Microrna 29b mimics
Chemically modified dsRNA miR29b mimics address the limitations of current compounds by enhancing efficacy and safety in treating fibrotic diseases through targeted nucleotide sequences and modifications.
Patent Information
- Application Number
- PCT/US2025/032489
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-06-05
- Filing Date
- 2025-06-05
- Publication Date
- 2025-12-11
AI Technical Summary
Current miR29b mimic compounds for treating fibrotic diseases, such as pulmonary fibrosis, lack efficacy, duration of response, and safety profile.
Development of chemically modified double-stranded RNA (dsRNA) miR29b mimics with specific nucleotide sequences and modifications, including 2'-O-methyl and phosphorothioate linkages, to enhance tissue distribution, reduce toxicity, and prolong activity.
The dsRNA miR29b mimics effectively repress fibrosis markers, surpassing previous mimics like MRG-229, with improved efficacy and safety in treating fibrotic diseases.
Smart Images

Figure IMGF000007_0001 
Figure IMGF000008_0001 
Figure IMGF000010_0001
Abstract
Description
MICRORNA 29B MIMICSCROSS REFERENCE TO RELATED APPLICATION
[0001] This application claims the benefit of U.S. Provisional Patent Application Serial No. 63 / 656,188, filed June 5, 2024. The entire content of the above-referenced patent application is incorporated by reference in its entirety herein.BACKGROUND
[0002] Fibrotic diseases and disorders, such as pulmonary fibrosis, poses a significant global health burden. Repeated injuries, chronic inflammation and repair are susceptible to fibrosis, where an accidental excessive accumulation of extracellular matrix components, such as the collagen, is produced by fibroblasts, leading to the formation of a permanent fibrotic scar. This can have a deleterious effect on the organs and tissues subjected to fibrosis.
[0003] Among the -2200 microRNAs found in the body, miR29b emerges as a potent therapeutic candidate, uniquely equipped to mitigate excessive extracellular matrix (ECM) deposition and fibrogenesis. Functioning as a key suppressor of collagen production, miR-29b targets pivotal ECM proteins that cause fibrosis. Additionally, miR29b exerts regulatory control over major fibrotic factors such as TGF-pi, connective tissue growth factor (CTGF), and SMAD phosphorylation. This has been demonstrated in hepatic stellate cells as they activate upon liver injury and produce the collagen-rich extracellular matrix present in liver fibrosis.
[0004] Prior work with a miR29b mimic, designated MRG-229, has shown promise in the treatment of pulmonary fibrosis in mice. However, the development of miR29b mimic compounds with greater efficacy, longer duration of response, and a better safety profile are needed.SUMMARY
[0005] In one aspect, the disclosure provides a double stranded RNA (dsRNA) comprising a sense strand and an antisense strand, each strand having a 5’ end and a 3’ end, wherein: the antisense strand comprises a nucleotide sequence of UAGCACCAUUUGAAAUCAGUG (SEQ ID NO: 1) , or a chemically modified variant thereof, and the sense strand is substantially complementary to the antisense strand and consists of 1 or 2 mismatches with the antisense strand.
[0006] In certain embodiments, the antisense strand comprises a mismatch with the sense strand at nucleotide position 1 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand comprises a mismatch with the sense strand at nucleotide position 2 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand comprises a mismatch with the sense strand at nucleotide position 3 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand comprises a mismatch with the sense strand at nucleotide position 3 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand comprises a mismatch with the sense strand at nucleotide position 4 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand comprises a mismatch with the sense strand at nucleotide position 5 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand comprises a mismatch with the sense strand at nucleotide position 6 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand comprises a mismatch with the sense strand at nucleotide position 7 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand comprises a mismatch with the sense strand at nucleotide position 8 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand comprises a mismatch with the sense strand at nucleotide position 9 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand comprises a mismatch with the sense strand at nucleotide position 10 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand comprises a mismatch with the sense strand at nucleotide position 11 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand comprises a mismatch with the sense strand at nucleotide position 12 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand comprises a mismatch with the sense strand at nucleotide position 13 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand comprises a mismatch with the sense strand at nucleotide position 14 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand comprises a mismatch with the sense strand at nucleotide position 15 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand comprises a mismatch with the sense strand at nucleotide position 16 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 1 and 2 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 1 and 3 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotideposition 1 and 4 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 1 and 5 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 1 and 6 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 1 and 7 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 1 and 8 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 1 and 9 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 1 and 10 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 1 and 11 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 1 and 12 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 1 and 13 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 1 and 14 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 1 and 15 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 1 and 16 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 11 and 2 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 11 and 3 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 11 and 4 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 11 and 5 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 11 and 6 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 11 and 7 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 11 and 8 from the 5’ end of theantisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 11 and 9 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 11 and 10 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 11 and 12 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 11 and 13 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 11 and 14 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 11 and 15 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 11 and 16 from the 5’ end of the antisense strand.
[0007] In certain embodiments, the antisense strand is 16 nucleotides to 25 nucleotides in length. In certain embodiments, the sense strand is 15 nucleotides to 25 nucleotides in length. In certain embodiments, the antisense strand is 20 nucleotides in length. In certain embodiments, the antisense strand is 21 nucleotides in length. In certain embodiments, the antisense strand is 22 nucleotides in length. In certain embodiments, the sense strand is 15 nucleotides in length. In certain embodiments, the sense strand is 16 nucleotides in length. In certain embodiments, the sense strand is 18 nucleotides in length. In certain embodiments, the sense strand is 20 nucleotides in length.
[0008] In certain embodiments, the dsRNA comprises a double-stranded region of 15 base pairs to 20 base pairs. In certain embodiments, the dsRNA comprises a double-stranded region of 15 base pairs. In certain embodiments, the dsRNA comprises a double-stranded region of 16 base pairs. In certain embodiments, the dsRNA comprises a double-stranded region of 18 base pairs. In certain embodiments, the dsRNA comprises a double-stranded region of 20 base pairs.
[0009] In certain embodiments, the dsRNA comprises at least one blunt-end.
[0010] In certain embodiments, the dsRNA comprises at least one single stranded nucleotide overhang.
[0011] In certain embodiments, the dsRNA comprises about a 2-nucleotide to 5-nucleotide single stranded nucleotide overhang. In certain embodiments, the dsRNA comprises 2- nucleotide single stranded nucleotide overhang. In certain embodiments, the dsRNA comprises 5-nucleotide single stranded nucleotide overhang.
[0012] In certain embodiments, the dsRNA comprises naturally occurring nucleotides.
[0013] In certain embodiments, the dsRNA comprises at least one modified nucleotide.
[0014] In certain embodiments, the modified nucleotide comprises a 2'-O-methyl modified nucleotide, a 2'-deoxy-2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, an abasic nucleotide, a 2'-amino-modified nucleotide, a 2'-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, a non-natural base comprising nucleotide, or a mixture thereof.
[0015] In certain embodiments, the modified nucleotide comprises a 2'-O-methyl modified nucleotide, a 2'-deoxy-2'-fluoro modified nucleotide, an unlocked nucleic acid (UNA) modified nucleotide, an abasic nucleotide, or a mixture thereof.
[0016] In one aspect, the disclosure provides a double stranded RNA (dsRNA) comprising a sense strand and an antisense strand, each strand having a 5’ end and a 3’ end, wherein: the antisense strand comprises a nucleotide sequence of UAGC ACC AUUUGAAAUC AGUG, or a chemically modified variant thereof, and the sense strand is substantially complementary to the antisense strand and comprises at least one destabilizing nucleotide.
[0017] In certain embodiments, the at least one destabilizing nucleotide is an unlocked nucleic acid (UNA) modified nucleotide, an abasic nucleotide, or a mixture thereof.
[0018] In certain embodiments, the abasic nucleotide is a dSpacer (l,2'-dideoxyribose) nucleotide.
[0019] In certain embodiments, the at least one destabilizing nucleotide is at position 6 from the 5’ end of the sense strand. In certain embodiments, the at least one destabilizing nucleotide is at position 9 from the 5’ end of the sense strand. In certain embodiments, the at least one destabilizing nucleotide is at position 1 from the 5’ end of the sense strand. In certain embodiments, the at least one destabilizing nucleotide is at position 2 from the 5’ end of the sense strand. In certain embodiments, the at least one destabilizing nucleotide is at position 3 from the 5’ end of the sense strand. In certain embodiments, the at least one destabilizing nucleotide is at position 4 from the 5’ end of the sense strand. In certain embodiments, the at least one destabilizing nucleotide is at position 5 from the 5’ end of the sense strand. In certain embodiments, the at least one destabilizing nucleotide is at position 7 from the 5’ end of the sense strand. In certain embodiments, the at least one destabilizing nucleotide is at position 8 from the 5’ end of the sense strand. In certain embodiments, the at least one destabilizing nucleotide is at position 10 from the 5’ end of the sense strand. In certain embodiments, the at least one destabilizing nucleotide is at position 11 from the 5’ end of the sense strand. In certainembodiments, the at least one destabilizing nucleotide is at position 12 from the 5’ end of the sense strand. In certain embodiments, the at least one destabilizing nucleotide is at position 13 from the 5’ end of the sense strand. In certain embodiments, the at least one destabilizing nucleotide is at position 14 from the 5’ end of the sense strand. In certain embodiments, the at least one destabilizing nucleotide is at position 15 from the 5’ end of the sense strand. In certain embodiments, the at least one destabilizing nucleotide is at position 16 from the 5’ end of the sense strand.
[0020] In certain embodiments, the sense strand consists of one destabilizing nucleotide. In certain embodiments, the sense strand consists of two destabilizing nucleotides. In certain embodiments, the sense strand consists of three destabilizing nucleotides.
[0021] In certain embodiments, the dsRNA comprises at least one modified intemucleotide linkage.
[0022] In certain embodiments, the modified internucleotide linkage comprises a phosphorothioate internucleotide linkage. In certain embodiments, the dsRNA comprises 4-16 phosphorothioate intemucleotide linkages. In certain embodiments, the dsRNA comprises 8- 13 phosphorothioate intemucleotide linkages. In certain embodiments, the antisense strand comprises 2-10 phosphorothioate intemucleotide linkages.
[0023] In certain embodiments, the dsRNA comprises at least one modified intemucleotide linkage of Formula I:(i); wherein:B is a base pairing moiety;W is selected from the group consisting of O, OCH2, OCH, CH2, and CH;X is selected from the group consisting of halo, hydroxy, and C1-6 alkoxy;Y is selected from the group consisting of O , OH, OR, NH , NH2, S", and SH;Z is selected from the group consisting of O and CH2;R is a protecting group; and= is an optional double bond.
[0024] In certain embodiments, W is OCH2 and Z is O.
[0025] In certain embodiments, the antisense strand comprises at least one modified internucleotide linkage of Formula I.
[0026] In certain embodiments, the antisense strand comprises the modified intemucleotide linkage of Formula I at the antisense strand 3’ end.
[0027] In certain embodiments, the antisense strand comprises 2 to 5 modified internucleotide linkages of Formula I at the antisense strand 3’ end.
[0028] In certain embodiments, the modified internucleotide linkage of Formula (I) is a modified internucleotide linkage of Formula VI:
[0029] In certain embodiments, the dsRNA comprises at least 80% chemically modified nucleotides.
[0030] In certain embodiments, the dsRNA is fully chemically modified.
[0031] In certain embodiments, the dsRNA comprises at least 70% 2’-O-methyl nucleotide modifications.
[0032] In certain embodiments, the antisense strand comprises at least 70% 2’-O-methyl nucleotide modifications.
[0033] In certain embodiments, the antisense strand comprises about 70% to 90% 2’-O-methyl nucleotide modifications.
[0034] In certain embodiments, the sense strand comprises at least 65% 2’-O-methyl nucleotide modifications.
[0035] In certain embodiments, the sense strand comprises 100% 2’-O-methyl nucleotide modifications.
[0036] In certain embodiments, the antisense strand comprises a 5’ phosphate, a 5 ’-alkyl phosphonate, a 5’ alkylene phosphonate, or a 5’ alkenyl phosphonate. In certain embodiments, the antisense strand comprises a 5’ vinyl phosphonate.
[0037] In certain embodiments, a functional moiety is linked to the 5’ end and / or 3’ end of the antisense strand.
[0038] In certain embodiments, a functional moiety is linked to the 5’ end and / or 3’ end of the sense strand.
[0039] In certain embodiments, a functional moiety is linked to the 3’ end of the sense strand.
[0040] In certain embodiments, the functional moiety comprises a hydrophobic moiety.
[0041] In certain embodiments, the hydrophobic moiety is selected from the group consisting of fatty acids, steroids, secosteroids, lipids, gangliosides, nucleoside analogs, endocannabinoids, vitamins, and a mixture thereof.
[0042] In certain embodiments, the steroid selected from the group consisting of cholesterol and lithocholic acid (LA).
[0043] In certain embodiments, the fatty acid selected from the group consisting of Eicosapentaenoic acid (EP A), Docosahexaenoic acid (DHA) and Docosanoic acid (DCA).
[0044] In certain embodiments, the vitamin is selected from the group consisting of choline, vitamin A, vitamin E, and derivatives or metabolites thereof.
[0045] In certain embodiments, the vitamin is selected from the group consisting of retinoic acid and alpha-tocopheryl succinate.
[0046] In certain embodiments, the functional moiety comprises an N-acetylgalactosamine (GalNAc) moiety.
[0047] In certain embodiments, the functional moiety is linked to the antisense strand and / or sense strand by a linker.
[0048] In certain embodiments, the linker comprises an ethylene glycol chain, an alkyl chain, a peptide, an RNA, a DNA, a phosphodiester, a phosphorothioate, a phosphoramidate, an amide, a carbamate, or a combination thereof.
[0049] In certain embodiments, the linker comprises a divalent or trivalent linker.
[0050] In certain embodiments, the divalent or trivalent linker is selected from the group consisting of:wherein n is 1, 2, 3, 4, or 5.
[0051] In certain embodiments, when the linker is a trivalent linker, the linker further links a phosphodiester or phosphodiester derivative.
[0052] In certain embodiments, the phosphodiester or phosphodiester derivative is selected from the group consisting of: ndwherein X is O, S or BH3.
[0053] In certain embodiments, the nucleotides at positions 1 and 2 from the 3’ end of sense strand, and the nucleotides at positions 1 and 2 from the 5’ end of antisense strand are connected to adjacent ribonucleotides via phosphorothioate linkages.
[0054] In certain embodiments, the sense strand comprises or consists of AUUUCCAAUGGUGCUU (SEQ ID NO: ##), or a chemically modified variant thereof.
[0055] In certain embodiments, the sense strand comprises or consists ofAUUUCAAACGGUGCUU (SEQ ID NO: ##), or a chemically modified variant thereof.
[0056] In certain embodiments, the sense strand comprises or consists ofAUUUCAAAUGGUGCUA (SEQ ID NO: ##), or a chemically modified variant thereof.
[0057] In certain embodiments, the antisense strand comprises or consists ofV(mU)#(fA)#(mG)(fC)(mA)(fC)(mC)(fA)(mU)(fU)(mU)(fG)(mA)(fA)#(mA)#(fU)#(mC)#(f A)#(mG)#(fU)#(mG) (SEQ ID NO: ##), wherein “m” corresponds to a 2'-O-methyl modified nucleotide, “f” corresponds to a 2'-deoxy-2'-fluoro modified nucleotide, “#” corresponds to a phosphorothioate modified intemucleotide linkage, and “V” corresponds to a 5’ vinyl phosphonate.
[0058] In certain embodiments, the antisense strand comprises or consists of V(mU)#(fA)#(mG)(fC)(fA)(fC)(mC)(fA)(mU)(fU)(mU)(fG)(mA)(fA)#(mA)#(fU)#(mC)#(m A)#(mG)#(fU)#(mG) (SEQ ID NO: ##), wherein “m” corresponds to a 2'-O-methyl modified nucleotide, “f” corresponds to a 2'-deoxy-2'-fluoro modified nucleotide, “#” corresponds to a phosphorothioate modified intemucleotide linkage, and “V” corresponds to a 5’ vinyl phosphonate.
[0059] In certain embodiments, the antisense strand comprises or consists of V(mU)#(fA)#(mG)(fC)(fA)(fC)(mC)(fA)(mU)(fU)(mU)(fG)(mA)(fA)#(mA)#(fU)#(mC)#(m A)#(mG)#(fU)#(mU) (SEQ ID NO: ##), wherein “m” corresponds to a 2'-O-methyl modified nucleotide, “f” corresponds to a 2'-deoxy-2'-fluoro modified nucleotide, “#” corresponds to a phosphorothioate modified intemucleotide linkage, and “V” corresponds to a 5’ vinyl phosphonate.
[0060] In certain embodiments, the sense strand comprises or consists of (mA)#(fU)#(mU)(fU)(mC)(fC)(mA)(fA)(mU)(fG)(mG)(fU)(mG)(fC)#(mU)#(fU) (SEQ ID NO: ##), wherein “m” corresponds to a 2'-O-m ethyl modified nucleotide, “f ’ corresponds to a 2'-deoxy-2'-fluoro modified nucleotide, and “#” corresponds to a phosphorothioate modified internucleotide linkage.
[0061] In certain embodiments, the sense strand comprises or consists of (mA)#(mU)#(mU)(fU)(mC)(fC)(mA)(fA)(mU)(fG)(mG)(mU)(mG)(fC)#(mU)#(mU) (SEQ ID NO: ##), wherein “m” corresponds to a 2'-O-methyl modified nucleotide, “f” corresponds to a 2'-deoxy-2'-fluoro modified nucleotide, and “#” corresponds to a phosphorothioate modified internucleotide linkage.
[0062] In certain embodiments, the sense strand comprises or consists of (mA)#(fU)#(mU)(fU)(mC)(fA)(mA)(fA)(mC)(fG)(mG)(fU)(mG)(fC)#(mU)#(fU) (SEQ ID NO: ##), wherein “m” corresponds to a 2'-O-m ethyl modified nucleotide, “f ’ corresponds to a 2'-deoxy-2'-fluoro modified nucleotide, and “#” corresponds to a phosphorothioate modified internucleotide linkage.
[0063] In certain embodiments, the sense strand comprises or consists of (mA)#(mU)#(mU)(fU)(mC)(fA)(mA)(fA)(mC)(fG)(mG)(mU)(mG)(fC)#(mU)#(mU) (SEQ ID NO: ##), wherein “m” corresponds to a 2'-O-methyl modified nucleotide, “f” corresponds to a 2'-deoxy-2'-fluoro modified nucleotide, and “#” corresponds to a phosphorothioate modified internucleotide linkage.
[0064] In certain embodiments, the sense strand comprises or consists of (mA)#(fU)#(mU)(fU)(mC)(fA)(mA)(fA)(mU)(fG)(mG)(fU)(mG)(fC)#(mU)#(fA) (SEQ ID NO: ##), wherein “m” corresponds to a 2'-O-m ethyl modified nucleotide, “f ’ corresponds to a 2'-deoxy-2'-fluoro modified nucleotide, and “#” corresponds to a phosphorothioate modified internucleotide linkage.
[0065] In certain embodiments, the sense strand comprises or consists of (mA)#(mU)#(mU)(fU)(mC)(fA)(mA)(fA)(mU)(fG)(mG)(mU)(mG)(fC)#(mU)#(mA) (SEQ ID NO: ##), wherein “m” corresponds to a 2'-O-methyl modified nucleotide, “f” corresponds to a 2'-deoxy-2'-fluoro modified nucleotide, and “#” corresponds to a phosphorothioate modified internucleotide linkage.
[0066] In one aspect, the disclosure provides a pharmaceutical composition comprising the dsRNA described herein and a pharmaceutically acceptable carrier.
[0067] In one aspect, the disclosure provides a method of treating or preventing a fibrotic disease or disorder comprising administering to a patient in need of such treatment a therapeutically effective amount of the dsRNA described herein.
[0068] In certain embodiments, the fibrotic disease or disorder is selected from the group consisting of pulmonary fibrosis, cystic fibrosis, liver fibrosis, cirrhosis, myocardial fibrosis, arterial stiffness, arthrofibrosis, ocular fibrosis, tendinopathy, renal fibrosis, Dupuytren’s contractures, cutaneous fibrosis, fibrosis caused by inflammatory bowel disease, fibrosis caused by osteoarthritis, and metabolic dysfunction-associated steatohepatitis (MASH).
[0069] In one aspect, the disclosure provides a branched RNA compound comprising two or more of the dsRNA described herein covalently bound to one another.
[0070] In certain embodiments, the dsRNA are covalently bound to one another by way of a linker, spacer, or branching point.
[0071] In certain embodiments, the branched RNA compound comprises the structure:rimer); or(tetramer), wherein “oligonucleotide” corresponds to either the sense strand or antisense strand.
[0072] In certain embodiments, the sense strand 3’ end, the sense strand 5’ end, the antisense strand 3’ end, or the antisense strand 5’ end are covalently bound to one another by way of a linker, spacer, or branching point.
[0073] In one aspect, the disclosure provides a pharmaceutical composition comprising the branched RNA compound described herein and a pharmaceutically acceptable carrier.
[0074] In one aspect, the disclosure provides a method of treating or preventing a fibrotic disease or disorder comprising administering to a patient in need of such treatment a therapeutically effective amount of the branched RNA compound described herein.
[0075] In certain embodiments, the fibrotic disease or disorder is selected from the group consisting of pulmonary fibrosis, cystic fibrosis, liver fibrosis, cirrhosis, myocardial fibrosis, arterial stiffness, arthrofibrosis, ocular fibrosis, tendinopathy, renal fibrosis, Dupuytren’s contractures, cutaneous fibrosis, fibrosis caused by inflammatory bowel disease, fibrosis caused by osteoarthritis, and metabolic dysfunction-associated steatohepatitis (MASH).
[0076] In one aspect, the disclosure provides a composition comprising the dsRNA described herein (i.e., miR29b mimics described herein) and an oligonucleotide with a sequence sufficiently complementary to a NADPH oxidase-4 (NOX-4) nucleic acid sequence.
[0077] In certain embodiments, the oligonucleotide with a sequence sufficiently complementary to a. NOX-4 nucleic acid sequence is an antisense oligonucleotide (ASO).
[0078] In certain embodiments, the oligonucleotide with a sequence sufficiently complementary to a NOX-4 nucleic acid sequence is a dsRNA comprising a sense strand and an antisense strand, each strand having a 5’ end and a 3’ end, wherein the antisense strand comprises a nucleotide sequence sufficiently complementary to the NOX-4 nucleic acid sequence.
[0079] In certain embodiments, the oligonucleotide comprises a sequence sufficiently complementary to any one of the NOX-4 nucleic acid sequence target region sequences recited in Table 2, optionally wherein the oligonucleotide comprises a sequence sufficiently complementary to SEQ ID NO: 28 or SEQ ID NO: 29.
[0080] In one aspect, the disclosure provides a branched RNA compound comprising the dsRNA described herein (i.e., miR29b mimics described herein) covalently bound to an oligonucleotide with a sequence sufficiently complementary to a NADPH oxidase-4 (NOX-4 nucleic acid sequence.
[0081] In certain embodiments, the oligonucleotide with a sequence sufficiently complementary to a NOX-4 nucleic acid sequence is an antisense oligonucleotide (ASO).
[0082] In certain embodiments, the oligonucleotide with a sequence sufficiently complementary to a NOX-4 nucleic acid sequence is a dsRNA comprising a sense strand and an antisense strand, each strand having a 5’ end and a 3’ end, wherein the antisense strand comprises a nucleotide sequence sufficiently complementary to the NOX-4 nucleic acid sequence.
[0083] In certain embodiments, the oligonucleotide comprises a sequence sufficiently complementary to any one of the NOX-4 nucleic acid sequence target region sequences recited in Table 2, optionally wherein the oligonucleotide comprises a sequence sufficiently complementary to SEQ ID NO: 28 or SEQ ID NO: 29.
[0084] In one aspect, the disclosure provides a composition comprising the dsRNA described herein (i.e., miR29b mimics described herein) and an oligonucleotide with a sequence sufficiently complementary to a diacylglycerol acyltransferase 2 (DGAT2) nucleic acid sequence.
[0085] In certain embodiments, the oligonucleotide with a sequence sufficiently complementary to DGAT2 nucleic acid sequence is an antisense oligonucleotide (ASO).
[0086] In certain embodiments, the oligonucleotide with a sequence sufficiently complementary to a DGAT2 nucleic acid sequence is a dsRNA comprising a sense strand and an antisense strand, each strand having a 5’ end and a 3’ end, wherein the antisense strand comprises a nucleotide sequence sufficiently complementary to the DGAT2 nucleic acid sequence.
[0087] In certain embodiments of the branched RNA compound, the oligonucleotide comprises a sequence sufficiently complementary to any one of the DGAT2 nucleic acid sequence target region sequences recited in Table 1. In certain embodiments, the oligonucleotide comprises a sequence sufficiently complementary to any one of the DGAT2 nucleic acid sequence target region sequences of SEQ ID NOs: 18-22. In certain embodiments, the oligonucleotide comprises a sequence sufficiently complementary to SEQ ID NO: 18. In certain embodiments, the oligonucleotide comprises a sequence sufficiently complementary to SEQ ID NO: 19. In certain embodiments, the oligonucleotide comprises a sequence sufficiently complementary to SEQ ID NO: 20. In certain embodiments, the oligonucleotide comprises a sequence sufficiently complementary to SEQ ID NO: 21. In certain embodiments, the oligonucleotide comprises a sequence sufficiently complementary to SEQ ID NO: 22. In certain embodiments, the oligonucleotide comprises a sequence sufficiently complementary to any one of the DGAT2 nucleic acid sequence target region sequences of SEQ ID NOs: 23-27. In certain embodiments, the oligonucleotide comprises a sequence sufficiently complementary to SEQ ID NO: 23. In certain embodiments, the oligonucleotide comprises a sequence sufficiently complementary to SEQ ID NO: 24. In certain embodiments, the oligonucleotide comprises a sequence sufficiently complementary to SEQ ID NO: 25. In certain embodiments, the oligonucleotide comprises a sequence sufficiently complementary to SEQ ID NO: 26. In certain embodiments, the oligonucleotide comprises a sequence sufficiently complementary to SEQ ID NO: 27.
[0088] In one aspect, the disclosure provides a branched RNA compound comprising the dsRNA described herein (i.e., miR29b mimics described herein) covalently bound to an oligonucleotide with a sequence sufficiently complementary to a DGAT2 nucleic acid sequence.
[0089] In certain embodiments, the oligonucleotide with a sequence sufficiently complementary to DGAT2 nucleic acid sequence is an antisense oligonucleotide (ASO).
[0090] In certain embodiments, the oligonucleotide with a sequence sufficiently complementary to a DGAT2 nucleic acid sequence is a dsRNA comprising a sense strand and an antisense strand, each strand having a 5’ end and a 3’ end, wherein the antisense strand comprises a nucleotide sequence sufficiently complementary to the NOX-4 nucleic acid sequence.
[0091] In certain embodiments of the branched RNA compound, the oligonucleotide comprises a sequence sufficiently complementary to any one of the DGAT2 nucleic acid sequence target region sequences recited in Table 1. In certain embodiments, the oligonucleotide comprises a sequence sufficiently complementary to any one of the DGAT2 nucleic acid sequence target region sequences of SEQ ID NOs: 18-22. In certain embodiments, the oligonucleotide comprises a sequence sufficiently complementary to SEQ ID NO: 18. In certain embodiments, the oligonucleotide comprises a sequence sufficiently complementary to SEQ ID NO: 19. In certain embodiments, the oligonucleotide comprises a sequence sufficiently complementary to SEQ ID NO: 20. In certain embodiments, the oligonucleotide comprises a sequence sufficiently complementary to SEQ ID NO: 21. In certain embodiments, the oligonucleotide comprises a sequence sufficiently complementary to SEQ ID NO: 22. In certain embodiments, the oligonucleotide comprises a sequence sufficiently complementary to any one of the DGAT2 nucleic acid sequence target region sequences of SEQ ID NOs: 23-27. In certain embodiments, the oligonucleotide comprises a sequence sufficiently complementary to SEQ ID NO: 23. In certain embodiments, the oligonucleotide comprises a sequence sufficiently complementary to SEQ ID NO: 24. In certain embodiments, the oligonucleotide comprises a sequence sufficiently complementary to SEQ ID NO: 25. In certain embodiments, the oligonucleotide comprises a sequence sufficiently complementary to SEQ ID NO: 26. In certain embodiments, the oligonucleotide comprises a sequence sufficiently complementary to SEQ ID NO: 27.
[0092] In one aspect, the disclosure provides a branched RNA compound comprising at least a first dsRNA and a second dsRNA, each dsRNA comprising a sense strand and an antisense strand, each strand having a 5’ end and a 3’ end, wherein the antisense strand of the first dsRNA and the second dsRNA comprises UAGCACCAUUUGAAAUCAGUGUUUU, or a chemically modified variant thereof, and the sense strand of the first dsRNA and the second dsRNA comprises AACACUGUUUACAAAUGGUCCUA, or a chemically modified variant thereof, wherein the at least first dsRNA is covalently bound to the second dsRNA.
