Immunogenic compositions and methods for eliciting an immune response against clostridioides (clostridium) difficile

Abstract

The present invention relates to immunogenic compositions that comprise a Clostridioides difficile toxoid A and / or a C. difficile toxoid B, and an adjuvant, and methods of use thereof. The present invention further relates to methods for eliciting an enhanced immune response in a human against a C. difficile infection. The methods include administering to the human an effective dose of an immunogenic composition, which includes a C. difficile toxoid and an adjuvant, wherein the composition is administered two or three times.

Description

[0001]PC073139A IMMUNOGENIC COMPOSITIONS AND METHODS FOR ELICITING AN IMMUNE RESPONSE AGAINST CLOSTRIDIOIDES (CLOSTRIDIUM) DIFFICILE REFERENCE TO SEQUENCE LISTING The instant application contains a sequence listing which has been submittedelectronically in .xml format and is hereby incorporated by reference in its entirety. The .xmlfile, named “PC073139A Sequence Listing.xml”, was created on June 4, 2025, and is 2359KB in size. FIELD The present invention is directed to compositions and methods concerningClostridioides difficile toxoids and methods thereof.BACKGROUND Clostridioides difficile (C. difficile), formerly Clostridium difficile, is a Gram-positive anaerobic bacterium that is associated with gastrointestinal disease in humans. Colonization of C. difficile usually occurs in the colon if the natural gut flora is diminished by treatment with antibiotics. An infection can lead to antibiotic-associated diarrhea and sometimes pseudomembranous colitis through the secretion of the glucosylating toxins, toxin A and toxin B (approximately 308 and 270 kDa, respectively), which are the primary virulence factors of C. difficile. In the last decade, the numbers and severity of C. difficile outbreaks in hospitals,nursing homes, and other long-term care facilities increased dramatically. Key factors in this escalation include emergence of hypervirulent pathogenic strains, increased use of antibiotics, improved detection methods, and increased exposure to airborne spores in health care facilities. The increasing burden of C. difficile infection (CDI) on patients and on the healthcaresystem demonstrates that prevention of CDI constitutes a significant unmet medical need. To date, there is no approved vaccine to prevent primary or recurrent CDI, and treatment optionsare non-optimal. Thus, there is a need for efficacious C. difficile vaccines for the prevention ofCDI. SUMMARY OF THE INVENTION The present invention provides for methods of eliciting an immune response in a humansubject against Clostridioides difficile (C. difficile), the method comprising administering to ahuman subject at least a first dose and a second dose of an immunogenic compositiondescribed herein comprising a C. difficile toxoid A and / or C. difficile toxoid B, and a CpGadjuvant or saponin containing liposomal adjuvant. The present invention further provides for methods of preventing, reducing, treating orameliorating a C. difficile infection in a human subject, the method comprising administeringto a human subject at least a first dose and a second dose of an immunogenic compositiondescribed herein comprising a C. difficile toxoid A and / or C. difficile toxoid B, and a CpGadjuvant or saponin containing liposomal adjuvant. In one aspect, the second dose is administered about 1 month after the first dose (M 0,1). In one aspect, the second dose is administered about 2 months after the first dose (M 0,2). In another aspect, the second dose is administered about 6 months after the first dose (M0, 4). In another aspect, the second dose is administered about 6 months after the first dose(M 0, 6). In one aspect, the second dose is administered about 12 months after the first dose(M 0, 12). In some aspects, an immune response is elicited and comprises neutralizing antibodiesagainst C. difficile toxin A and / or neutralizing antibodies against C. difficile toxin B, whereinthe neutralizing antibody concentration (e.g. GMCs, GMFRs and / or percentage of subjectswith at least a 4-fold rise (≥4-fold rise) in C. difficile toxin A and / or toxin B neutralizing antibodyconcentrations) elicited against C. difficile toxin A and / or B is higher after administration of 2doses of the immunogenic composition compared to the neutralizing antibody concentrationelicited against C. difficile toxin A and / or B after administration of 3 doses of an Al(OH)3-containing a C. difficile vaccine.The present invention further provides for at least one additional dose or booster dose administered after the second dose, e.g. about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,16, 17, 18 months, 2, 2.5, 3, 3.5, 4, 4.5 or 5 years or later after the second dose. The presentinvention further provides for the administration of the additional dose or booster dose after the second dose within a flexible time period, such as within a 2, 3, 4, 5 or 6 month or longer time period. For example, a first and second dose is administered at Month 0 and 2 and the additional or booster dose is administered between Months 4-6. In some aspects, the GMCs of C. difficile toxin A and / or toxin B neutralizing antibodiesat 1 month after the booster dose are higher compared to the GMCs of C. difficile toxin Aand / or toxin B neutralizing antibodies at 1 month after the first dose and / or 1 month after thesecond dose. In some aspects, the GMFRs in C. difficile toxin A and / or toxin B neutralizingantibodies from baseline to 1 month after the booster dose are higher compared to the GMFRsin C. difficile toxin A and / or toxin B neutralizing antibodies from baseline to 1month after thefirst dose and / or 1 month after the second dose. In some aspects, the percentage of subjectswith at least a 4-fold rise in C. difficile toxin A and / or toxin B neutralizing antibody concentrations is at least 5, 10, 20, 30, 40, 50, 60, 70, 80, 90% or higher from baseline to 1 month after the booster dose and / or at least 5, 10, 20, 30, 40, 50, 60, 70, 80, 90% or higher from before the booster dose to 1 month after the booster dose. The present invention further provides for methods of eliciting an immune response in ahuman subject against Clostridioides difficile (C. difficile), the method comprisingadministering to a human subject at least a first dose, a second dose and a third dose of animmunogenic composition described herein comprising a C. difficile toxoid A and / or C. difficiletoxoid B, and a CpG adjuvant or saponin containing liposomal adjuvant.The present invention further provides for methods of preventing, reducing, treating orameliorating a C. difficile infection in a human subject, the method comprising administeringto a human subject at least a first dose, a second dose and a third dose of an immunogeniccomposition described herein comprising a C. difficile toxoid A and / or C. difficile toxoid B, anda CpG adjuvant or saponin containing liposomal adjuvant. In one aspect, the second dose is administered about 1 month after the first dose and the third dose is administered about 6 months after the first dose (e.g. M 0, 1 and 6). In one aspect, the second dose is administered about 2 months after the first dose and the third dose is administered about 6 months after the first dose (e.g. M 0, 2 and 6). In one aspect, thesecond dose is administered about 4 months after the first dose and the third dose isadministered about 12 months after the first dose (M 0, 4 and 12). In one aspect, the seconddose is administered about 2 months after the first dose and the third dose is administeredabout 15 months after the first dose (e.g. M 0, 2 and 15). In some aspects, an immune response is elicited and comprises neutralizing antibodiesagainst C. difficile toxin A and / or neutralizing antibodies against C. difficile toxin B, whereinthe neutralizing antibody concentration (e.g. GMCs, GMFRs and / or percentage of subjects with at least a 4-fold rise in C. difficile toxin A and / or toxin B neutralizing antibodyconcentrations) elicited against C. difficile toxin A and / or B is higher after administration of 3doses of the immunogenic composition compared to the neutralizing antibody concentrationelicited against C. difficile toxin A and / or B after administration of 3 doses of an Al(OH)3-containing a C. difficile vaccine.The present invention further provides for at least one additional dose or booster dose administered after the third dose, e.g.1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18months, 2, 2.5, 3, 3.5, 4, 4.5 or 5 years or later after the third dose. The present inventionfurther provides for the administration of the additional or booster dose after the third dose within a flexible time period, such as within a 2, 3, 4, 5 or 6 month or longer time period. Forexample, a first, second and third dose is administered at Month 0, 2 and 6 and the additionalor booster dose is administered between Months 8-10. In one aspect, the GMCs of C. difficile toxin A and / or toxin B neutralizing antibodies at 1month after the booster dose are higher compared to the GMCs of C. difficile toxin A and / or toxin B neutralizing antibodies 1 month after the first dose, 1 month after the second doseand / or 1 month after the third dose. In one aspect, the GMFRs in C. difficile toxin A and / ortoxin B neutralizing antibodies from baseline to 1 month after the booster dose are highercompared to the GMFRs in C. difficile toxin A and / or toxin B neutralizing antibodies frombaseline to 1 month after the first dose, 1 month after the second dose and / or 1 month afterthe third dose. In one aspect, the percentage of subjects with at least a 4-fold rise in C. difficiletoxin A and / or toxin B neutralizing antibody concentrations is at least 5, 10, 20, 30, 40, 50, 60, 70, 80, 90% or higher from baseline to 1 month after the booster dose 5, 10, 20, 30, 40, 50, 60, 70, 80, 90% or higher from before the booster dose to 1 month after the booster dose. In one aspect, at least one additional dose or booster dose is administered about every year or as generally needed prior to prior to undergoing surgery, entering a long-term care facility, initiating immunosuppressive therapy (chemotherapy, transplantation, etc.) or other events which would put an individual at increased risk of C. difficile infection. In one aspect, the C. difficile infection is a primary C. difficile infection. In one aspect,the C. difficile infection is medically attended C. difficile infection and / or clinically meaningfulC. difficile infection. In another aspect, the C. difficile infection is medically attended primaryC. difficile infection and / or clinically meaningful primary C. difficile infection. In one aspect, thehuman subject is an adult. In one aspect, the human subject is 18 years of age or older, 50years of age or older, 55 years of age or older, 60 years of age or older, 65 years of age orolder, 70 years of age or older, 75 years of age or older, 80 years of age or older or 85 yearsof age or older. In one aspects, the CpG adjuvant comprises about 0.1 to 5 mg / mL or higher, about 0.1to about 1.0 mg / mL, about 0.5 to about 1.5 mg / mL, about 0.8 to about 1.8 mg / mL, or about3.0 to about 4.0 mg / mL CpG. In some aspects, the CpG adjuvant comprises about 0.5 mg / mL,about 1.0 mg / mL, about 1.2 mg / mL, or about 3.6 mg / mL CpG. In some aspects, the CpGadjuvant comprises about 3.6 mg / mL CpG. In some aspects, the CpG adjuvant comprisesabout 3.6 mg / mL CpG alone, without an additional adjuvant. In one aspect, the CpG adjuvantcomprises about 3.6 mg / mL CpG alone, without aluminum hydroxide (Al(OH)3. In one aspect,the CpG adjuvant comprises CpG 24555 (SEQ ID NO: 48). In a preferred aspect, the CpGadjuvant comprises about 3.6 mg / mL CpG 24555. In a preferred aspect, the CpG adjuvantcomprises about 3.6 mg / mL CpG 24555, without aluminum hydroxide (Al(OH)3. In anotheraspect, the C. difficile toxoid A and / or toxoid B are lyophilized and reconstituted with a CpGadjuvant comprising about 0.1 to 5 mg / mL CpG 24555. In a preferred aspect, the C. difficiletoxoid A and / or toxoid B are lyophilized and reconstituted with a CpG adjuvant comprisingabout 3.6 mg / mL CpG 24555, without aluminum hydroxide (Al(OH)3.In another aspect, the CpG adjuvant comprises about 0.5 to about 3.6 mg / mL CpG andabout 0.1 to 5 mg / mL Al(OH)3. In a preferred aspect, the CpG adjuvant comprises the CpGadjuvant comprises CpG 24555 (SEQ ID NO: 48). In some aspects, the CpG adjuvantcomprises about 1.0 mg / mL CpG 24555 and about 1.5 mg / mL of Al(OH)3. In some aspects,the C. difficile toxoid A and / or toxoid B are lyophilized and reconstituted with a CpG adjuvantcomprising about 0.5 to about 3.6 mg / mL CpG and about 0.1 to 5 mg / mL Al(OH)3. In apreferred aspect, the CpG adjuvant comprises the lyophilized C. difficile toxoid A and / or toxoidB are reconstituted with a CpG adjuvant comprising about 1.0 mg / mL CpG 24555 and about 1.5 mg / mL Al(OH)3. In one aspect, the CpG adjuvant comprises a histidine or phosphate buffer. In oneaspect, the CpG adjuvant comprises sodium chloride.In another aspect, the saponin containing liposomal adjuvant comprises a saponin anda monophosphoryl lipid A (MPLA)-containing liposome composition, wherein the liposomecomposition comprises i) a lipid bilayer comprising phospholipids and ii) cholesterol. In someaspects, the saponin containing liposomal adjuvant comprises: about 0.1 to about 0.4 mg / mLof QS-21, preferably about 0.2 mg / mL of QS-21; about 0.2 to about 0.6 mg / mL of MPLA,preferably about 0.4 mg / mL of MPLA; about 5 to about 15 mg / mL of cholesterol, preferablyabout 11 mg / mL of cholesterol; about 5 to about 20 mg / mL of DMPC, preferably about 14mg / mL of DMPC; and / or about 1.0 to about 2.0 mg / mL of DMPG, preferably about 1.6 mg / mLof DMPG. In some aspects, the C. difficile toxoid A and / or toxoid B are lyophilized andreconstituted with a saponin containing liposomal adjuvant comprising about 0.1 to about 0.4 mg / mL of QS-21, about 0.2 to about 0.6 mg / mL of MPLA, about 5 to about 15 mg / mL of cholesterol, about 5 to about 20 mg / mL of DMPC and about 1.0 to about 2.0 mg / mL of DMPG.In a preferred aspect, the lyophilized C. difficile toxoid A and / or toxoid B are reconstituted witha saponin containing liposomal adjuvant comprising about 0.2 mg / mL QS-21, about 0.4 mg / mLMonophosphoryl 3-Deacyl Lipid A, about 14 mg / mL DMPC, about 1.6 mg / mL DMPG and about 11 mg / mL cholesterol. In one aspect, the saponin containing liposomal adjuvant comprises a histidine orphosphate buffer. In one aspect, the saponin containing liposomal adjuvant comprises sodiumchloride. The methods of the present invention further provide for immunogenic compositionscomprising a C. difficile toxoid A comprises the amino acid sequence of SEQ ID NO: 4, whereinthe initial methionine is absent. For example, the mutant C. difficile toxin A comprises theamino acid sequence set forth in SEQ ID NO: 84. In one aspect, the C. difficile toxoid Bcomprises the amino acid sequence of SEQ ID NO: 6, wherein the initial methionine is absent.For example, the mutant C. difficile toxin B comprises the amino acid sequence set forth inSEQ ID NO: 86. In one aspect, the immunogenic compositions comprise the C. difficile toxoid A and theC. difficile toxoid B in a ratio of about 3:1 to about 1:1. In one aspect, the immunogeniccompositions comprise 50-200 µg of toxoid. In a preferred aspect, the immunogeniccompositions comprise 200 µg of toxoid per dose. In one aspect, the immunogeniccompositions further comprise at least one of a buffer, a stabilizer, and a surfactant.In a preferred aspect, the composition is administered at a dose volume of 0.5 mL. In one aspect, the immunogenic composition comprises at least one additional C. difficiletoxin antigen or C. difficile toxoid. In one aspect, the at least one additional C. difficile toxinantigen is a toxin A protein, a toxin B protein, a binary toxin protein A (CDTa) and / or a binary toxin protein B (CDTb), or mutant or toxoid or thereof. In one aspect, the immunogenic composition is co-administered (concomitantly orconcurrently) with another vaccine, such as a pneumococcal vaccine, a respiratory syncytialvirus (RSV) vaccine, a human metapneumovirus (hMPV) vaccine, a betacoronavirus vaccine, a meningococcal vaccine, a varicella zoster virus (VZV) vaccine, an influenza vaccine, a human cytomegalovirus (hCMV) vaccine, an Escherichia coli (E. coli) vaccine, aPseudomonas aeruginosa vaccine, a Klebsiella pneumoniae vaccine, an Epstein-Barr virus(EBV) vaccine, a Group B Streptococcus (GBS) vaccine and / or a tetanus vaccine, diphtheriavaccine, pertussis vaccine (e.g. Tdap), or other vaccine for an infectious disease, such as ahospital-acquired or healthcare-associated infection. BRIEF DESCRIPTION OF THE DRAWINGSFIG.1 shows the neutralization titers of individual animals (NHPs) immunized with C. difficiletoxoid antigens formulated with LiNA-2 adjuvant (2 doses and 3 doses) compared toformulations with aluminum hydroxide (Al(OH)3) (3 doses). Formulation of toxoid antigenswith LiNA-2 elicits a robust and more rapid immune response able to neutralize TcdB cytotoxicity after 2 doses compared to 3 doses formulated with Al(OH)3.FIG.2 shows the neutralization titers of individual animals (NHPs) immunized with C. difficiletoxoid antigens formulated with LiNA-2 adjuvant (2 doses - M 0, 2) or CpG adjuvantcombined with Al(OH)3 (2 doses - M 0, 2) compared to formulations with Al(OH)3 (3 doses).Formulation of toxoid antigens with either LiNA-2 or CpG / Al(OH)3 elicits robust and more rapid immune responses able to neutralize TcdB cytotoxicity after 2 doses (Month 0,2) compared to 3 doses (Month 0,1,6) formulated with Al(OH)3.FIG.3 shows the neutralization titers of individual animals (NHPs) immunized with C. difficiletoxoid antigens formulated with LiNA-2 adjuvant (2 doses - M 0, 6) or CpG adjuvantcombined with Al(OH)3 (2 doses - M 0, 6) compared to formulations with Al(OH)3 (3 doses).Formulation of toxoid antigens with either LiNA-2 or CpG / Al(OH)3 elicits robust and rapid immune responses able to neutralize TcdB cytotoxicity after 2 doses (Month 0,6) compared to 3 doses (Month 0,1,6) formulated with Al(OH)3.FIG.4 shows the neutralization titers of individual animals (NHPs) immunized with C. difficiletoxoid antigens with two levels of CpG adjuvant (0.5 or 1.0 mg / mL CpG) combined withAl(OH)3 (2 doses – M 0, 6) compared to formulations with Al(OH)3 (3 doses). Formulation oftoxoid antigens with CpG / Al(OH)3 elicits robust and rapid immune responses able to neutralize TcdB cytotoxicity after 2 doses (Month 0,6) compared to 3 doses (Month 0,1,6) formulated with Al(OH)3.FIG.5 shows the neutralization titers of individual animals (NHPs) immunized with C. difficiletoxoid antigens with CpG adjuvant alone (0.5 or 3.6 mg / mL CpG) or CpG adjuvant combinedwith Al(OH)3 at different levels of CpG (0.5, 1 or 3.6 mg / mL CpG) (2 doses - M 0, 2)compared to formulations with Al(OH)3 (3 doses). Formulation of toxoid antigens with eitherCpG or CpG / Al(OH)3 elicits robust and rapid immune responses able to neutralize TcdB cytotoxicity after 2 doses (Month 0,2) compared to 3 doses (Month 0,1,6) formulated with Al(OH)3. FIG.6 shows the neutralization titers of individual animals (rats) immunized with C. difficiletoxoid antigens formulated with different LiNA-2 adjuvants (homogeneous andheterogeneous).FIG.7 shows the relationship between the % toxoids binding and the mass ratio of theAl(OH)3 / CpG. DETAILED DESCRIPTION OF THE INVENTION The present invention provides for C. difficile adjuvanted vaccine formulationscontaining a CpG adjuvant or LiNA-2 adjuvant and optimized dosage regimens which areshown to elicit an improved immune response (more rapid rise in protective antibodies withmaintained durability) in a human subject when compared to an Al(OH)3-containing(“investigational”) vaccine formulation. The C. difficile adjuvanted vaccines resulted in higherfunctional antibody responses, specific to toxin A and / or toxin B, compared to the Al(OH)3-containing C. difficile vaccine 1 month after the last active dose. In particular, the C. difficileadjuvanted vaccine formulations containing a CpG adjuvant or LiNA-2 adjuvant elicited robusttoxin A and / or toxin B neutralizing antibody levels in human subjects (see GMCs, GMFRs andpercentage of subjects with at least a 4-fold rise in C. difficile toxin A and / or B neutralizingantibody concentrations described in Example 9).The investigational C. difficile vaccine drug product (also referred to as “PF-06425090”,“Al(OH)3-containing” or “Al(OH)3 formulation”, once reconstituted with Al(OH)3, herein)includes a mixture of genetically modified C. difficile toxoid A (TxdA), i.e., a polypeptidecomprising SEQ ID NO: 4, wherein the initial methionine is not present (for example SEQ IDNO: 84) and genetically modified C. difficile toxoid B (TxdB), i.e., a polypeptide comprisingSEQ ID NO: 6, wherein the initial methionine is not present (for example SEQ ID NO: 86) that were further chemically inactivated by 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide) (EDC) and N-Hydroxysuccinimide (NHS) to eliminate residual cytotoxicity but retain native antigenic structure and generate a neutralizing antibody response. The investigational C. difficilevaccine is presented as a sterile lyophilized powder with a 1:1 ratio of TxdA and TxdB, in adosage strength of 200 µg / dose (total dose for TxdA and TxdB) comprising 10 mM Tris bufferat pH 7.4, 4.5% (w / w) trehalose dihydrate, and 0.01% (w / v) polysorbate 80. Prior toimmunization, the lyophilized powder is reconstituted with 1 mg / mL aluminum as aluminumhydroxide (Al(OH)3) acting as an adsorbent / diluent for a 0.5 mL IM injection. The reconstitutedinvestigational C. difficile vaccine comprises tromethamine, Tris-HCl, trehalose dihydrate,polysorbate 80, sodium chloride and aluminum in the form of aluminum hydroxide. See WIPO Patent Application WO / 2012 / 143902, U.S. Patent No.9187536, and WIPO Patent Application WO / 2014 / 060898, which are each incorporated by reference herein in their respective entireties. The investigational C. difficile vaccine was designed to induce protective, functionaltoxin–neutralizing antibody responses against Toxin A (TcdA) and Toxin B (TcdB) fromclinically relevant and hypervirulent C. difficile strains. The vaccine is intended to preventinitial / primary C. difficile infection (CDI) episodes in subjects 50 years of age and older. The vaccine has been shown to be safe and well tolerated after a 3-dose regimen. Theinvestigational C. difficile vaccine has been evaluated in multiple clinical studies, including,B5091001, B5091002, B5091003, B5091007, B5091008, B5091009, B5091010, andB5091019. Studies B5091001, B5091009, B5091010, B5091008, B5091019 and B5091007assessed the C. difficile Al(OH)3-containing vaccine, Studies B5091001 and B5091003assessed the C. difficile vaccine toxoid-alone formulation (no Al(OH)3 or adjuvant), and StudyB5091002 assessed C. difficile vaccine QS-21-adjuvatned formulation. See also WIPO Patent Application WO / 2019 / 064115, WIPO Patent Application WO / 2020 / 201985, and WIPO Patent Application WO / 2021,255690, which are each incorporated by reference herein in their respective entireties. Study B5091001 is a first-in human Phase 1 study to assess the safety tolerability andimmunogenicity of a 3-dose regimen of C. difficile vaccine in healthy adults aged 50 to 85years as a 3-dose regimen at Months 0, 1 and 6. Three (3) antigen dose levels (50 µg, 100µg and 200 µg total toxoids) were assessed either alone or in combination with Al(OH)3. Theanalysis of safety demonstrated that both formulations and all 3 dose levels were generallywell tolerated. Overall, robust anti-toxin neutralizing responses were elicited by bothformulations, although there was a trend for greater responses in recipients of the toxoid-aloneformulation. Study B5091002 is a Phase 1 study initiated to investigate the safety, tolerability andimmunogenicity of a C. difficile vaccine adjuvanted with 50 µg QS-21 at a dose level of 100µg total toxoid, administered as a 3-dose regimen at either Days 1, 8, and 30 or Months 0, 1,and 3 to healthy adults 50 to 85 years of age. However, recruitment and vaccinations werehalted because of the occurrence of Grade 3 injection site redness after Dose 2 triggered aprotocol-defined stopping rule. Study B5091003 is a Phase 2 study initiated to assess the safety, tolerability, andimmunogenicity of a C. difficile vaccine toxoid-alone formulation reconstituted with sodiumchloride (60 mM) at 2 antigen dose levels (100 µg and 200 µg total toxoids), administered asa 3-dose regimen (Days 1, 8, and 30) to healthy adults aged 50 to 85 years of age. However,recruitment and vaccinations were halted because of the occurrence of Grade 3 injection siteredness after Dose 2. Following the observed tolerability profile in Study B5091003, thedecision was made to progress development of the Al(OH)3-containing formulation into asecond Phase 2 study, B5091009. Study B5091009 is a Phase 2 study to evaluate the safety tolerability and immunogenicity of 2 antigen dose levels (100 µg and 200 µg total toxoid) of the C. difficile Al(OH)3-containing vaccine administered as a 3-dose regimen either at Days 1, 8 and 30 or Months 0, 1 and 6 in healthy adults 65 to 85 years of age. The extension of this study assessed safety tolerability and persistence of neutralizing antibody titers against toxins A and b following a fourth dose (booster) of the C. difficile Al(OH)3-containing vaccine at the same antigen dose level as the participants received previously or placebo, approximately 1 year after the third dose. Results from the original planned stage of the study demonstrated that the 200-μg dose level was more immunogenic, as evidenced by numerically higher proportions of participants achieving antibody levels ≥ prespecified thresholds, GMCs, and GMFRs, than the 100-μg dose level in both dosing regimens. The month regimen resulted in numerically higher post-Dose 3 immune response for both the 100-μg and 200-μg dose levels, particularly for toxin B in participants who were seronegative at baseline. Overall, the C difficile vaccine was highly immunogenic, was well tolerated, and exhibited an acceptable safety profile. Study B5091010 is a first-in Japanese participants Phase 1 study to assess the safety tolerability and immunogenicity of 2 antigen dose levels of the C. difficile Al(OH)3-containing vaccine (100 µg and 200 µg total toxoid) in 2 different dosing regimens (Months 0, 1 and 6 or Days 1, 8 and 30) in healthy Japanese adults 65 to 85 years of age. The C difficile vaccine was well tolerated when administered in the 0-, 1 -, and 6-month regimen with no unexpected AEs observed in this regimen, indicating a favorable safety profile in this elderly population of healthy Japanese adults 65 to 85 years of age when administered in the month regimen. Therewere no notable differences between the 100- or 200-pg dose groups observed within eachregimen based on an evaluation of the proportion of participants reporting AEs, SAEs, or newly diagnosed chronic medical conditions (NDCMCs). Study B5091008 is a Phase 3 study to evaluate the lot consistency, safety, tolerability and immunogenicity of the C. difficile Al(OH)3-containing vaccine (200 µg total toxoid) administered as a 3-dose regimen at Months 0, 1, and 6 in healthy adults 65 to 85 years of age. Study B5091019 is a Phase 3 study to evaluate the immunogenicity, safety andtolerability of a 2-dose regimen (Months 0 and 6) of the C. difficile Al(OH)3-containing vaccinecompared to a 3-dose regimen (Months 0, 1 and 6) of the C. difficile Al(OH)3-containingvaccine in adults 50 years of age and older. Study B5091007 is a Phase 3 study to evaluate the efficacy, safety, and tolerability of the C. difficile Al(OH)3-containing vaccine (200 µg total toxoid) administered as a 3-doseregimen at Months 0, 1, and 6 in adults 50 years of age and above. The trial did not meet itspre-specified primary endpoint of prevention of primary CDI, however, for all CDI cases recorded at 14 days post dose 3, vaccine efficacy was 49%, 47% and 31% up to 12 months, 24 months and at final analysis, respectively. However, initial analyses of two protocol defined secondary endpoints indicated a highly favorable benefit in reducing CDI severity and 100% vaccine efficacy in preventing medically attended CDI. Safety reviews indicated that the investigational vaccine was safe and well tolerated. To date, there is no approved vaccine to prevent primary or recurrent CDI. Theinvestigational C. difficile vaccine reconstituted with Al(OH)3 administered at a 3-dose schedule(0, 1, 6-month) elicited a functional immune response required to protect from CDI, inparticular, to achieve sufficient toxin-neutralizing titers in subjects with low pre-vaccination toxinB neutralizing titers. The investigational C. difficile vaccine reconstituted with Al(OH)3 has beenshown to be safe and well tolerated and, after a 3-dose regimen, has shown encouraging efficacy data against CDI cases severe enough to require medical intervention. Thus, the present invention provides for C. difficile vaccines further comprising anadjuvant to enhance the magnitude, kinetics, and persistence of the anti-toxin immuneresponse to a C. difficile toxoid antigens.The present invention further provides for C. difficile vaccines comprising an adjuvantto enhance the immune response to the C. difficile toxoid antigens, in particular the immuneresponse to toxin B, and potentially reduce the number of doses (2 doses vs 3 doses) requiredto prevent CDI in humans. Further, a 2 dose schedule would likely increase vaccineadherence and provide an advantage for subjects who have transient risk of CDI.The present invention provides for C. difficile vaccines comprising an adjuvantadministered in a 2- or 3-dose regimen to improve the immune response to the C. difficiletoxoid antigens, in particular the immune response to toxin B, when compared to theinvestigational C. difficile vaccine formulated with Al(OH)3.As provided herein, the investigational C. difficile vaccine is formulated with differentadjuvants at various doses and compared to the investigational C. difficile vaccine formulatedwith Al(OH)3 as an adsorbent. The present invention provides for the investigational C. difficile vaccine, as describedherein, and further comprising an adjuvant. In particular, the present invention provides for theinvestigational C. difficile vaccine formulated with a CpG adjuvant, a CpG adjuvant incombination with Al(OH)3and / or a saponin containing liposomal adjuvant. In one aspect, the immunogenic compositions of the present invention comprisegenetically modified C. difficile toxoid A (TxdA), i.e., a polypeptide comprising SEQ ID NO: 4,wherein the initial methionine is not present (for example SEQ ID NO: 84) and geneticallymodified C. difficile toxoid B (TxdB), i.e., a polypeptide comprising SEQ ID NO: 6, wherein theinitial methionine is not present (for example SEQ ID NO: 86) at 200 µg / dose (total dose forTxdA and TxdB) with a 1:1 ratio of TxdA and TxdB, and an adjuvant. In one aspect, the adjuvant is a CpG adjuvant, which comprises at least one CpGoligonucleotide, preferably a CpG oligodeoxynucleotides (ODN). In one aspect the CpG is aB class CpG. In one aspect the CpG is CpG 24555, a 21-mer oligodeoxynucleotide TLR9agonist. In one aspect, the adjuvant comprises CpG alone, without an additional adjuvant. Inone aspect, the CpG is combined with aluminum hydroxide (Al(OH)3). In one aspect, the CpGadjuvant comprising CpG 24555 alone, or combined with aluminum hydroxide (Al(OH)3), isdesigned to reconstitute lyophilized the investigational C. difficile vaccine drug product foradministration. In one aspect, the immunogenic composition comprises about 0.1 to about 5 mg / mLCpG. In one aspect, the immunogenic composition comprises about 0.5, about 1.0 or about3.6 mg / mL CpG. In one aspect, the immunogenic composition comprises 0.5 mg / mL CpGalone, or combined with aluminum hydroxide (Al(OH)3). In one aspect, the immunogeniccomposition comprises 0.5 mg / mL CpG alone, without an additional adjuvant. In one aspect,the immunogenic composition comprises 0.5 mg / mL CpG combined with 1.0 mg / mL Al(OH)3.In one aspect, the immunogenic composition comprises 0.5 mg / mL CpG combined with 1.5mg / mL Al(OH)3.In one aspect, the immunogenic composition comprises 1.0 mg / mL CpG alone, orcombined with aluminum hydroxide (Al(OH)3). In one aspect, the immunogenic compositioncomprises 1.0 mg / mL CpG alone, without an additional adjuvant. In one aspect, theimmunogenic composition comprises 1.0 mg / mL CpG combined with 1.0 mg / mL Al(OH)3. Inone aspect, the immunogenic composition comprises 1.0 mg / mL CpG combined with 1.5mg / mL Al(OH)3.In one aspect, the immunogenic composition comprises 3.6 mg / mL CpG alone, orcombined with aluminum hydroxide (Al(OH)3). In one aspect, the immunogenic compositioncomprises 3.6 mg / mL CpG alone, without an additional adjuvant. In one aspect, theimmunogenic composition comprises 3.6 mg / mL CpG combined with 1.0 mg / mL Al(OH)3. Inone aspect, the immunogenic composition comprises 3.6 mg / mL CpG combined with 1.5mg / mL Al(OH)3. In one aspect, the immunogenic composition comprises 3.6 mg / mL CpGcombined with 1.8 mg / mL aluminum hydroxide Al(OH)3.In one aspect, the immunogenic composition comprises a CpG combined with about1.0, about 1.5, about 1.7, about 1.8, about 2.0, or about 2.5 mg / mL Al(OH)3.In a preferred aspect, the CpG adjuvant comprises CpG alone, without an additionaladjuvant. In a preferred aspect, the CpG adjuvant comprises CpG alone in a histidine bufferand sodium chloride (NaCl) at a pH of about 6.5. In a preferred aspect, the CpG adjuvantcomprises CpG alone in 10 mM histidine buffer and 60 mM sodium chloride (NaCl) at a pH ofabout 6.5. In a preferred aspect, the CpG adjuvant comprises 3.6 mg / mL CpG 24555 (i.e. high-dose CpG). In a preferred aspect, the CpG adjuvant comprises 3.6 mg / mL CpG 24555 alone(i.e. high-dose CpG). For example, the adjuvant comprises CpG 24555 alone, without anadditional adjuvant. In a preferred aspect, the CpG adjuvant comprises 3.6 mg / mL CpG 24555alone in a histidine buffer and sodium chloride (NaCl) at a pH of about 6.5. In a preferredaspect, the CpG adjuvant comprises 3.6 mg / mL CpG 24555 alone in 10 mM histidine bufferand 60 mM sodium chloride (NaCl) at a pH of about 6.5. In another preferred aspect, the CpG adjuvant comprises 1.0 mg / mL CpG 24555combined with 1.5 mg / mL Al(OH)3 (i.e. low-dose CpG). In another preferred aspect, the CpGadjuvant comprises 1.0 mg / mL CpG 24555 combined with 1.5 mg / mL Al(OH)3 in a histidinebuffer and sodium chloride (NaCl) at a pH of about 6.5. In another preferred aspect, the CpGadjuvant comprises 1.0 mg / mL CpG combined with 1.5 mg / mL Al(OH)3 in 10 mM histidinebuffer and 50 mM sodium chloride (NaCl) at a pH of about 6.5.In another preferred aspect, the CpG adjuvant comprises CpG combined with Al(OH)3in a histidine buffer and sodium chloride (NaCl) at a pH of about 6.5. In another preferredaspect, the CpG adjuvant comprises CpG combined with Al(OH)3 in 10 mM histidine bufferand 50 mM sodium chloride (NaCl) at a pH of about 6.5.The present invention provides for immunogenic compositions comprising geneticallymodified C. difficile toxoid A (TxdA), i.e., a polypeptide comprising SEQ ID NO: 4, wherein theinitial methionine is not present (for example SEQ ID NO: 84) and genetically modified C.difficile toxoid B (TxdB), i.e., a polypeptide comprising SEQ ID NO: 6, wherein the initialmethionine is not present (for example SEQ ID NO: 86) at 200 µg / dose (total dose for TxdAand TxdB) and a CpG adjuvant comprising CpG 24555. In one aspect, the immunogeniccomposition comprises 0.5, 1.0, or 3.6 mg / mL CpG 24555. In a preferred aspect, theimmunogenic composition comprises 3.6 mg / mL CpG 24555. In a preferred aspect, the immunogenic composition comprises 3.6 mg / mL CpG 24555 alone, without an additionaladjuvant. In a preferred aspect, the immunogenic composition comprises 3.6 mg / mL CpG24555 alone in a histidine buffer and sodium chloride (NaCl). In a preferred aspect, theimmunogenic composition comprises 3.6 mg / mL CpG 24555 alone in 10 mM histidine bufferand 60 mM sodium chloride (NaCl). In a preferred aspect, the immunogenic composition comprises the investigational C.difficile vaccine and 3.6 mg / mL CpG 24555. In a preferred aspect, the immunogeniccomposition comprises the investigational C. difficile vaccine and 3.6 mg / mL CpG 24555alone, without an additional adjuvant. In a preferred aspect, the lyophilized investigational C.difficile vaccine is reconstituted with 3.6 mg / mL CpG 24555 alone in a histidine buffer andsodium chloride (NaCl). In a preferred aspect, the lyophilized investigational C. difficile vaccineis reconstituted with 3.6 mg / mL CpG 24555 alone in a 10 mM histidine buffer and 60mMsodium chloride (NaCl). The present invention further provides for immunogenic compositions comprisinggenetically modified C. difficile toxoid A (TxdA), i.e., a polypeptide comprising SEQ ID NO: 4,wherein the initial methionine is not present (for example SEQ ID NO: 84) and geneticallymodified C. difficile toxoid B (TxdB), i.e., a polypeptide comprising SEQ ID NO: 6, wherein theinitial methionine is not present (for example SEQ ID NO: 86) at 200 µg / dose (total dose forTxdA and TxdB), a CpG adjuvant comprising CpG 24555 and aluminum hydroxide (Al(OH)3).In one aspect, the immunogenic composition comprises 0.5, 1.0, or 3.6 mg / mL CpG 24555and aluminum hydroxide (Al(OH)3). In one aspect, the immunogenic composition comprisesCpG 24555 and 1.0 or 1.5 mg / mL aluminum hydroxide Al(OH)3. In a preferred aspect, theimmunogenic composition comprises 1.0 mg / mL CpG 24555 and 1.5 mg / mL aluminumhydroxide (Al(OH)3). In a preferred aspect, the immunogenic composition comprises 1.0mg / mL CpG 24555 and 1.5 mg / mL Al(OH)3 in a histidine buffer and sodium chloride (NaCl).In a preferred aspect, the immunogenic composition comprises 1.0 mg / mL CpG 24555 and1.5 mg / mL Al(OH)3 in 10 mM histidine buffer and 50 mM sodium chloride (NaCl).In a preferred aspect, the immunogenic composition comprises the investigational C.difficile vaccine, 1.0 mg / mL CpG 24555 and 1.5 mg / mL aluminum hydroxide (Al(OH)3). In apreferred aspect, the lyophilized investigational C. difficile vaccine is reconstituted with 1.0mg / mL CpG 24555 and 1.5 mg / mL aluminum hydroxide (Al(OH)3) in a histidine buffercomprising sodium chloride (NaCl). In a preferred aspect, the lyophilized investigational C.difficile vaccine is reconstituted with 1.0 mg / mL CpG 24555 and 1.5 mg / mL aluminumhydroxide (Al(OH)3) in 10 mM histidine buffer and 50 mM sodium chloride (NaCl).In one aspect, an adjuvanted immunogenic composition of the present invention comprises a C. difficile toxoid A (TxdA) comprising SEQ ID NO: 4, wherein the initialmethionine is not present (for example SEQ ID NO: 84), and a C. difficile toxoid B (TxdB)comprising SEQ ID NO: 6, wherein the initial methionine is not present (for example SEQ IDNO: 86), and a CpG (e.g. CpG 24555) adjuvant alone or in combination with aluminum (e.g.aluminum hydroxide (Al(OH)3)). In another aspect, the adjuvant is a saponin containing liposomal adjuvant, whichcomprises a monophosphoryl lipid A (MPLA) and a triterpenoid glycoside saponin (QS-21). Inone aspect, the saponin containing liposomal adjuvant further comprises 1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC). In one aspect, the saponin containing liposomal adjuvantfurther comprises 1,2-dimyristoyl-sn-glycero-3-phospho-(1'-rac-glycerol) (DMPG). In oneaspect, the saponin containing liposomal adjuvant further comprises cholesterol.In a preferred aspect, the saponin containing liposomal adjuvant comprises MPLA (e.g.