, SEQ ID NO: 39), LCDR2 (EDNQRPS, SEQ ID NO: 40), and LCDR3 (QSYDTDLGVV, SEQ ID NO: 41). In some embodiments, the scFv comprises a VH region comprising the amino acid sequence of SEQ ID NO: 28 and a Vi, region comprising the amino acid sequence set forth in SEQ ID NO: 20. In another embodiment, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 12 or is encoded by a nucleic acid comprising the nucleotide sequence set forth in SEQ ID NO: 4.
[0144] In another embodiment, the scFv comprises a VH region comprising an HCDR1 (GFTFSSYA, SEQ ID NO: 32), HCDR2 (SGSGGS, SEQ ID NO: 33), and HCDR3 (GAWVYSYGELSAFDI, SEQ ID NO: 38); and a VL region comprising an LCDR1 (SSGSIASNY, SEQ ID NO: 42), LCDR2 (EDNQRPS, SEQ ID NO: 40). and LCDR3 (QSYDNEMTAVV. SEQ ID NO: 43). In one embodiment, the scFv comprises a VH region comprising the amino acid sequence set forth in SEQ ID NO: 28 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 21. In another embodiment, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 13 or is encoded by a nucleic acid comprising the nucleotide sequence set forth in SEQ ID NO: 5.
[0145] In another embodiment, the scFv comprises a VH region comprising an HCDR1 (GFTFSSYA, SEQ ID NO: 32), HCDR2 (SGSGGS, SEQ ID NO: 33), and HCDR3 (GAWVYSYGELSAFDI, SEQ ID NO: 38); and a VL region comprising an LCDR1 (SSGSIASNY. SEQ ID NO: 42), LCDR2 (EDNQRPS, SEQ ID NO: 40). and LCDR3 (QSYDNNAVV, SEQ ID NO: 44). In one embodiment, the scFv comprises a VH region comprising the amino acid sequence set forth in SEQ ID NO: 28 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 22. In another embodiment, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 14 or is encoded by a nucleic acid comprising the nucleotide sequence set forth in SEQ ID NO: 6. In another embodiment, scFv comprises a VH region comprising an HCDR1 (GFTFSSYA, SEQ ID NO: 32), HCDR2 (SGSGGS, SEQ ID NO: 33), and HCDR3 (GFYWQSEMFAFDI, SEQ ID NO: 45 and a VL region comprising an LCDR1 (SSGSIASNY, SEQ ID NO: 42), LCDR2 (EDNQRPS, SEQ ID NO: 40), and LCDR3 (QSYDWKSVV, SEQ ID NO: 46). In one embodiment, the scFv comprises a VH region comprising a VH region comprising the amino acid sequence set forth in SEQ ID NO: 29 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 23. In another embodiment, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 15 or is encoded by a nucleic acid comprising the nucleotide sequence set forth in SEQ ID NO: 7.
[0146] In another embodiment, the scFv comprises a VH region comprising an HCDR1 (GFTFSSYA, SEQ ID NO: 32), HCDR2 (SGSGGS, SEQ ID NO: 33), and HCDR3 (GFYWQSEMFAFDI, SEQ ID NO: 45); and a Vi. region comprising an LCDR1 (SSGSIASNY, SEQ ID NO: 42), LCDR2 (EDNQRPS, SEQ ID NO: 40), and LCDR3 (QSYDYKTVV, SEQ ID NO: 47). In one embodiment, the scFv comprises a VH region comprising the amino acid sequence set forth in SEQ ID NO: 29 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 24. In another embodiment, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 16 or is encoded by a nucleic acid comprising the nucleotide sequence set forth in SEQ ID NO: 8.
[0147] In another embodiment, the scFv comprises a VH region comprising an HCDR1 (GFTFSSYA, SEQ ID NO: 32), HCDR2 (SGSGGS, SEQ ID NO: 33), and HCDR3 (GYYWQSEMFAFDI, SEQ ID NO: 48); and a VL region composing an LCDR1 (SSGSIASNY, SEQ ID NO: 42), LCDR2 (EDNQRPS, SEQ ID NO: 75), and LCDR3 (QSYDYKSVV, SEQ ID NO: 49). In one embodiment, the scFv comprises a VH region comprising the amino acid sequence set forth in SEQ ID NO: 30 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 25. In another embodiment, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 17 or is encoded by a nucleic acid comprising the nucleotide sequence set forth in SEQ ID NO: 9.
[0148] In another embodiment, the scFv comprises a VH region comprising an HCDR1 (GFTFSSYA, SEQ ID NO: 32). HCDR2 (SGSGGS, SEQ ID NO: 33), and HCDR3 (GSFHQSSIVAFDI, SEQ ID NO: 50); and a VL region comprising an LCDR1 (SSGSIASNY, SEQ ID NO: 42), LCDR2 (EDNQRPS, SEQ ID NO: 40), and LCDR3 (QSYDHLMKVV, SEQ ID NO: 51). In one embodiment, the scFv comprises a VH region comprising the amino acid sequence set forth in SEQ ID NO: 31 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 26. In another embodiment, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 18 or is encoded by a nucleic acid comprising the nucleotide sequence set forth in SEQ ID NO: 10.
[0149] In another embodiment, the scFv comprises a VH region comprising an HCDR1 (GFTFSHYA, SEQ ID NO: 78), HCDR2 (SGDGGD, SEQ ID NO: 79), and HCDR3 (GAWVYSYGELSAFDI, SEQ ID NO: 38); and a VL region comprising an LCDR1 (SRGSIARNY, SEQ ID NO: 80), LCDR2 (EDNQRPS. SEQ ID NO: 40), and LCDR3 (QSYDMEAKTVV. SEQ ID NO: 81). In one embodiment, the scFv comprises a VH region comprising the amino acid sequence set forth in SEQ ID NO: 76 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 77. In another embodiment, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 75.
[0150] In another embodiment, the scFv comprises a VH region comprising an HCDR1 (GFTFAHYA, SEQ ID NO: 86), HCDR2 (SGDGGT, SEQ ID NO: 87), and HCDR3 (GAWVYSYGELSAFDI, SEQ ID NO: 38); and a VL region comprising an LCDR1 (SRGSIAGNY, SEQ ID NO: 88), LCDR2 (EDNQRPS, SEQ ID NO: 40), and LCDR3 (QSYDNDTGTVV, SEQ ID NO: 89). In one embodiment, the scFv comprises a VH region comprising the amino acid sequence set forth in SEQ ID NO: 84 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 85. In another embodiment, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 83.
[0151] In another embodiment, the scFv comprises a VH region comprising the HCDR1 (GFTFSHYA, SEQ ID NO: 78). HCDR2 (SGDGGD. SEQ ID NO: 79), and HCDR3 (GVWVYSYGELS AFDI, SEQ ID NO: 94); and a VL region comprising the LCDR1 (SHGSIARNY, SEQ ID NO: 95), LCDR2 (EDNQRPS, SEQ ID NO: 40), and LCDR3 (QSYDNDTDTVV, SEQ ID NO: 96). In one embodiment, the scFv comprises a VH region comprising the amino acid sequence set forth in SEQ ID NO: 92 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 93. In another embodiment, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 91.
[0152] In another embodiment, the scFv comprises a VH region comprising the HCDR1 (GFTFSHYA, SEQ ID NO: 78). HCDR2 (SGDGGD. SEQ ID NO: 79), and HCDR3 (GAWVYSYGELAAFDI. SEQ ID NO: 100); and a VL region compnsing the LCDR1 (SHGSIARNY, SEQ ID NO: 95), LCDR2 (EDNQRPS, SEQ ID NO: 40), and LCDR3 (QSYDNDTDTVV, SEQ ID NO: 96). In one embodiment, the scFv comprises a VH region comprising the amino acid sequence set forth in SEQ ID NO: 99 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 93. In another embodiment, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 98. In another embodiment, the scFv comprises a Vn region comprising the HCDR1 (GFTFSHYA, SEQ ID NO: 78). HCDR2 (SGDGGD. SEQ ID NO: 79), and HCDR3 (AAWVYSYGELSAFDI, SEQ ID NO: 104); and a VL region compnsing the LCDR1 (SHGSIARNY, SEQ ID NO: 95), LCDR2 (EDNQRPS, SEQ ID NO: 40), and LCDR3 (QSYDNDTDTVV, SEQ ID NO: 96). In one embodiment, the scFv comprises a VH region comprising the amino acid sequence set forth in SEQ ID NO: 103 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 93. In another embodiment, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 102.
[0153] In another embodiment, the scFv comprises a Vn region comprising the HCDR1 (GFTFSHYA, SEQ ID NO: 78), HCDR2 (SGDGGD, SEQ ID NO: 79), and HCDR3 (HAWVYSYGELSAFDI, SEQ ID NO: 108); and a VL region comprising the LCDR1 (SHGSIARNY, SEQ ID NO: 95), LCDR2 (EDNQRPS, SEQ ID NO: 40), and LCDR3 (QSYDNDTDTVV, SEQ ID NO: 96). In one embodiment, the scFv comprises a Vn region comprising the amino acid sequence set forth in SEQ ID NO: 107 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 93. In another embodiment, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 106.
[0154] In another embodiment, the scFv comprises a Vn region comprising the HCDR1 (GFTFSHYA, SEQ ID NO: 78), HCDR2 (SGDGGD, SEQ ID NO: 79), and HCDR3 (GAWVYSYGELTAFDI, SEQ ID NO: 112); and a VL region comprising the LCDR1 (SHGSIARNY, SEQ ID NO: 95), LCDR2 (EDNQRPS. SEQ ID NO: 40), and LCDR3 (QSYDNDTDTVV, SEQ ID NO: 96). In one embodiment, the scFv comprises a Vn region comprising the amino acid sequence set forth in SEQ ID NO: 111 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 93. In another embodiment, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 110.
[0155] In another embodiment, the scFv comprises a VH region comprising the HCDR1 (GFTFNNYA, SEQ ID NO: 117), HCDR2 (SGDGGD, SEQ ID NO: 118), and HCDR3 (GAWVYSYGELSAFDI, SEQ ID NO: 38); and a VL region comprising the LCDR1 (SHGSIASNY, SEQ ID NO: 119), LCDR2 (EDNQRPS, SEQ ID NO: 40), and LCDR3 (QSYDNDSQTVV, SEQ ID NO: 120). In one embodiment, the scFv comprises a VH region comprising the amino acid sequence set forth in SEQ ID NO: 1 15 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 116. In another embodiment, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 114.
[0156] In another embodiment, the scFv comprises a VH region comprising the HCDR1 (GFTFNNYA, SEQ ID NO: 117), HCDR2 (SGDGGD, SEQ ID NO: 118), and HCDR3 (HAWVYSYGELSAFDI, SEQ ID NO: 108); and a VL region comprising the LCDR1 (STGSIAANY, SEQ ID NO: 125), LCDR2 (EDNQRPS, SEQ ID NO: 40). and LCDR3 (QSYDNTLATVV, SEQ ID NO: 126). In one embodiment, the scFv comprises a VH region comprising the amino acid sequence set forth in SEQ ID NO: 123 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 124. In another embodiment, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 122.
[0157] In another embodiment, the scFv comprises a VH region comprising the HCDR1 (GFTFSHYA, SEQ ID NO: 78), HCDR2 (SGDGGD, SEQ ID NO: 79), and HCDR3 (HAWVYSYGELVAFDI, SEQ ID NO: 129); and a VL region comprising the LCDR1 (SHGSIARNY, SEQ ID NO: 95), LCDR2 (EDNQRPS. SEQ ID NO: 40), and LCDR3 (QSYDNDTDTVV, SEQ ID NO: 96). In one embodiment, the scFv comprises a VH region comprising the amino acid sequence set forth in SEQ ID NO: 128 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 93. In another embodiment, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 231.
[0158] In another embodiment, the scFv comprises a VH region comprising the HCDR1 (GFTFNNYA, SEQ ID NO: 117), HCDR2 (SGDGGS, SEQ ID NO: 133), and HCDR3 (GAWVYSYGELTAFDI, SEQ ID NO: 134); and a VL region comprising the LCDR1 (SHGSIASNY, SEQ ID NO: 119), LCDR2 (EDNQRPS, SEQ ID NO: 40), and LCDR3 (QSYDNDSQTVV, SEQ ID NO: 120). In one embodiment, the scFv comprises a VH region comprising the amino acid sequence set forth in SEQ ID NO: 132 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 1 16. In another embodiment, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 131.
[0159] In another embodiment, the scFv comprises a VH region comprising the HCDR1 (GFTFSHYA, SEQ ID NO: 78). HCDR2 (SGDGGD. SEQ ID NO: 79), and HCDR3 (GAWVYSYGELSAFDI, SEQ ID NO: 38); and a VL region comprising the LCDR1 (SHGSIARNY, SEQ ID NO: 95), LCDR2 (EDNQRPS, SEQ ID NO: 40), and LCDR3 (QSYDNDTDTVV, SEQ ID NO: 96). In one embodiment, the scFv comprises a VH region comprising the amino acid sequence set forth in SEQ ID NO: 137 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 93. In another embodiment, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 136.
[0160] In another embodiment, the scFv comprises a VH region comprising the HCDR1 (GFTFNNYA, SEQ ID NO: 117), HCDR2 (SGDGGN, SEQ ID NO: 118), and HCDR3 (SAWVYSYGELSAFDI, SEQ ID NO: 142); and a VL region comprising the LCDR1 (SHGSIARNY, SEQ ID NO: 95), LCDR2 (EDNQRPS, SEQ ID NO: 40), and LCDR3 (QSYDNSQGTVV, SEQ ID NO: 143). In one embodiment, the scFv comprises a VH region comprising the amino acid sequence set forth in SEQ ID NO: 140 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 141. In another embodiment, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 139.
[0161] In another embodiment, the scFv comprises a VH region comprising the HCDR1 (GFTFNNYA, SEQ ID NO: 117), HCDR2 (SGDGGS, SEQ ID NO: 133), and HCDR3 (HAWVYSYGELSAFDE SEQ ID NO: 108); and a VL region comprising the LCDR1 (SHGSIASNY, SEQ ID NO: 119), LCDR2 (EDNQRPS, SEQ ID NO: 40), and LCDR3 (QSYDNDSQTVV, SEQ ID NO: 120). In one embodiment, scFv comprises a VH region comprising the amino acid sequence set forth in SEQ ID NO: 146 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 116. In another embodiment, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 145.
[0162] In another embodiment, the scFv comprises a VH region comprising the HCDR1 (GFTFNNYA, SEQ ID NO: 117), HCDR2 (SGDGGN, SEQ ID NO: 118), and HCDR3 (GVWVYSYGELSAFDI, SEQ ID NO: 94); and a VL region comprising the LCDR1 (SRGSIARNY, SEQ ID NO: 80), LCDR2 (EDNQRPS, SEQ ID NO: 40), and LCDR3 (QSYDNEEQTVV, SEQ ID NO: 151). In one embodiment, the scFv comprises a VH region comprising the amino acid sequence set forth in SEQ ID NO: 149 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 150. In another embodiment, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 148.
[0163] In another embodiment, the scFv comprises a VH region comprising the HCDR1 (GFTFSSYA, SEQ ID NO: 32), HCDR2 (SGSGGS, SEQ ID NO: 33), and HCDR3 (GAWVYSYGELSAFDI, SEQ ID NO: 38); and a VL region comprising the LCDR1 (SSGSIASNYV. SEQ ID NO: 39), LCDR2 (EDNQRPS, SEQ ID NO: 40). and LCDR3 (QSYDDAGEVV, SEQ ID NO: 151). In one embodiment, the scFv comprises a VH region comprising the amino acid sequence set forth in SEQ ID NO: 28 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 214. In another embodiment, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 216.
[0164] Bispecific Antibodies
[0165] The present invention also encompasses bispecific antibodies. A bispecific antibody comprises two different binding specificities and thus binds to two different antigens. In such an embodiment, the bispecific antibody comprises a first antigen binding domain that binds to a first antigen and a second antigen binding domain that binds to a second antigen. The bispecific antibody may specifically bind to more than one epitope on the same target, such as a cell or receptor, or to more than one epitope on different targets. In another embodiment, the bispecific antibody comprises a bispecific antigen binding domain.
[0166] In some embodiments, an mKRAS binding domain described herein is conjugated or fused to a second antigen binding domain to form a bispecific antibody, such as a tandem bispecific antibody. In certain embodiments, the mKRAS binding domain is conjugated or fused to an immune-cell engaging binding domain from an immune cell engager. As used herein, the term ‘'immune cell engager” (sometimes referred to as an '‘engager”) refers to a molecule, e.g., a fusion polypeptide, which is capable of forming a link between an immune cell, e.g., a T cell, a NK cell, a NKT cell, a B cell, a macrophage, a neutrophil) and a tumor cell; and activating the immune cell. Examples of engagers include, but are not limited to, bispecific T cell engagers (BiTEs), bi-specific killer cell engagers (BiKEs), tri-specific killer cell engagers, or multi-specific killer cell engagers, or universal engagers compatible with multiple immune cell ty pes. Further as used herein, an immune cell engager that binds to a T cell is referred to as a “T cell engager.”
[0167] In some embodiments, the bispecific antibody or T-cell engager antibody has specificity for at least one antigen on a T cell. The T cell antigen includes an antigen found on the surface of a T cell. The T cell antigen may include a co-stimulatory molecule as described elsewhere herein. In one embodiment, the T cell antigen is CD3, CD4, CD8, T cell receptor (TCR), or any fragment thereof. In this embodiment, the bispecific antibody comprises an antibody that specifically binds to the T cell antigen. Examples of the bispecific antibody may include anti-CD3, anti-CD4, anti-CD8, anti -TCR, anti-IgD Fc, antiIgA Fc, any fragment thereof, and any combination thereof. The other target antigen of the bispecific antibody could also be a T cell antigen such as CD3, CD4, CD8, TCR. or any fragment thereof.
[0168] In certain embodiments, the immune cell engager binds specifically to proteins on T- cells, including but not limited to CD3, CD4, CD8, TCR, or any fragment thereof. In other embodiments, the immune cell engager is an NK-cell engager that binds specifically to proteins on NK cells including but not limited to CD56. CD 16. NKG2D. or any fragment thereof.
[0169] In an embodiment, an mKRAS bispecific antibody recognizes a T cell antigen and is referred to as a bispecific T cell engager (BiTE) configured as a tandem bispecific antibody comprising a first antigen binding domain (e.g., mKRAS scFv) and a second antigen binding domain (e.g., T-cell binding scFv) wherein the first scFv is capable of binding mKRAS on a tumor cell and the second scFv is capable of binding T cell antigen (e.g., CD3, CD4, CD8, or TCR). In one embodiment, the bispecific antibody is tandem bispecific antibody in which the second antigen binding domain is an anti-CD3 epsilon (CD3e) scFv. In certain embodiments, the anti-CD3e scFv comprises the amino acid sequence set forth in SEQ ID NO: 206.
[0170] The present invention should not be construed to be limited to any particular bispecific antibody. Rather, any bispecific antibody is useful in the present invention. The bispecific antibody may be constructed from or include a synthetic antibody, a human antibody, a humanized antibody, a single chain variable fragment (scFv), a single domain antibody, an antigen binding fragment thereof, and any combination thereof. In one embodiment, the bispecific antibody is constructed by linking two different antibodies, or portions thereof, such as Fab, F(ab')2, Fab’, scFv, and sdAb from two different antibodies. Techniques for making human and humanized antibodies and antibody fragments, such as a scFv, are also described elsewhere herein. In another embodiment, the bispecific antibody comprises an antigen binding domain comprising a first and a second single chain variable fragment (scFv) molecule.
[0171] Techniques for engineering and expressing bispecific antibodies include, but are not limited to, recombinant co-expression of two immunoglobulin heavy chain-light chain pairs having different specificities (see Milstein and Cuello, Nature 305: 537 (1983), WO 93 / 08829, and Traunecker et al., EMBO J. 10: 3655 (1991)), and “knob-in-hole’' engineering (see, e.g.. U.S. Pat. No. 5,731.168). Multi-specific antibodies may also be made by engineering electrostatic steering effects for making antibody Fc-heterodimeric molecules (WO 2009 / 089004A1); cross-linking two or more antibodies or fragments (see, e.g., U.S. Pat. No. 4,676,980, and Brennan et al., Science 229:81 (1985)); using leucine zippers to produce bispecific antibodies (see, e.g.. Kostelny et al., J. Immunol. 148(5): 1547-1553 (1992)); using “diabody” technology for making bispecific antibody fragments (see, e.g., Hollinger et al.. Proc. Natl. Acad. Sci. USA, 90:6444-6448 (1993)); and using single-chain Fv (scFv) dimers (see, e.g., Gruber et al., J. Immunol., 152:5368 (1994)); and preparing trispecific antibodies as described, e.g., in Tutt et al. J. Immunol. 147: 60 (1991). Engineered antibodies with three or more functional antigen binding sites, including “Octopus antibodies,” are also included herein (see, e.g., US 2006 / 0025576A1).
[0172] In some embodiments, the bispecific antibody may be expressed and secreted by the cell. When the cell expresses the bispecific antibody, a nucleic acid sequence encoding the bispecific antibody may be introduced into the cell. The nucleic acid sequence may be introduced by any method described elsewhere herein or other methods known in the art. Exemplary nucleic acid and amino acid sequences described herein are described in
[0173] Table 1.
[0174] Table 1. Exemplary nucleic acid and amino sequences.
[0175]
[0176]
[0177]
[0178]
[0179]
[0180]
[0181]
[0182]
[0183]
[0184]
[0185]
[0186] Chimeric Antigen Receptors
[0187] In another aspect, the present invention provides a chimeric antigen receptor (CAR) that binds specifically to the KRAS G12V epitope presented in the context of an HL A complex, comprising e.g., HLA A* 11 or HLA A*2. A CAR of the present disclosure can be prepared using an antigen binding fragment (e.g, scFv) having one or more of the VH and / or VL sequences or any fragments thereof disclosed herein as a starting material to engineer a modified CAR having altered properties as compared with the starting scFv or antibody or antigen-binding fragment thereof.
