TRNA sequence elements that regulate mRNA stability

Abstract

Provided herein are methods and compositions for modulating CNOT3 recruitment in a cell ribosome. The methods and compositions can modulate a target mRNA stability and / or half-life. Also provided are pharmaceutical compositions for use in the treatment of an mRNA-decay associated disease, nonsense mutation associated disease, obesity, a mitochondrial- associated disorder, or a metabolic disorder.

Description

TRNA SEQUENCE ELEMENTS THAT REGULATE MRNA STABILITYCROSS REFERENCE TO RELATED APPLICATION

[0001] This application claims priority to U.S. Provisional Patent Application Serial No. 63 / 659,711 , filed June 13, 2024, and titled “TRNA SEQUENCE ELEMENTS THAT REGULATE MRNA STABILITY,” which is incorporated by reference herein in its entiretyACKNOWLEDGEMENT OF GOVERNMENT SUPPORT

[0002] This invention was made with government support under grant number 5R01GM135617-02 awarded by the National Institutes of Health - National Institute of General Medical Sciences. The government has certain rights in this invention.INCORPORATION OF SEQUENCE LISTING

[0003] The present application contains a Sequence Listing which has been submitted in .XML format via Patent Center and is hereby incorporated by reference in its entirety. Said WIPO Sequence Listing was created on June 8, 2025, XML copy is named 106546- 8220147-4447_Sequence listing. xml, and is 301 ,600 bytes in sizeBACKGROUND1. Field

[0002] The present disclosure relates to compositions and methods, that impact mRNA stability. In one aspect, the disclosure relates to medical treatments using the disclosed composition and methods.2. Background

[0003] Cellular precise control of messenger RNA (mRNA) translation and stability plays a central role in establishing appropriate levels of gene expression. These parameters are highly influenced by the poly(A) tail, which is present on nearly all eukaryotic mRNAs. The poly(A) tail is bound by cytoplasmic polyadenylate-binding proteins (PABPCs), which stimulate efficient translation and protect the message from exonucleolytic degradation from both the 5' and 3' ends. Opposing these activities is the CCR4-NOT complex, a highly conserved multisubunit assembly that functions as the major cytoplasmic deadenylase. mRNA deadenylation rates and half-lives vary by several orders of magnitude and are highly influenced by mechanisms that recruit the CCR4-NOT complex to specific transcripts. For example, many RNA binding proteins (RBPs), such as YTHDF2, Pumilio, and the cytoplasmic polyadenylationelement binding (CPEB) proteins, interact with the CCR4-N0T complex, thus accelerating the deadenylation of specific mRNAs to which they are bound. Likewise, microRNAs (miRNAs) recruit CCR4-NOT to target mRNAs through direct interaction of TNRC6 with CNOT9, core components of the miRNA-induced silencing complex (miRISC) and the CCR4-NOT complex, respectively.

[0004] The CCR4-NOT complex can also be recruited directly to translating ribosomes to elicit accelerated degradation of specific sets of transcripts. In Saccharomyces cerevisiae, the rate of decoding is a key determinant of Ccr4-Not engagement with ribosomes. When a ribosome encounters a non-optimal codon, defined as a codon with a low concentration of cognate tRNA, the E-site tRNA may be released before the A-site codon is decoded. The resulting ribosomal conformation, with empty A- and E-sites, enables the N-terminal helical bundle of Not5, a component of Ccr4-Not and homolog of human CNOT3, to enter the vacant E site. In this manner, the Ccr4-Not complex can monitor the efficiency of decoding, accelerating the degradation of mRNAs enriched in non-optimal codons. Recently, stalling of mammalian ribosomes on a highly non-optimal codon in an in vitro rabbit reticulocyte lysate system was shown to similarly lead to recruitment of CNOT3 to empty E-sites. Moreover, multiple studies have documented that slow translation elongation, due to codon content or amino acid availability, is associated with accelerated mRNA turnover in mammalian cells. While these observations suggest a conserved function for CCR4-NOT in monitoring decoding efficiency, the predominant determinants of CNOT3 recruitment to translating ribosomes in mammals have not yet been studied on a transcriptome-wide level.

[0005] Thus, there is an unmet need for harnessing the mechanisms of ribosomal translation and mRNA stability to modify gene expression.SUMMARY

[0006] The present disclosure discloses a synthetic tRNA comprising a nucleotide sequence of a length up to 100 nucleotides and comprising a sequence modification relative to a wildtype tRNA sequence, wherein the sequence modification modifies the ability of the tRNA to recruit CNOT3 to a cell ribosome and / or modifies the stability of a target mRNA in the cell.

[0007] In one aspect, the sequence modification increases CNOT3 recruitment to the ribosome and / or increases the decay of the target mRNA. In such aspects, the nucleotide sequence comprises a U13:A22:A46 triplet.

[0008] In further aspects, the sequence modification decreases CNOT3 recruitment to the ribosome and / or stabilizes the translated target mRNA. The sequence modification, in such aspects, comprises an extra nucleotide in a D-loop a element of the tRNA or an extra nucleotide preceding a GG motif at position 18:19.

[0009] In some aspects, the sequence modification disclosed herein is a modification to a D-arm or anticodon stem of the tRNA.

[0010] In another aspect, the sequence modification is a chemical modification of one or more nucleotides in the sequence.

[0011] Further disclosed herein is an engineered nucleic acid comprising a nucleotide sequence recognizing a nucleic acid sequence encoding a mammalian CNOT3, the engineered nucleic acid molecule selected from an antisense oligonucleotide (ASO), siRNA, miRNA, a cluster regularly interspaced short palindromic repeats (CRISPR) related nucleic acid, a single guide RNA (sgRNA), a CRISPR-RNA (crRNA), a trans-activating crRNA (tracrRNA), and an aptamer, wherein the engineered nucleic acid modifies the ability of a tRNA to recruit CNOT3 to a cell ribosome and / or modifies the stability of a target mRNA in the cell. In some aspects, the nucleic acid is an sgRNA having a nucleotide sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to GAGGGACCAAATCAAGACAT (SEQ ID NO: 1) or TCTTGCGGATGGCGTCAACG (SEQ ID NO: 2).