® 3D-PHAD), QS-21, DMPC, DMPG and cholesterol. In a preferred aspect, the saponincontaining liposomal adjuvant comprises 0.4 mg / mL MPLA (e.g. 3D-PHAD®), 0.2 mg / mL QS-21, 14 mg / mL DMPC, 1.6 mg / mL DMPG and 11 / mg / mL cholesterol (i.e. LiNA-2). In anotherpreferred aspect, the saponin containing liposomal adjuvant comprises MPLA (e.g. 3D-® PHAD), QS-21, DMPC, DMPG and cholesterol in a phosphate buffer and sodium chloride(NaCl). In another preferred aspect, the saponin containing liposomal adjuvant comprises® MPLA (e.g.3D-PHAD ), QS-21, DMPC, DMPG and cholesterol in 10 mM phosphate bufferand 150 mM sodium chloride (NaCl). In another preferred aspect, the saponin containingliposomal adjuvant comprises MPLA (e.g.3D-PHAD® ), QS-21, DMPC, DMPG and cholesterolin a phosphate buffer and sodium chloride (NaCl) at a pH of about 6.2. In a preferred aspect,the saponin containing liposomal adjuvant is designed to reconstitute the lyophilizedinvestigational C. difficile vaccine drug product for administration.The present invention further provides for immunogenic compositions comprisinggenetically modified C. difficile toxoid A (TxdA), i.e., a polypeptide comprising SEQ ID NO: 4,wherein the initial methionine is not present (for example SEQ ID NO: 84) and geneticallymodified C. difficile toxoid B (TxdB), i.e., a polypeptide comprising SEQ ID NO: 6, wherein theinitial methionine is not present (for example SEQ ID NO: 86) at 200 µg / dose (total dose forTxdA and TxdB) and a saponin containing liposomal adjuvant (e.g. LiNA-2). In one aspect,the immunogenic composition comprises a saponin containing liposomal adjuvant comprising® MPLA (e.g. 3D-PHAD ) and QS-21. In a preferred aspect, the immunogenic compositioncomprises a saponin containing liposomal adjuvant comprising MPLA (e.g. 3D-PHAD® ), QS-21, DMPC, DMPG and cholesterol in a phosphate buffer and sodium chloride (NaCl). In apreferred aspect, the immunogenic composition comprises a saponin containing liposomal ® adjuvant comprising MPLA (e.g.3D-PHAD), QS-21, DMPC, DMPG and cholesterol in a 10mM phosphate buffer and 150 mM sodium chloride (NaCl). In a preferred aspect, theimmunogenic composition comprises 0.4 mg / mL MPLA (e.g. 3D-PHAD®), 0.2 mg / mL QS-21,14 mg / mL DMPC, 1.6 mg / mL DMPG and 11 / mg / mL cholesterol. In a preferred aspect, theimmunogenic composition comprises 0.4 mg / mL MPLA (e.g. 3D-PHAD®), 0.2 mg / mL QS-21,14 mg / mL DMPC, 1.6 mg / mL DMPG and 11 / mg / mL cholesterol in a 10 mM phosphate bufferand 150 mM sodium chloride (NaCl). In a preferred aspect, the immunogenic composition comprises the investigational C.difficile vaccine, 0.4 mg / mL MPLA (e.g.3D-PHAD®), 0.2 mg / mL QS-21, 14 mg / mL DMPC, 1.6mg / mL DMPG and 11 / mg / mL cholesterol. In a preferred aspect, the lyophilized investigationalC. difficile vaccine is reconstituted with 0.4 mg / mL MPLA (e.g. 3D-PHAD®), 0.2 mg / mL QS-21, 14 mg / mL DMPC, 1.6 mg / mL DMPG and 11 / mg / mL cholesterol in a phosphate buffer andsodium chloride (NaCl). In a preferred aspect, the lyophilized investigational C. difficilevaccine is reconstituted with 0.4 mg / mL MPLA (e.g.3D-PHAD®), 0.2 mg / mL QS-21, 14 mg / mLDMPC, 1.6 mg / mL DMPG and 11 / mg / mL in a 10 mM phosphate buffer and 150 mM sodiumchloride (NaCl). In a preferred aspect, the immunogenic composition comprises theinvestigational C. difficile vaccine and LiNA-2. In a preferred aspect, the lyophilizedinvestigational C. difficile vaccine is reconstituted with LiNA-2 in a phosphate buffer comprisingsodium chloride (NaCl). In a preferred aspect, the lyophilized investigational C. difficile vaccineis reconstituted with LiNA-2 in 10 mM phosphate buffer and 150 mM sodium chloride (NaCl).In one aspect, an adjuvanted immunogenic composition of the present invention comprises a C. difficile toxoid A (TxdA) comprising SEQ ID NO: 4, wherein the initialmethionine is not present (for example SEQ ID NO: 84), and a C. difficile toxoid B (TxdB)comprising SEQ ID NO: 6, wherein the initial methionine is not present (for example SEQ IDNO: 86), and a saponin containing liposomal adjuvant (e.g. LiNA-2).In one aspect, immunogenic compositions of the present invention are prepared byreconstituting the lyophilized investigational C. difficile vaccine for injection with either CpGalone (e.g. CpG 24555), CpG (e.g. CpG 24555) combined with aluminum hydroxide (Al(OH)3),or a saponin containing liposomal adjuvant (e.g. LiNA-2). The reconstituted immunogeniccompositions are withdrawn in the syringe using the vial adapter to enable a dose of 0.5 mL for IM administration. In one aspect, immunogenic compositions of the present invention are prepared byreconstituting the lyophilized investigational C. difficile vaccine for injection with aluminumhydroxide (Al(OH)3) adsorbent (current formulation). The reconstituted immunogeniccompositions are presented as a sterile liquid suspension in a dosage strength of 1 mg / mLaluminum in the form of aluminum hydroxide containing sodium chloride (NaCl).In one aspect, the immunogenic compositions disclosed herein are administered twotimes each dose being separated from one another by about 1 to about 2 months. In oneaspect, the immunogenic compositions disclosed herein are administered two times eachdose being separated from one another by about 1 or 2 months. In a preferred aspect, theimmunogenic compositions disclosed herein are administered two times each dose beingseparated from one another by about 1 month. In one aspect, methods of the present inventioninclude administering a first dose and a second dose of an immunogenic compositiondescribed herein, preferably the second dose is administered about 1 month after the firstdose (M 0, 1; 0- and 1-month dosing schedule).In one aspect, the immunogenic compositions disclosed herein are administered twotimes each dose being separated from one another by about 1 to about 4 months. In oneaspect, the immunogenic compositions disclosed herein are administered two times each dose being separated from one another by about 1, 2, 3 or 4 months. In a preferred aspect, the immunogenic compositions disclosed herein are administered two times each dose being separated from one another by about two months. In one aspect, methods of the presentinvention include administering a first dose and a second dose of an immunogenic compositiondescribed herein, preferably the second dose is administered about 2 months after the firstdose (M 0, 2; 0- and 2-month dosing schedule).In one aspect, the immunogenic compositions disclosed herein are administered twotimes each dose being separated from one another by about 1 to about 6 months. In oneaspect, the immunogenic compositions disclosed herein are administered two times eachdose being separated from one another by about 1, 2, 3, 4, 5 or 6 months. In a preferredaspect, the immunogenic compositions disclosed herein are administered two times eachdose being separated from one another by about four months. In one aspect, methods of thepresent invention include administering a first dose and a second dose of an immunogeniccomposition described herein, preferably the second dose is administered about 4 monthsafter the first dose (M 0, 4; 0- and 4-month dosing schedule).In another aspect, the immunogenic compositions disclosed herein are administeredtwo times each dose being separated from one another by about 1 to about 8 months. In one aspect, the immunogenic compositions disclosed herein are administered two times each dose being separated from one another by about 1, 2, 3, 4, 5, 6, 7 or 8 months. In a preferred aspect, the immunogenic compositions disclosed herein are administered two times eachdose being separated from one another by about 6 months. In one aspect, methods of thepresent invention include administering a first dose and a second dose of an immunogeniccomposition described herein, preferably the second dose is administered about 6 monthsafter the first dose (M 0, 6; 0- and 6-month dosing schedule).In another aspect, the immunogenic compositions disclosed herein are administeredtwo times each dose being separated from one another by about 1 to about 14 months. Inone aspect, the immunogenic compositions disclosed herein are administered two times each dose being separated from one another by about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14months. In a preferred aspect, the immunogenic compositions disclosed herein areadministered two times each dose being separated from one another by about 12 months. Inone aspect, methods of the present invention include administering a first dose and a seconddose of an immunogenic composition described herein, preferably the second dose isadministered about 12 months after the first dose (M 0, 12; 0- and 12-month dosing schedule).In another aspect, the immunogenic compositions disclosed herein are administeredtwo times, the second dose being administered about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,14, 15, 16 or more months after the administration of the first dose.In one aspect, the method includes further administration of a booster dose after thesecond dose, e.g. about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 1213, 14, 15, 16, 17, 18 months, 2,2.5, 3, 3.5, 4, 4.5 or 5 years or later after the second dose, e.g. 6 months, 12 months, 2 yearor 3 year or later after the second dose. In one aspect, the method includes administeringimmunogenic compositions disclosed herein on a 0- and 1-month, 0- and 2-month, 0- and 4-month, 0- and 6-month, or 0- and 12-month dosing schedule and administering at least onebooster dose after the second dose. Further boosters may be administered. In one aspect, the method does not include further administration of a booster after the second dose. In one aspect, the immunogenic compositions disclosed herein are administered threetimes, the first and second dose being separated from one another by about 1 to about 4months and the third dose being separated from the first dose by about 5 to about 10 months.In a preferred aspect, the immunogenic compositions disclosed herein are administered threetimes, the first and second dose being separated from one another by about 1month and thethird dose being separated from the first dose by about 6 months. In one aspect, methods of the present invention include administering a first dose, a second dose and a third dose of an immunogenic composition described herein, preferably the second dose is administered about 1 month after the first dose and the third dose is administered about 6 months after the firstdose (M 0, 1, 6; 0-, 1- and 6-month dosing schedule).In one aspect, the immunogenic compositions disclosed herein are administered threetimes, the first and second dose being separated from one another by about 1 to about 5months and the third dose being separated from the first dose by about 5 to about 10 months. In a preferred aspect, the immunogenic compositions disclosed herein are administered threetimes, the first and second dose being separated from one another by about 2 months and thethird dose being separated from the first dose by about 6 months. In one aspect, methods of the present invention include administering a first dose, a second dose and a third dose of an immunogenic composition described herein, preferably the second dose is administered about 2 months after the first dose and the third dose is administered about 6 months after the firstdose (M 0, 2, 6; 0-, 2- and 6-month dosing schedule). In one aspect, the immunogenic compositions disclosed herein are administered threetimes, the first and second dose being separated from one another by about 1 to about 7months and the third dose being separated from the first dose by about 10 to about 16 months.In a preferred aspect, the immunogenic compositions disclosed herein are administered threetimes, the first and second dose being separated from one another by about 4 months and thethird dose being separated from the first dose by about 12 months. In one aspect, methods ofthe present invention include administering a first dose, a second dose and a third dose of an immunogenic composition described herein, preferably the second dose is administered about4 months after the first dose and the third dose is administered about 12 months after the firstdose (M 0, 4, 12; 0-, 4- and 12-month dosing schedule).In one aspect, the immunogenic compositions disclosed herein are administered threetimes, the first and second dose being separated from one another by about 1 to about 5months and the third dose being separated from the first dose by about 14 to about 19 months.In a preferred aspect, the immunogenic compositions disclosed herein are administered threetimes, the first and second dose being separated from one another by about 2 months and thethird dose being separated from the first dose by about 15 months. In one aspect, methods ofthe present invention include administering a first dose, a second dose and a third dose of animmunogenic composition described herein, preferably the second dose is administered about2 months after the first dose and the third dose is administered about 15 months after the firstdose (M 0, 2, 15; 0-, 2- and 15-month dosing schedule).In another aspect, the immunogenic compositions disclosed herein are administeredthree times, the second dose being administered about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,14, 15, 16 or more months after the administration of the first dose, and the third doseadministered 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or more months after the firstdose. In another aspect, the immunogenic compositions disclosed herein are administeredthree times, the second dose being administered about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,14, 15, 16 or more months after the administration of the first dose, and the third doseadministered 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or more months after the seconddose. In one aspect, the methods and uses include further administration of a booster doseafter the third dose, e.g. about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 months,2, 2.5, 3, 3.5, 4, 4.5 or 5 years or later after the third dose, e.g.6 months 12 months, 2 yearsor 3 years after the third dose. In one aspect, the method includes administering immunogeniccompositions disclosed herein on a 0-, 1- and 6-month, 0-, 2- and 6-month, 0-, 4- and 12-month, or 0-, 2- and 15-month dosing schedule and administering at least one booster dose after the third dose. Further boosters may be administered. In one aspect, the method does not include further administration of a booster after the third dose. Examples 1 to 4 of the present invention compare the relative immunogenicity innonhuman primates (NHPs) of C. difficile toxoid antigens formulated with adjuvantformulations compared to an Al(OH)3 formulation. The formulations were assessed forenhanced immune responses, in particular the immune response to toxin B, and potentialreduction in the number of doses (2 doses vs 3 doses) required to prevent C. difficile infection(CDI) in humans.As provided in the examples herein, multiple immunogenicity studies were conductedin NHPs to compare the functional response of adjuvanted formulations to Al(OH)3 formulatedtoxoid antigens. See Examples 1-4. The adjuvanted formulations including a CpG adjuvant(e.g. CpG 24555), both with and without Al(OH)3, as well as a saponin containing liposomaladjuvant (e.g. LiNA-2), elicited a robust and more rapid immune response in NHPs following2 doses (at Month 0, 2 or Month 0, 6) compared to 3 doses (at Months 0, 1, and 6) of theAl(OH)3 formulation. As further provided in the examples herein, dose-ranging immunogenicity studies wereconducted with CpG-adjuvanted C. difficile toxoid antigens in NHPs. The functional immuneresponse to 2 doses (at Months 0, 2) of toxoid antigen increased in parallel with the amountof CpG included (0.5, 1.0, and 3.6 mg / mL CpG 24555) when formulated together with Al(OH)3.The inclusion of CpG at either 1.0 or 3.6 mg / mL elicited a more rapid and robust immuneresponse than 3 doses of the Al(OH)3 formulation. See Examples 3 and 4. The functionalimmune response to 2 doses (at Months 0, 2) of toxoid antigen formulated with either 0.5 or3.6 mg / mL CpG alone (no Al(OH)3) was also evaluated in NHPs. Both elicited a more rapidresponse compared to 3 doses of the Al(OH)3 formulation. See Example 4.Example 5 provides immunogenicity studies conducted with homogeneous andheterogenous LiNA-2-adjuvanted C. difficile toxoid antigens in rats. The toxoids formulatedwith homogeneous and heterogeneous saponin containing liposomal adjuvant (e.g. LiNA-2)elicited similar immune responses able to neutralize Toxin B cytotoxicity.Example 6 of the present invention provides binding studies with various CpG and Al(OH)3 concentrations and ratios to understand the binding properties of the C difficile toxoidsand CpG adjuvant.Example 7 of the present invention provides binding and resuspension studies forvarious CpG / Al(OH)3 formulations to assess the properties of the C difficile toxoids and CpGadjuvant. Examples 8 and 9 provide preferred immunogenic compositions and administrationregimens of the present invention. For example, immunogenic compositions formulated withCpG adjuvant alone, CpG adjuvant + Al(OH)3 and / or a saponin containing liposomal adjuvant(LiNA-2) administered in 2 doses (e.g. M 0, 2; M 0, 4; M 0, 6; M 0, 12) or 3 doses (M 0, 2 and15; M 0, 1 and 6; M 0, 2 and 6; M 0, 4 and 12). Preliminary immunogenicity results illustratethat toxoids formulated with a CpG or LiNA-2 adjuvant elicit a robust immune response at 1month after the last dose for the 0- and 2-month and 0- and 6-month dosing schedules andneutralizing antibody titers remain above baseline at Month 12 and at Month 18.A Phase 1 / 2 study in adults ≥65 years of age is evaluating the safety andimmunogenicity of C difficile vaccine formulations containing a CpG or LiNA-2 adjuvant.Phase 1 assess whether adjuvanted formulations show a similar safety profile with improved immunogenicity (more rapid rise in protective antibodies with maintained durability) when compared to the Al(OH)3-containing vaccine formulation. Preliminary Phase 1 immunogenicity results described in Example 9 show thatincreases in functional antibody responses (TNA concentrations) were observed 1 month afterthe second active dose for all 3 adjuvanted formulations (low-dose CpG, high-dose CpG andLiNA-2) for both Toxin A and Toxin B for the 0-, 2-month and 0-, 6-month dosing schedules.For Toxins A and B, a higher GMFR was observed 1 month after the last active dose(second dose) for the low-dose CpG + Al(OH)3 adjuvanted C. difficile vaccine formulationadministered on the 0- and 2-month dosing schedule (6.1 and 28.3, respectively at Month 3)compared to 1 month after the second dose for the C. difficile vaccine Al(OH)3-containingformulation on the 0-, 1- and 6-month dosing schedule (1.7 and 3.2, respectively at Month 2).For Toxins A and B, a higher GMFR was observed 1 month after the last active dose(second dose) for the high-dose CpG-adjuvanted C. difficile vaccine formulation administeredon the 0- and 2-month dosing schedule (9.69 and 48.56, respectively at Month 3) comparedto 1 month after the second dose for the C. difficile vaccine Al(OH)3-containing formulation onthe 0-, 1- and 6-month dosing schedule (1.7 and 3.2, respectively at Month 2), and a higherGMFR was observed 1 month after the last active dose (second dose) for the high-dose CpG-adjuvanted C. difficile vaccine formulation administered on the 0- and 2-month dosingschedule (9.69 and 48.56, respectively at Month 3) compared to 1 month after the last activedose (third dose) for the C. difficile vaccine Al(OH)3-containing formulation on the 0-, 1- and 6-month dosing schedule (8.49 and 29.05, respectively at Month 7). For Toxins A and B, a higher GMFR was observed 1 month after the last active dose(second dose) for the LiNA-2-adjuvanted C. difficile vaccine formulation administered on the0- and 2-month dosing schedule (9.5 and 71.0, respectively at Month 3) compared to 1 monthafter the second dose for the C. difficile vaccine Al(OH)3-containing formulation on a 0-, 1- and6-month dosing schedule (1.7 and 3.2, respectively at Month 2), and a higher GMFR wasobserved 1 month after the last active dose (second dose) for the LiNA-2-adjuvantedC. difficile vaccine formulation administered on the 0- and 2-month dosing schedule (9.45 and71.00, respectively at Month 3) compared to 1 month after the last active dose (third dose) forthe C. difficile vaccine Al(OH)3-containing formulation on the 0-, 1- and 6-month dosingschedule (8.49 and 29.05, respectively at Month 7). For toxin A and B, a higher GMFR was observed 1 month after the last active dose(second dose) for the low-dose CpG + Al(OH)3 -adjuvanted C. difficile vaccine formulation onthe 0- and 6-month dosing schedule (17.22 and 98.05, respectively at Month 7) compared to1 month after the second dose for the C. difficile vaccine Al(OH)3-containing formulation onthe 0-, 1- and 6-month dosing schedule (1.7 and 3.2, respectively at Month 2), and a higherGMFR was observed 1 month after the last active dose (second dose) for the low-dose CpG+ Al(OH)3 -adjuvanted C. difficile vaccine formulation on the 0- and 6-month dosing schedule(17.22 and 98.05, respectively at Month 7) compared to 1 month after the last active dose(third dose) for the C. difficile vaccine Al(OH)3-containing formulation on the 0-, 1- and 6-monthdosing schedule (8.49 and 29.05, respectively at Month 7). For toxin A and B, a higher GMFR was observed 1 month after the last active dose(second dose) for the high-dose CpG-adjuvanted C. difficile vaccine formulation on the 0- and6-month dosing schedule (22.60 and 159.68, respectively at Month 7) compared to 1 monthafter the second dose for the C. difficile vaccine Al(OH)3-containing formulation on the 0-, 1-and 6-month dosing schedule (1.7 and 3.2, respectively at Month 2), and a higher GMFR wasobserved 1 month after the last active dose (second dose) for the high-dose CpG-adjuvantedC. difficile vaccine formulation on the 0- and 6-month dosing schedule (22.60 and 159.68,respectively at Month 7) compared to 1 month after the last active dose (third dose) for theC. difficile vaccine Al(OH)3-containing formulation on the 0-, 1- and 6-month dosing schedule(8.49 and 29.05, respectively at Month 7). For toxin A and B, a higher GMFR was observed 1 month after the last active dose(second dose) for the LiNA-2-adjuvanted C. difficile vaccine formulation on the 0- and 6-monthdosing schedule (25.60 and 168.84, respectively at Month 7) compared to 1 month after thesecond dose for the C. difficile vaccine Al(OH)3-containing formulation on the 0-, 1- and 6-month dosing schedule (1.7 and 3.2, respectively at Month 2), and a higher GMFR wasobserved 1 month after the last active dose (second dose) for the LiNA-2-adjuvantedC. difficile vaccine formulation on the 0- and 6-month dosing schedule (25.60 and 168.84,respectively at Month 7) compared to 1 month after the last active dose (third dose) for theC. difficile vaccine Al(OH)3-containing formulation on the 0-, 1- and 6-month dosing schedule(8.49 and 29.05, respectively at Month 7). Phase 1 immunogenicity results at Month 12 (i.e., 10 months after the last active dosewith the 0- and 2-month schedule, 6 months after the last active dose with the 0- and 6-monthschedule, and 6 months after the last active dose with the 3-dose Al(OH)3 only group at the 0- , 1-, and 6-month schedule) described in Example 9 show that, compared with the 3-dose Al(OH)3only group, toxin B GMCs and GMFRs were higher in the 2-dose adjuvanted groupswith the 0- and 2-month schedules, and toxin A and toxin B GMCs and GMFRs were higherin the 2-dose adjuvanted groups with the 0- and 6-month schedule.A higher immune response to toxin B was observed at Month 12 (i.e. 10 months afterthe second dose) for the low-dose CpG + Al(OH)3 adjuvanted formulation administered on the0- and 2-month dosing schedule (GMFR from baseline 9.5), compared to the immuneresponse to toxin B observed at Month 12 (i.e. 6 months after a third dose) of the Al(OH)3-containing formulation administered on a 0-, 1- and 6-month dosing schedule (GMFR frombaseline 5.8). Ahigher immune response to toxin B was observed at Month 12 (i.e. 10 months afterthe second dose) for the high-dose CpG adjuvanted formulation administered on the 0- and2-month dosing schedule (GMFR from baseline 21.7), compared to the immune response to toxin B observed at Month 12 (i.e. 6 months after a third dose) of the Al(OH)3-containingformulation administered on a 0-, 1- and 6-month dosing schedule (GMFR from baseline 5.8).A higher immune response to toxin B was observed at Month 12 (i.e. 10 months afterthe second dose) for the LiNA-2 adjuvanted formulation administered on the 0- and 2-monthdosing schedule (GMFR from baseline 11.1), compared to the immune response to toxin Bobserved at Month 12 (i.e. 6 months after a third dose) of the Al(OH)3-containing formulationadministered on a 0-, 1- and 6-month dosing schedule (GMFR from baseline 5.8).A higher immune response to toxins A and B was observed at Month 12 (i.e. 6 monthsafter the second dose) for the low-dose CpG adjuvanted formulation administered on the 0- and 6-month dosing schedule (GMFRs from baseline 5.4 and 22.6, respectively), comparedto the immune response to toxins A and B observed at Month 12 (i.e. 6 months after a thirddose) of the Al(OH)3-containing formulation administered on a 0-, 1- and 6-month dosingschedule (GMFR from baseline 4.6 and 5.8, respectively). Ahigher immune response to toxins A and B was observed at Month 12 (i.e. 6 monthsafter the second dose) for the high-dose CpG adjuvanted formulation administered on the 0- and 6-month dosing schedule (GMFRs from baseline 6.8 and 23.1, respectively), comparedto the immune response to toxins A and B observed at Month 12 (i.e. 6 months after a thirddose) of the Al(OH)3-containing formulation administered on a 0-, 1- and 6-month dosingschedule (GMFR from baseline 4.6 and 5.8, respectively). Ahigher immune response to toxins A and B was observed at Month 12 (i.e. 6 monthsafter the second dose) for the LiNA-2 adjuvanted formulation administered on the 0- and 6-month dosing schedule (GMFRs from baseline 7.8 and 29.2, respectively), compared to theimmune response to toxins A and B observed at Month 12 (i.e.6 months after a third dose) ofthe Al(OH)3-containing formulation administered on a 0-, 1- and 6-month dosing schedule(GMFR from baseline 4.6 and 5.8, respectively). Phase 1 immunogenicity results at Month 18 (i.e., 16 months after the last active dosewith the 0- and 2-month schedule, 12 months after the last active dose with the 0- and 6-monthschedule, and 12 months after the last active dose with the 3-dose Al(OH)3 only group at the 0-, 1-, and 6-month schedule), described in Example 9 show that, compared with the 3-dose Al(OH)3only group, toxin B GMCs and GMFRs were higher in the evaluable 2-doseadjuvanted groups with the 0- and 2-month schedules (high-dose CpG not evaluated at Month18), and toxin A and toxin B GMCs and GMFRs were higher in the 2-dose adjuvanted groupswith the 0- and 6-month schedule.A higher immune response to toxin B was observed at Month 18 (i.e. 16 months afterthe second dose) for the low-dose CpG + Al(OH)3 adjuvanted formulation administered on the0- and 2-month dosing schedule (GMFR from baseline 10.0), compared to the immuneresponse to toxin B observed at Month 18 (i.e. 12 months after a third dose) of the Al(OH)3-containing formulation administered on a 0-, 1- and 6-month dosing schedule (GMFR frombaseline 6.4). Ahigher immune response to toxin B was observed at Month 18 (i.e. 16 months afterthe second dose) for the LiNA-2 adjuvanted formulation administered on the 0- and 2-monthdosing schedule (GMFR from baseline 12.2), compared to the immune response to toxin Bobserved at Month 18 (i.e. 12 months after a third dose) of the Al(OH)3-containing formulationadministered on a 0-, 1- and 6-month dosing schedule (GMFR from baseline 6.4).A higher immune response to toxin B was observed at Month 18 (i.e. 12 months afterthe second dose) for the low-dose CpG + Al(OH)3 adjuvanted formulation administered on the0- and 6-month dosing schedule (GMFR from baseline 3.9 and 18.0, respectively), comparedto the immune response to toxin B observed at Month 18 (i.e.12 months after a third dose) ofthe Al(OH)3-containing formulation administered on a 0-, 1- and 6-month dosing schedule(GMFR from baseline 3.6 and 6.4, respectively). Ahigher immune response to toxin B was observed at Month 18 (i.e. 12 months afterthe second dose) for the high-dose CpG adjuvanted formulation administered on the 0- and6-month dosing schedule (GMFR from baseline 5.1 and 17.1, respectively), compared to theimmune response to toxin B observed at Month 18 (i.e. 12 months after a third dose) of theAl(OH)3-containing formulation administered on a 0-, 1- and 6-month dosing schedule (GMFRfrom baseline 3.6 and 6.4, respectively). Ahigher immune response to toxin B was observed at Month 18 (i.e. 12 months afterthe second dose) for the LiNA-2 adjuvanted formulation administered on the 0- and 6-monthdosing schedule (GMFR from baseline 6.2 and 27.8, respectively), compared to the immuneresponse to toxin B observed at Month 18 (i.e. 12 months after a third dose) of the Al(OH)3-containing formulation administered on a 0-, 1- and 6-month dosing schedule (GMFR frombaseline 3.6 and 6.4, respectively).Phase 1 immunogenicity results described in Example 9 further show that GMCs andGMFRs were substantially increased in participants receiving a booster dose. A booster dosewas administered at Month 15 of the 0- and 2-month low-dose CpG group, at Month 16 (1month after booster dose) both toxin A and toxin B GMCs and GMFRs were substantially increased compared to those at 1 month after the first dose and second dose, and were higherthan 1 month after the last active dose of the 0- and 6-month high-dose CpG and 0-, 1- and6-month 3-dose Al(OH)3only group. For toxins A and B, at 1 month after the booster dose (Month 16), both toxin A and toxin B GMCs (5794.5 and 164447.5, respectively) and GMFRs from baseline (39.1 and 425.8, respectively) were substantially higher compared with those at 1 month after the first dose (Month 1) (GMCs 341.7 and 2124.8; respectively, and GMFRs 2.2 and 6.3, respectively) and1 month after the second dose (Month 3) (GMCs 1415.9 and 16893.7, respectively, andGMFRs 9.7 and 48.6, respectively). COMPOSITION AND VACCINE In one aspect, the composition is an immunogenic composition. In one aspect, the composition is an immunogenic composition for a human. In another aspect, the composition is a vaccine. A “vaccine” refers to a composition that includes an antigen, which contains at least one epitope that induces an immune response that is specific for that antigen. Thevaccine may be administered directly into the subject by subcutaneous, oral, oronasal, orintranasal routes of administration. Preferably, the vaccine is administered intramuscularly. In one aspect, the composition is a human vaccine. In one aspect, the composition is an immunogenic composition against C. difficile. In certain aspects, the compositions may furthercomprise one or more C. difficile antigens, one or more pharmaceutically acceptable carriersand / or one or more adjuvants, as described herein. As described above, the investigational C. difficile vaccine (also referred to as“PF-06425090”, “Al(OH)3-containing” or “Al(OH)3 formulation”, once reconstituted withAl(OH)3, herein) includes a mixture of genetically modified C. difficile toxoid A (TxdA), i.e., apolypeptide comprising SEQ ID NO: 4, wherein the initial methionine is not present (forexample SEQ ID NO: 84) and genetically modified C. difficile toxoid B (TxdB), i.e., apolypeptide comprising SEQ ID NO: 6, wherein the initial methionine is not present (forexample SEQ ID NO: 86) that were further chemically inactivated by 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide) (EDC) and N-Hydroxysuccinimide (NHS). The vaccine is presented as a lyophilized powder with a 1:1 ratio of TxdA and TxdB in a dosage strength of200 μg / dose (total dose for TxdA and TxdB). Prior to immunization, the investigational C.difficile vaccine is reconstituted with Al(OH)3 as an adsorbent. The vaccine is administered in3 doses (M 0, 1, 6).The present invention provides for the investigational C. difficile vaccine formulated toinclude an oligonucleotide CpG adjuvant (e.g. CpG 24555) alone, a CpG adjuvant (e.g. CpG24555) combined with Al(OH)3 and / or a saponin containing liposomal adjuvant (e.g. LiNA-2)to enhance the immune response, in particular the immune response to toxin B, thus providinga more rapid onset of protection and use of a 2-dose regimen (M 0, 2 or M 0, 6). Theadjuvanted vaccine compositions described herein are presented as a lyophilized dosage form(investigational C. difficile vaccine) and prepared for injection by reconstituting with either anoligonucleotide CpG adjuvant (e.g. CpG 24555) alone, an oligonucleotide CpG adjuvant (e.g.CpG 24555) combined with aluminum hydroxide (Al(OH)3), or a saponin containing liposomaladjuvant (e.g. LiNA-2) for use in a 2-dose regimen.The present invention provides for the investigational C. difficile vaccine formulated toinclude an oligonucleotide CpG adjuvant (e.g. CpG 24555) alone, a CpG adjuvant (e.g. CpG24555) combined with Al(OH)3 and / or a saponin containing liposomal adjuvant (e.g. LiNA-2)to enhance the immune response, in particular the immune response to toxin B, thus providinga more rapid onset of protection and use of a 3-dose regimen as described herein. Theadjuvanted vaccine compositions described herein are presented as a lyophilized dosage form(investigational C. difficile vaccine) and prepared for injection by reconstituting with either anoligonucleotide CpG adjuvant (e.g. CpG 24555) alone, an oligonucleotide CpG adjuvant (e.g.CpG 24555) combined with aluminum hydroxide (Al(OH)3), or a saponin containing liposomaladjuvant (e.g. LiNA-2) for use in a 3-dose regimen.C. difficile toxoidsThe term "C. difficile toxoid" is used herein to refer to a C. difficile toxin (Toxin A orToxin B) that has been partially or completely inactivated. A toxin is inactivated if it has less toxicity (e.g., 100%, 99%, 98%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10% or less toxicity or any value therebetween) than untreated toxin, as measured by for example an in vitrocytotoxicity assay or by animal toxicity. C. difficile toxoids can be produced by purification oftoxins from C. difficile cultures and inactivation of toxins by chemical (e.g., formaldehyde,glutaraldehyde, peroxide or oxygen treatment). Alternatively, wild type or mutant C. difficile toxins that lack or have reduced toxicity can be produced using recombinant methods and / or alternative chemical crosslinking agents. For example, genetic mutations resulting in reducedtoxicity can be made. Wild type or mutant C. difficile toxins lacking specific regions to reducetoxicity can also be made. The C. difficile toxoid or mutant C. difficile toxin refers to a molecule that exhibits astructure or sequence that differs from the corresponding wild-type structure or sequence, e.g., by having crosslinks as compared to the corresponding wild-type structure and / or by having at least one mutation, as compared to the corresponding wild-type sequence when optimally aligned, such as by the programs GAP or BESTFIT using default gap weights. The term toxoid or mutant toxin as used herein further exhibits a functional property (e.g., abrogated glucosyltransferase and / or abrogated cysteine protease activity) that differs from the corresponding wild-type molecule. The toxoid as used herein may be any of the toxoids or mutant C. difficile toxins asdescribed in WIPO Patent Application WO / 2012 / 143902, U.S. Patent No.9187536, and WIPO Patent Application WO / 2014 / 060898, which are each incorporated by reference herein in their respective entireties. That is, the toxoid as used herein may be any of the polypeptides as described in WIPO Patent Application WO / 2012 / 143902, U.S. Patent No.9187536, and WIPO Patent Application WO / 2014 / 060898, which are each incorporated by reference herein in their respective entireties. A C. difficile toxin from any of the wild-type strains described abovemay be used as a source from which a toxoid or mutant C. difficile toxin is produced.Preferably, C. difficile 630 is the source from which a C. difficile toxoid is produced.In one aspect, the toxoid refers to a polypeptide that has any one sequence selectedfrom the toxoid polypeptides of SEQ ID NO: 1 to SEQ ID NO: 861, wherein the initialmethionine is absent, and wherein the polypeptide has been contacted with a chemicalcrosslinker, such as, for example, formaldehyde or EDC, as described herein, and / or has been genetically mutated. More specifically, in one aspect, the toxoid is a polypeptide having the amino acid sequence set forth in any one of SEQ ID NOs: 1-8, 15, 17, 19, 21, 23, 25, 28-35, 82-761, and 762-840. In another aspect, the polypeptide has an amino acid sequence that is about 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 1-8, 15, 17, 19, 21, 23, 25, 28-35, 82-761, and 762-840. In another aspect, the polypeptide has an amino acid sequence having at least 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450, 1500, 1550, 1600, 1650, 1700, 1750, 1800, 1850, 1900, 1950, 2000, 2050, 2100, 2150, or 2200 consecutive amino acids to any one of SEQ ID NOs: 1-8, 15, 17, 19, 21, 23, 25, 28-35, 82-761, and 762-840. The mutation may involve a substitution, deletion, truncation or modification of the wild type amino acid residue normally located at that position. Accordingly, the polypeptide may be any one of a fusion polypeptide, glycosylated polypeptide, non-glycosylated polypeptide, lipidated polypeptide, non-lipidated polypeptide, phosphorylated polypeptide, non- phosphorylated polypeptide, myristoylated polypeptide, non-myristoylated polypeptide, monomeric polypeptide, multimeric polypeptide, particulate polypeptide, denatured polypeptide, etc. Preferably, the mutation is a non-conservative amino acid substitution. The mutant toxins of the invention may be prepared by techniques known in the art for preparing mutations, such as, for example, site-directed mutagenesis, mutagenesis using a mutagen (e.g., UV light), etc. Preferably, site-directed mutagenesis is used. Alternatively, a nucleic acid molecule having an objective sequence may be directly synthesized. Such chemical synthesis methods are known in the art. In the present invention, the mutant C. difficile toxin includes at least one mutation ina glucosyltransferase domain, relative to the corresponding wild-type C. difficile toxin. In oneaspect, the glucosyltransferase domain includes at least two mutations. Preferably, the mutation decreases or abrogates glucosyltransferase enzyme activity of the toxin, as compared to the glucosyltransferase enzyme activity of the corresponding wild-type C. difficile toxin. An exemplary C. difficile toxoid A includes the amino acid sequence set forth in SEQID NO: 4, wherein the initial methionine is not present. SEQ ID NO: 4 has D285A, D287A andC700A mutations, as compared to SEQ ID NO: 1 (wild-type toxin A). In another aspect, themutant C. difficile toxin A includes the amino acid sequence set forth in SEQ ID NO: 84. Inanother aspect, the C. difficile toxoid A includes a glucosyltransferase domain including SEQID NO: 29 having an amino acid substitution at positions 285 and 287, and a cysteine protease domain comprising SEQ ID NO: 32 having an amino acid substitution at position 158, relativeto the corresponding wild-type C. difficile toxin A. In another aspect, the C. difficile toxoid Aincludes the amino acid sequence set forth in SEQ ID NO: 1, wherein the initial methionine isnot present, having D285A, D287A, and C700A mutations.Further examples of a C. difficile toxoid A include the amino acid sequence set forth in SEQ ID NO: 7, which has a D269A, R272A, D285A, D287A, E460A, R462A, and C700A mutation, as compared to SEQ ID NO: 1, wherein the initial methionine is optionally not present. In another aspect, the mutant C. difficile toxin A includes the amino acid sequence set forth in SEQ ID NO: 83. An exemplary C. difficile toxoid B includes the amino acid sequence set forth in SEQID NO: 6, wherein the initial methionine is not present. SEQ ID NO: 6 has D286A, D288A andC689A mutations, as compared to SEQ ID NO: 2 (wild-type toxin B). In another aspect, themutant C. difficile toxin A includes the amino acid sequence set forth in SEQ ID NO: 86. Further examples of a mutant C. difficile TcdB include the amino acid sequence set forth in SEQ ID NO: 8, which has a D270A, R273A, D286A, D288A, D461A, K463A, and C698A mutation, as compared to SEQ ID NO: 2, and wherein the initial methionine of SEQ ID NO: 8 is optionally not present. In another aspect, the mutant C. difficile toxin B includes theamino acid sequence set forth in SEQ ID NO: 85. In another aspect, the C. difficile toxoid Bincludes the amino acid sequence set forth in SEQ ID NO: 2, wherein the initial methionine isnot present, having D286A, D288A and C689A mutations. In addition to generating an immune response in a mammal, the toxoids described herein also have reduced cytotoxicity compared to the corresponding wild-type C. difficile toxin. Preferably, the immunogenic compositions are safe and have minimal (e.g., about a 6- 8 log10reduction) to no cytotoxicity, relative to the cytotoxicity of a respective wild-type toxin, for administration in mammals. As used herein, the term cytotoxicity is a term understood in the art and refers to apoptotic cell death and / or a state in which one or more usual biochemical or biological functions of a cell are aberrantly compromised, as compared to an identical cell under identical conditions but in the absence of the cytotoxic agent. Toxicity can be quantitated, for example, in cells or in mammals as the amount of an agent needed to induce 50% cell death (i.e., EC50or ED50, respectively) or by other methods known in the art. In one aspect, the toxoid is a polypeptide that has any one sequence selected from the toxoid polypeptides of SEQ ID NO: 1 to SEQ ID NO: 861, more specifically, the toxoid is a polypeptide having the amino acid sequence set forth in any one of SEQ ID NOs: 1-8, 15, 17, 19, 21, 23, 25, 28-35, 82-761, and 762-840, wherein the initial methionine is absent, and wherein the polypeptide has been contacted with a chemical crosslinker, such as, for example, formaldehyde or EDC, as described herein. Crosslinking (also referred to as “chemical inactivation” or “inactivation” herein) is a process of chemically joining two or more molecules by a covalent bond. The terms “crosslinking reagents,” “crosslinking agents,” and “crosslinkers” refer to molecules that are capable of reacting with and / or chemically attaching to specific functional groups (primary amines, sulfhydryls, carboxyls, carbonyls, etc.) on peptides, polypeptides, and / or proteins. In one aspect, the molecule may contain two or more reactive ends that are capable of reacting with and / or chemically attaching to specific functional groups (primary amines, sulfhydryls, carboxyls, carbonyls, etc.) on peptides, polypeptides, and / or proteins. Preferably, the chemical crosslinking agent is water-soluble. In another preferred aspect, the chemical crosslinking agent is a heterobifunctional crosslinker. In another aspect, the chemical crosslinking agent is not a bifunctional crosslinker. Chemical crosslinking agents are known in the art. Exemplary suitable chemical crosslinking agents include formaldehyde; formalin; acetaldehyde; propionaldehyde; water-soluble carbodiimides (RN=C=NR’), which include 1- Ethyl-3-(3-Dimethylaminopropyl)-Carbodiimide (EDC), 1-Ethyl-3-(3-Dimethylaminopropyl)- Carbodiimide Hydrochloride, 1-Cyclohexyl-3-(2-morpholinyl-(4-ethyl)carbodiimide metho-p- toluenesulfonate (CMC), N,N′-dicyclohexylcarbodiimide (DCC), and N,N′- diisopropylcarbodiimide (DIC), and derivatives thereof; and N-hydroxysuccinimide (NHS); phenylglyoxal; and / or UDP-dialdehyde. In another aspect, the at least one amino acid may be chemically crosslinked by an agent that includes EDC and NHS. For example, in one aspect, the invention relates to an isolated polypeptide having the amino acid sequence set forth in SEQ ID NO: 4, wherein the methionine residue at position 1 is optionally not present, wherein the polypeptide includes at least one amino acid side chain chemically modified by EDC and NHS. In another aspect, the invention relates to an isolated polypeptide having the amino acid sequence set forth in SEQ ID NO: 6, wherein the methionine residue at position 1 is optionally not present, wherein the polypeptide includes at least one amino acid side chain chemically modified by EDC and NHS. In yet another aspect, the invention relates to an isolated polypeptide having the amino acid sequence set forth in SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 7, or SEQ ID NO: 8. The polypeptide is modified by contacting the polypeptide with EDC and NHS. As yet another example of a chemically crosslinked mutant C. difficile toxin, i.e., a polypeptide, the at least one amino acid may be chemically crosslinked by an agent that includes formaldehyde. Formaldehyde may react with the amino group of an N-terminal amino acid residue and the side-chains of arginine, cysteine, histidine, and lysine. Formaldehyde and glycine may form a Schiff-base adduct, which may