[0188] In one embodiment, the CAR construct comprises an antigen binding domain, a transmembrane domain, and an intracellular signaling domain. In certain embodiments, the antigen-binding domain comprises an scFv comprising an amino acid sequence set forth in SEQ ID NOs: 11-18, 75, 83, 91, 98, 102, 106, 110, 114, 122, 231, 131, 136, 139, 145, 148, or 216.
[0189] A subject CAR of the invention comprises an antigen binding domain (e.g., mKRAS binding domain), a transmembrane domain, a costimulatory signaling domain, and an intracellular signaling domain. A subject CAR of the invention may optionally comprise a hinge domain. Accordingly, a subject CAR of the invention comprises an antigen binding domain (e.g. mKRAS binding domain), a hinge domain, a transmembrane domain, a costimulatory signaling domain, and an intracellular signaling domain. In some embodiments, each of the domains of a subject CAR is separated by a linker.
[0190] The antigen binding domain may be operably linked to another domain of the CAR, such as the transmembrane domain, the costimulatory signaling domain or the intracellular signaling domain, each described elsewhere herein, for expression in the cell. In one embodiment, a first nucleic acid sequence encoding the antigen binding domain is operably linked to a second nucleic acid encoding a transmembrane domain, and further operably linked to a third a nucleic acid sequence encoding a costimulalory signaling domain.
[0191] The antigen binding domains described herein, including antibodies or antigenbinding fragments thereof, scFvs, and the like, can be combined with any of the transmembrane domains, any of the costimulatory signaling domains, any of the intracellular signaling domains, or any of the other domains described herein that may be included in a CAR of the present invention.
[0192] In one aspect, the invention includes a chimeric antigen receptor (CAR) that specifically binds an epitope of mutant KRAS, comprising: a mKRAS-specific antigen binding domain, optionally a hinge domain, a transmembrane domain, a costimulatory signaling domain, and an intracellular signaling domain.
[0193] In one aspect, the invention includes a chimeric antigen receptor (CAR) that specifically binds an epitope of mutant KRAS, comprising: a mKRAS-specific antigen binding domain, optionally a hinge domain, a transmembrane domain, and an intracellular signaling domain.
[0194] In one exemplary embodiment, the invention includes a chimeric antigen receptor (CAR) that specifically binds mKRAS, comprising: a mKRAS-specific antigen binding domain comprising a heavy chain variable (Vn) domain and a light chain variable (VL) domain, wherein the VH domain comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 27-34. 76. 84, 92, 99, 103, 107. I l l, 115. 123, 128, 132, 137, 140, 146, 149, and 28; and wherein the Vi. domain comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 19-26, 67, 77, 85, 93, 116, 124, 141, 150, and 214; a transmembrane domain; and an intracellular domain comprising a costimulatory domain and a signaling domain. In some embodiments, the CAR further comprises an optional hinge region and / or a signaling domain comprising at least one costimulatory signaling domain, and an intracellular signaling domain
[0195] In other embodiments, the antigen binding domain of the CAR is encoded by a nucleic acid sequence comprising the nucleotide sequence of any one of SEQ ID NOs: 3-10. In certain embodiments, the antigen-binding domain of the CAR comprises the amino acid sequence set forth in any one of SEQ ID NOs: 11-18, 75, 83, 91, 98, 102, 106, 110, 114, 122, 231, 131. 136, 139, 145, 148, or 216.
[0196] A subject mKRAS CAR may further comprise a leader sequence (i.e., signal peptide sequence) comprising, e.g., a CD8a leader sequence comprising an amino acid sequence set forth in SEQ ID NO: 52 or an IL-12 leader sequence comprising an amino acid sequence set forth in SEQ ID NO: 230. A subject mKRAS CAR may further comprise a CD8a hinge domain comprising, e.g., the amino acid sequence set forth in SEQ ID NO: 53. A subject mKRAS CAR may further comprise a transmembrane domain comprising, e.g., a CD8a transmembrane domain comprising the amino acid sequence set forth in SEQ ID NO: 54. A subject mKRAS CAR may further comprise a costimulatory domain, such as 4-1BB and / or CD28 costimulatory domains comprising the amino acid sequences set forth in SEQ ID NOs: 55 and 56, respectively. A subject mKRAS CAR may further comprise a signaling domain, such as a CD3zeta signaling domain comprising the amino acid sequence set forth in SEQ ID NO: 57.
[0197] Nucleic acid and amino acid sequences directed to CARs and their individual domains are described in Table 1.
[0198] Antigen Binding Domain
[0199] The antigen binding domain of a CAR is an extracellular region of the CAR for binding to a specific target antigen including proteins, carbohydrates, and glycolipids. In some embodiments, the CAR comprises affinity to a target antigen (e.g, a tumor associated antigen) on a target cell (e.g., a cancer cell). The target antigen may include any type of protein, or epitope thereof, associated with the target cell. For example, the CAR may comprise affinity to a target antigen on a target cell that indicates a particular status of the target cell. In certain embodiments, the CAR of the invention comprises an antigen binding domain that binds to an epitope derived from mutant KRAS protein (mKRAS) presented in the context of HLA A*11 or A*2 complexes. In certain exemplary embodiments, the antigen binding domain is an scFv antibody that binds to an epitope of mKRAS. The choice of antigen binding domain depends upon the ty pe and number of antigens that are present on the surface of a target cell. For example, the antigen binding domain may be chosen to recognize an antigen that acts as a cell surface marker on a target cell associated with a particular status of the target cell.
[0200] As described herein, a CAR of the present disclosure having affinity for a specific target antigen on a target cell may comprise a target-specific binding domain. In some embodiments, the target-specific binding domain is a human target-specific binding domain. e.g.. the target-specific binding domain is of human origin. In an exemplary embodiment, a CAR of the present disclosure having affinity for an epitope of mKRAS on a target cell may comprise a mKRAS binding domain.
[0201] The antigen binding domain can include any domain that binds to the antigen and may include, but is not limited to. a monoclonal antibody, a polyclonal antibody, a synthetic antibody, a human antibody, a humanized antibody, a non-human antibody, and any fragment thereof. Thus, in one embodiment, the antigen binding domain portion comprises a mammalian antibody or a fragment thereof. In another embodiment, the antigen binding domain of the CAR is selected from the group consisting of an anti-mKRAS antibody and a fragment thereof. In some embodiments, the antigen binding domain is selected from the group consisting of an antibody, an antigen binding fragment (Fab), a single-chain variable fragment (scFv), and a single domain antibody (sdAb). In some embodiments, a mKRAS binding domain of the present invention is selected from the group consisting of a mKRAS- specific antibody, a mKRAS-specific Fab, and a mKRAS-specific scFv. In one embodiment, a mKRAS binding domain is a mKRAS-specific scFv.
[0202] As used herein, the term “single-chain variable fragment” or “scFv” is a fusion protein of the variable regions of the heavy (VH) and light chains (VL) of an immunoglobulin (e.g., mouse or human) covalently linked to form a VH: VL heterodimer. The heavy (VH) and light chains (VL) are either joined directly or joined by a peptide-encoding linker or spacer, which connects the N-terminus of the VH with the C-terminus of the VL, or the C-terminus of the VH with the N-terminus of the VL. The terms “linker” and “spacer” are used interchangeably herein. In some embodiments, the antigen binding domain (e.g., mKRAS binding domain) comprises an scFv having the configuration from N-terminus to C-terminus, VH - linker - VL. In some embodiments, the antigen binding domain (e.g., mKRAS binding domain) comprises an scFv having the configuration from N-terminus to C-terminus, VL - linker - VH. Those of skill in the art would be able to select the appropriate configuration for use in the present invention.
[0203] In some embodiments, the mKRAS binding domain is derived from an scFv specific for human mKRAS as disclosed elsewhere herein. Accordingly, a CAR of the present disclosure comprises a mKRAS binding domain derived from an scFv disclosed elsewhere herein.
[0204] As used herein, “Fab” refers to a fragment of an antibody structure that binds to an antigen but is monovalent and does not have a Fc portion, for example, an antibody digested by the enzyme papain yields two Fab fragments and an Fc fragment (e.g.. a heavy (H) chain constant region; Fc region that does not bind to an antigen).
[0205] As used herein, “F(ab')2” refers to an antibody fragment generated by pepsin digestion of whole IgG antibodies, wherein this fragment has two antigen binding (ab') (bivalent) regions, wherein each (ab') region comprises two separate amino acid chains, a part of a H chain and a light (L) chain linked by an S — S bond for binding an antigen and where the remaining H chain portions are linked together. A “F(ab')2” fragment can be split into two individual Fab' fragments.
[0206] In one embodiment, the mKRAS binding domain comprises a light chain variable (VL) region comprising an amino acid sequence set forth in SEQ ID NOs: 19-26. 67. 77. 85, 93, 116, 124, 141 , 150, or 214; and / or a heavy chain variable (VH) region comprising an amino acid sequence set forth in any one of SEQ ID NOs: 27-34, 107, 117, 127, 137, 147, 157, 167, 177, 187, 197, 207, 217, 227, 237, 247, or 318.
[0207] In another embodiment, the mKRAS binding domain comprises a heavy chain variable (VH) region comprising an HCDR1 of SEQ ID NO: 32, an HCDR2 of SEQ ID NO: 33, and an HCDR3 of SEQ ID NO: 34; and a light chain variable (VL) region comprising an LCDR1 of SEQ ID NO: 35, an LCDR2 of SEQ ID NO: 36, and an LCDR3 of SEQ ID NO: 37. In some embodiments, the mKRAS binding domain comprises a VH region comprising the amino acid sequence of SEQ ID NO: 27 and a VL region comprising the amino acid sequence of SEQ ID NO: 19. In another embodiment, the mKRAS binding domain is an scFv comprising the amino acid sequence set forth in SEQ ID NO: 11 or encoded by a nucleic acid comprising the nucleotide sequence set forth in SEQ ID NO: 3.
[0208] In another embodiment, the mKRAS binding domain comprises a VH region comprising an HCDR1 of SEQ ID NO: 32, an HCDR2 of SEQ ID NO: 33, and an HCDR3 of SEQ ID NO: 38; and a VL region comprising an LCDR1 of SEQ ID NO: 39, an LCDR2 of SEQ ID NO: 40, and an LCDR3 of SEQ ID NO: 41. In some embodiments, the mKRAS binding domain comprises a VH region comprising the amino acid sequence of SEQ ID NO: 28 and a VL region comprising the amino acid sequence of SEQ ID NO: 20. In another embodiment, the mKRAS binding domain is an scFv comprising the amino acid sequence set forth in SEQ ID NO: 12 or encoded by a nucleic acid comprising the nucleotide sequence set forth in SEQ ID NO: 4.
[0209] In another embodiment, the mKRAS binding domain comprises a VH region comprising an HCDR1 of SEQ ID NO: 32, an HCDR2 of SEQ ID NO: 33, and an HCDR3 of SEQ ID NO: 38; and a VL region comprising an LCDR1 of SEQ ID NO: 42, an LCDR2 of SEQ ID NO: 40, and an LCDR3 of SEQ ID NO: 43. In some embodiments, the mKRAS binding domain comprises a VH region comprising the amino acid sequence of SEQ ID NO: 28 and a VL region comprising the amino acid sequence of SEQ ID NO: 21. In another embodiment, the mKRAS binding domain is an scFv comprising the amino acid sequence set forth in SEQ ID NO: 13 or encoded by a nucleic acid comprising the nucleotide sequence set forth in SEQ ID NO: 5.
[0210] In another embodiment, the mKRAS binding domain comprises a VH region comprising an HCDR1 of SEQ ID NO: 32, an HCDR2 of SEQ ID NO: 33, and an HCDR3 of SEQ ID NO: 38; and a VL region comprising an LCDR1 of SEQ ID NO: 42, an LCDR2 of SEQ ID NO: 40. and an LCDR3 of SEQ ID NO: 44. In some embodiments, the mKRAS binding domain comprises a VH region comprising the amino acid sequence of SEQ ID NO:
[0211] 28 and a VL region comprising the amino acid sequence of SEQ ID NO: 22. In another embodiment, the mKRAS binding domain is an scFv comprising the amino acid sequence set forth in SEQ ID NO: 14 or encoded by a nucleic acid comprising the nucleotide sequence set forth in SEQ ID NO: 6.
[0212] In another embodiment, the mKRAS binding domain comprises a VH region comprising an HCDR1 of SEQ ID NO: 32, an HCDR2 of SEQ ID NO: 33, and an HCDR3 of SEQ ID NO: 45; and a VL region comprising an LCDR1 of SEQ ID NO: 42, an LCDR2 of SEQ ID NO: 40. and an LCDR3 of SEQ ID NO: 46. In some embodiments, the mKRAS binding domain comprises a VH region comprising the amino acid sequence of SEQ ID NO:
[0213] 29 and a VL region comprising the amino acid sequence of SEQ ID NO: 23. In another embodiment, the mKRAS binding domain is an scFv comprising the amino acid sequence set forth in SEQ ID NO: 15 or encoded by a nucleic acid comprising the nucleotide sequence set forth in SEQ ID NO: 7. In another embodiment, the mKRAS binding domain comprises a VH region comprising an HCDR1 of SEQ ID NO: 32, an HCDR2 of SEQ ID NO: 33, and an HCDR3 of SEQ ID NO: 45; and a VL region comprising an LCDR1 of SEQ ID NO: 42, an LCDR2 of SEQ ID NO: 40, and an LCDR3 of SEQ ID NO: 47. In some embodiments, the mKRAS binding domain comprises a VH region comprising the amino acid sequence set forth in SEQ ID NO: 29 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 24. In another embodiment, the mKRAS binding domain is an scFv comprising the amino acid sequence set forth in SEQ ID NO: 16 or encoded by a nucleic acid comprising the nucleotide sequence set forth in SEQ ID NO: 8.
[0214] In another embodiment, the mKRAS binding domain comprises a VH region comprising an HCDR1 of SEQ ID NO: 32, an HCDR2 of SEQ ID NO: 33. and an HCDR3 of SEQ ID NO: 48; and a Vi. region comprising an LCDR1 of SEQ ID NO: 42, an LCDR2 of SEQ ID NO: 40, and an LCDR3 of SEQ ID NO: 49. In some embodiments, the mKRAS binding domain comprises a VH region comprising the amino acid sequence set forth in SEQ ID NO: 30 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 25. In another embodiment, the mKRAS binding domain is an scFv comprising the amino acid sequence set forth in SEQ ID NO: 17 or encoded by a nucleic acid comprising the nucleotide sequence set forth in SEQ ID NO: 9
[0215] In another embodiment, the mKRAS binding domain comprises a VH region comprising an HCDR1 of SEQ ID NO: 32, an HCDR2 of SEQ ID NO: 33. and an HCDR3 of SEQ ID NO: 50; and a VL region comprising an LCDR1 of SEQ ID NO: 42, an LCDR2 of SEQ ID NO: 40, and an LCDR3 of SEQ ID NO: 51. In some embodiments, the mKRAS binding domain comprises a VH region comprising the amino acid sequence of SEQ ID NO: 31 and a VL region comprising the amino acid sequence of SEQ ID NO: 26. In another embodiment, the mKRAS binding domain is an scFv comprising the amino acid sequence set forth in SEQ ID NO: 18 or encoded by a nucleic acid comprising the nucleotide sequence set forth in SEQ ID NO: 10.
[0216] In another embodiment, the mKRAS binding domain comprises a VH region comprising an HCDR1 of SEQ ID NO: 78, an HCDR2 of SEQ ID NO: 79. and an HCDR3 of SEQ ID NO: 38; and a VL region comprising an LCDR1 of SEQ ID NO: 80, an LCDR2 of SEQ ID NO: 40, and an LCDR3 of SEQ ID NO: 81. In another embodiment, the mKRAS binding domain is an scFv comprising the amino acid sequence set forth in SEQ ID NO: 76 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 77. In one embodiment, the mKRAS binding domain comprises an scFv comprising the amino acid sequence set forth in SEQ ID NO: 75.
[0217] In another embodiment, the mKRAS binding domain comprises a VH region comprising an HCDR1 of SEQ ID NO: 86, an HCDR2 of SEQ ID NO: 87, and an HCDR3 of SEQ ID NO: 38; and a VL region comprising an LCDR1 of SEQ ID NO: 88, an LCDR2 of SEQ ID NO: 40, and an LCDR3 of SEQ ID NO: 89. In some embodiments, the mKRAS binding domain comprises a VH region comprising the ammo acid sequence set forth in SEQ ID NO: 84 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 85. In one embodiment, the mKRAS binding domain comprises an scFv comprising the amino acid sequence set forth in SEQ ID NO: 83.
[0218] In another embodiment, the mKRAS binding domain comprises a VH region comprising an HCDR1 of SEQ ID NO: 78, an HCDR2 of SEQ ID NO: 79, and an HCDR3 of SEQ ID NO: 94; and a VL region comprising an LCDR1 of SEQ ID NO: 95, an LCDR2 of SEQ ID NO: 40, and an LCDR3 of SEQ ID NO: 96. In some embodiments, the mKRAS binding domain comprises a VH region comprising the amino acid sequence set forth in SEQ ID NO: 92 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 93. In one embodiment, the mKRAS binding domain comprises an scFv comprising the amino acid sequence set forth in SEQ ID NO: 91.
[0219] In another embodiment, the mKRAS binding domain comprises a VH region comprising an HCDR1 of SEQ ID NO: 78, an HCDR2 of SEQ ID NO: 79. and an HCDR3 of SEQ ID NO: 100; and a VL region comprising an LCDR1 of SEQ ID NO: 95, an LCDR2 of SEQ ID NO: 40, and an LCDR3 of SEQ ID NO: 96. In some embodiments, the mKRAS binding domain comprises a VH region comprising the amino acid sequence set forth in SEQ ID NO: 99 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 93. In one embodiment, the mKRAS binding domain comprises an scFv comprising the amino acid sequence set forth in SEQ ID NO: 98.
[0220] In another embodiment, the mKRAS binding domain comprises a VH region comprising an HCDR1 of SEQ ID NO: 78, an HCDR2 of SEQ ID NO: 79, and an HCDR3 of SEQ ID NO: 104; and a VL region comprising an LCDR1 of SEQ ID NO: 95, an LCDR2 of SEQ ID NO: 40, and an LCDR3 of SEQ ID NO: 96. In some embodiments, the mKRAS binding domain comprises a VH region comprising the amino acid sequence set forth in SEQ ID NO: 103 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 93. In one embodiment, the mKRAS binding domain comprises an scFv comprising the amino acid sequence set forth in SEQ ID NO: 102. In another embodiment, the mKRAS binding domain comprises a VH region comprising an HCDR1 of SEQ ID NO: 78, an HCDR2 of SEQ ID NO: 79, and an HCDR3 of SEQ ID NO: 108; and a VL region comprising an LCDR1 of SEQ ID NO: 95, an LCDR2 of SEQ ID NO: 40, and an LCDR3 of SEQ ID NO: 96. In some embodiments, the mKRAS binding domain comprises a VH region comprising the amino acid sequence set forth in SEQ ID NO: 107 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 93. In one embodiment, the mKRAS binding domain comprises an scFv comprising the amino acid sequence set forth in SEQ ID NO: 106.
[0221] In another embodiment, the mKRAS binding domain comprises a VH region comprising an HCDR1 of SEQ ID NO: 78, an HCDR2 of SEQ ID NO: 79, and an HCDR3 of SEQ ID NO: 112; and a VL region comprising an LCDR1 of SEQ ID NO: 95, an LCDR2 of SEQ ID NO: 40, and an LCDR3 of SEQ ID NO: 96. In some embodiments, the mKRAS binding domain comprises a VH region comprising the amino acid sequence set forth in SEQ ID NO: 111 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 93. In one embodiment, the mKRAS binding domain comprises an scFv comprising the amino acid sequence set forth in SEQ ID NO: 110.
[0222] In another embodiment, the mKRAS binding domain comprises a VH region comprising an HCDR1 of SEQ ID NO : 117, an HCDR2 of SEQ ID NO : 118, and an HCDR3 of SEQ ID NO: 38; and a VL region comprising an LCDR1 of SEQ ID NO: 119, an LCDR2 of SEQ ID NO: 40, and an LCDR3 of SEQ ID NO: 120. In some embodiments, the mKRAS binding domain comprises a VH region comprising the amino acid sequence set forth in SEQ ID NO: 115 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 116. In one embodiment, the mKRAS binding domain comprises an scFv comprising the amino acid sequence set forth in SEQ ID NO: 114.
[0223] In another embodiment, the mKRAS binding domain comprises a VH region comprising an HCDR1 of SEQ ID NO: 117, an HCDR2 of SEQ ID NO: 118, and an HCDR3 of SEQ ID NO: 108; and a VL region comprising an LCDR1 of SEQ ID NO: 125, an LCDR2 of SEQ ID NO: 40, and an LCDR3 of SEQ ID NO: 126. In some embodiments, the mKRAS binding domain comprises a VH region comprising the ammo acid sequence set forth in SEQ ID NO: 123 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 124. In one embodiment, the mKRAS binding domain comprises an scFv comprising the amino acid sequence set forth in SEQ ID NO: 122.
[0224] In another embodiment, the mKRAS binding domain comprises a VH region comprising an HCDR1 of SEQ ID NO: 78, an HCDR2 of SEQ ID NO: 79, and an HCDR3 of SEQ ID NO: 129; and a VL region comprising an LCDR1 of SEQ ID NO: 95, an LCDR2 of SEQ ID NO: 40, and an LCDR3 of SEQ ID NO: 96. In some embodiments, the mKRAS binding domain comprises a VH region comprising the amino acid sequence set forth in SEQ ID NO: 128 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 93. In one embodiment, the mKRAS binding domain comprises an scFv comprising the amino acid sequence set forth in SEQ ID NO: 231.