[0093] In certain embodiments, the antisense strand comprises V(mU)#(fA)#(mG)(fC)(mA)(fC)(mC)(fA)(mU)(fU)(mU)(mG)(mA)(fA)(mA)(fU)(mC)(fA)( mG)(fU)(mG)(fU)(mU)#(mU)#(mU), and the sense strand C0mprises(fA)#(mA)#(fC)(mA)(fC)(mU)(fG)(mU)(fU)(mU)(fA)(fC)(fA)(mA)(fA)(mU)(fG)( mG)(fU)(mC)(fC)(mU)(fA), wherein “m” corresponds to a 2'-O-methyl modified nucleotide, “f” corresponds to a 2'-deoxy-2'-fluoro modified nucleotide, “#” corresponds to a phosphorothioate modified intemucleotide linkage, and “V” corresponds to a 5’ vinyl phosphonate.
[0094] In certain embodiments, the dsRNA are covalently bound to one another by way of a linker, spacer, or branching point.
[0095] In certain embodiments, the branched RNA compound comprises the structure:Oigonucleotide-O^^^^O^^ / O^^^O^^ / O^^^O'°li9onucleotideOH (dimer);wherein “oligonucleotide” corresponds to either the sense strand or antisense strand.
[0096] In certain embodiments, the sense strand 3’ end, the sense strand 5’ end, the antisense strand 3’ end, or the antisense strand 5’ end are covalently bound to one another by way of a linker, spacer, or branching point.BRIEF DESCRIPTION OF THE DRAWINGS
[0097] Fig. lA-Fig. IE shows the effects of select miR29 mimics on stellate cell activation. LX2 human stellate cells were plated in 96 well plates and serum-starved overnight. After 4- hour pre-treatment with cholesterol conjugated oligonucleotides (1.5 pM final concentration), stellate cell activation was initiated by addition of recombinant human Tgf-P (5ng / ml final concentration). 48 hrs after initiation cells were lysed and mRNA levels of (Fig. 1 A) COL1 Al, (Fig. IB) ACTA2 and (Fig. 1C) FASN were measured by Quantigene Singleplex assay. (Fig. ID) 8-point dose response analysis against COL1 Al gene of selected compounds in activated LX2 cells. To investigate changes in cell morphology same experiment was carried out using 6-well plates. (Fig. IE) Light microscope image of each treatment group and corresponding Procollagen peptidesecretion into cell culture media was measured using ELISA (ns: Not significant, *:p<0.05, **:p<0.005, ***:p<0.0005, ****:p<0.00005).
[0098] Fig. 2A-Fig. 2C shows the effects of select miR29 mimics on fibrotic collagen secretion in human hepatic stellate cells. LX2 human stellate cells were plated in 6 well plates and serum- starved overnight. After 4-hour pre-treatment with select cholesterol conjugated mir29b mimics (1.5 pM final concentration) from the initial screen, stellate cell activation was initiated by addition of recombinant human Tgf-P (5ng / ml final concentration). 48 hrs after initiation (Fig. 2A) light microscope images of each treatment group and (Fig. 2B) corresponding Procollagen peptide secretion into cell culture media was measured using ELISA cells. (Fig. 2C) Cells were lysed, and mRNA levels of various collagen gene expressions were measured by qPCR. (ns: Not significant, *:p<0.05, **:p<0.005, ***:p<0.0005, ****:p<0.00005.
[0099] Fig. 3A-Fig. 3C shows the effects of miR29 mimic P2111 on fibrosis in a human liver organoid model of metabolic dysfunction-associated steatohepatitis (MASH). Human liver organoids (HLOs) were prepared as explained previously (PMID: 37962490). At the last day of differentiation, Tgf-P and palmitate was added in the media to induce MASH phenotype in HLOs. Concurrently, HLOs were treated either with cholesterol conjugated non-target control (NTC) dsRNA or cholesterol conjugated Dgat2 -targeting dsRNA combined with miR29 mimic P2111. 5 days post treatment HLOs were harvested and mRNA levels of (Fig. 3 A) COL1A1,(Fig. 3B) C0L3A1, and (Fig. 3C) ACTA2 were measured by qPCR. (ns: Not significant, *: p<0.05, **:p<0.005, ***:p<0.0005, ****:p<0.00005).
[0100] Fig. 4A-Fig. 4B show fluorescent images (Fig. 4A) and mean fluorescent intensity (MFI) (Fig. 4B) of HLOs incubated with the cholesterol conjugated Dgat2 -targeting dsRNA combined with miR29 mimic P2111. HLOs were stained for collagen type 1 with an anticollagen type 1 antibody to show fibrosis development. Quantification of the collagen protein levels were done in ImageLab.
[0101] Fig. 5A-Fig. 5B show liver stiffness measurements (Fig. 5A) and liver Sirus red staining (Fig. 5B) in 10-week-old male C57BL6 mice that were injected with either Dgat2 siRNA, P2111 or both at a lOmg / kg dose. The mice were then put on the MASH causing diet (CDAHFD) to induce liver fibrosis. Liver stiffness was measured at 6-weeks and 9-weeks after the mice were put on the CDAHFD diet with a SonoVol Shear wave elastography system. After 9 weeks of CDAHFD, mice were sacrificed, and liver fibrosis levels were evaluated using liver sections stained with Sirius red staining.
[0102] Fig. 6 shows liver stiffness measurements in 10-week-old male C57BL6 mice that were injected with GalNac conjugated bivalent oligonucleotides that contained Dgat2 siRNA linked to different miR29b mimics at a lOmg / kg dose. The mice were then put on the MASH causing diet (CDAHFD) for 5 weeks to induce MASH. Liver stiffness measurements were taken using SonoVol Shear wave elastography system.DETAILED DESCRIPTION
[0103] The present disclosure relates to double strand RNA (dsRNA) compounds which act as microRNA 29b (miR29b) mimics. The dsRNA miR29b mimics described herein effectively blunt fibrosis in a variety of tissues and repress genetic markers of fibrosis, such as COL1A1 and ACTA2. The efficacy of the dsRNA miR29b mimics described herein exceed prior miR29b mimics, such as MRG-229. Moreover, the dsRNA miR29b mimics described herein are chemically modified to enhance tissue distribution and retention, reduce in vivo toxicity, and prolong duration of activity.
[0104] Unless otherwise specified, nomenclature used in connection with cell and tissue culture, molecular biology, immunology, microbiology, genetics and protein and nucleic acid chemistry and hybridization described herein are those well-known and commonly used in theart. Unless otherwise specified, the methods and techniques provided herein are performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification unless otherwise indicated. Enzymatic reactions and purification techniques are performed according to manufacturer’s specifications, as commonly accomplished in the art or as described herein. The nomenclature used in connection with, and the laboratory procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well-known and commonly used in the art. Standard techniques are used for chemical syntheses, chemical analyses, pharmaceutical preparation, formulation, delivery, and treatment of patients.
[0105] Unless otherwise defined herein, scientific and technical terms used herein have the meanings that are commonly understood by those of ordinary skill in the art. In the event of any latent ambiguity, definitions provided herein take precedent over any dictionary or extrinsic definition. Unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. The use of “or” means “and / or” unless stated otherwise. The use of the term “including,” as well as other forms, such as “includes” and “included,” is not limiting.
[0106] So that the disclosure may be more readily understood, certain terms are first defined.
[0107] As used herein in the context of oligonucleotide sequences, “A” represents a nucleoside comprising the base adenine (e.g., adenosine or a chemically-modified derivative thereof), “G” represents a nucleoside comprising the base guanine (e.g., guanosine or a chemically-modified derivative thereof), “U” represents a nucleoside comprising the base uracil (e.g., uridine or a chemically-modified derivative thereof), and “C” represents a nucleoside comprising the base adenine (e.g., cytidine or a chemically-modified derivative thereof).
[0108] The term “nucleoside” refers to a molecule having a purine or pyrimidine base covalently linked to a ribose or deoxyribose sugar. Exemplary nucleosides include adenosine, guanosine, cytidine, uridine and thymidine. Additional exemplary nucleosides include inosine, 1 -methyl inosine, pseudouridine, 5,6-dihydrouridine, ribothymidine, 2N-methylguanosine and N2,N2-dimethylguanosine (also referred to as “rare” nucleosides). The term “nucleotide” refers to a nucleoside having one or more phosphate groups joined in ester linkages to the sugar moiety. Exemplary nucleotides include nucleoside monophosphates, diphosphates and triphosphates. The terms “polynucleotide” and “nucleic acid molecule” are usedinterchangeably herein and refer to a polymer of nucleotides joined together by a phosphodiester or phosphorothioate linkage between 5' and 3' carbon atoms.
[0109] The term “RNA” or “RNA molecule” or “ribonucleic acid molecule” refers to a polymer of ribonucleotides (e.g., 2, 3, 4, 5, 10, 15, 20, 25, 30, or more ribonucleotides). The term “DNA” or “DNA molecule” or “deoxyribonucleic acid molecule" refers to a polymer of deoxyribonucleotides. DNA and RNA can be synthesized naturally (e.g., by DNA replication or transcription of DNA, respectively). RNA can be post-transcriptionally modified. DNA and RNA can also be chemically synthesized. DNA and RNA can be single-stranded (i.e., ssRNA and ssDNA, respectively) or multi-stranded (e.g., double stranded, i.e., dsRNA and dsDNA, respectively). "mRNA" or "messenger RNA" is single-stranded RNA that specifies the amino acid sequence of one or more polypeptide chains. This information is translated during protein synthesis when ribosomes bind to the mRNA.
[0110] As used herein, the term "small interfering RNA" ("siRNA") (also referred to in the art as "short interfering RNAs") refers to an RNA (or RNA analog) comprising between about 10- 50 nucleotides (or nucleotide analogs), which is capable of directing or mediating RNA interference. The siRNA is a duplex (i.e., a dsRNA) formed by a sense strand and antisense strand which have sufficient complementarity to each other to form said duplex. In certain embodiments, a siRNA comprises between about 15-30 nucleotides or nucleotide analogs, or between about 16-25 nucleotides (or nucleotide analogs), or between about 18-23 nucleotides (or nucleotide analogs), or between about 19-22 nucleotides (or nucleotide analogs) (e.g., 19, 20, 21 or 22 nucleotides or nucleotide analogs). The term "short" siRNA refers to a siRNA comprising about 21 nucleotides (or nucleotide analogs), for example, 19, 20, 21 or 22 nucleotides. The term "long" siRNA refers to a siRNA comprising about 24-25 nucleotides, for example, 23, 24, 25 or 26 nucleotides. Short siRNAs may, in some instances, include fewer than 19 nucleotides, e.g., 16, 17 or 18 nucleotides, provided that the shorter siRNA retains the ability to mediate RNAi. Likewise, long siRNAs may, in some instances, include more than 26 nucleotides, provided that the longer siRNA retains the ability to mediate RNAi absent further processing, e.g., enzymatic processing, to a short siRNA.[OHl] The term "nucleotide analog" or "altered nucleotide" or "modified nucleotide" or “chemically modified nucleotide” refers to a non-standard nucleotide, including non-naturally occurring ribonucleotides or deoxyribonucleotides. Exemplary nucleotide analogs are modified at any position so as to alter certain chemical properties of the nucleotide yet retainthe ability of the nucleotide analog to perform its intended function. Examples of positions of the nucleotide, which may be derivatized include: the 5 position, e.g., 5-(2-amino)propyl uridine, 5-bromo uridine, 5-propyne uridine, 5-propenyl uridine, etc.; the 6 position, e.g., 6-(2- amino)propyl uridine; and the 8-position for adenosine and / or guanosines, e.g., 8-bromo guanosine, 8-chloro guanosine, 8-fluoroguanosine, etc. Nucleotide analogs also include deaza nucleotides, e.g., 7-deaza-adenosine; O- and N-modified (e.g., alkylated, e.g., N6-methyl adenosine, or as otherwise known in the art) nucleotides; and other heterocyclically modified nucleotide analogs, such as those described in Herdewijn, Antisense Nucleic Acid Drug Dev., 2000 Aug. 10(4):297-310.
[0112] Nucleotide analogs may also comprise modifications to the sugar portion of the nucleotides. For example, the 2' OH-group may be replaced by a group selected from H, OR, R, F, Cl, Br, I, SH, SR, NH2, NHR, NR2, or COOR, wherein R is substituted or unsubstituted Ci-Ce alkyl, alkenyl, alkynyl, aryl, etc. Other possible modifications include those described in U.S. Pat. Nos. 5,858,988, and 6,291,438. In certain embodiments, the nucleotide analog comprises a 2’-O-methyl modification. In certain embodiments, the nucleotide analog comprises a 2’ -fluoro modification.
[0113] The phosphate group of the nucleotide may also be modified, e.g., by substituting one or more of the oxygens of the phosphate group with sulfur (e.g., phosphorothioate), or by making other substitutions, which allow the nucleotide to perform its intended function, such as described in, for example, Eckstein, Antisense Nucleic Acid Drug Dev. 2000 Apr. 10(2): 117-21, Rusckowski et al. Antisense Nucleic Acid Drug Dev. 2000 Oct. 10(5):333-45, Stein, Antisense Nucleic Acid Drug Dev. 2001 Oct. 11(5): 317-25, Vorobjev et al. Antisense Nucleic Acid Drug Dev. 2001 Apr. 11(2):77-85, and U.S. Pat. No. 5,684,143. Certain of the above-referenced modifications (e.g., phosphate group modifications) decrease the rate of hydrolysis of, for example, polynucleotides comprising said analogs in vivo or in vitro.
[0114] The term "oligonucleotide" refers to a short polymer of nucleotides and / or nucleotide analogs. The term “oligonucleotide” includes, but is not limited to, antisense oligonucleotide (ASO), siRNA, and micro-RNA.
[0115] The term "RNA analog" refers to a polynucleotide (e.g., a chemically synthesized polynucleotide) having at least one altered or modified nucleotide as compared to a corresponding unaltered or unmodified RNA, but retaining the same or similar nature or function as the corresponding unaltered or unmodified RNA. As discussed above, theoligonucleotides may be linked with linkages, which result in a lower rate of hydrolysis of the RNA analog as compared to an RNA molecule with phosphodiester linkages. For example, the nucleotides of the analog may comprise methylenediol, ethylene diol, oxymethylthio, oxyethylthio, oxycarbonyloxy, phosphorodiamidate, phosphoroamidate, and / or phosphorothioate linkages. Some RNA analogues include sugar- and / or backbone-modified ribonucleotides and / or deoxyribonucleotides. Such alterations or modifications can further include addition of non-nucleotide material, such as to the end(s) of the RNA or internally (at one or more nucleotides of the RNA). An RNA analog need only be sufficiently similar to natural RNA that it has the ability to mediate RNA interference.
[0116] As used herein, the term "RNA interference" ("RNAi") refers to a selective intracellular degradation of RNA. RNAi occurs in cells naturally to remove foreign RNAs (e.g., viral RNAs). Natural RNAi proceeds via fragments cleaved from free dsRNA, which direct the degradative mechanism to other similar RNA sequences. Alternatively, RNAi can be initiated by the hand of man, for example, to silence the expression of target genes.
[0117] An RNAi agent, e.g., an RNA silencing agent, having a strand, which is "sequence sufficiently complementary to a target mRNA sequence to direct target-specific RNA interference (RNAi)" means that the strand has a sequence sufficient to trigger the destruction of the target mRNA by the RNAi machinery or process.
[0118] As used herein, the term “isolated RNA” (e.g., "isolated siRNA" or "isolated siRNA precursor") refers to RNA molecules, which are substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized.
[0119] As used herein, the term “RNA silencing” refers to a group of sequence-specific regulatory mechanisms (e.g., RNA interference (RNAi), transcriptional gene silencing (TGS), post-transcriptional gene silencing (PTGS), quelling, co-suppression, and translational repression) mediated by RNA molecules, which result in the inhibition or "silencing" of the expression of a corresponding protein-coding gene. RNA silencing has been observed in many types of organisms, including plants, animals, and fungi.
[0120] The term "in vitro" has its art recognized meaning, e.g., involving purified reagents or extracts, e.g., cell extracts. The term "in vivo" also has its art recognized meaning, e.g., involving living cells, e.g., immortalized cells, primary cells, cell lines, and / or cells in an organism.
[0121] As used herein, a “target” refers to a particular nucleic acid sequence (e.g., a gene, an mRNA, a miRNA or the like) that an oligonucleotide conjugate or branched oligonucleotide of the disclosure binds to and / or otherwise effects the expression of. In certain embodiments, the target is expressed in the lung, liver, or kidney. In certain embodiments, target is expressed in a specific lung, liver, or kidney cell. In other embodiments, a target is associated with a particular disease or disorder in a subject.
[0122] As used herein, the term "target gene" is a gene whose expression is to be substantially inhibited or "silenced." This silencing can be achieved by RNA silencing, e.g., by cleaving the mRNA of the target gene or translational repression of the target gene. The term "non-target gene" is a gene whose expression is not to be substantially silenced. In one embodiment, the polynucleotide sequences of the target and non-target gene (e.g., mRNA encoded by the target and non-target genes) can differ by one or more nucleotides. In another embodiment, the target and non-target genes can differ by one or more polymorphisms (e.g., Single Nucleotide Polymorphisms or SNPs). In another embodiment, the target and non-target genes can share less than 100% sequence identity. In another embodiment, the non-target gene may be a homologue (e.g., an orthologue or paralogue) of the target gene.
[0123] As described herein, the term microRNA 29b” or “miR29b” refers to a micro RNA that is part of the miR29 family of micro RNAs, and is involved in regulating the expression of pro- fibrotic genes in vivo. The mature hsa-miR-29b-3p has a miRBase accession number of MIMAT0000100, and the mature hsa-miR-29b-l-5p has a miRBase accession number of MIMAT0004514. The mature miR29b is processes from the precurosr miRNA hsa-mir-29b-l precursor miRNA, with has a miRBase accession number of MI0000105, and the following hairpin sequence: cuucaggaaGCU GGUUU C AUAU GGU GGUUUAGAuuuaaauagugauuguc UA GCA CCA UU UGAAAUCAGUGUUcuuggggg, wherein the bold italics text is the sequence of mature hsa- miR-29b-3p and the bold underlines text is the sequence of mature hsa-miR-29b-l-5p.
[0124] As described herein, the term “N0X4” refers to the gene encoding for the enzyme, Nicotinamide Adenine Dinucleotide Phosphate Hydrogen Oxidases 4 (N0X4). N0X4 is a constitutive NADPH oxidase which generates superoxide intracellularly upon formation of a complex with CYBA / p22phox. The N0X4 gene is located on chromosome 11 and is strongly expressed in kidney and to a lower extent in heart, adipocytes, hepatoma, endothelial cells,skeletal muscle, brain, several brain tumor cell lines and airway epithelial cells. The N0X4 protein is 578 amino acids in length and has a molecular mass of approximately 66,932 Da.
[0125] As described herein, the term “DGAT2” refers to the gene encoding for the enzyme, Diacylglycerol O-Acyltransferase 2. DGAT2 catalyzes the reaction that covalently joins diacylglycerol to long chain fatty acyl-CoAs in the final step of triglyceride synthesis. The DGAT2 gene is located on chromosome 11, is made up of 9 exons and is mainly expressed in the liver and white adipose tissue. The DGAT2 protein is 388 amino acids in length and has a molecular mass of approximately 43,831 Da.
[0126] As used herein, the term "RNA silencing agent" refers to an RNA, which is capable of inhibiting or "silencing" the expression of a target gene. In certain embodiments, the RNA silencing agent is capable of preventing complete processing (e.g., the full translation and / or expression) of a mRNA molecule through a post-transcriptional silencing mechanism. RNA silencing agents include small (<50 b.p.), noncoding RNA molecules, for example RNA duplexes comprising paired strands, as well as precursor RNAs from which such small noncoding RNAs can be generated. Exemplary RNA silencing agents include siRNAs, miRNAs, siRNA-like duplexes, antisense oligonucleotides, GAPMER molecules, short hairpin RNA (shRNA), and dual-function oligonucleotides, as well as precursors thereof. In one embodiment, the RNA silencing agent is capable of inducing RNA interference. In another embodiment, the RNA silencing agent is capable of mediating translational repression.
[0127] As used herein, the term "rare nucleotide" refers to a naturally occurring nucleotide that occurs infrequently, including naturally occurring deoxyribonucleotides or ribonucleotides that occur infrequently, e.g., a naturally occurring ribonucleotide that is not guanosine, adenosine, cytosine, or uridine. Examples of rare nucleotides include, but are not limited to, inosine, 1- methyl inosine, pseudouridine, 5,6-dihydrouridine, ribothymidine, 2N-methylguanosine and 2,2N,N-dimethylguanosine.
[0128] The term "engineered," as in an engineered RNA precursor, or an engineered nucleic acid molecule, indicates that the precursor or molecule is not found in nature, in that all or a portion of the nucleic acid sequence of the precursor or molecule is created or selected by a human. Once created or selected, the sequence can be replicated, translated, transcribed, or otherwise processed by mechanisms within a cell. Thus, an RNA precursor produced within a cell from a transgene that includes an engineered nucleic acid molecule is an engineered RNA precursor.
[0129] As used herein, the term "microRNA" ("miRNA"), also known in the art as "small temporal RNAs" ("stRNAs"), refers to a small (10-50 nucleotide) RNA, which are genetically encoded (e.g., by viral, mammalian, or plant genomes) and are capable of directing or mediating RNA silencing.
[0130] As used herein, the term "dual functional oligonucleotide" refers to an RNA silencing agent having the formula T-L-p, wherein T is an mRNA targeting moiety, L is a linking moiety, and p is a miRNA recruiting moiety. As used herein, the terms "mRNA targeting moiety," "targeting moiety," "mRNA targeting portion" or "targeting portion" refer to a domain, portion or region of the dual functional oligonucleotide having sufficient size and sufficient complementarity to a portion or region of an mRNA chosen or targeted for silencing (i.e., the moiety has a sequence sufficient to capture the target mRNA).
[0131] As used herein, the term "linking moiety" or "linking portion" refers to a domain, portion or region of the RNA-silencing agent which covalently joins or links the mRNA.
[0132] As used herein, the term "antisense strand" of an RNA silencing agent, e.g., an siRNA, refers to a strand that is substantially complementary to a section of about 10-50 nucleotides, e.g., about 15-30, 16-25, 18-23 or 19-22 nucleotides of the mRNA of the gene targeted for silencing. The antisense strand or first strand has sequence sufficiently complementary to the desired target mRNA sequence to direct target-specific silencing, e.g., complementarity sufficient to trigger the destruction of the desired target mRNA by the RNAi machinery or process (RNAi interference) or complementarity sufficient to trigger translational repression of the desired target mRNA.
[0133] The term "sense strand" or "second strand" of an RNA silencing agent, e.g., an siRNA or RNA silencing agent, refers to a strand that is complementary to the antisense strand or first strand. Antisense and sense strands can also be referred to as first or second strands, the first or second strand having complementarity to the target sequence and the respective second or first strand having complementarity to said first or second strand. miRNA duplex intermediates or siRNA-like duplexes include a miRNA strand having sufficient complementarity to a section of about 10-50 nucleotides of the mRNA of the gene targeted for silencing and a miRNA* strand having sufficient complementarity to form a duplex with the miRNA strand.
[0134] As used herein, the term "guide strand" refers to a strand of an RNA silencing agent, e.g., an antisense strand of an siRNA duplex or siRNA sequence, that enters into the RISC complex and directs cleavage of the target mRNA.
[0135] As used herein, the term "asymmetry," as in the asymmetry of the duplex region of an RNA silencing agent (e.g., the stem of an shRNA), refers to an inequality of bond strength or base pairing strength between the termini of the RNA silencing agent (e.g., between terminal nucleotides on a first strand or stem portion and terminal nucleotides on an opposing second strand or stem portion), such that the 5' end of one strand of the duplex is more frequently in a transient unpaired, e.g., single- stranded, state than the 5' end of the complementary strand. This structural difference determines that one strand of the duplex is preferentially incorporated into a RISC complex. The strand whose 5' end is less tightly paired to the complementary strand will preferentially be incorporated into RISC and mediate RNAi.
[0136] As used herein, the term "bond strength" or "base pair strength" refers to the strength of the interaction between pairs of nucleotides (or nucleotide analogs) on opposing strands of an oligonucleotide duplex (e.g., an siRNA duplex), due primarily to H-bonding, van der Waals interactions, and the like, between said nucleotides (or nucleotide analogs).
[0137] As used herein, the "5' end," as in the 5' end of an antisense strand, refers to the 5' terminal nucleotides, e.g., between one and about 5 nucleotides at the 5' terminus of the antisense strand. As used herein, the "3' end," as in the 3' end of a sense strand, refers to the region, e.g., a region of between one and about 5 nucleotides, that is complementary to the nucleotides of the 5' end of the complementary antisense strand.
[0138] As used herein the term "destabilizing nucleotide" refers to a first nucleotide or nucleotide analog capable of forming a base pair with second nucleotide or nucleotide analog such that the base pair is of lower bond strength than a conventional base pair (i.e., Watson- Crick base pair). In certain embodiments, the destabilizing nucleotide is capable of forming a mismatch base pair with the second nucleotide. In other embodiments, the destabilizing nucleotide is capable of forming a wobble base pair with the second nucleotide. In yet other embodiments, the destabilizing nucleotide is capable of forming an ambiguous base pair with the second nucleotide. In some embodiments, the destabilizing nucleotide is an unlocked nucleic acid (UNA) modified nucleotide or an abasic nucleotide. In some embodiments, the abasic nucleotide is a dSpacer (1,2'-Dideoxyribose) nucleotide.
[0139] As used herein, the term "base pair" refers to the interaction between pairs of nucleotides (or nucleotide analogs) on opposing strands of an oligonucleotide duplex (e.g., a duplex formed by a strand of a RNA silencing agent and a target mRNA sequence), due primarily to H-bonding, van der Waals interactions, and the like between said nucleotides (ornucleotide analogs). As used herein, the term "bond strength" or "base pair strength" refers to the strength of the base pair.
[0140] As used herein, the term "mismatched base pair" refers to a base pair consisting of non- complementary or non-Watson-Crick base pairs, for example, not normal complementary G:C, A:T or A:U base pairs. As used herein the term "ambiguous base pair" (also known as a non- discriminatory base pair) refers to a base pair formed by a universal nucleotide.
[0141] As used herein, term "universal nucleotide" (also known as a "neutral nucleotide") include those nucleotides (e.g., certain destabilizing nucleotides) having a base (a "universal base" or "neutral base") that does not significantly discriminate between bases on a complementary polynucleotide when forming a base pair. Universal nucleotides are predominantly hydrophobic molecules that can pack efficiently into antiparallel duplex nucleic acids (e.g., double-stranded DNA or RNA) due to stacking interactions. The base portion of universal nucleotides typically comprise a nitrogen-containing aromatic heterocyclic moiety.
[0142] As used herein, the terms "sufficient complementarity" or "sufficient degree of complementarity" mean that the RNA silencing agent has a sequence (e.g., in the antisense strand, mRNA targeting moiety or miRNA recruiting moiety), which is sufficient to bind the desired target RNA, respectively, and to trigger the RNA silencing of the target mRNA.
[0143] As used herein, the term "translational repression" refers to a selective inhibition of mRNA translation. Natural translational repression proceeds via miRNAs cleaved from shRNA precursors. Both RNAi and translational repression are mediated by RISC. Both RNAi and translational repression occur naturally or can be initiated by the hand of man, for example, to silence the expression of target genes.
[0144] Various methodologies of the instant disclosure include a step that involves comparing a value, level, feature, characteristic, property, etc. to a "suitable control," referred to interchangeably herein as an "appropriate control." A "suitable control" or "appropriate control" is any control or standard familiar to one of ordinary skill in the art useful for comparison purposes. In one embodiment, a "suitable control" or "appropriate control" is a value, level, feature, characteristic, property, etc. determined prior to performing an RNAi methodology, as described herein. For example, a transcription rate, mRNA level, translation rate, protein level, biological activity, cellular characteristic or property, genotype, phenotype, etc. can be determined prior to introducing an RNA silencing agent of the disclosure into a cell or organism. In another embodiment, a "suitable control" or "appropriate control" is a value,level, feature, characteristic, property, etc. determined in a cell or organism, e.g., a control or normal cell or organism, exhibiting, for example, normal traits. In yet another embodiment, a "suitable control" or "appropriate control" is a predefined value, level, feature, characteristic, property, etc.