[0012] The disclosure further encompasses a vector comprising the engineered nucleic acid of the present application. The vector may be a viral vector. Further disclosed is a cell comprising the disclosed vector. In some aspects, the cell is a mammalian cell.

[0013] The disclosure further provides a method of modifying a half-life of a target mRNA in a cell, the method comprising: delivering to the cell at least one nucleic acid capable of modifying recruitment of CNOT3 to a ribosome in the cell. In one aspect, the nucleic acid is an sgRNA. The sgRNA has a nucleotide sequence at least at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of GAGGGACCAAATCAAGACAT (SEQ ID NO: 1) or TCTTGCGGATGGCGTCAACG (SEQ ID NO: 2). In another aspect, the nucleic acid is a tRNA comprising a U13:A22:A46 triplet. In an alternative aspect, the nucleic acid is a tRNA comprising an extra nucleotide preceding the GG motif at positions 18:19.

[0014] Also provided herein is a synthetic tRNA comprising a nucleic acid sequence set forth in any one of SEQ ID NOs. 55-66 or 68-70.

[0015] The disclosure further provides a CNOT3 variant comprising an amino acid substitution selected from the group consisting of K105S, R59S, and E95A relative to the amino acid sequence set forth in SEQ ID NO: 327.

[0016] In some aspects, provided herein is a method of modulating half-life of a target mRNA in a cell, the method comprising modifying the cell to express a target mRNA having asequence modification relative to a wild-type target mRNA, wherein the mRNA sequence modification adds at least one subsequence to the DNA sequence encoding the target mRNA and modifies the half-life of the target mRNA in the cell.

[0017] In one aspect, the modification enhances the half-life of the target mRNA. In such aspects, the modification comprises adding one or more codons selected from CGC, AGA, and CGU. In another aspect, the modification comprises adding one or more codons selected from AAT, AAC, AAA, AAG, ATT, ATC, ATA, TAT, TAG, TTT, TTC, ATG, and ACU.

[0018] In one aspect, the modification decreases the half-life of the target mRNA. In such aspects, the modification comprises adding one or more codons selected from CGG, CGA, and AGG.

[0019] Further provided herein is a pharmaceutical composition comprising the synthetic tRNA, the engineered nucleic acid, the vector, or the cell, disclosed herein, and at least one pharmaceutically acceptable carrier, excipient or delivery agent. In one aspect, the delivery agent is selected from a lipidoid, a liposome, a lipoplex, a nanoparticle, a lipid nanoparticle, a polymeric compound, a peptide, a protein, a cell, a nanoparticle mimic, a nanotube, and a conjugate.

[0020] Use of the pharmaceutical composition, for the treatment of an mRNA-decay associated disease, obesity, a mitochondrial-associated disorder, or a metabolic disorder, further disclosed.

[0021] The disclosure further comprises a method of treating a subject suffering from or at risk of developing an mRNA-decay associated disease, nonsense mutation associated diseases, obesity, mitochondrial-associated disorder, or a metabolic disorder comprising administering to the subject a pharmaceutical composition, disclosed herein.

[0022] In one aspect, the mRNA-decay associated disease is cystic fibrosis, muscular dystrophy, autosomal dominant polycystic kidney disease (ADOKD), ataxia telangiectasia, beta-thalassemia, factor VI I deficiency, familial atrial fibrillation, hemophilia B, hepatic carnitine palmitoyltransferase 1A deficiency (CPT1A), heritable pulmonary arterial hypertension (HPAH), late infantile neuronal ceroid lipofuscinosis (LNCL), leukocyte adhesion deficiency 1 (LAD1), methylmalonic acidemia (MMA), Hurler syndrome, nephropathic cystinosis, obesity, peroxisome biogenesis disorder (PBD), renal tubular acidosis (RTA), retinitis pigmentosa (RP), Rett syndrome (RTT), spinal muscular atrophy (SMA), Stuve-Wiedemann syndrome (SMS), X-linked nephrogenic diabetes insipidus (XNDI), or Usher syndrome (USH1).

[0023] In another aspect, the nonsense mutation associated disease is beta-thalassemia,Marfan synfrome, Duchenne Muscular Dystrophy, Becker Muscular Dystrophy,Ullrich disease, Hurler syndrome, cancer, cystic fibrosis, Spinal muscular atrophy, amylosis, LINCL (Late Infantile Neuronal Ceroid Lipofuscinosis), Haemophilia, Alzheimer's disease, Atherosclerosis, Gigantism, Dwarfism, Hypothyroidism, Hyperthyroidism, Obesity, Parkinson's disease, Niemann Pick disease, Family hypercholesterolemia, and retinitis pigmentosa.BRIEF DESCRIPTION OF THE DRAWINGS

[0024] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application with color drawing(s) will be provided by the Office by request and payment of the necessary fee.

[0025] Aspects of the present disclosure are illustrated by way of example in which like reference numerals indicate similar elements and in which:

[0026] FIG. 1A - FIG. 1G show that select arginine codons are enriched in the ribosomal P-site of CNOT3-bound ribosomes. FIG. 1A and FIG. 1 B show sucrose density gradient profiles of HEK293T cell lysate and western blot analysis of fractions without (FIG. 1A) or with RNase A treatment (FIG. 1 B). FIG. 1C shows western blot analysis of CNOT3 or control immunoprecipitates. Representative results from n=3 biological replicates shown for sucrose density gradient profiles and CNOT3 I P. FIG. 1 D is a Schematic of CNOT3-selective ribosome profiling. FIG. 1 E depcits meta-codon plots showing the triplet periodicity of ribosome profiling reads. FIG. 1 F shows codon enrichment in ribosomal E, P, and A-sites of CNOT3-bound ribosomes. FIG. 1G shows Sequence logo representation of amino acid enrichment in ribosomal E, P, and A-sites of CNOT3-bound ribosomes.