[0225] In another embodiment, the mKRAS binding domain comprises a VH region comprising an HCDR1 of SEQ ID NO: 117, an HCDR2 of SEQ ID NO: 133, and an HCDR3 of SEQ ID NO: 134; and a VL region comprising an LCDR1 of SEQ ID NO: 119, an LCDR2 of SEQ ID NO: 40, and an LCDR3 of SEQ ID NO: 120. In some embodiments, the mKRAS binding domain comprises a VH region comprising the amino acid sequence set forth in SEQ ID NO: 132 and a Vi. region comprising the amino acid sequence set forth in SEQ ID NO: 116. In one embodiment, the mKRAS binding domain comprises an scFv comprising the amino acid sequence set forth in SEQ ID NO: 131.
[0226] In another embodiment, the mKRAS binding domain comprises a VH region comprising an HCDR1 of SEQ ID NO: 78, an HCDR2 of SEQ ID NO: 79, and an HCDR3 of SEQ ID NO: 38; and a VL region comprising an LCDR1 of SEQ ID NO: 95, an LCDR2 of SEQ ID NO: 40, and an LCDR3 of SEQ ID NO: 96. In some embodiments, the mKRAS binding domain comprises a VH region comprising the amino acid sequence set forth in SEQ ID NO: 137 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 93. In one embodiment, the mKRAS binding domain comprises an scFv comprising the amino acid sequence set forth in SEQ ID NO: 136.
[0227] In another embodiment, the mKRAS binding domain comprises a VH region comprising an HCDR1 of SEQ ID NO: 117. an HCDR2 of SEQ ID NO: 118, and an HCDR3 of SEQ ID NO: 142; and a VL region comprising an LCDR1 of SEQ ID NO: 95, an LCDR2 of SEQ ID NO: 40, and an LCDR3 of SEQ ID NO: 143. In some embodiments, the mKRAS binding domain comprises a VH region comprising the amino acid sequence set forth in SEQ ID NO: 140 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 141. In one embodiment, the mKRAS binding domain comprises an scFv comprising the amino acid sequence set forth in SEQ ID NO: 139.
[0228] In another embodiment, the mKRAS binding domain comprises a VH region comprising an HCDR1 of SEQ ID NO: 117. an HCDR2 of SEQ ID NO: 133, and an HCDR3 of SEQ ID NO: 108; and a VL region comprising an LCDR1 of SEQ ID NO: 119, an LCDR2 of SEQ ID NO: 40, and an LCDR3 of SEQ ID NO: 120. In some embodiments, the mKRAS binding domain comprises a VH region comprising the amino acid sequence set forth in SEQ ID NO: 146 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 116. In one embodiment the mKRAS binding domain comprises an scFv comprising the amino acid sequence set forth in SEQ ID NO: 145.
[0229] In another embodiment, the mKRAS binding domain comprises a VH region comprising an HCDR1 of SEQ ID NO : 117. an HCDR2 of SEQ ID NO : 118, and an HCDR3 of SEQ ID NO: 94; and a VL region comprising an LCDR1 of SEQ ID NO: 80, an LCDR2 of SEQ ID NO: 40, and an LCDR3 of SEQ ID NO: 151. In some embodiments, the mKRAS binding domain comprises a VH region comprising the amino acid sequence set forth in SEQ ID NO: 149 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 150. In one embodiment, the mKRAS binding domain comprises an scFv comprising the amino acid sequence set forth in SEQ ID NO: 148.
[0230] In another embodiment, the mKRAS binding domain comprises a VH region comprising an HCDR1 of SEQ ID NO: 32, an HCDR2 of SEQ ID NO: 33, and an HCDR3 of SEQ ID NO: 38; and a VL region comprising an LCDR1 of SEQ ID NO: 39, an LCDR2 of SEQ ID NO: 40, and an LCDR3 of SEQ ID NO: 215. In some embodiments, the mKRAS binding domain comprises a VH region comprising the amino acid sequence set forth in SEQ ID NO: 28 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 214. In one embodiment, the mKRAS binding domain comprises an scFv comprising the amino acid sequence set forth in SEQ ID NO: 216.
[0231] Tolerable variations of the mKRAS binding domain will be known to those of skill in the art, while maintaining specific binding to mKRAS. For example, in some embodiments the mKRAS binding domain comprises an amino acid sequence that has at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to any of the amino acid sequences set forth in any one of SEQ ID NOs: 11-18, 75, 83, 91, 98, 102, 106, 110, 1 14, 122, 231, 131, 136, 139, 145, 148, or 216.
[0232] In some embodiments, the mKRAS binding domain is encoded by a nucleic acid sequence comprising the nucleotide sequence that has at least at least 90%. at least 91%. at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the nucleotide sequences and / or corresponding amino acid sequences described herein.
[0233] The antigen binding domain may be operably linked to another domain of the CAR, such as the transmembrane domain or the costimulatory signaling domain, both described elsewhere herein. In one embodiment, a nucleic acid encoding the antigen binding domain is operably linked to a nucleic acid encoding a transmembrane domain and a nucleic acid encoding a coslimulatory signaling domain.
[0234] The antigen binding domains described herein, such as the antibody or fragment thereof that binds to mKRAS, can be combined with any of the transmembrane domains described herein, any of the intracellular domains or cytoplasmic domains described herein, or any of the other domains described herein that may be included in the CAR.
[0235] Transmembrane Domain
[0236] With respect to the transmembrane domain, the CAR of the present invention (e.g, mKRAS CAR) can be designed to comprise a transmembrane domain that connects the antigen binding domain of the CAR to the intracellular domain. The transmembrane domain of a subject CAR is a region that is capable of spanning the plasma membrane of a cell (e.g., an immune cell or precursor thereof). The transmembrane domain is for insertion into a cell membrane, e.g., a eukaiyotic cell membrane. In some embodiments, the transmembrane domain is interposed between the antigen binding domain and the intracellular domain of a CAR.
[0237] In one embodiment, the transmembrane domain is naturally associated with one or more of the domains in the CAR. In some instances, the transmembrane domain can be selected or modified by amino acid substitution to avoid binding of such domains to the transmembrane domains of the same or different surface membrane proteins to minimize interactions with other members of the receptor complex.
[0238] The transmembrane domain may be derived either from a natural or from a synthetic source. Where the source is natural, the domain may be derived from any membrane-bound or transmembrane protein, e.g., a Type I transmembrane protein. Where the source is synthetic, the transmembrane domain may be any artificial sequence that facilitates insertion of the CAR into a cell membrane, e.g., an artificial hydrophobic sequence. Examples of the transmembrane regions of particular use in this invention include, without limitation, transmembrane domains derived from (i.e., comprise at least the transmembrane region(s) of) the alpha, beta or zeta chain of the T-cell receptor, CD28, CD2, CD3 epsilon, CD45, CD4, CD5, CD7, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134 (OX-40), CD137 (4-1BB), CD154 (CD40L), CD278 (ICOS), CD357 (GITR), Toll-like receptor 1 (TLR1), TLR2, TLR3. TLR4, TLR5, TLR6, TLR7, TLR8, and TLR9. In some embodiments, the transmembrane domain may be synthetic, in which case it will comprise predominantly hydrophobic residues such as leucine and valine. In certain exemplary embodiments, a triplet of phenylalanine, tryptophan and valine will be found at each end of a synthetic transmembrane domain.
[0239] The transmembrane domains described herein can be combined with any of the antigen binding domains described herein, any of the costimulatory signaling domains described herein, any of the intracellular signaling domains described herein, or any of the other domains described herein that may be included in a subject CAR.
[0240] In some embodiments, the transmembrane domain further comprises a hinge region.
[0241] A subject CAR of the present invention may also include a hinge region. The hinge region of the CAR is a hydrophilic region which is located between the antigen binding domain and the transmembrane domain. In some embodiments, this domain facilitates proper protein folding for the CAR. The hinge region is an optional component for the CAR. The hinge region may include a domain selected from Fc fragments of antibodies, hinge regions of antibodies, CH2 regions of antibodies, CH3 regions of antibodies, artificial hinge sequences or combinations thereof. Examples of hinge regions include, without limitation, a CD8a hinge, artificial hinges made of polypeptides which may be as small as three glycines (Gly), as well as CHI and CH3 domains of IgGs (such as human IgG4).
[0242] In some embodiments, a subject CAR of the present disclosure includes a hinge region that connects the antigen binding domain with the transmembrane domain, which, in turn, connects to the intracellular domain. The hinge region is preferably capable of supporting the antigen binding domain to recognize and bind to the target antigen on the target cells (see, e.g., Hudecek et al., Cancer Immunol. Res. (2015) 3(2): 125-135). In some embodiments, the hinge region is a flexible domain, thus allowing the antigen binding domain to have a structure to optimally recognize the specific structure and density of the target antigens on a cell such as tumor cell. The flexibility of the hinge region permits the hinge region to adopt many different conformations.
[0243] The hinge region can have a length of from about 4 amino acids to about 50 amino acids, e.g., from about 4 amino acids to about 10 amino acids, from about 10 amino acids to about 15 amino acids, from about 15 amino acids to about 20 amino acids, from about 20 amino acids to about 25 amino acids, from about 25 amino acids to about 30 amino acids, from about 30 amino acids to about 40 amino acids, or from about 40 amino acids to about 50 amino acids.
[0244] Suitable hinge regions can be readily selected and can be of any of a number of suitable lengths, such as from 1 amino acid e.g.. Gly) to 20 amino acids, from 2 amino acids to 15 amino acids, from 3 amino acids to 12 amino acids, including 4 amino acids to 10 amino acids, 5 amino acids to 9 amino acids, 6 amino acids to 8 amino acids, or 7 amino acids to 8 amino acids, and can be 1, 2, 3, 4, 5, 6, or 7 amino acids.
[0245] For example, hinge regions include glycine polymers (G)n, glycine-serine polymers (including, for example, (GS)n, (GSGGS)n (SEQ ID NO: 166) and (GGGS)n(SEQ ID NO: 168), where n is an integer of at least one), glycine-alanine polymers, alanine-serine polymers, and other flexible linkers known in the art. Glycine and glycine-serine polymers can be used; both Gly and Ser are relatively unstructured, and therefore can serve as a neutral tether between components. Glycine polymers can be used; glycine accesses significantly more phi-psi space than even alanine and is much less restricted than residues with longer side chains (see, e.g.. Scheraga, Rev. Computational. Chem. (1992) 2: 73-142). Exemplary hinge regions can comprise amino acid sequences including, but not limited to, GGSG (SEQ ID NO: 179), GGSGG (SEQ ID NO: 180), GSGSG (SEQ ID NO: 181), GSGGG (SEQ ID NO: 182), GGGSG (SEQ ID NO: 183), GSSSG (SEQ ID NO: 184), and the like.
[0246] In some embodiments, the hinge region is an immunoglobulin heavy chain hinge region. Immunoglobulin hinge region amino acid sequences are known in the art; see, e.g. Tan et al., Proc. Natl. Acad. Set. USA (1990) 87(1): 162-166; and Huck et al., Nucleic Acids Res. (1986) 14(4): 1779-1789. As non-limiting examples, an immunoglobulin hinge region can include one of the following amino acid sequences: DKTHT (SEQ ID NO: 190); CPPC (SEQ ID NO: 191); CPEPKSCDTPPPCPR (SEQ ID NO: 192) (see, e.g., Glaser et al., J. Biol. Chem. (2005) 280:41494-41503); ELKTPLGDTTHT (SEQ ID NO: 193); KSCDKTHTCP (SEQ ID NO: 194); KCCVDCP (SEQ ID NO: 195); KYGPPCP (SEQ ID NO: 196); EPKSCDKTHTCPPCP (SEQ ID NO: 197) (human IgGl hinge); ERKCCVECPPCP (SEQ ID NO: 198) (human IgG2 hinge); ELKTPLGDTTHTCPRCP (SEQ ID NO: 199) (human IgG3 hinge); SPNMVPHAHHAQ (SEQ ID NO: 200) (human IgG4 hinge); and the like.
[0247] The hinge region can comprise an amino acid sequence of a human IgGl, IgG2, IgG3, or IgG4, hinge region. In one embodiment, the hinge region can include one or more amino acid substitutions and / or insertions and / or deletions compared to a wild-type (naturally occurring) hinge region. For example, His229 of human IgGl hinge can be substituted with Tyr, so that the hinge region comprises the sequence EPKSCDKTYTCPPCP (SEQ ID NO: 197); see, e.g., Yan et al., J. Biol. Chem. (2012) 287: 5891-5897. In one embodiment, the hinge region can comprise an amino acid sequence derived from human CD8, or a variant thereof. The transmembrane domains described herein, such as a transmembrane region of alpha, beta or zeta chain of the T-cell receptor, CD28. CD2. CD3 epsilon, CD45. CD4. CD5, CD7, CD8, CD9, CD 16, CD22, CD33, CD37, CD64, CD80, CD86, CD134 (OX-40), CD137 (4-1BB), CD154 (CD40L), CD278 (ICOS), CD357 (GITR), Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, and TLR9, can be combined with any of the antigen binding domains described herein, any of the costimulatory signaling domains or intracellular domains or cytoplasmic domains described herein, or any of the other domains described herein that may be included in the CAR.
[0248] In one embodiment, the transmembrane domain may be synthetic, in which case it will comprise predominantly hydrophobic residues such as leucine and valine. In exemplary embodiments, a triplet of phenylalanine, tryptophan and valine will be found at each end of a synthetic transmembrane domain.
[0249] In some embodiments, a subject CAR may further comprise, between the extracellular domain and the transmembrane domain of the CAR, or between the intracellular domain and the transmembrane domain of the CAR, a spacer domain. As used herein, the term “spacer domain” generally means any oligo- or polypeptide that functions to link the transmembrane domain to, either the extracellular domain or, the intracellular domain in the polypeptide chain. A spacer domain may comprise up to 300 amino acids, e.g., 10 to 100 amino acids, or 25 to 50 amino acids. In some embodiments, the spacer domain may be a short oligo- or polypeptide linker, e.g., between 2 and 10 amino acids in length. For example, glycine-serine doublet provides a particularly suitable linker between the transmembrane domain and the intracellular signaling domain of the subject CAR.
[0250] Accordingly, a subject CAR of the present disclosure may comprise any of the transmembrane domains, hinge domains, or spacer domains described herein.
[0251] Intracellular Domain
[0252] A subject CAR of the present invention also includes an intracellular domain. The intracellular domain of the CAR is responsible for activation of at least one of the effector functions of the cell in which the CAR is expressed (e.g., immune cell). The intracellular domain transduces the effector function signal and directs the cell (e.g, immune cell) to perform its specialized function, e.g., harming and / or destroying a target cell.
[0253] The intracellular domain or otherwise the cytoplasmic domain of the CAR is responsible for activation of the cell in which the CAR is expressed. Examples of an intracellular domain for use in the invention include, but are not limited to, the cytoplasmic portion of a surface receptor, co-stimulatory molecule, and any molecule that acts in concert to initiate signal transduction in the T cell, as well as any derivative or variant of these elements and any synthetic sequence that has the same functional capability.
[0254] In certain embodiments, the intracellular domain comprises a costimulatory signaling domain. In certain embodiments, the intracellular domain comprises an intracellular signaling domain. In certain embodiments, the intracellular domain comprises a costimulatory signaling domain and an intracellular signaling domain.
[0255] In one embodiment, the intracellular domain of the CAR comprises a costimulatory signaling domain which includes any portion of one or more co-stimulatory molecules, such as at least one signaling domain from CD2, CD3, CD8, CD27, CD28, 0X40, ICOS, 4- IBB, PD-1, any derivative or variant thereof, any synthetic sequence thereof that has the same functional capability, and any combination thereof.
[0256] Examples of the intracellular signaling domain include, without limitation, the chain of the T cell receptor complex or any of its homologs, e.g., q chain, FcsRIy and chains. MB 1 (Iga) chain, B29 (Ig) chain, etc., human CD3 zeta chain, CD3 polypeptides (A, 5 and E), syk family tyrosine kinases (Syk, ZAP 70. etc.), src family tyrosine kinases (Lek. Fyn. Lyn, etc.), and other molecules involved in T cell transduction, such as CD2, CD5 and CD28. In one embodiment, the intracellular signaling domain may be human CD3 zeta chain, FcyRIII, FcsRI, cy toplasmic tails of Fc receptors, an immunoreceptor tyrosine-based activation motif (IT AM) bearing cytoplasmic receptors, and combinations thereof.
[0257] Other examples of the intracellular domain include a fragment or domain from one or more molecules or receptors including, but are not limited to, TCR, CD3 zeta, CD3 gamma, CD3 delta, CD3 epsilon, CD86, common FcR gamma, FcR beta (Fc Epsilon Rib), CD79a, CD79b, Fc gamma R1 la, DAP10, DAP12, T cell receptor (TCR), CD8, CD27. CD28, 4-1BB (CD137), 0X9, 0X40, CD30, CD40, PD-1, ICOS, a KIR family protein, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, a ligand that specifically binds with CD83, CD5, ICAM-1, GITR, BAFFR, HVEM (LIGHTR), SLAMF7, NKp80 (KLRF1), CD127, CD160, CD19, CD4. CD8alpha, CD8beta, IL2R beta. IL2R gamma, IL7R alpha. ITGA4, VLA1. CD49a, ITGA4. IA4, CD49D. ITGA6, VLA-6. CD49L ITGAD, CD lid, ITGAE, CD 103, ITGAL, CD1 la, LFA-1, ITGAM, CD lib, ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, TNFR2, TRANCE / RANKL, DNAM1 (CD226), SLAMF4 (CD244, 2B4), CD84, CD96 (Tactile), CEACAM1, CRTAM, Ly9 (CD229), CD 160 (BY55), PSGL1, CD 100 (SEMA4D). CD69, SLAMF6 (NTB-A. Lyl08), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD 162), LTBR, LAT, GADS, SLP-76, PAG / Cbp, NKp44, NKp30, NKp46, NKG2D, Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4. TLR5, TLR6, TLR7, TLR8. TLR9, other co-stimulatory molecules described herein, any derivative, variant, or fragment thereof, any synthetic sequence of a costimulatory molecule that has the same functional capability, and any combination thereof.
[0258] Additional examples of intracellular domains include, without limitation, intracellular signaling domains of several types of various other immune signaling receptors, including, but not limited to, first, second, and third generation T cell signaling proteins including CD3, B7 family costimulatory, and Tumor Necrosis Factor Receptor (TNFR) superfamily receptors (see, e.g., Park and Brentjens, J. Clin. Oncol. (2015) 33(6): 651-653). Additionally, intracellular signaling domains may include signaling domains used by NK and NKT cells (see, e.g.. Hermanson and Kaufman. Front. Immunol. (2015) 6: 195) such as signaling domains of NKp30 (B7-H6) (see, e.g., Zhang et al., J. Immunol. (2012) 189(5): 2290-2299), and DAP 12 (see, e.g., Topfer et al., J. Immunol. (2015) 194(7): 3201-3212), NKG2D, NKp44, NKp46, DAP 10, and CD3z.
[0259] Intracellular signaling domains suitable for use in a subject CAR of the present invention include any desired signaling domain that provides a distinct and detectable signal (e.g., increased production of one or more cytokines by the cell; change in transcription of a target gene; change in activity7of a protein; change in cell behavior, e.g., cell death; cellular proliferation; cellular differentiation; cell survival; modulation of cellular signaling responses; etc.) in response to activation of the CAR (i.e.. activated by antigen and dimerizing agent).
[0260] In one embodiment, the intracellular signaling domain is derived from T-cell surface glycoprotein CD3 delta chain (also known as CD3D; CD3-DELTA; T3D; CD3 antigen, delta subunit; CD3 delta; CD3d antigen, delta polypeptide (TiT3 complex); OKT3, delta chain; T- cell receptor T3 delta chain; T-cell surface glycoprotein CD3 delta chain; etc.). In one embodiment, the intracellular signaling domain is derived from T-cell surface glycoprotein CD3 epsilon chain (also known as CD3e, T-cell surface antigen T3 / Leu-4 epsilon chain, T- cell surface glycoprotein CD3 epsilon chain, AI504783, CD3, CD3epsilon. T3e, etc.). In one embodiment, the intracellular signaling domain is derived from T-cell surface glycoprotein CD3 gamma chain (also known as CD3G, T-cell receptor T3 gamma chain, CD3-GAMMA, T3G, gamma polypeptide (TiT3 complex), etc.). In one embodiment, the intracellular signaling domain is derived from T-cell surface glycoprotein CD3 zeta chain (also known as CD3Z, T-cell receptor T3 zeta chain, CD247, CD3-ZETA, CD3H, CD3Q, T3Z, TCRZ, etc ). In one embodiment, the intracellular signaling domain is derived from CD79A (also known as B-cell antigen receptor complex-associated protein alpha chain; CD79a antigen (immunoglobulin-associated alpha); MB-1 membrane glycoprotein; Ig-alpha; membranebound immunoglobulin-associated protein; surface IgM-associated protein; etc.). In one embodiment, an intracellular signaling domain suitable for use in a subject CAR of the present disclosure includes a DAP10 / CD28 type signaling chain. In one embodiment, an intracellular signaling domain suitable for use in a subject CAR of the present disclosure includes a ZAP70 polypeptide. In some embodiments, the intracellular signaling domain includes a cytoplasmic signaling domain of TCR zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, or CD66d. In one embodiment, the intracellular signaling domain in the CAR includes a cytoplasmic signaling domain of human CD3 zeta.
[0261] While usually the entire intracellular signaling domain can be employed, in many cases it is not necessary to use the entire chain. To the extent that a truncated portion of the intracellular signaling domain is used, such truncated portion may be used in place of the intact chain as long as it transduces the effector function signal. The intracellular signaling domain includes any truncated portion of the intracellular signaling domain sufficient to transduce the effector function signal.