[0145] In one aspect, instead of the RNA silencing agent being an interfering ribonucleic acid, e.g., an siRNA or shRNA as described above, the RNAi agent can encode an interfering ribonucleic acid, e.g., an shRNA, as described above. In other words, the RNAi agent can be a transcriptional template of the interfering ribonucleic acid. Thus, RNAi agents of the present disclosure can also include small hairpin RNAs (shRNAs), and expression constructs engineered to express shRNAs. Transcription of shRNAs is initiated at a polymerase III (pol III) promoter, and is thought to be terminated at position 2 of a 4-5-thymine transcription termination site. Upon expression, shRNAs are thought to fold into a stem-loop structure with 3' UU-overhangs; subsequently, the ends of these shRNAs are processed, converting the shRNAs into siRNA-like molecules of about 21-23 nucleotides (Brummelkamp et al., 2002; Lee et al., 2002, Supra, Miyagishi et al., 2002; Paddison et al., 2002, supra, Paul et al., 2002, supra, Sui et al., 2002 supra, Yu et al., 2002, supra. More information about shRNA design and use can be found on the internet at the following addresses: katandin.cshl.org:9331 / RNAi / docs / BseRI-BamHI Strategy.pdf and katandin.cshl.org:9331 / RNAi / docs / W eb_version_of_PCR_strategy 1.pdf).
[0146] Expression constructs of the present disclosure include any construct suitable for use in the appropriate expression system and include, but are not limited to, retroviral vectors, linear expression cassettes, plasmids and viral or virally-derived vectors, as known in the art. Such expression constructs can include one or more inducible promoters, RNA Pol III promoter systems, such as U6 snRNA promoters or Hl RNA polymerase III promoters, or other promoters known in the art. The constructs can include one or both strands of the siRNA. Expression constructs expressing both strands can also include loop structures linking both strands, or each strand can be separately transcribed from separate promoters within the same construct. Each strand can also be transcribed from a separate expression construct. (Tuschl, T., 2002, Supra).
[0147] Synthetic siRNAs can be delivered into cells by methods known in the art, including cationic liposome transfection and electroporation. To obtain longer term suppression of the target genes (e.g., targets of miR29b) and to facilitate delivery under certain circumstances,one or more siRNA can be expressed within cells from recombinant DNA constructs. Such methods for expressing siRNA duplexes within cells from recombinant DNA constructs to allow longer-term target gene suppression in cells are known in the art, including mammalian Pol III promoter systems (e.g., Hl or U6 / snRNA promoter systems (Tuschl, T., 2002, supra) capable of expressing functional double-stranded siRNAs; (Bagella et al., 1998; Lee et al., 2002, supra, Miyagishi et al., 2002, supra, Paul et al., 2002, supra, Yu et al., 2002, supra, Sui et al., 2002, supra). Transcriptional termination by RNA Pol III occurs at runs of four consecutive T residues in the DNA template, providing a mechanism to end the siRNA transcript at a specific sequence. The siRNA is complementary to the sequence of the target gene in 5'-3' and 3'-5' orientations, and the two strands of the siRNA can be expressed in the same construct or in separate constructs. Hairpin siRNAs, driven by Hl or U6 snRNA promoter and expressed in cells, can inhibit target gene expression (Bagella et al., 1998; Lee et al., 2002, supra, Miyagishi et al., 2002, supra, Paul et al., 2002, supra, Yu et al., 2002), supra,' Sui et al., 2002, supra). Constructs containing siRNA sequence under the control of T7 promoter also make functional siRNAs when co-transfected into the cells with a vector expressing T7 RNA polymerase (Jacque et al., 2002, supra).
[0148] Animal cells express a range of noncoding RNAs of approximately 22 nucleotides termed micro-RNA (miRNAs), which can regulate gene expression at the post transcriptional or translational level during animal development. One common feature of miRNAs is that they are all excised from an approximately 70 nucleotide precursor RNA stem-loop, probably by Dicer, an RNase Ill-type enzyme, or a homolog thereof. By substituting the stem sequences of the miRNA precursor with sequence complementary to the target mRNA, a vector construct that expresses the engineered precursor can be used to produce siRNAs to initiate RNAi against specific mRNA targets in mammalian cells (Zeng et al., 2002, supra). When expressed by DNA vectors containing polymerase III promoters, micro-RNA designed hairpins can silence gene expression (McManus et al., 2002, supra). MicroRNAs targeting polymorphisms may also be useful for blocking translation of mutant proteins, in the absence of siRNA-mediated genesilencing. Such applications may be useful in situations, for example, where a designed siRNA caused off-target silencing of wild type protein.
[0149] Viral-mediated delivery mechanisms can also be used to induce specific silencing of targeted genes through expression of siRNA, for example, by generating recombinant adenoviruses harboring siRNA under RNA Pol II promoter transcription control (Xia et al.,2002, supra). Infection of HeLa cells by these recombinant adenoviruses allows for diminished endogenous target gene expression. Injection of the recombinant adenovirus vectors into transgenic mice expressing the target genes of the siRNA results in in vivo reduction of target gene expression. Id. In an animal model, whole-embryo electroporation can efficiently deliver synthetic siRNA into post-implantation mouse embryos (Calegari et al., 2002). In adult mice, efficient delivery of siRNA can be accomplished by "high-pressure" delivery technique, a rapid injection (within 5 seconds) of a large volume of siRNA containing solution into animal via the tail vein (Liu et al., 1999, supra,' McCaffrey et al., 2002, supra, Lewis et al., 2002. Nanoparticles and liposomes can also be used to deliver siRNA into animals. In certain exemplary embodiments, recombinant adeno-associated viruses (rAAVs) and their associated vectors can be used to deliver one or more siRNAs into cells, e.g., neural cells (e.g., brain cells) (US Patent Applications 2014 / 0296486, 2010 / 0186103, 2008 / 0269149, 2006 / 0078542 and 2005 / 0220766).
[0150] The nucleic acid compositions of the disclosure include both unmodified siRNAs and modified siRNAs, such as crosslinked siRNA derivatives or derivatives having non-nucleotide moieties linked, for example to their 3' or 5' ends. Modifying siRNA derivatives in this way may improve cellular uptake or enhance cellular targeting activities of the resulting siRNA derivative, as compared to the corresponding siRNA, and are useful for tracing the siRNA derivative in the cell, or improving the stability of the siRNA derivative compared to the corresponding siRNA.
[0151] Engineered RNA precursors, introduced into cells or whole organisms as described herein, will lead to the production of a desired siRNA molecule. Such an siRNA molecule will then associate with endogenous protein components of the RNAi pathway to bind to and target a specific mRNA sequence for cleavage and destruction. In this fashion, the mRNA, which will be targeted by the siRNA generated from the engineered RNA precursor, and will be depleted from the cell or organism, leading to a decrease in the concentration of the protein encoded by that mRNA in the cell or organism. The RNA precursors are typically nucleic acid molecules that individually encode either one strand of a dsRNA or encode the entire nucleotide sequence of an RNA hairpin loop structure.
[0152] The nucleic acid compositions of the disclosure can be unconjugated or can be conjugated to another moiety, such as a nanoparticle, to enhance a property of the compositions, e.g., a pharmacokinetic parameter such as absorption, efficacy, bioavailabilityand / or half-life. The conjugation can be accomplished by methods known in the art, e.g., using the methods of Lambert et al., Drug Deliv. Rev.: 47(1), 99-112 (2001) (describes nucleic acids loaded to polyalkylcyanoacrylate (PACA) nanoparticles); Fattal et al., J. Control Release 53(1- 3): 137-43 (1998) (describes nucleic acids bound to nanoparticles); Schwab et al., Ann. Oncol. 5 Suppl. 4:55-8 (1994) (describes nucleic acids linked to intercalating agents, hydrophobic groups, polycations or PACA nanoparticles); and Godard et al., Eur. J. Biochem. 232(2):404- 10 (1995) (describes nucleic acids linked to nanoparticles).
[0153] The nucleic acid molecules of the present disclosure can also be labeled using any method known in the art. For instance, the nucleic acid compositions can be labeled with a fluorophore, e.g., Cy3, fluorescein, or rhodamine. The labeling can be carried out using a kit, e.g., the SILENCER™ siRNA labeling kit (Ambion). Additionally, the siRNA can be radiolabeled, e.g., using3H,32P or another appropriate isotope.
[0154] Moreover, because RNAi is believed to progress via at least one single-stranded RNA intermediate, the skilled artisan will appreciate that ss-siRNAs (e.g., the antisense strand of a ds-siRNA) can also be designed (e.g., for chemical synthesis), generated (e.g., enzymatically generated), or expressed (e.g., from a vector or plasmid) as described herein and utilized according to the claimed methodologies. Moreover, in invertebrates, RNAi can be triggered effectively by long dsRNAs (e.g., dsRNAs about 100-1000 nucleotides in length, such as about 200-500, for example, about 250, 300, 350, 400 or 450 nucleotides in length) acting as effectors of RNAi. (Brondani et al., Proc Natl Acad Sci USA. 2001 Dec. 4; 98(25): 14428-33. Epub 2001 Nov. 27.)MicroRNA 29b Mimic Oligonucleotides
[0155] Described herein are siRNA-based (i.e., dsRNA-based) miR29b mimics. The miR29b mimics are capable of blunting fibrosis in vivo and repressing the expression of pro-fibrotic genes. The miR29b mimics described herein are optimized in one or more ways to promote activity, reduce toxicity in vivo, and improve tissue distribution, uptake, and retention.
[0156] In one aspect, the miR29b mimics possess base pair mismatches between the antisense strand and sense strand of the miR29b mimic. The use of mismatches leads to dsRNA duplex destabilization which improves productive RISC loading.
[0157] Thus, in one aspect, the disclosure provides a double stranded RNA (dsRNA) comprising a sense strand and an antisense strand, each strand having a 5’ end and a 3’ end, wherein: the antisense strand comprises a nucleotide sequence of UAGCACCAUUUGAAAUCAGUG, a chemically modified variant thereof, or UAGCACCAUUUGAAAUCAGUGUU, or a chemically modified variant thereof, and the sense strand is substantially complementary to the antisense strand and consists of 1 or 2 mismatches with the antisense strand. As used herein, the term “chemically modified variant thereof’ refers to the specific antisense and sense strand sequences disclosed herein having one or more of the chemical modifications described herein. While the specific antisense and sense strand sequences disclosed herein are shown in an unmodified form, it will be readily apparent to one of skill in the art that any of the chemical modifications described herein may be applied to these unmodified strands to form chemically modified variants thereof.
[0158] In certain embodiments, the antisense strand comprises a mismatch with the sense strand at nucleotide position 1 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand comprises a mismatch with the sense strand at nucleotide position 2 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand comprises a mismatch with the sense strand at nucleotide position 3 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand comprises a mismatch with the sense strand at nucleotide position 3 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand comprises a mismatch with the sense strand at nucleotide position 4 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand comprises a mismatch with the sense strand at nucleotide position 5 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand comprises a mismatch with the sense strand at nucleotide position 6 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand comprises a mismatch with the sense strand at nucleotide position 7 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand comprises a mismatch with the sense strand at nucleotide position 8 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand comprises a mismatch with the sense strand at nucleotide position 9 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand comprises a mismatch with the sense strand at nucleotide position 10 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand comprises a mismatch with the sense strand at nucleotide position 11 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand comprises a mismatch with the sense strand atnucleotide position 12 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand comprises a mismatch with the sense strand at nucleotide position 13 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand comprises a mismatch with the sense strand at nucleotide position 14 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand comprises a mismatch with the sense strand at nucleotide position 15 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand comprises a mismatch with the sense strand at nucleotide position 16 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 1 and 2 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 1 and 3 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 1 and 4 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 1 and 5 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 1 and 6 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 1 and 7 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 1 and 8 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 1 and 9 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 1 and 10 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 1 and 11 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 1 and 12 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 1 and 13 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 1 and 14 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 1 and 15 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 1 and 16 from the 5’ end of theantisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 11 and 2 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 11 and 3 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 11 and 4 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 11 and 5 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 11 and 6 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 11 and 7 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 11 and 8 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 11 and 9 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 11 and 10 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 11 and 12 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 11 and 13 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 11 and 14 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 11 and 15 from the 5’ end of the antisense strand. In certain embodiments, the antisense strand consists of a mismatch with the sense strand at nucleotide position 11 and 16 from the 5’ end of the antisense strand.
[0159] In certain embodiments, the sense strand comprises or consists of AUUUCCAAUGGUGCUU (SEQ ID NO: ##), or a chemically modified variant thereof.
[0160] In certain embodiments, the sense strand comprises or consists ofAUUUCAAACGGUGCUU (SEQ ID NO: ##), or a chemically modified variant thereof.
[0161] In certain embodiments, the sense strand comprises or consists ofAUUUCAAAUGGUGCUA (SEQ ID NO: ##), or a chemically modified variant thereof.
[0162] In In certain embodiments, the antisense strand comprises about 15 nucleotides to 25 nucleotides in length (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length). In certain embodiments, the antisense strand is 20 nucleotides in length, 21 nucleotides in length, or 22 nucleotides in length. In certain embodiments, the sense strand comprises about 15 nucleotides to 25 nucleotides in length (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length). In certain embodiments, the sense strand is 15 nucleotides in length, 16 nucleotides in length, 18 nucleotides in length, or 20 nucleotides in length.
[0163] In certain embodiments, the siRNA (i.e., dsRNA) comprises a double-stranded region of 15 base pairs to 20 base pairs (e.g., 15, 16, 17, 18, 19, or 20 base pairs). In certain embodiments, the siRNA comprises a double-stranded region of 15 base pairs, 16 base pairs, 18 base pairs, or 20 base pairs.
[0164] In certain embodiments, the siRNA comprises at least one blunt-end. In certain embodiments, the siRNA comprises two blunt-ends.
[0165] In certain embodiments, the siRNA comprises at least one single stranded nucleotide overhang (also referred to herein as a “single-stranded tail”). In certain embodiments, the siRNA comprises two single stranded nucleotide overhangs. In certain embodiments, the siRNA comprises about a 2-nucleotide to 5-nucleotide single stranded nucleotide overhang (e.g., a 2-, 3-, 4-, or 5-nucleotide overhang). In certain embodiments, the siRNA comprises a 2-nucleotide single stranded nucleotide overhang or a 5-nucleotide single stranded nucleotide overhang.
[0166] In certain embodiments, the siRNA comprises naturally occurring nucleotides (i.e., unmodified ribonucleotides).
[0167] In certain embodiments, the siRNA comprises at least one modified nucleotide. In certain embodiments, the modified nucleotide comprises a 2'-O-methyl modified nucleotide, a 2'-deoxy-2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, an abasic nucleotide, a 2'-amino-modified nucleotide, a 2'-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, a non-natural base comprising nucleotide, or a mixture thereof.
[0168] In certain embodiments, the modified nucleotide comprises a 2'-O-methyl modified nucleotide, a 2'-deoxy-2'-fluoro modified nucleotide, an unlocked nucleic acid (UNA) modified nucleotide, an abasic nucleotide, or a mixture thereof.
[0169] In an additional aspect of the disclosure, the miR29b mimics may employ at least one destabilizing nucleotide in the sense strand.
[0170] The use of destabilizing modifications such as Unlocked Nucleic Acid (UNA) or an abasic nucleotide (such as dSpacer) without a nucleobase can provide an alternative strategy with higher metabolic stabilization compared to the mismatch incorporation described above, which partially exposes a labile single-stranded region.
[0171] Thus, in one aspect, the disclosure provides a double stranded RNA (dsRNA) comprising a sense strand and an antisense strand, each strand having a 5’ end and a 3’ end, wherein: the antisense strand comprises a nucleotide sequence ofUAGCACCAUUUGAAAUCAGUG, or a chemically modified variant thereof, or UAGCACCAUUUGAAAUCAGUGUU, or a chemically modified variant thereof, and the sense strand is substantially complementary to the antisense strand and comprises at least one destabilizing nucleotide.
[0172] In certain embodiments, the at least one destabilizing nucleotide is an unlocked nucleic acid (UNA) modified nucleotide, an abasic nucleotide, or a mixture thereof. In certain embodiments, the abasic nucleotide is a dSpacer (l,2'-dideoxyribose) nucleotide.
[0173] In certain embodiments, the at least one destabilizing nucleotide is at position 6 from the 5’ end of the sense strand. In certain embodiments, the at least one destabilizing nucleotide is at position 9 from the 5’ end of the sense strand. In certain embodiments, the at least one destabilizing nucleotide is at position 1 from the 5’ end of the sense strand. In certain embodiments, the at least one destabilizing nucleotide is at position 2 from the 5’ end of the sense strand. In certain embodiments, the at least one destabilizing nucleotide is at position 3 from the 5’ end of the sense strand. In certain embodiments, the at least one destabilizing nucleotide is at position 4 from the 5’ end of the sense strand. In certain embodiments, the at least one destabilizing nucleotide is at position 5 from the 5’ end of the sense strand. In certain embodiments, the at least one destabilizing nucleotide is at position 7 from the 5’ end of the sense strand. In certain embodiments, the at least one destabilizing nucleotide is at position 8 from the 5’ end of the sense strand. In certain embodiments, the at least one destabilizing nucleotide is at position 10 from the 5’ end of the sense strand. In certain embodiments, the at least one destabilizing nucleotide is at position 11 from the 5’ end of the sense strand. In certain embodiments, the at least one destabilizing nucleotide is at position 12 from the 5’ end of the sense strand. In certain embodiments, the at least one destabilizing nucleotide is at position 13from the 5’ end of the sense strand. In certain embodiments, the at least one destabilizing nucleotide is at position 14 from the 5’ end of the sense strand. In certain embodiments, the at least one destabilizing nucleotide is at position 15 from the 5’ end of the sense strand. In certain embodiments, the at least one destabilizing nucleotide is at position 16 from the 5’ end of the sense strand.
[0174] In certain embodiments, the sense strand consists of one destabilizing nucleotide. In certain embodiments, the sense strand consists of two destabilizing nucleotides. In certain embodiments, the sense strand consists of three destabilizing nucleotides.
[0175] In certain embodiments, the at least one destabilizing nucleotide may be incorporated into the sense strand in combination with at least one mismatch between the sense strand and the antisense strand, as described above. In certain embodiments, the at least one destabilizing nucleotide may be incorporated into the sense strand without any mismatches between the sense strand and the antisense strand.
[0176] In certain embodiments, the siRNA comprises at least one modified intemucleotide linkage. In certain embodiments, the modified intemucleotide linkage comprises a phosphorothioate intemucleotide linkage. In certain embodiments, the siRNA comprises 4-16 phosphorothioate intemucleotide linkages. In certain embodiments, the siRNA comprises 8-13 phosphorothioate intemucleotide linkages.
[0177] In certain embodiments, the siRNA comprises at least 80% chemically modified nucleotides (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% chemically modified nucleotides). In certain embodiments, the siRNA is fully chemically modified.
[0178] In certain embodiments, the siRNA comprises at least 70% 2’-O-methyl nucleotide modifications (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% % 2’-O-methyl nucleotide modifications). In certain embodiments, the antisense strand comprises at least 70% 2’-O-methyl nucleotide modifications (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% % 2’-O-methyl nucleotide modifications). In certain embodiments, the antisense strand comprises about 70% to 90% 2’-O-methyl nucleotide modifications. In certain embodiments, the sense strand comprises at least 65% 2’-O-methyl nucleotide modifications (e.g., 65%, 66%, 67%, 68%, 69%70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% % 2’-O-methyl nucleotide modifications). In certain embodiments, the sense strand comprises 100% 2’-O-methyl nucleotide modifications.
[0179] In certain embodiments, the antisense strand comprises a 5’ phosphate, a 5 ’-alkyl phosphonate, a 5’ alkylene phosphonate, or a 5’ alkenyl phosphonate. In certain embodiments, the antisense strand comprises a 5’ vinyl phosphonate.
[0180] Exemplary chemically modified antisense and sense strands of the exemplary miR29b mimics
[0181] In certain embodiments, the antisense strand comprises or consists of V(mU)#(fA)#(mG)(fC)(mA)(fC)(mC)(fA)(mU)(fU)(mU)(fG)(mA)(fA)#(mA)#(fU)#(mC)#(f A)#(mG)#(fU)#(mG) (SEQ ID NO: ##), wherein “m” corresponds to a 2'-O-methyl modified nucleotide, “f ’ corresponds to a 2'-deoxy-2'-fluoro modified nucleotide, “#” corresponds to a phosphorothioate modified intemucleotide linkage, and “V” corresponds to a 5’ vinyl phosphonate.
[0182] In certain embodiments, the antisense strand comprises or consists of V(mU)#(fA)#(mG)(fC)(fA)(fC)(mC)(fA)(mU)(fU)(mU)(fG)(mA)(fA)#(mA)#(fU)#(mC)#(m A)#(mG)#(fU)#(mG) (SEQ ID NO: ##), wherein “m” corresponds to a 2'-O-methyl modified nucleotide, “f ’ corresponds to a 2'-deoxy-2'-fluoro modified nucleotide, “#” corresponds to a phosphorothioate modified intemucleotide linkage, and “V” corresponds to a 5’ vinyl phosphonate.
[0183] In certain embodiments, the antisense strand comprises or consists of V(mU)#(fA)#(mG)(fC)(fA)(fC)(mC)(fA)(mU)(fU)(mU)(fG)(mA)(fA)#(mA)#(fU)#(mC)#(m A)#(mG)#(fU)#(mU) (SEQ ID NO: ##), wherein “m” corresponds to a 2'-O-methyl modified nucleotide, “f ’ corresponds to a 2'-deoxy-2'-fluoro modified nucleotide, “#” corresponds to a phosphorothioate modified intemucleotide linkage, and “V” corresponds to a 5’ vinyl phosphonate.
[0184] In certain embodiments, the sense strand comprises or consists of (mA)#(fU)#(mU)(fU)(mC)(fC)(mA)(fA)(mU)(fG)(mG)(fU)(mG)(fC)#(mU)#(fU) (SEQ ID NO: ##), wherein “m” corresponds to a 2'-O-m ethyl modified nucleotide, “f ’ corresponds to a2'-deoxy-2'-fluoro modified nucleotide, and “#” corresponds to a phosphorothioate modified internucleotide linkage.
[0185] In certain embodiments, the sense strand comprises or consists of (mA)#(mU)#(mU)(fU)(mC)(fC)(mA)(fA)(mU)(fG)(mG)(mU)(mG)(fC)#(mU)#(mU) (SEQ ID NO: ##), wherein “m” corresponds to a 2'-O-methyl modified nucleotide, “f ’ corresponds to a 2'-deoxy-2'-fluoro modified nucleotide, and “#” corresponds to a phosphorothioate modified internucleotide linkage.
[0186] In certain embodiments, the sense strand comprises or consists of (mA)#(fU)#(mU)(fU)(mC)(fA)(mA)(fA)(mC)(fG)(mG)(fU)(mG)(fC)#(mU)#(fU) (SEQ ID NO: ##), wherein “m” corresponds to a 2'-O-m ethyl modified nucleotide, “f ’ corresponds to a 2'-deoxy-2'-fluoro modified nucleotide, and “#” corresponds to a phosphorothioate modified internucleotide linkage.
[0187] In certain embodiments, the sense strand comprises or consists of (mA)#(mU)#(mU)(fU)(mC)(fA)(mA)(fA)(mC)(fG)(mG)(mU)(mG)(fC)#(mU)#(mU) (SEQ ID NO: ##), wherein “m” corresponds to a 2'-O-methyl modified nucleotide, “f ’ corresponds to a 2'-deoxy-2'-fluoro modified nucleotide, and “#” corresponds to a phosphorothioate modified internucleotide linkage.
[0188] In certain embodiments, the sense strand comprises or consists of (mA)#(fU)#(mU)(fU)(mC)(fA)(mA)(fA)(mU)(fG)(mG)(fU)(mG)(fC)#(mU)#(fA) (SEQ ID NO: ##), wherein “m” corresponds to a 2'-O-m ethyl modified nucleotide, “f ’ corresponds to a 2'-deoxy-2'-fluoro modified nucleotide, and “#” corresponds to a phosphorothioate modified internucleotide linkage.
[0189] In certain embodiments, the sense strand comprises or consists of (mA)#(mU)#(mU)(fU)(mC)(fA)(mA)(fA)(mU)(fG)(mG)(mU)(mG)(fC)#(mU)#(mA) (SEQ ID NO: ##), wherein “m” corresponds to a 2'-O-methyl modified nucleotide, “f ’ corresponds to a 2'-deoxy-2'-fluoro modified nucleotide, and “#” corresponds to a phosphorothioate modified internucleotide linkage.
[0190] In one aspect, the disclosure provides a dsRNA comprising a antisense strand and a sense strand, wherein the antisense strand comprises or consists of V(mU)#(fA)#(mG)(fC)(mA)(fC)(mC)(fA)(mU)(fU)(mU)(fG)(mA)(fA)#(mA)#(fU)#(mC)#(f A)#(mG)#(fU)#(mG) (SEQ ID NO: ##), and the sense strand comprises or consists of(mA)#(fU)#(mU)(fU)(mC)(fC)(mA)(fA)(mU)(fG)(mG)(fU)(mG)(fC)#(mU)#(fU) (SEQ ID NO: ##), wherein “m” corresponds to a 2'-O-m ethyl modified nucleotide, “f ’ corresponds to a 2'-deoxy-2'-fluoro modified nucleotide, “#” corresponds to a phosphorothioate modified internucleotide linkage, and “V” corresponds to a 5’ vinyl phosphonate.
[0191] In one aspect, the disclosure provides a dsRNA comprising a antisense strand and a sense strand, wherein the antisense strand comprises or consists of V(mU)#(fA)#(mG)(fC)(mA)(fC)(mC)(fA)(mU)(fU)(mU)(fG)(mA)(fA)#(mA)#(fU)#(mC)#(f A)#(mG)#(fU)#(mG) (SEQ ID NO: ##), and the sense strand comprises or consists of (mA)#(fU)#(mU)(fU)(mC)(fA)(mA)(fA)(mC)(fG)(mG)(fU)(mG)(fC)#(mU)#(fU) (SEQ ID NO: ##), wherein “m” corresponds to a 2'-O-m ethyl modified nucleotide, “f ’ corresponds to a 2'-deoxy-2'-fluoro modified nucleotide, “#” corresponds to a phosphorothioate modified internucleotide linkage, and “V” corresponds to a 5’ vinyl phosphonate.
[0192] In one aspect, the disclosure provides a dsRNA comprising a antisense strand and a sense strand, wherein the antisense strand comprises or consists of V(mU)#(fA)#(mG)(fC)(mA)(fC)(mC)(fA)(mU)(fU)(mU)(fG)(mA)(fA)#(mA)#(fU)#(mC)#(f A)#(mG)#(fU)#(mG) (SEQ ID NO: ##), and the sense strand comprises or consists of (mA)#(fU)#(mU)(fU)(mC)(fA)(mA)(fA)(mU)(fG)(mG)(fU)(mG)(fC)#(mU)#(fA) (SEQ ID NO: ##), wherein “m” corresponds to a 2'-O-m ethyl modified nucleotide, “f ’ corresponds to a 2'-deoxy-2'-fluoro modified nucleotide, “#” corresponds to a phosphorothioate modified internucleotide linkage, and “V” corresponds to a 5’ vinyl phosphonate.
[0193] In one aspect, the disclosure provides a dsRNA comprising a antisense strand and a sense strand, wherein the antisense strand comprises or consists of V(mU)#(fA)#(mG)(fC)(fA)(fC)(mC)(fA)(mU)(fU)(mU)(fG)(mA)(fA)#(mA)#(fU)#(mC)#(m A)#(mG)#(fU)#(mG) (SEQ ID NO: ##), and the sense strand comprises or consists of (mA)#(mU)#(mU)(fU)(mC)(fC)(mA)(fA)(mU)(fG)(mG)(mU)(mG)(fC)#(mU)#(mU) (SEQ ID NO: ##), wherein “m” corresponds to a 2'-O-methyl modified nucleotide, “f ’ corresponds to a 2'-deoxy-2'-fluoro modified nucleotide, “#” corresponds to a phosphorothioate modified internucleotide linkage, and “V” corresponds to a 5’ vinyl phosphonate.
[0194] In one aspect, the disclosure provides a dsRNA comprising a antisense strand and a sense strand, wherein the antisense strand comprises or consists of V(mU)#(fA)#(mG)(fC)(fA)(fC)(mC)(fA)(mU)(fU)(mU)(fG)(mA)(fA)#(mA)#(fU)#(mC)#(m A)#(mG)#(fU)#(mG) (SEQ ID NO: ##), and the sense strand comprises or consists of(mA)#(mU)#(mU)(fU)(mC)(fA)(mA)(fA)(mC)(fG)(mG)(mU)(mG)(fC)#(mU)#(mU) (SEQ ID NO: ##), wherein “m” corresponds to a 2'-O-methyl modified nucleotide, “f ’ corresponds to a 2'-deoxy-2'-fluoro modified nucleotide, “#” corresponds to a phosphorothioate modified internucleotide linkage, and “V” corresponds to a 5’ vinyl phosphonate.MicroRNA 29b Mimic Short Hairpin RNA (shRNA) Molecules
[0195] In certain featured embodiments, the instant disclosure provides shRNAs capable of mediating RNA silencing of miR29b target genes. In contrast to siRNAs, shRNAs mimic the natural precursors of micro RNAs (miRNAs) and enter at the top of the gene silencing pathway. For this reason, shRNAs are believed to mediate gene silencing more efficiently by being fed through the entire natural gene silencing pathway.