[0027] FIG. 2A - FIG. 2M show analysis of ribosomal recruitment of Not5 / CNOT3, related to FIGs. 1A-1G. 1. FIG. 2A and FIG. 2B show sucrose density gradient profiles of lysates from HEK293T cells expressing CNOT3-3Tlag and western blot analysis of fractions without (FIG. 2A) or with RNase A treatment (FIG. 2B). FIG. 2C shows western blot analysis of CNOT3- 3Tlag or control immunoprecipitates. Representative results from n=3 biological replicates shown for sucrose density gradient profiles and Flag IP. FIG. 2D and FIG. 2E show reproducibility of selective ribosome profiling data across biological replicates. FIG. 2F and FIG. 2G show codon enrichment in the ribosomal A-site of Not4-bound ribosomes in S. cerevisiae, grouped by amino acid (FIG. 2F) or codon (FIG. 2G). FIG. 2H show correlation of codon enrichment in the ribosomal A-site of Not4-bound ribosomes and tAI in S. cerevisiae. FIG. 2I and FIG. 2J show codon enrichment in the ribosomal A-site of CNOT3-bound ribosomes in HEK293T cells, grouped by amino acid (FIG. 2I) or codon (FIG. 2J). FIG. 2K shows correlation of codon enrichment in the ribosomal A-site of CNOT3-bound ribosomesand tAI in HEK293T cells. FIG. 2L shows correlation of codon enrichment in the ribosomal A- site of CNOT3-bound ribosomes and A-site dwell time in HEK293T cells. FIG. 2M shows top 20 enriched tripeptides encoded by CNOT3-bound ribosomal footprints.

[0028] FIG. 3A - FIG. 3G show regulation of CGG / CGA / AGG-rich transcripts by CNOT3, related to FIG. 4A - FIG. 4J. FIG. 3A shows western blot analysis of CNOT3 protein in HEK293T cells after lentiviral delivery of Cas9 and non-targeting (NT) or C / VOT3-targeting sgRNAs. FIG. 3B shows CDF plot showing the fold-change in half-lives of mRNAs with high weighted CGG / CGA / AGG scores or mRNAs rich in CGC / AGA / CGU arginine codons in CNOT3-depleted Jurkat cell. mRNAs rich in CGC / AGA / CGU codons that also had a high weighted CGG / CGA / AGG score (top 1000) were excluded from this gene set. P values were calculated by one-sided Wilcoxon rank sum test. FIG. 3C shows CDF plot showing the foldchange in steady-state abundance of mRNAs in pro-B cells from Cnot3 knockout mice. FIG. 3D to FIG. 3F show GSEA of mRNA decay rate data from CNOT3- knockout HEK293T cells (FIG. 3D) or CNOT3- knockdown Jurkat cells (FIG. 3E), or steady-state mRNA levels from Cnot3 knockout pro-B cells (FIG. 3F). All gene sets with FDR<0.25 are shown for HEK293T cells, while the top 15 gene sets (all with FDR<0.25) are shown for Jurkat and pro-B cells. NES, normalized enrichment score. Red triangles indicate gene sets containing mitochondrial ribosomal proteins. FIG. 3G shows GSEA showing the top 15 enriched gene sets based upon weighted CGG / CGA / AGG score (all with FDR<0.25).

[0029] FIG. 4A - FIG. 4J show mRNAs rich in CGG, CGA, and AGG arginine codons are destabilized by CNOT3. FIG. 4A shows cumulative distribution function (CDF) plots showing the fold-change in half-lives of the following sets of mRNAs in CNOT3-depleted HEK293T cells, measured by SLAM-seq: i) mRNAs with high P-site scores, calculated for each mRNA by averaging the enrichment value of each codon in the P-site of CNOT3-bound ribosomes; ii) mRNAs with high weighted CGG / CGA / AGG scores, calculated as the sum of the enrichment values of each of these codons in the P-site of CNOT3-bound ribosomes, normalized to total codon number, in each mRNA; iii) mRNAs rich in arginine encoded by CGC, AGA, and CGU. mRNAs rich in these codons that also had a high weighted CGG / CGA / AGG score (top 1000) were excluded from this gene set. P values were calculated by one-sided Wilcoxon rank sum test. FIG. 4B shows stability of a reporter construct encoding 42 arginine-centered tripeptides, with arginine encoded by CGG, CGA, or AGG, or a control reporter with arginine codons replaced with codons that were not enriched in the P-site of CNOT3-bound ribosomes. CNOT3 knockout (sgC / VOT3-1) or control (sgNT1) HEK293T cells were treated with 1 mg / mL doxycycline, and reporter mRNA levels relative to GAPDH at each time point were measured by qRT-PCR. n=3 biological replicates (mean ± SD shown). P values were calculated by student’s t test, comparing sgC / VOT3-1 to sgNT 1 for each reporter.**P<0.01 ; ***P<0.001; n.s., not significant. FIG. 4C shows GSEA analysis of global mRNA half-life data showing stabilization of mRNAs encoding mitochondrial ribosomal proteins in CN0T3-depleted HEK293T cells and Jurkat cells. FIG. 4D is GSEA showing that human mRNAs encoding mitochondrial ribosomal proteins exhibit a high weighted CGG / CGA / AGG score. FIG. 4E and FIG. 4F show qRT-PCR analysis of mitochondrial ribosomal protein mRNAs, normalized to GAPDH, in HEK293T (FIG. 4E) and Jurkat cells (FIG. 4F) infected with lentivirus expressing the indicated sgRNAs. n=3 biological replicates (mean ± SD shown). P values were calculated by student’s t test. *P<0.05; **P<0.01; ***P<0.001. FIG. 4G and FIG. 4H show flow cytometry analysis of HEK293T (FIG. 4G) and Jurkat cells (FIG. 4H) expressing the indicated sgRNAs and stained with MitoTracker. Representative data from n=3 biological replicates shown. FIG. 4I is a schematic of mitochondrial translation assay. Cytosolic translation was inhibited with anisomycin (ANS) and nascent mitochondrial peptides were labeled with L-homopropargylglycine (HPG). FIG. 4J are representative images of HPG- labeled Jurkat cells expressing the indicated sgRNAs. TOMM20 is a mitochondrial membrane protein. Representative data from n=3 biological replicates shown.