[0262] The intracellular signaling domains described herein can be combined with any of the costimulatory signaling domains described herein, any of the antigen binding domains described herein, any of the transmembrane domains described herein, or any of the other domains described herein that may be included in the CAR.
[0263] In one embodiment, the intracellular domain of a subject CAR comprises a CD3zeta intracellular signaling domain comprising the amino acid sequence set forth in SEQ ID NO: 88.
[0264] Tolerable variations of the intracellular domain that maintain specific activity will be know n to those of skill in the art. For example, in some embodiments the intracellular domain comprises an amino acid sequence that has at least 60%, at least 65%, at least 70%, at least
[0265] 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least
[0266] 86%. at least 87%. at least 88%. at least 89%. at least 90%. at least 91%. at least 92%, at least
[0267] 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to any of the intracellular domain nucleotide or amino acid sequences described herein.
[0268] Modified Immune Cells
[0269] I l l In another aspect, the present invention provides a modified immune cell (e.g, a modified T cell, a modified NK cell, a modified NKT cell), comprising a subject CAR possessing binding specificity for an epitope derived from mutant KRAS (mKRAS) protein that is presented by HL A A*11 or HLA A*2 complexes. Accordingly, such modified cells possess the specificity directed by the CAR that is expressed therein. Any modified immune cell comprising a CAR comprising any antigen binding domain, any hinge, any transmembrane domain, any intracellular costimulatory domain, and any intracellular signaling domain described herein is envisioned, and can readily be understood and made by a person of skill in the art in view of the disclosure herein.
[0270] In some embodiments, the modified immune cell is engineered to express and / or secrete a monospecific or bispecific antibody as described herein.
[0271] As used herein, the term '‘modified immune cell” should be construed as additionally including precursor cells thereof. In an exemplar}7embodiment, the modified cell is a T cell. In an exemplary7embodiment, the modified cell is an autologous cell. In an exemplary embodiment, the modified cell is an autologous immune cell. In an exemplary embodiment, the modified cell is an autologous T cell.
[0272] In some embodiments, the modified immune cell or precursor thereof is further engineered by modifying the expression of the endogenous T cell receptor (TCR) chains (e.g, TCRalpha, TCRbeta, TCRdelta, and TCRgamma). In certain embodiments, expression of one or more endogenous TCR chains is reduced or eliminated. In this way, the modified immune cell or precursor thereof of the invention expresses primarily the CAR constructs of the invention as antigen recognition proteins or receptors. Elimination or reduction of endogenous TCR chains in CAR expressing T cells which have also been modified to express IL- 12 ensures that the CAR proteins are the exclusive activators of IL- 12 secretion by the cell and thus limits toxicity caused inappropriate or excessive IL- 12 production in response to endogenous TCR activation. Such toxicity has been found to the limit the therapeutic usefulness of previous IL-12-secreting T cell immunotherapies.
[0273] The term “knockdown” as used herein refers to a decrease in gene expression of one or more genes. The term “knockout” as used herein refers to the ablation of gene expression of one or more genes.
[0274] In some embodiments, the modified immune cell is a T cell comprising a full or partial knock-out of TCR a and / or P chain gene(s). In other embodiments, the modified immune cell is a T cell comprising a knock-down of TCR a and / or chain gene(s). Endogenous gene expression may be knocked-out or knocked-down, and / or inhibited by, for example, an antisense RNA, antagomir RNA, siRNA, shRNA, a CRISPR system, etc. Non-limiting types of CRISPR-mediated modifications include a substitution, an insertion, a deletion, and an insertion / deletion (INDEL). The modification can be located in any part of the target site (e.g., an endogenous gene locus of any one of the targeted genes described herein, e.g.,TCR a and / or P chain gene(s)), including but not limited to an exon, a splice donor, or a splice acceptor.
[0275] In some embodiments, the provided compositions and methods include those in which at least or greater than about 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% of modified immune cells (e.g., T cells) in a composition of immune cells (e.g., T cells) contain the desired genetic modification. For example, in other embodiments, about 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% of immune cells (e.g. T cells) in a composition of cells into which an agent (e.g., gRNA / Cas9) for knockout or genetic disruption of endogenous gene (e.g., TCR a and / or chain) was introduced contain the genetic disruption; do not express the targeted endogenous polypeptide, do not contain a contiguous and / or functional copy of the targeted gene.
[0276] In some embodiments, the modified immune cell or precursor thereof is further engineered by introducing a nucleic acid sequence encoding an immune-modulating agent. In certain embodiments, the immune-modulating agent improves or enhances the cytotoxic function of the modified immune cell or precursor thereof. In certain embodiments, the immune-modulating agent is a cytokine or chemokine. In certain embodiments, the cytokine is IL-12. In certain embodiments, the cytokine is IL-18. In certain embodiments the nucleic acid sequence encoding an immune-modulating agent is operably linked to an inducible promoter. In certain embodiments, the inducible promoter is activated by a signaling system that is endogenous with respect to the modified immune cell. A non-limiting example of such an endogenous signaling system is the NF AT signaling system. It is contemplated that any endogenous signaling system that is known in the art can be used to activate the inducible promoter to drive expression of the immune-modulating agent. One who is skilled in the art would be able to choose an inducible promoter that is appropriate for use with the type of modified immune cell used.
[0277] Nucleic Acids and Expression Vectors
[0278] The present disclosure provides an isolated nucleic acid encoding a polypeptide. The nucleic acid of the present disclosure can comprise a polynucleotide sequence encoding any one of the binding polypeptides, scFvs, bispecific antibodies, CARs, or any fragments thereof disclosed herein.
[0279] One aspect of the present disclosure includes an isolated nucleic acid encoding a CAR comprising a single-chain variable fragment (scFv) comprising a heavy chain variable region and a light chain variable region. In certain embodiments, the heavy chain variable region comprises the amino acid sequences set forth in any one of SEQ ID NOs: 27-31, 76, 84, 92, 99. 103, 107. I l l, 115, 123, 128, 132. 137, 140. 146, 149, or 28, and the light chain variable region comprises the amino acid sequences set forth in any one of SEQ ID NOs: 19-26, 77, 85, 93, 116, 124, 141, 150, or 214.
[0280] Also provided is an isolated nucleic acid encoding a single-chain variable fragment (scFv) comprising a polynucleotide sequence set forth in SEQ ID NOs: 3-10 or a polynucleotide sequence encoding an amino acid sequence set forth in any one of SEQ ID NOs: 11-18, 75, 83, 91, 98, 102, 106, 110, 114, 122, 231, 131, 136, 139, 145, 148, or 216.
[0281] Tolerable variations of the nucleic acid sequences will be know n to those of skill in the art. For example, in some embodiments the nucleic acid encoding an scFv fragment comprises a nucleotide sequence that has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any of the scFv nucleotide or amino acid sequences described herein.
[0282] In certain embodiments, a nucleic acid of the present disclosure comprises a first polynucleotide sequence and a second polynucleotide sequence. The first and second polynucleotide sequence can be connected by a linker. For example, in certain embodiments the heavy chain variable region and the light chain variable region of an scFv are connected by a linker. In certain embodiments, the nucleic acid comprises from 5’ to 3’ the first polynucleotide sequence, the linker, and the second polynucleotide sequence. In certain embodiments, the nucleic acid comprises, from 5’ to 3’, the second polynucleotide sequence, the linker, and the first polynucleotide sequence.
[0283] Another aspect of the present disclosure provides a vector comprising any one of the isolated nucleic acids disclosed herein. In certain embodiments, the vector is selected from the group consisting of a DNA vector, an RNA vector, a plasmid, a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, and a retroviral vector. In certain embodiments, the vector is an expression vector. In some embodiments, a nucleic acid of the present disclosure can be operably linked to a transcriptional control element, e.g, a promoter, and enhancer, etc. Suitable promoter and enhancer elements are known to those of skill in the art.
[0284] In certain embodiments, the nucleic acid is in operable linkage with a promoter. In certain embodiments, the promoter is a phosphoglycerate kinase-1 (PGK) promoter.
[0285] For expression in a eukaryotic cell, suitable promoters include, but are not limited to. light and / or heavy chain immunoglobulin gene promoter and enhancer elements; cytomegalovirus immediate early promoter; herpes simplex virus thymidine kinase promoter; early and late SV40 promoters; promoter present in long terminal repeats from a retrovirus; mouse metallothionein-I promoter; and various art-known tissue specific promoters. Suitable reversible promoters, including reversible inducible promoters are known in the art. Such reversible promoters can be isolated and derived from many organisms, e.g, eukaryotes and prokaryotes. Modification of reversible promoters derived from a first organism for use in a second organism, e.g, a first prokary ote and a second a eukaryote, a first eukaryote and a second a prokaryote, etc., is well known in the art. Such reversible promoters, and systems based on such reversible promoters but also compnsing additional control proteins, include, but are not limited to, alcohol regulated promoters (e.g, alcohol dehydrogenase I (alcA) gene promoter, promoters responsive to alcohol transactivator proteins (AlcR), etc.), tetracycline regulated promoters, (e.g, promoter systems including TetActivators, TetON, TetOFF, etc.), steroid regulated promoters (e.g., rat glucocorticoid receptor promoter systems, human estrogen receptor promoter systems, retinoid promoter systems, thyroid promoter systems, ecdysone promoter systems, mifepristone promoter systems, etc.), metal regulated promoters (e.g, metallothionein promoter systems, etc ), pathogenesis-related regulated promoters (e g., salicylic acid regulated promoters, ethylene regulated promoters, benzothiadiazole regulated promoters, etc.), temperature regulated promoters (e.g, heat shock inducible promoters (e.g, HSP-70, HSP-90, soybean heat shock promoter, etc.), light regulated promoters, synthetic inducible promoters, and the like.
[0286] Other examples of suitable promoters include the immediate early cytomegalovirus (CMV) promoter sequence. This promoter sequence is a strong constitutive promoter sequence capable of driving high levels of expression of any polynucleotide sequence operatively linked thereto. Other constitutive promoter sequences can also be used, including, but not limited to a simian virus 40 (SV40) early promoter, a mouse mammary tumor virus (MMTV) or human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, a MoMuLV promoter, an avian leukemia virus promoter, an Epstein-Barr virus immediate early promoter, a Rous sarcoma virus promoter, the EF-1 alpha promoter, as well as human gene promoters such as, but not limited to, an actin promoter, a myosin promoter, a hemoglobin promoter, and a creatine kinase promoter. Further, the present disclosure should not be limited to the use of constitutive promoters. Inducible promoters are also contemplated as part of the present disclosure. The use of an inducible promoter provides a molecular switch capable of turning on expression of the polynucleotide sequence which it is operatively linked when such expression is desired or turning off the expression when expression is not desired. Examples of inducible promoters include, but are not limited to a metallothionine promoter, a glucocorticoid promoter, a progesterone promoter, and a tetracycline promoter.
[0287] In some embodiments, the locus or construct or transgene containing the suitable promoter is irreversibly switched through the induction of an inducible system. Suitable systems for induction of an irreversible switch are well known in the art, e.g., induction of an irreversible switch can make use of a Cre-lox-mediated recombination (see, e.g, Fuhrmann- Benzakein. et al., Proc. Natl. Acad. Sci. USA (2000) 28:e99, the present disclosure of which is incorporated herein by reference). Any suitable combination of recombinase, endonuclease, ligase, recombination sites, etc. known to the art can be used in generating an irreversibly switchable promoter. Methods, mechanisms, and requirements for performing site-specific recombination, described elsewhere herein, find use in generating irreversibly switched promoters and are well known in the art. see, e.g.. Grindley et al. Annual Review of Biochemistry (2006) 567-605; and Tropp, Molecular Biology (2012) (Jones & Bartlett Publishers, Sudbury, Mass.), the present disclosures of which are incorporated herein by reference.
[0288] A nucleic acid of the present disclosure can be present within an expression vector and / or a cloning vector. An expression vector can include a selectable marker, an origin of replication, and other features that provide for replication and / or maintenance of the vector. Suitable expression vectors include, e.g., plasmids, viral vectors, and the like. Large numbers of suitable vectors and promoters are known to those of skill in the art; many are commercially available for generating a subject recombinant construct. The following vectors are provided by way of example and should not be construed in anyway as limiting: Bacterial: pBs, phagescript, PsiX174, pBluescript SK, pBs KS, pNH8a, pNH16a, pNH18a, pNH46a (Stratagene. La Jolla, Calif., USA); pTrc99A, pKK223-3, pKK233-3, pDR540, and pRIT5 (Pharmacia. Uppsala. Sweden). Eukaryotic: pWLneo, pSV2cat, pOG44, PXR1. pSG (Stratagene) pSVK.3, pBPV, pMSG and pSVL (Pharmacia). Expression vectors generally have convenient restriction sites located near the promoter sequence to provide for the insertion of nucleic acid sequences encoding heterologous proteins. A selectable marker operative in the expression host can be present. Suitable expression vectors include, but are not limited to, viral vectors (e.g, viral vectors based on vaccinia vims; poliovirus; adenovirus (see, e.g., Li et al., Invest. Opthalmol. Vis. Sci. (1994) 35: 2543-2549; Borras et al., Gene Ther. (1999) 6: 515-524; Li and Davidson, Proc. Natl. Acad. Sci. USA (1995) 92: 7700-7704; Sakamoto et al.. H. Gene Ther. (1999) 5: 1088-1097; WO 94 / 12649, WO 93 / 03769; WO 93 / 19191; WO 94 / 28938; WO 95 / 11984 and WO 95 / 00655); adeno-associated vims (see, e.g., Ali et al., Hum. Gene Ther. (1998) 9: 81- 86, Flannery et al., Proc. Natl. Acad. Sci. USA (1997) 94: 6916-6921; Bennett et al., Invest. Opthalmol. Vis. Sci. (1997) 38: 2857-2863; Jomary et al.. Gene Ther. (1997) 4:683 690, Rolling et al.. Hum. Gene Ther. (1999) 10: 641-648; Ali et al.. Hum. Mol. Genet. (1996) 5: 591-594; Srivastava in WO 93 / 09239, Samulski et al., J. Vir. (1989) 63: 3822-3828; Mendelson et al.. Virol. (1988) 166: 154-165; and Flotte et al., Proc. Natl. Acad. Sci. USA (1993) 90: 10613-10617); SV40; herpes simplex virus; human immunodeficiency virus (see. e.g., Miyoshi et al., Proc. Natl. Acad. Sci. USA (1997) 94: 10319-23; Takahashi et al.. J. Virol. (1999) 73: 7812-7816); a retroviral vector (e.g.. Murine Leukemia Vims, spleen necrosis virus, and vectors derived from retroviruses such as Rous Sarcoma Vims, Harvey Sarcoma Virus, avian leukosis virus, human immunodeficiency virus, myeloproliferative sarcoma vims, and mammary tumor virus); and the like.
[0289] Additional expression vectors suitable for use are, e.g., without limitation, a lentivirus vector, a gamma retrovirus vector, a foamy virus vector, an adeno-associated virus vector, an adenovirus vector, a pox virus vector, a herpes virus vector, an engineered hy brid virus vector, a transposon mediated vector, and the like. Viral vector technology is well known in the art and is described, for example, in Sambrook et al., 2012, Molecular Cloning: A Laboratory Manual, volumes 1-4, Cold Spring Harbor Press, NY), and in other virology and molecular biology manuals. Viruses, which are useful as vectors include, but are not limited to, retroviruses, adenoviruses, adeno- associated viruses, herpes viruses, and lentiviruses.
[0290] In general, a suitable vector contains an origin of replication functional in at least one organism, a promoter sequence, convenient restriction endonuclease sites, and one or more selectable markers, (e.g., WO 01 / 96584; WO 01 / 29058; and U.S. Pat. No. 6,326,193).
[0291] In some embodiments, an expression vector (e.g., a lentiviral vector) can be used to introduce the nucleic acid into a host cell. Accordingly, an expression vector (e.g., a lentiviral vector) of the present disclosure can comprise a nucleic acid encoding a polypeptide. In some embodiments, the expression vector (e.g., lentiviral vector) will comprise additional elements that will aid in the functional expression of the polypeptide encoded therein. In some embodiments, an expression vector comprising a nucleic acid encoding for a polypeptide further comprises a mammalian promoter. In one embodiment, the vector further comprises an elongation-factor-1 -alpha promoter (EF-la promoter, SEQ ID NO: 158). Use of an EF-la promoter can increase the efficiency in expression of downstream transgenes. Physiologic promoters (e.g., an EF-la promoter) can be less likely to induce integration mediated genotoxicity and can abrogate the ability of the retroviral vector to transform stem cells. Other physiological promoters suitable for use in a vector (e.g., lentiviral vector) are known to those of skill in the art and can be incorporated into a vector of the present disclosure.
[0292] In some embodiments, the vector (e.g., lentiviral vector) further comprises a nonrequisite cis acting sequence that can improve titers and gene expression. One non-limiting example of a non-requisite cis acting sequence is the central polypurine tract and central termination sequence (cPPT / CTS) which is important for efficient reverse transcription and nuclear import. Other non-requisite cis acting sequences are known to those of skill in the art and can be incorporated into a vector (e.g., lentiviral vector) of the present disclosure.
[0293] In some embodiments, the vector further comprises a posttranscriptional regulatory element. Posttranscriptional regulator}' elements can improve RNA translation, improve transgene expression and stabilize RNA transcripts. One example of a posttranscriptional regulatory element is the woodchuck hepatitis virus posttranscriptional regulatory element (WPRE, SEQ ID NO: 58). Accordingly, in some embodiments a vector for the present disclosure further comprises a WPRE sequence. Various posttranscriptional regulator elements are known to those of skill in the art and can be incorporated into a vector (e.g., lentiviral vector) of the present disclosure.
[0294] A vector of the present disclosure can further comprise additional elements such as a rev response element (RRE) for RNA transport, packaging sequences, and 5’ and 3’ long terminal repeats (LTRs). The term “long terminal repeat” or “LTR” refers to domains of base pairs located at the ends of retroviral DNAs which comprise U3, R and U5 regions. LTRs generally provide functions required for the expression of retroviral genes (e.g., promotion, initiation and polyadenylation of gene transcripts) and to viral replication. In one embodiment, a vector (e.g., lentiviral vector) of the present disclosure includes a 3’ U3 deleted LTR. Accordingly, a vector (e.g., lentiviral vector) of the present disclosure can comprise any combination of the elements described herein to enhance the efficiency of functional expression of transgenes. For example, a vector (e.g., lentiviral vector) of the present disclosure can comprise a WPRE sequence, cPPT sequence, RRE sequence, 5’LTR, 3’ U3 deleted LTR’ in addition to a nucleic acid encoding for a CAR.
[0295] Vectors of the present disclosure can be self-inactivating vectors. As used herein, the term '‘self-inactivating vector” refers to vectors in which the 3 ’ LTR enhancer promoter region (U3 region) has been modified (e.g., by deletion or substitution). A self-inactivating vector can prevent viral transcription beyond the first round of viral replication. Consequently, a self-inactivating vector can be capable of infecting and then integrating into a host genome (e.g, a mammalian genome) only once, and cannot be passed further. Accordingly, self-inactivating vectors can greatly reduce the risk of creating a replication- competent virus.
[0296] In one embodiment, the lentiviral vector is a self-inactivating HIV vector comprising a 5’ U3 LTR (e.g., SEQ ID NO: 207), a partial HIV gag sequence comprising an RRE sequence and packaging signal (i|i) (e.g., SEQ ID NO: 208), an HIV central polypurine tract (cPPT) sequence (e.g., SEQ ID NO: 209), and / or a 3’ U3 deleted LTR (e.g., SEQ ID NO: 210). In some embodiments, the expression vector and / or HIV vector comprises a Woodchuck Hepatitis virus post-transcriptional regulatory element (WPRE) sequence (e.g., SEQ ID NO: 58).
[0297] In some embodiments, a nucleic acid of the present disclosure can be RNA, e.g., in vitro synthesized RNA. Methods for in vitro synthesis of RNA are known to those of skill in the art; any known method can be used to synthesize RNA comprising a sequence encoding a polypeptide of the present disclosure. Methods for introducing RNA into a host cell are known in the art. See, e.g., Zhao et al. Cancer Res. (2010) 15: 9053. Introducing RNA comprising a nucleotide sequence encoding a polypeptide of the present disclosure into a host cell can be carried out in vitro, ex vivo or in vivo. For example, a host cell (e.g, an NK. cell, a cytotoxic T lymphocyte, etc.) can be electroporated in vitro or ex vivo with RNA comprising a nucleotide sequence encoding a polypeptide of the present disclosure.
[0298] In order to assess the expression of a polypeptide or portions thereof, the expression vector to be introduced into a cell can also contain either a selectable marker gene or a reporter gene, or both, to facilitate identification and selection of expressing cells from the population of cells sought to be transfected or infected through viral vectors. In some embodiments, the selectable marker can be carried on a separate piece of DNA and used in a co-transfection procedure. Both selectable markers and reporter genes can be flanked with appropriate regulatory sequences to enable expression in the host cells. Useful selectable markers include, without limitation, antibiotic-resistance genes. Reporter genes are used for identifying potentially transfected cells and for evaluating the functionality of regulatory sequences. In general, a reporter gene is a gene that is not present in or expressed by the recipient organism or tissue and that encodes a polypeptide whose expression is manifested by some easily detectable property, e.g., enzymatic activity. Expression of the reporter gene is assessed at a suitable time after the DNA has been introduced into the recipient cells. Suitable reporter genes can include, without limitation, genes encoding luciferase, beta-galactosidase, chloramphenicol acetyl transferase, secreted alkaline phosphatase, or the green fluorescent protein gene (e.g., Ui-Tei et al., 2000 FEBS Letters 479: 79-82).
[0299] Exemplary nucleic acids for use in the present invention are described in Table 1.