[0196] miRNAs are noncoding RNAs of approximately 22 nucleotides, which can regulate gene expression at the post transcriptional or translational level during plant and animal development. One common feature of miRNAs is that they are all excised from an approximately 70 nucleotide precursor RNA stem-loop termed pre-miRNA, probably by Dicer, an RNase Ill-type enzyme, or a homolog thereof. Naturally-occurring miRNA precursors (pre- miRNA) have a single strand that forms a duplex stem including two portions that are generally complementary, and a loop, which connects the two portions of the stem. In typical pre- miRNAs, the stem includes one or more bulges, e.g., extra nucleotides that create a single nucleotide "loop" in one portion of the stem, and / or one or more unpaired nucleotides that create a gap in the hybridization of the two portions of the stem to each other. Short hairpin RNAs, or engineered RNA precursors, of the present application are artificial constructs based on these naturally occurring pre-miRNAs, but which are engineered to deliver desired RNA silencing agents (e.g., siRNAs of the disclosure). By substituting the stem sequences of the pre- miRNA with sequence complementary to the target mRNA, a shRNA is formed. The shRNA is processed by the entire gene silencing pathway of the cell, thereby efficiently mediating RNAi.
[0197] The requisite elements of a shRNA molecule include a first portion and a second portion, having sufficient complementarity to anneal or hybridize to form a duplex or doublestranded stem portion. The two portions need not be fully or perfectly complementary. The first and second "stem" portions are connected by a portion having a sequence that has insufficient sequence complementarity to anneal or hybridize to other portions of the shRNA.This latter portion is referred to as a "loop" portion in the shRNA molecule. The shRNA molecules are processed to generate siRNAs. shRNAs can also include one or more bulges, i.e., extra nucleotides that create a small nucleotide "loop" in a portion of the stem, for example a one-, two- or three-nucleotide loop. The stem portions can be the same length, or one portion can include an overhang of, for example, 1-5 nucleotides. The overhanging nucleotides can include, for example, uracils (Us), e.g., all Us. Such Us are notably encoded by thymidines (Ts) in the shRNA-encoding DNA which signal the termination of transcription.
[0198] In shRNAs (or engineered precursor RNAs) of the instant disclosure, one portion of the duplex stem is a nucleic acid sequence that is complementary (or anti-sense) to miR29b target gene sequences. In certain embodiments, one strand of the stem portion of the shRNA is sufficiently complementary (e.g., antisense) to a target RNA (e.g., mRNA) sequence to mediate degradation or cleavage of said target RNA via RNA interference (RNAi). Thus, engineered RNA precursors include a duplex stem with two portions and a loop connecting the two stem portions. The antisense portion can be on the 5' or 3' end of the stem. The stem portions of a shRNA are about 15 to about 50 nucleotides in length. In certain embodiments, the two stem portions are about 18 or 19 to about 21, 22, 23, 24, 25, 30, 35, 37, 38, 39, or 40 or more nucleotides in length. In certain embodiments, the length of the stem portions should be 21 nucleotides or greater. When used in mammalian cells, the length of the stem portions should be less than about 30 nucleotides to avoid provoking non-specific responses like the interferon pathway. In non-mammalian cells, the stem can be longer than 30 nucleotides. In fact, the stem can include much larger sections complementary to the target mRNA (up to, and including the entire mRNA). In fact, a stem portion can include much larger sections complementary to the target mRNA (up to, and including the entire mRNA).
[0199] The two portions of the duplex stem must be sufficiently complementary to hybridize to form the duplex stem. Thus, the two portions can be, but need not be, fully or perfectly complementary. In addition, the two stem portions can be the same length, or one portion can include an overhang of 1, 2, 3, or 4 nucleotides. The overhanging nucleotides can include, for example, uracils (Us), e.g., all Us. The loop in the shRNAs or engineered RNA precursors may differ from natural pre-miRNA sequences by modifying the loop sequence to increase or decrease the number of paired nucleotides, or replacing all or part of the loop sequence with a tetraloop or other loop sequences. Thus, the loop in the shRNAs or engineered RNA precursors can be 2, 3, 4, 5, 6, 7, 8, 9, or more, e.g., 15 or 20, or more nucleotides in length.
[0200] The loop in the shRNAs or engineered RNA precursors may differ from natural pre- miRNA sequences by modifying the loop sequence to increase or decrease the number of paired nucleotides, or replacing all or part of the loop sequence with a tetraloop or other loop sequences. Thus, the loop portion in the shRNA can be about 2 to about 20 nucleotides in length, i.e., about 2, 3, 4, 5, 6, 7, 8, 9, or more, e.g., 15 or 20, or more nucleotides in length. In certain embodiments, a loop consists of or comprises a "tetraloop" sequence. Exemplary tetraloop sequences include, but are not limited to, the sequences GNRA, where N is any nucleotide and R is a purine nucleotide, GGGG, and UUUU.
[0201] In certain embodiments, shRNAs of the present application include the sequences of a desired siRNA molecule described supra. In other embodiments, the sequence of the antisense portion of a shRNA can be designed essentially as described above or generally by selecting an 18, 19, 20, 21 nucleotide, or longer, sequence from within the target RNA (e.g., APP mRNA), for example, from a region 100 to 200 or 300 nucleotides upstream or downstream of the start of translation. In general, the sequence can be selected from any portion of the target RNA (e.g., mRNA) including the 5' UTR (untranslated region), coding sequence, or 3' UTR. This sequence can optionally follow immediately after a region of the target gene containing two adjacent AA nucleotides. The last two nucleotides of the nucleotide sequence can be selected to be UU. This 21 or so nucleotide sequence is used to create one portion of a duplex stem in the shRNA. This sequence can replace a stem portion of a wild-type pre-miRNA sequence, e.g., enzymatically, or is included in a complete sequence that is synthesized. For example, one can synthesize DNA oligonucleotides that encode the entire stem-loop engineered RNA precursor, or that encode just the portion to be inserted into the duplex stem of the precursor, and using restriction enzymes to build the engineered RNA precursor construct, e.g., from a wild-type pre-miRNA.
[0202] Engineered RNA precursors include, in the duplex stem, the 21-22 or so nucleotide sequences of the siRNA or siRNA-like duplex desired to be produced in vivo. Thus, the stem portion of the engineered RNA precursor includes at least 18 or 19 nucleotide pairs corresponding to the sequence of an exonic portion of the gene whose expression is to be reduced or inhibited. The two 3' nucleotides flanking this region of the stem are chosen so as to maximize the production of the siRNA from the engineered RNA precursor and to maximize the efficacy of the resulting siRNA in targeting the corresponding mRNA for translational repression or destruction by RNAi in vivo and in vitro.
[0203] In certain embodiments, shRNAs of the disclosure include miRNA sequences, optionally end-modified miRNA sequences, to enhance entry into RISC. The miRNA sequence can be similar or identical to that of any naturally occurring miRNA (see e.g. The miRNA Registry; Griffiths-Jones S, Nuc. Acids Res., 2004). Over one thousand natural miRNAs have been identified to date and together they are thought to comprise about 1% of all predicted genes in the genome. Many natural miRNAs are clustered together in the introns of pre-mRNAs and can be identified in silico using homology-based searches (Pasquinelli et al., 2000; Lagos- Quintana et al., 2001; Lau et al., 2001; Lee and Ambros, 2001) or computer algorithms (e.g. MiRScan, MiRSeeker) that predict the capability of a candidate miRNA gene to form the stem loop structure of a pri-mRNA (Grad et al., Mol. Cell., 2003; Lim et al., Genes Dev., 2003; Lim et al., Science, 2003; Lai E C et al., Genome Bio., 2003). An online registry provides a searchable database of all published miRNA sequences (The miRNA Registry at the Sanger Institute website; Griffiths-Jones S, Nuc. Acids Res., 2004). Exemplary, natural miRNAs include lin-4, let-7, miR-10, mirR-15, miR-16, miR-168, miR-175, miR-196 and their homologs, as well as other natural miRNAs from humans and certain model organisms including Drosophila melanogaster, Caenorhabditis elegans. zebrafish, Arabidopsis thalania. Mus musculus, and Rattus norvegicus as described in International PCT Publication No. WO 03 / 029459.
[0204] Naturally-occurring miRNAs are expressed by endogenous genes in vivo and are processed from a hairpin or stem-loop precursor (pre-miRNA or pri-miRNAs) by Dicer or other RNAses (Lagos-Quintana et al., Science, 2001; Lau et al., Science, 2001; Lee and Ambros, Science, 2001; Lagos-Quintana et al., Curr. Biol., 2002; Mourelatos et al., Genes Dev., 2002; Reinhart et al., Science, 2002; Ambros et al., Curr. Biol., 2003; Brennecke et al., 2003; Lagos- Quintana et al., RNA, 2003; Lim et al., Genes Dev., 2003; Lim et al., Science, 2003). miRNAs can exist transiently in vivo as a double-stranded duplex, but only one strand is taken up by the RISC complex to direct gene silencing. Certain miRNAs, e.g., plant miRNAs, have perfect or near-perfect complementarity to their target mRNAs and, hence, direct cleavage of the target mRNAs. Other miRNAs have less than perfect complementarity to their target mRNAs and, hence, direct translational repression of the target mRNAs. The degree of complementarity between a miRNA and its target mRNA is believed to determine its mechanism of action. For example, perfect or near-perfect complementarity between a miRNA and its target mRNA is predictive of a cleavage mechanism (Yekta et al., Science, 2004), whereas less than perfect complementarity is predictive of a translational repression mechanism. In certainembodiments, the miRNA sequence is that of a naturally-occurring miRNA sequence, the aberrant expression or activity of which is correlated with a miRNA disorder.N0X4 Antisense Oligonucleotide (ASO)
[0205] In certain embodiments, the oligonucleotide with a sequence substantially complementary a Nicotinamide Adenine Dinucleotide Phosphate Oxidase (N0X4) nucleic acid sequence, is an antisense oligonucleotide (ASO).
[0206] In certain embodiments, the ASO comprises a sequence substantially complementary to N0X4 nucleic acid sequence of any one of Table 10.
[0207] As used herein, the term “antisense oligonucleotide” or “antisense compound” refers to an oligonucleotide molecule which is capable of binding to RNA inside cells by Watson-Crick base pairing. Depending on the sequence and chemistry of the antisense oligonucleotide, this interaction can lead to silencing of a target gene (i.e. reducing the level of expression of mature mRNA and / or protein from that gene) or activation of a target gene (i.e. increasing the level of expression of mature mRNA and / or protein from that gene). The antisense oligonucleotides of the present disclosure are focused on activating gene expression, which can be done utilizing different mechanisms. Some antisense oligonucleotides are designed to recruit RNase H to cleave their target RNAs. RNase H is a family of non-sequence-specific endonuclease enzymes that catalyze the cleavage of RNA in an RNA / DNA substrate via a hydrolytic mechanism. In certain embodiments, the antisense oligonucleotides of the disclosure trigger RNase H-mediated cleavage of a pre-mRNA target, which can be compatible with activation of overall target gene expression. Other antisense oligonucleotides, called steric blockers, are designed not to elicit cleavage of their targets but to block interactions with cellular factors. For example, these cellular factors could modulate splicing, block interactions of noncoding RNAs or of RNA-binding proteins, stabilize mRNA to prolong its half-life, or increase the efficiency of translation of an mRNA.
[0208] As used herein, the term “heteroduplex oligonucleotide” or “HDO” refers to an antisense oligonucleotide-based compound that comprises an antisense oligonucleotide as described herein and a complementary oligonucleotide, annealed to said antisense oligonucleotide, thereby producing a duplex (the HDO). The HDO complementary oligonucleotide may comprise any of the chemical modifications employed in the ASO. HDOsare described in further detail in Nishina et al. (Nature Communications volume 6, Article number: 7969. 2015), W02014192310A1, and WO2014203518A1 each of which is incorporated herein by reference.
[0209] Antisense oligonucleotides designed to recruit RNase H are often designed as “gapmers.” The term “gapmer” means a chimeric antisense oligonucleotide in which an internal region having a plurality of nucleosides that support RNase H cleavage is positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions. The internal region can be referred to as a “gap segment” and the external regions can be referred to as “wing segments.” “Chimeric antisense oligonucleotide” means an antisense oligonucleotide that has at least two chemically distinct regions.
[0210] The term “antisense activity” means any detectable or measurable activity attributable to the hybridization of an antisense compound to its target nucleic acid. In some embodiments, antisense activity is an increase in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid.
[0211] The term “antisense inhibition” means reduction of target nucleic acid levels in the presence of an antisense oligonucleotide having a sequence that is sufficiently complementary to a target nucleic acid compared to target nucleic acid levels in the absence of the antisense compound. A target nucleic acid can be any nucleic acid.
[0212] The term “target-recognition sequence” refers to the portion of an antisense compound that recognizes a target nucleic acid. The target-recognition sequence has a nucleobase sequence that permits hybridization to a corresponding region or segment of a target nucleic acid.
[0213] The term “conserved region” refers to a portion, or portions, of a nucleic acid sequence that is conserved, i.e. a portion, or portions of the nucleic acid sequence having a similar or identical sequence across species. A conserved region can be computationally identified, e.g., using any sequence alignment software available in the art.
[0214] As used herein, a “region of complementarity” refers to a portion of the antisense oligonucleotide that is complementary to the target. For example, but in no way limiting, an 18-nucleotide long antisense oligonucleotide can comprise a contiguous 12-nucleotide portion that is complementary to the target transcript. In certain embodiments, the antisenseoligonucleotide is complementary to the target transcript over the full length of the antisense oligonucleotide.
[0215] In some embodiments, an antisense compound of the present disclosure is an antisense oligonucleotide. Chimeric antisense oligonucleotides typically contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity for the target nucleic acid, and / or increased activity. A second region of a chimeric antisense compound can optionally serve as a substrate for the cellular endonuclease RNase H, which cleaves the RNA strand of an RNA:DNA duplex. In some embodiments, an antisense compound of the present disclosure is a chimeric antisense oligonucleotide having a gapmer motif. In a gapmer, an internal region having a plurality of nucleotides that supports RNase H cleavage is positioned between external regions having a plurality of nucleotides that are chemically distinct from the nucleosides of the internal region.
[0216] In some embodiments, the present disclosure provides an antisense oligonucleotide having a target-recognition sequence that is sufficiently complementary to a target transcript or portion thereof, to direct cleavage of the target transcript by RNase H. The targetrecognition sequence of the antisense oligonucleotide can be the full length of the antisense oligonucleotide, or a portion thereof. In some embodiments, the antisense oligonucleotide comprises a gapmer motif.
[0217] In the case of an antisense compound having a gapmer motif, the gap segment generally serves as the substrate for endonuclease cleavage, while the wing segments comprise modified nucleosides. In certain embodiments, the regions of a gapmer are differentiated by the types of sugar moieties comprising each distinct region. The types of sugar moieties that are used to differentiate the regions of a gapmer can in some embodiments include P-D-ribonucleosides, P-D-deoxyribonucleosides, 2'-modified nucleosides (such 2'-modified nucleosides can include 2'-M0E, and 2'-O-CH3 (i.e., OMe), among others), and bicyclic sugar modified nucleosides (such bicyclic sugar modified nucleosides can include those having a 4'-(CH2)n-O-2' bridge, where n=l or n=2). In some embodiments, the wing segments of the gapmer contain one or more tricyclo-DNA (tcDNA) modifications. In some embodiments, each distinct region comprises uniform sugar moieties. In some embodiments, each wing segment comprises a mixture of different nucleotide modifications. For example, in one embodiment, a LNA modification and a 2'-M0E modification could be used in combination for one antisense compound. In one embodiment, a LNA modification and a 2'-O-Methyl modification could beused in combination for one antisense compound. In one embodiment, a LNA modification and a 2'-deoxy modification could be used in combination for one antisense compound. In one embodiment, a LNA modification and a tricyclo-DNA modification could be used in combination for one antisense compound. In one embodiment, a 2'-M0E modification and a tricyclo-DNA modification could be used in combination for one antisense compound.
[0218] The gapmer motif can be described using the formula “A-B-C”, where “A” represents the length of the 5’ wing region, “B” represents the length of the gap region, and “C” represents the length of the 3’ wing region. As such, in some embodiments, an antisense oligonucleotide of the present disclosure has the formula:A-B-C.
[0219] As used herein, a gapmer described as “A-B-C” has a configuration such that the gap segment is positioned immediately adjacent each of the 5' wing segment and the 3' wing segment. Thus, no intervening nucleotides exist between the 5' wing segment and gap segment, or the gap segment and the 3 ' wing segment.
[0220] In some embodiments, the 5’ wing region represented by “A” comprises from about 0 to about 8 modified nucleotides, e.g., from about 1 to about 6 modified nucleotides. For example, the 5’ wing region represented by “A” can be 0, 1, 2, 3, 4, 5, 6, 7, or 8 nucleotides in length. In some embodiments, the 3’ wing region represented by “C” comprises about 0 to about 8 modified nucleotides, e.g., from about 1 to about 6 modified nucleotides. For example, the 3’ wing region represented by “C” can be 0, 1, 2, 3, 4, 5, 6, 7, or 8 nucleotides in length. In some embodiments, “A” and “C” are the same, in some embodiments, they are different.
[0221] In some embodiments, the gap region represented by “B” comprises from about 6 to about 18 DNA nucleotides and / or DNA-like nucleotides, e.g., from about 6 to about 12 DNA nucleotides and / or DNA-like nucleotides. For example, the gap region represented by “B” can be 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 DNA nucleotides and / or DNA-like nucleotides in length. Thus, an antisense oligonucleotide of the present disclosure having a targetrecognition sequence with the formula “A-B-C” include, but are not limited to the following gapmer formats, for example, 1-10-1 (i.e., one nucleotide - ten nucleotides - one nucleotide), 1-10-1, 1-11-1, 1-12-1, 2-8-2, 2-9-2, 2-10-2, 2-11-2, 2-12-2, 3-6-3, 3-7-3, 3-8-3, 3-9-3, 3-10- 3, 3-11-3, 3-12-3, 4-6-4, 4-7-4, 4-8-4, 4-9-4, 4-10-4, 4-11-4, 4-12-4, 5-6-5, 5-7-5, 5-8-5, 5-9- 5, 5-10-5, 5-11-5, 5-12-5, 6-6-6, 6-7-6, 6-8-6, 6-9-6, 6-10-6, 6-11-6, or 6-12-6. The wings can also be of different lengths, such as 1-10-6, 3-9-5, 7-9-2, 4-10-5, or other asymmetriccombinations of wing lengths flanking a central DNA gap. In certain embodiments, the gapmer of “A-B-C” is at least 12 nucleotides in length. In certain embodiments, “B” is at least 6 nucleotides in length. A person of skill in the art will be able to identify additional asymmetric combinations of wing lengths.
[0222] In certain embodiments, antisense compounds targeted to a target nucleic acid possess a 5-9-4 gapmer format. In some embodiments, the antisense compound is an antisense oligonucleotide having a target-recognition sequence with the 5-9-4 format that is sufficiently complementary to a target transcript, or a portion thereof, to direct cleavage of the target transcript by RNase H. In some embodiments, the target-recognition sequence has the formula “A-B-C”, wherein “A” comprises about 2 to 6 modified nucleotides, “B” comprises about 6 to 12 DNA nucleotides and / or DNA-like nucleotides, and “C” comprises about 2 to 6 modified nucleotides. In some embodiments, the target-recognition sequence has the formula “A-B- C”, wherein “A” comprises 5 modified nucleotides, “B” comprises 9 DNA nucleotides and / or DNA-like nucleotides, and “C” comprises 4 modified nucleotides. In some embodiments, the target-recognition sequence has the formula “A-B-C”, wherein “A” comprises 2 to 62’-< -(2- methoxyethyl) (MOE) modified nucleotides, “B” comprises 6 to 12 DNA nucleotides and / or DNA-like nucleotides, and “C” comprises 2 to 6 2’-< -(2-methoxyethyl) (MOE) modified nucleotides. In some embodiments, the target-recognition sequence has the formula “A-B- C”, wherein “A” comprises 5 2’-<9-(2-methoxyethyl) (MOE) modified nucleotides, “B” comprises 9 DNA nucleotides and / or DNA-like nucleotides, and “C” comprises 4 2’-< -(2- methoxy ethyl) (MOE) modified nucleotides.
[0223] In some embodiments, antisense compounds that target a target nucleic acid possess a “wingmer” motif. The wingmer motif can be described using the formula “X-Y” or “Y-X”, where “X” represents the length of the wing region, and “Y” represents the length of the gap region. As such, in some embodiments, an antisense oligonucleotide of the present disclosure has the formula:X-Y, orY-X.
[0224] As used herein, a wingmer described as “X-Y” or “Y-X” has a configuration such that the gap segment is positioned immediately adjacent to the wing segment. Thus, no intervening nucleotides exist between the wing segment and the gap segment. Non-limiting examples of wingmer configurations of an antisense compound of the present disclosure include, e.g., 1-15,1-17, 1-19, 2-15, 2-17, 2-19, 2-22, 3-13, 3-17, 3-20, 3-21, 3-22, 4-12, 4-14, 4-16, 4-18, 4-19, 4-21, 5-11, 5-13, 5-14, 5-15, 5-16, 5-18, or 5-20.
[0225] In some embodiments, antisense compounds targeted to a target nucleic acid possess a gap-widened motif. As used herein, “gap-widened” refers to an antisense compound having a gap segment of 12 or more contiguous DNA nucleotides and / or DNA-like nucleotides adjacent to a wing region. In the case of a gap-widened gapmer, the gapmer comprises a gap region having 12 or more contiguous DNA nucleotides and / or DNA-like nucleotides positioned between and immediately adj acent to the 5 ’ and 3 ’ wing segments. In the case of a gap-widened wingmer, the wingmer comprises a gap region having 12 or more contiguous DNA nucleotides and / or DNA-like nucleotides positioned immediately adjacent to the wing segment.
[0226] A nucleoside is a base-sugar combination. The nucleobase (also known as base) portion of the nucleoside is normally a heterocyclic base moiety. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2', 3' or 5' hydroxyl moiety of the sugar. Oligonucleotides are formed through the covalent linkage of adjacent nucleosides to one another, to form a linear polymeric oligonucleotide. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the intemucleoside linkages of the oligonucleotide.
[0227] Modifications to antisense compounds encompass substitutions or changes to internucleoside linkages, sugar moieties, or nucleobases. Modified antisense compounds are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target, increased stability in the presence of nucleases, or increased inhibitory activity.
[0228] Chemically modified nucleosides can also be employed to increase the binding affinity of a shortened or truncated antisense oligonucleotide for its target nucleic acid. Consequently, comparable results can often be obtained with shorter antisense compounds that have such chemically modified nucleosides.
[0229] The naturally occurring internucleoside linkage of RNA and DNA is a 3' to 5' phosphodiester linkage. Antisense compounds having one or more modified, i.e. non-naturally occurring, intemucleoside linkages are often selected over antisense compounds having naturally occurring intemucleoside linkages because of desirable properties such as, forexample, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.
[0230] Oligonucleotides having modified internucleoside linkages include intemucleoside linkages that retain a phosphorus atom as well as internucleoside linkages that do not have a phosphorus atom. Representative phosphorus containing internucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates. Methods of preparation of phosphorous-containing and non- phosphorous-containing linkages are well known.
[0231] In certain embodiments, antisense compounds targeted to a target nucleic acid comprise one or more modified internucleoside linkages. In certain embodiments, the modified internucleoside linkages are phosphorothioate linkages. In certain embodiments, each internucleoside linkage of an antisense compound is a phosphorothioate internucleoside linkage.
[0232] Antisense compounds of the disclosure can optionally contain one or more nucleosides wherein the sugar group has been modified. Such sugar-modified nucleosides can impart enhanced nuclease stability, increased binding affinity or some other beneficial biological property to the antisense compounds. In certain embodiments, nucleosides comprise a chemically modified ribofuranose ring moieties. Examples of chemically modified ribofuranose rings include without limitation, addition of substituent groups (including 5' and 2' substituent groups, bridging of ring atoms to form bicyclic nucleic acids (BNA), replacement of the ribosyl ring oxygen atom with S, N(R), or C(R1)(R2) (R, R1, R2=H, C1-C12 alkyl or a protecting group) and combinations thereof. Examples of chemically modified sugars include 2'-F-5 '-methyl substituted nucleoside (see WO 2008 / 101157 for other disclosed 5',2'-bis substituted nucleosides) or replacement of the ribosyl ring oxygen atom with S with further substitution at the 2'-position (see U.S. Patent Application US20050130923) or alternatively 5 '-substitution of a BNA (see WO 2007 / 134181, wherein LNA is substituted with for example a 5 '-methyl or a 5 '-vinyl group).
[0233] Examples of nucleosides having modified sugar moieties include without limitation nucleosides comprising 5'-vinyl, 5'-methyl (R or S), 4'-S, 2'-F (i.e., 2’-fluoro), 2'-OCH3 (i.e., 2’-O-methyl) and 2'-O(CH2)2OCH3 (i.e., 2’-O-methoxyethyl) substituent groups. The substituent at the 2' position can also be selected from allyl, amino, azido, thio, O-allyl, O-Cl- C10 alkyl, OCF3, O(CH2)2SCH3, O(CH2)2-O-N(Rm)(Rn), and O-CH2-C(=O)-N(Rm)(Rn),where each Rmand Rnis, independently, H or substituted or unsubstituted Cl -CIO alkyl. 2’- modified nucleotides are useful in the present disclosure, for example, 2’-O-methyl RNA, 2’- O-methoxy ethyl RNA, 2’ -fluoro RNA, and others envisioned by one of ordinary skill in the art.
[0234] Examples of bicyclic nucleic acids (BNAs) include without limitation nucleosides comprising a bridge between the 4' and the 2' ribosyl ring atoms. A BNA comprising a bridge between the 4’ and 2’ ribosyl ring atoms can be referred to as a locked nucleic acid (LNA), and is often referred to as inaccessible RNA. As used herein, the term “locked nucleotide” or “locked nucleic acid (LNA)” comprises nucleotides in which the 2' deoxy ribose sugar moiety is modified by introduction of a structure containing a heteroatom bridging from the 2' to the 4' carbon atoms. The term “non-locked nucleotide” comprises nucleotides that do not contain a bridging structure in the ribose sugar moiety. Thus, the term comprises DNA and RNA nucleotide monomers (phosphorylated adenosine, guanosine, uridine, cytidine, deoxyadenosine, deoxyguanosine, deoxythymidine, deoxycytidine) and derivatives thereof as well as other nucleotides having a 2'-deoxy-erythro-pentofuranosyl sugar moiety or a ribo- pentofuranosyl moiety. In certain embodiments, antisense compounds provided herein include one or more BNA nucleosides wherein the bridge comprises one of the formulas: 4'-(CH2)-O- 2' (LNA); 4'-(CH2)-S-2'; 4'-(CH2)-O-2' (LNA); 4'-(CH2)2-O-2' (ENA); 4'-C(CH3)2-O-2' (see PCT / US2008 / 068922); 4'-CH(CH3)-O-2' and 4'-CH(CH2OCH3) -0-2' (see U.S. Pat. No. 7,399,845, issued on Jul. 15, 2008); 4'-CH2-N(OCH3)-2' (see PCT / US2008 / 064591); 4'- CH2-O-N(CH3)-2' (see published U.S. Patent Application US2004-0171570, published Sep. 2, 2004); 4'-CH2-N(R)-O-2' (see U.S. Pat. No. 7,427,672, issued on Sep. 23, 2008); 4'-CH2- C(CH3)-2' and 4'-CH2-C(=CH2)-2' (see PCT / US2008 / 066154); and wherein R is, independently, H, C1-C12 alkyl, or a protecting group. Each of the foregoing BNAs include various stereochemical sugar configurations including for example a-L-ribofuranose and P-D- ribofuranose (see PCT international application PCT / DK98 / 00393, published on Mar. 25, 1999 as WO 99 / 14226).
[0235] In some embodiments, antisense compounds provided herein include one or more 2’, 4’ -constrained nucleotides. For example, antisense compounds provided by the present disclosure include those having one or more constrained ethyl (cEt) or constrained methoxyethyl (cMOE) nucleotides. In some embodiments, antisense compounds providedherein are antisense oligonucleotides comprising one or more constrained ethyl (cEt) nucleotides. The terms “constrained ethyl” and “ethyl-constrained” are used interchangeably.