attach to primary N-terminal aminogroups, arginine, and tyrosine residues, and to a lesser degree asparagine, glutamine,histidine, and tryptophan residues. A chemical crosslinking agent is said to reduce cytotoxicity of a toxin if the treated toxin has less toxicity (e.g., about 100%, 99%, 95%, 90%, 80%, 75%, 60%, 50%, 25%, or 10% less toxicity) than untreated toxin under identical conditions, as measured, for example, by an invitro cytotoxicity assay, or by animal toxicity.In one aspect, an immunogenic composition of the present invention comprises apolypeptide having the amino acid sequence SEQ ID NO: 4, wherein the methionine is notpresent (toxoid A), for example SEQ ID NO: 84, and a second polypeptide having the aminoacid sequence SEQ ID NO: 6, wherein the methionine is not present (toxoid B), for exampleSEQ ID NO: 86, and an adjuvant, such as a CpG adjuvant or a saponin containing liposomal adjuvant. In one aspect, immunogenic compositions comprising an effective amount of C. difficiletoxoid A and toxoid B (e.g., from about 40 to about 500 μg / dose, such as about any of 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, or 500 µg / dose, such as about 50 to about 100 μg / dose (w / w, total amount of toxoids A and B in the composition)) at an effective toxoid A:B ratio (e.g., about any of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 3:1 , 3:2, or 1:1 toxoid A to toxoid B by weight), and with a sufficient purity (e.g., at least about 80 to about 100%, such as about any of 80, 85, 90, 95 or 90-100% (w / w)), using one or more administrations (e.g., at least two, three administrations or doses) by any suitable route (e.g., intramuscularly), each dose of a multiple dose administration regimen being suitably separated from one another (e.g., by atleast about one to about ten days, such as about any of one, two, three, four, five, six, seven,eight, nine or ten, such as about seven days or by at least one to about seven months, such as about any one of one, two, three, four, five, six, or seven months) are provided. The length of time (time interval) between doses would be understood by those of ordinary skill to vary depending on the individual and that that interval should be long enough (e.g., as measuredin days or months) such that the immune response from the prior dose both has time todevelop (e.g., to be primed) and is not in any way inhibited by the subsequent dose (e.g., the boosting dose or doses). In one aspect, the immunogenic composition used in the vaccination regimen of thepresent invention includes from about 40 to about 500 μg / dose of C. difficile toxoid A. In anaspect the composition includes from about 50 to about 400 μg / dose of C. difficile toxoid A. Inone aspect, the composition includes from about 50 to about 200 μg / dose of C. difficile toxoidA. In one aspect the composition includes from about 50 to about 150 μg / dose. In one aspectthe composition includes about any of 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150,160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, or 500µg / dose of C. difficile toxoid A. In one aspect, the composition includes about 50 µg / dose ofC. difficile toxoid A. In another aspect, the composition includes about 100 µg / dose of C.difficile toxoid A.In one aspect the immunogenic composition used in the vaccination regimen of thepresent invention includes from about 40 to about 500 μg / dose of C. difficile toxoid B. In oneaspect the composition includes from about 50 to about 400 μg / dose of C. difficile toxoid B. Inone aspect the composition includes from about 50 to about 200 μg / dose of C. difficile toxoidB. In one aspect the composition includes from about 50 to about 150 μg / dose. In one aspectthe composition includes about any of 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150,160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, or 500µg / dose of C. difficile toxoid B. In one aspect, the composition includes about 50 µg / dose ofC. difficile toxoid B. In another aspect, the composition includes about 100 µg / dose of C.difficile toxoid B.In one aspect, the immunogenic composition used in the vaccination regimen of thepresent invention includes C. difficile toxoid A and B at the doses disclosed herein. In oneaspect, the toxoid A to B ratio is 3:1, 3:2, or 1:1 toxoid A to toxoid B by weight. In one aspect,the toxoid A to B ratio is 1:3, 2:3, or 1:1 toxoid A to toxoid B by weight. In one aspect, thetoxoid A to B ratio is 1:1 toxoid A to toxoid B by weight. In one aspect the composition used inthe vaccination regimen of the present invention includes C. difficile toxoid A and B with apurity of at least about 80 to about 100%. In one aspect the composition used in thevaccination regimen of the present invention includes C. difficile toxoid A and B with a purityof at least about 90 to about 100%. In one aspect the composition used in the vaccinationregimen of the present invention includes C. difficile toxoid A and B with a purity of about 80,85, 90, 95 or 100% (w / w). The present invention further provides for immunogenic compositions comprisingmutants of C. difficile toxin A and / or toxin B and at least one addition C. difficile toxin antigen.In one aspect, the immunogenic composition comprises a mutant toxin A and at least oneaddition C. difficile toxin antigen. In one aspect, the immunogenic composition comprises amutant toxin B and at least one addition C. difficile toxin antigen. In one aspect, the additionalC. difficile toxin antigen may comprise a C. difficile binary toxin (CDT) or binary toxin, such asCDTa and / or CDTb protein, or mutant thereof . The present invention further provides for immunogenic compositions comprising of a C.difficile toxoid A and / or toxoid B and at least one addition C. difficile toxoid antigen. In oneaspect, the immunogenic composition comprises a toxoid A and at least one addition C.difficile toxoid antigen. In one aspect, the immunogenic composition comprises a toxoid B andat least one addition C. difficile toxoid antigen. In one aspect, the additional C. difficile toxoidantigen may comprise a C. difficile binary toxin (CDT) or binary toxin, such as CDTa and / orCDTb protein, or mutant thereof . Pharmaceutically acceptable carriers In one aspect, the immunogenic compositions described herein may further compriseone or more pharmaceutically acceptable carriers and / or one or more adjuvants. In oneaspect, the C. difficile toxoids A and / or B as described herein may be combined with one ormore pharmaceutically acceptable carriers to provide a composition prior to administration. In one aspect, the composition, which may be a vaccine, may be provided as a lyophilizedformulation that may be reconstituted at the clinical site with diluent, and / or mixed withadjuvant, when specified.A pharmaceutically acceptable carrier is a material that is not biologically or otherwiseundesirable, e.g., the material may be administered to a subject, without causing any undesirable biological effects or interacting in a deleterious manner with any of the other components of the pharmaceutical composition in which it is contained. The carrier would naturally be selected to minimize any degradation of the active ingredient and to minimize any adverse side effects in the subject, as would be well known to one of skill in the art. Suitable pharmaceutical carriers and their formulations are described in, for example, Remington 's: The Science and Practice of Pharmacy, 274' Edition, David B. Troy, ed., Lippicott Williams &Wilkins (2005), and may be appropriate. Typically, an appropriate amount of apharmaceutically-acceptable salt is used in the formulation to render the formulation isotonic. Examples of the pharmaceutically acceptable carriers include, but are not limited to,sterile water, saline, buffered solutions like Ringer's solution, and dextrose solution. The pH of the solution is generally from about 5 to about 8 or from about 7 to about 7.5. Other carriers include sustained-release preparations such as semipermeable matrices of solid hydrophobicpolymers containing polypeptides or fragments thereof. Matrices may be in the form of shapedarticles, e.g., films, liposomes or microparticles. It will be apparent to those persons skilled in the art that certain carriers may be more preferable depending upon, for instance, the route of administration and concentration of composition being administered. Carriers are those suitable for administration to humans or other subjects. In one aspect, the composition includes a pharmaceutically acceptable carrier(s), which refer to any solvents, dispersion media, stabilizers, diluents, and / or buffers that arephysiologically suitable. Exemplary stabilizers include carbohydrates, such as sorbitol,mannitol, starch, dextran, sucrose, trehalose, lactose, and / or glucose; inert proteins, such as albumin and / or casein; and / or other large, slowly metabolized macromolecules, such aspolysaccharides such as chitosan, polylactic acids, polyglycolic acids and copolymers (suchas latex functionalized SEPHAROSE™ agarose, agarose, cellulose, etc.), amino acids,polymeric amino acids, amino acid copolymers, and lipid aggregates (such as oil droplets or liposomes). Additionally, these carriers may function as immunostimulating agents (i.e., adjuvants). Preferably, the C. difficile immunogenic composition includes trehalose. Preferredamounts of trehalose (% by weight) include from a minimum of about 1%, 2%, 3%, or 4% to a maximum of about 10%, 9%, 8%, 7%, 6%, or 5%. Any minimum value can be combined with any maximum value to define a suitable range. In one aspect, the composition includes about3% to about 6% trehalose, most preferably, about 4.5% trehalose, for example, per 0.5 mLdose. Exemplary buffers include phosphate (such as potassium phosphate, sodiumphosphate); acetate (such as sodium acetate); succinate (such as sodium succinate); glycine; histidine; carbonate, Tris (tris(hydroxymethyl)aminomethane), and / or bicarbonate (such as ammonium bicarbonate) buffers. Preferably, the C. difficile immunogenic composition includes a Tris buffer. Preferredamounts of Tris buffer include from a minimum of about 1 mM, 5 mM, 6 mM, 7 mM, 8 mM, 9 mM, 10 mM to a maximum of about 100 mM, 50 mM, 20 mM,19 mM, 18 mM, 17 mM, 16 mM, 15 mM, 14 mM, 13 mM, 12 mM, or 11 mM. Any minimum value can be combined with anymaximum value to define a suitable range. In one aspect, the composition includes about 10mM to about 15 mM Tris buffer, more preferably, about 8 mM to about 12 mM Tris buffer, mostpreferably, about 10 mM Tris buffer, for example, per 0.5 mL dose. In another aspect, the C. difficile immunogenic composition includes histidine buffer.Preferred amounts of histidine buffer include from a minimum of about 1 mM, 5 mM, 6 mM, 7 mM, 8 mM, 9 mM, 10 mM to a maximum of about 100 mM, 50 mM, 20 mM,19 mM, 18 mM, 17 mM, 16 mM, 15 mM, 14 mM, 13 mM, 12 mM, or 11 mM. Any minimum value can be combined with any maximum value to define a suitable range. In one aspect, the composition includes about 10 mM to about 15 mM histidine buffer, more preferably, about 8 mM to about 12 mM histidine buffer most preferably, about 10 mM histidine buffer, for example, per 0.5 mL dose. In another aspect, the C. difficile immunogenic composition includes phosphate buffer.Preferred amounts of phosphate buffer include from a minimum of about 1 mM, 5 mM, 6 mM, 7 mM, 8 mM, 9 mM, 10 mM to a maximum of about 100 mM, 50 mM, 20 mM,19 mM, 18 mM, 17 mM, 16 mM, 15 mM, 14 mM, 13 mM, 12 mM, or 11 mM. Any minimum value can be combined with any maximum value to define a suitable range. In one aspect, the compositionincludes about 10 mM to about 15 mM phosphate buffer, more preferably, about 8 mM toabout 12 mM phosphate buffer, most preferably, about 10 mM phosphate buffer, for example, per 0.5 mL dose. In some aspects, the composition includes a surfactant. Any surfactant is suitable, whether it is amphoteric, non-ionic, cationic or anionic. Exemplary surfactants include the polyoxyethylene sorbitan esters surfactants (e.g., TWEEN ®), such as polysorbate 20 and / or polysorbate 80; polyoxyethylene fatty ethers derived from lauryl, cetyl, stearyl and oleylalcohols (known as BRIJ surfactants), such as triethyleneglycol monolauryl ether (BRIJ 30);TRITON X 100, or t- octylphenoxypolyethoxyethanol; and sorbitan esters (commonly knownas the SPANs), such as sorbitan trioleate (SPAN 85) and sorbitan monolaurate, and combinations thereof. Preferred surfactants include polysorbate 80 (polyoxyethylene sorbitan monooleate). Polysorbate 80 (PS-80) is a non-ionic surfactant. In one aspect, the composition includes a PS-80 concentration ranging from 0.0005% to 1%. For example, the PS-80 concentration in the composition may be at least 0.0005%, 0.005%, 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, 0.10%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, or 1.1% PS-80. In one aspect, the PS-80 concentration in the composition may be at most 2.0%, 1.9%, 1.8%, 1.7%, 1.6%, 1.5%, 1.4%, 1.3%, 1.2%, 1.1%, 1.0%, 0.9%, 0.8%, or 0.7% PS-80. Any minimum value may be combined with any maximum valuedescribed herein to define a range. Preferably, the composition comprises about 0.01% PS-80. In an exemplary aspect, the immunogenic composition of the present inventioncomprises C. difficile Toxoid A and Toxoid B in trehalose, Tris buffer and polysorbate 80. Inanother exemplary aspect, the immunogenic composition of the present invention is alyophilized composition comprising C. difficile Toxoid A and Toxoid B in trehalose, Tris bufferand polysorbate 80 and is reconstituted with an adjuvant or adsorbent. For example, a CpG adjuvant comprising a CpG alone or a CpG and aluminum hydroxide, or a saponin containing liposomal adjuvant. In another exemplary aspect, the immunogenic composition includes trehalose, trisbuffer, histidine buffer and polysorbate 80. In another exemplary aspect, the immunogeniccomposition includes trehalose, tris buffer, sodium phosphate buffer, potassium phosphate buffer and polysorbate 80. The pH of the buffer will generally be chosen to stabilize the activematerial of choice, and can be ascertainable by those in the art by known methods. Preferably,the pH of the buffer will be in the range of physiological pH. Thus, preferred pH ranges are from about 3 to about 8; more preferably, from about 6.0 to about 8.0; yet more preferably, from about 6.5 to about 7.5. The adjuvant may comprise, for instance, a suitable concentration (e.g., about any of800- 5000 μg / mL) of an adjuvant. The immunogenic compositions may further comprisealuminum (e.g., aluminum hydroxide or aluminum phosphate), for example, aluminumhydroxide in Sodium Chloride may be used as the diluent to reconstitute the lyophilizedformulation. WFI may be used to dilute the lyophilized vaccine for the unadjuvanted formulations. The final dosing solution may comprise, for instance, composition / vaccine, diluent and adjuvant. In one aspect, the pharmaceutical composition includes one, two or more differentadjuvants. Alternatively, in one aspect, the composition is administered to the mammal in the absence of an adjuvant. That is, the composition does not comprise an adjuvant. In some aspects, the pharmaceutical composition further includes formaldehyde. For example, in a preferred aspect, a pharmaceutical composition that further includes formaldehyde has an immunogenic composition, wherein the mutant C. difficile toxin of the immunogenic composition has been contacted with a chemical crosslinking agent that includes formaldehyde. The amount of formaldehyde present in the pharmaceutical composition may vary from a minimum of about 0.001%, 0.002%, 0.003%, 0.004%, 0.005%, 0.006%, 0.007%, 0.008%, 0.009%, 0.010%, 0.013%, or 0.015%, to a maximum of about 0.020%, 0.019%, 0.018%, 0.017% 0.016%, 0.015%, 0.014%, 0.013%, 0.012% 0.011% or 0.010%. Any minimum value can be combined with any maximum value to define a suitable range. In one aspect, the pharmaceutical composition includes about 0.010% formaldehyde. In some alternative aspects, the pharmaceutical compositions described herein do not include formaldehyde. For example, in a preferred aspect, a pharmaceutical composition that does not include formaldehyde has an immunogenic composition, wherein at least one aminoacid of the mutant C. difficile toxin is chemically crosslinked by an agent that includes EDC.More preferably, in such an aspect, the mutant C. difficile toxin has not been contacted with achemical crosslinking agent that includes formaldehyde. As another exemplary aspect, a pharmaceutical composition that is in a lyophilized form does not include formaldehyde.Also provided herein are kits for administering the C. difficile antigens. In one aspect,one or more of C. difficile antigens may form part of and / or be provided as a kit foradministration to a subject. Instructions for administering the C. difficile antigens may also beprovided by the kit. Compositions comprising C. difficile antigens as described herein may beincluded in a kit (e.g., a vaccine kit). For example, the kit may comprise a first container containing a composition described herein in dried or lyophilized form and a second container containing an aqueous solution for reconstituting the composition. The kit may optionally include the device for administration of the reconstituted liquid form of the composition (e.g., hypodermic syringe, microneedle array) and / or instructions for use. The device for administration may be supplied pre-filled with an aqueous solution for reconstituting the composition. The volume of each delivered dose of study drug (vaccine or placebo) may be about 0.5 mL. The volume of each delivered dose of the composition disclosed herein may be about 0.2, 0.3, 0.4, 0.5, 0.6, 0.7; 0.8, 0.9 or 1 mL. The volume of each delivered dose of the composition disclosed herein may be about 0.4, 0.5, 0.6 ml. The volume of each delivered dose of the composition disclosed herein may be about 0.5 mL. The volume of each delivered dose of the composition disclosed herein may be about 1 mL. Formulations may be administered by any suitable route (e.g., subcutaneously, intravenously, intramuscularly, intraperitoneally, intradermally, intranodally, intranasally, orally). As referred to above, an immunological composition is typically one that comprises C.difficile antigen(s) and, upon administration to a host / subject (e.g., a human), induces orenhances an immune response directed against the antigen (e.g., C. difficile). Such responses may include the generation of antibodies (e.g., through the stimulation of B cells) or a T cell- based response (e.g., a cytolytic response), which may be protective and / or neutralizing. A protective or neutralizing immune response may be one that is detrimental to the infectious organism corresponding to the antigen (e.g., from which the antigen was derived) and beneficial to the host (e.g., by reducing or preventing infection). As used herein, protective or neutralizing antibodies and / or cellular responses may be reactive with the C. difficile antigen(s) described here, especially when administered in an effective amount and / or schedule. Those antibodies and / or cellular responses may reduce or inhibit the severity, time,and / or lethality of C. difficile infection when tested in animals. As shown in the examples, theimmunogenic compositions comprising adjuvants described herein may be used to induce animmune response against C. difficile. An immunological composition that, upon administration to a host, results in a therapeutic (e.g., typically administered during an active infection) and / or protective (e.g., typically administered before or after an active infection) and / or neutralizing immune response, may be considered a vaccine. Adjuvants The present invention further provides for immunogenic compositions comprising anadjuvant. An adjuvant is a substance that enhances the immune response when administered together with an immunogen or antigen. Antigens may act primarily as a delivery system, primarily as an immune modulator or have strong features of both. Suitable adjuvants includethose suitable for use in mammals, including humans. Preferred adjuvants augment theintrinsic immune response to an immunogen without causing conformational changes in theimmunogen that may affect the qualitative form of the immune response. Suitable adjuvantsinclude MPL™ (3-O-deacylated monophosphoryl lipid A; Corixa, Hamilton, MT), which isdescribed in U.S. Patent No. 4,912,094, which is hereby incorporated by reference in itsentirety, an aluminum hydroxide gel such as ALHYDROGEL™ (Brenntag Biosector,Denmark); aluminum salts (such as aluminum hydroxide, aluminum phosphate, aluminum sulfate), which may be used with or without an immunostimulating agent such as MPL or 3- DMP, QS-21, polymeric or monomeric amino acids such as polyglutamic acid or polylysine. Suitable adjuvants further include an immunostimulatory oligonucleotide such as aCpG oligonucleotide (see, e.g., WO 1998 / 040100, WO2010 / 067262 and further describedherein), a saponin containing liposomal adjuvant (further described herein), or a saponin andan immunostimulatory oligonucleotide, such as a CpG oligonucleotide (see, e.g., WO00 / 062800), which are incorporated by reference herein in their entireties.Other adjuvants include RC-529, GM-CSF and Complete Freund's Adjuvant (CFA) and Incomplete Freund's Adjuvant (IFA). Yet another class of adjuvants is glycolipid analogues including N-glycosylamides, N-glycosylureas and N-glycosylcarbamates, each of which is substituted in the sugar residue by an amino acid. An effective amount of an adjuvant, such as those described herein, refers to theamount necessary or sufficient to realize a desired biologic effect. For example, an effectiveamount of an adjuvant administered with an antigen for inducing an antigen-specific immuneresponse is that amount necessary to induce an immune response in response to an antigen upon exposure to the antigen. Combined with the teachings provided herein, by choosingamong the various adjuvants and weighing factors such as potency, relative bioavailability,subject body weight, severity of adverse side-effects and preferred mode of administration, aneffective prophylactic or therapeutic treatment regimen can be planned which does not cause substantial toxicity and yet is effective to treat the particular subject. The effective amount for any particular application can vary depending on such factors as the disease or conditionbeing treated, the particular adjuvant being administered, the size of the subject, or theseverity of the disease or condition. CpG Adjuvants In some aspects, the immunogenic compositions described herein comprise C. difficiletoxoids, TxdA and TxdB, and an immunostimulatory oligonucleotide adjuvant. In a preferred aspect, the immunostimulatory oligonucleotide adjuvant is a CpGoligonucleotide, and most preferably a CpG oligodeoxynucleotides (CpG ODN), and accordingly these terms are used interchangeably unless otherwise indicated. A “CpG” refers to cytosine-phosphoguanosine (CpG) motif-containing oligodeoxynucleotide (CpG ODN), which is a toll-like receptor 9 (TLR9) agonist. A CpG oligonucleotide is a short nucleic acid molecule containing a cytosine followed by a guanine linked by a phosphate bond in which the pyrimidine ring of the cytosine is unmethylated. A CpG motif is a pattern of bases that include an unmethylated central CpG surrounded by at least one base flanking (on the 3' and the 5' side of) the central CpG. CpG oligonucleotides include both D and K oligonucleotides. The entire CpG oligonucleotide may be unmethylated or portions may be unmethylated. Examples of CpG oligonucleotides useful in the methods provided by the present disclosure include those disclosed in U.S. Patent Nos. 6194388, 6207646, 6214806, 628371 , 6239116, and 6339068. CpG oligonucleotides may encompass various chemical modifications and substitutions, in comparison to natural RNA and DNA, involving a phosphodiester internucleoside bridge, a beta -D-ribose (deoxyhbose) unit and / or a natural nucleoside base (adenine, guanine, cytosine, thymine, uracil). Examples of chemical modifications are known to the skilled person and are described, for example in Uhlmann E. et al. (1990), Chem. Rev. 90:543; "Protocols for Oligonucleotides and Analogs", Synthesis and Properties and Synthesis and Analytical Techniques, S. Agrawal, Ed., Humana Press, Totowa, USA 1993; Crooke, ST. et al. (1996) Annu. Rev. Pharmacol. Toxicol.36:107-129; and Hunziker J. et al., (1995), Mod. Synth. Methods 7:331 -417. Specifically, a CpG oligonucleotide can contain a modified cytosine. A modified cytosine is a naturally occurring or non-naturally occurring pyrimidine base analog of cytosine which can replace this base without impairing the immunostimulatoryactivity of the oligonucleotide. Modified cytosines include but are not limited to 5-substitutedcytosines (e.g. 5-methyl-cytosine, 5-fluorocytosine, 5-chloro-cytosine, 5-bromo-cytosine, 5-iodo- cytosine, 5-hydroxy-cytosine, 5- hydroxymethyl-cytosine, 5-difluoromethyl-cytosine, andunsubstituted or substituted 5- alkynyl-cytosine), 6-substituted cytosines, N4-substitutedcytosines (e.g. N4-ethyl- cytosine), 5-aza-cytosine, 2-mercapto-cytosine, isocytosine, pseudo-isocytosine, cytosine analogs with condensed ring systems (e.g. N,N'-propylene cytosine orphenoxazine), and uracil and its derivatives (e.g. 5-fluoro-uracil, 5-bromo- uracil, 5-bromovinyl-uracil, 4-thio-uracil, 5-hydroxy-uracil, 5-propynyl-uracil). Some of the preferredcytosines include 5-methyl-cytosine, 5-fluoro-cytosine, 5-hydroxy-cytosine, 5- hydroxymethyl-cytosine, and N4-ethyl-cytosine. A CpG oligonucleotide can also contain a modified guanine. A modified guanine is a naturally occurring or non-naturally occurring purine base analog of guanine which can replace this base without impairing the immunostimulatory activity of the oligonucleotide. Modified guanines include but are not limited to 7-deeazaguanine, 7-deaza-7-substituted guanine, hypoxanthine, N2-substituted guanines (e.g. N2-methyl-guanine), 5-amino-3-methyl-3H,6H- thiazolo[4,5-d]pyhmidine-2,7-dione, 2,6-diaminopuhne, 2-aminopuhne, purine, indole, adenine, substituted adenines (e.g. N6-methyl-adenine, 8-oxo-adenine), 8-substituted guanine (e.g.8-hydroxyguanine and 8-bromoguanine), and 6-thioguanine. In some aspects of the disclosure, the guanine base is substituted by a universal base (e.g.4-methyl-indole, 5- nitro-indole, and K-base), an aromatic ring system (e.g. benzimidazole or dichloro- benzimidazole, 1 -methyl-1 H-[1,2,4]triazole-3-carboxylic acid amide) or a hydrogen atom. In certain aspects, the CpG oligonucleotides include modified backbones. It has been demonstrated that modification of the nucleic acid backbone provides enhanced activity of nucleic acids when administered in vivo. Secondary structures, such as stem loops, can stabilize nucleic acids against degradation. Alternatively, nucleic acid stabilization can be accomplished via phosphate backbone modifications. A preferred stabilized nucleic acid has at least a partial phosphorothioate modified backbone. Phosphorothioates may be synthesized using automated techniques employing either phosphoramidate or H-phosphonate chemistries. Aryl- and alkyl-phosphonates can be made, e.g. as described inU.S. Patent No.4,469,863; and alkylphosphotriesters (in which the charged oxygen moiety is alkylated as described in U.S. Pat. No.5,023,243 and European Patent No.092,574) can be prepared by automated solid phase synthesis using commercially available reagents. Methods for making other DNA backbone modifications and substitutions have been described (Uhlmann, E. and Peyman, A. (1990) Chem. Rev.90:544; Goodchild, J. (1990) Bioconjugate Chem.1:165).2'-0-methyl nucleic acids with CpG motifs also cause immune activation, as do ethoxy-modified CpG nucleic acids. In fact, no backbone modifications have been found that completely abolish the CpG effect, although it is greatly reduced by replacing the C with a 5- methyl C. Constructs having phosphorothioate linkages provide maximal activity and protectthe nucleic acid from degradation by intracellular exo- and endo- nucleases.In one aspect of the invention the oligonucleotide includes at least onephosphorothioate linkage. In another aspect all internucleotide linkages of the oligonucleotideare phosphorothioate linkages. In another aspect the oligonucleotide includes at least onephosphodiester-like linkage. In another aspect the phosphodiester-like linkage is aphosphodiester linkage. In another aspect a lipophilic group is conjugated to theoligonucleotide. In one aspect the lipophilic group is cholesterol.In an embodiment, all the internucleotide linkage of the CpG oligonucleotides disclosed herein are phosphodiester bonds (“soft” oligonucleotides, as described in WO 2007 / 026190). In another embodiment, CpG oligonucleotides of the invention are rendered resistant todegradation (e.g., are stabilized). In an aspect, all the internucleotide linkage of the CpGoligonucleotides disclosed herein are phosphodiester bonds (“soft” oligonucleotides, as described in WO 2007 / 026190). In another aspect, CpG oligonucleotides of the invention are rendered resistant to degradation (e.g., are stabilized). The immunostimulatory oligonucleotides may have a chimeric backbone, which have combinations of phosphodiester and phosphorothioate linkages. For purposes of the instant invention, a chimeric backbone refers to a partially stabilized backbone, wherein at least one internucleotide linkage is phosphodiester or phosphodiester-like, and wherein at least one other internucleotide linkage is a stabilized internucleotide linkage, wherein the at least one phosphodiester or phosphodiester-like linkage and the at least one stabilized linkage are different. When the phosphodiester linkage is preferentially located within the CpG motif such molecules are called “semi-soft” as described in WO 2007 / 026190. Other modified oligonucleotides include phosphodiester modified oligonucleotides, combinations of phosphodiester and phosphorothioate oligonucleotides, methylphosphonate, methyl phosphorothioate, phosphorordithioate, p-ethoxy, and combinations thereof. Each of these combinations and their particular effects on immune cells is discussed in more detail with respect to CpG nucleic acids in PCT Publication Nos. WO 96 / 02555 and WO 98 / 18810 and in U.S. Pat. Nos.6,194,388 and 6,239,116. Mixed backbone modified ODN may be synthesized as described in WO 2007 / 026190.In an aspect, the CpG oligonucleotides disclosed herein may comprise substitutions ormodifications, such as in the bases and / or sugars as described in WO 2007 / 026190.In some aspects of the invention, CpG-containing nucleic acids might be mixed withimmunogenic carriers according to methods known to those skilled in the art (see, e.g., WO 03 / 024480). The CpG oligonucleotides may have one or two accessible 5' ends. It is possible to create modified oligonucleotides having two such 5' ends, for instance, by attaching two oligonucleotides through a 3'-3' linkage to generate an oligonucleotide having one or two accessible 5' ends. The 3'-3'-linkage may be a phosphodiester, phosphorothioate or any other modified internucleoside bridge. Methods for accomplishing such linkages are known in the art. For instance, such linkages have been described in Seliger, H. et al., Oligonucleotideanalogs with terminal 3'-3'- and 5'-5'-internucleotidic linkages as antisense inhibitors of viralgene expression, Nucleosides and Nucleotides (1991), 10(1-3), 469-77 and Jiang, et al., Pseudo-cyclic oligonucleotides: in vitro and in vivo properties, Bioorganic and Medicinal Chemistry (1999), 7(12), 2727-2735. Additionally, 3'-3'-linked oligonucleotides where the linkage between the 3'- terminalnucleosides is not a phosphodiester, phosphorothioate or other modified bridge, can beprepared using an additional spacer, such as tri- or tetra-ethyleneglycol phosphate moiety(Durand, M. et al., Triple-helix formation by an oligonucleotide containing one (dA)12 and two (dT)12 sequences bridged by two hexaethylene glycol chains, Biochemistry (1992), 31 (38), 9197-204, US Pat. Nos. 5,658,738 and 5,668,265). Alternatively, the non-nucleotidic linker may be derived from ethanediol, propanediol, or from an abasic deoxyhbose (dSpacer) unit (Fontanel, Marie Laurence et al., Nucleic Acids Research (1994), 22(11), 2022-7) using standard phosphoramidite chemistry. The non-nucleotidic linkers can be incorporated once or multiple times, or combined with each other allowing for any desirable distance between the 3'-ends of the two oligonucleotides to be linked. A phosphodiester internucleoside bridge located at the 3' and / or the 5' end of a nucleoside can be replaced by a modified internucleoside bridge, wherein the modified internucleoside bridge is for example selected from phosphorothioate, phosphorodithioate, NR1R2-phosphoramidate, boranophosphate, a-hydroxybenzyl phosphonate, phosphate-(C1- C21)-O-alkyl ester, phosphate-[(C6-C21)aryl-(C1-C21)-O-alkyl]ester, (C1-C8)alkylphosphonate and / or (C6-C12)arylphosphonate bridges, (C7-C-12)-a-hydroxymethyl-aryl (e.g. disclosed in PCT Publication No. WO 95 / 01363), wherein (C6-C12)aryl, (C6-C20)aryl and (C6-C14)aryl are optionally substituted by halogen, alkyl, alkoxy, nitro, cyano, and where R1 and R2 are,independently of each other, hydrogen, (C1-C18)-alkyl, (C6-C20)-aryl, (C6-C14)-aryl, (C1-C8)-alkyl, preferably hydrogen, (C1-C8)-alkyl, preferably (C1-C4)-alkyl and / or methoxyethyl, or R1and R2 form, together with the nitrogen atom carrying them, a 5 to 6-membered heterocyclic ring which can additionally contain a further heteroatom selected from the group O, S and N. The replacement of a phosphodiester bridge located at the 3' and / or the 5' end of a nucleoside by a dephospho bridge (dephospho bridges are described, for example, in Uhlmann E. and Peyman A. in "Methods in Molecular Biology", Vol. 20, "Protocols for Oligonucleotides and Analogs", S. Agrawal, Ed., Humana Press, Totowa 1993, Chapter 16, pp.355 ff), wherein a dephospho bridge is for example selected from the dephospho bridgesformacetal, 3'-thioformacetal, methylhydroxylamine, oxime, methylenedimethyl- hydrazo,dimethylenesulfone and / or silyl groups. Different classes of CpG immunostimulatory oligonucleotides have been identified andare described in greater detail in WO 2010 / 125480. Compositions and methods of the presentinvention include the use of these different classes of CpG immunostimulatoryoligonucleotides. In aspects of the invention, the immunostimulatory oligonucleotides include,but are not limited to, oligonucleotides that are A-Class, B-Class, C-Class, T-Class, P-Class or any Class with an E modification. In an aspect of the present invention, the immunogenic compositions as disclosedherein comprise an A class CpG ODN. In some aspects, the A class CpG oligonucleotide ofthe present invention comprises the nucleic acid sequence: 5’GGGGACGACGTCGTGGGGGGG 3’ (SEQ ID NO: 847). In any of the A class CpG oligonucleotide sequences, all of the linkages may be allphosphorothioate bonds. In another aspect, one or more of the linkages may bephosphodiester, preferably between the “C” and the “G” of the CpG motif making a semi-soft CpG oligonucleotide. In any of these sequences, an ethyl-uridine or a halogen may substitute for the 5' T; examples of halogen substitutions include but are not limited to bromo-uridine or iodo-uridine substitutions. In a preferred aspect of the present invention, the immunogenic compositions asdisclosed herein comprise a B class CpG ODN that preferentially activate B cells. In oneaspect, the CpG oligonucleotide of the present invention is a B class CpG oligonucleotiderepresented by at least the formula: 5' X1X2CGX3X4 3’, wherein X1, X2, X3, and X4 arenucleotides. In one embodiment, X2is adenine, guanine, or thymine. In another embodiment, X3is cytosine, adenine, or thymine. The B class CpG oligonucleotide sequences of thepresent invention may include those described in WO 96 / 02555, WO 98 / 18810 and U.S.Patent Nos.6,194,388; 6,207,646; 6,214,806; 6,218,371; 6,239,116 and 6,339,068. In some aspects, the B class CpG oligonucleotides of the present invention mayinclude, but are not limited to, the following nucleic acid sequences: 5’ TCGTCGTTTTTCGGTGCTTTT 3’ (SEQ ID NO: 48; CpG 24555),5’ TGACTGTGAACGTTCGAGATGA 3’ (SEQ ID NO: 841; CpG 1018);5' TCGTCGTTTTGTCGTTTTGTCGTT 3' (SEQ ID NO: 842; CpG 7909); 5' TCGTCGTTTTTCGGTCGTTTT 3' (SEQ ID NO: 843; CpG 10103);5’ TCCATGACGTTCCTGACGTT 3’ (SEQ ID NO: 844; CpG 1826);5’ TCGTCGTTTCGTCGTTTTGTCGTT 3’ (SEQ ID NO: 845); and5’ TCGTCGTTTTGTCGTTTTTTTCGA 3’ (SEQ ID NO: 846). In any of the B class CpG oligonucleotide sequences, all of the linkages may be allphosphorothioate bonds. In another aspect, in any of these sequences, one or more of the linkages may be phosphodiester, preferably between the “C” and the “G” of the CpG motif making a semi-soft CpG oligonucleotide. In any of these sequences, an ethyl-uridine or a halogen may substitute for the 5' T; examples of halogen substitutions include but are not limited to bromo-uridine or iodo-uridine substitutions. In a preferred aspect of the invention, the CpG ODN comprises the nucleic acidsequence 5’ T*C*G*T*C*G*T*T*T*T*T*C*G*G*T*G*C*T*T*T*T 3’ (SEQ ID NO: 48) wherein *indicates a phosphorothioate linkage. The CpG ODN of this sequence is known as CpG 24555, which is described in WO2010 / 067262. CpG 24555 is a TLR9 agonist with potent Th1 cell activity that stimulates strong B-cell and NK-cell activation.In an aspect of the present invention, the immunogenic compositions as disclosedherein comprise a C class CpG oligonucleotide. In some aspects, the C class CpGoligonucleotides of the present invention may include, but are not limited to, the following nucleic acid sequences: 5’ TCGCGTCGTTCGGCGCGCGCCG 3’ (SEQ ID NO: 848); 5’ TCGTCGACGTTCGGCGCGCGCCG 3’ (SEQ ID NO: 849); 5’ TCGGACGTTCGGCGCGCGCCG 3’ (SEQ ID NO: 850); 5’ TCGGACGTTCGGCGCGCCG 3’ (SEQ ID NO: 851); 5’ TCGCGTCGTTCGGCGCGCCG 3’ (SEQ ID NO: 852); 5’ TCGACGTTCGGCGCGCGCCG 3’ (SEQ ID NO: 853); 5’ TCGACGTTCGGCGCGCCG 3’ (SEQ ID NO: 854); 5’ TCGCGTCGTTCGGCGCCG 3’ (SEQ ID NO: 855); 5’ TCGCGACGTTCGGCGCGCGCCG 3’ (SEQ ID NO: 856); 5’ TCGTCGTTTTCGGCGCGCGCCG 3’ (SEQ ID NO: 857); 5’ TCGTCGTTTTCGGCGGCCGCCG 3’ (SEQ ID NO: 858); 5’ TCGTCGTTTTACGGCGCCGTGCCG 3’ (SEQ ID NO: 859); and 5’ TCGTCGTTTTCGGCGCGCGCCGT 3’ (SEQ ID NO: 860). In any of the C class CpG oligonucleotide sequences, all of the linkages may be allphosphorothioate bonds. In another embodiment, in any of these sequences, one or more of the linkages may be phosphodiester, preferably between the “C” and the “G” of the CpG motifmaking a semi-soft CpG oligonucleotide. In any of these sequences, an ethyl-uridine or ahalogen may substitute for the 5' T; examples of halogen substitutions include but are not limited to bromo-uridine or iodo-uridine substitutions. In an aspect of the present invention, the immunogenic compositions as disclosedherein comprise a P class CpG Oligonucleotide. In some aspects, the CpG oligonucleotidesof the present invention may include a P class CpG oligonucleotide containing a 5' TLRactivation domain and at least two palindromic regions, one palindromic region being a 5' palindromic region of at least 6 nucleotides in length and connected to a 3' palindromic region of at least 8 nucleotides in length either directly or through a spacer, wherein theoligonucleotide includes at least one YpR dinucleotide. In one aspect, the P class CpGoligonucleotide includes at least one unmethylated CpG dinucleotide. In another aspect, theTLR activation domain is TCG, TTCG, TTTCG, TYpR, TTYpR, TTTYpR, UCG, UUCG,UUUCG, TTT, or TTTT. In yet another aspect, the TLR activation domain is within the 5'palindromic region. In another aspect, the TLR activation domain is immediately 5' to the 5'palindromic region. In some aspects, the P class CpG oligonucleotides of the inventioncomprise the nucleic acid sequence: 5’ TCGTCGACGATCGGCGCGCGCCG 3’ (SEQ ID NO:861).In any of the P class CpG oligonucleotide sequences, all of the linkages may be allphosphorothioate bonds. In another aspect, one or more of the linkages may bephosphodiester, preferably between the “C” and the “G” of the CpG motif making a semi-soft CpG oligonucleotide. In any of these sequences, an ethyl-uridine or a halogen may substitute for the 5' T; examples of halogen substitutions include but are not limited to bromo-uridine or iodo-uridine substitutions. The immunogenic compositions comprising a CpG adjuvant may further comprise abuffer. Exemplary buffers include phosphate (such as potassium phosphate, sodiumphosphate); acetate (such as sodium acetate); succinate (such as sodium succinate); glycine; histidine; carbonate, Tris (tris(hydroxymethyl)aminomethane), and / or bicarbonate (such as ammonium bicarbonate) buffers. In a preferred aspect, the CpG adjuvant may include a histidine buffer. Preferredamounts of histidine buffer include a concentration from about 1 mM, 5 mM, 6 mM, 7 mM, 8 mM, 9 mM, 10 mM, 11 mM, 12 mM, 13 mM, 14 mM, 15 mM, 16 mM, 17 mM, 18 mM, 19 mM,20 mM, 50 mM, or 100 mM. In one aspect, the CpG adjuvant includes histidine buffer at aconcentration of about 5 mM to about 15 mM histidine buffer. In one aspect, the CpG adjuvantincludes histidine buffer at a concentration of about 8 mM to about 12 mM. In a preferredaspect, the CpG adjuvant includes histidine buffer at a concentration of about 10 mM.In another aspect, the CpG adjuvant may include a phosphate buffer. Preferredamounts of phosphate buffer include a concentration from about 1 mM, 5 mM, 6 mM, 7 mM, 8 mM, 9 mM, 10 mM, 11 mM, 12 mM, 13 mM, 14 mM, 15 mM, 16 mM, 17 mM, 18 mM, 19mM, 20 mM, 50 mM, or 100 mM. In one aspect, the CpG adjuvant includes phosphate bufferat a concentration of about 10 mM to about 25 mM. In a preferred aspect, the CpG adjuvantincludes phosphate buffer at a concentration of about 20 mM phosphate. The CpG adjuvant may further comprise a salt. Exemplary salts include magnesium chloride, potassium chloride, sodium chloride and a combination thereof. In a preferred aspect, the CpG adjuvant may include sodium chloride (NaCl). Preferredamounts of sodium chloride include a concentration from a minimum of about 10 mM, 20 mM, 25 mM, 30 mM, 40 mM, 50 mM, 60 mM, 75 mM, 80 mM, 90 mM, 100 mM, 125 mM, 150 mM, 175 mM, 200 mM, 225 mM, 250 mM, 270 mM, or 300 mM. In a preferred aspect, the CpGadjuvant includes sodium chloride at a concentration of about 20 to about 100 mM. In apreferred aspect, the CpG adjuvant includes sodium chloride at a concentration of about 40to about 200 mM. In a preferred aspect, the CpG adjuvant includes sodium