[0300] Methods of Generating Modified Immune Cells
[0301] The present invention provides methods for producing / generating a modified immune cell (e.g., a T cell / NK cell / NKT cell). The cells are generally engineered by introducing a nucleic acid encoding a CAR (e.g, mKRAS CAR) or bispecific antibody. In some embodiments, the CAR is accompanied by a gene modification system that is capable of modifying the expression or sequence of one or more of the endogenous T cell receptor (TCR) genes (e.g., TCRalpha, TCRbeta, TCRgamma, TCRdelta). In some embodiments, the modification reduces or eliminates expression of one or more endogenous TCR chains.
[0302] Methods of introducing nucleic acids into a cell include physical, biological and chemical methods. Physical methods for introducing a polynucleotide, such as RNA, into a host cell include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like. RNA can be introduced into target cells using commercially available methods which include electroporation (Amaxa Nucleofector-II (Amaxa Biosystems, Cologne, Germany)), (ECM 830 (BTX) (Harvard Instruments, Boston, MA) or the Gene Pulser II (BioRad, Denver, CO), Multiporator (Eppendorf, Hamburg Germany). RNA can also be introduced into cells using cationic liposome mediated transfection using lipofection, using polymer encapsulation, using peptide mediated transfection, or using biolistic particle delivery systems such as "‘gene guns?’ (see, for example, Nishikawa, et al. Hum Gene Ther., 12(8): 861 -70 (2001).
[0303] Biological methods for introducing a polynucleotide of interest into a host cell include the use of DNA and RNA vectors. Viral vectors, and especially retroviral vectors, have become the most widely used method for inserting genes into mammalian, e.g., human cells. Other viral vectors can be derived from lentivirus, poxviruses, herpes simplex virus I, adenoviruses and adeno-associated viruses, and the like. See, for example, U.S. Pat. Nos. 5,350,674 and 5,585,362.
[0304] In some embodiments, a nucleic acid encoding a subject CAR of the invention is introduced into a cell by an expression vector. Expression vectors comprising a nucleic acid encoding a subject CAR (e.g., mKRAS CAR) are provided herein. Suitable expression vectors include lentivirus vectors, gamma retrovirus vectors, foamy virus vectors, adeno associated virus (AAV) vectors, adenovirus vectors, engineered hybrid viruses, naked DNA. including but not limited to transposon mediated vectors, such as Sleeping Beauty, Piggyback, and Integrases such as Phi31. Some other suitable expression vectors include herpes simplex virus (HSV) and retrovirus expression vectors.
[0305] Adenovirus expression vectors are based on adenoviruses, which have a low capacity for integration into genomic DNA but a high efficiency for transfecting host cells. Adenovirus expression vectors contain adenovirus sequences sufficient to: (a) support packaging of the expression vector and (b) to ultimately express the subject CAR in the host cell. In some embodiments, the adenovirus genome is a 36 kb, linear, double stranded DNA, where a foreign DNA sequence (e.g., a nucleic acid encoding a subject CAR) may be inserted to substitute large pieces of adenoviral DNA in order to make the expression vector of the present invention (see, e.g., Danthinne and Imperiale, Gene Therapy (2000) 7(20): 1707- 1714).
[0306] Another expression vector is based on an adeno associated virus, which takes advantage of the adenovirus coupled systems. This AAV expression vector has a high frequency of integration into the host genome. It can infect non-dividing cells, thus making it useful for delivery of genes into mammalian cells, for example, in tissue cultures or in vivo. The AAV vector has a broad host range for infectivity. Details concerning the generation and use of AAV vectors are described in U.S. Patent Nos. 5,139,941 and 4,797,368.
[0307] Retrovirus expression vectors are capable of integrating into the host genome, delivering a large amount of foreign genetic material, infecting a broad spectrum of species and cell types and being packaged in special cell lines. The retrovirus vector is constructed by inserting a nucleic acid (e.g.. a nucleic acid encoding a subject CAR) into the viral genome at certain locations to produce a virus that is replication defective. Though the retrovirus vectors are able to infect a broad variety of cell types, integration and stable expression of the subject CAR, requires the division of host cells.
[0308] Lentivirus vectors are derived from lentiviruses. which are complex retroviruses that, in addition to the common retroviral genes gag, pol, and env, contain other genes with regulatory' or structural function (see, e.g., U.S. Patent Nos. 6,013,516 and 5,994. 136). Some examples of lentiviruses include the human immunodeficiency viruses (HIV-1. HIV-2) and the simian immunodeficiency virus (SIV). Lentivirus vectors have been generated by multiply attenuating the HIV virulence genes, for example, the genes env, vif, vpr, vpu and nef are deleted making the vector biologically safe. Lentivirus vectors are capable of infecting non-dividing cells and can be used for both in vivo and ex vivo gene transfer and expression, e.g., of anucleic acid encoding a subject CAR (see. e.g., U.S. Patent No. 5,994,136).
[0309] Expression vectors including a nucleic acid of the present disclosure can be introduced into a host cell by any means known to persons skilled in the art. Hie expression vectors may include viral sequences for transfection, if desired. Alternatively, the expression vectors may be introduced by fusion, electroporation, biolistics, transfection, lipofection, or the like. The host cell may be grown and expanded in culture before introduction of the expression vectors, followed by the appropriate treatment for introduction and integration of the vectors. The host cells are then expanded and may be screened by virtue of a marker present in the vectors. Various markers that may be used are known in the art, and may include hprt, neomycin resistance, thymidine kinase, hygromycin resistance, etc. As used herein, the terms “cell,” “cell line,” and “cell culture” may be used interchangeably. In some embodiments, the host cell is an immune cell or precursor thereof, e.g., a T cell, an NK cell, or an NK.T cell.
[0310] The present invention also provides genetically engineered cells which include and stably express a subject CAR of the present disclosure. In some embodiments, the genetically engineered cells are genetically engineered T-lymphocytes (T cells), regulatory T cells (Tregs), naive T cells (TN), memory T cells (for example, central memory T cells (TCM), effector memory cells (TEM)), natural killer cells (NK cells), natural killer T cells (NKT cells) and macrophages capable of giving rise to therapeutically relevant progeny. In one embodiment, the genetically engineered cells are autologous cells.
[0311] Modified cells (e.g., comprising a subject CAR) may be produced by stably transfecting host cells with an expression vector including a nucleic acid of the present disclosure. Additional methods to generate a modified cell of the present disclosure include, without limitation, chemical transformation methods (e.g., using calcium phosphate, dendrimers, liposomes and / or cationic polymers), non-chemical transformation methods (e.g., electroporation, optical transformation, gene electro transfer and / or hydrodynamic delivery) and / or particle-based methods (e.g, impalefection, using a gene gun and / or magnetofection). Transfected cells expressing a subj ect CAR of the present disclosure may be expanded ex vivo.
[0312] Physical methods for introducing an expression vector into host cells include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like. Methods for producing cells including vectors and / or exogenous nucleic acids are well-known in the art. See. e.g., Sambrook et al. (2001). Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York.
[0313] Chemical means for introducing a polynucleotide into a host cell include colloidal dispersion systems, such as macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. An exemplary colloidal system for use as a delivery vehicle in vitro and in vivo is a liposome (e.g., an artificial membrane vesicle).
[0314] Lipids suitable for use can be obtained from commercial sources. For example, dimyristy l phosphatidylcholine (“DMPC”) can be obtained from Sigma, St. Louis, MO; dicetyl phosphate (“DCP”) can be obtained from K & K Laboratories (Plainview, NY); cholesterol C'Choi”) can be obtained from Calbiochem-Behring; dimyristyl phosphatidylglycerol ( “DMPG”) and other lipids may be obtained from Avanti Polar Lipids, Inc. (Birmingham, AL). Stock solutions of lipids in chloroform or chloroform / methanol can be stored at about -20°C. Chloroform is used as the only solvent since it is more readily- evaporated than methanol. '‘Liposome’’ is a generic term encompassing a variety of single and multilamellar lipid vehicles formed by the generation of enclosed lipid bilayers or aggregates. Liposomes can be characterized as having vesicular structures with a phospholipid bilayer membrane and an inner aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo self-rearrangement before the formation of closed structures and entrap water and dissolved solutes between the lipid bilayers (Ghosh et al., 1991 Glycobiology 5: 505-10). However, compositions that have different structures in solution than the normal vesicular structure are also encompassed. For example, the lipids may assume a micellar structure or merely exist as nonuniform aggregates of lipid molecules. Also contemplated are lipofectamine-nucleic acid complexes.
[0315] Regardless of the method used to introduce exogenous nucleic acids into a host cell or otherwise expose a cell to the inhibitor of the present invention, in order to confirm the presence of the nucleic acids in the host cell, a variety of assays may be performed. Such assays include, for example, “molecular biological” assays well known to those of skill in the art, such as Southern and Northern blotting, RT-PCR and PCR; “biochemical” assays, such as detecting the presence or absence of a particular peptide, e.g., by immunological means (ELIS As and Western blots) or by assays described herein to identify agents falling within the scope of the invention.
[0316] Moreover, the nucleic acids may be introduced by any means, such as transducing the expanded T cells, transfecting the expanded T cells, and electroporating the expanded T cells. One nucleic acid may be introduced by one method and another nucleic acid may be introduced into the T cell by a different method.
[0317] Sources of Immune Cells
[0318] Prior to expansion, a source of immune cells is obtained from a subject for ex vivo manipulation. Sources of target cells for ex vivo manipulation may also include, e.g., autologous or heterologous donor blood, cord blood, or bone marrow. For example, the source of immune cells may be from the subject to be treated with the modified immune cells of the invention, e.g., the subject's blood, the subject's cord blood, or the subject’s bone marrow. Non-limiting examples of subjects include humans, dogs, cats, mice, rats, and transgenic species thereof. In certain exemplary embodiments, the subject is a human.
[0319] Immune cells can be obtained from a number of sources, including blood, peripheral blood mononuclear cells, bone marrow, lymph node tissue, spleen tissue, umbilical cord, lymph, or lymphoid organs. Immune cells are cells of the immune system, such as cells of the innate or adaptive immunity, e.g., myeloid or lymphoid cells, including lymphocytes, typically T cells and / or NK cells and / or NKT cells. Other exemplary cells include stem cells, such as multipotent and pluripotent stem cells, including induced pluripotent stem cells (iPSCs). In certain aspects, the cells are human cells. With reference to the subject to be treated, the cells may be allogeneic and / or autologous. The cells ty pically are primary' cells, such as those isolated directly from a subject and / or isolated from a subject and frozen.
[0320] In certain embodiments, the immune cell is a T cell, e.g., a CD8+ T cell (e.g.. a CD8+ naive T cell, central memory T cell, or effector memory7T cell), a CD4+ T cell, a natural killer T cell (NKT cells), a regulatory7T cell (Treg), a stem cell memory7T cell, a lymphoid progenitor cell, a hematopoietic stem cell, a natural killer cell (NK cell), a natural killer T cell (NK cell) or a dendritic cell. In some embodiments, the cells are monocytes or granulocytes. e.g.. myeloid cells, macrophages, neutrophils, dendritic cells, mast cells, eosinophils, and / or basophils. In an embodiment, the target cell is an induced pluripotent stem (iPS) cell or a cell derived from an iPS cell, e.g, an iPS cell generated from a subject, manipulated to alter (e.g., induce a mutation in) or manipulate the expression of one or more target genes, and differentiated into, e.g., a T cell, e.g., a CD8+ T cell (e.g., a CD8+ naive T cell, central memory T cell, or effector memory7T cell), a CD4+ T cell, a stem cell memory T cell, a lymphoid progenitor cell or a hematopoietic stem cell.
[0321] In some embodiments, the cells include one or more subsets of T cells or other cell ty pes, such as whole T cell populations, CD4+ cells, CD8+ cells, and subpopulations thereof, such as those defined by function, activation state, maturity7, potential for differentiation, expansion, recirculation, localization, and / or persistence capacities, antigen- specificity7, type of antigen receptor, presence in a particular organ or compartment, marker or cytokine secretion profile, and / or degree of differentiation. Among the sub-types and subpopulations of T cells and / or of CD4+ and / or of CD8+ T cells are naive T (TN) cells, effector T cells (TEFF), memory T cells and sub-ty pes thereof, such as stem cell memory7T (TSCM), central memory T (TCM), effector memory T (TEM), or terminally differentiated effector memory T cells, tumor-infiltrating lymphocytes (TIL), immature T cells, mature T cells, helper T cells, cytotoxic T cells, mucosa-associated invariant T (MAIT) cells, naturally occurring and adaptive regulatory T (Treg) cells, helper T cells, such as TH1 cells, TH2 cells, TH3 cells, TH 17 cells, TH9 cells, TH22 cells, follicular helper T cells, alpha / beta T cells, and delta / gamma T cells. In certain embodiments, any number of T cell lines available in the art. may be used.
[0322] In some embodiments, the methods include isolating immune cells from the subject, preparing, processing, culturing, and / or engineering them. In some embodiments, preparation of the engineered cells includes one or more culture and / or preparation steps. The cells for engineering as described may be isolated from a sample, such as a biological sample, e.g, one obtained from or derived from a subject. In some embodiments, the subject from which the cell is isolated is one having the disease or condition or in need of a cell therapy or to which cell therapy will be administered. The subject in some embodiments is a human in need of a particular therapeutic intervention, such as the adoptive cell therapy for which cells are being isolated, processed, and / or engineered. Accordingly, the cells in some embodiments are primary cells, e.g., primary7human cells. The samples include tissue, fluid, and other samples taken directly from the subject, as well as samples resulting from one or more processing steps, such as separation, centrifugation, genetic engineering (e.g., transduction with viral vector), washing, and / or incubation. The biological sample can be a sample obtained directly from a biological source or a sample that is processed. Biological samples include, but are not limited to, body fluids, such as blood, plasma, serum, cerebrospinal fluid, synovial fluid, urine and sweat, tissue and organ samples, including processed samples derived therefrom.
[0323] In certain aspects, the sample from which the cells are derived or isolated is blood or a blood-derived sample or is or is derived from an apheresis or leukapheresis product. Exemplary samples include whole blood, peripheral blood mononuclear cells (PBMCs). leukocytes, bone marrow, thymus, tissue biopsy, tumor, leukemia, lymphoma, lymph node, gut associated lymphoid tissue, mucosa associated lymphoid tissue, spleen, other lymphoid tissues, liver, lung, stomach, intestine, colon, kidney, pancreas, breast, bone, prostate, cervix, testes, ovaries, tonsil, or other organ, and / or cells derived therefrom. Samples include, in the context of cell therapy, e.g. adoptive cell therapy, samples from autologous and allogeneic sources.
[0324] In some embodiments, the cells are derived from cell lines, e.g., T cell lines. The cells in some embodiments are obtained from a xenogeneic source, for example, from mouse, rat, non-human primate, and pig. In some embodiments, isolation of the cells includes one or more preparation and / or non-affinity -based cell separation steps. In some examples, cells are washed, centrifuged, and / or incubated in the presence of one or more reagents, for example, to remove unwanted components, enrich for desired components, lyse or remove cells sensitive to particular reagents. In some examples, cells are separated based on one or more property, such as density, adherent properties, size, sensitivity and / or resistance to particular components.
[0325] In some examples, cells from the circulating blood of a subject are obtained, e.g., by apheresis or leukapheresis. The samples, in certain aspects, contain lymphocytes, including T cells, monocytes, granulocytes, B cells, other nucleated white blood cells, red blood cells, and / or platelets, and in certain aspects contains cells other than red blood cells and platelets. In some embodiments, the blood cells collected from the subject are washed, e.g., to remove the plasma fraction and to place the cells in an appropriate buffer or media for subsequent processing steps. In some embodiments, the cells are washed with phosphate buffered saline (PBS). In some embodiments, a washing step is accomplished by tangential flow filtration (TFF) according to the manufacturer's instructions. In certain embodiments, the cells are resuspended in a variety of biocompatible buffers after washing. In certain embodiments, components of a blood cell sample are removed, and the cells directly resuspended in culture media. In some embodiments, the methods include density-based cell separation methods, such as the preparation of white blood cells from peripheral blood by lysing the red blood cells and centrifugation through a Percoll or Ficoll gradient.
[0326] In one embodiment, immune cells are obtained from the circulating blood of an individual are obtained by apheresis or leukapheresis. The apheresis product typically contains lymphocytes, including T cells, monocytes, granulocytes, B cells, other nucleated white blood cells, red blood cells, and platelets. The cells collected by apheresis may be washed to remove the plasma fraction and to place the cells in an appropriate buffer or media, such as phosphate buffered saline (PBS) or wash solution lacks calcium and may lack magnesium or may lack many if not all divalent cations, for subsequent processing steps. As those of ordinary skill in the art would readily appreciate a washing step may be accomplished by methods known to those in the art. such as by using a semi-automated “flow-through’’ centrifuge (for example, the Cobe 2991 cell processor, the Baxter CytoMate, or the Haemonetics Cell Saver 5) according to the manufacturer's instructions. After washing, the cells may be resuspended in a variety of biocompatible buffers, such as, for example, Ca2+-free, Mg2+-free PBS, PlasmaLyte A, or another saline solution with or without buffer. In some embodiments, the undesirable components of the apheresis sample may be removed, and the cells directly resuspended in culture media.
[0327] In some embodiments, the isolation methods include the separation of different cell types based on the expression or presence in the cell of one or more specific molecules, such as surface markers, e.g, surface proteins, intracellular markers, or nucleic acid. In some embodiments, any known method for separation based on such markers may be used. In some embodiments, the separation is affinity- or immunoaffinity -based separation. For example, the isolation in certain aspects includes separation of cells and cell populations based on the cells' expression or expression level of one or more markers, typically cell surface markers, for example, by incubation with an antibody or binding partner that specifically binds to such markers, followed generally by washing steps and separation of cells having bound the antibody or binding partner, from those cells having not bound to the antibody or binding partner. Such separation steps can be based on positive selection, in which the cells having bound the reagents are retained for further use, and / or negative selection, in which the cells having not bound to the antibody or binding partner are retained. In some examples, both fractions are retained for further use. In certain aspects, negative selection can be particularly useful where no antibody is available that specifically identifies a cell type in a heterogeneous population, such that separation is best carried out based on markers expressed by cells other than the desired population. The separation need not result in 100% enrichment or removal of a particular cell population or cells expressing a particular marker. For example, positive selection of or enrichment for cells of a particular type, such as those expressing a marker, refers to increasing the number or percentage of such cells, but need not result in a complete absence of cells not expressing the marker. Likewise, negative selection, removal, or depletion of cells of a particular type, such as those expressing a marker, refers to decreasing the number or percentage of such cells, but need not result in a complete removal of all such cells.
[0328] In certain exemplary embodiments, multiple rounds of separation steps are carried out, where the positively or negatively selected fraction from one step is subjected to another separation step, such as a subsequent positive or negative selection. In certain exemplary embodiments, a single separation step can deplete cells expressing multiple markers simultaneously, such as by incubating cells with a plurality of antibodies or binding partners, each specific for a marker targeted for negative selection. Likewise, multiple cell types can simultaneously be positively selected by incubating cells with a plurality of antibodies or binding partners expressed on the various cell types.
[0329] In some embodiments, one or more of the T cell populations is enriched for or depleted of cells that are positive for (marker+) or express high levels (markerhlgh) of one or more particular markers, such as surface markers, or that are negative for (marker") or express relatively low levels (markerlow) of one or more markers. For example, in certain aspects, specific subpopulations of T cells, such as cells positive or expressing high levels of one or more surface markers, e.g., CD28+, CD62L+, CCR7+, CD27+, CD127+, CD4+, CD8+, CD45RA+, and / or CD45RO+ T cells, are isolated by positive or negative selection techniques. In some cases, such markers are those that are absent or expressed at relatively low levels on certain populations of T cells (such as non-memory cells) but are present or expressed at relatively higher levels on certain other populations of T cells (such as memory cells). In one embodiment, the cells (such as the CD8+ cells or the T cells, e.g., CD3+ cells) are enriched for (i.e., positively selected for) cells that are positive or expressing high surface levels of CD45RO, CCR7. CD28, CD27, CD44, CD 127, and / or CD62L and / or depleted of (e.g., negatively selected for) cells that are positive for or express high surface levels of CD45RA. In some embodiments, cells are enriched for or depleted of cells positive or expressing high surface levels of CD122, CD95, CD25, CD27, and / or IL7-Ra (CD127). In certain exemplary' embodiments. CD8+ T cells are enriched for cells positive for CD45RO (or negative for CD45RA) and for CD62L. For example, CD3+, CD28+ T cells can be positively selected using CD3 / CD28 conjugated magnetic beads (e.g., DYNABEADS® M- 450 CD3 / CD28 T Cell Expander).
[0330] In some embodiments, T cells are separated from a PBMC sample by negative selection of markers expressed on non-T cells, such as B cells, monocytes, or other white blood cells, such as CD 14. In certain aspects, a CD4+ or CD8+ selection step is used to separate CD4+ helper and CD8+ cytotoxic T cells. Such CD4+ and CD8+ populations can be further sorted into sub-populations by positive or negative selection for markers expressed or expressed to a relatively higher degree on one or more naive, memory, and / or effector T cell subpopulations. In some embodiments, CD8+ cells are further enriched for or depleted of naive, central memory, effector memory, and / or central memory' stem cells, such as by positive or negative selection based on surface antigens associated with the respective subpopulation. In some embodiments, enrichment for central memory T (TCM) cells is carried out to increase efficacy, such as to improve long-term survival, expansion, and / or engraftment following administration, which in certain aspects is particularly robust in such sub-populations. In some embodiments, combining TCM-enriched CD8+ T cells and CD4+ T cells further enhances efficacy.