[0030] FIG. 5A - FIG. 5C show in vitro translation of CGG / CGA / AGG-rich transcripts, related to FIG. 6A - FIG. 6J. FIG. 5A shows sucrose density gradient profile of in vitro translation reactions performed with or without added mRNA. FIG. 5B shows sucrose density gradient profiles and western blot analysis of combined polysome fractions from in vitro translation reactions assembled on the indicated mRNAs. Representative data from n=3 biological replicates shown. FIG. 5C is a schematic showing strategy for enrichment of CNOT3-3'Flag-bound ribosomes translating 41 'LRCGGD mRNA for cryo-EM analysis.

[0031] FIG. 6A - FIG. 6J show structural analysis of a human CNOT3-ribosome complex. FIG. 6A shows sucrose density gradient profiles and western blot analysis of in vitro translation reactions performed with 41 'LRCGGD or 41 'LKAAGD mRNA. FIG. 6B shows western blot analysis of CCR4-NOT components in combined polysome fractions from in vitro translation reactions assembled as in FIG. 6A. FIG. 6C shows sucrose density gradient profiles and western blot analysis of combined polysome fractions from in vitro translation reactions assembled on the indicated mRNAs. Representative data from n=3 biological replicates shown for panels FIG. 6A- FIG. 6C. FIG. 6D and FIG. 6E show Cryo-EM density map (FIG. 6D) and schematic model (FIG. 6E) of the human CNOT3-ribosome complex. The 60S subunit is shown in cyan / grey and the 40S subunit in light blue / grey. CNOT3 is highlighted in green and the P-site tRNA in orange. FIG. 6F shows Clipped density map (left panel) and atomic model (right panel) highlighting the ribosomal E, P, and A-sites. CNOT3 and the P-site tRNA are colored as before. FIG. 6G is a schematic model and secondary structure representation of CNOT3-arginyl tRNA interactions, highlighting tRNA elements in the D-loop (cyan) andanticodon stem (purple) contacted by CNOT3 (green). AAS, amino acid acceptor stem; TSL, T stem loop; ASL, anticodon stem loop; DSL, D stem loop. FIG. 6H is a schematic model of the CNOT3 / tRNA complex highlighting the codomanticodon base-pairing and nascent peptide:tRNA attachment. FIG. 61 and FIG. 6J show density maps and atomic models of codomanticodon base-pairing consistent with tRNAArg CCG(FIG. 61) and nascent chain with the predicted amino acid repeats (FIG. 6J).

[0032] FIG. 7A - FIG.7F show cryo-EM analysis of CNOT3-bound ribosomes, related to FIG. 6A - FIG. 6J. FIG. 7A shows representative micrograph used for the 80S ribosome- CNOT3 reconstruction. FIG. 7B shows Representative 2D classes of 80S ribosomes with a broad distribution of orientations. FIG. 7C shows workflow of the 3D classification scheme. Map volumes are shown for all steps and masks (red) indicate the volumes selected for local classification and post-processing. Major sorting and classification criteria, particle numbers and percentages (for each 3D classification step) as well as final map resolutions are indicated. FIG. 7D shows gold-standard Fourier shell correlation (FSC) curves indicating an overall resolution of 2 A, approaching the Nyquist limit for the collection setup. FIG. 7E and FIG. 7F show overall (FIG. 7E) and CNOT3 / P-site tRNA centered (FIG. 7F) maps colored according to local resolution.

[0033] FIG. 8A - FIG. 8C show analysis of tRNA in the CNOT3-ribosome structure, related to FIG. 6A - FIG. 6J. FIG. 8A shows northern blot analysis of in vitro transcribed tRNAs to verify probe specificity. FIG. 8B shows northern blot analysis of arginine tRNAs in CNOT3- bound ribosomes purified from in vitro translation reactions programmed with 41 'LRCGGD mRNA. Input represents polysome fractions prior to anti-Flag IP. Representative data from n=2 biological replicates shown. FIG. 8C shows molecular structures and cryo-EM densities of tRNAArg CCG'1modifications modeled in the CNOT3-ribosome structure.

[0034] FIG. 9A - FIG. 9B show mRNA configuration in CNOT3-bound ribosomes and arginine tRNA sequences, related to FIG. 6A - FIG. 6J and FIG. 10. FIG. 9A is a schematic showing structures and molecular models (insets) showing the configuration of mRNA in the CNOT3-bound ribosome structure (left panel) compared to the mRNA configuration in ribosomes bound by EEF1A-tRNAPhe GAA-GTPyS (right panel). FIG. 9B shows secondary structures of the most abundant tRNAArgisoacceptors, highlighting differences in primary and secondary structures compared to tRNAArg CCG'1. tRNA molecules depicted in the drawing comprises a nucleic acid sequence of SEQ ID NOs: 71-75, respectively. Conserved nucleotides are greyed out to highlight nucleotide differences. Shared features involved in CNOT3 binding (marked in green in the tRNAArg CCG'1structure) are indicated by red arrows.

[0035] FIG. 10A - FIG. 10K show a U13:A22:A46 triplet in select arginine tRNAs promotesco-translational CNOT3 recruitment. FIG. 10A is a schematic of arginine tRNAs, showing their key distinguishing features and the codons they decode, arranged by their enrichment in the P-site of CNOT3-bound ribosomes. FIG. 10B shows secondary structure and schematic depictions of tRNA and CNOT3, highlighting the CNOT3 interaction with nucleotide 22 of the P-site tRNA as well as the 13:22:46 base triplet. FIG. 10C - FIG. 10G show In vitro translation of 41 'LRCGUD mRNA in the presence of in vitro transcribed arginine tRNA variants, followed by western blot analysis of combined polysome fractions to assess CNOT3 recruitment. All experiments were performed with n=3-6 biological replicates (mean ± SD shown). P values were calculated by student’s t test, comparing to ml (FIG. 10D), WT (FIG. 10E), m10 (FIG. 10G), or as indicated with brackets (FIG. 10F). **P<0.01; ***P<0.001; n.s., not significant. FIG. 10H to FIG. 10J show structural models of CNOT3 / Not5 interactions with the 13:22:46 base triplet of tRNAAr9CCG(FIG. 10H), tRNAjMet(I), or tRNALeu UAA(FIG. 10J). FIG. 10K shows in vitro translation of the 73xCGG / CGA / AGG mRNA in lysates from cells expressing Flag-tagged wild-type CNOT3 or CNOT3 E95A, followed by western blot analysis of combined polysome fractions. n=3 biological replicates (mean ± SD shown). P values were calculated by student’s t test. ***P<0.001.