[0236] In certain embodiments, nucleosides are modified by replacement of the ribosyl ring with a sugar surrogate. Such modification includes without limitation, replacement of the ribosyl ring with a surrogate ring system (sometimes referred to as DNA analogs) such as a morpholino ring, a cyclohexenyl ring, a cyclohexyl ring or a tetrahydropyranyl ring such as one having one of the formula:
[0237] In certain embodiments, antisense oligonucleotides may comprise morpholino rings joined by phosphorodiamidate linkages. These may be referred to as PMO oligomers or phosphorodiamidate morpholino oligomers. In certain such embodiments, the backbone of these oligonucleotides may be uncharged. In other embodiments, one or more of the phosphorodiamidate linkages may comprise a charged moiety.
[0238] Many other bicyclo and tricyclo sugar surrogate ring systems are also known in the art that can be used to modify nucleosides for incorporation into antisense compounds (see for example review article: Leumann, J. C, Bioorganic & Medicinal Chemistry, 2002, 10, 841- 854; Ito, K. R.; Obika, S., Recent Advances in Medicinal Chemistry of Antisense Oligonucleotides. In Comprehensive Medicinal Chemistry, 3rd edition, Elsevier: 2017). Such ring systems can undergo various additional substitutions to enhance activity.
[0239] Methods for the preparations of modified sugars are well known to those skilled in the art. In nucleotides having modified sugar moieties, the nucleobase moieties (natural, modified or a combination thereof) are maintained for hybridization with an appropriate nucleic acid target.
[0240] In certain embodiments, antisense compounds targeted to a target nucleic acid comprise one or more kinds of modified nucleotides. In one embodiment, antisense compounds targeted to a target nucleic acid comprise 2’-modified nucleotides. In one embodiment, antisense compounds targeted to a target nucleic acid comprise a 2’-O-methyl RNA, a 2’-O- methoxyethyl RNA, or a 2’-fluoro RNA. In one embodiment, antisense compounds targetedto a target nucleic acid comprise tricyclo-DNA (tcDNA). Tricyclo-DNA belongs to a class of constrained DNA analogs that display improved hybridizing capacities to complementary RNA, see, e.g., Ittig et al., Nucleic Acids Res . 32:346-353 (2004); Ittig et al., Prague, Academy of Sciences of the Czech Republic. 7:21-26 (Coll. Symp. Series, Hocec, M., 2005); Ivanova et al., Oligonucleotides 17:54-65 (2007); Renneberg et al., Nucleic Acids Res. 30:2751-2757 (2002); Renneberg et al., Chembiochem. 5: 1114-1118 (2004); and Renneberg et al., JACS. 124:5993-6002 (2002). In one embodiment, antisense compounds targeted to a target nucleic acid comprise a locked nucleotide, an ethyl-constrained nucleotide, or an alpha-L-locked nucleic acid. Various alpha-L-locked nucleic acids are known by those of ordinary skill in the art, and are described in, e.g., Sorensen et al., J. Am. Chem. Soc. (2002) 124(10):2164-2176.
[0241] In certain embodiments, the antisense compounds targeting a target nucleic acid are fully chemically modified, i.e., every nucleotide is chemically modified. In certain embodiments, every nucleotide comprises a 2 ’-O-(2 -methoxy ethyl) (MOE) modification. In certain embodiments, every nucleotide comprises a tricyclo-DNA modification. In certain embodiments, the antisense compounds targeting a target nucleic acid comprise a mixture of tricyclo-DNA modifications and 2’-< -(2-methoxyethyl) (MOE) modifications, wherein every nucleotide of the antisense compounds is either tcDNA or MOE.
[0242] In certain embodiments, antisense compounds targeted to a target nucleic acid comprise one or more modified nucleotides having modified sugar moieties. In some embodiments, the modified nucleotide is a locked nucleotide. In certain embodiments, the locked nucleotides are arranged in a gapmer motif, e.g. a 3-9-3 gapmer format wherein 9 non-locked nucleotides are flanked by 3 locked nucleotides on each side.
[0243] Nucleobase (or base) modifications or substitutions are structurally distinguishable from, yet functionally interchangeable with, naturally occurring or synthetic unmodified nucleobases. Both natural and modified nucleobases are capable of participating in hydrogen bonding. Such nucleobase modifications can impart nuclease stability, binding affinity or some other beneficial biological property to antisense compounds. Modified nucleobases include synthetic and natural nucleobases such as, for example, 5-methylcytosine (5-me-C). Certain nucleobase substitutions, including 5-methylcytosine substitutions, are useful for increasing the binding affinity of an antisense compound for a target nucleic acid. For example, 5- methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2° C (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278).
[0244] Additional modified nucleobases include 5 -hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2- thiocytosine, 5-halouracil and cytosine, 5-propynyl (-OC-CH3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8- substituted adenines and guanines, 5-halo such as 5-bromo, 5-trifluoromethyl and other 5- substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2- amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3- deazaguanine and 3 -deazaadenine.
[0245] Heterocyclic base moieties can also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2- aminopyridine and 2-pyridone. Nucleobases that are useful for increasing the binding affinity of antisense compounds include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2 aminopropyladenine, 5-propynyluracil and 5- propynylcytosine.
[0246] In certain embodiments, antisense compounds targeted to a target nucleic acid comprise one or more modified nucleotides having modified sugar moieties. In some embodiments, the modified nucleotide is a locked nucleotide. In certain embodiments, the locked nucleotides are arranged in a gapmer motif, e.g. a 3-9-3 gapmer format wherein 9 non-locked nucleotides are flanked by 3 locked nucleotides on each side. In certain embodiments, antisense compounds targeted to a target nucleic acid comprise one or more modified nucleotides. In some embodiments, the modified nucleotide is 5-methylcytosine. In certain embodiments, each cytosine is a 5-methylcytosine. In some embodiments, the modified nucleotide is a 2’ -O -(2- methoxy ethyl) (MOE) modified nucleotide. In certain embodiments, the 2’-0-(M0E) modified nucleotides are arranged in a gapmer motif, e.g. a 5-9-4 gapmer format wherein 9 non-2’-O- (MOE) modified nucleotides are flanked by 4 or 5 -O- (MOE) modified nucleotides on one or both sides. In certain embodiments, antisense compounds targeted to a target nucleic acid comprise a steric blocking chemical modification format. In some embodiments of the steric blocking chemical modification format, every nucleotide of theantisense compound is a 2’-<9-(2-methoxyethyl) (MOE) modified nucleotide. In some embodiments of the steric blocking chemical modification format, every nucleotide of the antisense compound is a tricyclo-DNA modified nucleotide. In some embodiments of the steric blocking chemical modification format, the antisense compound comprises at least one MOE modified nucleotide and at least one tricyclo-DNA modified nucleotide. Many different chemical modification patterns steric blocking antisense oligonucleotides are envisioned. For example, but in no way limiting, the steric blocking antisense oligonucleotide can comprise a mixture of different types of modifications, such as a mixture of 2 ’-< -(2 -methoxy ethyl) modifications, LNA modifications, tricyclo-DNA modifications, and DNA modifications where the DNA stretches are four nucleotides or less.
[0247] In some embodiments, an antisense compound of the present disclosure directs cleavage of a target transcript by RNase H. In such embodiments, the antisense compound can be referred to as an RNase H-dependent antisense compound. In some embodiments the antisense compound is an RNase H-dependent antisense oligonucleotide. In some embodiments, an antisense oligonucleotide of the present disclosure is an RNase H-dependent antisense oligonucleotide, and can be a single-stranded, chemically modified oligonucleotide that binds to a complementary sequence in the target transcript (e.g., a target transcript). An RNase H-dependent antisense oligonucleotide of the present disclosure reduces expression of a target gene by RNase H-mediated cleavage of the target transcript, and by inhibition of translation by steric blockade of ribosomes. In some embodiments, an antisense compound of the present disclosure is capable of mediating cleavage of at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or more of target transcripts by RNase-H. In one embodiment, the antisense compound is capable of mediating cleavage of at least 80% of target transcripts by RNase-H. In one embodiment, the antisense compound is capable of mediating cleavage of at least 90% of target transcripts by RNase-H.
[0248] In certain embodiments, an antisense compound that targets a target transcript is from about 6 to about 24 subunits in length. In other embodiments, the antisense compound that targets a target transcript is from about 8 to about 80 subunits in length. For example, the antisense compounds are 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76,77, 78, 79, or 80 linked subunits in length, or a range defined by any two of the above values. In some embodiments, the antisense compounds are less than 40 linked subunits in length. In some embodiments, the antisense compounds are from about 10 to about 30 linked subunits in length. In some embodiments, the antisense compounds are from about 12 to about 25 linked subunits in length. In some embodiments, the antisense compounds are from about 15 to about 20 linked subunits in length. In some embodiments, the antisense compound is an antisense oligonucleotide that targets a target transcript, and the linked subunits are linked nucleotides.
[0249] In certain embodiments antisense compounds targeted to a target transcript can be shortened or truncated. For example, a single subunit can be deleted from the 5' end (5' truncation), or alternatively from the 3' end (3' truncation). A shortened or truncated antisense compound targeted to a target transcript can have two subunits deleted from the 5' end, or alternatively can have two subunits deleted from the 3' end, of the antisense compound. Alternatively, the deleted nucleosides can be dispersed throughout the antisense compound, for example, in an antisense compound having one nucleoside deleted from the 5' end and one nucleoside deleted from the 3' end.
[0250] When a single additional subunit is present in a lengthened antisense compound, the additional subunit can be located at the 5' or 3' end of the antisense compound. When two or more additional subunits are present, the added subunits can be adjacent to each other, for example, in an antisense compound having two subunits added to the 5' end (5' addition), or alternatively to the 3' end (3' addition), of the antisense compound. Alternatively, the added subunits can be dispersed throughout the antisense compound, for example, in an antisense compound having one subunit added to the 5' end and one subunit added to the 3' end.
[0251] It is possible to increase or decrease the length of an antisense compound, such as an antisense oligonucleotide, and / or introduce mismatch bases without eliminating activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), a series of antisense oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model. Antisense oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the antisense oligonucleotides were able to direct specific cleavage of the target mRNA, albeit to a lesser extent than the antisense oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase antisense oligonucleotides, including those with 1 or 3 mismatches.
[0252] In certain embodiments, the antisense oligonucleotide comprises the formula:A-B-C, wherein:
[0253] A comprises from about 0 to about 18 modified nucleotides;
[0254] B comprises from about 0 to about 4 deoxyribonucleic acid (DNA) nucleotides and / or DNA-like nucleotides; and
[0255] C comprises from about 0 to about 18 modified nucleotides;
[0256] and the overall length of the antisense oligonucleotide is about 10 to about 30 nucleotides.
[0257] Antisense oligonucleotides that contain 4 or fewer DNA and / or DNA-like nucleotides in “B” should not recruit RNase H and direct cleavage of a target. In these instances, the antisense oligonucleotide is not a gapmer format, but can rather act as a steric blocker.Modified MicroRNA 29b Mimics
[0258] In certain aspects of the disclosure, the miR29b mimics (e.g., miR29b mimic dsRNA) (or any portion thereof) of the present application, as described supra, may be modified, such that the activity of the mimic is further improved. For example, the miR29b mimics described in Section II supra, may be modified with any of the modifications described infra. The modifications can, in part, serve to further enhance target discrimination, to enhance stability of the miR29b mimics (e.g., to prevent degradation), to promote cellular uptake, to enhance the target efficiency, to improve efficacy in binding (e.g., to the targets), to improve patient tolerance to the agent, and / or to reduce toxicity.1) Modifications to Enhance Target Discrimination
[0259] In certain embodiments, the miR29b mimics of the present application may be substituted with a destabilizing nucleotide to enhance single nucleotide target discrimination (see U.S. application Ser. No. 11 / 698,689, filed Jan. 25, 2007, and U.S. Provisional Application No. 60 / 762,225 filed Jan. 25, 2006, both of which are incorporated herein by reference). Such a modification may be sufficient to abolish the specificity of the miR29b mimics for a nontarget mRNA (e.g., wild-type mRNA), without appreciably affecting the specificity of the miR29b mimics for a target mRNA (e.g., gain-of-function mutant mRNA).
[0260] In certain embodiments, the RNA silencing agents of the present application are modified by the introduction of at least one universal nucleotide in the antisense strand thereof. Universal nucleotides comprise base portions that are capable of base pairing indiscriminately with any of the four conventional nucleotide bases (e.g., A, G, C, U). A universal nucleotide is contemplated because it has relatively minor effect on the stability of the RNA duplex or the duplex formed by the guide strand of the RNA silencing agent and the target mRNA. Exemplary universal nucleotides include those having an inosine base portion or an inosine analog base portion selected from the group consisting of deoxyinosine (e.g., 2'-deoxyinosine), 7-deaza-2'-deoxyinosine, 2'-aza-2'-deoxyinosine, PNA-inosine, morpholino-inosine, LNA- inosine, phosphoramidate-inosine, 2'-O-methoxyethyl-inosine, and 2'-OMe-inosine. In certain embodiments, the universal nucleotide is an inosine residue or a naturally occurring analog thereof.
[0261] In certain embodiments, the RNA silencing agents of the disclosure are modified by the introduction of at least one destabilizing nucleotide within 5 nucleotides from a specificitydetermining nucleotide (i.e., the nucleotide which recognizes the disease-related polymorphism). For example, the destabilizing nucleotide may be introduced at a position that is within 5, 4, 3, 2, or 1 nucleotide(s) from a specificity-determining nucleotide. In exemplary embodiments, the destabilizing nucleotide is introduced at a position which is 3 nucleotides from the specificity-determining nucleotide (i.e., such that there are 2 stabilizing nucleotides between the destabilizing nucleotide and the specificity-determining nucleotide). In RNA silencing agents having two strands or strand portions (e.g., siRNAs and shRNAs), the destabilizing nucleotide may be introduced in the strand or strand portion that does not contain the specificity-determining nucleotide. In certain embodiments, the destabilizing nucleotide is introduced in the same strand or strand portion that contains the specificity-determining nucleotide.2) Modifications to Enhance Efficacy and Specificity
[0262] In certain embodiments, the RNA silencing agents of the disclosure may be altered to facilitate enhanced efficacy and specificity in mediating RNAi according to asymmetry design rules (see U.S. Patent Nos. 8,309,704, 7,750,144, 8,304,530, 8,329,892 and 8,309,705). Such alterations facilitate entry of the antisense strand of the siRNA (e.g., a siRNA designed using the methods of the present application or an siRNA produced from a shRNA) into RISC infavor of the sense strand, such that the antisense strand preferentially guides cleavage or translational repression of a target mRNA, and thus increasing or improving the efficiency of target cleavage and silencing. In certain embodiments, the asymmetry of an RNA silencing agent is enhanced by lessening the base pair strength between the antisense strand 5' end (AS 5') and the sense strand 3' end (S 3') of the RNA silencing agent relative to the bond strength or base pair strength between the antisense strand 3' end (AS 3') and the sense strand 5' end (S '5) of said RNA silencing agent.
[0263] In one embodiment, the asymmetry of an RNA silencing agent of the present application may be enhanced such that there are fewer G:C base pairs between the 5' end of the first or antisense strand and the 3' end of the sense strand portion than between the 3' end of the first or antisense strand and the 5' end of the sense strand portion. In another embodiment, the asymmetry of an RNA silencing agent of the disclosure may be enhanced such that there is at least one mismatched base pair between the 5' end of the first or antisense strand and the 3' end of the sense strand portion. In certain embodiments, the mismatched base pair is selected from the group consisting of G:A, C:A, C:U, G:G, A:A, C:C and U:U. In another embodiment, the asymmetry of an RNA silencing agent of the disclosure may be enhanced such that there is at least one wobble base pair, e.g., G:U, between the 5' end of the first or antisense strand and the 3' end of the sense strand portion. In another embodiment, the asymmetry of an RNA silencing agent of the disclosure may be enhanced such that there is at least one base pair comprising a rare nucleotide, e.g., inosine (I). In certain embodiments, the base pair is selected from the group consisting of an I: A, I:U and I:C. In yet another embodiment, the asymmetry of an RNA silencing agent of the disclosure may be enhanced such that there is at least one base pair comprising a modified nucleotide. In certain embodiments, the modified nucleotide is selected from the group consisting of 2-amino-G, 2-amino-A, 2,6-diamino-G, and 2,6-diamino-A.3) RNA Silencing Agents with Enhanced Stability
[0264] The RNA silencing agents of the present application can be modified to improve stability in serum or in growth medium for cell cultures. In order to enhance the stability, the 3 '-residues may be stabilized against degradation, e.g., they may be selected such that they consist of purine nucleotides, such as adenosine or guanosine nucleotides. Alternatively, substitution of pyrimidine nucleotides by modified analogues, e.g., substitution of uridine by 2'-deoxythymidine is tolerated and does not affect the efficiency of RNA interference.
[0265] In a one aspect, the present application features RNA silencing agents that include first and second strands wherein the second strand and / or first strand is modified by the substitution of internal nucleotides with modified nucleotides, such that in vivo stability is enhanced as compared to a corresponding unmodified RNA silencing agent. As defined herein, an "internal" nucleotide is one occurring at any position other than the 5' end or 3' end of nucleic acid molecule, polynucleotide or oligonucleotide. An internal nucleotide can be within a singlestranded molecule or within a strand of a duplex or double-stranded molecule. In one embodiment, the sense strand and / or antisense strand is modified by the substitution of at least one internal nucleotide. In another embodiment, the sense strand and / or antisense strand is modified by the substitution of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more internal nucleotides. In another embodiment, the sense strand and / or antisense strand is modified by the substitution of at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more of the internal nucleotides. In yet another embodiment, the sense strand and / or antisense strand is modified by the substitution of all of the internal nucleotides.
[0266] In one aspect, the present application features RNA silencing agents that are at least 80% chemically modified. In certain embodiments, the RNA silencing agents may be fully chemically modified, i.e., 100% of the nucleotides are chemically modified. In another aspect, the present application features RNA silencing agents comprising 2’-OH ribose groups that are at least 80% chemically modified. In certain embodiments, the RNA silencing agents comprise 2’ -OH ribose groups that are about 80%, 85%, 90%, 95%, or 100% chemically modified.
[0267] In certain embodiments, the RNA silencing agents may contain at least one modified nucleotide analogue. The nucleotide analogues may be located at positions where the targetspecific silencing activity, e.g., the RNAi mediating activity or translational repression activity is not substantially affected, e.g., in a region at the 5'-end and / or the 3'-end of the siRNA molecule. Moreover, the ends may be stabilized by incorporating modified nucleotide analogues.
[0268] Exemplary nucleotide analogues include sugar- and / or backbone-modified ribonucleotides (i.e., include modifications to the phosphate-sugar backbone). For example, the phosphodiester linkages of natural RNA may be modified to include at least one of a nitrogen or sulfur heteroatom. In exemplary backbone-modified ribonucleotides, the phosphoester group connecting to adjacent ribonucleotides is replaced by a modified group, e.g., ofphosphothioate group. In exemplary sugar-modified ribonucleotides, the 2' OH-group is replaced by a group selected from H, OR, R, halo, SH, SR, NH2, NHR, NR2 or ON, wherein R is Ci-Ce alkyl, alkenyl or alkynyl and halo is F, Cl, Br or I.
[0269] In certain embodiments, the modifications are 2'-fluoro, 2'-amino and / or 2'-thio modifications. Modifications include 2'-fluoro-cytidine, 2'-fluoro-uridine, 2'-fluoro-adenosine, 2'-fluoro-guanosine, 2'-amino-cytidine, 2'-amino-uridine, 2'-amino-adenosine, 2'-amino- guanosine, 2,6-diaminopurine, 4-thio-uridine, and / or 5-amino-allyl-uridine. In a certain embodiment, the 2'-fluoro ribonucleotides are every uridine and cytidine. Additional exemplary modifications include 5-bromo-uridine, 5-iodo-uridine, 5-methyl-cytidine, ribothymidine, 2-aminopurine, 2'-amino-butyryl-pyrene-uridine, 5-fluoro-cytidine, and 5-fluoro- uridine. 2'-deoxy-nucleotides and 2'-0me nucleotides can also be used within modified RNA- silencing agent moieties of the instant disclosure. Additional modified residues include, deoxy - abasic, inosine, N3-methyl-uridine, N6,N6-dimethyl-adenosine, pseudouridine, purine ribonucleoside and ribavirin. In a certain embodiment, the 2' moiety is a methyl group such that the linking moiety is a 2'-O-methyl oligonucleotide.
[0270] In a certain embodiment, the RNA silencing agent of the present application comprises Locked Nucleic Acids (LNAs). LNAs comprise sugar-modified nucleotides that resist nuclease activities (are highly stable) and possess single nucleotide discrimination for mRNA (Elmen et al., Nucleic Acids Res., (2005), 33(1): 439-447; Braasch et al. (2003) Biochemistry 42:7967- 7975, Petersen et al. (2003) Trends Biotechnol 21 :74-81). These molecules have 2'-O,4'-C- ethylene-bridged nucleic acids, with possible modifications such as 2'-deoxy-2"-fluorouridine. Moreover, LNAs increase the specificity of oligonucleotides by constraining the sugar moiety into the 3'-endo conformation, thereby pre-organizing the nucleotide for base pairing and increasing the melting temperature of the oligonucleotide by as much as 10 °C per base.
[0271] In another exemplary embodiment, the RNA silencing agent of the present application comprises Peptide Nucleic Acids (PNAs). PNAs comprise modified nucleotides in which the sugar-phosphate portion of the nucleotide is replaced with a neutral 2-amino ethylglycine moiety capable of forming a polyamide backbone , which is highly resistant to nuclease digestion and imparts improved binding specificity to the molecule (Nielsen, et al., Science, (2001), 254: 1497-1500).
[0272] Also contemplated are nucleobase-modified ribonucleotides, i.e., ribonucleotides, containing at least one non-naturally occurring nucleobase instead of a naturally occurringnucleobase. Bases may be modified to block the activity of adenosine deaminase. Exemplary modified nucleobases include, but are not limited to, uridine and / or cytidine modified at the 5- position, e.g., 5-(2-amino)propyl uridine, 5-bromo uridine; adenosine and / or guanosines modified at the 8 position, e.g., 8-bromo guanosine; deaza nucleotides, e.g., 7-deaza-adenosine; O- and N-alkylated nucleotides, e.g., N6-methyl adenosine are suitable. It should be noted that the above modifications may be combined.
[0273] In other embodiments, cross-linking can be employed to alter the pharmacokinetics of the RNA silencing agent, for example, to increase half-life in the body. Thus, the present application includes RNA silencing agents having two complementary strands of nucleic acid, wherein the two strands are crosslinked. The present application also includes RNA silencing agents which are conjugated or unconjugated (e.g., at its 3' terminus) to another moiety (e.g., a non-nucleic acid moiety such as a peptide), an organic compound (e.g., a dye), or the like). Modifying siRNA derivatives in this way may improve cellular uptake or enhance cellular targeting activities of the resulting siRNA derivative as compared to the corresponding siRNA, are useful for tracing the siRNA derivative in the cell, or improve the stability of the siRNA derivative compared to the corresponding siRNA.
[0274] Other exemplary modifications include: (a) 2' modification, e.g., provision of a 2' OMe moiety on a U in a sense or antisense strand, but especially on a sense strand, or provision of a 2' OMe moiety in a 3' overhang, e.g., at the 3' terminus (3' terminus means at the 3' atom of the molecule or at the most 3' moiety, e.g., the most 3' P or 2' position, as indicated by the context); (b) modification of the backbone, e.g., with the replacement of an 0 with an S, in the phosphate backbone, e.g., the provision of a phosphorothioate modification, on the U or the A or both, especially on an antisense strand; e.g., with the replacement of a O with an S; (c) replacement of the U with a C5 amino linker; (d) replacement of an A with a G (sequence changes can be located on the sense strand and not the antisense strand in certain embodiments); and (d) modification at the 2', 6', 7', or 8' position. Exemplary embodiments are those in which one or more of these modifications are present on the sense but not the antisense strand, or embodiments where the antisense strand has fewer of such modifications. Yet other exemplary modifications include the use of a methylated P in a 3' overhang, e.g., at the 3' terminus; combination of a 2' modification, e.g., provision of a 2' O Me moiety and modification of the backbone, e.g., with the replacement of a O with an S, e.g., the provision of a phosphorothioate modification, or the use of a methylated P, in a 3' overhang, e.g., at the 3' terminus; modificationwith a 3' alkyl; modification with an abasic pyrrolidone in a 3' overhang, e.g., at the 3' terminus; modification with naproxen, ibuprofen, or other moi eties which inhibit degradation at the 3' terminus.Heavily modified RNA silencing agents
[0275] In certain embodiments, the RNA silencing agent comprises at least 80% chemically modified nucleotides. In certain embodiments, the RNA silencing agent is fully chemically modified, i.e., 100% of the nucleotides are chemically modified.
[0276] In certain embodiments, the RNA silencing agent is 2’-O-methyl rich, i.e., comprises greater than 50% 2’-O-methyl content. In certain embodiments, the RNA silencing agent comprises at least about 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% 2’-O- methyl nucleotide content. In certain embodiments, the RNA silencing agent comprises at least about 70% 2’-O-methyl nucleotide modifications. In certain embodiments, the RNA silencing agent comprises between about 70% and about 90% 2’-O-methyl nucleotide modifications. In certain embodiments, the RNA silencing agent is a dsRNA comprising an antisense strand and sense strand. In certain embodiments, the antisense strand comprises at least about 70% 2’-O- methyl nucleotide modifications. In certain embodiments, the antisense strand comprises between about 70% and about 90% 2’-O-methyl nucleotide modifications. In certain embodiments, the sense strand comprises at least about 70% 2’-O-methyl nucleotide modifications. In certain embodiments, the sense strand comprises between about 70% and about 90% 2’-O-methyl nucleotide modifications. In certain embodiments, the sense strand comprises between 100% 2’-O-methyl nucleotide modifications.
[0277] 2’-O-methyl rich RNA silencing agents and specific chemical modification patterns are further described in US20200087663 and US20210115442, each of which is incorporated herein by reference.Internucleotide linkage modifications
[0278] In certain embodiments, at least one internucleotide linkage, intersubunit linkage, or nucleotide backbone is modified in the RNA silencing agent. In certain embodiments, all of the intemucleotide linkages in the RNA silencing agent are modified. In certain embodiments, the modified internucleotide linkage comprises a phosphorothioate internucleotide linkage. Incertain embodiments, the RNA silencing agent comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 phosphorothioate intemucleotide linkages. In certain embodiments, the RNA silencing agent comprises 4-16 phosphorothioate internucleotide linkages. In certain embodiments, the RNA silencing agent comprises 8-13 phosphorothioate intemucleotide linkages. In certain embodiments, the RNA silencing agent is a dsRNA comprising an antisense strand and a sense strand, each comprising a 5’ end and a 3’ end. In certain embodiments, the nucleotides at positions 1 and 2 from the 5’ end of sense strand are connected to adjacent ribonucleotides via phosphorothioate intemucleotide linkages. In certain embodiments, the nucleotides at positions 1 and 2 from the 3’ end of sense strand are connected to adjacent ribonucleotides via phosphorothioate intemucleotide linkages. In certain embodiments, the nucleotides at positions 1 and 2 from the 5’ end of antisense strand are connected to adjacent ribonucleotides via phosphorothioate intemucleotide linkages. In certain embodiments, the nucleotides at positions 1-2 to 1-8 from the 3’ end of antisense strand are connected to adjacent ribonucleotides via phosphorothioate intemucleotide linkages. In certain embodiments, the nucleotides at positions 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, or 1-8 from the 3’ end of antisense strand are connected to adjacent ribonucleotides via phosphorothioate intemucleotide linkages. In certain embodiments, the nucleotides at positions 1-2 to 1-7 from the 3’ end of antisense strand are connected to adjacent ribonucleotides via phosphorothioate intemucleotide linkages.
[0279] In one aspect, the disclosure provides a modified oligonucleotide, said oligonucleotide having a 5’ end, a 3’ end, that is complementary to a target, wherein the oligonucleotide comprises a sense and antisense strand, and at least one modified intersubunit linkage of Formula (I):(i); wherein:B is a base pairing moiety;W is selected from the group consisting of O, OCH2, OCH, CH2, and CH;X is selected from the group consisting of halo, hydroxy, and C1-6 alkoxy;Y is selected from the group consisting of O , OH, OR, NH , NH2, S", and SH;Z is selected from the group consisting of O and CH2;R is a protecting group; and= is an optional double bond.
[0280] In an embodiment of Formula (I), when W is CH, — is a double bond.
[0281] In an embodiment of Formula (I), when W selected from the group consisting of O, OCH2, OCH, CH2, = is a single bond.
[0282] In an embodiment of Formula (I), when Y is O , either Z or W is not O.