[0331] In some embodiments, memory T cells are present in both CD62L+ and CD62L- subsets of CD8+ peripheral blood lymphocytes. PBMC can be enriched for or depleted of CD62L-CD8+ and / or CD62L+CD8+ fractions, such as using anti-CD8 and anti-CD62L antibodies. In some embodiments, a CD4+ T cell population and / or a CD8+ T population is enriched for central memory (TCM) cells. In some embodiments, the enrichment for central memory T (TCM) cells is based on positive or high surface expression of CD45RO, CD62L, CCR7, CD28, CD3, and / or CD 127; in certain aspects, it is based on negative selection for cells expressing or highly expressing CD45RA and / or granzyme B. In certain aspects, isolation of a CD8+ population enriched for TCM cells is earned out by depletion of cells expressing CD4, CD 14, CD45RA, and positive selection or enrichment for cells expressing CD62L. In one aspect, enrichment for central memory' T (TCM) cells is carried out starting with a negative fraction of cells selected based on CD4 expression, which is subjected to a negative selection based on expression of CD 14 and CD45RA. and a positive selection based on CD62L. Such selections in certain aspects are carried out simultaneously and in other aspects are carried out sequentially, in either order. In some embodiments, the same CD4 expression-based selection step used in preparing the CD8+ cell population or subpopulation, also is used to generate the CD4+ cell population or sub-population, such that both the positive and negative fractions from the CD4-based separation are retained and used in subsequent steps of the methods, optionally following one or more further positive or negative selection steps.
[0332] CD4+ T helper cells are sorted into naive, central memorw and effector cells by identifying cell populations that have cell surface antigens. CD4+ lymphocytes can be obtained by standard methods. In some embodiments, naive CD4+ T lymphocytes are CD45RO-, CD45RA+, CD62L+, CD4+ T cells. In some embodiments, central memory CD4+ cells are CD62L+ and CD45RO+. In some embodiments, effector CD4+ cells are CD62L- and CD45RO. In one example, to enrich for CD4+ cells by negative selection, a monoclonal antibody cocktail typically includes antibodies to CD14, CD20, CDl lb, CD16, HLA-DR, and CD8. In some embodiments, the antibody or binding partner is bound to a solid support or matrix, such as a magnetic bead or paramagnetic bead, to allow for separation of cells for positive and / or negative selection.
[0333] In some embodiments, the cells are incubated and / or cultured prior to or in connection with genetic engineering. The incubation steps can include culture, cultivation, stimulation, activation, and / or propagation. In some embodiments, the compositions or cells are incubated in the presence of stimulating conditions or a stimulatory agent. Such conditions include those designed to induce proliferation, expansion, activation, and / or survival of cells in the population, to mimic antigen exposure, and / or to prime the cells for genetic engineering, such as for the introduction of a recombinant antigen receptor. The conditions can include one or more of particular media, temperature, oxygen content, carbon dioxide content, time, agents. e.g.. nutrients, amino acids, antibiotics, ions, and / or stimulatory factors, such as cytokines, chemokines, antigens, binding partners, fusion proteins, recombinant soluble receptors, and any other agents designed to activate the cells. In some embodiments, the stimulating conditions or agents include one or more agent, e.g., ligand, which is capable of activating an intracellular signaling domain of a TCR complex. In certain aspects, the agent turns on or initiates TCR / CD3 intracellular signaling cascade in a T cell. Such agents can include antibodies, such as those specific for a TCR component and / or costimulatory receptor, e.g., anti-CD3, anti-CD28, for example, bound to solid support such as a bead, and / or one or more cytokines. Optionally, the expansion method may further comprise the step of adding anti- CD3 and / or anti-CD28 antibody to the culture medium (e.g.. at a concentration of at least about 0.5 ng / ml). In some embodiments, the stimulating agents include IL-2 and / or IL-15, for example, an IL-2 concentration of at least about 10 units / mL.
[0334] In another embodiment, T cells are isolated from peripheral blood by lysing the red blood cells and depleting the monocytes, for example, by centrifugation through a PERCOLL™ gradient. Alternatively, T cells can be isolated from an umbilical cord. In any event, a specific subpopulation of T cells can be further isolated by positive or negative selection techniques.
[0335] The cord blood mononuclear cells so isolated can be depleted of cells expressing certain antigens, including, but not limited to, CD34, CD8, CD14, CD19, and CD56. Depletion of these cells can be accomplished using an isolated antibody, a biological sample comprising an antibody, such as ascites, an antibody bound to a physical support, and a cell bound antibody.
[0336] Enrichment of a T cell population by negative selection can be accomplished using a combination of antibodies directed to surface markers unique to the negatively selected cells. An exemplary method is cell sorting and / or selection via negative magnetic immunoadherence or flow cytometry that uses a cocktail of monoclonal antibodies directed to cell surface markers present on the cells negatively selected. For example, to enrich for CD4+cells by negative selection, a monoclonal antibody cocktail typically includes antibodies to CD14, CD20, CDl lb, CD16, HLA-DR. and CD8.
[0337] For isolation of a desired population of cells by positive or negative selection, the concentration of cells and surface (e.g, particles such as beads) can be varied. In certain embodiments, it may be desirable to significantly decrease the volume in which beads and cells are mixed together (i.e., increase the concentration of cells), to ensure maximum contact of cells and beads. For example, in one embodiment, a concentration of 2 billion cells / ml is used. In one embodiment, a concentration of 1 billion cells / ml is used. In a further embodiment, greater than 100 million cells / ml is used. In a further embodiment, a concentration of cells of 10, 15, 20, 25, 30, 35, 40, 45, or 50 million cells / ml is used. In yet another embodiment, a concentration of cells from 75, 80, 85, 90, 95. or 100 million cells / ml is used. In further embodiments, concentrations of 125 or 150 million cells / ml can be used. Using high concentrations can result in increased cell yield, cell activation, and cell expansion.
[0338] T cells can also be frozen after the washing step, which does not require the monocyte-removal step. While not wishing to be bound by theory, the freeze and subsequent thaw step provides a more uniform product by removing granulocytes and to some extent monocytes in the cell population. After the washing step that removes plasma and platelets, the cells may be suspended in a freezing solution. While many freezing solutions and parameters are known in the art and will be useful in this context, in a non-limiting example, one method involves using PBS containing 20% DMSO and 8% human serum albumin, or other suitable cell freezing media. The cells are then frozen to -80°C at a rate of 1°C per minute and stored in the vapor phase of a liquid nitrogen storage tank. Other methods of controlled freezing may be used as well as uncontrolled freezing immediately at -20°C or in liquid nitrogen.
[0339] In one embodiment, the population of T cells is comprised within cells such as peripheral blood mononuclear cells, cord blood cells, a purified population of T cells, and a T cell line. In another embodiment, peripheral blood mononuclear cells comprise the population of T cells. In yet another embodiment, purified T cells comprise the population of T cells.
[0340] Expansion of Immune Cells
[0341] Whether prior to or after modification of cells to express a subject CAR, the cells can be activated and expanded in number using methods as described, for example, in U.S. Patent Nos. 6,352,694; 6,534,055; 6,905,680; 6,692,964; 5,858,358; 6,887,466; 6,905,681; 7,144,575; 7,067,318; 7,172,869; 7,232,566; 7,175,843; 5,883,223; 6,905,874; 6,797,514; 6,867,041; and U.S. Publication No. 20060121005, the relevant contents of which are incorporated by reference. For example, the immune cells of the invention may be expanded by contact with a surface having attached thereto an agent that stimulates a CD3 / TCR complex associated signal and a ligand that stimulates a co-stimulatory molecule on the surface of the immune cells. In particular, immune cell populations may be stimulated by contact with an anti-CD3 antibody, or an antigen-binding fragment thereof, or an anti-CD2 antibody immobilized on a surface, or by contact with a protein kinase C activator (e.g., bryostatin) in conjunction with a calcium ionophore. For co-stimulation of an accessory molecule on the surface of the immune cells, a ligand that binds the accessory' molecule is used. For example, immune cells can be contacted with an anti-CD3 antibody and an anti- CD28 antibody, under conditions appropriate for stimulating proliferation of the immune cells. Examples of an anti-CD28 antibody include 9.3, B-T3, XR-CD28 (Diaclone, Besancon, France) and these can be used in the invention, as can other methods and reagents known in the art (see, e.g., ten Berge et al., Transplant Proc. (1998) 30(8): 3975-3977; Haanen et al., J. Exp. Med. (1999) 190(9): 1319-1328; and Garland et al., J. Immunol. Methods (1999) 227(1- 2): 53-63).
[0342] Expanding the immune cells by the methods disclosed herein can be multiplied by about 10-fold, 20-fold. 30-fold, 40-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold. 100-fold, 200-fold. 300-fold. 400-fold, 500-fold, 600-fold, 700 fold, 800-fold, 900-fold, 1000-fold, 2000-fold, 3000-fold, 4000-fold, 5000-fold, 6000-fold, 7000-fold, 8000-fold, 9000-fold, 10,000-fold, 100,000-fold, 1,000,000-fold, 10,000,000-fold, or greater, and any and all whole or partial integers therebetween. In one embodiment, the immune cells expand in the range of about 20-fold to about 50-fold.
[0343] Following culturing, the immune cells can be incubated in cell medium in a culture apparatus for a period of time or until the cells reach confluency or high cell density7for optimal passage before passing the cells to another culture apparatus. The culturing apparatus can be of any culture apparatus commonly used for culturing cells in vitro. In certain exemplary embodiments, the level of confluence is 70% or greater before passing the cells to another culture apparatus. In particularly exemplary7embodiments, the level of confluence is 90% or greater. A period of time can be any time suitable for the culture of cells in vitro. The immune cell medium may be replaced during the culture of the immune cells at any time. In certain exemplary embodiments, the immune cell medium is replaced about every 2 to 3 days. The immune cells are then harvested from the culture apparatus whereupon the immune cells can be used immediately or cryopreserved to be stored for use at a later time. In one embodiment, the invention includes cryopreserving the expanded immune cells. The cryopreserved immune cells are thawed prior to introducing nucleic acids into the immune cell.
[0344] In another embodiment, the method comprises isolating immune cells and expanding the immune cells. In another embodiment, the invention further comprises cryopreserving the immune cells prior to expansion. In yet another embodiment, the cryopreserved immune cells are thawed for electroporation with the RNA encoding the chimeric membrane protein.
[0345] Another procedure for ex vivo expansion cells is described in U.S. Pat. No. 5,199,942 (incorporated herein by reference). Expansion, such as described in U.S. Pat. No. 5,199,942 can be an alternative or in addition to other methods of expansion described herein. Briefly, ex vivo culture and expansion of immune cells comprises the addition to the cellular growth factors, such as those described in U.S. Pat. No. 5,199,942, or other factors, such as flt3-L, IL-1, IL-3 and c-kit ligand. In one embodiment, expanding the immune cells comprises culturing the immune cells with a factor selected from the group consisting of flt3-L. IL-1, IL-3, and c-kit ligand.
[0346] The culturing step as described herein (contact with agents as described herein or after electroporation) can be very short, for example less than 24 hours such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10. 11. 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 hours. The culturing step as described further herein (contact with agents as described herein) can be longer, for example 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or more days. Various terms are used to describe cells in culture. Cell culture refers generally to cells taken from a living organism and grown under controlled condition. A primary cell culture is a culture of cells, tissues or organs taken directly from an organism and before the first subculture. Cells are expanded in culture when they are placed in a growth medium under conditions that facilitate cell growth and / or division, resulting in a larger population of the cells. When cells are expanded in culture, the rate of cell proliferation is typically measured by the amount of time required for the cells to double in number, otherwise known as the doubling time.
[0347] Each round of subculturing is referred to as a passage. When cells are subcultured, they are referred to as having been passaged. A specific population of cells, or a cell line, is sometimes referred to or characterized by the number of times it has been passaged. For example, a cultured cell population that has been passaged ten times may be referred to as a PIO culture. The primary culture, i.e., the first culture following the isolation of cells from tissue, is designated PO. Following the first subculture, the cells are described as a secondaryculture (Pl or passage 1). After the second subculture, the cells become a tertiary culture (P2 or passage 2), and so on. It will be understood by those of skill in the art that there may be many population doublings during the period of passaging. Therefore, the number of population doublings of a culture is greater than the passage number. The expansion of cells (i.e., the number of population doublings) during the period between passaging depends on many factors, including but is not limited to the seeding density, substrate, medium, and time between passaging.
[0348] In one embodiment, the cells may be cultured for several hours (about 3 hours) to about 14 days or any hourly integer value in between. Conditions appropriate for immune cell culture include an appropriate media (e.g.. Minimal Essential Media or RPMI Media 1640 or, X-vivo 15, (Lonza)) that may contain factors necessary for proliferation and viability, including serum (e.g., fetal bovine or human serum), interleukin-2 (IL-2), insulin, IFN- gamma, IL-4, IL-7, GM-CSF, IL-10, IL-12, IL-15, TGF-beta, and TNF-a or any other additives for the growth of cells known to the skilled artisan. Other additives for the growth of cells include, but are not limited to. surfactant, plasmanate. and reducing agents such as N- acetylcysteine and 2-mercaptoethanol. Media can include RPMI 1640, AIM-V, DMEM, MEM, a-MEM, F-12, X-Vivo 15, and X-Vivo 20, Optimizer, with added amino acids, sodium pyruvate, and vitamins, either serum-free or supplemented with an appropriate amount of serum (or plasma) or a defined set of hormones, and / or an amount of cytokine(s) sufficient for the growth and expansion of immune cells. Antibiotics, e.g.. penicillin and streptomycin, are included only in experimental cultures, not in cultures of cells that are to be infused into a subject. The target cells are maintained under conditions necessary to support growth, for example, an appropriate temperature (e.g., 37° C) and atmosphere (e.g., air plus 5% CO2).
[0349] The medium used to culture the immune cells may include an agent that can costimulate the immune cells. For example, an agent that can stimulate CD3 is an antibody to CD3. and an agent that can stimulate CD28 is an antibody to CD28. This is because, as demonstrated by the data disclosed herein, a cell isolated by the methods disclosed herein can be expanded approximately 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 60-fold, 70-fold, 80- fold, 90-fold. 100-fold, 200-fold, 300-fold, 400-fold, 500-fold, 600-fold, 700-fold, 800-fold, 900-fold. 1000-fold, 2000-fold, 3000-fold, 4000-fold. 5000-fold, 6000-fold, 7000-fold, 8000- fold, 9000-fold, 10,000-fold, 100,000-fold, 1,000,000-fold, 10,000,000-fold, or greater. In one embodiment, the immune cells expand in the range of about 2-fold to about 50-fold, or more by culturing the electroporated population. In one embodiment, human T regulatory7cells are expanded via anti-CD3 antibody coated KT64.86 artificial antigen presenting cells (aAPCs). Methods for expanding and activating immune cells can be found in U.S. Patent Numbers 7,754,482, 8,722,400, and 9,555,105, the contents of which are incorporated herein in their entirety7.
[0350] In one embodiment, the method of expanding the immune cells can further comprise isolating the expanded immune cells for further applications. In another embodiment, the method of expanding can further comprise a subsequent electroporation of the expanded immune cells followed by culturing. The subsequent electroporation may include introducing a nucleic acid encoding an agent, such as a transducing the expanded immune cells, transfecting the expanded immune cells, or electroporating the expanded immune cells with a nucleic acid, into the expanded population of immune cells, wherein the agent further stimulates the immune cell. The agent may stimulate the immune cells, such as by stimulating further expansion, effector function, or another immune cell function.
[0351] Methods of Treatment
[0352] The CARs and modified immune cells (e.g., T cells) comprising the CARs described herein may be included in a composition for immunotherapy. The composition may include a pharmaceutical composition and further include a pharmaceutically acceptable carrier. A therapeutically effective amount of the pharmaceutical composition comprising the modified T cells may be administered. In one aspect, the invention includes a method for adoptive cell transfer therapy comprising administering to a subject in need thereof a modified T cell of the present invention. In another aspect, the invention includes a method of treating a disease or condition in a subject comprising administering to a subject in need thereof a population of modified T cells.
[0353] Also included is a method of treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of a modified immune cell of the invention of the current disclosure, or a modified immune cell generated by the methods of the invention of the current disclosure, thereby treating the cancer. In some embodiments, the immune cell comprises an isolated nucleic acid encoding a CAR of the invention of the current disclosure. In some embodiments, the modified immune cell is selected from the group consisting of a T cell, e.g, a CD8+ T cell (e.g., a CD8+ naive T cell, central memory T cell, or effector memory T cell), a CD4+ T cell, a natural killer T cell (NKT cells), a regulatory7T cell (Treg), a stem cell memory' T cell, a lymphoid progenitor cell, a hematopoietic stem cell, a natural killer cell (NK cell), a natural killer T cell (NK cell), and a dendritic cell. In some embodiments, the CAR of the invention has a binding specificity for an epitope of mKRAS presented in the context of HLA A* 11 or HLA A*2 complexes. In some embodiments, the cancer is a hematologic cancer. In some embodiments, the cancer is a solid cancer. In some embodiments, the cancer is associated with the expression of mKRAS. In some embodiments, the mKRAS is expressed by tumor cells. In some embodiments, the cancer is selected from the group consisting of pancreatic ductal adenocarcinoma (PDA), colon cancer, colorectal adenocarcinoma, myeloma, multiple myeloma, lung adenocarcinoma, melanoma, uterine cancer, thyroid cancer, acute myelogenous leukemia (AML), urothelial cancer, gastric adenocarcinoma and cervical adenocarcinoma, head and neck squamous cell carcinoma (SCC), Diffuse large B-cell lymphoma (DLBCL), esophageal adenocarcinoma, Chronic lymphocytic leukemia (CLL), lung SCC, small cell lung cancer (SCLC), renal papillary cancer, Hepatocellular carcinoma (HCC). breast cancer, cervical SCC, ovarian adenocarcinoma, adrenal cancer, prostate cancer, neuroblastoma, glioblastoma multiforme (GBM), medulloblastoma, Renal cell carcinoma (RCC), esophageal SCC, osteosarcoma, sarcoma, and small intestine neuroendocrine tumor (NET). It is also contemplated that the modified cells of the invention can be used to treat any mKRAS expressing cancer wherein the tumor cells also express HLA A* 11 or HLA A*2. In some embodiments, the subject is a human. In one aspect, the present disclosure provides a method for treating a disease or condition in a subject in need thereof comprising administering to the subject an engineered immune cell or precursor thereof comprising a CAR described herein. The composition can include a pharmaceutical composition and further include a pharmaceutically acceptable carrier. A therapeutically effective amount of the pharmaceutical composition can be administered to the subject.
[0354] In certain embodiments, described herein are compositions comprising a modified immune cell or precursor thereof comprising a CAR described herein, for use as a medicament.
[0355] In certain embodiments, described herein are compositions comprising a modified immune cell or precursor thereof comprising a CAR described herein for use as a medicament for the treatment of cancer.
[0356] In certain embodiments, described herein is use of a composition comprising a modified immune cell or precursor thereof comprising a CAR described herein for the manufacture of a medicament.
[0357] In certain embodiments, described herein is use of a composition comprising a modified immune cell or precursor thereof comprising a CAR described herein for the manufacture of a medicament for the treatment of cancer.
[0358] Treatment refers to a method that seeks to improve or ameliorate the condition being treated. With respect to cancer, treatment includes, but is not limited to, reduction of tumor volume, reduction in growth of tumor volume, increase in progression-free survival, or overall life expectancy. In certain embodiments, treatment will affect remission of a cancer being treated. In certain embodiments, treatment encompasses use as a prophylactic or maintenance dose intended to prevent reoccurrence or progression of a previously treated cancer or tumor. It is understood by those of skill in the art that not all individuals will respond equally or at all to a treatment that is administered, nevertheless these individuals are considered to be treated.
[0359] In some embodiments, the method comprises administering to the subject an engineered or modified immune effector cell comprising an isolated CAR comprising an antigen binding domain comprising a heavy chain variable region comprising an amino acid sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 27-31, 76, 84, 92, 99, 103, 107, 111, 115, 123. 128, 132, 137, 140, 146, 149, or 28; and a light chain variable region comprising an amino acid sequence at least 80%. 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 19-26, 77, 85, 93, 116, 124, 141, 150, or 213. In certain embodiments, the immune effector cell is a T cell.
[0360] In certain embodiments, the modified immune effector cell is further engineered or modified to express an immune-modulating agent. In certain embodiments, this immune modulating agent is a cytokine or chemokine. In certain embodiments, the cytokine is IL- 12. In certain embodiments, the cytokine is IL- 18. In certain embodiments, expression of the immune-modulating agent is operably linked to an inducible promoter. In certain embodiments, the inducible promoter is activated by the activity of the NF AT signaling system. In certain embodiments, the inducible promoter and the immune-modulating agent are comprised within in the same construct that encodes the CAR.
[0361] In certain embodiments, the cancer is associated with expression of mutant KRAS comprising a mutation residue G12 (e.g.. G12V). In certain embodiments, the mKRAS is expressed by a malignant cell of the subject. In certain embodiments, the malignant cells are associated with a solid cancer.
[0362] In certain embodiments, the method further comprises administering one or more additional therapeutics or interventions. There is no limitation on such additional therapeutics or interventions, which can include any therapeutic agents or small molecule drugs that is helpful for treating the subject in need thereof. In some embodiments, the additional therapeutics or interventions are administered with the antibody or antigen-binding fragments thereof or the scFv or engineered immune effector cell described herein, or the bispecific molecule or the immunoconjugates comprising these, as a combination therapy. Non-limiting examples of additional therapeutics or interventions include chemotherapy (e.g., asparaginase, busulfan, carboplatin, cisplatin, daunorubicin, doxorubicin, fluorouracil, gemcitabine, hydroxyurea, methotrexate, paclitaxel, rituximab, vinblastine, and / or vincristine), radiation therapy, immunotherapy, and other targeted therapy.