[0036] FIG. 11A - FIG. 11 K show impact of P-site tRNA on CNOT3 recruitment, related to FIG. 10A - FIG. 10K. FIG. 11A shows in vitro aminoacylation efficiency of all tRNAs used in FIG. 10A-10K. Representative data from n=2 biological replicates shown. FIG. 11B to FIG. 11G show sucrose density gradient profiles of in vitro translation reactions in FIG. 10C - FIG. 10G. FIG. 11H shows secondary structure and schematic depictions of the interaction between the CNOT3 tCM motif and the anticodon stem loop, highlighting the nucleotides (purple) involved in CNOT3 binding (left panel). Molecular details of the interaction between the tCM (green) and the ASL (purple) (right panel). FIG. 111 shows in vitro translation of the 73xCGG / CGA / AGG mRNA in lysates from cells expressing Flag-tagged wild-type CNOT3 or CNOT3 K105S, followed by western blot analysis of combined polysome fractions. n=3 biological replicates (mean ± SD shown). P values were calculated by student’s t test. ***P<0.001. FIG. 11 J shows sucrose density gradient profiles of in vitro translation reactions in FIG. 111 and FIG. 10K. FIG. 11K shows sequences and nucleotide modifications in the anticodon stems of arginine tRNAs, highlighting the presence of G-Y wobble base pairs in the ASLs of tRNAs with reduced CNOT3 recruitment.

[0037] FIG. 12 shows D-loop sequences of human tRNAs, related to FIG. 15A - FIG. 15L. Alignment of human tRNA D-arms, grouped by amino acids and arranged from highest to lowest average enrichment of each isoacceptor group in the P-site of CNOT3-bound ribosomes. Nucleotide residues at positions 10 to 46 of nucleic acid sequence of SEQ ID NOs. 76-230 are shown, respectively. tRNAs expressed at low levels [<500 RPM in HEK293T tRNAsequencing data were excluded. The G at position 46 in Leu and Ser tRNAs does not form the triple interaction with nucleotides 13:22 because of the large variable region in these tRNAs (indicated with #).

[0038] FIG. 14A - FIG. 141 show analysis of codon depletion in CNOT-bound ribosomes, related to FIG. 15A - FIG. 15L. FIG. 14A shows P-site codon enrichment in CNOT3-bound ribosomes. Red and black, arginine codons; blue, codons decoded by tRNAs with a element insertions. FIG. 14B shows sucrose density gradient profiles of in vitro translation reactions in FIG. 15C. FIG. 14C shows molecular models of rabbit tRNALys UUUin ribosomal P-site (left panel) and crystal structure of isolated bovine tRNALys UUU(right panel). FIG. 14D and FIG. 14E depict CDF plots showing the fold-change in half-lives (FIG. 14D) or steady-state abundance (FIG. 14E) of mRNAs rich in codons decoded by tRNAs with an a element insertion (N, K, I, Y, M, F, and TACU) in CNOT3-depleted Jurkat cells or mouse pro-B cells, respectively. P values calculated by one-sided Wilcoxon rank sum test. FIG. 14F is GSEA showing the top 15 gene sets based on N, K, I, Y, M, F, and TACU content (all with FDR<0.25). Blue triangles indicate gene sets containing cytosolic ribosomal proteins. FIG. 14G shows N, K, I, Y, M, F, and TACU content of cytosolic and mitochondrial ribosomal proteins. P value calculated by student’s t test. FIG. 14H shows in vitro aminoacylation efficiency of all tRNAs used in FIG. 15L. Representative data from n=2 biological replicates shown. FIG. 141 shows sucrose density gradient profiles of in vitro translation reactions in FIG. 15L.

[0039] FIG. 15A - FIG. 15L show an extra nucleotide in the D-loop an a element preceding the GG motif blocks CNOT3 recruitment. FIG. 15A shows alignment of the D-arms of human arginine tRNAs and tRNAs that have an extra nucleotide in the element. Alignment of nucleotide residue 10 to 25 of nucleic acid sequence of SEQ ID NOs. 76-90, 116-121, 187- 195, and 209-230 are shown. FIG. 15B shows secondary structure and cartoon depictions of tRNA and CNOT3, highlighting the CNOT3 interaction with the D-loop element of the P-site tRNA. FIG. 15C shows in vitro translation of the 73xCGG / CGA / AGG mRNA in lysates from cells expressing Flag-tagged wild-type CNOT3 or CNOT3 R59S, followed by western blot analysis of combined polysome fractions. n=3 biological replicates (mean ± SD shown). P values were calculated by student’s t test. ***P<0.001. FIG. 15D to FIG. 151 show molecular models of CNOT3 / Not5 interactions with the a element of P-site tRNAArg CGG(FIG. 15D and FIG. 15G), tRNAjMet(E and H) and tRNALys UUU(FIG. 15F and FIG. 151). FIG. 15J is a CDF plot showing the fold-change in half-lives of mRNAs rich in codons decoded by tRNAs with the a element insertion relative to other transcripts in CNOT3-depleted HEK293T cells, measured by SLAM-seq. P value calculated by one-sided Wilcoxon rank sum test. FIG. 15K shows comparison of the D-arms of human tRNAjMetand tRNAMet. FIG. 15L shows in vitro translation of 41 'LMAUGD mRNA in the presence of in vitro transcribed tRNAMetvariants, followed bywestern blot analysis of combined polysome fractions to assess CNOT3 recruitment. All experiments were performed with n=3 biological replicates (mean ± SD shown). P values were calculated by student’s t test, comparing mutants to WT. **P<0.01.