[0283] In an embodiment of Formula (I), Z is CH2 and W is CH2. In another embodiment, the modified intersubunit linkage of Formula (I) is a modified intersubunit linkage of Formula (II):
[0284] In an embodiment of Formula (I), Z is CH2 and W is O. In another embodiment, wherein the modified intersubunit linkage of Formula (I) is a modified intersubunit linkage of Formula (III):
[0285] In an embodiment of Formula (I), Z is O and W is CH2. In another embodiment, the modified intersubunit linkage of Formula (I) is a modified intersubunit linkage of Formula (IV):
[0286] In an embodiment of Formula (I), Z is O and W is CH. In another embodiment, the modified intersubunit linkage of Formula (I) is a modified intersubunit linkage of Formula V:
[0287] In an embodiment of Formula (I), Z is O and W is OCH2. In another embodiment, the modified intersubunit linkage of Formula (I) is a modified intersubunit linkage of Formula VI:
[0288] In an embodiment of Formula (I), Z is CH2 and W is CH. In another embodiment, the modified intersubunit linkage of Formula (I) is a modified intersubunit linkage of Formula VII:
[0289] In an embodiment of Formula (I), the base pairing moiety B is selected from the group consisting of adenine, guanine, cytosine, and uracil.
[0290] In an embodiment, the modified oligonucleotide is incorporated into siRNA, said modified siRNA having a 5 ’ end, a 3 ’ end, that is complementary to a target, wherein the siRNA comprises a sense and antisense strand, and at least one modified intersubunit linkage of any one or more of Formula (I), Formula (II), Formula (III), Formula (IV), Formula (V), Formula (VI), or Formula (VII).
[0291] In an embodiment, the modified oligonucleotide is incorporated into siRNA, said modified siRNA having a 5’ end, a 3’ end, that is complementary to a target and comprises a sense and antisense strand, wherein the siRNA comprises at least one modified intersubunit linkage is of Formula VIII:(VIII); wherein:D is selected from the group consisting of O, OCH2, OCH, CH2, and CH;C is selected from the group consisting of O , OH, OR1, NH , NH2, S", and SH;A is selected from the group consisting of O and CH2;R1is a protecting group; is an optional double bond; and the intersubunit is bridging two optionally modified nucleosides.
[0292] In an embodiment, when C is O , either A or D is not O.
[0293] In an embodiment, D is CH2. In another embodiment, the modified intersubunit linkage of Formula VIII is a modified intersubunit linkage of Formula (IX):(IX).
[0294] In an embodiment, D is O. In another embodiment, the modified intersubunit linkage of Formula VIII is a modified intersubunit linkage of Formula (X):
[0295] In an embodiment, D is CH2. In another embodiment, the modified intersubunit linkage of Formula (VIII) is a modified intersubunit linkage of Formula (XI):(XI).
[0296] In an embodiment, D is CH. In another embodiment, the modified intersubunit linkage of Formula VIII is a modified intersubunit linkage of Formula (XII):
[0297] In another embodiment, the modified intersubunit linkage of Formula (VII) is a modified intersubunit linkage of Formula (XIV):(XIV).
[0298] In an embodiment, D is OCH2. In another embodiment, the modified intersubunit linkage of Formula (VII) is a modified intersubunit linkage of Formula (XIII):
[0299] In another embodiment, the modified intersubunit linkage of Formula (VII) is a modified intersubunit linkage of Formula (XXa):(XXa).
[0300] In an embodiment of the modified siRNA linkage, each optionally modified nucleoside is independently, at each occurrence, selected from the group consisting of adenosine, guanosine, cytidine, and uridine.
[0301] In certain exemplary embodiments of Formula (I), W is O. In another embodiment, W is CH2. In yet another embodiment, W is CH.
[0302] In certain exemplary embodiments of Formula (I), X is OH. In another embodiment, X is OCH3. In yet another embodiment, X is halo.
[0303] In a certain embodiment of Formula (I), the modified siRNA does not comprise a 2’- fluoro substituent.
[0304] In an embodiment of Formula (I), Y is O . In another embodiment, Y is OH. In yet another embodiment, Y is OR. In still another embodiment, Y is NH". In an embodiment, Y is NH2. In another embodiment, Y is S . In yet another embodiment, Y is SH.
[0305] In an embodiment of Formula (I), Z is O. In another embodiment, Z is CH2.
[0306] In an embodiment, the modified intersubunit linkage is inserted on position 1-2 of the antisense strand. In another embodiment, the modified intersubunit linkage is inserted on position 6-7 of the antisense strand. In yet another embodiment, the modified intersubunit linkage is inserted on position 10-11 of the antisense strand. In still another embodiment, the modified intersubunit linkage is inserted on position 19-20 of the antisense strand. In an embodiment, the modified intersubunit linkage is inserted on positions 5-6 and 18-19 of the antisense strand.
[0307] In an exemplary embodiment of the modified siRNA linkage of Formula (VIII), C is O . In another embodiment, C is OH. In yet another embodiment, C is OR1. In still another embodiment, C is NH . In an embodiment, C is NH2. In another embodiment, C is S". In yet another embodiment, C is SH.
[0308] In an exemplary embodiment of the modified siRNA linkage of Formula (VIII), A is O. In another embodiment, A is CH2. In yet another embodiment, C is OR1. In still another embodiment, C is NH . In an embodiment, C is NH2. In another embodiment, C is S". In yet another embodiment, C is SH.
[0309] In a certain embodiment of the modified siRNA linkage of Formula (VIII), the optionally modified nucleoside is adenosine. In another embodiment of the modified siRNA linkage of Formula (VIII), the optionally modified nucleoside is guanosine. In another embodiment of the modified siRNA linkage of Formula (VIII), the optionally modified nucleoside is cytidine. In another embodiment of the modified siRNA linkage of Formula (VIII), the optionally modified nucleoside is uridine.
[0310] In an embodiment of the modified siRNA linkage, wherein the linkage is inserted on position 1-2 of the antisense strand. In another embodiment, the linkage is inserted on position 6-7 of the antisense strand. In yet another embodiment, the linkage is inserted on position 10- 11 of the antisense strand. In still another embodiment, the linkage is inserted on position 19-20 of the antisense strand. In an embodiment, the linkage is inserted on positions 5-6 and 18- 19 of the antisense strand.
[0311] In certain embodiments of Formula (I), the base pairing moiety B is adenine. In certain embodiments of Formula (I), the base pairing moiety B is guanine. In certain embodiments of Formula (I), the base pairing moiety B is cytosine. In certain embodiments of Formula (I), the base pairing moiety B is uracil.
[0312] In an embodiment of Formula (I), W is O. In an embodiment of Formula (I), W is CH2. In an embodiment of Formula (I), W is CH.
[0313] In an embodiment of Formula (I), X is OH. In an embodiment of Formula (I), X is OCH3. In an embodiment of Formula (I), X is halo.
[0314] In an exemplary embodiment of Formula (I), the modified oligonucleotide does not comprise a 2’ -fluoro substituent.
[0315] In an embodiment of Formula (I), Y is O . In an embodiment of Formula (I), Y is OH. In an embodiment of Formula (I), Y is OR. In an embodiment of Formula (I), Y is NH . In an embodiment of Formula (I), Y is NH2. In an embodiment of Formula (I), Y is S . In an embodiment of Formula (I), Y is SH.
[0316] In an embodiment of Formula (I), Z is O. In an embodiment of Formula (I), Z is CH2.
[0317] In an embodiment of the Formula (I), the linkage is inserted on position 1-2 of the antisense strand. In another embodiment of Formula (I), the linkage is inserted on position 6-7 of the antisense strand. In yet another embodiment of Formula (I), the linkage is inserted on position 10-11 of the antisense strand. In still another embodiment of Formula (I), the linkage is inserted on position 19-20 of the antisense strand. In an embodiment of Formula (I), the linkage is inserted on positions 5-6 and 18-19 of the antisense strand.
[0318] Modified intersubunit linkages are further described in U.S. Patent Publication No. 2020 / 0385740A1, and U.S. Patent Publication No. 2022 / 0010309, each of which is incorporated herein by reference.4) Conjugated Functional Moieties
[0319] In other embodiments, RNA silencing agents may be modified with one or more functional moieties. A functional moiety is a molecule that confers one or more additionalactivities to the RNA silencing agent. In certain embodiments, the functional moieties enhance cellular uptake by target cells (e.g., neuronal cells). Thus, the disclosure includes RNA silencing agents which are conjugated or unconjugated (e.g., at its 5’ and / or 3' terminus) to another moiety (e.g., a non-nucleic acid moiety such as a peptide), an organic compound (e.g., a dye), or the like. The conjugation can be accomplished by methods known in the art, e.g., using the methods of Lambert et al., Drug Deliv. Rev.: 47(1), 99-112 (2001) (describes nucleic acids loaded to polyalkylcyanoacrylate (PACA) nanoparticles); Fattal et al., J. Control Release 53(1-3): 137-43 (1998) (describes nucleic acids bound to nanoparticles); Schwab et al., Ann. Oncol. 5 Suppl. 4:55-8 (1994) (describes nucleic acids linked to intercalating agents, hydrophobic groups, polycations or PACA nanoparticles); and Godard et al., Eur. J. Biochem. 232(2):404-10 (1995) (describes nucleic acids linked to nanoparticles).
[0320] In a certain embodiment, the functional moiety is a hydrophobic moiety. In a certain embodiment, the hydrophobic moiety is selected from the group consisting of fatty acids, steroids, secosteroids, lipids, gangliosides and nucleoside analogs, endocannabinoids, and vitamins. In a certain embodiment, the steroid selected from the group consisting of cholesterol and lithocholic acid (LA). In a certain embodiment, the fatty acid selected from the group consisting of Eicosapentaenoic acid (EP A), Docosahexaenoic acid (DHA) and Docosanoic acid (DC A). In a certain embodiment, the vitamin selected from the group consisting of choline, vitamin A, vitamin E, and derivatives or metabolites thereof. In a certain embodiment, the vitamin is selected from the group consisting of retinoic acid and alpha-tocopheryl succinate.
[0321] In a certain embodiment, an RNA silencing agent of disclosure is conjugated to a lipophilic moiety. In one embodiment, the lipophilic moiety is a ligand that includes a cationic group. In another embodiment, the lipophilic moiety is attached to one or both strands of an siRNA. In an exemplary embodiment, the lipophilic moiety is attached to one end of the sense strand of the siRNA. In another exemplary embodiment, the lipophilic moiety is attached to the 3' end of the sense strand. In certain embodiments, the lipophilic moiety is selected from the group consisting of cholesterol, vitamin E, vitamin K, vitamin A, folic acid, a cationic dye (e.g., Cy3). In an exemplary embodiment, the lipophilic moiety is cholesterol. Other lipophilic moieties include cholic acid, adamantane acetic acid, 1 -pyrene butyric acid, dihydrotestosterone, 1,3-Bis-O(hexadecyl)glycerol, geranyl oxy hexyl group, hexadecylglycerol, borneol, menthol, 1,3 -propanediol, heptadecyl group, palmitic acid,myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine.
[0322] In certain embodiments, the functional moieties may comprise one or more ligands tethered to an RNA silencing agent to improve stability, hybridization thermodynamics with a target nucleic acid, targeting to a particular tissue or cell-type, or cell permeability, e.g., by an endocytosis-dependent or -independent mechanism. Ligands and associated modifications can also increase sequence specificity and consequently decrease off-site targeting. A tethered ligand can include one or more modified bases or sugars that can function as intercal ators. These can be located in an internal region, such as in a bulge of RNA silencing agent / target duplex. The intercalator can be an aromatic, e.g., a polycyclic aromatic or heterocyclic aromatic compound. A polycyclic intercalator can have stacking capabilities, and can include systems with 2, 3, or 4 fused rings. The universal bases described herein can be included on a ligand. In one embodiment, the ligand can include a cleaving group that contributes to target gene inhibition by cleavage of the target nucleic acid. The cleaving group can be, for example, a bleomycin (e.g., bleomycin-A5, bleomycin-A2, or bleomycin-B2), pyrene, phenanthroline (e.g., O-phenanthroline), a polyamine, a tripeptide (e.g., lys-tyr-lys tripeptide), or a metal ion chelating group. The metal ion chelating group can include, e.g., an Lu(III) or EU(III) macrocyclic complex, a Zn(II) 2,9-dimethylphenanthroline derivative, a Cu(II) terpyridine, or acridine, which can promote the selective cleavage of target RNA at the site of the bulge by free metal ions, such as Lu(III). In some embodiments, a peptide ligand can be tethered to an RNA silencing agent to promote cleavage of the target RNA, e.g., at the bulge region. For example, l,8-dimethyl-l,3,6,8,10,13-hexaazacyclotetradecane (cyclam) can be conjugated to a peptide (e.g., by an amino acid derivative) to promote target RNA cleavage. A tethered ligand can be an aminoglycoside ligand, which can cause an RNA silencing agent to have improved hybridization properties or improved sequence specificity. Exemplary aminoglycosides include glycosylated polylysine, galactosylated polylysine, neomycin B, tobramycin, kanamycin A, and acridine conjugates of aminoglycosides, such as Neo-N-acridine, Neo-S- acridine, Neo-C-acridine, Tobra-N-acridine, and KanaA-N-acridine. Use of an acridine analog can increase sequence specificity. For example, neomycin B has a high affinity for RNA as compared to DNA, but low sequence-specificity. An acridine analog, neo-5-acridine, has an increased affinity for the HIV Rev-response element (RRE). In some embodiments, the guanidine analog (the guanidinoglycoside) of an aminoglycoside ligand is tethered to an RNA silencing agent. In a guanidinoglycoside, the amine group on the amino acid is exchanged fora guanidine group. Attachment of a guanidine analog can enhance cell permeability of an RNA silencing agent. A tethered ligand can be a poly-arginine peptide, peptoid or peptidomimetic, which can enhance the cellular uptake of an oligonucleotide agent.
[0323] Exemplary ligands are coupled, either directly or indirectly, via an intervening tether, to a ligand-conjugated carrier. In certain embodiments, the coupling is through a covalent bond. In certain embodiments, the ligand is attached to the carrier via an intervening tether. In certain embodiments, a ligand alters the distribution, targeting or lifetime of an RNA silencing agent into which it is incorporated. In certain embodiments, a ligand provides an enhanced affinity for a selected target, e.g., molecule, cell or cell type, compartment, e.g., a cellular or organ compartment, tissue, organ or region of the body, as, e.g., compared to a species absent such a ligand.
[0324] Exemplary ligands can improve transport, hybridization, and specificity properties and may also improve nuclease resistance of the resultant natural or modified RNA silencing agent, or a polymeric molecule comprising any combination of monomers described herein and / or natural or modified ribonucleotides. Ligands in general can include therapeutic modifiers, e.g., for enhancing uptake; diagnostic compounds or reporter groups e.g., for monitoring distribution; cross-linking agents; nuclease-resistance conferring moieties; and natural or unusual nucleobases. General examples include lipophiles, lipids, steroids (e.g., uvaol, hecigenin, diosgenin), terpenes (e.g., triterpenes, e.g., sarsasapogenin, Friedelin, epifriedelanol derivatized lithocholic acid), vitamins (e.g., folic acid, vitamin A, biotin, pyridoxal), carbohydrates, proteins, protein binding agents, integrin targeting molecules, polycationics, peptides, polyamines, and peptide mimics. Ligands can include a naturally occurring substance, (e.g., human serum albumin (HSA), low-density lipoprotein (LDL), or globulin); carbohydrate (e.g., a dextran, pullulan, chitin, chitosan, inulin, cyclodextrin or hyaluronic acid); amino acid, or a lipid. The ligand may also be a recombinant or synthetic molecule, such as a synthetic polymer, e.g., a synthetic polyamino acid. Examples of polyamino acids include polyamino acid is a polylysine (PLL), poly L-aspartic acid, poly L-glutamic acid, styrene-maleic acid anhydride copolymer, poly(L-lactide-co-glycolied) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacryllic acid), N- isopropyl acrylamide polymers, or polyphosphazine. Example of polyamines include: polyethylenimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide-polyamine, peptidomimetic polyamine, dendrimer polyamine, arginine, amidine, protamine, cationic lipid, cationic porphyrin, quaternary salt of a polyamine, or an alpha helical peptide.
[0325] Ligands can also include targeting groups, e.g., a cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid or protein, e.g., an antibody, that binds to a specified cell type such as a kidney cell. A targeting group can be a thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetyl- galactosamine (GalNAc) or derivatives thereof, N-acetyl-glucosamine, multivalent mannose, multivalent fucose, glycosylated polyaminoacids, multivalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, a lipid, cholesterol, a steroid, bile acid, folate, vitamin B12, biotin, or an RGD peptide or RGD peptide mimetic. Other examples of ligands include dyes, intercalating agents (e.g. acridines and substituted acridines), cross-linkers (e.g. psoralene, mitomycin C), porphyrins (TPPC4, texaphyrin, Sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine, phenanthroline, pyrenes), lys-tyr-lys tripeptide, aminoglycosides, guanidium aminoglycodies, artificial endonucleases (e.g. EDTA), lipophilic molecules, e.g, cholesterol (and thio analogs thereof), cholic acid, cholanic acid, lithocholic acid, adamantane acetic acid, 1 -pyrene butyric acid, dihydrotestosterone, glycerol (e.g., esters (e.g., mono, bis, or tris fatty acid esters, e.g., Cio, Cn, C12, C13, C14, C15, Ci6, C17, Cis, C19, or C20 fatty acids) and ethers thereof, e.g., Cio, Cn, C12, C13, C14, C15, Ci6, C17, Cis, C19, or C20 alkyl; e.g., l,3-bis-O(hexadecyl)glycerol, l,3-bis-O(octaadecyl)glycerol), geranyl oxy hexyl group, hexadecylglycerol, borneol, menthol, 1,3 -propanediol, heptadecyl group, palmitic acid, stearic acid (e.g., glyceryl distearate), oleic acid, myristic acid, 03- (oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine) and peptide conjugates (e.g., antennapedia peptide, Tat peptide), alkylating agents, phosphate, amino, mercapto, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g. biotin), transport / absorption facilitators (e.g., aspirin, naproxen, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu3+complexes of tetraazamacrocycles), dinitrophenyl, HRP or AP. In certain embodiments, the ligand is GalNAc or a derivative thereof.
[0326] In certain embodiments, the GalNAc is represented by the formula below:
[0327] Ligands can be proteins, e.g., glycoproteins, or peptides, e.g., molecules having a specific affinity for a co-ligand, or antibodies e.g., an antibody, that binds to a specified cell type such as a cancer cell, endothelial cell, or bone cell. Ligands may also include hormones and hormone receptors. They can also include non-peptidic species, such as lipids, lectins, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galactose, N-acetyl- galactosamine, N-acetyl-glucosamine multivalent mannose, or multivalent fucose. The ligand can be, for example, a lipopolysaccharide, an activator of p38 MAP kinase, or an activator of NF-kB.
[0328] The ligand can be a substance, e.g., a drug, which can increase the uptake of the RNA silencing agent into the cell, for example, by disrupting the cell's cytoskeleton, e.g., by disrupting the cell's microtubules, microfilaments, and / or intermediate filaments. The drug can be, for example, taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, or myoservin. The ligand can increase the uptake of the RNA silencing agent into the cell by activating an inflammatory response, for example. Exemplary ligands that would have such an effect include tumor necrosis factor alpha (TNF-alpha), interleukin-1 beta, or gamma interferon. In one aspect, the ligand is a lipid or lipid-based molecule. Such a lipid or lipid-based molecule can bind a serum protein, e.g., human serum albumin (HSA). An HSA binding ligand allows for distribution of the conjugate to a target tissue, e.g., a non-kidney target tissue of the body. For example, the target tissue can be the liver, including parenchymal cells of the liver. Other molecules that can bind HSA can also be used as ligands. For example, neproxin or aspirin can be used. A lipid or lipid-basedligand can (a) increase resistance to degradation of the conjugate, (b) increase targeting or transport into a target cell or cell membrane, and / or (c) can be used to adjust binding to a serum protein, e.g., HSA. A lipid-based ligand can be used to modulate, e.g., control the binding of the conjugate to a target tissue. For example, a lipid or lipid-based ligand that binds to HSA more strongly will be less likely to be targeted to the kidney and therefore less likely to be cleared from the body. A lipid or lipid-based ligand that binds to HSA less strongly can be used to target the conjugate to the kidney. In a certain embodiment, the lipid-based ligand binds HSA. A lipid-based ligand can bind HSA with a sufficient affinity such that the conjugate will be distributed to a non-kidney tissue. However, it is contemplated that the affinity is not so strong that the HSA-ligand binding cannot be reversed. In another embodiment, the lipid-based ligand binds HSA weakly or not at all, such that the conjugate will be distributed to the kidney. Other moieties that target to kidney cells can also be used in place of or in addition to the lipid- based ligand.
[0329] In another aspect, the ligand is a moiety, e.g., a vitamin, which is taken up by a target cell, e.g., a proliferating cell. These can be useful for treating disorders characterized by unwanted cell proliferation, e.g., of the malignant or non-malignant type, e.g., cancer cells. Exemplary vitamins include vitamin A, E, and K. Other exemplary vitamins include are B vitamin, e.g., folic acid, B12, riboflavin, biotin, pyridoxal or other vitamins or nutrients taken up by cancer cells. Also included are HSA and low-density lipoprotein (LDL).
[0330] In another aspect, the ligand is a cell-permeation agent, such as a helical cell-permeation agent. In certain embodiments, the agent is amphipathic. An exemplary agent is a peptide such as tat or antennopedia. If the agent is a peptide, it can be modified, including a peptidylmimetic, invertomers, non-peptide or pseudo-peptide linkages, and use of D-amino acids. The helical agent can be an alpha-helical agent, which may have a lipophilic and a lipophobic phase.
[0331] The ligand can be a peptide or peptidomimetic. A peptidomimetic (also referred to herein as an oligopeptidomimetic) is a molecule capable of folding into a defined three- dimensional structure similar to a natural peptide. The attachment of peptide and peptidomimetics to oligonucleotide agents can affect pharmacokinetic distribution of the RNA silencing agent, such as by enhancing cellular recognition and absorption. The peptide or peptidomimetic moiety can be about 5-50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long. A peptide or peptidomimetic can be, for example, a cell permeation peptide, cationic peptide, amphipathic peptide, or hydrophobic peptide (e.g.,consisting primarily of Tyr, Trp or Phe). The peptide moiety can be a dendrimer peptide, constrained peptide or crosslinked peptide. The peptide moiety can be an L-peptide or D- peptide. In another alternative, the peptide moiety can include a hydrophobic membrane translocation sequence (MTS). A peptide or peptidomimetic can be encoded by a random sequence of DNA, such as a peptide identified from a phage-display library, or one-bead-one- compound (OBOC) combinatorial library (Lam et al., Nature 354:82-84, 1991). In exemplary embodiments, the peptide or peptidomimetic tethered to an RNA silencing agent via an incorporated monomer unit is a cell targeting peptide such as an arginine-glycine-aspartic acid (RGD)-peptide, or RGD mimic. A peptide moiety can range in length from about 5 amino acids to about 40 amino acids. The peptide moieties can have a structural modification, such as to increase stability or direct conformational properties. Any of the structural modifications described below can be utilized.
[0332] In certain embodiments, the functional moiety is linked to the 5’ end and / or 3’ end of the RNA silencing agent of the disclosure. In certain embodiments, the functional moiety is linked to the 5’ end and / or 3’ end of an antisense strand of the RNA silencing agent of the disclosure. In certain embodiments, the functional moiety is linked to the 5’ end and / or 3’ end of a sense strand of the RNA silencing agent of the disclosure. In certain embodiments, the functional moiety is linked to the 3’ end of a sense strand of the RNA silencing agent of the disclosure.
[0333] In certain embodiments, the functional moiety is linked to the RNA silencing agent by a linker. In certain embodiments, the functional moiety is linked to the antisense strand and / or sense strand by a linker. In certain embodiments, the functional moiety is linked to the 3’ end of a sense strand by a linker. In certain embodiments, the linker comprises a divalent or trivalent linker. In certain embodiments, the linker comprises an ethylene glycol chain, an alkyl chain, a peptide, RNA, DNA, a phosphodiester, a phosphorothioate, a phosphoramidate, an amide, a carbamate, or a combination thereof. In certain embodiments, the divalent or trivalent linker is selected from:is 1, 2, 3, 4, or 5.
[0334] In certain embodiments, the linker further comprises a phosphodiester or phosphodiester derivative. In certain embodiments, the phosphodiester or phosphodiester derivative is selected from the group consisting of:wherein X is O, S or BH3.
[0335] The various functional moieties of the disclosure and means to conjugate them to RNA silencing agents are described in further detail in W02017 / 030973A1 andBranched Oligonucleotides
[0336] The miR29b mimics described herein may be contained in a branched oligonucleotide structure (i.e., a branched RNA compound). The branched oligonucleotides comprise two or more oligonucleotides linked together. The different branched oligonucleotides described herein (e.g., a branched oligonucleotide with two, three, or four oligonucleotides) enhance tissue delivery and retention of the miR29b mimics, including lung cell-specific delivery.
[0337] In certain embodiments, the two or more oligonucleotides in the branched oligonucleotide are connected to one another by one or more moieties independently selected from a linker, a spacer and a branching point.
[0338] In certain embodiments, the linker comprises an ethylene glycol chain, an alkyl chain, a peptide, an RNA, a DNA, a phosphate, a phosphonate, a phosphoramidate, an ester, an amide, a triazole, or combinations thereof.
[0339] In certain embodiments, the branching point comprises a polyvalent organic species or derivative thereof.
[0340] In another embodiment, the branching point is an amino acid derivative. In another embodiment of the branching point is selected from the formulas of:
[0341] Polyvalent organic species are moieties comprising carbon and three or more valencies (i.e., points of attachment with moieties such as S, L or N, as defined above). Non-limiting examples of polyvalent organic species include triols (e.g., glycerol, phloroglucinol, and the like), tetrols (e.g., ribose, pentaerythritol, 1,2,3,5-tetrahydroxybenzene, and the like), tricarboxylic acids (e.g., citric acid, 1,3,5-cyclohexanetricarboxylic acid, trimesic acid, and the like), tetra-carboxylic acids (e.g., ethylenediaminetetraacetic acid, pyromellitic acid, and the like), tertiary amines (e.g., tripropargylamine, triethanolamine, and the like), triamines (e.g., diethylenetriamine and the like), tetramines, and species comprising a combination of hydroxyl, thiol, amino, and / or carboxyl moieties (e.g., amino acids such as lysine, serine, cysteine, and the like).
[0342] In certain embodiments, the spacer comprises an ethylene glycol chain, an alkyl chain, a peptide, an RNA, a DNA, a phosphate, a phosphonate, a phosphoramidate, an ester, an amide, a triazole, or a combination thereof.
[0343] In certain embodiments, the linker comprises the structure LI :
[0345] In certain embodiments, the linker comprises the structure L2:
[0347] In certain embodiments, the branched oligonucleotide consists of two oligonucleotides. In certain embodiments, the branched oligonucleotide consists of three oligonucleotides. In certain embodiments, the branched oligonucleotide consists of four oligonucleotides. In certain embodiments, the oligonucleotides are siRNA (i.e., dsRNA).
[0348] In certain embodiments, the branched oligonucleotide comprises the structure:Oigonucleotide-(dimer);Oligonucleotide.uiigonucieonoe(trimer); or(tetramer).
[0349] For any of the above recited structures, the term “oligonucleotide” corresponds to any of the oligonucleotides recited herein, e.g., an ASO or siRNA. In certain embodiments, the term “oligonucleotide” in the structures recited above corresponds to the sense strand of an siRNA. In certain embodiments, the oxygen immediately adjacent to the term “oligonucleotide” in the structures is linked to the 3’ end of a sense strand of an siRNA.
[0350] In one aspect, the disclosure provides a branched RNA compound comprising at least a first dsRNA and a second dsRNA, each dsRNA comprising a sense strand and an antisense strand, each strand having a 5’ end and a 3’ end, wherein the antisense strand of the first dsRNA and the second dsRNA comprises UAGCACCAUUUGAAAUCAGUGUUUU, or a chemically modified variant thereof, and the sense strand of the first dsRNA and the seconddsRNA comprises AACACUGUUUACAAAUGGUCCUA, or a chemically modified variant thereof, wherein the at least first dsRNA is covalently bound to the second dsRNA.
[0351] In certain embodiments, the antisense strand comprises V(mU)#(fA)#(mG)(fC)(mA)(fC)(mC)(fA)(mU)(fU)(mU)(mG)(mA)(fA)(mA)(fU)(mC)(fA)( mG)(fU)(mG)(fU)(mU)#(mU)#(mU), and the sense strand C0mprises(fA)#(mA)#(fC)(mA)(fC)(mU)(fG)(mU)(fU)(mU)(fA)(fC)(fA)(mA)(fA)(mU)(fG)( mG)(fU)(mC)(fC)(mU)(fA), wherein “m” corresponds to a 2'-O-methyl modified nucleotide, “f’ corresponds to a 2'-deoxy-2'-fluoro modified nucleotide, “#” corresponds to a phosphorothioate modified intemucleotide linkage, and “V” corresponds to a 5’ vinyl phosphonate.