chloride at aconcentration of about 50 mM. In another preferred aspect, the CpG adjuvant includes sodiumchloride at a concentration of about 60 mM. Doses of the CpG oligonucleotides describe herein may range from about 0.1 µg to 50mg per dose depending on the application. In some aspects, the dose may range from about10 µg to 10 mg per administration. In some aspects, the immunogenic composition comprisesCpG alone, without an additional adjuvant. In some aspects, the immunogenic composition comprises CpG and an additional adjuvant. In one aspect, the immunogenic composition comprises about 0.1 to 5 mg / mL orhigher of CpG, including at least about 0.1 mg / mL, at least about 0.5 mg / mL, at least about 1.0 mg / mL, at least about 1.1 mg / mL, at least about 1.2 mg / mL, at least about 1.3 mg / mL, at least about 1.4 mg / mL, at least about 1.5 mg / mL, at least about 1.6 mg / mL, at least about 1.7 mg / mL, at least about 1.8 mg / mL, at least about 1.9 mg / mL, at least about 2.0 mg / mL, at least about 2.1 mg / mL, at least about 2.2 mg / mL, at least about 2.3 mg / mL, at least about 2.4 mg / mL, at least about 2.5 mg / mL, at least about 3.0 mg / mL, at least about 3.1 mg / mL, at least about 3.2 mg / mL, at least about 3.3 mg / mL, at least about 3.4 mg / mL, at least about 3.5 mg / mL, at least about 3.6 mg / mL, at least about 3.7 mg / mL, at least about 3.8 mg / mL, at least about 3.9 mg / mL, at least about 4.0 mg / mL, at least about 4.5 mg / mL, at least about 5.0mg / mL or higher of CpG.In one aspect, the immunogenic composition comprises about 0.1 to about 1.0 mg / mLof CpG. In one preferred aspect, the immunogenic composition comprises about 0.5 mg / mLof CpG. In one preferred aspect, the immunogenic composition comprises about 0.5 mg / mLof CpG alone. In one aspect, the immunogenic composition comprises about 0.1 to about 1.0mg / mL of CpG 24555. In one preferred aspect, the immunogenic composition comprises about0.5 mg / mL of CpG 24555. In one preferred aspect, the immunogenic composition comprisesabout 0.5 mg / mL of CpG 24555 alone.In one aspect, the immunogenic composition comprises about 0.5 to about 1.5 mg / mLof CpG. In one preferred aspect, the immunogenic composition comprises about 1.0 mg / mLof CpG. In one preferred aspect, the immunogenic composition comprises about 1.0 mg / mLof CpG alone. In one aspect, the immunogenic composition comprises about 0.5 to about 1.5mg / mL of CpG 24555. In one preferred aspect, the immunogenic composition comprises about1.0 mg / mL of CpG 24555. In one preferred aspect, the immunogenic composition comprisesabout 1.0 mg / mL of CpG 24555 alone.In one aspect, the immunogenic composition comprises about 0.8 to about 1.8 mg / mLof CpG. In one preferred aspect, the immunogenic composition comprises about 1.2 mg / mLof CpG. In one preferred aspect, the immunogenic composition comprises about 1.2 mg / mLof CpG alone. In one aspect, the immunogenic composition comprises about 0.8 to about 1.8mg / mL of CpG 24555. In one preferred aspect, the immunogenic composition comprises about1.2 mg / mL of CpG 24555. In one preferred aspect, the immunogenic composition comprisesabout 1.2 mg / mL of CpG 24555 alone.In one aspect, the immunogenic composition comprises about 3.0 to about 4.0 mg / mLof CpG. In one preferred aspect, the immunogenic composition comprises about 3.6 mg / mLof CpG. In one preferred aspect, the immunogenic composition comprises about 3.6 mg / mLof CpG alone. In one aspect, the immunogenic composition comprises about 3.0 to about 4.0mg / mL of CpG 24555. In one preferred aspect, the immunogenic composition comprises about3.6 mg / mL of CpG 24555. In one preferred aspect, the immunogenic composition comprisesabout 3.6 mg / mL of CpG 24555 alone.In a preferred aspect, an immunogenic composition comprises lyophilized C. difficiletoxoid A and toxoid B, reconstituted with a CpG adjuvant comprising about 3.6 mg / mL of CpG24555 (high-dose CpG). In a preferred aspect, an immunogenic composition compriseslyophilized C. difficile toxoids A and B, reconstituted with a CpG adjuvant comprising about3.6 mg / mL of CpG 24555 in 10mM histidine, 60mM NaCl at pH 6.5 (high-dose CpG). In apreferred aspect, the composition is administered at a dose volume of 0.5 mL. In a preferred aspect, an immunogenic composition comprises lyophilized C. difficiletoxoid A and toxoid B, reconstituted with a CpG adjuvant comprising about 3.6 mg / mL of CpG24555 alone (high-dose CpG). In a preferred aspect, an immunogenic composition compriseslyophilized C. difficile toxoids A and B, reconstituted with a CpG adjuvant comprising about3.6 mg / mL of CpG 24555 alone in 10mM histidine, 60mM NaCl at pH 6.5 (high-dose CpG). Ina preferred aspect, the composition is administered at a dose volume of 0.5 mL. In a preferred aspect, an immunogenic composition comprises lyophilized C. difficiletoxoid A and toxoid B at 0.4 mg / mL total (200 μg / mL of toxoid A and 200 μg / mL of toxoid B),reconstituted with a CpG adjuvant comprising about 3.6 mg / mL of CpG 24555 (high-doseCpG). In a preferred aspect, an immunogenic composition comprises lyophilized C. difficiletoxoid A and toxoid B at 0.4 mg / mL total (200 μg / mL of toxoid A and 200 μg / mL of toxoid B),reconstituted with a CpG adjuvant comprising about 3.6 mg / mL of CpG 24555 in 10mMhistidine, 60mM NaCl at pH 6.5 (high-dose CpG). In a preferred aspect, the composition isadministered at a dose volume of 0.5 mL. In a preferred aspect, an immunogenic composition comprises lyophilized C. difficiletoxoid A and toxoid B at 0.4 mg / mL total (200 μg / mL of toxoid A and 200 μg / mL of toxoid B),reconstituted with a CpG adjuvant comprising about 3.6 mg / mL of CpG 24555 alone (high-dose CpG). In a preferred aspect, an immunogenic composition comprises lyophilized C.difficile toxoid A and toxoid B at 0.4 mg / mL total (200 μg / mL of toxoid A and 200 μg / mL oftoxoid B), reconstituted with a CpG adjuvant comprising about 3.6 mg / mL of CpG 24555 alonein 10mM histidine, 60mM NaCl at pH 6.5 (high-dose CpG). In a preferred aspect, thecomposition is administered at a dose volume of 0.5 mL. The immunogenic compositions comprising CpG adjuvants disclosed herein mayfurther comprise an additional adjuvant.In an aspect, the immunogenic compositions comprising CpG adjuvants disclosedherein may further comprise aluminum salts (alum) (e.g., aluminum phosphate, aluminumsulfate or aluminum hydroxide). In one aspect, the immunogenic compositions comprisingCpG adjuvants further comprise aluminum phosphate or aluminum hydroxide (Al(OH)3) as adjuvant. In a preferred aspect, the immunogenic compositions comprising CpG adjuvants further comprise aluminum hydroxide (Al(OH)3). In one aspect, the immunogenic compositions comprising CpG may further compriseabout 0.1 to 5 mg / mL or higher of Al(OH)3, including at least about 0.1 mg / mL, at least about0.5 mg / mL, at least about 1.0 mg / mL, at least about 1.1 mg / mL, at least about 1.2 mg / mL, at least about 1.3 mg / mL, at least about 1.4 mg / mL, at least about 1.5 mg / mL, at least about 1.6 mg / mL, at least about 1.7 mg / mL, at least about 1.8 mg / mL, at least about 1.9 mg / mL, at least about 2.0 mg / mL, at least about 2.1 mg / mL, at least about 2.2 mg / mL, at least about 2.3 mg / mL, at least about 2.4 mg / mL, at least about 2.5 mg / mL, at least about 3.0 mg / mL, at least about 3.1 mg / mL, at least about 3.2 mg / mL, at least about 3.3 mg / mL, at least about 3.4mg / mL, at least about 3.5 mg / mL, at least about 3.6 mg / mL, at least about 3.7 mg / mL, at leastabout 3.8 mg / mL, at least about 3.9 mg / mL, at least about 4.0 mg / mL, at least about 4.5mg / mL, at least about 5.0 mg / mL or higher of Al(OH)3.In one aspect, the immunogenic compositions comprising CpG may further compriseabout 0.5 to about 2.5 mg / mL of Al(OH)3. In one aspect, the immunogenic compositionscomprising CpG may further comprise about 1.0 to about 2.5 mg / mL of Al(OH)3. In one aspect,the immunogenic compositions comprising CpG may further comprise about 1.5 to about 2.5mg / mL of Al(OH)3. In one preferred aspect, the immunogenic compositions comprising CpGmay further comprise about 1.0 mg / mL of Al(OH)3. In one preferred aspect, the immunogeniccompositions comprising CpG may further comprise about 1.5 mg / mL of Al(OH)3. In onepreferred aspect, the immunogenic compositions comprising CpG may further comprise about1.7 mg / mL of Al(OH)3. In one preferred aspect, the immunogenic compositions comprisingCpG may further comprise about 1.8 mg / mL of Al(OH)3. In one preferred aspect, theimmunogenic compositions comprising CpG adjuvants further comprise about 2.0 mg / mL ofAl(OH)3. In one preferred aspect, the immunogenic compositions comprising CpG adjuvantsfurther comprise about 2.5 mg / mL of Al(OH)3.In one aspect, the immunogenic compositions comprise about 0.5 mg / mL or higher ofCpG (e.g. CpG 24555) and 1.0 mg / mL or higher of Al(OH)3.In one aspect, the immunogenic compositions comprise about 0.5 / 1.0, 0.5 / 1.5, 0.5 / 1.6,0.5 / 1.7, 0.5 / 1.8, 0.5 / 1.9, 0.5 / 2.0, 0.5 / 2.5 mg / mL or higher of CpG / Al(OH)3. In one aspect, theimmunogenic compositions comprise about 1.0 / 1.0, 1.0 / 1.5, 1.0 / 1.6, 1.0 / 1.7, 1.0 / 1.8, 1.0 / 1.9,1.0 / 2.0, 1.0 / 2.5 mg / mL or higher of CpG / Al(OH)3. In one aspect, the immunogeniccompositions comprise about 1.1 / 1.0, 1.1 / 1.5, 1.1 / 1.6, 1.1 / 1.7, 1.1 / 1.8, 1.1 / 1.9, 1.1 / 2.0, 1.1 / 2.5mg / mL or higher of CpG / Al(OH)3. In one aspect, the immunogenic compositions compriseabout 1.2 / 1.0, 1.2 / 1.5, 1.2 / 1.6, 1.2 / 1.7, 1.2 / 1.8, 1.2 / 1.9, 1.2 / 2.0, 1.2 / 2.5 mg / mL or higher ofCpG / Al(OH)3. In one aspect, the immunogenic compositions comprise about 1.3 / 1.0, 1.3 / 1.5,1.3 / 1.6, 1.3 / 1.7, 1.3 / 1.8, 1.3 / 1.9, 1.3 / 2.0, 1.3 / 2.5 mg / mL or higher of CpG / Al(OH)3. In oneaspect, the immunogenic compositions comprise about 1.4 / 1.0, 1.4 / 1.5, 1.4 / 1.6, 1.4 / 1.7,1.4 / 1.8, 1.4 / 1.9, 1.4 / 2.0, 1.4 / 2.5 mg / mL or higher of CpG / Al(OH)3. In one aspect, theimmunogenic compositions comprise about 1.5 / 1.0, 1.5 / 1.5, 1.5 / 1.6, 1.5 / 1.7, 1.5 / 1.8, 1.5 / 1.9,1.5 / 2.0, 1.5 / 2.5 mg / mL or higher of CpG / Al(OH)3. In one aspect, the immunogeniccompositions comprise about 1.6 / 1.0, 1.6 / 1.5, 1.6 / 1.6, 1.6 / 1.7, 1.6 / 1.8, 1.6 / 1.9, 1.6 / 2.0, 1.6 / 2.5mg / mL or higher of CpG / Al(OH)3. In one aspect, the immunogenic compositions compriseabout 1.7 / 1.0, 1.7 / 1.5, 1.7 / 1.6, 1.7 / 1.7, 1.7 / 1.8, 1.7 / 1.9, 1.7 / 2.0, 1.7 / 2.5 mg / mL or higher ofCpG / Al(OH)3. In one aspect, the immunogenic compositions comprise about 1.8 / 1.0, 1.8 / 1.5,1.8 / 1.6, 1.8 / 1.7, 1.8 / 1.8, 1.8 / 1.9, 1.8 / 2.0, 1.8 / 2.5 mg / mL or higher of CpG / Al(OH)3. In oneaspect, the immunogenic compositions comprise about 1.9 / 1.0, 1.9 / 1.5, 1.9 / 1.6, 1.9 / 1.7,1.9 / 1.8, 1.9 / 1.9, 1.9 / 2.0, 1.9 / 2.5 mg / mL or higher of CpG / Al(OH)3. In one aspect, theimmunogenic compositions comprise about 2.0 / 1.0, 2.0 / 1.5, 2.0 / 1.6, 2.0 / 1.7, 2.0 / 1.8, 2.0 / 1.9,2.0 / 2.0, 2.0 / 2.5 mg / mL or higher of CpG / Al(OH)3. In one aspect, the immunogeniccompositions comprise about 2.1 / 1.0, 2.1 / 1.5, 2.1 / 1.6, 2.1 / 1.7, 2.1 / 1.8, 2.1 / 1.9, 2.1 / 2.0, 2.1 / 2.5mg / mL or higher of CpG / Al(OH)3. In one aspect, the immunogenic compositions compriseabout 2.2 / 1.0, 2.2 / 1.5, 2.2 / 1.6, 2.2 / 1.7, 2.2 / 1.8, 2.2 / 1.9, 2.2 / 2.0, 2.2 / 2.5 mg / mL or higher ofCpG / Al(OH)3. In one aspect, the immunogenic compositions comprise about 2.3 / 1.0, 2.3 / 1.5,2.3 / 1.6, 2.3 / 1.7, 2.3 / 1.8, 2.3 / 1.9, 2.3 / 2.0, 2.3 / 2.5 mg / mL or higher of CpG / Al(OH)3. In oneaspect, the immunogenic compositions comprise about 2.4 / 1.0, 2.4 / 1.5, 2.4 / 1.6, 2.4 / 1.7,2.4 / 1.8, 2.4 / 1.9, 2.4 / 2.0, 2.4 / 2.5 mg / mL or higher of CpG / Al(OH)3. In one aspect, theimmunogenic compositions comprise about 2.5 / 1.0, 2.5 / 1.5, 2.5 / 1.6, 2.5 / 1.7, 2.5 / 1.8, 2.5 / 1.9,2.5 / 2.0, 2.5 / 2.5 mg / mL or higher of CpG / Al(OH)3.In a preferred aspect, an immunogenic composition comprises lyophilized C. difficiletoxoid A and toxoid B, reconstituted with a CpG adjuvant comprising about 1.0 mg / mL of CpG24555 and about 1.5 mg / mL of Al(OH)3 (low-dose CpG). In a preferred aspect, animmunogenic composition comprises lyophilized C. difficile toxoid A and toxoid B,reconstituted with a CpG adjuvant comprising about 1.0 mg / mL of CpG 24555 and about 1.5mg / mL of Al(OH)3 in 10mM histidine, 50mM NaCl at pH 6.5 (low-dose adjuvant). In a preferredaspect, the composition is administered at a dose volume of 0.5 mL. In a preferred aspect, an immunogenic composition comprises lyophilized C. difficiletoxoid A and toxoid B at 0.4 mg / mL total (200 μg / mL of toxoid A and 200 μg / mL of toxoid B),reconstituted with about 1.0 mg / mL of CpG 24555 and about 1.5 mg / mL of Al(OH)3 (low-doseadjuvant). In a preferred aspect, an immunogenic composition comprises lyophilized C.difficile toxoid A and toxoid B total (200 μg / mL of toxoid A and 200 μg / mL of toxoid B),reconstituted with about 1.0 mg / mL of CpG 24555 and about 1.5 mg / mL of Al(OH)3 in 10mMhistidine, 50mM NaCl at pH 6.5 (low-dose adjuvant). In a preferred aspect, the composition isadministered at a dose volume of 0.5 mL. In one aspect, the immunogenic compositions comprise about 3.0 / 1.0, 3.0 / 1.5, 3.0 / 1.6,3.0 / 1.7, 3.0 / 1.8, 3.0 / 1.9, 3.0 / 2.0, 3.0 / 2.5 mg / mL or higher of CpG / Al(OH)3. In one aspect, theimmunogenic compositions comprise about 3.1 / 1.0, 3.1 / 1.5, 3.1 / 1.6, 3.1 / 1.7, 3.1 / 1.8, 3.1 / 1.9,3.1 / 2.0, 3.1 / 2.5 mg / mL or higher of CpG / Al(OH)3. In one aspect, the immunogeniccompositions comprise about 3.2 / 1.0, 3.2 / 1.5, 3.2 / 1.6, 3.2 / 1.7, 3.2 / 1.8, 3.2 / 1.9, 3.2 / 2.0, 3.2 / 2.5mg / mL or higher of CpG / Al(OH)3. In one aspect, the immunogenic compositions compriseabout 3.3 / 1.0, 3.3 / 1.5, 3.3 / 1.6, 3.3 / 1.7, 3.3 / 1.8, 3.3 / 1.9, 3.3 / 2.0, 3.3 / 2.5 mg / mL or higher ofCpG / Al(OH)3. In one aspect, the immunogenic compositions comprise about 3.4 / 1.0, 3.4 / 1.5,3.4 / 1.6, 3.4 / 1.7, 3.4 / 1.8, 3.4 / 1.9, 3.4 / 2.0, 3.4 / 2.5 mg / mL or higher of CpG / Al(OH)3. In oneaspect, the immunogenic compositions comprise about 3.5 / 1.0, 3.5 / 1.5, 3.5 / 1.6, 3.5 / 1.7,3.5 / 1.8, 3.5 / 1.9, 3.5 / 2.0, 3.5 / 2.5 mg / mL or higher of CpG / Al(OH)3. In one aspect, theimmunogenic compositions comprise about 3.6 / 1.0, 3.6 / 1.5, 3.6 / 1.6, 3.6 / 1.7, 3.6 / 1.8, 3.6 / 1.9,3.6 / 2.0, 3.6 / 2.5 mg / mL or higher of CpG / Al(OH)3. In one aspect, the immunogeniccompositions comprise about 3.7 / 1.0, 3.7 / 1.5, 3.7 / 1.6, 3.7 / 1.7, 3.7 / 1.8, 3.7 / 1.9, 3.7 / 2.0, 3.7 / 2.5mg / mL or higher of CpG / Al(OH)3. In one aspect, the immunogenic compositions compriseabout 3.8 / 1.0, 3.8 / 1.5, 3.8 / 1.6, 3.8 / 1.7, 3.8 / 1.8, 3.8 / 1.9, 3.8 / 2.0, 3.8 / 2.5 mg / mL or higher ofCpG / Al(OH)3. In one aspect, the immunogenic compositions comprise about 3.9 / 1.0, 3.9 / 1.5,3.9 / 1.6, 3.9 / 1.7, 3.9 / 1.8, 3.9 / 1.9, 3.9 / 2.0, 3.9 / 2.5 mg / mL or higher of CpG / Al(OH)3. In oneaspect, the immunogenic compositions comprise about 4.0 / 1.0, 4.0 / 1.5, 4.0 / 1.6, 4.0 / 1.7,4.0 / 1.8, 4.0 / 1.9, 4.0 / 2.0, 4.0 / 2.5 mg / mL or higher of CpG / Al(OH)3. In one aspect, theimmunogenic compositions comprise about 4.5 / 1.0, 4.5 / 1.5, 4.5 / 1.6, 4.5 / 1.7, 4.5 / 1.8, 4.5 / 1.9,4.5 / 2.0, 4.5 / 2.5 mg / mL or higher of CpG / Al(OH)3. In one aspect, the immunogeniccompositions comprise about 5.0 / 1.0, 5.0 / 1.5, 5.0 / 1.6, 5.0 / 1.7, 5.0 / 1.8, 5.0 / 1.9, 5.0 / 2.0, 5.0 / 2.5mg / mL or higher of CpG / Al(OH)3.Saponin Containing Liposomal AdjuvantsIn some aspects, the immunogenic compositions described herein comprise C. difficiletoxoids, TxdA and TxdB, and a saponin containing liposomal adjuvant.The saponin containing liposomal adjuvant may include, but is not limited to,STIMULON™ (QS-21 (Quillaja Saponaria-21), which is a triterpene glycoside or saponin,Aquila, Framingham, Mass.) or particles generated therefrom such as ISCOMs (immune stimulating complexes) and ISCOMATRIX ® adjuvant. Accordingly, the compositions of the present invention may be delivered in the form of ISCOMs, ISCOMS containing CTB, liposomes or encapsulated in compounds such as acrylates or poly(DL-lactide-co-glycoside) to form microspheres of a size suited to adsorption. Typically, the term “ISCOM” refers to immunogenic complexes formed between glycosides, such as triterpenoid saponins (particularly Quil A), and antigens which contain a hydrophobic region. In a preferred aspect, the adjuvant is an ISCOMATRIX adjuvant. In a further preferred aspect, the saponin containing liposomal adjuvant comprises atleast one saponin and a monophosphoryl lipid A (MPLA)-containing liposome composition. Inone aspect, the saponin containing liposomal adjuvant comprises at least one saponin and amonophosphoryl lipid A (MPLA)-containing liposome composition, wherein the liposome composition comprises i) a lipid bilayer comprising phospholipids and ii) cholesterol. In one aspect, the saponin may be selected from QS-7, QS-18, QS-21, or a mixture thereof. Preferably, the saponin is QS-21. In one aspect, the phospholipid is selected from dimyristoyl phosphatidylcholine (DMPC), dipalmitoyl phosphatidylcholine (DPPC), distearyl phosphatidylcholine (DSPC), dimyristoyl phosphatidylglycerol (DMPG), dipalmitoyl phosphatidylglycerol (DPPG), anddistearyl phosphatidylglycerol (DSPG). Preferably the phospholipids are DMPC and DMPG.In a preferred aspect, the saponin containing liposomal adjuvant comprises QS-21,MPLA, DMPC, DMPG and cholesterol. In a preferred aspect, the saponin containing liposomaladjuvant comprises QS-21, MPLA, DMPC, DMPG and cholesterol in a phosphate buffer.® ® MPLA is preferably Monophosphoryl 3-Deacyl Lipid A (also known as 3D-PHAD ).3D-PHADis a synthetic analogue of MPLA derived from Salmonella Minnesota. In a preferred aspect,the saponin containing liposomal adjuvant comprises QS-21, MPLA (3D-PHAD® ), DMPC, DMPG and cholesterol. In one aspect, the immunogenic composition comprises about 0.05 to about 1.0 mg / mL or higher of QS-21, including about 0.05 mg / mL, about 0.1 mg / mL, about 0.2 mg / mL, about 0.3 mg / mL, about 0.4 mg / mL, about 0.5 mg / mL, about 0.6 mg / mL, about 0.7 mg / mL, about0.8 mg / mL, about 0.9 mg / mL or about 1.0 mg / mL or higher of QS-21.In one aspect, the immunogenic composition comprises about 0.1 to about 0.4 mg / mL of QS-21. In one preferred aspect, the immunogenic composition comprises about 0.2 mg / mL of QS-21. In one aspect, the immunogenic composition comprises about 0.1 to about 1.0mg / mLor higher of MPLA, including about 0.1 mg / mL, about 0.2 mg / mL, about 0.3 mg / mL, about 0.4mg / mL, about 0.5 mg / mL, about 0.6 mg / mL, about 0.7 mg / mL, about 0.8 mg / mL, about 0.9mg / mL or about 1.0 mg / mL or higher of MPLA (preferably Monophosphoryl 3-Deacyl Lipid A).In one aspect, the immunogenic composition comprises about 0.2 to about 0.6 mg / mL of MPLA (preferably Monophosphoryl 3-Deacyl Lipid A). In one preferred aspect, the immunogenic composition comprises about 0.3 to about0.5 mg / mL of MPLA (preferably Monophosphoryl 3-Deacyl Lipid A).In one preferred aspect, the immunogenic composition comprises about 0.4 mg / mL ofMPLA (preferably Monophosphoryl 3-Deacyl Lipid A). In one aspect, the immunogenic composition comprises about 0.5 to about 20 mg / mLor higher of cholesterol, including about 1.0 mg / mL, about 2.0 mg / mL, about 3.0 mg / mL, about4.0 mg / mL, about 5.0 mg / mL, about 6.0 mg / mL, about 7.0 mg / mL, about 8.0 mg / mL, about 9.0 mg / mL, about 10.0 mg / mL, about 11.0 mg / mL, about 12.0 mg / mL, about 13.0 mg / mL, about 14.0 mg / mL, about 15.0 mg / mL, about 16.0 mg / mL, about 17.0 mg / mL, about 18.0mg / mL, about 19.0 mg / mL, about 20.0 mg / mL or higher of cholesterol.In one aspect, the immunogenic composition comprises about 5 to about 15 mg / mL ofcholesterol. In one preferred aspect, the composition comprises about 11 mg / mL ofcholesterol. In one aspect, the immunogenic composition comprises about 0.5 to about 20 mg / mL or higher of DMPC, including about 0.5 mg / mL, about 1.0 mg / mL, about 2.0 mg / mL, about 3.0 mg / mL, about 4.0 mg / mL, about 5.0 mg / mL, about 6.0 mg / mL, about 7.0 mg / mL, about 8.0 mg / mL, about 9.0 mg / mL, about 10.0 mg / mL, about 11.0 mg / mL, about 12.0 mg / mL, about 13.0 mg / mL, about 14.0 mg / mL, about 15.0 mg / mL, about 16.0 mg / mL, about 17.0 mg / mL,about 18.0 mg / mL, about 19.0 mg / mL, about 20.0 mg / mL or higher of DMPC.In one aspect, the immunogenic composition comprises about 5 to about 20 mg / mL ofDMPC. In one aspect, the immunogenic composition comprises about 5 to about 15 mg / mL of DMPC. In one preferred aspect, the immunogenic composition comprises about 14 mg / mL of DMPC. In one aspect, the immunogenic composition comprises about 0.5 to about 3.0 mg / mL or higher of DMPG, including about 0.5 mg / mL, about 0.6 mg / mL, about 0.7 mg / mL, about 0.8 mg / mL, about 0.9 mg / mL, about 1.0 mg / mL, about 1.1 mg / mL, about 1.2 mg / mL, about 1.3 mg / mL, about 1.4 mg / mL, about 1.5 mg / mL, about 1.6 mg / mL, about 1.7 mg / mL, about 1.8mg / mL, about 1.9 mg / mL, about 2.0 mg / mL or higher, at least about 2.5 mg / mL, or at leastabout 3.0 mg / mL or higher of DMPG.In one aspect, the immunogenic composition comprises about 1.0 to about 2.0 mg / mL of DMPG. In one preferred aspect, the immunogenic composition comprises about 1.6 mg / mL of DMPG. In a preferred aspect, the immunogenic composition comprising a saponin containingliposomal adjuvant comprises QS-21 at about 0.2 mg / mL, Monophosphoryl 3-Deacyl Lipid A® (also known as 3D-PHAD ) at about 0.4 mg / mL, DMPC at about 14 mg / mL, DMPG about 1.6mg / mL and cholesterol at about 11 mg / mL (LiNA-2).In another aspect, the immunogenic composition comprising a saponin containingliposomal adjuvant comprises QS-21 at about 0.4 mg / mL, Monophosphoryl 3-Deacyl Lipid A ® (also known as 3D-PHAD ) at about 0.8 mg / mL, DMPC at about 28 mg / mL, DMPG about 3.2mg / mL and cholesterol at about 22 mg / mL.In another aspect, the immunogenic composition comprising a saponin containingliposomal adjuvant comprises QS-21 at about 0.1 mg / mL, Monophosphoryl 3-Deacyl Lipid A® (also known as 3D-PHAD ) at about 0.2 mg / mL, DMPC at about 7 mg / mL, DMPG about 0.8mg / mL and cholesterol at about 5.5 mg / mL.In another aspect, the immunogenic composition comprising a saponin containingliposomal adjuvant may further comprise a buffer. Exemplary buffers include phosphate (suchas potassium phosphate, sodium phosphate); acetate (such as sodium acetate); succinate (such as sodium succinate); glycine; histidine; carbonate, Tris (tris(hydroxymethyl)aminomethane), and / or bicarbonate (such as ammonium bicarbonate) buffers. In a preferred aspect, the compositions comprising a saponin containing liposomaladjuvant may include a phosphate buffer. Preferred amounts of phosphate buffer include aconcentration from 1 mM, 5 mM, 6 mM, 7 mM, 8 mM, 9 mM, 10 mM, 11 mM, 12 mM, 13 mM,14 mM, 15 mM, 16 mM, 17 mM, 18 mM, 19 mM, 20 mM, 50 mM, or 100 mM. In one aspect,the saponin containing liposomal adjuvant includes phosphate buffer at a concentration ofabout 5 mM to about 15 mM. In one aspect, the saponin containing liposomal adjuvantincludes phosphate buffer at a concentration of about 8 mM to 12 mM. In a preferred aspect,the saponin containing liposomal adjuvant includes phosphate buffer at a concentration ofabout 10 mM. The saponin containing liposomal adjuvant may further comprise a salt. Exemplarysalts include magnesium chloride, potassium chloride, sodium chloride and a combination thereof. In a preferred aspect, the saponin containing liposomal adjuvant includes sodiumchloride (NaCl). Preferred amounts of sodium chloride include a concentration from a minimum of about 10 mM, 20 mM, 25 mM, 30 mM, 40 mM, 50 mM, 60 mM, 75 mM, 80 mM, 90 mM, 100 mM, 125 mM, 150 mM, 175 mM, 200 mM, 225 mM, 250 mM, 270 mM, or 300mM. In a preferred aspect, the saponin containing liposomal adjuvant includes sodiumchloride at a concentration of about 100 to about 200 mM. In a preferred aspect, the saponincontaining liposomal adjuvant includes sodium chloride at a concentration of about 150 mM.In a preferred aspect, an immunogenic composition comprises lyophilized C. difficiletoxoid A and toxoid B, reconstituted with a saponin containing liposomal adjuvant comprisingabout 0.2 mg / mL QS-21, about 0.4 mg / mL Monophosphoryl 3-Deacyl Lipid A (also known as® 3D-PHAD), about 14 mg / mL DMPC, about 1.6 mg / mL DMPG and about 11 mg / mLcholesterol (LiNA-2). In preferred aspect, an immunogenic composition comprises lyophilizedC. difficile toxoid A and toxoid B, reconstituted with a saponin containing liposomal adjuvantcomprising about 0.2 mg / mL QS-21, about 0.4 mg / mL Monophosphoryl 3-Deacyl Lipid A (also® known as 3D-PHAD), about 14 mg / mL DMPC, about 1.6 mg / mL DMPG and about 11 mg / mLcholesterol in 10 mM phosphate, 150 mM NaCl at pH 6.2 (LiNA-2). In a preferred aspect, the composition is administered at a dose volume of 0.5 mL. In a preferred aspect, an immunogenic composition comprises lyophilized C. difficiletoxoid A and toxoid B at 0.4 mg / mL total (200 μg / mL of toxoid A and 200 μg / mL of toxoid B),reconstituted with a saponin containing liposomal adjuvant comprising about 0.2 mg / mL QS-21, about 0.4 mg / mL Monophosphoryl 3-Deacyl Lipid A (also known as 3D-PHAD® ), about 14mg / mL DMPC, about 1.6 mg / mL DMPG and about 11 mg / mL cholesterol (LiNA-2). Inpreferred aspect, an immunogenic composition comprises lyophilized C. difficile toxoid A andtoxoid B, reconstituted with a saponin containing liposomal adjuvant comprising about 0.2mg / mL QS-21, about 0.4 mg / mL Monophosphoryl 3-Deacyl Lipid A (also known as 3D-® PHAD), about 14 mg / mL DMPC, about 1.6 mg / mL DMPG and about 11 mg / mL cholesterolin 10 mM phosphate, 150 mM NaCl at pH 6.2 (LiNA-2). In a preferred aspect, the composition is administered at a dose volume of 0.5 mL. As use herein, “liposomes” refer to closed bilayer membranes containing an entrapped aqueous volume. Liposomes may also be uni-lamellar vesicles possessing a single membrane bilayer or multi-lamellar vesicles with multiple membrane bilayers, each separated from thenext by an aqueous layer. The structure of the resulting membrane bilayer is such that thehydrophobic (non-polar) tails of the lipid are oriented toward the center of the bilayer while the hydrophilic (polar) heads orient towards the aqueous phase. Liposomes, as they are ordinarily used, consist of smectic mesophases, and can consist of either phospholipid or nonphospholipid smectic mesophases. Smectic mesophase is most accurately described by Small, HANDBOOK OF LIPID RESEARCH, Vol.4, Plenum, N.Y., 1986, pp.49-50. The saponin containing liposomal adjuvant may be homogeneous or heterogeneous.As used herein, the term “homogeneous” shall mean a final adjuvant formulation comprisingliposomes having a size range of 30 – 400 nm, as determined by methods known in the artincluding, but not limited to, Dynamic light scattering (DLS), Transmission electron cryomicroscopy (e.g. cryo-TEM or cryo-EM), Nanoparticle Tracking Analysis (NTA, e.g. ViewSizer). A “homogeneous” adjuvant formulation may also mean a final adjuvant formulation comprising liposomes having a polydispersity index (PDI) of between about 0.05 to 0.5 or between about 0.05 to about 0.3, preferably about 0.3. As used herein, the term “heterogeneous” shall mean a final adjuvant formulation comprising liposomes having varying sizes ranging from 30 nm to over 10 micrometers, about 30 nm to 4 micrometers, about 30 nm to 1400 nm, preferably about 30 nm to 1000 nm as determined by methods known in the art including, but not limited to, Dynamic light scattering (DLS), Transmission electron microscopy (e.g. cryo-TEM or cryo-EM), Nanoparticle Tracking Analysis (NTA, e.g. ViewSizer). A “heterogeneous” adjuvant formulation may also mean a final adjuvant formulation comprising liposomes having a polydispersity index (PDI) > 0.5. Calculations used for the determination of size and PDI parameters may be found in the ISOstandard documents 13321:1996 E and ISO 22412:2008 (Worldwide M.I. Dynamic LightScattering, Common Terms Defined. Malvern Instruments Limited; Malvern, UK: 2011. pp.1–6. Inform White Paper). As used herein a “heterogeneous” adjuvant formulation shall alsomean a “polydisperse” adjuvant formulation. The term “about” as used herein refers to ±5% ofthe referenced value. In an aspect, the saponin containing liposomal adjuvant of the invention ishomogeneous. In another aspect, the saponin containing liposomal adjuvant of the inventionis heterogeneous. Unless noted otherwise, the saponin containing liposomal adjuvant used in theExamples of the present application is a heterogeneous saponin containing liposomaladjuvant. In one aspect, the saponin containing liposomal adjuvant is produced according to theprocess and methods described in US Provisional Application Nos. 63 / 319,418 and63 / 485,964, and International Publication No. WO2023 / 175454, which are incorporated byreference herein in their entireties. the disclosures of which are incorporated by referenceherein in their entireties Multiple processes are described to prepare heterogeneous and homogeneous liposomal adjuvant formulations scalable for manufacturing. In the present invention, the saponin containing liposomal adjuvant may be producedby a first method for producing a homogeneous adjuvant formulation comprising a liposomebilayer comprising (a) monophosphoryl lipid A (MPLA), (b) a saponin, and (c) a liposome composition comprising (i) at least one phospholipid selected from phosphatidylcholine (PC) and / or phosphatidylglycerol (PG), wherein the phospholipid is selected from the group consisting of dimyristoyl phosphatidylcholine (DMPC), dipalmitoyl phosphatidylcholine (DPPC), distearyl phosphatidylcholine (DSPC), dimyristoyl phosphatidylglycerol (DMPG),dipalmitoyl phosphatidylglycerol (DPPG), and distearyl phosphatidylglycerol (DSPG), and acombination thereof, and (ii) cholesterol, wherein the mole percent concentration of thecholesterol in the liposome composition is greater than 50% (mol / mol), or the molar ratio ofcholesterol to phospholipid is greater than 1, said method comprising the steps of: (i) dissolving the phospholipids, cholesterol and MPLA in an organic solvent to form an organic phase; (ii) injecting the organic phase of step (i) into an aqueous phase at a specific flowrate and at a specific ratio of the organic phase to the aqueous phase to form a liposome; (iii) stirring the liposome of step (ii) to form an intermediate liposome; (iv) removing the organic phase of the intermediate liposome of step (iii); (v) concentrating the intermediate liposome of step (iv); and (vi) compounding the intermediate liposome of step (v) with a saponin to form a final adjuvant formulation having a size range of about 30-400 nm with a polydispersity of 0.05 to 0.5, thereby producing the homogeneous adjuvant formulation. In one aspect of the first method for producing a homogeneous adjuvant composition, wherein in step (i) the phospholipids, cholesterol and MPLA are dissolved in the organicsolvent by sonication, heat or a combination thereof, preferably by heating. In one aspect, theorganic solvent is ethanol or isopropyl alcohol. In another aspect, the organic phase is heated to a temperature between 45°C to 65°C. In another aspect of the first method for producing a homogeneous adjuvant composition, the aqueous phase comprises water, and optionally, a buffer. In a preferred aspect, the buffer comprises 10 mM phosphate at pH 6.2 containing 150 mM NaCl. In a preferred aspect, the aqueous phase is 10 mM phosphate at pH 6.2 containing 150 mM NaCl. In another aspect, the aqueous phase is at a temperature between 20°C to 60°C. In another aspect, the flowrate of step (ii) is 0.5 mL / min to 400 mL / min or quick addition. In another aspect, the flowrate of step (ii) is 0.5 mL / min to 400 mL / min. In another aspect, the injection of step (ii) is conducted by rapid injection of the organic phase of step (i). In another aspect of the first method for producing a homogeneous adjuvant composition, the intermediate liposome of step (iii) is stirred at a rate of 700 rpm to 900 rpm. In another aspect of the first method for producing a homogeneous adjuvant composition, the ratio of organic phase to aqueous phase of step (ii) ranges from 1:4 to 1:16. In a preferred aspect, the ratio is 1:8. In another aspect of the first method for producing a homogeneous adjuvant composition, the size of the intermediate liposome in step (iv) is downsized by using a high pressure extruder or a microfluid homogenizer. In one aspect, the size of the liposome is downsized in step (iv) by using membrane sizes ranging from 50 nm to 120 nm or homogenization pressures between 17000 PSI and 24000 PSI, or a combination of both. In another aspect of the first method for producing a homogeneous adjuvant composition, the organic solvent is removed before downsizing of step (iv) or after downsizing of step (iv). In one aspect, removing the organic phase of the intermediate liposome of step (iv) is by Tangential Flow Filtration (TFF). In another aspect, the TFF is TFF diafiltration. In another aspect, the TFF comprises membranes having a molecular weight cut-off (MWCO) ranging from 100-500 kDa. In another aspect of the first method for producing a homogeneous adjuvant composition, the concentrating of step (v) is by Ultrafiltration. In one aspect, the Ultrafiltration comprises a bioburden reduction filter and a sterile filter. In another aspect of the first method for producing a homogeneous adjuvant composition, the compounding of step (vi) is at a mixing speed of 300 rpm. In one aspect, the compounding of step (vi) ranges from 1 hour to 24 hours. In another aspect, the compounding of step (vi) occurs at room temperature or from 2-8°C. In another aspect of the first method for producing a homogeneous adjuvantcomposition, the final adjuvant formulation has a size range of about 30 nm - 400 nm.In another aspect of the first method for producing a homogeneous adjuvant composition, the final adjuvant formulation has a polydispersity of 0.05 to 0.5. In a further aspect of the first method for producing a homogeneous adjuvant composition, the injecting of step (ii) is by pump or syringe injection. In a preferred aspect, the injecting of step (ii) is by pump. In one aspect, the saponin containing liposomal adjuvant may be produced by asecond method for producing a homogeneous adjuvant formulation comprising a liposome bilayer comprising (a) monophosphoryl lipid A (MPLA), (b) a saponin, and (c) a liposome composition comprising (i) at least one phospholipid selected from phosphatidylcholine (PC) and / or phosphatidylglycerol (PG), wherein the phospholipid is selected from the group consisting of dimyristoyl phosphatidylcholine (DMPC), dipalmitoyl phosphatidylcholine (DPPC), distearyl phosphatidylcholine (DSPC), dimyristoyl phosphatidylglycerol (DMPG), dipalmitoyl phosphatidylglycerol (DPPG), distearyl phosphatidylglycerol (DSPG) and acombination thereof, and (ii) cholesterol, wherein the mole percent concentration of thecholesterol in the liposome composition is greater than 50% (mol / mol), or the molar ratio ofcholesterol to phospholipid is greater than 1, said method comprising the steps of: (i) dissolving the phospholipids, cholesterol and MPLA in an organic solvent or a mixture of organic solvents to form an organic phase; (ii) injecting the organic phase of step (i) into an aqueous phase at a specific flowrate and at a specific ratio of the organic phase to the aqueous phase to form an intermediate liposome; (iii) concentrating the intermediate liposome of step (ii); (iv) removing the organic phase of the intermediate liposome of step (iii); (v) filtering the intermediate liposome of step (iv); and(vi) compounding the intermediate liposome of step (v) with a saponin to form a final adjuvant formulation having a size range of about 30-400 nm with a polydispersity of 0.05 to 0.5, thereby producing the homogeneous adjuvant formulation. In another aspect of the second method for producing a homogeneous adjuvant composition, in step (i) the phospholipids, cholesterol and MPLA are dissolved in the organic solvent by sonication, heat, stirring or a combination thereof. In one aspect, the organic solvent is ethanol or isopropyl alcohol or other organic solvents. In one aspect, the organic solvent is ethanol or isopropyl alcohol. In another aspect, the organic phase is heated to a temperature between 45°C to 65°C. Preferably, between 50°C to 65°C or between 45°C to 55°C. In another aspect of the second method for producing a homogeneous adjuvant composition, the aqueous phase comprises water, and optionally, a buffer. In one aspect, the buffer comprises 10 mM phosphate at pH 6.2 containing 150 mM NaCl. In a preferred aspect, the aqueous phase is 10 mM phosphate at pH 6.2 containing 150 mM NaCl. In another aspect, the aqueous phase is at a temperature between 20 °C to 65°C. In another aspect, the flowrate of step (ii) is 5 mL / min to 15 mL / min. In another aspect, the flowrate of step (ii) is 12 mL / min. In another aspect, the intermediate liposome of step (ii) is stirred at a rate of 100 rpm to 1000 rpm. In another aspect, the ratio of organic phase to aqueous phase of step (ii) ranges from 1:2 to 1:16. In a preferred aspect, the ratio is 4:7. In another aspect of the second method for producing a homogeneous adjuvant composition, the concentrating of step (iii) is by Ultrafiltration. In another aspect of the second method for producing a homogeneous adjuvant composition, removing the organic phase of the intermediate liposome of step (iv) is by Tangential Flow Filtration (TFF). In one aspect, the TFF is TFF diafiltration. In another aspect, the TFF comprises membranes having a molecular weight cut-off (MWCO) ranging from 100- 500 kDa. In another aspect of the second method for producing a homogeneous adjuvant composition, the filtering of step (v) comprises a bioburden reduction filter and a sterile filter. In another aspect of the second method for producing a homogeneous adjuvant composition, the compounding of step (vi) is at a mixing speed of 350 rpm for 1 hour at RT. In another aspect of the second method for producing a homogeneous adjuvant composition, the final adjuvant formulation has a size range of about 50-200 nm. Preferably, the final adjuvant formulation has a size of about 100 nm. In another aspect of the second method for producing a homogeneous adjuvant composition, the final adjuvant formulation has a polydispersity of 0.05 to 0.5. Preferably, the final adjuvant formulation has a PDI of <0.2. In a further aspect of the second method for producing a homogeneous adjuvant composition, the injecting of step (ii) is by pump or syringe injection. In a preferred aspect, the injecting of step (ii) is by pump. In another aspect, the saponin containing liposomal adjuvant may be produced by afirst method for producing a heterogeneous adjuvant formulation comprising a liposome bilayer comprising (a) monophosphoryl lipid A (MPLA), (b) a saponin, and (c) a liposome composition comprising (i) at least one phospholipid selected from phosphatidylcholine (PC) and / or phosphatidylglycerol (PG), wherein the phospholipid is selected from the group consisting of dimyristoyl phosphatidylcholine (DMPC), dipalmitoyl phosphatidylcholine (DPPC), distearyl phosphatidylcholine (DSPC), dimyristoyl phosphatidylglycerol (DMPG), dipalmitoyl phosphatidylglycerol (DPPG), distearyl phosphatidylglycerol (DSPG), and a combination thereof, and (ii) cholesterol, wherein the mole percent concentration of thecholesterol in the liposome composition is greater than 50% (mol / mol), or the molar ratio ofcholesterol to phospholipid is greater than 1, said method comprising the steps of: (i) dissolving the phospholipids, cholesterol and MPLA in an organic solvent to form a lipid solution as an organic phase; (ii) simultaneously injecting the organic phase of step (i) and an aqueous phase together at specific flowrates and at a specific ratio of the organic solvent phase to the aqueous phase to form a liposome; (iii) concentrating the intermediate liposome of step (ii); (iv) removing the organic phase of the intermediate liposome of step (iii); (v) treating the intermediate liposome of step (iv) by microfluidizer for 10 passes at ~17500 psi; (vi) filtering the intermediate liposome of step (v) using 0.22 um membrane; and (vii) compounding the intermediate liposome of step (vi) with a saponin, thereby producing the heterogeneous adjuvant formulation. In another aspect of the first method for producing a heterogeneous adjuvant formulation, in step (i) the phospholipids, cholesterol and MPLA are dissolved in the organic solvent by sonication, heat, stirring or a combination thereof. In one aspect, the organic solvent is ethanol or isopropyl alcohol or their mixture. In another aspect, the lipid formulation organicphase is heated to a temperature of 45- 65°C.In another aspect of the first method for producing a heterogeneous adjuvant formulation, the aqueous phase comprises water, and optionally, a buffer. In one aspect, the buffer comprises 10 mM phosphate at pH 6.2 containing 150 mM NaCl. In a preferred aspect, the aqueous phase is 10 mM phosphate at pH 6.2 containing 150 mM NaCl. In another aspect, the aqueous phase is at a temperature between 45-60°C. In another aspect of the first method for producing a heterogeneous adjuvant formulation, in step (ii) the organic phase has a flowrate of 0.5 to 2 ml / min and the aqueous phase has a flowrate of 5 to 15 ml / min. In another aspect of the third method, in step (ii) the organic phase has a flowrate of 1.333 ml / min and the aqueous phase has a flowrate of 10.667 ml / min. In another aspect of the first method for producing a heterogeneous adjuvant formulation, the intermediate liposome of step (iii) is stirred at a rate of 100 rpm to 900 rpm. In another aspect of the first method for producing a heterogeneous adjuvant formulation, the ratio of organic phase to aqueous phase of step (ii) ranges from 1:4 to 1:8. In a preferred aspect, the ratio is 1:8. In another aspect of the first method for producing a heterogeneous adjuvant formulation, removing the organic phase of the intermediate liposome of step (iii) and step (iv) is by Tangential Flow Filtration (TFF). In one aspect, the TFF is TFF ultrafiltration and diafiltration. In another aspect, the TFF comprises membranes having a molecular weight cut- off (MWCO) ranging from 100-500 kDa. In another aspect of the first method for producing a heterogeneous adjuvant formulation, the concentrating of