[0363] Compositions of the present disclosure can be administered in dosages and routes and at times to be determined in appropriate pre-clinical and clinical experimentation and trials. Compositions can be administered multiple times at dosages within these ranges. Administration of the compositions can be combined with other methods useful to treat the desired disease or condition as determined by those of skill in the art. In certain embodiments, the antibodies can be administered to a subject in need thereof by any route suitable for the administration of antibody-containing pharmaceutical compositions, such as, for example, subcutaneous, intraperitoneal, intravenous, intramuscular, intratumoral. or intracerebral, etc. In certain embodiments, the antibodies are administered intravenously. In certain embodiments, the antibodies are administered subcutaneously. In certain embodiments, the antibodies are administered intratumoral. In certain embodiments, the antibodies are administered on a suitable dosage schedule, for example, weekly, twice weekly, monthly, twice monthly, once every two weeks, once every three weeks, or once a month etc. In certain embodiments, the antibodies are administered once every three weeks. The antibodies can be administered in any therapeutically effective amount. In certain embodiments, therapeutically acceptable amount is between about 0.1 mg / kg and about 50 mg / kg. In certain embodiments, therapeutically acceptable amount is between about 1 mg / kg and about 40 mg / kg. In certain embodiments, therapeutically acceptable amount is between about 1 mg / kg and about 20 mg / kg. In certain embodiments, therapeutically acceptable amount is between about 1 mg / kg and about 10 mg / kg. In certain embodiments, therapeutically acceptable amount is between about 5 mg / kg and about 30 mg / kg. In certain embodiments, therapeutically acceptable amount is between about 5 mg / kg and about 20 mg / kg. Therapeutically effective amounts include amounts sufficient to ameliorate one or more symptoms associated with the disease or affliction to be treated.
[0364] In terms of the present disclosure, prophylactic, palliative, symptomatic and / or curative treatments may represent separate aspects of the disclosure. An anti-mKRAS CAR or modified immune cell or precursor thereof comprising a CAR disclosed herein can be administered parenterally, such as intravenously, such as intramuscularly, such as subcutaneously. Alternatively, a modified immune cell or precursor thereof comprising a CAR of the present disclosure can be administered via a non-parenteral route, such as orally or topically. A modified immune cell or precursor thereof comprising a CAR of the present disclosure can be administered therapeutically (on demand).
[0365] Pharmaceutical Compositions, Kits, and Methods of Making the Compositions
[0366] Also provided are pharmaceutical compositions comprising any one of the modified or engineered immune cells comprising the CARs disclosed herein. Among the compositions are pharmaceutical compositions and formulations for administration, such as for treatment of a disease or disorder. Also provided are therapeutic methods for administering the pharmaceutical compositions to subjects, e.g., human subjects.
[0367] The pharmaceutical compositions and formulations generally include one or more optional pharmaceutically acceptable carrier or excipient. In some embodiments, the composition includes at least one additional therapeutic agent. The term "pharmaceutical formulation" refers to a preparation which is in such form as to permit the biological activity of an active ingredient contained therein to be effective, and which contains no additional components which are unacceptably toxic to a subject to which the formulation would be administered.
[0368] A "pharmaceutically acceptable carrier" refers to an ingredient in a pharmaceutical formulation, other than an active ingredient, which is nontoxic to a subject. A pharmaceutically acceptable carrier includes, but is not limited to, a buffer, excipient, stabilizer, or preservative. In some aspects, the choice of carrier is determined in part by the particular composition and / or by the method of administration. Accordingly, there are a variety of suitable formulations. For example, the pharmaceutical composition can contain preservatives. Suitable preservatives can include, for example, methylparaben, propylparaben, sodium benzoate, and benzalkonium chloride. In some aspects, a mixture of two or more preservatives is used. The preservatives or mixtures thereof are typically present in an amount of about 0.0001% to about 2% by weight of the total composition. Carriers are described, e.g.. by Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980). Pharmaceutically acceptable earners are generally nontoxic to recipients at the dosages and concentrations employed, and include, but are not limited to: buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzy l ammonium chloride; hexamethonium chloride; benzalkonium chloride; benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3- pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol; salt-forming counter-ions such as sodium; metal complexes (e.g, Zn- protein complexes); and / or non-ionic surfactants such as polyethylene glycol (PEG).
[0369] Buffering agents in some aspects are included in the compositions. Suitable buffering agents include, for example, citric acid, sodium citrate, phosphoric acid, potassium phosphate, and various other acids and salts. In some aspects, a mixture of two or more buffering agents is used. The buffering agent or mixtures thereof are typically present in an amount of about 0.001% to about 4% by weight of the total composition. Methods for preparing administrable pharmaceutical compositions are known. Exemplary methods are described in more detail in, for example, Remington: The Science and Practice of Pharmacy. Lippincott Williams & Wilkins; 21st ed. (May 1, 2005).
[0370] The formulations can include aqueous solutions. The formulation or composition can also contain more than one active ingredient useful for the particular indication, disease, or condition being treated with the composition, preferably those with activities complementary to the composition, where the respective activities do not adversely affect one another. Such active ingredients are suitably present in combination in amounts that are effective for the purpose intended. Thus, in some embodiments, the pharmaceutical composition further includes other pharmaceutically active agents or drugs, such as chemotherapeutic agents, e.g, asparaginase, busulfan, carboplatin, cisplatin, daunorubicin, doxorubicin, fluorouracil, gemcitabine, hydroxyurea, methotrexate, paclitaxel, rituximab, vinblastine, and / or vincristine. The pharmaceutical composition in some embodiments contains the composition in an amount effective to treat or prevent the disease or condition, such as a therapeutically effective or prophylactically effective amount. Therapeutic or prophylactic efficacy in some embodiments is monitored by periodic assessment of treated subjects. The desired dosage can be delivered by a single bolus administration of the composition, by multiple bolus administrations of the composition, or by continuous infusion administration of the composition.
[0371] Formulations include those for oral, intravenous, intraperitoneal, subcutaneous, pulmonary, transdermal. intramuscular, intranasal, buccal, sublingual, or suppository administration. Tn some embodiments, the composition is administered parenterally. The term "parenteral," as used herein, includes intravenous, intramuscular, subcutaneous, rectal, vaginal, and intraperitoneal administration. In some embodiments, the composition is administered to the subject using peripheral systemic delivery by intravenous, intraperitoneal, or subcutaneous injection. Compositions in some embodiments are provided as sterile liquid preparations, e.g., isotonic aqueous solutions, suspensions, emulsions, dispersions, or viscous compositions, which can in some aspects be buffered to a selected pH. Liquid preparations are normally easier to prepare than gels, other viscous compositions, and solid compositions. Additionally, liquid compositions are somewhat more convenient to administer, especially by injection. Viscous compositions, on the other hand, can be formulated within the appropriate viscosity range to provide longer contact periods with specific tissues. Liquid or viscous compositions can comprise carriers, which can be a solvent or dispersing medium containing, for example, water, saline, phosphate buffered saline, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol) and suitable mixtures thereof. Sterile injectable solutions can be prepared by incorporating the composition in a solvent, such as in admixture with a suitable carrier, diluent, or excipient such as sterile water, physiological saline, glucose, dextrose, or the like. The compositions can contain auxiliary substances such as wetting, dispersing, or emulsifying agents (e.g., methylcellulose), pH buffering agents, gelling or viscosity enhancing additives, preservatives, flavoring agents, and / or colors, depending upon the route of administration and the preparation desired. Standard texts can in some aspects be consulted to prepare suitable preparations.
[0372] Various additives which enhance the stability and sterility' of the compositions, including antimicrobial preservatives, antioxidants, chelating agents, and buffers, can be added. Prevention of the action of microorganisms can be ensured by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, and sorbic acid. Prolonged absorption of the injectable pharmaceutical form can be brought about by the use of agents delaying absorption, for example, aluminum monostearate and gelatin.
[0373] The formulations to be used for in vivo administration are generally sterile. Sterility' can be readily accomplished, e.g.. by filtration through sterile filtration membranes.
[0374] The contents of the articles, patents, and patent applications, and all other documents and electronically available information mentioned or cited herein, are hereby incorporated by reference in their entirety to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference. Applicants reserve the right to physically incorporate into this application any and all materials and information from any such articles, patents, patent applications, or other physical and electronic documents.
[0375] In certain embodiments the modified immune cell or precursor thereof comprising an anti-mKRAS CAR of the current disclosure are included in a pharmaceutical composition comprising one or more pharmaceutically acceptable excipients, carriers, and diluents. Pharmaceutically acceptable excipients, carriers and diluents can be included to increase shelf-life, stability, or the administrability of the modified immune cell or precursor thereof. Such compounds include salts, pH buffers, detergents, anti-coagulants, and preservatives. In certain embodiments, the antibodies of the current disclosure are administered suspended in a sterile solution. In certain embodiments, the solution comprises about 0.9% NaCl. In certain embodiments, the solution comprises about 5.0% dextrose. In certain embodiments, the solution further comprises one or more of: buffers, for example, acetate, citrate, histidine, succinate, phosphate, bicarbonate and hydroxymethylaminomethane (Tris); surfactants, for example, polysorbate 80 (Tween 80), polysorbate 20 (Tween 20). and pol oxamer 188; poly ol / disaccharide / poly saccharides, for example, glucose, dextrose, mannose, mannitol, sorbitol, sucrose, trehalose, and dextran 40; amino acids, for example, glycine or arginine; antioxidants, for example, ascorbic acid, methionine; or chelating agents, for example, EDTA or EGTA.
[0376] Also described herein are kits comprising one or more of the modified immune cells described herein in a suitable container and one or more additional components selected from: instructions for use; a diluent, an excipient, a carrier, and a device for administration.
[0377] While the present disclosure has been described with reference to the specific embodiments thereof, it should be understood by those skilled in the art that various changes can be made, and equivalents can be substituted without departing from the true spirit and scope of the present disclosure. It will be readily apparent to those skilled in the art that other suitable modifications and adaptations of the methods described herein can be made using suitable equivalents without departing from the scope of the embodiments disclosed herein. In addition, many modifications can be made to adapt a particular situation, material, composition of matter, process, process step or steps, to the objective, spirit and scope of the present disclosure. All such modifications are intended to be within the scope of the claims appended hereto. Having now described certain embodiments in detail, the same will be more clearly understood by reference to the following examples, which are included for purposes of illustration only and are not intended to be limiting.
[0378] EXAMPLES
[0379] The present disclosure is further described in detail by reference to the following experimental examples. These examples are provided for purposes of illustration only and are not intended to be limiting unless otherwise specified. Thus, the present disclosure should in no way be construed as being limited to the following examples, but rather, should be construed to encompass any and all variations which become evident as a result of the teaching provided herein. While preferred embodiments of the present invention have been shown and described herein, it is understood by those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the present disclosure. It should be understood that various alternatives to the embodiments of the present disclosure described herein can be employed in practicing the present disclosure. All publications, patent applications, issued patents, and other documents referred to in this specification are herein incorporated by reference as if each individual publication, patent application, issued patent, or other document was specifically and individually indicated to be incorporated by reference in its entirety. Definitions that are contained in text incorporated by reference are excluded to the extent that they contradict definitions in this disclosure.
[0380] Without further description, it is believed that one of ordinary skill in the art can, using the preceding description and the following illustrative examples, make and utilize the compounds of the present disclosure and practice the claimed methods. The following working examples, therefore, specifically point out some embodiments of the present disclosure.
[0381] The materials and methods used in the following examples are now described.
[0382] Cell Lines and Primary Human T Cells. All cell lines were cultured in complete medium (CM) comprising of RPMI 1640 (GIBCO) supplemented with 10% FBS (VWR), 100 U / mL of penicillin, and 100 pg / mL of streptomycin at 37 °C and 5% CO2. Cell line origins are listed in the Key Resource Table. All cell lines were routinely tested for mycoplasma. Human CAR-T cells were generated from normal donor T cells provided by the University of Pennsylvania Human Immunology7Core. All primary' T cell studies were covered through approval by the University of Pennsylvania Institutional Review Board (IRB). All de-identified donors signed approved consent forms. All cell lines were routinely tested for mycoplasma. Details are listed in Methods Details (Cell lines section). Normal donor T cells: T cells were isolated from healthy volunteers who previously signed an informed consent, which authorized use for general research purposes. Samples were centrally collected and sent to the laboratory for processing after complete anonymization. Normal donor T cells were cultured in CM with cytokine supplementation (Biolegend).
[0383] Animal Model Details. NOD / SCID / IL2ry null (NSG) mice were purchased from the Stem Cell and Xenograft Core (University of Pennsylvania). Mice (6-12 weeks old) were kept in a pathogen-free environment wi thin individually ventilated cages. Animal studies were performed in full accordance with the University of Pennsylvania Animal Model Details NOD / SCID / IL2ry null (NSG) mice were purchased from the Stem Cell and Xenograft Core (University' of Pennsylvania). Mice (6-12 weeks old) were kept in a pathogen-free environment within individually ventilated cages. The specific designs of in vivo studies are indicated at each experiment in the present disclosure. Both male and female animals were employed for separate experimental replicates. ReD platform screening for anti-mKRAS pMHC scFv. HLA-A* 11 :01 MHC complexes for antibody discovery and all characterization assays were expressed in E. coli as insoluble inclusion bodies and were refolded via dialysis against glutathione buffer with mKRAS peptides as per standard methods. Myrio's Ruby scFv library (>10 11 clone diversity) was panned for two rounds using mKRAS peptide-MHC bound to MyOne Streptavidin Cl Dynabeads (ThermoFisher). Panned library output was transferred into the Retained Display (ReD) cell-display platform (Myrio Bio) and cells were permeabilized using 0.5% n-octyl P-d-thioglucopyranoside (Anatrace) and labeled using mKRAS MHC ligated to fluorophores excitable by 405 nm and 488 nm lasers. Cells that were positive for target binding were isolated using the FACSMelody sorter (Becton-Dickinson). After two rounds of positive selection, two further FACS rounds were conducted using counter-labelled WT KRAS MHC complexed with unrelated peptides. After 4 rounds of FACS, individual colonies were picked and grown in 96-well plates before scFv induction, cell permeabilization, and mKRAS MHC labelling and detection by CytoFLEX (Beckman Coulter). Clones that were identified as binding specifically to the target complex were sequenced and unique scFvs were expressed as fusions to the AviTag biotinylation motif in E. coli. Biotinylated scFv protein was released via permeabilization with 0.5% n-octyl P-d- thioglucopyranoside and purified to -90% purity on Nickel NTA agarose resin (ABT).
[0384] ScFv Affinity Measurements. Affinity measurements were performed using the Gator Bio biolayer interferometry instrument (Gator Bio) and analyzed using GatorOne software. Streptavidin biosensors were loaded with AviTag- biotinylated scFv, blocked with biotin, washed in PBS, and then associated with mKRAS MHC protein in PBS.
[0385] Steady state scFv binding assay. A bead-based fluorometric assay was developed to measure scFv binding to soluble MHC complex. Briefly, 50 pg streptavidin coated Dynabeads were incubated with excess biotinylated scFv before being blocked with free biotin and washed in PBS. Fluorophore-labelled MHC complex was added to a concentration of 3.5 nM and incubated for 1 hour at 4 °C, followed by 10 minutes at 25 °C. Binding of MHC by scFv-coated beads was quantified using the CytoFLEX instrument and normalized to controls, including binding by beads without scFv and binding to unrelated MHC complex. The bead-based assay described above was used to assess scFv binding to a panel of 95 unrelated peptides refolded in the relevant HLA compared to target pHLA, as a preliminary readout of scFv selectivity. It was also used to characterize the ‘footprint’ of scFv binding on target peptide-HLA using X- scanning mutagenesis for the assessment of scFv crossreactivity toward peptides with homology to target peptide, identified using sequence-based analyses. Binding motifs determined by X-Scanning were uploaded to ScanProsite to analyze them against protein sequence databases (e.g, UniProtKB / Swiss-Prot) and identify any known human proteins containing the tolerated amino acids in the correct sequence. Identified peptides were then cross-referenced with The Immune Epitope Database (IEDB.org) to determine whether any are known to be presented.
[0386] Bispecific T cell engager cytotoxicity assay. Monoallelic cell lines stably expressing single chain B2m-HLA-A* l 1:01 fusion proteins in addition to a ICP47 HSV TAP inhibitor and eGFP were established using the K562 cell line (ATCC), which lacks surface expression of HLA-A alleles. For bispecific-mediated cytotoxicity assays, K562 target cells expressing the HLA allele of interest were washed and resuspended in fresh CM containing KRAS G12V or wildtype (7-16) peptide at luM concentration or solvent control (DMSO). The cell- peptide suspensions were then aliquoted into 96 well plates at 15,000 cells per well and incubated for 3 hours at 28°C and 5% CO2. Bispecific antibodies to be tested were added to the peptide-pulsed cells and incubated for a further 30 minutes at 28°C. before addition of CD3 / CD28-activated human cytotoxic T lymphocytes (50,000 per well; effectortarget ratio of 3 : 1 ). Assays were then incubated for 24 hours at 37°C and 5% CO2. and flow cytometry used to measure live and intact target cells on the basis of Sytox Blue viability staining and eGFP expression to discriminate target cells from effectors. Cytotoxicity7was calculated relative to controls lacking bispecific antibodies. All measurements were carried out in triplicate.
[0387] Design and molecular cloning of lenti viral constructs. The mKRAS scFv sequence was synthesized (Genscript) and cloned into 3rd generation self-inactivating (SIN) lentiviral transfer vector pTRPE that is used in the art for clinical CAR-T cell manufacturing. UniVect construct pASP18 was previously described, and construct pABL2 was generated by subcloning the RU96-14 CAR scFv into pASP19. All genetic constructs were prepared using standard digest and ligate restriction enzymes-based molecular cloning techniques and w ere sequence verified. All cloning and plasmid propagation steps were performed in XL 1 -Blue Super competent Cells (Agilent Technologies, Cat# 200236) to maintain integrity7of lentiviral transfer plasmids.
[0388] Lentivirus production. The human embryonic kidney (HEK) 293 T cell line (ATCC) were grown to 70% confluency in CM at 37 °C and 5% CO2. UniVect transfer plasmid and lentiviral packaging plasmids pRSV.REV (Rev expression vector), pMDLg / p.RRE (Gag / Pol expression plasmid) and pVSV-G (VSV glycoprotein expression vector) were added to Opti- MEM (Thermo Cat. 31985088) at a 15: 18: 18:7 mass-unit ratio. This mixture was added to a 10: 1 Opti-MEM and Lipofectamine 2000 (Thermo Cat# 11668019) mixture at 1 : 1 volume ratio and let incubate at RT for 15 min before addition to HEK 293T cells in fresh culturing media. Supernatants containing the lentivirus were collected at 24 h and 48 h and passed through 0.45 pm filters. Filtered lentivirus product was concentrated by ultracentrifugation at 25 000 rpm for 2.5 h and stored at -80 °C. The viral titer was determined by transducing HEK 293T cells and expressed as Infection Units per mL.
[0389] Generation of mKRAS NeoCARs. T-Cell activation, transduction and expansion Healthy donor primary human T cells were purchased from the Human Immunology Core (University of Pennsylvania). CD4 + + and CD8 T cells were combined at 1: 1 ratio and stimulated with anti-CD3 / CD28 dynabeads (Invitrogen) in a 3: 1 ratio on Day 0. After 24 h (Day 1), lentivirus was added at a multiplicity of infection (MOI) of 1-5 (depending on the experiment). CM volume was doubled every 2 days until Day 6 when Dynabeads were removed by magnetic separation. Cells were then counted every 1-2 days by Coulter Counter (Beckman Coulter) and maintained at 0.75 x 10 6 cells / mL by addition of fresh IL-7 / 15 (10 ng / mL each, R&D systems) supplemented CM until day 11 when media was switched to non- supplemented CM. Cells were either frozen or used experimentally once the cell volume reached 280- 330 fL at around Day 14. During manufacturing, T cells were maintained at 37 °C and 5% CO2. The transduction efficiency was determined by flow cytometry for the expression of relevant gene (mCherry or immune receptor). For experiments with Jurkat cell line, cells were transduced lentiviruses at various MOI 3 and used in experiments 3-5 days later.
[0390] TCR Knockout in CAR-T cells using CRISPR / Cas9 RNPs. Healthy donor primary human T cells were purchased from the Human Immunology Core (University of Pennsylvania). CD4 + + and CD8 T cells were combined at 1: 1 number ratio. On Day 0 T- cells were centrifuged and resuspended in fresh CM supplemented with IL-2 (200 IU / UL, BioLegend) IL-7 and IL-15 (5 ng / mL each, R&D Systems) with a 1 : 1 ratio of CD3 / 28 Dynabeads. On Day 2 T-cells were de-beaded was washed with PBS. Ipg TRAC targeting sgRNA (IDT) (5’- UGUGCUAGACAUGAGGUCUA-3', SEQ ID NO: 211) and Ipg SpyFi Cas9 (Aldevron) for 10 min. PBS was aspirated from washed T-cells and the 50e6 / ml (le6 in 20uL) cells were electroporated using the Amaxa P3 Primary Cell kit and protocol (Lonza) with a Lonza 4-D Nucleofector electroporation device (Cat# AAF-1002B model). After electroporation, cells were resuspended in IL-2 (200 IU / uL) IL-7 and IL-15 (5 ng / mL each) supplemented CM for ~12 days of additional expansion. On day 7 of expansion, edited TCR - CAR-T cell products were purified by negative selection with anti-biotin microbeads (Miltenyi Cat# 130-105-637) and biotin conjugated anti-CD3 (Biolegend, Cat# 317320) on a MACS separation column (Miltenyi, Cat# 130-042-201) where the remaining CD3 positive, and therefore TCR +, cells were removed. Flow through containing TCR - cells was collected and cells were placed in fresh CM with cytokines.