[0040] FIG. 16A - FIG. 16C show correlation of A-site codon enrichment in CNOT3-bound ribosomes and A-site dwell time, related to FIG. 1A - FIG. 1G. FIG. 16A to FIG. 16C show correlation of codon enrichment in the ribosomal A-site of CNOT3-bound ribosomes and A- site dwell time in HEK293T cells when the P-site is occupied by any codon (FIG. 16A), a CGG / CGA / AGG codon (FIG. 16B), or any codon other than CGG / CGA / AGG (FIG. 16C). Note that panel FIG. 16A is also shown in FIG. 2L and duplicated here to facilitate comparison with other panels.

[0041] FIG. 17 shows P-site tRNA-mediated decay (PTMD). Slow decoding, resulting in a ribosome with empty A- and E-sites, provides an opportunity for CNOT3 enter the E-site and probe the P-site tRNA. (i) If the P-site tRNA has the U13:A22:A46 triplet and lacks the extended a-element (i.e., tRNAs that decode CGG / CGA / AGG arginine codons), CNOT3 binding will be stabilized and mRNA decay will be favored, (ii) If the P-site tRNA is neutral, lacking both the extended D-loop a element and the U13:A22:A46 triplet, CNOT3 binding may be transient. However, if an extended ribosomal stall occurs due to scarcity of a charged tRNA that can enter the A-site, CCR4-NOT-mediated decay may occur, (iii) If the P-site tRNA has the extended D-loop a element (e.g., tRNAs that decode N, K, I, Y, M, F, and T), CNOT3 accommodation will be sterically blocked, CNOT3 will exit, and translation will resume.

[0042] FIG. 18 shows alignment of metazoan arginine tRNA D-arms, related to FIG. 17. Alignment of nucleotide residues 10-46 of nucleic acid sequence of SEQ ID NOs. 76, 78, 83, 85, 89, and 231-275 are shown.

[0043] FIG. 19A - FIG. 19E show co-translational recruitment of Not5 in yeast is less dependent upon P-site tRNA identity, related to FIG. 17. FIG. 19A shows alignment of S. cerevisiae tRNA D-arms. Alignment shows nucleotide residues 10-46 of nucleic acid sequence of SEQ ID NOs: 276-326. The G at position 46 in Leu and Ser tRNAs does not form the triple interaction with nucleotides 13:22 because of the large variable region in these tRNAs (indicated with #). FIG. 19B shows codon enrichment in the ribosomal P-site of Not4- bound ribosomes in S. cerevisiae. FIG. 19C shows enrichment of codons decoded by tRNAs with or without an a element insertion in the P-site of Not4-bound ribosomes. FIG. 19D shows non-optimal codons are enriched in the ribosomal E-, P-, and A-sites of Not4-bound ribosomes in S. cerevisiae. FIG. 19E shows non-optimal codons (defined by A-site dwell time > -0.165) are not enriched in the ribosomal E-, P-, or A-site of CNOT3-bound ribosomes in HEK293T cells.

[0044] The drawing figures do not limit the present disclosure to the specific aspects disclosed and described herein. The drawings are not necessarily to scale, emphasis instead being placed on clearly illustrating principles of certain aspects of the present disclosure.DETAILED DESCRIPTION

[0045] The following detailed description references the accompanying drawings that illustrate various aspects of the present disclosure. The drawings and description are intended to describe aspects and aspects of the present disclosure in sufficient detail to enable those skilled in the art to practice the present disclosure. Other components can be utilized and changes can be made without departing from the scope of the present disclosure. The following description is, therefore, not to be taken in a limiting sense.

[0046] The present disclosure is based, in part, on the surprising discovery that one of the determinants of CNOT3 recruitment is the identity of the codon in the P-site. Selective ribosome profiling in human cells were used to determine the features of mRNAs whose translation leads to CNOT3 recruitment to ribosomes. It was found that the one of the strongest determinant of CNOT3 recruitment was not the decoding efficiency of the codon in the ribosomal A-site, but rather the identity of the codon in the P-site. The presence of select arginine codons in the P-site were particularly strong signals for CNOT3 association, while codons specifying several other amino acids were depleted from the P-site of CNOT3-bound ribosomes. High-resolution cryo-electron microscopy (cryo-EM) structures of CNOT3-bound human ribosomes revealed that these effects were attributable to direct interactions between CNOT3 and the D-arm of the P-site tRNA, which promote or prevent accommodation of CNOT3 in the vacant ribosomal E-site. The disclosure of the present application demonstrate that, in addition to their canonical role in decoding, tRNAs recruit post-transcriptional regulators to translating ribosomes, and are involved in P-site tRNA-mediated mRNA decay (PTMD) pathway.

[0047] Disclosure of the present application provides methods for regulating mRNA translation and stability. In an aspect, the current disclosure encompasses compositions comprising agents that negatively or positively impact the level or functioning of CNOT3 in a cell and methods for using these compositions for therapeutic and / or non-therapeutic applications. Further provided are synthetic tRNAs that can promote mRNA stabilization or degradation through reduced or enhanced recruitment of CNOT3.I. Terminology

[0048] The phraseology and terminology employed herein are for the purpose of description and should not be regarded as limiting. For example, the use of a singular term, such as, “a”is not intended as limiting of the number of items. Also, the use of relational terms such as, but not limited to, “top,” “bottom,” “left,” “right,” “upper,” “lower,” “down,” “up,” and “side,” are used in the description for clarity in specific reference to the figures and are not intended to limit the scope of the present disclosure or the appended claims.

[0049] Further, as the present disclosure is susceptible to aspects of many different forms, it is intended that the present disclosure be considered as an example of the principles of the present disclosure and not intended to limit the present disclosure to the specific aspects shown and described. Any one of the features of the present disclosure may be used separately or in combination with any other feature. References to the terms “aspect,” “aspects,” and / or the like in the description mean that the feature and / or features being referred to are included in, at least, one aspect of the description. Separate references to the terms “aspect,” “aspects,” and / or the like in the description do not necessarily refer to the same aspect and are also not mutually exclusive unless so stated and / or except as will be readily apparent to those skilled in the art from the description. For example, a feature, structure, process, step, action, or the like described in one aspect may also be included in other aspects but is not necessarily included. Thus, the present disclosure may include a variety of combinations and / or integrations of the aspects described herein. Additionally, all aspects of the present disclosure, as described herein, are not essential for its practice. Likewise, other systems, methods, features, and advantages of the present disclosure will be, or become, apparent to one with skill in the art upon examination of the figures and the description. It is intended that all such additional systems, methods, features, and advantages be included within this description, be within the scope of the present disclosure, and be encompassed by the claims.