step (iii) is by Ultrafiltration. In another aspect of the first method for producing a heterogeneous adjuvant formulation, the size of the intermediate liposome in step (iv) is treated by using a microfluidizer. In another aspect of the first method for producing a heterogeneous adjuvant formulation, the organic solvent is removed before microfluidizing of step (v). In another aspect of the first method for producing a heterogeneous adjuvant formulation, a buffer is added to the compounding of step (vii). In one aspect, the compounding of step (vii) is at a mixing speed of 350 rpm for 1 hour to 48 at RT or agitated for 1hr. In another aspect, following the compounding of step (vii) the intermediate liposome is stored at RT without stirring for up to 48 hours. In another aspect of the first method for producing a heterogeneous adjuvant formulation, the final adjuvant formulation has a size of about 300 nm to 1000 nm. In another aspect of the first method for producing a heterogeneous adjuvant formulation, the final adjuvant formulation has a polydispersity of 0.4-1.0. In a further aspect of the first method for producing a heterogeneous adjuvant formulation, the injecting of step (ii) is by Nanoassemblr or pump or syringe injection. In another aspect, the saponin containing liposomal adjuvant may be produced by asecond method for producing a heterogeneous adjuvant formulation comprising a liposome bilayer comprising (a) monophosphoryl lipid A (MPLA), (b) a saponin, and (c) a liposome composition comprising (i) at least one phospholipid selected from phosphatidylcholine (PC) and / or phosphatidylglycerol (PG), wherein the phospholipid is selected from the group consisting of dimyristoyl phosphatidylcholine (DMPC), dipalmitoyl phosphatidylcholine (DPPC), distearyl phosphatidylcholine (DSPC), dimyristoyl phosphatidylglycerol (DMPG), dipalmitoyl phosphatidylglycerol (DPPG), distearyl phosphatidylglycerol (DSPG), and a combination thereof, and (ii) cholesterol, wherein the mole percent concentration of thecholesterol in the liposome composition is greater than 50% (mol / mol), or the molar ratio ofcholesterol to phospholipid is greater than 1, said method comprising the steps of: (i) dissolving the phospholipids, cholesterol and MPLA in an organic solvent to form a lipid formulation an organic phase; (ii) injecting the organic phase of step (i) into an aqueous phase at a specific flowrate and at a specific ratio of the organic phase to the aqueous phase to form a liposome; (iii) stirring the liposome of step (ii) to form an intermediate liposome; (iv) concentrating the intermediate liposome of step (iii); (v) removing the organic phase of the intermediate liposome of step (iv); and (vi) compounding the intermediate liposome of step (vi) with a saponin, thereby producing the heterogeneous adjuvant formulation. In another aspect of the second method for producing a heterogeneous adjuvant formulation, in step (i) the phospholipids, cholesterol and MPLA are dissolved in the organic solvent by sonication, heat, stirring or a combination thereof. In one aspect, the organic solvent comprises ethyl acetate and isopropyl alcohol. In another aspect, the lipid formulation organic phase is heated to a temperature from 50°C to 65°C. In another aspect of the second method for producing a heterogeneous adjuvant formulation, the aqueous phase comprises water, and optionally, a buffer. In one aspect, the buffer comprises 10 mM phosphate at pH 6.2 containing 150 mM NaCl. In a preferred aspect, the aqueous phase is 10 mM phosphate at pH 6.2 containing 150 mM NaCl. In another aspect, the aqueous phase is at a temperature of 20-25°C. In a further aspect, the flowrate of step (ii) is 10 to 30 mL / min. In a further aspect, the flowrate of step (ii) is 20 mL / min. In another aspect of the second method for producing a heterogeneous adjuvant formulation, the intermediate liposome of step (iii) is stirred at a rate of 100 rpm to 900 rpm. In another aspect of the second method for producing a heterogeneous adjuvant formulation, the ratio of organic phase to aqueous phase of step (ii) ranges from 1:4 to 1:8. In a preferred aspect, the ratio is 1.8. In another aspect of the second method for producing a heterogeneous adjuvant formulation, the organic solvent is removed before compounding of step (vi). In another aspect of the second method for producing a heterogeneous adjuvant formulation, removing the organic phase of the intermediate liposome of step (iv) and step (v) is by Tangential Flow Filtration (TFF). In one aspect, the TFF is TFF ultrafiltration and diafiltration. In another aspect, the TFF comprises membranes having a molecular weight cut- off (MWCO) ranging from 100-500 kDa. In another aspect of the second method for producing a heterogeneous adjuvant formulation, the concentrating of step (vi) is by Ultrafiltration. In another aspect of the second method for producing a heterogeneous adjuvant formulation, a buffer is added to the compounding of step (vi). In another aspect of the second method for producing a heterogeneous adjuvant formulation, the compounding of step (vi) is at a mixing speed of 300 rpm for 1 hour at RT. In one aspect, following the compounding of step (vii) the intermediate liposome is stored at RT without stirring for 24 hours. In another aspect of the second method for producing a heterogeneous adjuvant formulation, the final adjuvant formulation has a size range of 300 nm to 1000 nm. In another aspect of the second method for producing a heterogeneous adjuvant formulation, the final adjuvant formulation has a polydispersity of 0.4 to 1.0. In another aspect of the second method for producing a heterogeneous adjuvant formulation, the injecting of step (ii) is by pipette, pump or syringe injection. In another aspect, the saponin containing liposomal adjuvant may be produced by athird method for producing a heterogeneous adjuvant formulation comprising a liposome bilayer comprising (a) monophosphoryl lipid A (MPLA), (b) a saponin, and (c) a liposome composition comprising (i) at least one phospholipid selected from phosphatidylcholine (PC) and / or phosphatidylglycerol (PG), wherein the phospholipid is selected from the group consisting of dimyristoyl phosphatidylcholine (DMPC), dipalmitoyl phosphatidylcholine (DPPC), distearyl phosphatidylcholine (DSPC), dimyristoyl phosphatidylglycerol (DMPG), dipalmitoyl phosphatidylglycerol (DPPG), distearyl phosphatidylglycerol (DSPG), and a combination thereof, and (ii) cholesterol, wherein the mole percent concentration of thecholesterol in the liposome composition is greater than 50% (mol / mol), or the molar ratio ofcholesterol to phospholipid is greater than 1, said method comprising the steps of: (i) preparing a lyophilized organic phase comprising the phospholipids, cholesterol and MPLA; (ii) rehydrating the lyophilized organic phase of step (i) with an aqueous phase to form an intermediate liposome; (iii) downsizing of the intermediate liposome of step (ii) using microfluidizer; (iv) compounding the intermediate liposome of step (iii) with a saponin, thereby producing the heterogeneous adjuvant formulation. In another aspect of the third method for producing a heterogeneous adjuvant formulation, in step (i) the phospholipids, cholesterol and MPLA are dissolved in the organic solvent by sonication, heat, stirring or a combination thereof. In one aspect, the organic solvent comprises tert-butyl alcohol (TBA) or its mixture. In another aspect, the lipid organic phase is heated to a temperature from 25°C to 65°C. In another aspect, the organic phase solution is lyophilized. In another aspect of the third method for producing a heterogeneous adjuvant formulation, the aqueous phase comprises water or a buffer. In one aspect, the buffer comprises 10 mM phosphate at pH 6.2 containing 150 mM NaCl. In a preferred aspect, the aqueous phase is 10 mM phosphate at pH 6.2 containing 150 mM NaCl. In another aspect, the aqueous phase is at a temperature from 20°C to 70°C. In another aspect of the third method for producing a heterogeneous adjuvant formulation, the intermediate liposome of step (ii) is stirred at a rate of 100-1000 rpm. In another aspect of the third method for producing a heterogeneous adjuvant formulation, the size of the intermediate liposome in step (iii) is downsized with a microfluidizer and pressure at or about 18640 PSI. In another aspect of the third method for producing a heterogeneous adjuvant formulation, the organic solvent is removed before rehydration of step (ii). In one aspect, removing the organic solvent is by lyophilization. In another aspect of the third method for producing a heterogeneous adjuvant formulation, a buffer is added to the compounding of step (iv). In another aspect of the third method for producing a heterogeneous adjuvant formulation, the compounding of step (iv) is at a mixing speed of 300 rpm or by agitation for 1 hour at RT. In another aspect of the third method for producing a heterogeneous adjuvant formulation, the compounding of step (iv) the intermediate liposome is stored at RT without stirring for 24 hours. In another aspect of the third method for producing a heterogeneous adjuvant formulation, the final adjuvant formulation has a size > 300nm. In another aspect of the third method for producing a heterogeneous adjuvant formulation, the final adjuvant formulation has a polydispersity >0.4. In one aspect of the methods for producing a homogeneous or heterogeneousadjuvant formulation, the saponin is selected from the group consisting of QS-7, QS- 18, QS-21, or a mixture thereof. In a preferred aspect, the saponin is QS-21. In one aspect of the methods for producing a homogeneous or heterogeneous adjuvant formulation, said at least one phospholipid is a mixture of dimyristoyl phosphatidylcholine (DMPC) and dimyristoyl phosphatidylglycerol (DMPG). In one aspect, the liposome composition of the adjuvant formulation may comprise cholesterol at a mole percent concentration of over 50% (mol / mol), of about 55% to about 71% (mol / mol), or preferably about 55% (mol / mol). In one aspect, the saponin containing liposomal adjuvant is a monophosphoryl lipid A(MPLA)-containing liposome composition comprising at least one saponin (e.g., QS-21) asdescribed in US Patent No. 10,434,167 (e.g. ALFQ), which is hereby incorporated byreference in its entirety. METHODS AND ADMINISTRATION The C. difficile toxoids disclosed herein may be used as antigens. For example, theymay be part of a vaccine. Therefore, in one aspect, the immunogenic compositions of the invention are for use as a medicament. In an aspect, the immunogenic compositions of the invention are for use as a vaccine. Therefore, in an aspect, the immunogenic compositions described herein, comprisingC. difficile toxoid A and toxoid B, and an adjuvant, are for use in generating, inducing or elicitingan immune response in a subject. In one aspect, the subject is a mammal, such as a human, non-human primate, cat, sheep, pig, horse, bovine or dog. Preferably, the subject is a human. The immunogenic compositions described herein, comprising C. difficile toxoid A andtoxoid B, and an adjuvant, may be used in therapeutic or prophylactic methods for preventing,reducing, treating or ameliorating a bacterial infection, disease or condition in a human subject. The immunogenic compositions described herein, comprising C. difficile toxoid A andtoxoid B, and an adjuvant, may be used to prevent, reduce, treat or ameliorate a C. difficileinfection, disease or condition in a human subject. The immunogenic compositions describedherein comprising C. difficile toxoid A and toxoid B, and an adjuvant, may be used to prevent,reduce, treat or ameliorate an infection, disease or condition associated with C. difficile in ahuman subject. The immunogenic compositions described herein may be used to induce orelicit an immune response against C. difficile in a subject.The immunogenic compositions described herein, comprising C. difficile toxoid A andtoxoid B, and an adjuvant, may be used to prevent, reduce, treat or ameliorate a primary C.difficile infection, disease or condition in a human subject. A primary C. difficile infection is aninitial or first episode of C. difficile infection or no previous C. difficile infection onset in the prior8 weeks. The immunogenic compositions described herein, comprising C. difficile toxoid A andtoxoid B, and an adjuvant, may be used to prevent, reduce, treat or ameliorate a recurrent C.difficile infection, disease or condition in a human subject. A recurrent C. difficile infection isan episode of CDI that occurs 8 weeks or less after the onset of a previous CDI episode (provided the symptoms of the previous episode had resolved). The immunogenic compositions described herein, comprising C. difficile toxoid A andtoxoid B, and an adjuvant, may be used to prevent, reduce, treat or ameliorate medicallyattended C. difficile infection, disease or condition in a human subject. The immunogeniccompositions described herein may be used to prevent, reduce, treat or ameliorate medically attended C. difficile infection, disease or condition by the toxoids contained in the composition in a subject. Medically attended relates to the more severe spectrum of a disease and represents the real-world burden for both patients and healthcare systems. For example,medically attended primary C. difficile infection may be described as ≥3 unformed / liquid stools(per Bristol criteria) in ≤24 hours plus lab confirmation AND seeking care at outpatient, urgentcare, emergency department (or virtual visit) for diarrhea illness.The immunogenic compositions described herein, comprising C. difficile toxoid A andtoxoid B, and an adjuvant, may be used to prevent, reduce, treat or ameliorate clinicallymeaningful C. difficile infection, disease or condition in a human subject. The immunogeniccompositions described herein may be used to prevent, reduce, treat or ameliorate clinically meaningful C. difficile infection, disease or condition by the toxoids contained in the composition in a subject. Clinically meaningful is objective and represents clinicallymeaningful disease. For example, clinically meaningful primary C. difficile infection may bedescribed ≥3 unformed / liquid stools (per Bristol criteria) in ≤24 hours for duration greater than3 days plus lab confirmation AND have documentation of 1 or more of the following: fever,nausea / vomiting, abdominal pain / cramping, blood in stools, site assessment of illness impact of symptoms on participant’s activities. The immunogenic compositions described herein, comprising C. difficile toxoid A andtoxoid B, and an adjuvant, may be used to generate, induce or elicit an immune responseagainst C. difficile in a subject to prevent, reduce, treat or ameliorate medically attended and / orclinically meaningful C. difficile infection, comprising administering to the subject an immunogenic composition of the present disclosure. The immunogenic compositions described herein, comprising C. difficile toxoid A andtoxoid B, and an adjuvant, may be used to prevent, reduce, treat or ameliorate medicallyattended and clinically meaningful C. difficile infection, disease or condition in a humansubject. In one aspect, the invention relates to a method of preventing, reducing, treating orameliorating an infection, disease or condition associated with C. difficile in a human subject,comprising administering to the subject an immunogenic composition of the present disclosure. In another aspect, the invention relates to a method of preventing, reducing, treatingor ameliorating medically attended and / or clinically meaningful C. difficile infection in a humansubject, comprising administering to the subject an immunogenic composition of the presentdisclosure. In one aspect, the invention relates to a method of inducing an immune responseagainst C. difficile in a human. In another aspect, the invention relates to a method of vaccinating a human. In another aspect, the invention relates to a method of reducing the duration of C. difficile infection episodes, for example, about a 25, 50, 75, 85, 95% or higher reduction in the median duration of the disease episode. In another aspect, the invention relates to a method of reducing the requirement for antibiotic treatment in C. difficile infection cases. In one aspect, the invention relates to an immunogenic composition of the present disclosure for use in preventing, reducing, treating or ameliorating an infection, disease orcondition associated with C. difficile in a human subject. In one aspect, the invention relatesto an immunogenic composition of the present disclosure for use in preventing, reducing,treating or ameliorating a primary infection, disease or condition associated with C. difficile ina human subject. In another aspect, the invention relates to an immunogenic composition of the present disclosure for use in preventing, reducing, treating or ameliorating a medicallyattended and / or clinically meaningful C. difficile infection in a human subject. In one aspect,the invention relates to an immunogenic composition of the present disclosure for use in eliciting and / or inducing an immune response against C. difficile in a human. In anotheraspect, the invention relates to an immunogenic composition of the present disclosure for usein vaccinating a human.In one aspect, the invention relates to use of an immunogenic composition of the present disclosure for the manufacture of a medicament for preventing, reducing, treating or ameliorating an infection, disease or condition associated with C. difficile in a human subject. In one aspect, the invention relates to use of an immunogenic composition of the present disclosure for the manufacture of a medicament for preventing, reducing, treating orameliorating a primary infection, disease or condition associated with C. difficile in a humansubject. In another aspect, the invention relates to use of an immunogenic composition of the present disclosure for the manufacture of medicament for preventing, reducing, treating or ameliorating medically attended and / or clinically meaningful C. difficile infection in a human subject. In one aspect, the invention relates to use of an immunogenic composition of the present disclosure for the manufacture of a medicament for eliciting and / or inducing an immune response against C. difficile in a human. In another aspect, the invention relates to use of an immunogenic composition of the present disclosure for the manufacture of amedicament for vaccinating a human.In one aspect, the methods and uses described herein include administering to thehuman at least one dose of an immunogenic composition described herein. In one aspect, themethods and uses include administering to the human one dose of an immunogeniccomposition described herein. In one aspect, the methods and uses include administering to the human at least one dose of an immunogenic composition comprising an adjuvant, such as, 1.0 mg / mL CpG 24555 combined with 1.5 mg / mL Al(OH)3, 3.6 mg / mL CpG 24555 alone or a saponin containing liposomal adjuvant (e.g. LiNA-2). In one aspect, the methods and uses described herein include administering to the human at least two doses of an immunogenic composition described herein. In one aspect,the methods and uses described herein include administering to the human two doses of animmunogenic composition described herein. In another aspect, the methods and uses includeadministering to the human at least a first dose and a second dose of an immunogenic composition described herein. In one aspect, the methods and uses include administering to the human two doses of an immunogenic composition comprising an adjuvant, such as, 1.0 mg / mL CpG 24555 combined with 1.5 mg / mL Al(OH)3, 3.6 mg / mL CpG 24555 alone or a saponin containing liposomal adjuvant (e.g. LiNA-2). In one aspect, the second dose is administered about 6 months after the first dose,such as, for example, in a Month 0, 6 immunization schedule. In one aspect, the second doseis administered at least 20, 30, 50, 60, 100, 120, 160, 170, or 180 days after the first dose, and at most 250, 210, 200, or 190 days after the first dose. In one aspect, the methods and uses include administering to the human two doses of an immunogenic composition comprising an adjuvant, such as, 1.0 mg / mL CpG 24555 combined with 1.5 mg / mL Al(OH)3, 3.6 mg / mL CpG 24555 alone or a saponin containing liposomal adjuvant (e.g. LiNA-2) on a 0- and 6-month dosing schedule. In one aspect, the second dose is administered about 2 months after the first dose,such as, for example, in a Month 0, 2 immunization schedule. In one aspect, the second doseis administered at least 5, 10, 20, 30, 50, or 60 days after the first dose, and at most 150, 90, 80, or 70 days after the first dose. In one aspect, the methods and uses include administering to the human two doses of an immunogenic composition comprising an adjuvant, such as, 1.0 mg / mL CpG 24555 combined with 1.5 mg / mL Al(OH)3, 3.6 mg / mL CpG 24555 alone or asaponin containing liposomal adjuvant (e.g. LiNA-2) on a 0- and 2-month dosing schedule.In another aspect, the second dose is administered about 30 days (about 1 month) after the first dose, such as, for example, in a Month 0, 1 immunization schedule. In one aspect, the second dose is administered at least 5, 10, 15, 20, 25, or 30 days after the firstdose, and at most 70, 60, 50, or 40 days after the first dose. In one aspect, the methods anduses include administering to the human two doses of an immunogenic composition comprising an adjuvant, such as, 1.0 mg / mL CpG 24555 combined with 1.5 mg / mL Al(OH)3,3.6 mg / mL CpG 24555 alone or a saponin containing liposomal adjuvant (e.g. LiNA-2) on a 0-and 1-month dosing schedule. In another aspect, the second dose is administered about 60 days (about 2 months) after the first dose, such as, for example, in a Month 0, 2 immunization schedule. In another aspect, the second dose is administered about 180 days (about 6 months) after the first dose, such as, for example, in a Month 0, 6 immunization schedule. In another aspect, the second dose is administered about 30 days (about 1 month) after the first dose, such as, for example, in a Month 0, 1 immunization schedule. In another aspect, the second dose is administered about 120 days (about 4 months) after the first dose, such as, for example, in a Month 0, 4 immunization schedule. In yet another aspect, the second dose is administered about 365 days (about 12 months) after the first dose, such as, for example, in a Month 0, 12 immunization schedule. In another aspect, the second dose is administered about 120 days (about 4 months) after the first dose, such as, for example, in a Month 0, 4 immunization schedule. In one aspect, the second dose is administered at least 5, 10, 15, 20, 25, or 30 days after the first dose, and at most 70, 60, 50, or 40 days after the first dose. In one aspect, the methods anduses include administering to the human two doses of an immunogenic compositioncomprising an adjuvant, such as, 1.0 mg / mL CpG 24555 combined with 1.5 mg / mL Al(OH)3, 3.6 mg / mL CpG 24555 alone or a saponin containing liposomal adjuvant (e.g. LiNA-2) on a 0- and 4-month dosing schedule. In another aspect, the second dose is administered about 365 days (about 12 months)after the first dose, such as, for example, in a Month 0, 12 immunization schedule. In oneaspect, the second dose is administered at least 5, 10, 15, 20, 25, or 30 days after the first dose, and at most 70, 60, 50, or 40 days after the first dose. In one aspect, the methods and uses include administering to the human two doses of an immunogenic composition comprising an adjuvant, such as, 1.0 mg / mL CpG 24555 combined with 1.5 mg / mL Al(OH)3, 3.6 mg / mL CpG 24555 alone or a saponin containing liposomal adjuvant (e.g. LiNA-2) on a 0- and 12-month dosing schedule. In another aspect, the second dose is administered about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or more months after the first dose. In one aspect, the methods and uses include administering to the human two doses of an immunogenic composition comprising an adjuvant, such as, 1.0 mg / mL CpG 24555 combined with 1.5 mg / mL Al(OH)3, 3.6 mg / mL CpG 24555 alone or a saponin containing liposomal adjuvant (e.g. LiNA-2) on a 0-and 1-month, 0- and 2-month, 0- and 3-month, 0- and 4-month, 0- and 5-month, 0- and 6-month, 0- and 7-month, 0- and 8-month, 0- and 9-month, 0- and 10-month, 0- and 11-month,0- and 12-month, 0- and 13-month, 0- and 14-month, 0- and 15-month,or 0- and 16-monthdosing schedule. In one aspect, the methods and uses include administering to the human a single doseof the immunogenic composition and at most two doses. In one aspect, the methods and usesinclude administering to the human two doses of the immunogenic composition and at most two doses. In one aspect, the two doses are administered within a period of about 6 months after the first dose. In one aspect, the two doses are administered within a period of about 2 months after the first dose. In one aspect, the two doses are administered within a period of about 1 month after the first dose. In one aspect, the two doses are administered within a period of about 4 months after the first dose. In one aspect, the two doses are administered within a period of about 12 months after the first dose. Administering to the human at mosttwo doses of the immunogenic compositions described herein may be advantageous. Suchadvantages include, for example, facilitating a human to comply with a complete administration schedule and facilitating cost-effectiveness of the schedule. In one aspect, the methods and uses include further administration of a booster doseto the human after the second dose, e.g. about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,16, 17, 18 months, 2, 2.5, 3, 3.5, 4, 4.5 or 5 years or later after the second dose. For example,a booster does may be administered 6 months, 12 months, 2 years or 3 years or later afterthe second dose. In one aspect, the methods and uses include administering immunogeniccompositions disclosed herein on a 0- and 1-month, 0- and 2-month, 0- and 4-month, 0- and6-month, or 0- and 12-month dosing schedule and administering at least one booster doseafter the second dose. Further boosters may be administered. For example, subsequent boosters may be administered about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 months, 2, 2.5, 3, 3.5, 4, 4.5 or 5 years or later after the first booster dose, or every year after the first booster dose, or as generally needed prior to prior to undergoing surgery, entering a long-term care facility, initiating immunosuppressive therapy (chemotherapy, transplantation, etc.) or other events which would put an individual at increased risk of C. difficile infection. Inone aspect, the methods and uses do not include further administration of a booster to thehuman after the second dose. A “booster” as used herein refers to an additional administration of the immunogenic composition to the human. In one aspect, the methods and uses described herein include administering to the human at least three doses of an immunogenic composition described herein. In one aspect,the methods and uses described herein include administering to the human three doses of animmunogenic composition described herein. In another aspect, the methods and uses includeadministering to the human a first dose, a second dose and a third dose of an immunogenic composition described herein. In one aspect, the methods and uses include administering to the human three doses of an immunogenic composition comprising an adjuvant, such as, 1.0 mg / mL CpG 24555 combined with 1.5 mg / mL Al(OH)3, 3.6 mg / mL CpG 24555 alone or a saponin containing liposomal adjuvant (e.g. LiNA-2). In one aspect, the second dose is administered about 1 month after the first dose and a third dose is administered about 6 months after the first dose, such as, for example, in a Month 0, 1, 6 immunization schedule. In one aspect, the methods and uses described hereininclude administering to the human three doses of an immunogenic composition comprisingan adjuvant, such as, 1.0 mg / mL CpG 24555 combined with 1.5 mg / mL Al(OH)3, 3.6 mg / mLCpG 24555 alone or a saponin containing liposomal adjuvant (e.g. LiNA-2) on a 0-, 1- and 6-month dosing schedule. In one aspect, the second dose is administered about 2 months after the first dose and a third dose is administered about 6 months after the first dose, such as, for example, in a Month 0, 2, 6 immunization schedule. In one aspect, the methods and uses described herein include administering to the human three doses of an immunogenic composition comprising an adjuvant, such as, 1.0 mg / mL CpG 24555 combined with 1.5 mg / mL Al(OH)3, 3.6 mg / mLCpG 24555 alone or a saponin containing liposomal adjuvant (e.g. LiNA-2) on a 0-, 2- and 6-month dosing schedule. In one aspect, the second dose is administered about 4 months after the first dose and a third dose is administered about 12 months after the first dose, such as, for example, in a Month 0, 4, 12 immunization schedule. In one aspect, the methods and uses described herein include administering to the human three doses of an immunogenic composition comprising an adjuvant, such as, 1.0 mg / mL CpG 24555 combined with 1.5 mg / mL Al(OH)3, 3.6 mg / mLCpG 24555 alone or a saponin containing liposomal adjuvant (e.g. LiNA-2) on a 0-, 4- and 12-month dosing schedule. In one aspect, the second dose is administered about 2 months after the first dose and a third dose is administered about 15 months after the first dose, such as, for example, in a Month 0, 2, 15 immunization schedule. In one aspect, the methods and uses described herein include administering to the human three doses of an immunogenic composition comprising an adjuvant, such as, 1.0 mg / mL CpG 24555 combined with 1.5 mg / mL Al(OH)3, 3.6 mg / mLCpG 24555 alone or a saponin containing liposomal adjuvant (e.g. LiNA-2) on a 0-, 2- and 15-month dosing schedule. In one aspect the methods and uses include administering to the human at most threedoses of the immunogenic composition. In one aspect, the three doses are administered within a period of about 6 months after the first dose. In a further aspect, at most three doseswithin a period of about 6 months are administered to the human. In one aspect, the threedoses are administered within a period of about 12 months after the first dose. In a further aspect, at most three doses within a period of about 12 months are administered to the human. In one aspect, the three doses are administered within a period of about 15 months after the first dose. In a further aspect, at most three doses within a period of about 15 months are administered to the human. Administering to the human at most three doses of the immunogenic compositions described herein may be advantageous. In one aspect, the second dose is administered about 30 days (about 1 month) after the first dose, and the third dose is administered about 150 to 180 days after the second dose, such as, for example, in a Month 0, 1, 6 immunization schedule. In one aspect, the second dose is administered about 30 days (about 1 month) after the first dose, and the third dose is administered about 180 days (about 6 months) after the first dose, such as, for example, in a Month 0, 1, 6 immunization schedule. In another aspect, the second dose is administered about 60 days (about 2 months)after the first dose, and the third dose is administered about 120 to 150 days after the second dose, such as, for example, in a Month 0, 2, 6 month immunization schedule. In another aspect, the second dose is administered about 60 days (about 2 months) after the first dose, and the third dose is administered about 180 days (about 6 months) after the first dose, such as, for example, in a Month 0, 2, 6 month immunization schedule. In another aspect, the second dose is administered about 120 days (about 4 months) after the first dose, and the third dose is administered about 365 days (about 12 months) after the first dose, such as, for example, in a Month 0, 4, 12 month immunization schedule. In another aspect, the second dose is administered about 60 days (about 2 months) after the first dose, and the third dose is administered about 450 days (about 15 months) after the first dose, such as, for example, in a Month 0, 2, 15 month immunization schedule. In one aspect, the first dose, second dose, and third dose are administered to the human over a period of about 150, 160, 170, or 180 days, and at most 510, 480, 450, 420,390, 360, 330, 300, 270, 240, 210, 200, or 190 days. Any minimum value may be combinedwith any maximum value described herein to define a range. In another aspect, the first dose, second dose, and third dose is administered to the human over a period of about 180 days or 6 months. For example, the second dose may be administered to the human about 30 days after the first dose, and the third dose may beadministered to the human about 120 days after the second dose. Accordingly, a schedule ofadministration includes administering a dose to the human at about months 0, 1, and 6. For example, the second dose may be administered to the human about 60 days after the first dose, and the third dose may be administered to the human about 120 days after the seconddose. Accordingly, a schedule of administration includes administering a dose to the humanat about months 0, 2, and 6. For example, the second dose may be administered to the human about 120 days after the first dose, and the third dose may be administered to the human about 245 days after the second dose. Accordingly, a schedule of administration includes administering a dose to the human at about months 0, 4, and 12. For example, the second dose may be administered to the human about 60 days after the first dose, and the third dose may be administered to the human about 390 days after the second dose. Accordingly, a schedule of administration includes administering a dose to the human at about months 0, 2, and 15. In another aspect, the second dose is administered about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or more months after the first dose and the third dose is administeredabout 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or more months after the second dose.In one aspect, the methods and uses include an administration of a booster dose tothe human after the third dose, e.g. about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,17, or 18 months, 2, 2.5, 3, 3.5, 4, 4.5 or 5 years or later after the third dose. For example, abooster does may be administered 6 months, 12 months, 2 years, 3 years or later after thethird dose. In one aspect, the methods and uses include administering immunogeniccompositions disclosed herein on a 0-, 1- and 6-month, 0-, 2- and 6-month, 0-, 4- and 12-month, or 0-, 2- and 15-month dosing schedule and administering at least one booster doseafter the third dose. Further boosters may be administered. For example, subsequent boosters may be administered about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 months, 2, 2.5, 3, 3.5, 4, 4.5 or 5 years or later after the first booster dose, or every year after the first booster dose, or as generally needed prior to prior to undergoing surgery, entering a long-term care facility, initiating immunosuppressive therapy (chemotherapy, transplantation, etc.) or other events which would put an individual at increased risk of C. difficile infection. In one aspect, the methods and uses do not include further administration of a booster to thehuman after the second dose. In another aspect, the methods and uses do not includeadministration of a booster dose to the human after the third dose. As described above, multiple doses of the immunogenic composition may be administered to the human, and the number of days between each dose may vary. An advantage of the method includes, for example, flexibility for a human to comply with theadministration schedules. For example, the present invention further provides for theadministration of an additional or booster dose after the last dose within a flexible time period, such as within a 2, 3, 4, 5 or 6 month or longer time period. For example, a first and second dose is administered at Month 0 and 2 and the additional or booster dose is administered between Months 4-6. For example, a first, second and third dose is administered at Month 0, 2 and 6 and the additional or booster dose is administered between Months 8-10. Any minimum value may be combined with any maximum value described herein to define a range. The present invention further provides for methods of preventing a C. difficile infection-associated disease in a human subject, the method comprising administering to a human subject at least a first dose and a second dose of an immunogenic compositiondescribed herein comprising a C. difficile toxoid A and / or C. difficile toxoid B, and a CpGadjuvant or saponin containing liposomal adjuvant. The present invention provides for methods of preventing a C. difficile infection in a human subject, the method comprising administering to a human subject at least a first dose and a second dose of an immunogenic composition described herein comprising a C. difficiletoxoid A and / or C. difficile toxoid B, and a CpG adjuvant or saponin containing liposomaladjuvant. The present invention further provides for methods of preventing a primary C. difficile infection in a human subject, the method comprising administering to a human subject at least a first dose and a second dose of an immunogenic composition described herein comprisinga C. difficile toxoid A and / or C. difficile toxoid B, and a CpG adjuvant or saponin containingliposomal adjuvant. The present invention provides for methods of preventing medically attended C. difficile infection in a human subject, the method comprising administering to a human subject at least a first dose and a second dose of an immunogenic composition described herein comprisinga C. difficile toxoid A and / or C. difficile toxoid B, and a CpG adjuvant or saponin containingliposomal adjuvant. The present invention further provides for methods of preventing medically attended primary C. difficile infection in a human subject, the method comprising administering to a human subject at least a first dose and a second dose of an immunogenic compositiondescribed herein comprising a C. difficile toxoid A and / or C. difficile toxoid B, and a CpGadjuvant or saponin containing liposomal adjuvant. The present invention provides for methods of preventing clinically meaningful C. difficile infection in a human subject, the method comprising administering to a human subject at least a first dose and a second dose of an immunogenic composition described herein comprisinga C. difficile toxoid A and / or C. difficile toxoid B, and a CpG adjuvant or saponin containingliposomal adjuvant. The present invention further provides for methods of preventing clinical meaningful primary C. difficile infection in a human subject, the method comprising administering to a human subject at least a first dose and a second dose of an immunogenic compositiondescribed herein comprising a C. difficile toxoid A and / or C. difficile toxoid B, and a CpGadjuvant or saponin containing liposomal adjuvant. The present invention provides for methods of preventing clinically meaningful and / or medically attended C. difficile infection in a human subject, the method comprising administering to a human subject at least a first dose and a second dose of an immunogeniccomposition described herein comprising a C. difficile toxoid A and / or C. difficile toxoid B, anda CpG adjuvant or saponin containing liposomal adjuvant. The present invention further provides for methods of preventing clinically meaningful and / or medically attended primary C. difficile infection in a human subject, the method comprising administering to a human subject at least a first dose and a second dose of animmunogenic composition described herein comprising a C. difficile toxoid A and / or C. difficiletoxoid B, and a CpG adjuvant or saponin containing liposomal adjuvant. The present invention further provides for active immunization for the prevention of C.difficile infection-associated disease in adults, wherein the adults are administered at least afirst dose and a second dose of an immunogenic composition described herein comprising aC. difficile toxoid A and / or C. difficile toxoid B, and a CpG adjuvant or saponin containingliposomal adjuvant. The present invention provides for active immunization for the prevention of C. difficile infection in adults, wherein the adults are administered at least a first dose and a second doseof an immunogenic composition described herein comprising a C. difficile toxoid A and / or C.difficile toxoid B, and a CpG adjuvant or saponin containing liposomal adjuvant.The present invention further provides for active immunization for the prevention ofprimary C. difficile infection in adults, wherein the adults are administered at least a first doseand a second dose of an immunogenic composition described herein comprising a C. difficiletoxoid A and / or C. difficile toxoid B, and a CpG adjuvant or saponin containing liposomaladjuvant. The present invention further provides for active immunization for the prevention ofclinically meaningful and / or medically attended primary C. difficile infection in adults, whereinthe adults are administered at least a first dose and a second dose of an immunogeniccomposition described herein comprising a C. difficile toxoid A and / or C. difficile toxoid B, anda CpG adjuvant or saponin containing liposomal adjuvant. The present invention further provides for a method of eliciting an immune response ina human subject against C. difficile and / or a method of preventing a C. difficile infection (CDI)in a human subject, the method comprising administering to the human subject at least a firstdose and a second dose of an immunogenic composition comprising C. difficile toxoids A andB, and a CpG adjuvant or a saponin containing liposomal adjuvant, wherein the second dose is administered about 2 months after the first dose, wherein the geometric mean concentration(GMC) of C. difficile toxin A neutralizing antibodies is at least about 50, 100, 150, 200, 250,300, 310, 320, 330, 340, 350, 360, or 370 neutralization units / mL or higher at 1 month afterthe first dose (Month 1), at least about 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550,600, 650, 700, 750, 800, 810, 820, 830, 840, 850, 860, 900, 950, 1,000, 1,100, 1,200, 1,300,or 1,400 neutralization units / mL or higher at 1 month after the second dose (Month 