[0352] Branched oligonucleotides, including synthesis and methods of use, are described in greater detail in WO2017 / 132669, incorporated herein by reference. Further details regarding synthesis are provided in the Materials and Methods section of the Examples.Methods of Introducing Nucleic Acids, Vectors and Host Cells
[0353] RNA silencing agents of the disclosure may be directly introduced into the cell (e.g., a lung cell or liver cell) (i.e., intracellularly); or introduced extracellularly into a cavity, interstitial space, into the circulation of an organism, introduced orally, or may be introduced by bathing a cell or organism in a solution containing the nucleic acid. Vascular or extravascular circulation, the blood or lymph system, and the cerebrospinal fluid are sites where the nucleic acid may be introduced.
[0354] The RNA silencing agents of the disclosure can be introduced using nucleic acid delivery methods known in art including injection of a solution containing the nucleic acid, bombardment by particles covered by the nucleic acid, soaking the cell or organism in a solution of the nucleic acid, or electroporation of cell membranes in the presence of the nucleic acid. Other methods known in the art for introducing nucleic acids to cells may be used, such as lipid-mediated carrier transport, chemical-mediated transport, and cationic liposome transfection such as calcium phosphate, and the like. The nucleic acid may be introduced along with other components that perform one or more of the following activities: enhance nucleic acid uptake by the cell or otherwise increase inhibition of the target gene.
[0355] Physical methods of introducing nucleic acids include injection of a solution containing the RNA, bombardment by particles covered by the RNA, soaking the cell or organism in a solution of the RNA, or electroporation of cell membranes in the presence of the RNA. A viral construct packaged into a viral particle would accomplish both efficient introduction of an expression construct into the cell and transcription of RNA encoded by the expression construct. Other methods known in the art for introducing nucleic acids to cells may be used, such as lipid-mediated carrier transport, chemical-mediated transport, such as calcium phosphate, and the like. Thus, the RNA may be introduced along with components that perform one or more of the following activities: enhance RNA uptake by the cell, inhibit annealing of single strands, stabilize the single strands, or other-wise increase inhibition of the target gene.
[0356] The cell having the target gene may be from the germ line or somatic, totipotent or pluripotent, dividing or non-dividing, parenchyma or epithelium, immortalized or transformed, or the like. The cell may be a stem cell or a differentiated cell. Cell types that are differentiated include eye cells, adipocytes, fibroblasts, myocytes, cardiomyocytes, endothelium, neurons, glia, blood cells, megakaryocytes, lymphocytes, macrophages, neutrophils, eosinophils, basophils, mast cells, leukocytes, granulocytes, keratinocytes, chondrocytes, osteoblasts, osteoclasts, hepatocytes, and cells of the endocrine or exocrine glands.
[0357] Depending on the particular target gene and the dose of double stranded RNA material delivered, this process may provide partial or complete loss of function for the target gene. A reduction or loss of gene expression in at least 50%, 60%, 70%, 80%, 90%, 95% or 99% or more of targeted cells is exemplary. Inhibition of gene expression refers to the absence (or observable decrease) in the level of protein and / or mRNA product from a target gene. Specificity refers to the ability to inhibit the target gene without manifest effects on other genes of the cell. The consequences of inhibition can be confirmed by examination of the outward properties of the cell or organism (as presented below in the examples) or by biochemical techniques such as RNA solution hybridization, nuclease protection, Northern hybridization, reverse transcription, gene expression monitoring with a microarray, antibody binding, Enzyme Linked ImmunoSorbent Assay (ELISA), Western blotting, RadioImmunoAssay (RIA), other immunoassays, and Fluorescence Activated Cell Sorting (FACS).
[0358] For RNA-mediated inhibition in a cell line or whole organism, gene expression is conveniently assayed by use of a reporter or drug resistance gene whose protein product is easily assayed. Such reporter genes include acetohydroxyacid synthase (AHAS), alkalinephosphatase (AP), beta galactosidase (LacZ), beta glucoronidase (GUS), chloramphenicol acetyltransferase (CAT), green fluorescent protein (GFP), horseradish peroxidase (HRP), luciferase (Luc), nopaline synthase (NOS), octopine synthase (OCS), and derivatives thereof. Multiple selectable markers are available that confer resistance to ampicillin, bleomycin, chloramphenicol, gentarnycin, hygromycin, kanamycin, lincomycin, methotrexate, phosphinothricin, puromycin, and tetracyclin. Depending on the assay, quantitation of the amount of gene expression allows one to determine a degree of inhibition which is greater than 10%, 33%, 50%, 90%, 95% or 99% as compared to a cell not treated according to the present disclosure. Lower doses of injected material and longer times after administration of RNAi agent may result in inhibition in a smaller fraction of cells (e.g., at least 10%, 20%, 50%, 75%, 90%, or 95% of targeted cells). Quantization of gene expression in a cell may show similar amounts of inhibition at the level of accumulation of target mRNA or translation of target protein. As an example, the efficiency of inhibition may be determined by assessing the amount of gene product in the cell; mRNA may be detected with a hybridization probe having a nucleotide sequence outside the region used for the inhibitory double-stranded RNA, or translated polypeptide may be detected with an antibody raised against the polypeptide sequence of that region.
[0359] The RNA may be introduced in an amount which allows delivery of at least one copy per cell. Higher doses (e.g., at least 5, 10, 100, 500 or 1000 copies per cell) of material may yield more effective inhibition; lower doses may also be useful for specific applications.
[0360] In an exemplary aspect, the efficacy of an RNAi agent of the disclosure (e.g., miR29b mimic dsRNA) is tested for its ability to specifically degrade mutant mRNA (e.g., target mRNA of miR29b) in cells, such as cells in the central nervous system. In certain embodiments, cells in the central nervous system include, but are not limited to, neurons (e.g., striatal or cortical neuronal clonal lines and / or primary neurons), glial cells, and astrocytes. Also suitable for cellbased validation assays are other readily transfectable cells, for example, HeLa cells or COS cells. Cells are transfected with human wild type or mutant cDNAs .Standard siRNA, modified siRNA or vectors able to produce siRNA from U-looped mRNA are co-transfected. Selective reduction in target mRNA and / or target protein is measured. Reduction of target mRNA or protein can be compared to levels of target mRNA or protein in the absence of an RNAi agent or in the presence of an RNAi agent that does not target miR29b target mRNA. Exogenously- introduced mRNA or protein (or endogenous mRNA or protein) can be assayed for comparisonpurposes. When utilizing neuronal cells, which are known to be fairly resistant to standard transfection techniques, it may be desirable to introduce RNAi agents (e.g., siRNAs) by passive uptake.Recombinant Adeno- Associated Viruses and Vectors
[0361] In certain exemplary embodiments, recombinant adeno-associated viruses (rAAVs) and their associated vectors can be used to deliver one or more siRNAs into cells, e.g., neural cells (e.g., brain cells). AAV is able to infect many different cell types, although the infection efficiency varies based upon serotype, which is determined by the sequence of the capsid protein. Several native AAV serotypes have been identified, with serotypes 1-9 being the most commonly used for recombinant AAV. AAV-2 is the most well-studied and published serotype. The AAV-DJ system includes serotypes AAV-DJ and AAV-DJ / 8. These serotypes were created through DNA shuffling of multiple AAV serotypes to produce AAV with hybrid capsids that have improved transduction efficiencies in vitro (AAV-DJ) and in vivo ( N- DJ / 8) in a variety of cells and tissues.
[0362] rAAVs may be delivered to a subject in compositions according to any appropriate methods known in the art. An rAAV can be suspended in a physiologically compatible carrier (i.e., in a composition), and may be administered to a subject, i.e., a host animal, such as a human, mouse, rat, cat, dog, sheep, rabbit, horse, cow, goat, pig, guinea pig, hamster, chicken, turkey, a non-human primate (e.g., Macaque) or the like. In certain embodiments, a host animal is a non-human host animal.
[0363] Delivery of one or more rAAVs to a mammalian subject may be performed, for example, by intramuscular injection or by administration into the bloodstream of the mammalian subject. Administration into the bloodstream may be by injection into a vein, an artery, or any other vascular conduit. In certain embodiments, one or more rAAVs are administered into the bloodstream by way of isolated limb perfusion, a technique well known in the surgical arts, the method essentially enabling the artisan to isolate a limb from the systemic circulation prior to administration of the rAAV virions. A variant of the isolated limb perfusion technique, described in U.S. Pat. No. 6,177,403, can also be employed by the skilled artisan to administer virions into the vasculature of an isolated limb to potentially enhance transduction into muscle cells or tissue.
[0364] The compositions of the disclosure may comprise an rAAV alone, or in combination with one or more other viruses (e.g., a second rAAV encoding having one or more different transgenes). In certain embodiments, a composition comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more different rAAVs each having one or more different transgenes.
[0365] An effective amount of an rAAV is an amount sufficient to target infect an animal, target a desired tissue. In some embodiments, an effective amount of an rAAV is an amount sufficient to produce a stable somatic transgenic animal model. The effective amount will depend primarily on factors such as the species, age, weight, health of the subject, and the tissue to be targeted, and may thus vary among animal and tissue. For example, an effective amount of one or more rAAVs is generally in the range of from about 1 ml to about 100 ml of solution containing from about 109to 1016genome copies. In some cases, a dosage between about 1011to 1012rAAV genome copies is appropriate. In certain embodiments, 1012rAAV genome copies is effective to target heart, liver, and pancreas tissues. In some cases, stable transgenic animals are produced by multiple doses of an rAAV.
[0366] In some embodiments, rAAV compositions are formulated to reduce aggregation of AAV particles in the composition, particularly where high rAAV concentrations are present (e.g., about 1013genome copies / mL or more). Methods for reducing aggregation of rAAVs are well known in the art and, include, for example, addition of surfactants, pH adjustment, salt concentration adjustment, etc. (See, e.g., Wright et al. (2005) Molecular Therapy 12: 171-178, the contents of which are incorporated herein by reference.)
[0367] “Recombinant AAV (rAAV) vectors” comprise, at a minimum, a transgene and its regulatory sequences, and 5' and 3' AAV inverted terminal repeats (ITRs). It is this recombinant AAV vector which is packaged into a capsid protein and delivered to a selected target cell. In some embodiments, the transgene is a nucleic acid sequence, heterologous to the vector sequences, which encodes a polypeptide, protein, functional RNA molecule (e.g., siRNA) or other gene product, of interest. The nucleic acid coding sequence is operatively linked to regulatory components in a manner which permits transgene transcription, translation, and / or expression in a cell of a target tissue.
[0368] The AAV sequences of the vector typically comprise the cis-acting 5' and 3' inverted terminal repeat (ITR) sequences (See, e.g., B. J. Carter, in "Handbook of Parvoviruses", ed., P. Tijsser, CRC Press, pp. 155 168 (1990)). The ITR sequences are usually about 145 basepairs in length. In certain embodiments, substantially the entire sequences encoding the ITRs areused in the molecule, although some degree of minor modification of these sequences is permissible. The ability to modify these ITR sequences is within the skill of the art. (See, e.g., texts such as Sambrook et al, "Molecular Cloning. A Laboratory Manual", 2d ed., Cold Spring Harbor Laboratory, New York (1989); and K. Fisher et al., J Virol., 70:520 532 (1996)). An example of such a molecule employed in the present disclosure is a “cis-acting” plasmid containing the transgene, in which the selected transgene sequence and associated regulatory elements are flanked by the 5' and 3' AAV ITR sequences. The AAV ITR sequences may be obtained from any known AAV, including mammalian AAV types described further herein.Methods of Treatment
[0369] In one aspect, the present disclosure provides for both prophylactic and therapeutic methods of treating a subject at risk of (or susceptible to) developing a fibrotic disease or disorder. As used herein, the term “fibrotic disease or disorder” refers to disease or disorder characterized, in part, by an excessive accumulation of extracellular matrix components, such as collagen, leading to the formation of a fibrotic scar. Fibrosis is a pathological feature of most chronic inflammatory diseases. Fibrosis, or scarring, is defined by the accumulation of excess extracellular matrix components. If the fibrosis progresses, the fibrotic process eventually leads to organ malfunction and death. Fibrosis affects nearly every tissue in the body.
[0370] " Treatment," or "treating," as used herein, is defined as the application or administration of a therapeutic agent (e.g., a RNA agent or vector or transgene encoding same) to a patient, or application or administration of a therapeutic agent to an isolated tissue or cell line from a patient, who has the disease or disorder, a symptom of disease or disorder or a predisposition toward a disease or disorder, with the purpose to cure, heal, alleviate, relieve, alter, remedy, ameliorate, improve or affect the disease or disorder, the symptoms of the disease or disorder, or the predisposition toward disease.
[0371] Accordingly, in one aspect, the disclosure provides a method of treating or preventing a fibrotic disease or disorder comprising administering to a patient in need of such treatment a therapeutically effective amount of the miR29b mimic dsRNA or branched RNA compounds described herein, thereby treating or preventing the fibrotic disease or disorder in the patient.
[0372] In certain embodiments, the fibrotic disease or disorder is selected from the group consisting of pulmonary fibrosis, cystic fibrosis, liver fibrosis, cirrhosis, myocardial fibrosis,arterial stiffness, arthrofibrosis, ocular fibrosis, tendinopathy, renal fibrosis, Dupuytren’s contractures, cutaneous fibrosis, fibrosis caused by inflammatory bowel disease, fibrosis caused by osteoarthritis, and metabolic dysfunction-associated steatohepatitis (MASH).
[0373] In another aspect, the disclosure provides a method of reducing or preventing fibrosis in a patient, comprising administering to the patient the miR29b mimic dsRNA or branched RNA compounds described herein, thereby reducing or preventing fibrosis in the patient.
[0374] In another aspect, the disclosure provides a method of reducing expression of one or more pro-fibrotic genes in a patient, comprising administering to the patient the miR29b mimic dsRNA or branched RNA compounds described herein, thereby reducing the expression of the one or more pro-fibrotic genes in the patient.
[0375] In certain embodiments, the one or more pro-fibrotic genes is COL1A1, ACTA2 and FASN.Pharmaceutical Compositions and Methods of Administration
[0376] The disclosure pertains to uses of the above-described agents for prophylactic and / or therapeutic treatments as described infra. Accordingly, the modulators (e.g., RNAi agents) of the present disclosure can be incorporated into pharmaceutical compositions suitable for administration. Such compositions typically comprise the nucleic acid molecule, protein, antibody, or modulatory compound and a pharmaceutically acceptable carrier. As used herein the language "pharmaceutically acceptable carrier" is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the compositions is contemplated. Supplementary active compounds can also be incorporated into the compositions.
[0377] A pharmaceutical composition of the disclosure is formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral, e.g., intravenous, intravitreal, intradermal, subcutaneous, intraperitoneal, intramuscular, oral (e.g., inhalation), intratracheal, intranasal, transdermal (topical), and transmucosal administration.
[0378] The nucleic acid molecules of the disclosure can be inserted into expression constructs, e.g., viral vectors, retroviral vectors, expression cassettes, or plasmid viral vectors, e.g., using methods known in the art, including but not limited to those described in Xia et al., (2002), Supra. Expression constructs can be delivered to a subject by, for example, inhalation, orally, intravenous injection, local administration (see U.S. Pat. No. 5,328,470) or by stereotactic injection (see e.g., Chen et al. (1994), Proc. Natl. Acad. Sci. USA, 91, 3054-3057). The pharmaceutical preparation of the delivery vector can include the vector in an acceptable diluent, or can comprise a slow-release matrix in which the delivery vehicle is imbedded. Alternatively, where the complete delivery vector can be produced intact from recombinant cells, e.g., retroviral vectors, the pharmaceutical preparation can include one or more cells which produce the gene delivery system.
[0379] The nucleic acid molecules of the disclosure can also include small hairpin RNAs (shRNAs), and expression constructs engineered to express shRNAs. Transcription of shRNAs is initiated at a polymerase III (pol III) promoter, and is thought to be terminated at position 2 of a 4-5-thymine transcription termination site. Upon expression, shRNAs are thought to fold into a stem-loop structure with 3' UU-overhangs; subsequently, the ends of these shRNAs are processed, converting the shRNAs into siRNA-like molecules of about 21 nucleotides. Brummelkamp et al. (2002), Science, 296, 550-553; Lee et al, (2002). supra, Miyagishi and Taira (2002), Nature Biotechnol., 20, 497-500; Paddison et al. (2002), supra, Paul (2002), supra, Sui (2002) supra, Yu et al. (2002), supra.
[0380] The expression constructs may be any construct suitable for use in the appropriate expression system and include, but are not limited to retroviral vectors, linear expression cassettes, plasmids and viral or virally-derived vectors, as known in the art. Such expression constructs may include one or more inducible promoters, RNA Pol III promoter systems such as U6 snRNA promoters or Hl RNA polymerase III promoters, or other promoters known in the art. The constructs can include one or both strands of the siRNA. Expression constructs expressing both strands can also include loop structures linking both strands, or each strand can be separately transcribed from separate promoters within the same construct. Each strand can also be transcribed from a separate expression construct, Tuschl (2002), Supra.
[0381] In certain embodiments, a composition that includes a compound of the disclosure can be delivered to the nervous system of a subject by a variety of routes. Exemplary routes includeintrathecal, parenchymal (e.g., in the brain), nasal, and ocular delivery. The composition can also be delivered systemically, e.g., by intravenous, subcutaneous or intramuscular injection.
[0382] For example, compositions can include one or more species of a compound of the disclosure and a pharmaceutically acceptable carrier. The pharmaceutical compositions of the present disclosure may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic, intranasal, transdermal), oral or parenteral. Parenteral administration includes intravenous drip, subcutaneous, intraperitoneal or intramuscular injection, intrathecal, or intraventricular (e.g., intracerebroventricular) administration.The route of delivery can be dependent on the disorder of the patient. For example, a subject diagnosed with a fibrotic disease can be administered the miR29b mimics of the disclosure directly into the fibrotic tissue (e.g., into the lung for pulmonary fibrosis).EXAMPLESExample 1: Micro RNA 29b (miR29b) mimic development for fibrosis
[0383] The microRNA miR29 has been shown to be down-regulated in a variety of fibrotic tissues (van Rooji et al. Proc Natl Acad Sci U S A. 2008 Sep 2; 105(35): 13027-13032; Chioccioli et al. EBioMedicine. 2022 Nov:85: 104304). MRG-229, a miR29b mimic, has been shown to have potentially therapeutic benefits for fibrosis patients (see, Chioccioli, supra). None-the-less, improved miR29b mimics would have greater benefit to fibrosis patients.
[0384] Accordingly, a panel of chemically modified double stranded RNA (dsRNA) were prepared and compared against MRG-229. These new miR29b mimics were tested in LX2 human stellate cells, and levels of COL1 Al, ACTA2 and FASN mRNA were measured. Each of these genes are markers of fibrosis. As shown in Fig. 1A - Fig. IE, the panel of new miR29b mimics blocked stellate cell activation significantly better than MRG-229. This was based on the repression of stellate cell expressed genes, which also serve as markers of fibrosis, COL1 Al, ACTA2, and FASN. Each of the new miR29b mimics performed better than MRG- 229, with the new miR29b mimic designated P3111, P2111, and P218 singled out for further study. The sequences of the new miR29b mimics and MRG-229 are provided below.“m” corresponds to a 2'-0-methyl modified nucleotide, “f ’ corresponds to a 2'-deoxy-2'-fluoro modified nucleotide, “#” corresponds to a phosphorothioate modified intemucleotide linkage, “V” corresponds to a 5’ vinyl phosphonate, “TegChol” corresponds to a tri- or tetra-ethylene glycol linked cholesterol moiety, which is optionally present, “AS” corresponds to an antisense strand, and “S” corresponds to a sense strand.
[0385] In a following study, the new miR29b mimics designated P3111, P2111, and P218 were compared against MRG-229 for their ability to reduce fibrotic collagen secretion from human hepatic stellate cells. As shown in Fig. 2A - Fig. 2C, the miR29b mimics designated P3111, P2111, and P218 downregulated several collagen mRNAs as well as secreted procollagen la levels.
[0386] Based on these results, miR29b mimic P2111 was tested in a human liver organoid model of MASH in combination with a dsRNA targeting DGAT2. The model is further described in Hess et al. EMBO J. 2023. 42(24): el 13898. The human liver organoids (HLOs) were prepared as explained previously in Hess, supra. As shown in Fig. 3A - Fig. 3C, the miR29b mimic P2111 combined with the dsRNA targeting DGAT2 (leading to DGAT2 mRNA silencing) blunted fibrosis in the HLOs, as measured by mRNA levels of COL1A1, ACTA2 and FASN. Exemplary DGAT2 gene target regions for DGAT2 dsRNA are recited below. The miR29b mimic dsRNA of the disclosure may be combined with DGAT2 dsRNA targeting any one of the below recited DGAT2 gene target regions.
[0387] Fig. 4A-Fig. 4B show fluorescent images (Fig. 4A) and mean fluorescent intensity (MFI) (Fig. 4B) of HLOs incubated with the cholesterol conjugated Dgat2 -targeting dsRNA combined with miR29 mimic P2111. HLOs were stained for collagen type 1 with an anticollagen type 1 antibody to show fibrosis development. Quantification of the collagen protein levels were done in ImageLab. The data demonstrates that the combination a miR29 mimic and a Dgat2 -targeting dsRNA yields better results with reduced collagen type 1 accumulation.
[0388] Fig. 5A-Fig. 5B show liver stiffness measurements (Fig. 5A) and liver Sirus red staining (Fig. 5B) in 10-week-old male C57BL6 mice that were injected with either Dgat2 siRNA, P2111 or both at a lOmg / kg dose. The mice were then put on the MASH causing diet (CDAHFD) to induce liver fibrosis. Liver stiffness was measured at 6-weeks and 9-weeks after the mice were put on the CDAHFD diet with a SonoVol Shear wave elastography system. After9 weeks of CDAHFD, mice were sacrificed, and liver fibrosis levels were evaluated using liver sections stained with Sirius red staining. The data demonstrates that the combination a miR29 mimic and a Dgat2 -targeting dsRNA led to reduced liver stiffness, suggesting an effective treatment for MASH.
[0389] Fig. 6 shows liver stiffness measurements in 10-week-old male C57BL6 mice that were injected with GalNac conjugated bivalent oligonucleotides that contained Dgat2 siRNA linked to different miR29b mimics at a lOmg / kg dose. The mice were then put on the MASH causing diet (CDAHFD) for 5 weeks to induce MASH. Liver stiffness measurements were taken using SonoVol Shear wave elastography system. The data demonstrates that the bivalent oligonucleotides led to reduced liver stiffness, suggesting an effective treatment for MASH.Table 1. DGAT2 gene target regions and antisense and sense strands targeting said DGAT2 gene target regions.Example 2: Optimization of miR29b mimic
[0390] The results of Example 1 demonstrate several new miR29b mimics that display greater anti-fibrotic activity compared to MRG-229. However, further optimization is possible through1) the use of alternative mismatch positions between the antisense strand and sense strand; 2) the use of destabilized nucleotides in the sense strand, such as unlocked nucleic acids (UNA) or abasic nucleotides; and 3) the use of one or more of the internucleotide modification of Formula (I) or Formula (VI) in one or both of the antisense strand and sense strand. In particular the intemucleotide modification of Formula (I) or Formula (VI) will be employed in the two nucleotides at the 3’ end of the antisense strand.
[0391] Destabilization of the dsRNA duplex of the miR29b mimic is important to enable productive RISC loading. The use of destabilizing modifications such as Unlocked Nucleic Acid (UNA) or abasic nucleotides (such as a dSpacer) can provide an alternative strategy and ensure higher metabolic stabilization compared to the mismatch incorporation which partially exposes labile single-stranded region.Example 3: Multivalent miR29b mimics
[0392] The miR29b mimics described herein will be tested in a multivalent, branched RNA compound format. In this study, the 3’ end of a sense strand of a first miR29b mimic will be linked to at least the 3’ end of a sense strand of a. second miR29b mimic, thus forming a divalent miR29b mimic. A trivalent and tetravalent miR29b mimic will also be tested. The structure of the di-, tri-, and tetra-valent branched RNA compounds are shown below: compound comprises the structure:Oigonucleotide— OligonucleotideOH (dimer);OligonucleotideOligonucleotide (trimer); or(tetramer).
[0394] A bleomycin induced mouse model will be used to decrease miR29b levels, as previously reported, and consequently deliver the multivalent miR29b mimics intranasally. Briefly, mice will receive a single dose of bleomycin (1.5mg / kg in 30 pL saline). Controls will receive 30 pL saline. On day 3 post-bleomycin, mice will be treated with the miR29b mimics described herein or NTC. MicroCT scans and lung function tests will be repeated on Day 20 and mice will be sacrificed on Day 21 for sampling. Protein and RNA levels of fibrosis markers will be assessed. Lung sections for histopathology will be stained with hematoxylin & eosin for architecture and tri chrome for collagen. Total lung collagen content will be quantified by hydroxy-proline assay. Cobas Clinical Chemistry Analyzer and Multiplexed-Luminex will be used to measure plasma and bronchoalveolar lavage (BAL) levels of ILlb, IL4, IL6, IL10, MCP1, TNF-alpha and metalloproteases like MMP2, MMP9 and TIMP1, along with liver and kidney markers for toxicity (ALT, AST, Urea, Creatine).
[0395] The duration of effect will be determined. This study will contain 4 dose groups (15,7, 3 and 1 nmol / mice) with varying termination time points (1, 3, 6, 8 weeks) post single dose. Metabolic stability of the compounds will be measured by the quantification of remaining oligonucleotides within these lung tissues (by Peptide Nucleic Acid assay) and the measurement of oligonucleotides which is loaded to RISC (by immunoprecipitation of RISC from lung tissue and quantification of the small RNAs associated with Ago2) at the each timepoint.Example 4: miR29b mimics in combination with NOX-4 targeting oligonucleotides
[0396] Although miR29b mimics alone have incredible promise for fibrosis treatment, simultaneously targeting oxidative stress by concurrently silencing NOX-4 may achieve superior outcomes. Branched RNA compounds will be tested in which one of the two or more RNA compounds will be a miR29b mimic described herein, and the other RNA compound will be an oligonucleotide targeting NOX-4. Exemplary NOX-4 targeting oligonucleotides include, but are not limited to, dsRNA (i.e., siRNA) and antisense oligonucleotide (ASO). Exemplary NOX-4 gene target sequences for the dsRNA or ASO are recited below in Table 2 and Table 3. Table 2. Sequences targeting human N0X4 gene target regions.Table 3. Sequences targeting mouse NOX4 gene target regions.
Claims
CLAIMS1. A double stranded RNA (dsRNA) comprising a sense strand and an antisense strand, each strand having a 5’ end and a 3’ end, wherein: the antisense strand comprises a nucleotide sequence of UAGCACCAUUUGAAAUCAGUG (SEQ ID NO: 1), or a chemically modified variant thereof, and the sense strand is substantially complementary to the antisense strand and consists of 1 or 2 mismatches with the antisense strand.
2. The dsRNA of claim 1, wherein the antisense strand comprises a mismatch with the sense strand at nucleotide position 1 from the 5’ end of the antisense strand.
3. The dsRNA of claim 1 or 2, wherein the antisense strand comprises a mismatch with the sense strand at nucleotide position 2 from the 5’ end of the antisense strand.
4. The dsRNA of any one of claims 1-3, wherein the antisense strand comprises a mismatch with the sense strand at nucleotide position 3 from the 5’ end of the antisense strand.
5. The dsRNA of any one of claims 1-4, wherein the antisense strand comprises a mismatch with the sense strand at nucleotide position 3 from the 5’ end of the antisense strand.
6. The dsRNA of any one of claims 1-5, wherein the antisense strand comprises a mismatch with the sense strand at nucleotide position 4 from the 5’ end of the antisense strand.
7. The dsRNA of any one of claims 1-6, wherein the antisense strand comprises a mismatch with the sense strand at nucleotide position 5 from the 5’ end of the antisense strand.
8. The dsRNA of any one of claims 1-7, wherein the antisense strand comprises a mismatch with the sense strand at nucleotide position 6 from the 5’ end of the antisense strand.
9. The dsRNA of any one of claims 1-8, wherein the antisense strand comprises a mismatch with the sense strand at nucleotide position 7 from the 5’ end of the antisense strand.
10. The dsRNA of any one of claims 1-9, wherein the antisense strand comprises a mismatch with the sense strand at nucleotide position 8 from the 5’ end of the antisense strand.
11. The dsRNA of any one of claims 1-10, wherein the antisense strand comprises a mismatch with the sense strand at nucleotide position 9 from the 5’ end of the antisense strand.
12. The dsRNA of any one of claims 1-11, wherein the antisense strand comprises a mismatch with the sense strand at nucleotide position 10 from the 5’ end of the antisense strand.
13. The dsRNA of any one of claims 1-12, wherein the antisense strand comprises a mismatch with the sense strand at nucleotide position 11 from the 5’ end of the antisense strand.