[0050] Any term of degree such as, but not limited to, “substantially” as used in the description and the appended claims, should be understood to include an exact, or a similar, but not exact configuration. For example, “a substantially planar surface” means having an exact planar surface or a similar, but not exact planar surface. Similarly, the terms “about” or “approximately,” as used in the description and the appended claims, should be understood to include the recited values or a value that is three times greater or one third of the recited values. For example, about 3 mm includes all values from 1 mm to 9 mm, and approximately 50 degrees includes all values from 16.6 degrees to 150 degrees. For example, they can refer to less than or equal to ± 5%, such as less than or equal to ± 2%, such as less than or equal to ± 1 %, such as less than or equal to ± 0.5%, such as less than or equal to ± 0.2%, such as less than or equal to ± 0.1 %, such as less than or equal to ± 0.05%.

[0051] The terms "comprising," "including" and "having" are used interchangeably in this disclosure. The terms "comprising," "including" and "having" mean to include, but notnecessarily be limited to the things so described.

[0052] Lastly, the terms “or” and “and / or,” as used herein, are to be interpreted as inclusive or meaning any one or any combination. Therefore, “A, B or C” or “A, B and / or C” mean any of the following: “A,” “B” or “C”; “A and B”; “A and C”; “B and C”; “A, B and C.” An exception to this definition will occur only when a combination of elements, functions, steps or acts are in some way inherently mutually exclusive.

[0053] As used herein, the term transfer RNA or tRNA refers to a small RNA molecule that plays a key role in protein synthesis. Transfer RNA serves as a link (or adaptor) between the messenger RNA (mRNA) molecule and the growing chain of amino acids that make up a protein. T ransfer RNA is an RNA polymer that is about 70 to 100 nucleotides in length. During protein synthesis, a tRNA delivers an amino acid to the ribosome for addition to the growing peptide chain. Active tRNAs have a 3 ’CCA tail that may be transcribed into the tRNA during its synthesis or may be added later during post-transcriptional processing. The amino acid is covalently attached to the 2’ or 3’ hydroxyl group of the 3 ’-terminal ribose to form an aminoacyl-tRNA (aa-tRNA); an amino acid can spontaneously migrate from the 2’-OH to the 3’-OH and vice versa, but it is incorporated into a growing protein chain at the ribosome from the 3’-OH position. A loop at the other end of the folded aa-tRNA molecule contains a sequence of three bases known as the anticodon. When this anticodon sequence base-pairs with a three-base codon sequence in a ribosome- bound messenger RNA (mRNA), the aa- tRNA binds to the ribosome and its amino acid is incorporated into the nascent protein chain. Since all tRNAs that base -pair with a specific codon are aminoacylated with a single specific amino acid, the translation of the genetic code is effected by tRNAs: each of the 61 non termination codons in an mRNA directs the binding of its cognate aa-tRNA and the addition of a single specific amino acid to the growing protein polymer. In some embodiments, the tRNA may comprise a sequence in the anticodon region of the tRNA such that the aa-tRNA basepairs with a different codon on the mRNA. In certain embodiments, the mutated tRNA introduces a different amino acid into the growing protein chain than the amino acid encoded by the mRNA. In other embodiments, the mutated tRNA base- pairs with a stop codon and introduces an amino acid instead of terminating protein synthesis, thereby allowing the nascent peptide to continue to grow. In some embodiments, a tRNA, wild-type or mutated, may read through a stop codon and introduce an amino acid instead of terminating protein synthesis. In some embodiments, the tRNA may comprise a full-length tRNA with the 3’- terminal-CCA nucleotides included. In other embodiments, tRNAs lacking the 3 ’-terminal -A, -CA, or CCA are made full-length in vivo by the CCA-adding enzyme.

[0054] The term “codon” refers to a sequence of nucleotide triplets, i.e. three DNA or RNA nucleotides, corresponding to a specific amino acid or stop signal during protein synthesis.

[0055] The term “synthetic tRNA” refer to a tRNA modified by chemical or molecular biological methods or a non-naturally occurring tRNA. The terms "engineered" and "synthetic" are used synonymously here.

[0056] The terms "nucleic acid”, "nucleic acid molecule”, and "polynucleotide” are used interchangeably herein. The terms “nucleic acid encoding . . .” or “nucleic acid molecule encoding . . . ” should be understood as referring to the sequence of nucleotides which encodes a polypeptide. Deoxyribonucleic acids (DNA) or ribonucleic acids (RNA) and polymers thereof in either single- or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogues of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions), alleles, orthologs, SNPs, and complementary sequences as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and / or deoxyinosine residues.

[0057] A polynucleotide described herein may comprise one or more nucleic acids each encoding a polypeptide, operably linked to (i.e. , in a functional relationship with) one or more regulatory sequences, such as a promoter. Such a polynucleotide may alternatively be referred to herein as a "nucleic acid construct” or "construct”. As used herein, the term “operably linked” refers to a functional linkage between a promoter or other regulatory element and an associated transcribable DNA sequence or coding sequence of a gene (or transgene), such that the promoter, etc., operates to initiate, assist, affect, cause, and / or promote the transcription and expression of the associated transcribable DNA sequence or coding sequence, at least in certain tissue(s), developmental stage(s) and / or condition(s).

[0058] Within the context of the application a protein is represented by an amino acid sequence and correspondingly a nucleic acid molecule or a polynucleotide represented by a nucleic acid sequence. Identity and similarity between sequences: throughout this application, each time one refers to a specific nucleic acid sequence SEQ ID NO (take SEQ ID NO: Y as example), one may replace it by a polynucleotide represented by a nucleic acid sequence comprising a sequence that has at least 60%, 70%, 75%, 80%, 85%, 90%, 95, or 99% sequence identity or similarity with nucleic acid SEQ ID NO: Y.