3), at leastabout 50, 100, 150, 200, 210, 220, 230, 240, 250, 260, or 270 neutralization units / mL or higherat 10 months after the second dose (Month 12), and / or at least about 50, 100, 150, 200, 250,300, 310, 320, or 330 neutralization units / mL or higher at 16 months after the second dose(Month 18). The present invention further provides for a method of eliciting an immune response ina human subject against C. difficile and / or a method of preventing a C. difficile infection (CDI)in a human subject, the method comprising administering to the human subject at least a firstdose and a second dose of an immunogenic composition comprising C. difficile toxoids A andB, and a CpG adjuvant or a saponin containing liposomal adjuvant, wherein the second dose is administered about 2 months after the first dose, wherein the geometric mean concentration(GMC) of C. difficile toxin B neutralizing antibodies is at least about 50, 100, 150, 200, 250,300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,100, 2,200, 2,300, 2,400, 2,500,2,600, 2,700, or 2,800 neutralization units / mL or higher at 1 month after the first dose (Month1), at least about 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750,800, 850, 900, 950, 1,000, 1,500, 2,000, 2,500, 3,000, 3,500, 4,000, 4,500, 5,000, 5,500, 6,000, 6,500, 7,000, 7,500, 8,000, 8,500, 9,000, 9,500, 10,000, 10,500, 11,000, 12,000, 13,000, 14,000, 15,000, 16,000, 16,500, 17,000, 18,000, 19,000, 20,000, 21,000, 22,000,23,000, 24,000, 25,000, 26,000, or 27,000 neutralization units / mL or higher at 1 month afterthe second dose (Month 3), at least about 50, 100, 150, 200, 250, 300, 350, 400, 450, 500,550, 600, 650, 700, 750, 800, 850, 900, 950, 1,000, 1,500, 2,000, 2,500, 3,000, 3,500, 4,000,4,500, 5,000, 5,500, 6,000, 6,500, or 7,000 neutralization units / mL or higher at 10 months afterthe second dose (Month 12), and / or at least about 50, 100, 150, 200, 250, 300, 350, 400, 450,500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1,000, 1,500, 2,000, 2,500, 3,000, 3,500,4,000, or 4,500 neutralization units / mL or higher at 16 months after the second dose (Month18). In one aspect, the present invention provides for a method of eliciting an immuneresponse in a human subject against C. difficile and / or a method of preventing a C. difficileinfection in a human subject, the method comprising administering to the human subject at least a first dose and a second dose of an immunogenic composition comprising C. difficiletoxoids A and B, and about 1.0 mg / mL CpG 24555 and about 1.5 mg / mL Al(OH)3, wherein thesecond dose is administered about 2 months after the first dose, and the geometric meanconcentration (GMC) of C. difficile toxin A neutralizing antibodies is at least about 250, 500,600, 700, 800, or 850 neutralization units / mL or higher at 1 month after the second dose(Month 3), at least about 50, 100, 150, or 200 neutralization units / mL or higher at 10 monthsafter the second dose (Month 12), and / or at least about 50, 100, 150, or 200 neutralizationunits / mL or higher at 16 months after the second dose (Month 18) and / or wherein the seconddose is administered about 2 months after the first dose, and / or the GMC of C. difficile toxin Bneutralizing antibodies is at least about 2,000, 4,000, 6,000, 8,000, 9,000, or 10,000neutralization units / mL or higher at 1 month after the second dose (Month 3), at least about1,500, 2,000, 2,500, or 3,000 neutralization units / mL or higher at 10 months after the seconddose (Month 12), and / or at least about 1,500, 2,000, 2,500, 3,000, or 3,500 neutralizationunits / mL or higher at 16 months after the second dose (Month 18).In one aspect, the present invention provides for a method of eliciting an immuneresponse in a human subject against C. difficile and / or a method of preventing a C. difficileinfection in a human subject, the method comprising administering to the human subject at least a first dose and a second dose of an immunogenic composition comprising C. difficiletoxoids A and B, and about 3.6 mg / mL CpG alone, without aluminum hydroxide (Al(OH)3,wherein the second dose is administered about 2 months after the first dose, and the GMC ofC. difficile toxin A neutralizing antibodies is at least about 250, 500, or 1,000 neutralizationunits / mL or higher at 1 month after the second dose (Month 3) and / or at least about 50, 100,150, or 200 neutralization units / mL or higher at 10 months after the second dose (Month 12);and / or wherein the second dose is administered about 2 months after the first dose, and / orthe GMC of C. difficile toxin B neutralizing antibodies is at least about 2,000, 5,000, 10,000,or 15,000 neutralization units / mL or higher at 1 month after the second dose (Month 3), and / orat least about 3,000, 4,000, or 5,000 neutralization units / mL or higher at 10 months after thesecond dose (Month 12). In one aspect, the present invention provides for a method of eliciting an immuneresponse in a human subject against C. difficile and / or a method of preventing a C. difficileinfection in a human subject, the method comprising administering to the human subject at least a first dose and a second dose of an immunogenic composition comprising C. difficiletoxoids A and B, and LiNA-2, wherein the second dose is administered about 2 months afterthe first dose, and the GMC of C. difficile toxin A neutralizing antibodies is at least about 250,500, or 1,000 neutralization units / mL or higher at 1 month after the second dose (Month 3), atleast about 50, 100, 150, 200, or 250 neutralization units / mL or higher at 10 months after thesecond dose (Month 12), and / or at least about 50, 100, 150, 200, 250, or 300 neutralizationunits / mL or higher at 16 months after the second dose (Month 18); and / or wherein the seconddose is administered about 2 months after the first dose, and the GMC of C. difficile toxin Bneutralizing antibodies is at least about 10,000, 15,000, 20,000, or 25,000 neutralizationunits / mL or higher at 1 month after the second dose (Month 3), at least about 2,000, 2,500,3,000, 3,500, or 4,000 neutralization units / mL or higher at 10 months after the second dose(Month 12), and / or at least about 2,500, 3,000, 3,500, 4,000, or 4,500 neutralization units / mLor higher at 16 months after the second dose (Month 18).The present invention further provides for a method of eliciting an immune response ina human subject against C. difficile and / or a method of preventing a C. difficile infection (CDI)in a human subject, the method comprising administering to the human subject at least a firstdose and a second dose of an immunogenic composition comprising C. difficile toxoids A andB, and a CpG adjuvant or a saponin containing liposomal adjuvant, wherein the second dose is administered about 2 months after the first dose, wherein the geometric mean fold rise(GMFR) in C. difficile toxin A neutralizing antibodies is at least about 1.0, 1.5, 2.0, 2.1, 2.2,2.3, 2.4, 2.5, or 2.6 or higher from baseline to 1 month after the first dose (Month 1), at leastabout 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 7.0, 7.5, 8.0, 8.5,9.0, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, or 9.7 or higher from baseline to 1 month after the second dose(Month 3), at least about 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, or 1.9 or higher from baselineto 10 months after the second dose (Month 12), and / or at least about 1.0, 1.1, 1.2, 1.3, 1.4,1.5, 2.0, 2.1, 2.2, or 2.3, or higher from baseline to 16 months after the second dose (Month18). The present invention further provides for a method of eliciting an immune response ina human subject against C. difficile and / or a method of preventing a C. difficile infection (CDI)in a human subject, the method comprising administering to the human subject at least a firstdose and a second dose of an immunogenic composition comprising C. difficile toxoids A andB, and a CpG adjuvant or a saponin containing liposomal adjuvant, wherein the second dose is administered about 2 months after the first dose, wherein the geometric mean fold rise(GMFR) in C. difficile toxin B neutralizing antibodies is at least about 1.0, 1.5, 2.0, 2.5, 3.0,3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.5, 5.0, 5.5, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 7.0, 7.5, or 7.6 or higherfrom baseline to 1 month after the first dose (Month 1), at least about 1.0, 1.5, 2.0, 2.5, 3.0,3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10, 15, 20, 25, 26, 27, 28, 29, 30,35, 40, 45, 46, 47, 48, 49, 50, 60, 65, 70, or 71 or higher from baseline to 1 month after thesecond dose (Month 3), at least about 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5,7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 or higher frombaseline to 10 months after the second dose (Month 12), and / or at least about 1.0, 1.5, 2.0,2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10, 11, or 12 or higher frombaseline to 16 months after the second dose (Month 18). In one aspect, the present invention provides for a method of eliciting an immuneresponse in a human subject against C. difficile and / or a method of preventing a C. difficileinfection in a human subject, the method comprising administering to the human subject at least a first dose and a second dose of an immunogenic composition comprising C. difficiletoxoids A and B, and about 1.0 mg / mL CpG 24555 and about 1.5 mg / mL Al(OH)3, wherein thesecond dose is administered about 2 months after the first dose, and the geometric mean foldrise (GMFR) in C. difficile toxin A neutralizing antibodies is at least about 2, 3, 4, 5, or 6 orhigher from baseline to 1 month after the second dose (Month 3), at least about 1 or 1.5 orhigher from baseline to 10 months after the second dose (Month 12), and / or at least about 1or 1.5 or higher from baseline to 16 months after the second dose (Month 18); and / or whereinthe second dose is administered about 2 months after the first dose, and / or the GMFR in C.difficile toxin B neutralizing antibodies is at least about 10, 15, 20, or 25 or higher from baselineto 1 month after the second dose (Month 7), at least about 5, 6, 7, 8, or 9 or higher frombaseline to 6 months after the second dose (Month 12), and / or at least about 5, 6, 7, 8, 9, or10 or higher from baseline to 12 months after the second dose (Month 18).In one aspect, the present invention provides for a method of eliciting an immuneresponse in a human subject against C. difficile and / or a method of preventing a C. difficileinfection in a human subject, the method comprising administering to the human subject at least a first dose and a second dose of an immunogenic composition comprising C. difficiletoxoids A and B, and about 3.6 mg / mL CpG alone, without aluminum hydroxide (Al(OH)3,wherein the second dose is administered about 2 months after the first dose, and GMFR in C.difficile toxin A neutralizing antibodies is at least about 4, 5, 6, 7, 8, or 9 or higher from baselineto 1 month after the second dose (Month 3), and / or at least about 1 or higher from baseline to10 months after the second dose (Month 12); and / or wherein the second dose is administeredabout 2 months after the first dose, and / or the GMFR in C. difficile toxin B neutralizingantibodies is at least about 10, 20, 30, 35, 40, or 45 or higher from baseline to 1 month afterthe second dose (Month 3), and / or at least about 10, 15, or 20 or higher from baseline to 10months after the second dose (Month 12). In one aspect, the present invention provides for a method of eliciting an immuneresponse in a human subject against C. difficile and / or a method of preventing a C. difficileinfection in a human subject, the method comprising administering to the human subject at least a first dose and a second dose of an immunogenic composition comprising C. difficile toxoids A and B, and LiNA-2, wherein the second dose is administered about 2 months afterthe first dose, and the GMFR in C. difficile toxin A neutralizing antibodies is at least about 2,3, 4, 5, 6, 7, 8, or 9 or higher from baseline to 1 month after the second dose (Month 3), atleast about 1 or 1.5 or higher from baseline to 10 months after the second dose (Month 12),and / or at least about 1, 1.5, or 2 or higher from baseline to 16 months after the second dose(Month 18); and / or wherein the second dose is administered about 2 months after the firstdose, and the GMFR in C. difficile toxin B neutralizing antibodies is at least about 30, 40, 50,60, or 70 or higher from baseline to 1 month after the second dose (Month 3), at least about6, 7, 8, 9, 10, or 11 or higher from baseline to 10 months after the second dose (Month 12),and / or at least about 6, 7, 8, 9, 10, 11, or 12 or higher from baseline to 16 months after thesecond dose (Month 18). The present invention further provides for a method of eliciting an immune response ina human subject against C. difficile and / or a method of preventing a C. difficile infection (CDI)in a human subject, the method comprising administering to the human subject at least a firstdose and a second dose of an immunogenic composition comprising C. difficile toxoids A andB, and a CpG adjuvant or a saponin containing liposomal adjuvant, wherein the second dose is administered about 2 months after the first dose, wherein the percentage of subjects with at least a 4-fold rise in C. difficile toxin A neutralizing antibody concentrations is at least about1.0, 1.5, 2.0, 2.5, 3.5, 4.0, 4.5, 5.0, 5.5, 5.6, 5.7, 5.8, or 5.9% or higher from baseline to 1month after the first dose (Month 1), at least about 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5,6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 65, or 70% or higherfrom baseline to 1 month after the second dose (Month 3), and / or at least about 1.0, 1.5, 2.0,2.5, 3.5, 4.0, 4.5, 5.0, 5.5, 5.6, 5.7, 5.8, or 5.9% or higher from baseline to 16 months after thesecond dose (Month 18). The present invention further provides for a method of eliciting an immune response ina human subject against C. difficile and / or a method of preventing a C. difficile infection (CDI)in a human subject, the method comprising administering to the human subject at least a firstdose and a second dose of an immunogenic composition comprising C. difficile toxoids A andB, and a CpG adjuvant or a saponin containing liposomal adjuvant, wherein the second dose is administered about 2 months after the first dose, wherein the percentage of subjects with at least a 4-fold rise in C. difficile toxin B neutralizing antibody concentrations is at least about 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10, 15, 20, 25,30, or 35% or higher from baseline to 1 month after the first dose (Month 1), at least about 1.0,1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% from baseline to 1 month after the second dose (Month 3), at leastabout 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10, 15,20, 25, 30, 35, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, or 56% or higherfrom baseline to 10 months after the second dose (Month 12), and / or at least about 1.0, 1.5,2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10, 15, 20, 25, 30, 35,40, 45, 50, 51, 52, 53, 54, 55, 60, 65, or 66% or higher from baseline to 16 months after thesecond dose (Month 18). In one aspect, the present invention provides for a method of eliciting an immuneresponse in a human subject against C. difficile and / or a method of preventing a C. difficileinfection in a human subject, the method comprising administering to the human subject at least a first dose and a second dose of an immunogenic composition comprising C. difficiletoxoids A and B, and about 1.0 mg / mL CpG 24555 and about 1.5 mg / mL Al(OH)3, wherein thesecond dose is administered about 2 months after the first dose, and the percentage of subjects with at least a 4-fold rise in C. difficile toxin A neutralizing antibody concentrations isat least about 10, 20, 30, or 35% or higher from baseline to 1 month after the second dose(Month 3) and / or at least about 2, 3, 4, or 5% or higher from baseline to 16 months after thesecond dose (Month 18); and / or wherein the second dose is administered about 2 monthsafter the first dose, and / or the percentage of subjects with at least a 4-fold rise in C. difficiletoxin B neutralizing antibody concentrations is at least about 25, 30, 40, 50, 60, 70, or 80% orhigher from baseline to 1 month after the second dose (Month 3), at least about 25, 30, 35, or40% or higher from baseline to 10 months after the second dose (Month 12), at least about 25, 30, 35, 40, 45, or 50% or higher from baseline to 16 months after the second dose (Month 18). In one aspect, the present invention provides for a method of eliciting an immuneresponse in a human subject against C. difficile and / or a method of preventing a C. difficileinfection in a human subject, the method comprising administering to the human subject at least a first dose and a second dose of an immunogenic composition comprising C. difficiletoxoids A and B, and about 3.6 mg / mL CpG alone, without aluminum hydroxide (Al(OH)3,wherein the second dose is administered about 2 months after the first dose, and the percentage of subjects with at least a 4-fold rise in C. difficile toxin A neutralizing antibodyconcentrations is at least about 30, 40, 50, 60, or 70% or higher from baseline to 1 month afterthe second dose (Month 3); and / or wherein the second dose is administered about 2 monthsafter the first dose, and / or the percentage of subjects with at least a 4-fold rise in C. difficiletoxin B neutralizing antibody concentrations is at least about 30, 40, 50, 60, 70, 80, 90, or100% from baseline to 1 month after the second dose (Month 3), and / or at least about 40, 50,or 55% or higher from baseline to 10 months after the second dose (Month 12). In one aspect, the present invention provides for a method of eliciting an immuneresponse in a human subject against C. difficile and / or a method of preventing a C. difficileinfection in a human subject, the method comprising administering to the human subject at least a first dose and a second dose of an immunogenic composition comprising C. difficiletoxoids A and B, and LiNA-2, wherein the second dose is administered about 2 months afterthe first dose, and the percentage of subjects with at least a 4-fold rise in C. difficile toxin Aneutralizing antibody concentrations is at least about 30, 40, 50, or 60% or higher frombaseline to 1 month after the second dose (Month 3) and / or at least about 2, 3, 4, or 5% orhigher from baseline to 16 months after the second dose (Month 18); and / or wherein the second dose is administered about 2 months after the first dose, and the percentage of subjects with at least a 4-fold rise in C. difficile toxin B neutralizing antibody concentrations isat least about 30, 40, 50, 60, 70, 80, 90 or 100% from baseline to 1 month after the seconddose (Month 3), at least about 25, 30, 35, 40, 45, 50, or 55% or higher from baseline to 10months after the second dose (Month 12), at least about 35, 40, 45, 50, 55, 60, or 65% orhigher from baseline to 16 months after the second dose (Month 18). The present invention further provides for a method of eliciting an immune response ina human subject against C. difficile and / or a method of preventing a C. difficile infection (CDI)in a human subject, the method comprising administering to the human subject at least a firstdose and a second dose of an immunogenic composition comprising C. difficile toxoids A andB, and a CpG adjuvant or a saponin containing liposomal adjuvant, wherein the second dose is administered about 6 months after the first dose, wherein the geometric mean concentration(GMC) of C. difficile toxin A neutralizing antibodies is at least about 150, 200, 250, 300, 310,320, 330, 340, 350, 400, 450, 500, 550, 600, 610, or 620 neutralization units / mL or higher at1 month after the first dose (Month 1), at least about 50, 100, 150, 200, 250, 300, 350, 400,450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1,000, 1,500, 2,000, 2,100, 2,200, 2,300, 2,400, 2,500, 3,000, 3,100, 3,200, 3,300, 3,400, 3,500, 3,600, 3,700, or 3,800neutralization units / mL or higher at 1 month after the second dose (Month 7), at least about 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 760, 770, 780, 790,800, 850, 900, 950, 960, 970, 980, 990, or 1,000 neutralization units / mL or higher at 6 monthsafter the second dose (Month 12), and / or at least about 50, 100, 150, 200, 250, 300, 350, 400,450, 500, 550, 560, 600, 650, 700, 750, 760, 770, 800, 850, or 860 neutralization units / mL orhigher at 12 months after the second dose (Month 18).The present invention further provides for a method of eliciting an immune response ina human subject against C. difficile and / or a method of preventing a C. difficile infection (CDI)in a human subject, the method comprising administering to the human subject at least a firstdose and a second dose of an immunogenic composition comprising C. difficile toxoids A andB, and a CpG adjuvant or a saponin containing liposomal adjuvant, wherein the second dose is administered about 6 months after the first dose, wherein the geometric mean concentration(GMC) of C. difficile toxin B neutralizing antibodies is at least about 50, 100, 150, 200, 250,300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,100, 2,200, 2,300, or 2,400neutralization units / mL or higher at 1 month after the first dose (Month 1), at least about 50,100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1,000, 1,500, 2,000, 2,500, 3,000, 3,500, 4,000, 4,500, 5,000, 5,500, 6,000, 6,500, 7,000, 7,500, 8,000, 8,500, 9,000, 9,500, 10,000, 15,000, 20,000, 25,000, 30,000, 35,000, 36,000, 40,000, 45,000, 50,000, 55,000, 60,000, 65,000, 70,000, 71,000, 72,000, 73,000, 74,000, 75,000, 80,000, 85,000, 90,000, 95,000, 96,000, 97,000, 98,000, or 99,000 neutralizationunits / mL or higher at 1 month after the second dose (Month 7), at least about 50, 100, 150,200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1,0001,500, 2,000, 2,500, 3,000, 3,500, 4,000, 4,500, 5,000, 5,500, 6,000, 6,500, 7,000, 7,500, 8,000, 8,500, 9,000, 9,500, 9,600, 9,700, 9,800, 9,900, 10,000, 10,500, 11,000, 11,500, 12,000, 12,500, 13,000, 13,500, 14,000, 14,500, 15,000, 15,500, 16,000, 16,500, 17,000, 17,100,17,200, or 17,300 neutralization units / mL or higher at 6 months after the second dose (Month12), and / or at least about 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700,750, 800, 850, 900, 950, 1,000, 1,500, 2,000, 2,500, 3,000, 3,500, 4,000, 4,500, 5,000, 5,500, 6,000, 6,500, 6,600, 6,700, 7,000, 7,500, 8,000, 8,100, 8,500, 9,000, 9,500, 10,000, 10,500, 11,000, 11,500, 12,000, 12,500, 13,000, 13,500, 14,000, 14,500, 15,000, 15,500, 15,600, or15,700 neutralization units / mL or higher at 12 months after the second dose (Month 18).In one aspect, the present invention provides for a method of eliciting an immuneresponse in a human subject against C. difficile and / or a method of preventing a C. difficileinfection in a human subject, the method comprising administering to the human subject at least a first dose and a second dose of an immunogenic composition comprising C. difficiletoxoids A and B, and about 1.0 mg / mL CpG 24555 and about 1.5 mg / mL Al(OH)3, wherein thesecond dose is administered about 6 months after the first dose, and the geometric meanconcentration (GMC) of C. difficile toxin A neutralizing antibodies is at least about 250, 500,1000, 1500, 2,000, or 2,500 neutralization units / mL or higher at 1 month after the second dose(Month 7), at least about 500, 600, 700, or 750 neutralization units / mL or higher at 6 monthsafter the second dose (Month 12), and / or at least about 400, 450, 500, or 550 neutralizationunits / mL or higher at 12 months after the second dose (Month 18); and / or wherein the seconddose is administered about 6 months after the first dose, and / or the GMC of C. difficile toxin Bneutralizing antibodies is at least about 5,000, 10,000, 15,000, 20,000, 25,000, 30,000, or35,000 neutralization units / mL or higher at 1 month after the second dose (Month 7), at leastabout 3,000, 4,000, 5,000, 6,000, 7,000, 8,000, or 8,500 neutralization units / mL or higher at 6months after the second dose (Month 12), and / or at least about 3,000, 4,000, 5,000, 6,000, or6,500 neutralization units / mL or higher at 12 months after the second dose (Month 18).In one aspect, the present invention provides for a method of eliciting an immuneresponse in a human subject against C. difficile and / or a method of preventing a C. difficileinfection in a human subject, the method comprising administering to the human subject at least a first dose and a second dose of an immunogenic composition comprising C. difficiletoxoids A and B, and about 3.6 mg / mL CpG alone, without aluminum hydroxide (Al(OH)3,wherein the second dose is administered about 6 months after the first dose, and GMC of C.difficile toxin A neutralizing antibodies is at least about 500, 1000, 1500, 2,000, 2,500, 3,000,or 3,500 neutralization units / mL or higher at 1 month after the second dose (Month 7), at leastabout 500, 550, 600, 650, 700, 750, 800, 850, 900, or 950 neutralization units / mL or higher at6 months after the second dose (Month 12), and / or at least about 500, 550, 600, 650, 700, or750 neutralization units / mL or higher at 12 months after the second dose (Month 18); and / orwherein the second dose is administered about 6 months after the first dose, and / or the GMCof C. difficile toxin B neutralizing antibodies is at least about 3,000, 4,000, 5,000, 10,000,20,000, 30,000, 40,000, 50,000, 60,000, or 70,000 neutralization units / mL or higher at 1 monthafter the second dose (Month 7), at least about 3,000, 4,000, 5,000, 6,000, 7,000, 8,000,9,000, or 9,500 neutralization units / mL or higher at 6 months after the second dose (Month12), and / or at least about 3,000, 4,000, 5,000, 6,000, 7,000, or 8,000 neutralization units / mLor higher at 12 months after the second dose (Month 18).In one aspect, the present invention provides for a method of eliciting an immuneresponse in a human subject against C. difficile and / or a method of preventing a C. difficileinfection in a human subject, the method comprising administering to the human subject at least a first dose and a second dose of an immunogenic composition comprising C. difficile toxoids A and B, and LiNA-2, wherein the second dose is administered about 6 months afterthe first dose, and the GMC of C. difficile toxin A neutralizing antibodies is at least about 250,500, 1000, 2,000, 3,000, or 3,5000 neutralization units / mL or higher at 1 month after thesecond dose (Month 7), at least about 500, 750, or 1,000 neutralization units / mL or higher at6 months after the second dose (Month 12), and / or at least about 500, 600, 700, or 800neutralization units / mL or higher at 12 months after the second dose (Month 18); and / orwherein the second dose is administered about 6 months after the first dose, and / or whereinthe GMC of C. difficile toxin B neutralizing antibodies is at least about 15,000, 25,000, 50,000,75,000, 80,000, 90,000, or 95,000 neutralization units / mL or higher at 1 month after thesecond dose (Month 7), at least about 2,500, 5,000, 10,000, or 15,000 neutralization units / mLor higher at 6 months after the second dose (Month 12), and / or at least about 2,500, 5,000,10,000, or 15,000 neutralization units / mL or higher at 12 months after the second dose (Month18). The present invention further provides for a method of eliciting an immune response ina human subject against C. difficile and / or a method of preventing a C. difficile infection (CDI)in a human subject, the method comprising administering to the human subject at least a firstdose and a second dose of an immunogenic composition comprising C. difficile toxoids A andB, and a CpG adjuvant or a saponin containing liposomal adjuvant, wherein the second dose is administered about 6 months after the first dose, wherein the geometric mean fold rise(GMFR) in C. difficile toxin A neutralizing antibodies is at least about 1.0, 1.5, 2.0, 2.1, 2.2,2.3, 2.4, 2.5, 3.0, 3.5, 4.0, or 4.1 or higher from baseline to 1 month after the first dose (Month1), at least about 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0,9.5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 or higher from baseline to 1 month afterthe second dose (Month 7), at least about 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.1, 5.2,5.3, 5.4, 5.5, 6.0, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.5, 7.6, 7.7, or 7.8 or higher from baseline to 6months after the second dose (Month 12), and / or at least about 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 3.6,3.7, 3.8, 3.9, 4.0, 4.5, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 6.0, 6.1, or 6.2 or higher from baseline to 12months after the second dose (Month 18). The present invention further provides for a method of eliciting an immune response ina human subject against C. difficile and / or a method of preventing a C. difficile infection (CDI)in a human subject, the method comprising administering to the human subject at least abouta first dose and a second dose of an immunogenic composition comprising C. difficile toxoidsA and B, and a CpG adjuvant or a saponin containing liposomal adjuvant, wherein the second dose is administered about 6 months after the first dose, wherein the geometric mean fold rise(GMFR) in C. difficile toxin B neutralizing antibodies is at least about 1.0, 1.5, 2.0, 2.5, 2.6,2.7, 2.8, 2.9, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 5.6, 5.7, 5.8, 5.9, or 6.0 or higher from baseline to 1month after the first dose (Month 1), at least about 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5,6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 156,157, 158, 159, 160, 165, 166, 167, or 168 or higher from baseline to 1 month after the seconddose (Month 7), at least about 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5,8.0, 8.5, 9.0, 9.5, 10, 15, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29 or higher from baseline to 6months after the second dose (Month 12), and / or at least about 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0,4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25,26, or 27 or higher from baseline to 12 months after the second dose (Month 18).In one aspect, the present invention provides for a method of eliciting an immuneresponse in a human subject against C. difficile and / or a method of preventing a C. difficileinfection in a human subject, the method comprising administering to the human subject at least a first dose and a second dose of an immunogenic composition comprising C. difficile toxoids A and B, and about 1.0 mg / mL CpG 24555 and about 1.5 mg / mL Al(OH)3, wherein the second dose is administered about 6 months after the first dose, and the geometric mean foldrise (GMFR) in C. difficile toxin A neutralizing antibodies is at least about 5, 10, or 15 or higherfrom baseline to 1 month after the second dose (Month 7), at least about 4, 4.5, or 5 or higherfrom baseline to 6 months after the second dose (Month 12), and / or at least about 2, 2.5, 3,or 3.5 or higher from baseline to 12 months after the second dose (Month 18) and / or whereinthe second dose is administered about 6 months after the first dose, and / or the GMFR in C.difficile toxin B neutralizing antibodies is at least about 40, 50, 60, 70, 80, 90, or 95 or higherfrom baseline to 1 month after the second dose (Month 7), at least about 10, 15, or 20 orhigher from baseline to 6 months after the second dose (Month 12), and / or at least about 5,10, or 15 or higher from baseline to 12 months after the second dose (Month 18).In one aspect, the present invention provides for a method of eliciting an immuneresponse in a human subject against C. difficile and / or a method of preventing a C. difficileinfection in a human subject, the method comprising administering to the human subject at least a first dose and a second dose of an immunogenic composition comprising C. difficiletoxoids A and B, and about 3.6 mg / mL CpG alone, without aluminum hydroxide (Al(OH)3,wherein the second dose is administered about 6 months after the first dose, and GMFR in C.difficile toxin A neutralizing antibodies is at least about 5, 10, 15, or 20 or higher from baselineto 1 month after the second dose (Month 7), at least about 4, 5, 5.5, 6, or 6.5 or higher frombaseline to 6 months after the second dose (Month 12), and / or at least about 4, 4.5, or 5 orhigher from baseline to 12 months after the second dose (Month 18); and / or wherein thesecond dose is administered about 6 months after the first dose, and / or the GMFR in C. difficiletoxin B neutralizing antibodies is at least about 50, 75, 100, 125, 150, or 155 or higher frombaseline to 1 month after the second dose (Month 7), at least about 5, 10, 15, or 20 or higherfrom baseline to 6 months after the second dose (Month 12), and / or at least about 5, 10, or15 or higher from baseline to 12 months after the second dose (Month 18).In one aspect, the present invention provides for a method of eliciting an immuneresponse in a human subject against C. difficile and / or a method of preventing a C. difficileinfection in a human subject, the method comprising administering to the human subject at least a first dose and a second dose of an immunogenic composition comprising C. difficiletoxoids A and B, and LiNA-2, wherein the second dose is administered about 6 months afterthe first dose, and the GMFR in C. difficile toxin A neutralizing antibodies is at least about 5,10, 15, 20, or 25 or higher from baseline to 1 month after the second dose (Month 7), at leastabout 4, 5, 6, or 7 or higher from baseline to 6 months after the second dose (Month 12),and / or at least about 3, 4, 5, or 6 or higher from baseline to 12 months after the second dose(Month 18) and / or wherein the second dose is administered about 6 months after the firstdose, and the GMFR in C. difficile toxin B neutralizing antibodies is at least about 50, 75, 100,125, or 150 or higher from baseline to 1 month after the second dose (Month 7), at least about10, 15, 20, or 25 or higher from baseline to 6 months after the second dose (Month 12), and / orat least about 10, 15, 20, or 25 or higher from baseline to 12 months after the second dose(Month 18). The present invention further provides for a method of eliciting an immune response ina human subject against C. difficile and / or a method of preventing a C. difficile infection (CDI)in a human subject, the method comprising administering to the human subject at least a firstdose and a second dose of an immunogenic composition comprising C. difficile toxoids A andB, and a CpG adjuvant or a saponin containing liposomal adjuvant, wherein the second dose is administered about 6 months after the first dose, wherein the percentage of subjects with at least a 4-fold rise in C. difficile toxin A neutralizing antibody concentrations is at least about 1.0, 1.5, 2.0, 2.5, 3.5, 4.0, 4.5, 5.0, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5,10, 11, 12, 13, 14, 15, 16, or 17% or higher from baseline to 1 month after the first dose (Month1), at least about 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0,9.5, 10, 15, 20, 25, 30, 35, 40, 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80, 81, 82, 83, 84,85, 86, 87, or 88% or higher from baseline to 1 month after the second dose (Month 7), atleast about 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10,15, 20, 21, 22, 23, 24, 25, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40% or higher from baselineto 6 months after the second dose (Month 12), and / or at least about 1.0, 1.5, 2.0, 2.5, 3.0, 3.5,4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10, 11, 12, 13, 14, 15, 20, 21, 22, 23, 24,25, 26, or 27% or higher from baseline to 12 months after the second dose (Month 18).The present invention further provides for a method of eliciting an immune response ina human subject against C. difficile and / or a method of preventing a C. difficile infection (CDI)in a human subject, the method comprising administering to the human subject at least a firstdose and a second dose of an immunogenic composition comprising C. difficile toxoids A andB, and a CpG adjuvant or a saponin containing liposomal adjuvant, wherein the second dose is administered about 6 months after the first dose, wherein the percentage of subjects with at least a 4-fold rise in C. difficile toxin B neutralizing antibody concentrations is at least about 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10, 15, 20, 21,22, 23, 24, 25, 30, 31, 32, 33, 34, or 35% or higher from baseline to 1 month after the firstdose (Month 1), at least about 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5,8.0, 8.5, 9.0, 9.5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 95, 96, 97, 98, 99 or 100% from baseline to 1 month after the second dose(Month 7), at least about 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0,8.5, 9.0, 9.5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 61, 62, 63, 64, 65, 66, 67, or 68% orhigher from baseline to 6 months after the second dose (Month 12), and / or at least about 1.0,1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, or 88% orhigher from baseline to 12 months after the second dose (Month 18).In one aspect, the present invention provides for a method of eliciting an immuneresponse in a human subject against C. difficile and / or a method of preventing a C. difficileinfection in a human subject, the method comprising administering to the human subject at least a first dose and a second dose of an immunogenic composition comprising C. difficiletoxoids A and B, and about 1.0 mg / mL CpG 24555 and about 1.5 mg / mL Al(OH)3, wherein thesecond dose is administered about 6 months after the first dose, and the percentage of subjects with at least a 4-fold rise in C. difficile toxin A neutralizing antibody concentrations isat least about 10, 20, 30, 40, or 50% or higher from baseline to 1 month after the second dose(Month 7), at least about 25, 30, 35, or 40% or higher from baseline to 6 months after thesecond dose (Month 12), and / or at least about 5, 10, or 12% or higher from baseline to 12months after the second dose (Month 18) and / or wherein the second dose is administeredabout 6 months after the first dose, and / or the percentage of subjects with at least a 4-fold risein C. difficile toxin B neutralizing antibody concentrations is at least about 30, 40, 50, 60, 70,80, or 85% or higher from baseline to 1 month after the second dose (Month 7), at least about 30, 40, 50, 60, or 65% or higher from baseline to 6 months after the second dose (Month 12),at least about 30, 40, 50, 60, 70, or 75% or higher from baseline to 12 months after the seconddose (Month 18). In one aspect, the present invention provides for a method of eliciting an immuneresponse in a human subject against C. difficile and / or a method of preventing a C. difficileinfection in a human subject, the method comprising administering to the human subject at least a first dose and a second dose of an immunogenic composition comprising C. difficiletoxoids A and B, and about 3.6 mg / mL CpG alone, without aluminum hydroxide (Al(OH)3,wherein the second dose is administered about 6 months after the first dose, and the percentage of subjects with at least a 4-fold rise in C. difficile toxin A neutralizing antibodyconcentrations is at least about 20, 30, 40, 50, 60, 70, or 80% or higher from baseline to 1month after the second dose (Month 7), at least about 15, 20, or 25% or higher from baselineto 6 months after the second dose (Month 12), and / or at least about 15, 20, or 25% or higher from baseline to 12 months after the second dose (Month 18); and / or wherein the second doseis administered about 6 months after the first dose, and / or the percentage of subjects with atleast a 4-fold rise in C. difficile toxin B neutralizing antibody concentrations is at least about 20, 30, 40, 50, 60, 70, 80, 90, or 100% or higher from baseline to 1 month after the seconddose (Month 7), at least about 20, 30, 40, 50, 60% or higher from baseline to 6 months afterthe second dose (Month 12), at least about 20, 30, 40, 50, 60, 70, 80% or higher from baselineto 12 months after the second dose (Month 18). In one aspect, the present invention provides for a method of eliciting an immuneresponse in a human subject against C. difficile and / or a method of preventing a C. difficileinfection in a human subject, the method comprising administering to the human subject at least a first dose and a second dose of an immunogenic composition comprising C. difficile toxoids A and B, and LiNA-2, wherein the second dose is administered about 6 months after the first dose, and the percentage of subjects with at least a 4-fold rise in C. difficile toxin Aneutralizing antibody concentrations is at least about 10, 20, 30, 40, 50, 60, 70, 80, or 85% orhigher from baseline to 1 month after the second dose (Month 7), at least about 10, 20, or30% or higher from baseline to 6 months after the second dose (Month 12), and / or at leastabout 10, 20, or 25% or higher from baseline to 12 months after the second dose (Month 18);and / or wherein the second dose is administered about 6 months after the first dose, and / or the percentage of subjects with at least a 4-fold rise in C. difficile toxin B neutralizing antibodyconcentrations is at least about 30, 40, 50, 60, 70, 80, 90, or 100% from baseline to 1 monthafter the second dose (Month 7), at least about 40, 50, 60, or 65% or higher from baseline to6 months after the second dose (Month 12), at least about 50, 60, 70, 80, or 85% or higherfrom baseline to 12 months after the second dose (Month 18). The present invention further provides for a method of eliciting an immune response ina human subject against C. difficile and / or a method of preventing a C. difficile infection (CDI)in a human subject, the method comprising administering to the human subject at least a firstdose and a second dose of an immunogenic composition comprising C. difficile toxoids A andB, and a CpG adjuvant or a saponin containing liposomal adjuvant, wherein the second doseis administered about 2, 4, 6 or 12 months after the first dose, and a booster dose is aadministered after the second dose, preferably about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,14, 15, 16, 17, 18 months, 2, 3, 4, or 5 years or later after the second dose;wherein the geometric mean concentration (GMC) of C. difficile toxin A and / or toxin Bneutralizing antibodies at 1 month after the booster dose are higher compared to the GMCsof C. difficile