14. The dsRNA of any one of claims 1-13, wherein the antisense strand comprises a mismatch with the sense strand at nucleotide position 12 from the 5’ end of the antisense strand.
15. The dsRNA of any one of claims 1-14, wherein the antisense strand comprises a mismatch with the sense strand at nucleotide position 13 from the 5’ end of the antisense strand.
16. The dsRNA of any one of claims 1-15, wherein the antisense strand comprises a mismatch with the sense strand at nucleotide position 14 from the 5’ end of the antisense strand.
17. The dsRNA of any one of claims 1-16, wherein the antisense strand comprises a mismatch with the sense strand at nucleotide position 15 from the 5 ’ end of the antisense strand.
18. The dsRNA of any one of claims 1-17, wherein the antisense strand comprises a mismatch with the sense strand at nucleotide position 16 from the 5’ end of the antisense strand.
19. The dsRNA of claim 1 or 2, wherein the antisense strand consists of a mismatch with the sense strand at nucleotide position 1 and 2 from the 5’ end of the antisense strand.
20. The dsRNA of claim 1 or 2, wherein the antisense strand consists of a mismatch with the sense strand at nucleotide position 1 and 3 from the 5’ end of the antisense strand.
21. The dsRNA of claim 1 or 2, wherein the antisense strand consists of a mismatch with the sense strand at nucleotide position 1 and 4 from the 5’ end of the antisense strand.
22. The dsRNA of claim 1 or 2, wherein the antisense strand consists of a mismatch with the sense strand at nucleotide position 1 and 5 from the 5’ end of the antisense strand.
23. The dsRNA of claim 1 or 2, wherein the antisense strand consists of a mismatch with the sense strand at nucleotide position 1 and 6 from the 5’ end of the antisense strand.
24. The dsRNA of claim 1 or 2, wherein the antisense strand consists of a mismatch with the sense strand at nucleotide position 1 and 7 from the 5’ end of the antisense strand.
25. The dsRNA of claim 1 or 2, wherein the antisense strand consists of a mismatch with the sense strand at nucleotide position 1 and 8 from the 5’ end of the antisense strand.
26. The dsRNA of claim 1 or 2, wherein the antisense strand consists of a mismatch with the sense strand at nucleotide position 1 and 9 from the 5’ end of the antisense strand.
27. The dsRNA of claim 1 or 2, wherein the antisense strand consists of a mismatch with the sense strand at nucleotide position 1 and 10 from the 5’ end of the antisense strand.
28. The dsRNA of claim 1 or 2, wherein the antisense strand consists of a mismatch with the sense strand at nucleotide position 1 and 11 from the 5’ end of the antisense strand.
29. The dsRNA of claim 1 or 2, wherein the antisense strand consists of a mismatch with the sense strand at nucleotide position 1 and 12 from the 5’ end of the antisense strand.
30. The dsRNA of claim 1 or 2, wherein the antisense strand consists of a mismatch with the sense strand at nucleotide position 1 and 13 from the 5’ end of the antisense strand.
31. The dsRNA of claim 1 or 2, wherein the antisense strand consists of a mismatch with the sense strand at nucleotide position 1 and 14 from the 5’ end of the antisense strand.
32. The dsRNA of claim 1 or 2, wherein the antisense strand consists of a mismatch with the sense strand at nucleotide position 1 and 15 from the 5’ end of the antisense strand.
33. The dsRNA of claim 1 or 2, wherein the antisense strand consists of a mismatch with the sense strand at nucleotide position 1 and 16 from the 5’ end of the antisense strand.
34. The dsRNA of claim 1, wherein the antisense strand consists of a mismatch with the sense strand at nucleotide position 11 and 2 from the 5’ end of the antisense strand.
35. The dsRNA of claim 1, wherein the antisense strand consists of a mismatch with the sense strand at nucleotide position 11 and 3 from the 5’ end of the antisense strand.
36. The dsRNA of claim 1, wherein the antisense strand consists of a mismatch with the sense strand at nucleotide position 11 and 4 from the 5’ end of the antisense strand.
37. The dsRNA of claim 1, wherein the antisense strand consists of a mismatch with the sense strand at nucleotide position 11 and 5 from the 5’ end of the antisense strand.
38. The dsRNA of claim 1, wherein the antisense strand consists of a mismatch with the sense strand at nucleotide position 11 and 6 from the 5’ end of the antisense strand.
39. The dsRNA of claim 1, wherein the antisense strand consists of a mismatch with the sense strand at nucleotide position 11 and 7 from the 5’ end of the antisense strand.
40. The dsRNA of claim 1, wherein the antisense strand consists of a mismatch with the sense strand at nucleotide position 11 and 8 from the 5’ end of the antisense strand.
41. The dsRNA of claim 1, wherein the antisense strand consists of a mismatch with the sense strand at nucleotide position 11 and 9 from the 5’ end of the antisense strand.
42. The dsRNA of claim 1, wherein the antisense strand consists of a mismatch with the sense strand at nucleotide position 11 and 10 from the 5’ end of the antisense strand.
43. The dsRNA of claim 1, wherein the antisense strand consists of a mismatch with the sense strand at nucleotide position 11 and 12 from the 5’ end of the antisense strand.
44. The dsRNA of claim 1, wherein the antisense strand consists of a mismatch with the sense strand at nucleotide position 11 and 13 from the 5’ end of the antisense strand.
45. The dsRNA of claim 1, wherein the antisense strand consists of a mismatch with the sense strand at nucleotide position 11 and 14 from the 5’ end of the antisense strand.
46. The dsRNA of claim 1, wherein the antisense strand consists of a mismatch with the sense strand at nucleotide position 11 and 15 from the 5’ end of the antisense strand.
47. The dsRNA of claim 1, wherein the antisense strand consists of a mismatch with the sense strand at nucleotide position 11 and 16 from the 5’ end of the antisense strand.
48. The dsRNA of any one of claims 1-47, wherein the antisense strand is 16 nucleotides to 25 nucleotides in length.
49. The dsRNA of any one of claims 1-48, wherein the sense strand is 15 nucleotides to 25 nucleotides in length.
50. The dsRNA of any one of claims 1-49, wherein the antisense strand is 20 nucleotides in length.
51. The dsRNA of any one of claims 1-49, wherein the antisense strand is 21 nucleotides in length.
52. The dsRNA of any one of claims 1-49, wherein the antisense strand is 22 nucleotides in length.
53. The dsRNA of any one of claims 1-52, wherein the sense strand is 15 nucleotides in length.
54. The dsRNA of any one of claims 1-52, wherein the sense strand is 16 nucleotides in length.
55. The dsRNA of any one of claims 1-52, wherein the sense strand is 18 nucleotides in length.
56. The dsRNA of any one of claims 1-52, wherein the sense strand is 20 nucleotides in length.
57. The dsRNA of any one of claims 1-56, comprising a double-stranded region of 15 base pairs to 20 base pairs.
58. The dsRNA of any one of claims 1-57, comprising a double-stranded region of 15 base pairs.
59. The dsRNA of any one of claims 1-57, comprising a double-stranded region of 16 base pairs.
60. The dsRNA of any one of claims 1-57, comprising a double-stranded region of 18 base pairs.
61. The dsRNA of any one of claims 1-57, comprising a double-stranded region of 20 base pairs.
62. The dsRNA of any one of claims 1-61, wherein the dsRNA comprises at least one blunt-end.
63. The dsRNA of any one of claims 1-62, wherein the dsRNA comprises at least one single stranded nucleotide overhang.
64. The dsRNA of claim 63, wherein the dsRNA comprises about a 2-nucleotide to 5- nucleotide single stranded nucleotide overhang.
65. The dsRNA of claim 63, wherein the dsRNA comprises 2-nucleotide single stranded nucleotide overhang.
66. The dsRNA of claim 63, wherein the dsRNA comprises 5-nucleotide single stranded nucleotide overhang.
67. The dsRNA of any one of claims 1-66, wherein the dsRNA comprises naturally occurring nucleotides.
68. The dsRNA of any one of claims 1-67, wherein the dsRNA comprises at least one modified nucleotide.
69. The dsRNA of claim 68, wherein said modified nucleotide comprises a 2'-O-methyl modified nucleotide, a 2'-deoxy-2'-fluoro modified nucleotide, a 2'-deoxy -modified nucleotide, a locked nucleotide, an abasic nucleotide, a 2'-amino-modified nucleotide, a 2'-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, a non-natural base comprising nucleotide, or a mixture thereof.
70. The dsRNA of claim 68, wherein said modified nucleotide comprises a 2'-O-methyl modified nucleotide, a 2'-deoxy-2'-fluoro modified nucleotide, an unlocked nucleic acid (UNA) modified nucleotide, an abasic nucleotide, or a mixture thereof.
71. A double stranded RNA (dsRNA) comprising a sense strand and an antisense strand, each strand having a 5’ end and a 3’ end, wherein: the antisense strand comprises a nucleotide sequence of UAGCACCAUUUGAAAUCAGUG (SEQ ID NO: 1) , or a chemically modified variant thereof, and the sense strand is substantially complementary to the antisense strand and comprises at least one destabilizing nucleotide.
72. The dsRNA of claim 71, wherein the at least one destabilizing nucleotide is an unlocked nucleic acid (UNA) modified nucleotide, an abasic nucleotide, or a mixture thereof.
74. The dsRNA of claim 72, wherein the abasic nucleotide is a dSpacer (1,2'- dideoxyribose) nucleotide.
75. The dsRNA of any one of claims 71-74, wherein the at least one destabilizing nucleotide is at position 6 from the 5’ end of the sense strand.
76. The dsRNA of any one of claims 71-75, wherein the at least one destabilizing nucleotide is at position 9 from the 5’ end of the sense strand.
77. The dsRNA of any one of claims 71-76, wherein the at least one destabilizing nucleotide is at position 1 from the 5’ end of the sense strand.
78. The dsRNA of any one of claims 71-77, wherein the at least one destabilizing nucleotide is at position 2 from the 5’ end of the sense strand.
79. The dsRNA of any one of claims 71-78, wherein the at least one destabilizing nucleotide is at position 3 from the 5’ end of the sense strand.
80. The dsRNA of any one of claims 71-79, wherein the at least one destabilizing nucleotide is at position 4 from the 5’ end of the sense strand.
81. The dsRNA of any one of claims 71-80, wherein the at least one destabilizing nucleotide is at position 5 from the 5’ end of the sense strand.
82. The dsRNA of any one of claims 71-81, wherein the at least one destabilizing nucleotide is at position 7 from the 5’ end of the sense strand.
83. The dsRNA of any one of claims 71-82, wherein the at least one destabilizing nucleotide is at position 8 from the 5’ end of the sense strand.
84. The dsRNA of any one of claims 71-83, wherein the at least one destabilizing nucleotide is at position 10 from the 5’ end of the sense strand.
85. The dsRNA of any one of claims 71-84, wherein the at least one destabilizing nucleotide is at position 11 from the 5’ end of the sense strand.
86. The dsRNA of any one of claims 71-85, wherein the at least one destabilizing nucleotide is at position 12 from the 5’ end of the sense strand.
87. The dsRNA of any one of claims 71-86, wherein the at least one destabilizing nucleotide is at position 13 from the 5’ end of the sense strand.
88. The dsRNA of any one of claims 71-87, wherein the at least one destabilizing nucleotide is at position 14 from the 5’ end of the sense strand.
89. The dsRNA of any one of claims 71-88, wherein the at least one destabilizing nucleotide is at position 15 from the 5’ end of the sense strand.
90. The dsRNA of any one of claims 71-89, wherein the at least one destabilizing nucleotide is at position 16 from the 5’ end of the sense strand.
91. The dsRNA of any one of claims 1-90, wherein the dsRNA comprises at least one modified internucleotide linkage.
92. The dsRNA of claim 91, wherein said modified internucleotide linkage comprises a phosphorothioate intemucleotide linkage.
93. The dsRNA of any one of claims 1-93, comprising 4-16 phosphorothioate internucleotide linkages.
94. The dsRNA of any one of claims 1-94, comprising 8-13 phosphorothioate internucleotide linkages.
95. The dsRNA of any one of claims 1-95, wherein the antisense strand comprises 2-10 phosphorothioate intemucleotide linkages.
96. The dsRNA of any one of claims 1-96, wherein the dsRNA comprises at least one modified internucleotide linkage of Formula I:(i); wherein:B is a base pairing moiety;W is selected from the group consisting of O, OCH2, OCH, CH2, and CH;X is selected from the group consisting of halo, hydroxy, and C1-6 alkoxy;Y is selected from the group consisting of O , OH, OR, NH , NH2, S", and SH;Z is selected from the group consisting of O and CH2;R is a protecting group; and= is an optional double bond.
97. The dsRNA of claim 96, wherein W is OCH2 and Z is O.
98. The dsRNA of claim 96 or 97, wherein the antisense strand comprises at least one modified internucleotide linkage of Formula I.
99. The dsRNA of any one of claims 96-98, wherein the antisense strand comprises the modified internucleotide linkage of Formula I at the antisense strand 3’ end.
100. The dsRNA of any one of claims 96-99, wherein the antisense strand comprises 2 to 5 modified intemucleotide linkages of Formula I at the antisense strand 3’ end.
101. The dsRNA of any one of claims 96-100, wherein the modified intemucleotide linkage of Formula (I) is a modified internucleotide linkage of Formula VI:
102. The dsRNA of any one of claims 1-101, wherein the dsRNA comprises at least 80% chemically modified nucleotides.
103. The dsRNA of any one of claims 1-102, wherein the dsRNA is fully chemically modified.
104. The dsRNA of any one of claims 1-103, wherein the dsRNA comprises at least 70% 2’-O-methyl nucleotide modifications.
105. The dsRNA of any one of claims 1-104, wherein the antisense strand comprises at least 70% 2’-O-methyl nucleotide modifications.
106. The dsRNA of any one of claims 1-105, wherein the antisense strand comprises about 70% to 90% 2’-O-methyl nucleotide modifications.
107. The dsRNA of any one of claims 1-106, wherein the sense strand comprises at least 65% 2’-O-methyl nucleotide modifications.
108. The dsRNA of any one of claims 1-107, wherein the sense strand comprises 100% 2’-O-methyl nucleotide modifications.
109. The dsRNA of any one of claims 1-108, wherein the antisense strand comprises a 5’ phosphate, a 5 ’-alkyl phosphonate, a 5’ alkylene phosphonate, or a 5’ alkenyl phosphonate.
110. The dsRNA of claim 109, wherein the antisense strand comprises a 5’ vinyl phosphonate.
111. The dsRNA of any one of claims 1-110, wherein a functional moiety is linked to the 5’ end and / or 3’ end of the antisense strand.
112. The dsRNA of any one of claims 1-111, wherein a functional moiety is linked to the 5’ end and / or 3’ end of the sense strand.
113. The dsRNA of any one of claims 1-112, wherein a functional moiety is linked to the 3’ end of the sense strand.
114. The dsRNA of any one of claims 111-113, wherein the functional moiety comprises a hydrophobic moiety.
115. The dsRNA of claim 114, wherein the hydrophobic moiety is selected from the group consisting of fatty acids, steroids, secosteroids, lipids, gangliosides, nucleoside analogs, endocannabinoids, vitamins, and a mixture thereof.
116. The dsRNA of claim 115, wherein the steroid selected from the group consisting of cholesterol and lithocholic acid (LA).
117. The dsRNA of claim 115, wherein the fatty acid selected from the group consisting of Eicosapentaenoic acid (EP A), Docosahexaenoic acid (DHA) and Docosanoic acid (DCA).
118. The dsRNA of claim 115, wherein the vitamin is selected from the group consisting of choline, vitamin A, vitamin E, and derivatives or metabolites thereof.
119. The dsRNA of claim 115, wherein the vitamin is selected from the group consisting of retinoic acid and alpha-tocopheryl succinate.
120. The dsRNA of any one of claims 111-113, wherein the functional moiety comprises anN-acetylgalactosamine (GalNAc) moiety.
121. The dsRNA of any one of claims 111-120, wherein the functional moiety is linked to the antisense strand and / or sense strand by a linker.
122. The dsRNA of claim 121, wherein the linker comprises an ethylene glycol chain, an alkyl chain, a peptide, an RNA, a DNA, a phosphodiester, a phosphorothioate, a phosphoramidate, an amide, a carbamate, or a combination thereof.
123. The dsRNA of claim 121 or 122, wherein the linker comprises a divalent or trivalent linker.
124. The dsRNA of claim 123, wherein the divalent or trivalent linker is selected from the group consisting of:wherein n is 1, 2, 3, 4, or 5.
125. The dsRNA of claim 124, wherein when the linker is a trivalent linker, the linker further links a phosphodiester or phosphodiester derivative.
126. The dsRNA of claim 125, wherein the phosphodiester or phosphodiester derivative is selected from the group consisting of:ndwherein X is O, S or BH3.
127. The dsRNA of any one of claims 1-126, wherein the nucleotides at positions 1 and 2 from the 3’ end of sense strand, and the nucleotides at positions 1 and 2 from the 5’ end of antisense strand are connected to adjacent ribonucleotides via phosphorothioate linkages.
128. The dsRNA of any one of claims 1-127, wherein the sense strand comprises or consists of AUUUCCAAUGGUGCUU (SEQ ID NO: 2), or a chemically modified variant thereof.
129. The dsRNA of any one of claims 1-127, wherein the sense strand comprises or consists of AUUUCAAACGGUGCUU (SEQ ID NO: 3), or a chemically modified variant thereof.
130. The dsRNA of any one of claims 1-127, wherein the sense strand comprises or consists of AUUUCAAAUGGUGCUA (SEQ ID NO: 4), or a chemically modified variant thereof.
131. The dsRNA of claim 1, wherein the antisense strand comprises or consists of V(mU)#(fA)#(mG)(fC)(mA)(fC)(mC)(fA)(mU)(fU)(mU)(fG)(mA)(fA)#(mA)#(fU)#(mC)#(f A)#(mG)#(fU)#(mG) (SEQ ID NO: 5), wherein “m” corresponds to a 2'-O-methyl modified nucleotide, “f” corresponds to a 2'-deoxy-2'-fluoro modified nucleotide, “#” corresponds to aphosphorothioate modified intemucleotide linkage, and “V” corresponds to a 5’ vinyl phosphonate.
132. The dsRNA of claim 1, wherein the antisense strand comprises or consists of V(mU)#(fA)#(mG)(fC)(fA)(fC)(mC)(fA)(mU)(fU)(mU)(fG)(mA)(fA)#(mA)#(fU)#(mC)#(m A)#(mG)#(fU)#(mG) (SEQ ID NO: 6), wherein “m” corresponds to a 2'-O-methyl modified nucleotide, “f ’ corresponds to a 2'-deoxy-2'-fluoro modified nucleotide, “#” corresponds to a phosphorothioate modified intemucleotide linkage, and “V” corresponds to a 5’ vinyl phosphonate.
133. The dsRNA of claim 1, wherein the antisense strand comprises or consists of V(mU)#(fA)#(mG)(fC)(fA)(fC)(mC)(fA)(mU)(fU)(mU)(fG)(mA)(fA)#(mA)#(fU)#(mC)#(m A)#(mG)#(fU)#(mU) (SEQ ID NO: 7), wherein “m” corresponds to a 2'-O-methyl modified nucleotide, “f ’ corresponds to a 2'-deoxy-2'-fluoro modified nucleotide, “#” corresponds to a phosphorothioate modified intemucleotide linkage, and “V” corresponds to a 5’ vinyl phosphonate.
134. The dsRNA of any one of claims 1 and 131, wherein the sense strand comprises or consi sts of (m A)#(fU)#(mU)(fU)(mC)(fC)(m A)(f A)(mU)(fG)(mG)(fU)(mG)(fC)#(mU)#(fU) (SEQ ID NO: 8), wherein “m” corresponds to a 2'-O-methyl modified nucleotide, “f’ corresponds to a 2'-deoxy-2'-fluoro modified nucleotide, and “#” corresponds to a phosphorothioate modified intemucleotide linkage.
135. The dsRNA of any one of claims 1, 132, and 133, wherein the sense strand comprises or consists of(mA)#(mU)#(mU)(fU)(mC)(fC)(mA)(fA)(mU)(fG)(mG)(mU)(mG)(fC)#(mU)#(mU) (SEQ ID NO: 9), wherein “m” corresponds to a 2'-O-methyl modified nucleotide, “f ’ corresponds to a 2'-deoxy-2'-fluoro modified nucleotide, and “#” corresponds to a phosphorothioate modified intemucleotide linkage.
136. The dsRNA of any one of claims 1 and 131, wherein the sense strand comprises or consi sts of (m A)#(fU)#(mU)(fU)(mC)(fA)(m A)(fA)(mC)(fG)(mG)(fU)(mG)(fC)#(mU)#(fU) (SEQ ID NO: 10), wherein “m” corresponds to a 2'-O-m ethyl modified nucleotide, “f’corresponds to a 2'-deoxy-2'-fluoro modified nucleotide, and “#” corresponds to a phosphorothioate modified intemucleotide linkage.
137. The dsRNA of any one of claims 1, 132, and 133, wherein the sense strand comprises or consists of(mA)#(mU)#(mU)(fU)(mC)(fA)(mA)(fA)(mC)(fG)(mG)(mU)(mG)(fC)#(mU)#(mU) (SEQ ID NO: 11), wherein “m” corresponds to a 2'-O-methyl modified nucleotide, “f’ corresponds to a 2'-deoxy-2'-fluoro modified nucleotide, and “#” corresponds to a phosphorothioate modified internucleotide linkage.
138. The dsRNA of any one of claims 1 and 131, wherein the sense strand comprises or consi sts of (m A)#(fU)#(mU)(fU)(mC)(fA)(m A)(fA)(mU)(fG)(mG)(fU)(mG)(fC)#(mU)#(fA) (SEQ ID NO: 12), wherein “m” corresponds to a 2'-O-m ethyl modified nucleotide, “f’ corresponds to a 2'-deoxy-2'-fluoro modified nucleotide, and “#” corresponds to a phosphorothioate modified intemucleotide linkage.
139. The dsRNA of any one of claims 1, 132, and 133, wherein the sense strand comprises or consists of(mA)#(mU)#(mU)(fU)(mC)(fA)(mA)(fA)(mU)(fG)(mG)(mU)(mG)(fC)#(mU)#(mA) (SEQ ID NO: 13), wherein “m” corresponds to a 2'-O-methyl modified nucleotide, “f’ corresponds to a 2'-deoxy-2'-fluoro modified nucleotide, and “#” corresponds to a phosphorothioate modified intemucleotide linkage.
140. A pharmaceutical composition comprising the dsRNA of any one of claims 1-139 and a pharmaceutically acceptable carrier.
141. A method of treating or preventing a fibrotic disease or disorder comprising administering to a patient in need of such treatment a therapeutically effective amount of the dsRNA of any one of claims 1-139.
142. The method of claim 141, wherein the fibrotic disease or disorder is selected from the group consisting of pulmonary fibrosis, cystic fibrosis, liver fibrosis, cirrhosis, myocardial fibrosis, arterial stiffness, arthrofibrosis, ocular fibrosis, tendinopathy, renal fibrosis,Dupuytren’s contractures, cutaneous fibrosis, fibrosis caused by inflammatory bowel disease, fibrosis caused by osteoarthritis, and metabolic dysfunction-associated steatohepatitis (MASH).
143. A branched RNA compound comprising two or more of the dsRNA of any one of claims 1-139 covalently bound to one another.
144. The branched RNA compound of claim 143, wherein the dsRNA are covalently bound to one another by way of a linker, spacer, or branching point.
145. The branched RNA compound of claim 143 or 144, wherein the branched RNA compound comprises the structure:Oigonucleotide— OligonucleotideOH (dimer);wherein “oligonucleotide” corresponds to either the sense strand or antisense strand.
146. The branched RNA compound of claim 145, wherein the sense strand 3’ end, the sense strand 5’ end, the antisense strand 3’ end, or the antisense strand 5’ end are covalently bound to one another by way of a linker, spacer, or branching point.
147. A pharmaceutical composition comprising the branched RNA compound of any one of claims 143-146 and a pharmaceutically acceptable carrier.
148. A method of treating or preventing a fibrotic disease or disorder comprising administering to a patient in need of such treatment a therapeutically effective amount of the branched RNA compound of any one of claims 143-146.
149. The method of claim 148, wherein the fibrotic disease or disorder is selected from the group consisting of pulmonary fibrosis, cystic fibrosis, liver fibrosis, cirrhosis, myocardial fibrosis, arterial stiffness, arthrofibrosis, ocular fibrosis, tendinopathy, renal fibrosis, Dupuytren’s contractures, cutaneous fibrosis, fibrosis caused by inflammatory bowel disease, fibrosis caused by osteoarthritis, and metabolic dysfunction-associated steatohepatitis (MASH).
150. A composition comprising the dsRNA of any one of claims 1-139 and an oligonucleotide with a sequence sufficiently complementary to a NADPH oxidase-4 (NOX-4) nucleic acid sequence.
151. The composition of claim 150, wherein the oligonucleotide with a sequence sufficiently complementary to a. NOX-4 nucleic acid sequence is an antisense oligonucleotide (ASO).
152. The composition of claim 150, wherein the oligonucleotide with a sequence sufficiently complementary to a.NOX-4 nucleic acid sequence is a dsRNA comprising a sense strand and an antisense strand, each strand having a 5’ end and a 3’ end, wherein the antisense strand comprises a nucleotide sequence sufficiently complementary to the NOX-4 nucleic acid sequence.
153. The composition of any one of claims 150-152, wherein the oligonucleotide comprises a sequence sufficiently complementary to any one of the NOX-4 nucleic acid sequence target region sequences recited in Table 2, optionally wherein the oligonucleotide comprises a sequence sufficiently complementary to SEQ ID NO: 28 or SEQ ID NO: 29.
154. A branched RNA compound comprising the dsRNA of any one of claims 1-139 covalently bound to an oligonucleotide with a sequence sufficiently complementary to a NADPH oxidase-4 (NOX-4 nucleic acid sequence.
155. The composition of claim 154, wherein the oligonucleotide with a sequence sufficiently complementary to a NOX-4 nucleic acid sequence is an antisense oligonucleotide (ASO).
156. The composition of claim 154, wherein the oligonucleotide with a sequence sufficiently complementary to a. NOX-4 nucleic acid sequence is a dsRNA comprising a sense strand and an antisense strand, each strand having a 5’ end and a 3’ end, wherein the antisense strand comprises a nucleotide sequence sufficiently complementary to the NOX-4 nucleic acid sequence.
157. The composition of any one of claims 154-156, wherein the oligonucleotide comprises a sequence sufficiently complementary to any one of the NOX-4 nucleic acid sequence target region sequences recited in Table 2.
158. A branched RNA compound comprising at least a first dsRNA and a second dsRNA, each dsRNA comprising a sense strand and an antisense strand, each strand having a 5’ end and a 3’ end, wherein the antisense strand of the first dsRNA and the second dsRNA comprises UAGCACCAUUUGAAAUCAGUGUUUU (SEQ ID NO: 14), or a chemically modified variant thereof, and the sense strand of the first dsRNA and the second dsRNA comprises AACACUGUUUACAAAUGGUCCUA (SEQ ID NO: 15), or a chemically modified variant thereof, wherein the at least first dsRNA is covalently bound to the second dsRNA.
159. The branched RNA compound of claim 158, wherein the antisense strand comprises V(mU)#(fA)#(mG)(fC)(mA)(fC)(mC)(fA)(mU)(fU)(mU)(mG)(mA)(fA)(mA)(fU)(mC)(fA)( mG)(fU)(mG)(fU)(mU)#(mU)#(mU) (SEQ ID NO: 16), and the sense strandC0mprises(fA)#(mA)#(fC)(mA)(fC)(mU)(fG)(mU)(fU)(mU)(fA)(fC)(fA)(mA)(fA)(mU)(fG)( mG)(fU)(mC)(fC)(mU)(fA) (SEQ ID NO: 17), wherein “m” corresponds to a 2'-O-methyl modified nucleotide, “f” corresponds to a 2'-deoxy-2'-fluoro modified nucleotide, “#” corresponds to a phosphorothioate modified internucleotide linkage, and “V” corresponds to a 5’ vinyl phosphonate.
160. The branched RNA compound of claim 158 or 159, wherein the dsRNA are covalently bound to one another by way of a linker, spacer, or branching point.
161. The branched RNA compound of any one of claims 158-160, wherein the branchedRNA compound comprises the structure:Oigonucleotide-O^^|^^O^^O^^O^^O^^O'oli9°nucleotideOH (dimer);wherein “oligonucleotide” corresponds to either the sense strand or antisense strand.
162. The branched RNA compound of any one of claims 158-161, wherein the sense strand 3’ end, the sense strand 5’ end, the antisense strand 3’ end, or the antisense strand 5’ end are covalently bound to one another by way of a linker, spacer, or branching point.