[0391] Flow cytometry. Samples were spun down at 1300 RPM, then washed once with staining buffer. Samples collected from mice had 2 mL of Ack Lysis buffer added for 5 min to lyse red blood cells then washed once with PBS. Samples were stained for CAR surface expression for 30 minutes at room temperature with 100 pL solution containing the goat polyclonal anti-human IgG (Sigma- Aldrich, Cat# I1886-2ML) conjugated with Lightning- Link APC (Expedeon). After CAR staining, samples were washed three times with staining buffer and then incubated at 4°C for 30 minutes in 100 pL of an antibody cocktail to label the experimentally indicated human surface markers. Samples were washed three times and incubated with Live / Dead Aqua (Thermo-Fischer Scientific Cat# L-34966) for 10 minutes to discriminate live and dead cells. Samples were washed twice to remove Live / Dead Aqua before being run on a Fortessa.
[0392] Peptide titration / pulsing. K562 cells transduced with the indicated HLA-A construct w ere added to a 96 well plate at 20,000 cells / well in CM. For Jurkat based screens the following 10-mer KRAS peptides, Al l Mut: VVVGAVGVGK (SEQ ID NO: 1), Al l WT: VVVGAGGVGK (SEQ ID NO: 2), A2 Mut: KLVVVGAVGV (SEQ ID NO: 212), A2 WT: KLVVVGAGGV (SEQ ID NO: 213) were added to achieve a concentration of luM. For titrations, the indicated peptide and concentration was achieved for each replicate. After 90 min incubation at 37 C the peptide pulsed cells were centrifuged, washed with CM, then fresh CM was added. Next, mKRAS NeoCAR transduced Jurkat or primary' T cells were normalized for transduction added to achieve an E:T ratio of 2: 1 in 200uL CM. Target and Effector cells co-cultured for 24 h at 37 °C and 5% CO2 and supernatants were collected for cytokine quantification by ELISA according to the manufacturer’s instructions (BioLegend) as follows: human hlFN-y was detected by hlFN-y (BioLegend, Cat# 430104), human hIL-2 was detected by hIL-2 (BioLegend, Cat# 431804) and hIL- 12 was hIL-12 (BioLegend, Cat# 431704).
[0393] Luciferase based killing assays. Lytic function of mKRAS NeoCARs was measured using the LucScreen xtended-Glow' Luciferase Reporter Gene Assay System (Applied Biosystems). NeoCAR-T cells and tumor cells expressing click beetle green luciferase (CBG) were combined at the indicated E:T ratios in a total of 200 pL CM in a white opaque walled flat bottom plate and co-cultured for 48 h at 37 °C and 5% CO2. Plates were centrifuged and 100 pL of medium was removed from each well for further analysis by ELISA. Luciferase buffer was added directly into the plate according to the manufacturer’s protocol. Luciferase readings were obtained using a microplate reader (BioTek Synergy H4). Cytotoxicity was calculated using the following equation where: (1 - luminescence(CAR-T cells + target cells) / luminescence(Target cells)) x 100.
[0394] Cell binding avidity assay. COR-L tumor cells were attached in a monolayer on poly- L-lysine-coated chips for at least 3 h prior to testing on the z-Movi Cell Avidity Analyzer (Lumicks). CellTrace far-red labelled (ThermoFisher Scientific) CAR T cells from various donors were normalized for transduction efficiency and bound for 5 min prior to ramping up acoustic force from 0-1000 pN. Experiments were performed in triplicate with each of the three T cell conditions ran once on each chip. Cell detachment was analyzed using Ocean software. Experiments and analysis were conducted according to manufacturer recommendations.
[0395] MHC I upregulation assay. On Day 0 50,000 indicated target cells were added to a 24 well flat bottom plate. Next, mKRAS NeoCAR- T cells were normalized for transduction and added to achieve an E:T ratio of 2: 1 in 1 mL CM. Target and effector cells co-cultured for 24 h at 37 °C and 5% CO2. On Day 1, fresh target cells were added to a new 24 well plate in 500uL. Co-cultures were centrifuged and 500uL of supernatant was added to the fresh target cells to achieve a final volume of 1 mL. Target cells were cultured with supernatants for 24 h. Additional supernatant was saved for cytokine quantification by ELISA. On Day 2 Target cells were detached form the plate with TrypLE express (ThermoFisher) and analyzed for MHC I expression by flow cytometry.
[0396] Incucyte based spheroid assays. On day -3 1,250 target cells expressing GFP were plated in a 96 well round bottom ultra-low attachment plate (S-bio) in lOOuL CM. Next, mKRAS NeoCAR-T cells were normalized for transduction and 20,000 CAR+ cells were added to achieve an estimated E:T ratio of 2: 1 in 200 uL CM. Additionally, 0. 1 ug of CD45- PE was added to each well to visualize T cells. Co-cultures were placed in an Incycyte SX5 device (Sartorius) for 48 h and imaged every’ 3-6 hours in the trans, orange, and green channels. Normalized percent killing was calculated using fluorescence in the green channel and the equation (total intensity time=n / total intensity time=0) x 100.
[0397] Stimulation based assays. T cell products were stimulated according to specific experiment for 24 h either with 0.5x cell stimulation cocktail (Invitrogen), 1 : 1 CD3 / 28 beads, or through 2: 1 E:T co-culture with COR-L target cells. Cytokine levels were measured by a sandwich ELISA according to the manufacturer’s instructions (BioLegend) as follows: human hlFN-y was detected by hlFN-y (BioLegend, Cat# 430104), human hIL-2 was detected by hIL-2 (BioLegend, Cat# 431804) and hIL-12 was hIL-12 (BioLegend, Cat# 431704).
[0398] Animal studies. NOD / SCID / IL2ry null (NSG) mice were purchased from the Stem Cell and Xenograft Core (University of Pennsylvania). Female and male mice (6-12 weeks old) were kept in a pathogen-free environment within individually ventilated cages following protocols approved by the University of Pennsylvania Institutional Animal Care and Use Committee (IACUC protocol n. 805773). The specific designs of in vivo studies are indicated at each experiment in the manuscript. For solid human COR-L23 A*11 :01 ovarian cancer tumor models, mice were intravenously (i.v.) injected via tail veins with 0.25e6 tumor cells. After 7 days when tumors were established and confirmed by imaging, mKRAS NeoCARs were injected i.v. at doses indicated in the specific experiments in the figure. Tumor progression / clearance was measured via bioluminescence imaging and quantified as the total flux per second. Mice were sacrificed upon losing 20% body weight or reaching a total flux of more than 5el0 photons / s. Blood samples were collected via retro-orbital bleeds of days 18 and 25 post tumor injection. Number of peripheral blood T cells was quantified using countbright beads (Invitrogen). The staining panel consisted of anti-human CD3, anti- human CD45, anti-human CD8 and anti-human CD4. Plasma samples were collected from remaining blood and use for cytokine quantification by ELISA.
[0399] Quantification and statistical analysis. Information on specific statistical tests used is provided in the figure legends and / or Method Details. Statistical analysis was performed in GraphPad Prism 8.0 (GraphPad). Each figure legend denotes the statistical test used. All central tendencies indicate the mean, and all error bars indicate standard deviation unless otherwise indicated. Statistical analysis and tests performed included 2-tailed Student t test, Two-way ANOVA or ANOVA multiple-comparison with P values generated using Tukey’s or Welch multiple-comparisons test. For non-parametric comparisons, Kruskal-Wallis tests were used. All t-tests were two-sided. In figures, p values are shown. Log-Rank Mantel-Cox test was used for survival analysis. Technical replicates were assumed to be normally distributed, otherwise no assumptions of normality were made. Statistical details of all experiments can be found in figure legends.
[0400] Example 1: Isolation and characterization...
Claims
CLAIMSWhat is claimed is:
1. An antigen-binding domain targeting an epitope of mutant KRAS (mKRAS), wherein the antigen-binding domain comprises a VH region comprising three heavy chain complementarity determining regions (HCDRs) and a VL region comprising three light chain complementarity determining regions (LCDRs), wherein the antigen-binding domain comprises 90%, 95%, 96%, 96%, 97%, 98%, or 99% identity to an antigen-binding domain selected from the group consisting of: a) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 32, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 33, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 34; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 35, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 36, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 37; b) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 32, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 33, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 38; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 39, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 41; c) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 32, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 33, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 38; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 42, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 43; d) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 32, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 33, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 38; and a VLregion comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 42, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 44; e) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 32, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 33, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 45; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 42, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 46; f) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 32, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 33, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 45; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 42, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 47; g) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 32, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 33, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 48; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 42 an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 49; h) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 32, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 33, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 50; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 42, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 51; i) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 78, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 79, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 38; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ IDNO: 80, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 81; j) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 86, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 87, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 38; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 88, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 89; k) a Vu region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 78, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 79, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 94; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 95, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 96; l) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 78, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 79, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 100; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 95, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 96; m) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 78, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 79, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 104; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 95, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 96; n) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 78, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 79, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 108; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ IDNO: 95, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 96; o) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 78, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 79, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 112; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 95, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 96; p) a Vu region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 117, an HCDR2 comprising the amino acid sequence of SEQ ID NO:118, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 38; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 119, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 120; q) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 117, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 118, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 108; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 125, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 126; r) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 78, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 79, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 129; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 95, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 96; s) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 117, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 133, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 134; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ IDNO: 119, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 120; t) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 78, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 79, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 38; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 95, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 96; u) a Vu region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 117, an HCDR2 comprising the amino acid sequence of SEQ ID NO:118, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 142; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 95, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 143; and v) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 117, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 133, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 108; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 119, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 120; w) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 117, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 118, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 94; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 80, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 151, and x) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 32, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 33, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 38; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ IDNO: 39, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO:
215. wherein the epitope of mKRAS comprises a G12V mutation and is presented in the context of an HLA complex.
2. The antigen-binding domain of claim 1, wherein the antigen-binding domain comprises: a) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 32, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 33, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 34; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 35, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 36, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 37; b) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 32, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 33, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 38; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 39, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 41; c) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 32, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 33, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 38; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 42, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 43; d) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 32, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 33, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 38; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 42, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 44;e) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 32, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 33, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 45; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 42, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 46; f) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 32, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 33, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 45; and a Vi, region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 42, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 47; g) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 32, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 33, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 48; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 42, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 49; h) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 32, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 33, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 50; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 42, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 51; i) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 78, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 79, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 38; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 80, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 81;j) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 86, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 87, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 38; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 88, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 89; k) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 78, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 79, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 94; and a Vi, region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 95, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 96; l) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 78, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 79, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 100; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 95, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 96; m) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 78, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 79, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 104; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 95, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 96; n) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 78, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 79, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 108; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 95, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 96;o) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 78, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 79, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 112; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 95, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 96; p) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 117, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 118, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 38; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 119, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 120; q) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 117, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 118, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 108; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 125, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 126; r) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 78, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 79, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 129; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 95, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 96; s) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 117, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 133, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 134; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 119, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 120;t) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 78, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 79, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 38; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 95, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 96; u) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 117, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 118, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 142; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 95, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 143; and v) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 117, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 133, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 108; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 119, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 120; w) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 117, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 118, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 94; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 80, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 151; or x) a VH region comprising an HCDR1 comprising the amino acid sequence of SEQ ID NO: 32, an HCDR2 comprising the amino acid sequence of SEQ ID NO: 33, an HCDR3 comprising the amino acid sequence of SEQ ID NO: 38; and a VL region comprising an LCDR1 comprising the amino acid sequence of SEQ ID NO: 39, an LCDR2 comprising the amino acid sequence of SEQ ID NO: 40, and an LCDR3 comprising the amino acid sequence of SEQ ID NO: 215.
3. The antigen-binding domain of claim 1 or 2, wherein the antigen-binding domain comprises: a) a heavy chain variable (VH) region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 27-31, 76, 84, 92, 99, 103, 107, 111, 115, 123, 128, 132, 137, 140, 146, 149, and 213; and b) a light chain variable (VL) region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 19-26, 77, 85, 93, 93, 93, 93, 93, 116, 124, 93, 116, 93, 141, 116, 150, and 214.
4. The antigen-binding domain of claim 3, wherein the antigen-binding domain comprises: a) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 27 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 19; b) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 28 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 20; c) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 28 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 21; d) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 28 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 22; e) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 29 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 23; f) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 29 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 24; g) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 30 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 25; h) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 31 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 26; i) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 76 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 77; j) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 84 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 85;k) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 92 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 93; l) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 99 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 93; m) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 103 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 93; n) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 107 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 93; o) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 111 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 93; p) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 115 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 116; q) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 123 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 124; r) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 128 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 93; s) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 132 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 116; t) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 137 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 93; u) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 140 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 141; v) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 146 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 116; w) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 149 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 150, and x) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 28 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 214.
5. The antigen binding domain of any one of claims 1-4, wherein the antigen binding domain comprises a single-chain variable fragment (scFv).
6. The antigen binding domain of claim 5, wherein the antigen binding domain comprises an amino acid sequence set forth in any one of SEQ ID NOs: 11-18, 75, 83, 91, 98, 102, 106, 110, 114, 122, 231, 131, 136, 139, 145, 148, or 216.
7. The antigen binding domain of any one of claims 1-6, wherein the epitope of mKRAS is presented in the context of an HLA A*11 complex.
8. The antigen binding domain of any one of claims 1-6, wherein the epitope of mKRAS is presented in the context of an HLA A*2 complex.
9. A bispecific antibody comprising the antigen-binding domain of any one of claims 1-8.
10. The bispecific antibody of claim 9, wherein the bispecific antibody is a bispecific immune-cell engaging antibody.
11. The bispecific antibody of claim 10, wherein the bispecific immune cell engager is a bispecific T-cell engager (BiTE) antibody.
12. The bispecific antibody of claim 11, wherein the BiTE antibody targets mKRAS / HLA complex and CD3 epsilon (CD3e), optionally wherein CD3e comprises the amino acid sequence of SEQ ID NO: 166 or is encoded by the nucleotide sequence of SEQ ID NO: 167.
13. The bispecific antibody of claim 12, wherein the BiTE antibody comprises an amino acid sequence set forth in any one of SEQ ID NOs:82, 90, 97, 101, 105, 109, 113, 121, 127, 130, 135, 138, 144, 147, and 152-157.
14. A chimeric antigen receptor (CAR) comprising the antigen-binding domain of any one of claims 1-8, a transmembrane domain, and an intracellular domain.
15. The CAR of claim 14, wherein the transmembrane domain is a CD8 transmembrane domain.
16. The CAR of claim 15, wherein the CD8 transmembrane domain comprises an amino acid sequence set forth in SEQ ID NO: 54.
17. The CAR of any one of claims 14-16, wherein the intracellular domain comprises a costimulatory signaling domain and an intracellular signaling domain.
18. The CAR of claim 17, wherein the costimulatory signaling domain is a 4-1BB costimulatory domain or a CD28 costimulatory domain.
19. The CAR of claim 17 or 18, wherein the costimulatory domain comprises an amino acid sequence set forth in SEQ ID NO: 55 and / or SEQ ID NO: 56.
20. The CAR of any one of claims 14-19, wherein the intracellular signaling domain is a CD3 zeta intracellular signaling domain.
21. The CAR of claim 20, wherein the CD3 zeta intracellular signaling domain comprises an amino acid sequence set forth in SEQ ID NO: 57.
22. The CAR of any one of claims 10-21, wherein the CAR comprises an amino acid sequence set forth in any one of SEQ ID NOs: 59-66.
23. An isolated nucleic acid comprising a polynucleotide encoding the antigen binding domain of any one of claims 1-8.
24. An isolated nucleic acid encoding the bispecific T-cell engager antibody of any one of claims 11-13.
26. An isolated nucleic acid encoding the CAR of any one of claims 14-22.
27. The isolated nucleic acid of claim 26, wherein the antigen-binding domain is encoded by a polynucleotide comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 3-10.
28. The isolated nucleic acid of claim 26 or 27, wherein the CAR is encoded by a nucleic acid comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 67-74 or a nucleic acid encoding a CAR comprising an amino acid sequence set forth in any one of SEQ ID NOs: 59-66.
29. A vector comprising the isolated nucleic acid of any one of claims 23-28.
30. The vector of claim 29, wherein the vector is an expression vector.
31. The vector of claim 30, further comprising a nucleic acid comprising a promoter operably linked to an immune-modulating agent.
32. The vector of claim 31, wherein the immune-modulating agent is a cytokine.
33. The vector of claim 32, wherein the cytokine is IL-12, optionally wherein IL-12 is a single chain IL-12 and / or comprises the amino acid of SEQ ID NO: 174 or 230, or is encoded by a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 173.
34. The vector of any one of claims 31-33, wherein the promoter is an inducible promoter.
35. The vector of claim 34, wherein the inducible promoter is activated by NF AT signaling, optionally wherein the inducible promoter comprises the nucleotide sequence set forth in SEQ ID NO: 171.
36. The vector of any one of claims 29-35, wherein the vector is selected from the group consisting of a DNA vector, an RNA vector, a plasmid, a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, and a retroviral vector.
42. A modified immune cell, comprising the CAR of any one of claims 14-22.
43. The modified immune cell of claim 42, wherein the CAR comprises an antigen binding domain comprising: a) a VH region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 27-31, 76, 84, 92, 99, 103, 107, 111, 115, 123, 128, 132, 137, 140, 146, 149, and 213; and b) a VL region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 19-26, 77, 85, 93, 93, 93, 93, 93, 116, 124, 93, 116, 93, 141, 116, 150, and 214.
44. The modified immune cell of claim 42 or 43, wherein the CAR comprises an antigen binding domain comprising: a) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 27 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 19; b) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 28 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 20; c) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 28 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 21; d) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 28 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 22; e) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 29 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 23;f) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 29 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 24; g) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 30 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 25; h) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 31 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 26; i) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 76 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 77; j) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 84 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 85; k) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 92 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 93; l) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 99 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 93; m) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 103 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 93; n) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 107 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 93; o) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 111 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 93; p) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 115 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 116; q) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 123 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 124; r) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 128 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 93; s) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 132 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 116; t) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 137 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 93;u) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 140 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 141; v) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 146 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 116; w) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 149 and a VL region comprising the amino acid sequence set forth in SEQ ID NO: 150, and x) a VH region comprising the amino acid sequence set forth in SEQ ID NO: 28 and a Vi. region comprising the amino acid sequence set forth in SEQ ID NO: 214.
45. The modified immune cell of any one of claims 42-44, comprising the nucleic acid of any one of claims 19-25.
46. The modified immune cell of any one of claims 42-44, comprising the nucleic acid of any one of claims 26-32.
47. The modified immune cell of claim 46, wherein expression of endogenous TCR chains is reduced or eliminated.
48. The modified immune cell of any one of claims 42-47, wherein the antigen binding domain of the CAR comprises an scFv.
49. The modified immune cell of any one of claims 42-48, wherein the modified cell is an autologous cell.
50. The modified immune cell of any one of claims 42-48, wherein the modified cell is an allogeneic cell.
51. The modified immune cell of any one of claims 42-50, wherein the modified cell is a cell isolated from a human subject.
52. The modified immune cell of any one of claims 42-51, wherein the modified cell is a modified T cell.
53. The modified immune cell of any one of claims 42-52, wherein the modified immune cell comprises an exogenous nucleic acid comprising an inducible promoter activated by NF AT signaling, wherein the inducible promoter is operatively linked to an IL-12 coding sequence, optionally wherein the exogenous nucleic acid comprises the nucleotide sequence set forth in SEQ ID NO: 171.
54. The modified immune cell of any one of claims 42-52, wherein the modified immune cell comprises an exogenous nucleic acid encoding a BiTE antibody targeting mKRAS / HLA complex and CD3 epsilon (CD3e), optionally wherein the modified the BiTE antibody comprises a CD3e binding domain comprising the amino acid sequence of SEQ ID NO: 20655. A method for generating a modified immune cell, comprising introducing into the immune cell an isolated nucleic acid encoding the chimeric antigen receptor (CAR) of any one of claims 10-18 or comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 67-74.
56. The method of claim 55, wherein the modified immune cell is a T cell.
57. The method of claim 55 or 56, further comprising modifying the immune cell to express an immune modifying agent.
58. The method of claim 57, wherein the immune modifying agent is IL-12 or IL-18.
59. A method of treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of the modified immune cell of any one of claims 42-54 or a modified immune cell generated by the method of any one of claims 55-58.
60. The method of claim 59, wherein the cancer is a solid cancer.
61. The method of claim 59 or 60, wherein the cancer is associated with the expression of the G12V mutant of KRAS (mKRAS).
62. The method of claim 61, wherein the mKRAS is expressed by tumor cells.
63. The method of any one of claims 59-62, wherein the cancer is selected from the group consisting of pancreatic ductal adenocarcinoma (PDA), colon cancer, colorectal adenocarcinoma, myeloma, multiple myeloma, lung adenocarcinoma, melanoma, uterine cancer, thyroid cancer, acute myelogenous leukemia (AML), urothelial cancer, gastric adenocarcinoma and cervical adenocarcinoma, head and neck squamous cell carcinoma (SCC), Diffuse large B- cell lymphoma (DLBCL), esophageal adenocarcinoma, Chronic lymphocytic leukemia (CLL), lung SCC, small cell lung cancer (SCLC), renal papillary cancer, Hepatocellular carcinoma (HCC), breast cancer, cervical SCC, ovarian adenocarcinoma, adrenal cancer, prostate cancer, neuroblastoma, glioblastoma multiforme (GBM), medulloblastoma, Renal cell carcinoma (RCC), esophageal SCC, osteosarcoma, sarcoma, and small intestine neuroendocrine tumor (NET).
64. The method of claim 63, wherein the subject is a human.
65. An antigen binding domain targeting an epitope of mutant KRAS G12V which is presented in the context of an HLA complex, wherein the antigen-binding domain comprises an HCDR3 comprising the amino acid sequence of SEQ ID NO: 159.
Citation Information
Patent Citations
Plasmodium Vaccines, Antigens, Compositions and Methods
US20110314575A1