toxin A and / or toxin B neutralizing antibodies at 1 month after the first dose and / or1 month after the second dose, for example, the GMC of C. difficile toxin A neutralizingantibodies is at least about 500, 1000, 2,000, 3,000, 4,000, 5,000 or 6,000 neutralizationunits / mL or higher at 1 month after the booster dose, and / or the GMC of C. difficile toxin Bneutralizing antibodies is at least about 5,000, 10,000, 20,000, 30,000, 40,000, 50,000,60,000, 70,000, 80,000, 90,000, 100,000, 110,000, 120,000, 130,000, 140,000, 150,000,160,000 neutralization units / mL or higher at 1 month after the booster dose;wherein the geometric mean fold rise (GMFR) in C. difficile toxin A and / or toxin Bneutralizing antibodies from baseline to 1 month after the booster dose are higher comparedto the GMFRs in C. difficile toxin A and / or toxin B neutralizing antibodies from baseline to1month after the first dose and / or 1 month after the second dose, for example, and the GMFRin C. difficile toxin A neutralizing antibodies is at least about 5, 10, 15, 20, 25, 30 or 35 orhigher from baseline to 1 month after the booster dose, and / or GMFR in C. difficile toxin Bneutralizing antibodies is at least about at least about 10, 20, 30, 40, 50, 75, 100, 125, 150,175, 200, 225, 250, 275, 300, 35, 350, 375, 400 or 425 or higher or higher from baseline to 1month after the booster dose; and / or wherein the percentage of subjects with at least a 4-fold rise in C. difficile toxin A and / ortoxin B neutralizing antibody concentrations is at least about 5, 10, 20, 30, 40, 50, 60, 70, 80,90% or higher from baseline to 1 month after the booster dose and / or at least about 5, 10, 20,30, 40, 50, 60, 70, 80, 90% or higher from before the booster dose to 1 month after the booster dose. The present invention further provides for a method of eliciting an immune responsein a human subject against C. difficile and / or a method of preventing a C. difficile infection(CDI), the method comprising administering to the human subject an immunogeniccomposition comprising C. difficile toxoids A and B, and 1.0 mg / mL CpG 24555 and 1.5mg / mL of Al(OH)3 on a 0- and 2-month dosing schedule,wherein a higher immune response to toxin A and toxin B was observed 1 month afterthe second dose (Month 3) of the immunogenic composition (GMFRs from baseline 6.1 and28.3, respectively) compared to the immune response to toxin A and toxin B observed 1 monthafter the second dose (Month 2) of the Al(OH)3-containing formulation administered on a 0-,1- and 6-month dosing schedule (GMFRs from baseline 1.7 and 3.2, respectively),wherein a higher immune response to toxin B was observed at Month 12 (i.e.10 monthsafter the second dose) of the immunogenic composition (GMFR from baseline 9.5), comparedto the immune response to toxin B observed at Month 12 (i.e. 6 months after a third dose) ofthe Al(OH)3-containing formulation administered on a 0-, 1- and 6-month dosing schedule(GMFR from baseline 5.8), and / or wherein a higher immune response to toxin B was observed at Month 18 (i.e.16 monthsafter the second dose) of the immunogenic composition (GMFR from baseline 10.0),compared to the immune response to toxin B observed at Month 18 (i.e. 12 months after athird dose) of the Al(OH)3-containing formulation administered on a 0-, 1- and 6-month dosingschedule (GMFR from baseline 6.4). The present invention further provides for a method of eliciting an immune responsein a human subject against C. difficile and / or a method of preventing a C. difficile infection(CDI), the method comprising administering to the human subject an immunogeniccomposition comprising C. difficile toxoids A and B, and 1.0 mg / mL CpG 24555 and 1.5mg / mL of Al(OH)3 on a 0- and 6-month dosing schedule,wherein a higher immune response to toxin A and toxin B was observed 1 month afterthe second dose (Month 7) of the immunogenic composition (GMFRs from baseline 17.22 and98.05, respectively) compared to the immune response to toxin A and toxin B observed 1month after the second dose (Month 2) of the Al(OH)3-containing formulation administered ona 0-, 1- and 6-month dosing schedule (GMFRs from baseline 1.7 and 3.2, respectively),wherein a higher immune response to toxin A and toxin B was observed 1 month afterthe second dose (Month 7) of the immunogenic composition (GMFRs from baseline 17.22 and98.05, respectively) compared to the immune response to toxin A and toxin B observed 1month after a third dose (Month 7) of the Al(OH)3-containing formulation administered on a 0-, 1- and 6-month dosing schedule (GMFRs from baseline 8.49 and 29.05, respectively),wherein a higher immune response to toxin A and toxin B was observed at Month 12(i.e.6 months after the second dose) of the immunogenic composition (GMFRs from baseline5.4 and 22.6, respectively), compared to the immune response to toxin A and toxin B observedat Month 12 (i.e. 6 months after a third dose) of the Al(OH)3-containing formulationadministered on a 0-, 1- and 6-month dosing schedule (GMFRs from baseline 4.6 and 5.8,respectively), and / or wherein a higher immune response to toxin A and toxin B was observed at Month 18(i.e.12 months after the second dose) of the immunogenic composition (GMFRs from baseline3.9 and 18.0, respectively), compared to the immune response to toxin A and toxin B observedat Month 18 (i.e. 12 months after a third dose) of the Al(OH)3-containing formulationadministered on a 0-, 1- and 6-month dosing schedule (GMFRs from baseline 3.6 and 6.4,respectively). The present invention further provides for a method of eliciting an immune response ina human subject against C. difficile and / or a method of preventing a C. difficile infection in ahuman subject, the method comprising administering to the human subject an immunogeniccomposition comprising C. difficile toxoids A and B, and 3.6 mg / mL CpG 24555 on a 0- and2-month dosing schedule, wherein a higher immune response to toxin A and toxin B was observed 1 month afterthe second dose (Month 3) of the immunogenic composition (GMFRs from baseline 9.69 and48.56, respectively) compared to the immune response to toxin A and toxin B observed 1month after the second dose (Month 2) of the Al(OH)3-containing formulation administered ona 0-, 1- and 6-month dosing schedule (GMFRs from baseline 1.7 and 3.2, respectively),wherein a higher immune response to toxin A and toxin B was observed 1 month afterthe second dose (Month 3) of the immunogenic composition (GMFRs from baseline 9.69 and48.56, respectively) compared to the immune response to toxin A and toxin B observed 1month after a third dose (Month 7) of the Al(OH)3-containing formulation administered on a 0-, 1- and 6-month dosing schedule (GMFRs from baseline 8.49 and 29.05, respectively), and / orwherein a higher immune response to toxin B was observed at Month 12 (i.e.10 monthsafter the second dose) of the immunogenic composition (GMFR from baseline 21.7),compared to the immune response to toxin B observed at Month 12 (i.e.6 months after a thirddose) of the Al(OH)3-containing formulation administered on a 0-, 1- and 6-month dosingschedule (GMFR from baseline 5.8). The present invention further provides for a method of eliciting an immune response ina human subject against C. difficile and / or a method of preventing a C. difficile infection (CDI)in a human subject, the method comprising administering to the human subject animmunogenic composition comprising C. difficile toxoids A and B, and 3.6 mg / mL CpG 24555on a 0- and 6-month dosing schedule,wherein a higher immune response to toxin A and toxin B was observed 1 month afterthe second dose (Month 7) of the immunogenic composition (GMFRs from baseline 22.60 and159.68, respectively) compared to the immune response to toxin A and toxin B observed 1month after the second dose (Month 2) of the Al(OH)3-containing formulation administered ona 0-, 1- and 6-month dosing schedule (GMFRs from baseline 1.7 and 3.2, respectively),wherein a higher immune response to toxin A and toxin B was observed 1 month afterthe second dose (Month 7) of the immunogenic composition (GMFRs from baseline 22.60 and159.68, respectively) compared to the immune response to toxin A and toxin B observed 1month after a third dose (Month 7) of the Al(OH)3-containing formulation administered on a 0-, 1- and 6-month dosing schedule (GMFRs from baseline 8.49 and 29.05, respectively),wherein a higher immune response to toxin A and toxin B was observed at Month 12(i.e.6 months after the second dose) of the immunogenic composition (GMFRs from baseline6.8 and 23.1, respectively), compared to the immune response to toxin A and toxin B observedat Month 12 (i.e. 6 months after a third dose) of the Al(OH)3-containing formulationadministered on a 0-, 1- and 6-month dosing schedule (GMFRs from baseline 4.6 and 5.8,respectively), and / or wherein a higher immune response to toxin A and toxin B was observed at Month 18(i.e.12 months after the second dose) of the immunogenic composition (GMFRs from baseline5.1 and 17.1, respectively), compared to the immune response to toxin A and toxin B observedat Month 18 (i.e. 12 months after a third dose) of the Al(OH)3-containing formulationadministered on a 0-, 1- and 6-month dosing schedule (GMFRs from baseline 3.6 and 6.4,respectively). The present invention further provides for a method of eliciting an immune responsein a human subject against C. difficile and / or a method of preventing a C. difficile infection(CDI), the method comprising administering to the human subject an immunogeniccomposition comprising C. difficile toxoids A and B, and LiNA-2 on a 0- and 2-month dosingschedule, wherein a higher immune response to toxin A and toxin B was observed 1 month afterthe second dose (Month 3) of the immunogenic composition (GMFRs from baseline 9.5 and71.0, respectively) compared to the immune response to toxin A and toxin B observed 1 monthafter the second dose (Month 2) of the Al(OH)3-containing formulation administered on a 0-,1- and 6-month dosing schedule (GMFRs from baseline 1.7 and 3.2, respectively),wherein a higher immune response to toxin A and toxin B was observed 1 month afterthe second dose (Month 3) of the immunogenic composition (GMFRs from baseline 9.45 and71.00, respectively) compared to the immune response to toxin A and toxin B observed 1month after a third dose (Month 7) of the Al(OH)3-containing formulation administered on a 0-, 1- and 6-month dosing schedule (GMFRs from baseline 8.49 and 29.05, respectively),wherein a higher immune response to toxin B was observed at Month 12 (i.e. 10months after the second dose) of the immunogenic composition (GMFR from baseline 11.1),compared to the immune response to toxin B observed at Month 12 (i.e.6 months after a thirddose) of the Al(OH)3-containing formulation administered on a 0-, 1- and 6-month dosingschedule (GMFR from baseline 5.8, respectively), and / or wherein a higher immune response to toxin B was observed at Month 18 (i.e. 16months after the second dose) of the immunogenic composition (GMFR from baseline 12.2),compared to the immune response to toxin B observed at Month 18 (i.e. 12 months after athird dose) of the Al(OH)3-containing formulation administered on a 0-, 1- and 6-month dosingschedule (GMFR from baseline 6.4). The present invention further provides for a method of eliciting an immune responsein a human subject against C. difficile and / or a method of preventing a C. difficile infection(CDI), the method comprising administering to the human subject an immunogeniccomposition comprising C. difficile toxoids A and B, and LiNA-2 on a 0- and 6-month dosingschedule, wherein a higher immune response to toxin A and toxin B was observed 1 month afterthe second dose (Month 7) of the immunogenic composition (GMFRs from baseline 25.60 and168.84, respectively) compared to the immune response to toxin A and toxin B observed 1month after the second dose (Month 2) of the Al(OH)3-containing formulation administered ona 0-, 1- and 6-month dosing schedule (GMFRs from baseline 1.7 and 3.2, respectively), and / orwherein a higher immune response to toxin A and toxin B was observed 1 month afterthe second dose (Month 7) of the immunogenic composition (GMFRs from baseline 25.60 and168.84, respectively) compared to the immune response to toxin A and toxin B observed 1month after a third dose (Month 7) of the Al(OH)3-containing formulation administered on a 0-, 1- and 6-month dosing schedule (GMFRs from baseline 8.49 and 29.05, respectively),wherein a higher immune response to toxin A and toxin B was observed at Month 12(i.e.6 months after the second dose) of the immunogenic composition (GMFRs from baseline7.8 and 29.2, respectively), compared to the immune response to toxin A and toxin B observedat Month 12 (i.e. 6 months after a third dose) of the Al(OH)3-containing formulationadministered on a 0-, 1- and 6-month dosing schedule (GMFRs from baseline 4.6 and 5.8,respectively), and / or wherein a higher immune response to toxin A and toxin B was observed at Month 18(i.e.12 months after the second dose) of the immunogenic composition (GMFRs from baseline6.2 and 27.8, respectively), compared to the immune response to toxin A and toxin B observedat Month 18 (i.e. 12 months after a third dose) of the Al(OH)3-containing formulationadministered on a 0-, 1- and 6-month dosing schedule (GMFRs from baseline 3.6 and 6.4,respectively). The present invention further provides for a method of eliciting an immune responsein a human subject against C. difficile and / or a method of preventing a C. difficile infection(CDI), the method comprising administering to the human subject an immunogeniccomposition comprising C. difficile toxoids A and B, and 3.6 mg / mL CpG 24555 on a 0- and2-month dose dosing schedule with a booster dose at Month 15 (i.e. 15 months after thesecond dose), wherein at 1 month after the booster dose (Month 16), both Toxin A and Toxin B GMCs (5794.5 and 164447.5, respectively) and GMFRs from baseline (39.1 and 425.8, respectively) substantially higher compared with those at 1 month after the first dose (Month 1) (GMCs 341.7 and 2124.8; respectively, and GMFRs 2.2 and 6.3, respectively) and 1 month after the second dose (Month 3) (GMCs 1415.9 and 16893.7, respectively, and GMFRs 9.7 and 48.6, respectively). The present invention further provides for an immunogenic composition comprising aClostridioides difficile (C. difficile) toxoid A and / or toxoid B and 3.6 mg / mL CpG 24555, for usein a method of preventing a C. difficile infection in a human subject and / or a method of elicitingan immune response in a human subject, the method comprising administering thecomposition on a 0- and 2-month dosing schedule. In one aspect, the immunogeniccomposition comprises a C. difficile toxoid A and / or toxoid B and 3.6 mg / mL CpG 24555, foruse in a method of preventing a C. difficile infection in a human subject and / or a method ofeliciting an immune response in a human subject, the method comprising administering thecomposition on a 0- and 4-month dosing schedule. In one aspect, the immunogeniccomposition comprises a C. difficile toxoid A and / or toxoid B and 3.6 mg / mL CpG 24555, foruse in a method of preventing a C. difficile infection in a human subject and / or a method ofeliciting an immune response in a human subject, the method comprising administering thecomposition on a 0- and 6-month dosing schedule. In one aspect, the immunogeniccomposition comprises a C. difficile toxoid A and / or toxoid B and 3.6 mg / mL CpG 24555, foruse in a method of preventing a C. difficile infection in a human subject and / or a method ofeliciting an immune response in a human subject, the method comprising administering thecomposition on a 0- and 12-month dosing schedule. In one aspect, the immunogeniccomposition comprises a C. difficile toxoid A and / or toxoid B and 3.6 mg / mL CpG 24555, foruse in a method of preventing a C. difficile infection in a human subject and / or a method ofeliciting an immune response in a human subject, the method comprising administering the composition on a 0-, 1-, and 6-month dosing schedule. In one aspect, the immunogeniccomposition comprises a C. difficile toxoid A and / or toxoid B and 3.6 mg / mL CpG 24555, foruse in a method of preventing a C. difficile infection in a human subject and / or a method ofeliciting an immune response in a human subject, the method comprising administering the composition on a 0-, 2-, and 6-month dosing schedule. In one aspect, the immunogeniccomposition comprises a C. difficile toxoid A and / or toxoid B and 3.6 mg / mL CpG 24555, foruse in a method of preventing a C. difficile infection in a human subject and / or a method ofeliciting an immune response in a human subject, the method comprising administering the composition on a 0-, 2-, and 15-month dosing schedule. In one aspect, the immunogeniccomposition comprises a C. difficile toxoid A and / or toxoid B and 3.6 mg / mL CpG 24555, foruse in a method of preventing a C. difficile infection in a human subject and / or a method ofeliciting an immune response in a human subject, the method comprising administering the composition on a 0-, 4-, and 12-month dosing schedule. In one aspect, the present invention provides for an immunogenic compositioncomprising a Clostridioides difficile (C. difficile) toxoid A and / or toxoid B, 1.0 mg / mL CpG24555 and 1.5 mg / mL of Al(OH)3, for use in a method of preventing a C. difficile infection in ahuman subject and / or a method of eliciting an immune response in a human subject, themethod comprising administering the composition on a 0- and 2-month dosing schedule. Inone aspect, the immunogenic composition comprises a C. difficile toxoid A and / or toxoid B,1.0 mg / mL CpG 24555 and 1.5 mg / mL of Al(OH)3, for use in a method of preventing a C.difficile infection in a human subject and / or a method of eliciting an immune response in ahuman subject, the method comprising administering the composition on a 0- and 4-monthdosing schedule. In one aspect, the immunogenic composition comprises a C. difficile toxoidA and / or toxoid B, 1.0 mg / mL CpG 24555 and 1.5 mg / mL of Al(OH)3, for use in a method ofpreventing a C. difficile infection in a human subject and / or a method of eliciting an immuneresponse in a human subject, the method comprising administering the composition on a 0-and 6-month dosing schedule. In one aspect, the immunogenic composition comprises a C.difficile toxoid A and / or toxoid B, 1.0 mg / mL CpG 24555 and 1.5 mg / mL of Al(OH)3, for use ina method of preventing a C. difficile infection in a human subject and / or a method of elicitingan immune response in a human subject, the method comprising administering thecomposition on a 0- and 12-month dosing schedule. In one aspect, the immunogeniccomposition comprises a C. difficile toxoid A and / or toxoid B, 1.0 mg / mL CpG 24555 and 1.5mg / mL of Al(OH)3, for use in a method of preventing a C. difficile infection in a human subject and / or a method of eliciting an immune response in a human subject, the method comprisingadministering the composition on a 0-, 1- and 6-month dosing schedule. In one aspect, theimmunogenic composition comprises a C. difficile toxoid A and / or toxoid, 1.0 mg / mL CpG24555 and 1.5 mg / mL of Al(OH)3, for use in a method of preventing a C. difficile infection in ahuman subject and / or a method of eliciting an immune response in a human subject, themethod comprising administering the composition on a 0-, 2- and 6-month dosing schedule.In one aspect, the immunogenic composition comprises a C. difficile toxoid A and / or toxoid B,1.0 mg / mL CpG 24555 and 1.5 mg / mL of Al(OH)3, for use in a method of preventing a C.difficile infection in a human subject and / or a method of eliciting an immune response in ahuman subject, the method comprising administering the composition on a 0-, 2- and 15-month dosing schedule. In one aspect, the immunogenic composition comprises a C. difficile toxoid A and / or toxoid B, 1.0 mg / mL CpG 24555 and 1.5 mg / mL of Al(OH)3, for use in amethod of preventing a C. difficile infection in a human subject and / or a method of eliciting animmune response in a human subject, the method comprising administering the compositionadministered to a human subject on a 0-, 4- and 12-month dosing schedule.In one aspect, the present invention provides for an immunogenic compositioncomprising a Clostridioides difficile (C. difficile) toxoid A and / or toxoid B and LiNA-2, for usein a method of preventing a C. difficile infection in a human subject and / or a method of elicitingan immune response in a human subject, the method comprising administering thecomposition a 0- and 2-month dosing schedule. In one aspect, the immunogenic compositioncomprises a C. difficile toxoid A and / or toxoid B and LiNA-2, for use in a method of preventinga C. difficile infection in a human subject and / or a method of eliciting an immune response ina human subject, the method comprising administering the composition on a 0- and 4-monthdosing schedule. In one aspect, the immunogenic composition comprises a C. difficile toxoidA and / or toxoid B and LiNA-2, for use in a method of preventing a C. difficile infection in ahuman subject and / or a method of eliciting an immune response in a human subject, themethod comprising administering the composition on a 0- and 6-month dosing schedule. Inone aspect, the immunogenic composition comprises a C. difficile toxoid A and / or toxoid Band LiNA-2, for use in a method of preventing a C. difficile infection in a human subject and / ora method of eliciting an immune response in a human subject, the method comprisingadministering the composition on a 0- and 12-month dosing schedule. In one aspect, theimmunogenic composition comprises a C. difficile toxoid A and / or toxoid B and LiNA-2, for usein a method of preventing a C. difficile infection in a human subject and / or a method of elicitingan immune response in a human subject, the method comprising administering thecomposition on a 0-, 1- and 6-month dosing schedule. In one aspect, the immunogeniccomposition comprises a C. difficile toxoid A and / or toxoid B and LiNA-2, for use in a methodof preventing a C. difficile infection in a human subject and / or a method of eliciting an immuneresponse in a human subject, the method comprising administering the composition on a 0-,2- and 6-month dosing schedule. In one aspect, the immunogenic composition comprises aC. difficile toxoid A and / or toxoid B and LiNA-2, for use in a method of preventing a C. difficileinfection in a human subject and / or a method of eliciting an immune response in a humansubject, the method comprising administering the composition on a 0-, 2- and 15-month dosingschedule. In one aspect, the immunogenic composition comprises a C. difficile toxoid A and / ortoxoid B and LiNA-2, for use in a method of preventing a C. difficile infection in a human subject and / or a method of eliciting an immune response in a human subject, the method comprisingadministering the composition on a 0-, 4- and 12-month dosing schedule.Upon administration of compositions described herein using such methods to a host / subject, an immune response is typically observed, which typically includes a humoral immune response and may involve a cellular immune response. In certain aspects, the methods and uses may comprise administering theimmunogenic composition to a human, subject at risk for infection. In some aspects, the human subject may be at least about any of 18, 20, 25, 30, 35, 40, 50, 55, 65, 75, 80 or 85 years or older. In some aspects, the human subject may be about 40 to about 65 years of ageor older. In some aspects, the human subject may be about 65 to about 85 years of age older.In some aspects, the human subject may be about 18 years of age or older. In some aspects,the human subject may be about 50 years of age or older. In some aspects, the human subjectmay be about 55 years of age or older. In some aspects, the human subject may be about 60 years of age or older. In some aspects, the human subject may be about 65 years of age or older. In one aspect, the invention relates to methods and uses for immunizing a subject(e.g., a human being) against C. difficile by administering thereto a composition comprisingone or more antigens of C. difficile and an adjuvant. In one aspect, the invention relates to acomposition disclosed herein for use in a method for immunizing a subject against C. difficile. In one aspect, the invention relates to a composition disclosed herein for use in a method for immunizing a human subject against C. difficile. In one aspect, the human subject is 40-90years of age or older. In one aspect, the human subject is 50-85 years of age or older. In oneaspect, the human subject is 60-85 years of age or older. In an aspect, the human subject is65-85 years of age or older. In one aspect, the human subject is 65-69 years of age or older.In an aspect, the human subject is 70-79 years of age or older. In one aspect, the humansubject is 75-79 years of age or older. In one aspect, the human subject is at least 50, 55, 60,61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85,86, 87, 88, 89 or 90 years of age or older. In one aspect, the human subject is at least 65, 66,67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84 or 85 years of age or older.The immunogenic compositions described above may include one mutant C. difficiletoxin (A or B), i.e., polypeptides and an adjuvant. Accordingly, the immunogenic compositionscan occupy separate vials (e.g., a separate vial for a composition including mutant C. difficiletoxin A and a separate vial for a composition including mutant C. difficile toxin B) in thepreparation or kit. The immunogenic compositions may be intended for simultaneous, sequential, or separate use. In another aspect, the immunogenic compositions described above may include bothmutant C. difficile toxins (A and B), i.e., polypeptides. Any combination of mutant C. difficiletoxin A and mutant C. difficile toxin B described may be combined for an immunogenic composition. Accordingly, the immunogenic compositions can be combined in a single vial (e.g., a single vial containing both a composition including mutant C. difficile TcdA and acomposition including mutant C. difficile TcdB). Preferably, the immunogenic compositionsinclude a mutant C. difficile TcdA and a mutant C. difficile TcdB, i.e., polypeptides.In certain aspects, it is preferred that the compositions described herein exhibit immunogenic properties (e.g., inducing a detectable and / or neutralizing and / or protective immune response) following appropriate administration to a subject. The presence of neutralizing and / or protective immune response may be demonstrated as described above and / or by showing that infection by a pathogen (e.g., C. difficile) is affected (e.g., decreased) in individuals (e.g., human being or other animal) to whom the materials described herein have been administered as compared to individuals to whom the materials have not been administered. For instance, one or more test subjects (e.g., human or non-human) may be administered by any suitable route and schedule a composition described herein, and then after a suitable amount of time (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 weeks) challenged by a pathogenic organism. The animal(s) may be monitored for immune function (e.g., antibody production, T cell activity) following administration and / or challenge. Sera may be analyzed for total antibody response or for expression of particular subtypes using, for example, an antibody ELISA and / or a pathogen neutralization assay. T cell activity may be measured by, for example, measuring IFN-γ production after re-stimulation with the antigen. Statisticalanalysis (e.g., Fisher's exact test, Wilcoxon test, Mann- Whitney Test) may then be performedon data to determine whether the effectiveness of the material in affecting the immune response.The immunogenic compositions described herein may be used together or co-administered (e.g. concomitantly or concurrently) with one or more vaccines. In some aspects,the immunogenic compositions described herein are co-administered with a secondimmunogenic composition directed against an infectious disease, such as a viral infection ora bacterial infection. Thus, the present invention provides for protecting a human against a C.difficile infection and another infectious disease. In one aspect, the infectious disease is ahospital-acquired or healthcare-associated infection. For example, the C. difficile vaccines described herein may be co-administered with apneumococcal vaccine, such as a pneumococcal conjugate vaccine (PCV) used to protectagainst disease caused by Streptococcus pneumoniae, including PREVNAR, PREVNAR 7,PREVNAR 13, PREVNAR 20 and VAXNEUVANCE; a respiratory syncytial virus (RSV)vaccine, such as ABRYSVO and AREXVY; a human metapneumovirus vaccine (hMPV); abetacoronavirus vaccine, including severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) which causes COVID-19, such as COMIRNATY and SPIKEVAX; a meningococcalvaccine used to protect against Neisseria meningitidis vaccine, such as TRUMENBA, NIMENRIX, PENBRAYA, MENVEO, and BEXSERO; a varicella zoster virus (VZV) vaccine, such as SHINGRIX or a mRNA vaccine; an influenza vaccine; a human cytomegalovirus(hCMV) vaccine, an Escherichia coli (E. coli) vaccine; a Pseudomonas aeruginosa vaccine; aKlebsiella pneumoniae vaccine; an Epstein-Barr virus (EBV) vaccine; a Group BStreptococcus (GBS) vaccine and / or a tetanus vaccine, diphtheria vaccine, pertussis vaccine(e.g. Tdap), or other vaccine for an infectious disease, such as a hospital-acquired orhealthcare-associated infection. In some aspects, the C. difficile vaccines described hereinmay be co-administered with a mRNA vaccine. In some aspects, the present invention relates to a method for eliciting an immuneresponse in a human against C. difficile and another antigen. In some aspects, the presentinvention relates to a method for eliciting an immune response in a human against C. difficile and an infectious disease-causing bacterium or virus. In some aspects, the present invention relates to a method for eliciting an immuneresponse in a human against C. difficile and an infectious disease-causing bacterium or virus,the method comprising co-administering a C. difficile immunogenic composition describedherein and an immunogenic composition comprising an antigen derived from the infectious disease-causing bacterium or virus. In some aspects, the present invention relates to a method for eliciting an immuneresponse in a human against C. difficile and an infectious disease-causing bacterium or virus,the method comprising co-administering an immunogenic composition comprising C. difficiletoxoid A and / or toxoid B, and a CpG adjuvant or a saponin containing liposomal adjuvant, and an immunogenic composition comprising an antigen derived from the infectious disease- causing bacterium or virus. In some aspects, the present invention relates to a method for eliciting an immuneresponse in a human against C. difficile and an infectious disease-causing bacterium or virus,the method comprising co-administering an immunogenic composition comprising C. difficiletoxoid A and / or toxoid B, and a CpG adjuvant comprising 3.6 mg / mL of CpG 24555, a CpG adjuvant comprising about 1.0 mg / mL of CpG 24555 and about 1.5 mg / mL of Al(OH)3, or asaponin containing liposomal adjuvant, and an immunogenic composition comprising anantigen derived from the infectious disease-causing bacterium or virus. In some aspects, the present invention relates to a method for eliciting an immuneresponse in a human against C. difficile and an infectious disease-causing bacterium or virus,the method comprising co-administering a C. difficile vaccine comprising toxoid A and / ortoxoid B and a CpG adjuvant or a saponin containing liposomal adjuvant, and a secondvaccine, such as a pneumococcal vaccine, a respiratory syncytial virus (RSV) vaccine, ahuman metapneumovirus (hMPV) vaccine, a betacoronavirus vaccine, a meningococcalvaccine, a varicella zoster virus (VZV) vaccine, an influenza vaccine, a human cytomegalovirus (hCMV) vaccine, an Escherichia coli (E. coli) vaccine, a Pseudomonasaeruginosa vaccine, a Klebsiella pneumoniae vaccine, an Epstein-Barr virus (EBV) vaccine,a Group B Streptococcus (GBS) vaccine and / or a tetanus vaccine, diphtheria vaccine,pertussis vaccine (e.g. Tdap), or other vaccine for an infectious disease, such as a hospital-acquired or healthcare-associated infection. In some aspects, the present invention relates to a method for eliciting an immuneresponse in a human against C. difficile and an infectious disease-causing bacterium or virus,the method comprising co-administering a C. difficile vaccine composition comprising C.difficile toxoid A and / or toxoid B, and a CpG adjuvant comprising 3.6 mg / mL of CpG 24555, aCpG adjuvant comprising about 1.0 mg / mL of CpG 24555 and about 1.5 mg / mL of Al(OH)3,or a saponin containing liposomal adjuvant, and a second vaccine, such as a pneumococcalvaccine, a respiratory syncytial virus (RSV) vaccine, a human metapneumovirus (hMPV) vaccine, a betacoronavirus vaccine, a meningococcal vaccine, a varicella zoster virus (VZV) vaccine, an influenza vaccine, a human cytomegalovirus (hCMV) vaccine, an Escherichia coli(E. coli) vaccine, a Pseudomonas aeruginosa vaccine, a Klebsiella pneumoniae vaccine, anEpstein-Barr virus (EBV) vaccine, a Group B Streptococcus (GBS) vaccine and / or a tetanus vaccine, diphtheria vaccine, pertussis vaccine (e.g. Tdap), or other vaccine for an infectious disease, such as a hospital-acquired or healthcare-associated infection. TOXIN NEUTRALIZING ACTIVITY Immune response induced by administering the immunogenic compositions of thepresent invention may be determined using a toxin neutralization assay (TNA), ELISA, or more preferably, a cytotoxicity assay, such as that described in WIPO Patent Application WO / 2012 / 143902, U.S. Patent No.9187536, and WIPO Patent Application WO / 2014 / 060898, which are each incorporated by reference herein in their respective entireties. In one aspect, the immune response induced in the human is neutralizing against a C. difficile strain that expresses a toxin A having an amino acid sequence that has at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the toxoid A of the composition. In another aspect, the immune response induced in the human is neutralizing against a C. difficile strain that expresses a toxin B including an amino acid sequence that has at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the toxoid B of the composition. The usefulness (e.g., immunogenicity) of any of the materials (e.g., compositions) and / or methods described herein may be assayed by any of the variety of methods known to those of skill in the art. Any one or more of the assays described herein, or any other one or more suitable assays, may be used to determine the suitability of any of the materials described herein for an intended purpose. It is to be understood that these methods areexemplary and non- limiting; other assays may also be suitable. For instance, thecompositions described herein typically induce and / or enhance the production of antibodiesagainst C. difficile upon administration to a subject. Such antibodies may be detected in thesubject using any of the methods available to those of ordinary skill in the art. For instance, as described in the Examples section, serum may be obtained from a subject and tested byELISA to detect immunoglobulin type G (IgG) antibodies to C. difficile toxin A and / or toxin B(e.g., "primary immunogenicity data"). Antibodies present in test sera may be reacted with toxin A or B antigens adsorbed to individual wells of a microtiter plate. The amount of antibody bound to the antigen coated wells may be determined using a colorimetric substrate reaction after binding of a secondary anti-IgG (e.g., anti-human IgG) antibody-enzyme conjugate. Substrate for the enzyme is then typically added that causes colorimetric change that was directly proportional to the antibody bound to the antigen. The concentration of antibodies in serum may be derived by extrapolation from a standard curve, which was generated from multiple dilutions of a reference standard serum with defined IgG units (ELISA unit (EU) / mL)). A toxin neutralization assay (TNA) may also be used to quantitate neutralizing antibodies toC. difficile toxin. In this assay, serial diluted serum may be incubated with a fixed amount ofC. difficile toxin A or B. Test cells (e.g., Vero cells) may then then added and serum- toxin-cellmixture incubated under appropriate conditions (e.g., 37 °C for 6 days). The ability of the serato neutralize the cytotoxic effect of the C. difficile toxin may be determined by and correlatedto the viability of the cells. The assay utilizes the accumulation of acid metabolites in closed culture wells as an indication of normal cell respiration. In cells exposed to toxin, metabolism and CO2 production is reduced; consequently, the pH rises (e.g., to 7.4 or higher) as indicated by the phenol red pH indicator in the cell culture medium. At this pH, the medium appears red. Cell controls, or cells exposed to toxin which have been neutralized by antibody, however, metabolize and produce CO2in normal amounts; as a result, the pH is maintained (e.g., at 7.0or below) and at this pH, the medium appears yellow. Therefore, C. difficile toxin neutralizingantibodies correlate with the ability of the serum to neutralize the metabolic effects of C. difficile toxin on cells as evidenced by their ability to maintain a certain pH (e.g., of 7.0 or lower). The color change of the media may be measured (e.g., at 562 nm to 630 nm) using a plate reader to further calculate the antitoxin neutralizing antibody titer at 50% inhibition of the C. difficile toxin-mediated cytotoxicity. In one aspect, the composition induces a toxin neutralizing antibody titer that is at least greater than 1-fold, such as, for example, at least 1.01-fold, 1.1- fold, 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 11-fold, 12-fold, 13-fold, 14-fold, 15-fold, 16-fold, 32-fold, or higher in the human after receiving a dose of the composition than a toxin neutralizing antibody titer in the human prior to receiving said dose, when measured under identical conditions in a toxin neutralization assay. The toxin neutralization assay (TNA) utilized for Examples 1-7 provided herein is described. Briefly, a 384-well microtiter plate was seeded with IMR-90 cells serving as the target of toxin-mediated cytotoxicity. Each test serum sample was analyzed separately for the ability to neutralize Toxin A or Toxin B. Four serial dilutions of test sera were mixed with fixed concentrations of Toxin A (TcdA) or Toxin B (TcdB) for 60 minutes in a humidified incubator (37°C / 5% CO2) to allow for neutralization of the toxins to occur. All plates included a reference standard and quality controls which consisted of antitoxin antibodies of known titer to monitor assay performance. After the 60-minute incubation, the toxin-antiserum mixture was applied to the IMR-90 cell monolayers and the plates were incubated for an additional 72 hours. Viability of the IMR-90 cell monolayers was then tested using the luciferase-based CellTiter- Glo® reagent which provides a measure of ATP levels in metabolically active cells and was reported as relative luminescence units (RLU). A high ATP level indicates high cell viability and antibody mediated neutralization of TcdA or TcdB. The neutralizing antibody concentration was determined by comparing the RLU value of a test sample to the calibration curve from the antitoxin A or B reference standard using a custom Statistical Analysis System (SAS®) program. The functional antibody concentrations were expressed as arbitrary units per mL (or neutralizing units / mL) of serum. The lower limit of quantitation (LLOQ) for the TcdA and TcdB TNA assays are 75.9 and 249.7 neutralizing units / mL of serum, respectively. CLINICAL STUDIES Estimands The estimands to evaluate each immunogenicity objective is based on the evaluableimmunogenicity population. These estimands estimate the vaccine effect in the setting where participants follow the study schedules and protocol requirements as directed. Concentrations below the LLOQ were set to 0.5 × LLOQ for analysis. Missing serology results are not imputed. However, for the proportion of participants with a ≥4-fold rise, it will require postvaccination results ≥4 × LLOQ to be defined as a responder for participants with the prevaccination results below the LLOQ. Confidence Intervals Confidence Intervals (CIs) are exponentiations of CIs based on the Student t distribution for the mean logarithm of the concentrations, or the mean fold rise. CIs for all endpoints will be presented as 2-sided at the 95% level unless specified otherwise.Geometric Mean Concentration (GMC) and Geometric Mean Ratio (GMR)The GMC for each vaccine group is calculated as the mean of the logarithmically transformed assay results and then exponentiating the mean. The 2-sided 95% CI is obtained by exponentiating the limits of the CI for the mean of the logarithmically transformed assay results based on the Student t distribution. GMCs were calculated using all participants with valid and determinate assay results at the given sampling time point. The GMR is calculated as the ratio of GMCs from the 2-dose regimen to the 3-dose regimen for each 2-dose regimen. The 2-sided 95% CI is obtained by exponentiating the limits of the CI for the mean difference of the logarithmically transformed assay results based on the Student t distribution. Geometric Mean Fold Rise (GMFR) The GMFR for each vaccine group is defined as the geometric mean of the fold rise in the assay results from before to a specified time point after vaccination. Only data from participants with nonmissing assay results at both time points are included in the GMFR calculation. GMFR is calculated as the mean difference of logarithmically transformed assayresults (time point after vaccination – before vaccination) and exponentiating the meandifference. The 2-sided 95% CI is obtained by exponentiating the limits of the CI for the mean difference of the logarithmically transformed assay results based on the Student t distribution. Reverse Cumulative Distribution Curves (RCDC) Empirical RCDCs for immunogenicity results is plotted as a step function of the proportion of participants with the assay results equal to or exceeding a specified value over the full range of the observed assay results. SEQUENCE IDENTIFIERSSEQ ID NO: 1 sets forth the amino acid sequence for wild-type C. difficile 630 toxin A (TcdA).SEQ ID NO:...

Claims

WHAT IS CLAIMED IS:

1. A method of preventing or reducing a Clostridioides difficile (C. difficile) infection, diseaseor condition associated with C. difficile in a human subject, the method comprising administering to the human subject at least a first and a second dose of an immunogenic composition comprising a C. difficile toxoid A and / or toxoid B, and a CpG adjuvant.

2. A method of eliciting an immune response in a human subject against C. difficile, themethod comprising administering to the human subject at least a first and second dose of an immunogenic composition comprising a C. difficile toxoid A and / or toxoid B, and aCpG adjuvant.

3. The method of claim 1 or 2, wherein the CpG adjuvant comprises about 0.1 to 5 mg / mLor higher, about 0.1 to about 1.0 mg / mL, about 0.5 to about 1.5 mg / mL, about 0.8 to about 1.8 mg / mL, or about 3.0 to about 4.0 mg / mL CpG; wherein the CpG adjuvantcomprises about 0.5 mg / mL, about 1.0 mg / mL, about 1.2 mg / mL, or about 3.6 mg / mLCpG; and / or wherein the CpG adjuvant comprises about 3.6 mg / mL CpG.

4. The method of any one of claims 1-3, wherein the CpG adjuvant comprises about 3.6mg / mL CpG alone, without aluminum hydroxide (Al(OH)3.

5. The method of any one of claims 1-4, wherein the CpG adjuvant comprises CpG 24555(SEQ ID NO: 48).

6. The method of any one of claims 1-5, wherein the C. difficile toxoid A and toxoid B arelyophilized and reconstituted with a CpG adjuvant comprising about 0.1 to 5 mg / mL CpG 24555; and / or wherein the C. difficile toxoid A and toxoid B are lyophilized and reconstituted with a CpG adjuvant comprises about 3.6 mg / mL CpG 24555.

7. The method of any one of claims 1-6, wherein an immune response is elicited andcomprises neutralizing antibodies against C. difficile toxin A and / or neutralizingantibodies against C. difficile toxin B.

8. The method of any one of claims 1-7, wherein the second dose is administered about 1month after the first dose (M 0, 1), the second dose is administered about 2 months after the first dose (M 0, 2), the second dose is administered about 4 months after the firstdose (M 0, 4), the second dose is administered about 4 months after the first dose, the second dose is administered about 6 months after the first dose (M 0, 6), or the second does is administered about 12 months after the first dose (M 0, 12).

9. The method of any one of claims 1-8, wherein the second dose is administered about 6months after the first dose, and the geometric mean concentration (GMC) of C. difficile toxin A neutralizing antibodies is at least about 500, 1000, 1500, 2,000, 2,500, 3,000, or 3,500 neutralization units / mL or higher at 1 month after the second dose (Month 7), atleast about 500, 550, 600, 650, 700, 750, 800, 850, 900, or 950 neutralization units / mL or higher at 6 months after the second dose (Month 12), and / or at least about 500, 550,600, 650, 700, or 750 neutralization units / mL or higher at 12 months after the seconddose (Month 18); and / or wherein the second dose is administered about 6 months after the first dose, and the GMC of C. difficile toxin B neutralizing antibodies is at least about3,000, 4,000, 5,000, 10,000, 20,000, 30,000, 40,000, 50,000, 60,000, or 70,000 neutralization units / mL or higher at 1 month after the second dose (Month 7), at leastabout 3,000, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000, or 9,500 neutralization units / mL or higher at 6 months after the second dose (Month 12), and / or at least about 3,000,4,000, 5,000, 6,000, 7,000, or 8,000 neutralization units / mL or higher at 12 months afterthe second dose (Month 18); wherein the second dose is administered about 6 months after the first dose, and the geometric mean fold rise (GMFR) in C. difficile toxin A neutralizing antibodies is atleast about 4, 5, 10, 15, or 20 or higher from baseline to 1 month after the second dose (Month 7), at least about 4, 5, 5.5, 6, or 6.5 or higher from baseline to 6 months after thesecond dose (Month 12), and / or at least about 4, 4.5, or 5 or higher from baseline to 12 months after the second dose (Month 18); and / or wherein the second dose is administered about 6 months after the first dose, and the GMFR in C. difficile toxin Bneutralizing antibodies is at least about 5, 10, 15, or 20, 25, 50, 75, 100, 125, 150, or 155 or higher from baseline to 1 month after the second dose (Month 7), at least about5, 10, 15, or 20 or higher from baseline to 6 months after the second dose (Month 12),and / or at least about 5, 10, or 15 or higher from baseline to 12 months after the seconddose (Month 18); and / or wherein the second dose is administered about 6 months after the first dose, and the percentage of subjects with at least a 4-fold rise in C. difficile toxin A neutralizing antibody concentrations is at least about 15, 20, 30, 40, 50, 60, 70, or 80% or higher from baseline to 1 month after the second dose (Month 7), at least about 15, 20, or 25% or higher from baseline to 6 months after the second dose (Month 12), and / or at least about 15, 20, or 25% or higher from baseline to 12 months after the second dose (Month 18); and / or wherein the second dose is administered about 6 months after the first dose, and the percentage of subjects with at least a 4-fold rise in C. difficile toxin B neutralizing antibody concentrations is at least about 20, 30, 40, 50, 60, 70, 80, 90, or 100% or higher from baseline to 1 month after the second dose (Month 7), at least about 20, 30, 40, 50,60% or higher from baseline to 6 months after the second dose (Month 12), at least about 20, 30, 40, 50, 60, 70, 80% or higher from baseline to 12 months after the seconddose (Month 18).

10. The method of any one of claims 1-9, wherein the second dose is administered about 2months after the first dose, and the geometric mean concentration (GMC) of C. difficile toxin A neutralizing antibodies is at least about 50, 100, 150, 200, 250, 500, or 1,000 neutralization units / mL or higher at 1 month after the second dose (Month 3) and / or atleast about 50, 100, 150, or 200 neutralization units / mL or higher at 10 months after thesecond dose (Month 12); and / or wherein the second dose is administered about 2 months after the first dose, and the GMC of C. difficile toxin B neutralizing antibodies isat least about 50, 100, 500, 1,000, 2,000, 5,000, 10,000, or 15,000 neutralization units / mL or higher at 1 month after the second dose (Month 3), and / or at least about 50,100, 500, 1,000, 2,000, 3,000, 4,000, or 5,000 neutralization units / mL or higher at 10months after the second dose (Month 12); wherein the second dose is administered about 2 months after the first dose, and the geometric mean fold rise (GMFR) in C. difficile toxin A neutralizing antibodies is atleast about 4, 5, 6, 7, 8, or 9 or higher from baseline to 1 month after the second dose (Month 3), and / or at least about 1 or higher from baseline to 10 months after the seconddose (Month 12); and / or wherein the second dose is administered about 2 months after the first dose, and the GMFR in C. difficile toxin B neutralizing antibodies is at least about4, 5, 6, 7, 8, 9, 10, 20, 30, 35, 40, or 45 or higher from baseline to 1 month after thesecond dose (Month 3), and / or at least about 10, 15, or 20 or higher from baseline to 10months after the second dose (Month 12); and / or wherein the second dose is administered about 2 months after the first dose, and the percentage of subjects with at least a 4-fold rise in C. difficile toxin A neutralizing antibody concentrations is at least about 30, 40, 50, 60, or 70% or higher from baseline to 1 month after the second dose (Month 3); and / or wherein the second dose is administered about 2 months after the first dose, and the percentage of subjects with at least a 4-fold rise in C. difficile toxin B neutralizing antibody concentrations is at least about 30, 40, 50, 60, 70, 80, 90, or 100% from baseline to 1 month after the second dose (Month 3), and / or at least about 30, 40, 50, or 55% or higher from baseline to 10 months after the second dose (Month 12).

11. A method of preventing or reducing a Clostridioides difficile (C. difficile) infection, diseaseor condition associated with C. difficile in a human subject, the method comprising administering to the human subject at least a first and a second dose of an immunogeniccomposition comprising a C. difficile toxoid A and / or toxoid B, and a CpG adjuvantcomprising CpG and aluminum hydroxide (Al(OH)3.

12. A method of eliciting an immune response in a human subject against C. difficile, themethod comprising administering to the human subject at least a first and second dose of an immunogenic composition comprising a C. difficile toxoid A and / or toxoid B, and aCpG adjuvant comprising CpG and aluminum hydroxide (Al(OH)3.

13. The method of claim 11 or 12, wherein the CpG adjuvant comprises about 0.5 to about3.6 mg / mL CpG and about 0.1 to 5 mg / mL Al(OH)3; optionally wherein the CpG adjuvant comprises about 1.0 mg / mL CpG 24555 and about 1.5 mg / mL of Al(OH)3.

14. The method of any one of claims 11-13, wherein an immune response is elicited andcomprises neutralizing antibodies against C. difficile toxin A and / or neutralizingantibodies against C. difficile toxin B.

15. The method of any one of claims 11-14, wherein the second dose is administered about6 months after the first dose, and the geometric mean concentration (GMC) of C. difficile toxin A neutralizing antibodies is at least about 250, 500, 1000, 1500, 2,000, or 2,500 neutralization units / mL or higher at 1 month after the second dose (Month 7), at leastabout 250, 500, 600, 700, or 750 neutralization units / mL or higher at 6 months after thesecond dose (Month 12), and / or at least about 250, 300, 350, 400, 450, 500, or 550 neutralization units / mL or higher at 12 months after the second dose (Month 18); and / orwherein the second dose is administered about 6 months after the first dose, and the GMC of C. difficile toxin B neutralizing antibodies is at least about 3,000, 4,000, 5,000,10,000, 15,000, 20,000, 25,000, 30,000, or 35,000 neutralization units / mL or higher at 1month after the second dose (Month 7), at least about 3,000, 4,000, 5,000, 6,000, 7,000, 8,000, or 8,500 neutralization units / mL or higher at 6 months after the second dose(Month 12), and / or at least about 3,000, 4,000, 5,000, 6,000, or 6,500 neutralizationunits / mL or higher at 12 months after the second dose (Month 18),wherein the second dose is administered about 6 months after the first dose, and the geometric mean fold rise (GMFR) in C. difficile toxin A neutralizing antibodies is atleast about 2, 4, 5, 10, or 15 or higher from baseline to 1 month after the second dose (Month 7), at least about 2, 4, 4.5, or 5 or higher from baseline to 6 months after thesecond dose (Month 12), and / or at least about 2, 2.5, 3, or 3.5 or higher from baseline to 12 months after the second dose (Month 18) and / or wherein the second dose is administered about 6 months after the first dose, and the GMFR in C. difficile toxin Bneutralizing antibodies is at least about 10, 15, 20, 40, 50, 60, 70, 80, 90, or 95 or higherfrom baseline to 1 month after the second dose (Month 7), at least about 10, 15, or 20 or higher from baseline to 6 months after the second dose (Month 12), and / or at leastabout 5, 10, or 15 or higher from baseline to 12 months after the second dose (Month18); and / or wherein the second dose is administered about 6 months after the first dose, and the percentage of subjects with at least a 4-fold rise in C. difficile toxin A neutralizing antibody concentrations is at least about 10, 20, 30, 40, or 50% or higher from baseline to 1 month after the second dose (Month 7), at least about 10, 20, 25, 30, 35, or 40% or higher from baseline to 6 months after the second dose (Month 12), and / or at least about 5, 10, or 12% or higher from baseline to 12 months after the second dose (Month 18) and / or wherein the second dose is administered about 6 months after the first dose, and the percentage of subjects with at least a 4-fold rise in C. difficile toxin B neutralizing antibody concentrations is at least about 30, 40, 50, 60, 70, 80, or 85% or higher from baseline to 1 month after the second dose (Month 7), at least about 30, 40, 50, 60, or 65% or higher from baseline to 6 months after the second dose (Month 12), at least about 30, 40, 50, 60, 70, or 75% or higher from baseline to 12 months after the second dose (Month 18).

16. The method of any one of claims 11-15, wherein the second dose is administered about2 months after the first dose, and the geometric mean concentration (GMC) of C. difficile toxin A neutralizing antibodies is at least about 50, 100, 150, 200, 250, 500, 600, 700, 800, or 850 neutralization units / mL or higher at 1 month after the second dose (Month3), at least about 50, 100, 150, or 200 neutralization units / mL or higher at 10 monthsafter the second dose (Month 12), and / or at least about 50, 100, 150, or 200 neutralization units / mL or higher at 16 months after the second dose (Month 18) and / orwherein the second dose is administered about 2 months after the first dose, and the GMC of C. difficile toxin B neutralizing antibodies is at least about 1,500, 2,000, 4,000,6,000, 8,000, 9,000, or 10,000 neutralization units / mL or higher at 1 month after thesecond dose (Month 3), at least about 1,500, 2,000, 2,500, or 3,000 neutralization units / mL or higher at 10 months after the second dose (Month 12), and / or at least about1,500, 2,000, 2,500, 3,000, or 3,500 neutralization units / mL or higher at 16 months afterthe second dose (Month 18); wherein the second dose is administered about 2 months after the first dose, and the geometric mean fold rise (GMFR) in C. difficile toxin A neutralizing antibodies is atleast about 1, 1.5, 2, 3, 4, 5, or 6 or higher from baseline to 1 month after the second dose (Month 3), at least about 1 or 1.5 or higher from baseline to 10 months after thesecond dose (Month 12), and / or at least about 1 or 1.5 or higher from baseline to 16months after the second dose (Month 18); and / or wherein the second dose is administered about 2 months after the first dose, and the GMFR in C. difficile toxin Bneutralizing antibodies is at least about 5, 6, 7, 8, 9, 10, 15, 20, or 25 or higher frombaseline to 1 month after the second dose (Month 7), at least about 5, 6, 7, 8, or 9 or higher from baseline to 6 months after the second dose (Month 12), and / or at least about5, 6, 7, 8, 9, or 10 or higher from baseline to 12 months after the second dose (Month18); and / or wherein the second dose is administered about 2 months after the first dose, and the percentage of subjects with at least a 4-fold rise in C. difficile toxin A neutralizing antibody concentrations is at least about 2, 3, 4, 5, 10, 20, 30, or 35% or higher from baseline to 1 month after the second dose (Month 3) and / or at least about 2, 3, 4, or 5% or higher from baseline to 16 months after the second dose (Month 18); and / or wherein the second dose is administered about 2 months after the first dose, and the percentage of subjects with at least a 4-fold rise in C. difficile toxin B neutralizing antibody concentrations is at least about 25, 30, 40, 50, 60, 70, or 80% or higher from baseline to 1 month after the second dose (Month 3), at least about 25, 30, 35, or 40% or higher from baseline to 10 months after the second dose (Month 12), at least about 25, 30, 35, 40, 45, or 50% or higher from baseline to 16 months after the second dose (Month 18).

17. A method of preventing or reducing Clostridioides difficile (C. difficile) infection, diseaseor condition associated with C. difficile in a human subject, the method comprising administering to the human subject at least a first and a second dose of an immunogenic composition comprising a C. difficile toxoid A and / or toxoid B, and a saponin containingliposomal adjuvant.

18. A method of eliciting an immune response in a human subject against C. difficile, themethod comprising administering to the human subject at least a first and second dose of an immunogenic composition comprising a C. difficile toxoid A and / or toxoid B, and asaponin containing liposomal adjuvant.

19. The method of claim 17 or 18, wherein the saponin containing liposomal adjuvantcomprises a saponin and a monophosphoryl lipid A (MPLA)-containing liposome composition, wherein the liposome composition comprises i) a lipid bilayer comprising phospholipids and ii) cholesterol; optionally wherein the saponin containing liposomal adjuvant comprises:- about 0.1 to about 0.4 mg / mL of QS-21, preferably about 0.2 mg / mL of QS-21;- about 0.2 to about 0.6 mg / mL of MPLA, preferably about 0.4 mg / mL of MPLA.;- about 5 to about 15 mg / mL of cholesterol, preferably about 11 mg / mL ofcholesterol; -about 5 to about 20 mg / mL of DMPC, preferably about 14 mg / mL of DMPC; and / or- about 1.0 to about 2.0 mg / mL of DMPG, preferably about 1.6 mg / mL of DMPG.

20. The method of any one of claims 17-19, wherein an immune response is elicited andcomprises neutralizing antibodies against C. difficile toxin A and / or neutralizingantibodies against C. difficile toxin B.

21. The method of any one of claims 17-20, wherein the second dose is administered about6 months after the first dose, and the geometric mean concentration (GMC) of C. difficile toxin A neutralizing antibodies is at least about 250, 500, 1000, 2,000, 3,000, or 3,5000 neutralization units / mL or higher at 1 month after the second dose (Month 7), at leastabout 250, 500, 750, or 1,000 neutralization units / mL or higher at 6 months after thesecond dose (Month 12), and / or at least about 250, 500, 600, 700, or 800 neutralization units / mL or higher at 12 months after the second dose (Month 18); and / or wherein thesecond dose is administered about 6 months after the first dose, and wherein the GMC of C. difficile toxin B neutralizing antibodies is at least about 2,500, 5,000, 10,000,15,000, 25,000, 50,000, 75,000, 80,000, 90,000, or 95,000 neutralization units / mL or higher at 1 month after the second dose (Month 7), at least about 2,500, 5,000, 10,000,or 15,000 neutralization units / mL or higher at 6 months after the second dose (Month12), and / or at least about 2,500, 5,000, 10,000, or 15,000 neutralization units / mL orhigher at 12 months after the second dose (Month 18);wherein the second dose is administered about 6 months after the first dose, and the geometric mean fold rise (GMFR) in C. difficile toxin A neutralizing antibodies is atleast about 3, 4, 5, 10, 15, 20, or 25 or higher from baseline to 1 month after the second dose (Month 7), at least about 3, 4, 5, 6, or 7 or higher from baseline to 6 months afterthe second dose (Month 12), and / or at least about 3, 4, 5, or 6 or higher from baseline to 12 months after the second dose (Month 18) and / or wherein the second dose is administered about 6 months after the first dose, and the GMFR in C. difficile toxin Bneutralizing antibodies is at least about 10, 15, 20, 25, 50, 75, 100, 125, or 150 or higher from baseline to 1 month after the second dose (Month 7), at least about 10, 15, 20, or 25 or higher from baseline to 6 months after the second dose (Month 12), and / or at leastabout 10, 15, 20, or 25 or higher from baseline to 12 months after the second dose(Month 18); and / or wherein the second dose is administered about 6 months after the first dose, and the percentage of subjects with at least a 4-fold rise in C. difficile toxin A neutralizingantibody concentrations is at least about 10, 20, 30, 40, 50, 60, 70, 80, or 85% or higher from baseline to 1 month after the second dose (Month 7), at least about 10, 20, or 30% or higher from baseline to 6 months after the second dose (Month 12), and / or at least about 10, 20, or 25% or higher from baseline to 12 months after the second dose (Month 18); and / or wherein the second dose is administered about 6 months after the first dose, and the percentage of subjects with at least a 4-fold rise in C. difficile toxin B neutralizing antibody concentrations is at least about 30, 40, 50, 60, 70, 80, 90, or 100% from baseline to 1 month after the second dose (Month 7), at least about 30, 40, 50, 60, or 65% or higher from baseline to 6 months after the second dose (Month 12), at least about 30, 40, 50, 60, 70, 80, or 85% or higher from baseline to 12 months after the second dose (Month 18).

22. The method of any one of claims 17-21, wherein the second dose is administered about2 months after the first dose, and the geometric mean concentration (GMC) of C. difficile toxin A neutralizing antibodies is at least about 50, 100, 150, 200, 250, 500, or 1,000 neutralization units / mL or higher at 1 month after the second dose (Month 3), at leastabout 50, 100, 150, 200, or 250 neutralization units / mL or higher at 10 months after thesecond dose (Month 12), and / or at least about 50, 100, 150, 200, 250, or 300 neutralization units / mL or higher at 16 months after the second dose (Month 18); and / orwherein the second dose is administered about 2 months after the first dose, and the GMC of C. difficile toxin B neutralizing antibodies is at least about 2,000, 2,500, 3,000,3,500, 4,000, 5,000, 10,000, 15,000, 20,000, or 25,000 neutralization units / mL or higher at 1 month after the second dose (Month 3), at least about 2,000, 2,500, 3,000, 3,500, or 4,000 neutralization units / mL or higher at 10 months after the second dose (Month12), and / or at least about 2,000, 2,500, 3,000, 3,500, 4,000, or 4,500 neutralization units / mL or higher at 16 months after the second dose (Month 18);wherein the second dose is administered about 2 months after the first dose, and the geometric mean fold rise (GMFR) in C. difficile toxin A neutralizing antibodies is atleast about 1, 2, 3, 4, 5, 6, 7, 8, or 9 or higher from baseline to 1 month after the second dose (Month 3), at least about 1 or 1.5 or higher from baseline to 10 months after thesecond dose (Month 12), and / or at least about 1, 1.5, or 2 or higher from baseline to 16 months after the second dose (Month 18); and / or wherein the second dose is administered about 2 months after the first dose, and the GMFR in C. difficile toxin Bneutralizing antibodies is at least about 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, or 70 or higherfrom baseline to 1 month after the second dose (Month 3), at least about 6, 7, 8, 9, 10, or 11 or higher from baseline to 10 months after the second dose (Month 12), and / or atleast about 6, 7, 8, 9, 10, 11, or 12 or higher from baseline to 16 months after the seconddose (Month 18); and / or wherein the second dose is administered about 2 months after the first dose, and the percentage of subjects with at least a 4-fold rise in C. difficile toxin A neutralizing antibody concentrations is at least about 2, 3, 4, 5, 10, 20, 30, 40, 50, or 60% or higher from baseline to 1 month after the second dose (Month 3) and / or at least about 2, 3, 4, or 5% or higher from baseline to 16 months after the second dose (Month 18); and / or wherein the second dose is administered about 2 months after the first dose, and the percentage of subjects with at least a 4-fold rise in C. difficile toxin B neutralizing antibody concentrations is at least about 25, 30, 40, 50, 60, 70, 80, 90 or 100% from baseline to 1 month after the second dose (Month 3), at least about 25, 30, 35, 40, 45, 50, or 55% or higher from baseline to 10 months after the second dose (Month 12), at least about 25, 30, 35, 40, 45, 50, 55, 60, or 65% or higher from baseline to 16 months after the second dose (Month 18).

23. The method of any one of claims 1-22, wherein the neutralizing antibody concentrationelicited against C. difficile toxin A and / or B is higher after administration of 2 doses ofthe immunogenic composition compared to the neutralizing antibody concentration elicited against C. difficile toxin A and / or B after administration of 3 doses of an Al(OH)3-containing a C. difficile vaccine.

24. The method of any one of claims 1-23, wherein at least one booster dose is administeredafter the second dose, preferably about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 months, 2, 2.5, 3, 3.5, 4, 4.5 or 5 years or later after the second dose.

25. The method of claim 24, wherein the GMCs of C. difficile toxin A and / or toxin Bneutralizing antibodies at 1 month after the booster dose are higher compared to the GMCs of C. difficile toxin A and / or toxin B neutralizing antibodies at 1 month after thefirst dose and / or 1 month after the second dose; wherein the GMFRs in C. difficile toxin A and / or toxin B neutralizing antibodies frombaseline to 1 month after the booster dose are higher compared to the GMFRs in C. difficile toxin A and / or toxin B neutralizing antibodies from baseline to 1month after thefirst dose and / or 1 month after the second dose; and / or wherein the percentage of subjects with at least a 4-fold rise in C. difficile toxin A and / or toxin B neutralizing antibody concentrations is at least about 5, 10, 20, 30, 40, 50, 60, 70, 80, 90% or higher from baseline to 1 month after the booster dose and / or at least about 5, 10, 20, 30, 40, 50, 60, 70, 80, 90% or higher from before the booster dose to 1 month after the booster dose.

26. The method of any one of claims 1-25, further comprising administering to the humansubject at least a third dose of the immunogenic composition.

27. The method of claim 26, wherein the second dose is administered about 1 month afterthe first dose and the third dose is administered about 6 months after the first dose (M 0, 1 and 6), the second dose is administered about 2 months after the first dose and the third dose is administered about 6 months after the first dose (M 0, 2 and 6), the second dose is administered about 4 months after the first dose and the third dose is administered about 12 months after the first dose (M 0, 4 and 12) or the second dose is administered about 2 months after the first dose and the third dose is administered about 15 months after the first dose (M 0, 2 and 15); optionally wherein at least one booster dose is administered after the third dose, preferably about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 months, 2, 2.5, 3, 3.5, 4, 4.5 or 5 years or later after the thirddose.

28. The method of claim 26 or 27, wherein the neutralizing antibody concentration elicitedagainst C. difficile toxin A and / or B is higher after administration of 3 doses of theimmunogenic composition compared to the neutralizing antibody concentration elicited against C. difficile toxin A and / or B after administration of 3 doses of an Al(OH)3-containing a C. difficile vaccine.

29. The method of any one of claims 1-28, wherein the C. difficile infection is a primary C.difficile infection; wherein the C. difficile infection is medically attended C. difficile infection and / or clinically meaningful C. difficile infection; and / or wherein the C. difficile infection is medically attended primary C. difficile infection and / or clinically meaningful primary C. difficile infection.

30. The method of any one of claims 1-29, wherein the human subject is 18 years of age orolder, 50 years of age or older, 55 years of age or older, 60 years of age or older, 65 years of age or older, 70 years of age, 75 years of age, 80 years of age, or 85 years of age or older.

31. The method of any one of claims 1-30, wherein the C. difficile toxoid A comprises theamino acid sequence of SEQ ID NO: 84, and C. difficile toxoid B comprises the amino acid sequence of SEQ ID NO: 86; and / or wherein the C. difficile toxoid A comprises theamino acid sequence of SEQ ID NO: 4, wherein the initial methionine is absent, and C. difficile toxoid B comprises the amino acid sequence of SEQ ID NO: 6, wherein the initial methionine is absent.

32. The method of any one of claims 1-31, wherein the composition comprises the C. difficiletoxoid A and the C. difficile toxoid B in a ratio of about 3:1 to about 1:1; and / or wherein the composition comprises 200 µg of toxoid per dose.

33. The method of any one of claims 1-32, wherein the composition is administered at adose volume of 0.5 mL.

34. The method of any one of claims 1-33, wherein the immunogenic composition comprisesat least one additional C. difficile toxin antigen or C. difficile toxoid; optionally whereinthe at least one additional C. difficile toxin antigen is a toxin A protein, a toxin B protein,a binary toxin protein A (CDTa) and / or a binary toxin protein B (CDTb), or mutant thereof.

35. The method of any one of claims 1-34, wherein the immunogenic composition is co-administered (concomitantly or concurrently) with another vaccine, such as apneumococcal vaccine, a respiratory syncytial virus (RSV) vaccine, a human metapneumovirus (hMPV) vaccine, a betacoronavirus vaccine, a meningococcal vaccine, a varicella zoster virus (VZV) vaccine, an influenza vaccine, a human cytomegalovirus (hCMV) vaccine, an Escherichia coli (E. coli) vaccine, Pseudomonas aeruginosa vaccine, Klebsiella pneumoniae vaccine, Epstein-Barr virus (EBV) vaccine,Group B Streptococcus (GBS) vaccine and / or a tetanus vaccine, diphtheria vaccine, pertussis vaccine (e.g. Tdap), or other vaccine for an infectious disease, such as a hospital-acquired or healthcare-associated infection.

Images