[0059] A polynucleotide described herein may comprise one or more nucleic acids each encoding a polypeptide, operably linked to (i.e., in a functional relationship with) one or more regulatory sequences, such as a promoter. Such a polynucleotide may alternatively bereferred to herein as a "nucleic acid construct” or "construct”. As used herein, the term “operably linked” refers to a functional linkage between a promoter or other regulatory element and an associated transcribable DNA sequence or coding sequence of a gene (or transgene), such that the promoter, etc., operates to initiate, assist, affect, cause, and / or promote the transcription and expression of the associated transcribable DNA sequence or coding sequence, at least in certain tissue(s), developmental stage(s) and / or condition(s).

[0060] Sequences described herein can also be the reverse, the complement, or the reverse complement of the nucleotide sequences described herein. The RNA goes in the reverse direction compared to the DNA, but its base pairs still match (e.g., G to C). The reverse complementary RNA for a positive strand DNA sequence will be identical to the corresponding negative strand DNA sequence. Reverse complement converts a DNA sequence into its reverse, complement, or reverse-complement counterpart. Complementarity is a property shared between two nucleic acid sequences (e.g., RNA, DNA), such that when they are aligned antiparallel to each other, the nucleotide bases at each position will be complementary. Two bases are complementary if they form Watson-Crick base pairs.

[0061] As used herein, “regulatory elements” refer to any sequence elements that regulate, positively or negatively, the expression of an operably linked sequence. “Regulatory elements” include, without being limiting, a promoter, an enhancer, a leader, a transcription start site (TSS), a linker, 5' and 3' untranslated regions (UTRs), an intron, a polyadenylation signal, and a termination region or sequence, etc., that are suitable, necessary or preferred for regulating or allowing expression of the gene or transcribable DNA sequence in a cell. Such additional regulatory element(s) can be optional and used to enhance or optimize expression of the gene or transcribable DNA sequence. A regulatory sequence can, for example, be inducible, noninducible, constitutive, cell-cycle regulated, metabolically regulated, and the like. A regulatory sequence may be a promoter. As used herein, the term “promoter” refers to a DNA sequence that contains an RNA polymerase binding site, a transcription start site, and / or a TATA box and assists or promotes the transcription and expression of an associated transcribable polynucleotide sequence and / or gene (or transgene). A promoter can be synthetically produced, varied, or derived from a known or naturally occurring promoter sequence or other promoter sequence. A promoter can also include a chimeric promoter comprising a combination of two or more heterologous sequences. A promoter of the present application can thus include variants of promoter sequences that are similar in composition, but not identical to, other promoter sequence(s) known or provided herein.

[0062] As used herein, the term “operably linked” refers to a functional linkage between a promoter or other regulatory element and an associated transcribable DNA sequence or coding sequence of a gene (or transgene), such that the promoter, etc., operates to initiate,assist, affect, cause, and / or promote the transcription and expression of the associated transcribable DNA sequence or coding sequence, at least in certain tissue(s), developmental stage(s) and / or condition(s).

[0063] As used herein, the term “encoding” refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom. Thus, a gene encodes a protein if transcription and translation of mRNA corresponding to that gene produces the protein in a cell or other biological system. Both the coding strand, the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings, and the non-coding strand, used as the template for transcription of a gene or cDNA, can be referred to as encoding the protein or other product of that gene or cDNA.

[0064] A “vector” is a nucleic acid sequence designed to be propagated and or transcribed upon exposure to a cellular environment, such as a cell lysate or a whole cell. Vector: A vector may comprise a polynucleotide cassette as defined herein. A vector as described herein may be selected from any genetic element known in the art which can facilitate transfer of nucleic acids between cells, such as, but not limited to, plasmids, transposons, cosmids, chromosomes, artificial chromosomes, viruses, virions, and the like. A vector may also be a chemical vector, such as a lipid complex or naked DNA. “Naked DNA” or “naked nucleic acid” refers to a nucleic acid molecule that is not contained in encapsulating means that facilitates delivery of a nucleic acid into the cytoplasm of a target host cell. Naked DNA may be circular or linear (linearized DNA sequence). Optionally, a naked nucleic acid can be associated with standard means used in the art for facilitating its delivery of the nucleic acid to the target host cell, for example to facilitate the transport of the nucleic acid through the cell membrane. A vector may be a viral vector.

[0065] As used herein, the term “viral vector” can refer to a nucleic acid vector construct that includes at least one element of viral origin and has the capacity to be packaged into a viral vector particle and encodes at least an exogenous polynucleotide. A viral vector is a modified virus that serves as a delivery vehicle for the transfer of genetic material into a host cell. The viral vector is engineered to carry and express a specific gene or genes of interest in the target cells. The viral vector retains the ability to infect cells but is modified to be replicationdeficient or replication-competent with controlled replication, ensuring safety and controllability. In certain aspects, the vector and / or particle can be utilized for the purpose of transferring any nucleic acids into cells either in vitro or in vivo. Numerous viral vectors are known in the art. The term virion can refer to a single infective viral particle. “Viral vector,” “viralvector particle,” and “viral particle” also refer to a complete virus particle with its DNA or RNA core and protein coat as it exists outside the cell. Non-limiting examples of viral vectors for use herein can include adenoviruses, adeno-associated viruses (AAV), herpesviruses, retroviruses, lentiviruses, integrase defective lentiviruses (IDLV), and the like.

[0066] As used herein, “expression vector” refers to a vector comprising a recombinant polynucleotide comprising expression control sequences operatively linked to a nucleotide sequence to be expressed. An expression vector comprises sufficient cis-acting elements for expression; other elements for expression can be supplied by the host cell or in an in vitro expression system. Expression vectors include all those known in the art, such as cosmids, plasmids (e.g, naked or contained in liposomes) and viruses (e.g., lentiviruses, retroviruses, adenoviruses (e.g., Ad5F35), and adeno-associated viruses) that incorporate the recombinant polynucleotide.

[0067] As used herein, “CCR4-NOT Transcription Complex Subunit 3,” or “CNOT3” is protein, which is a subunit of CCR4-NOT transcription complex. CNOT3 is involved in regulating RNA polymerase II transcription and in various cellular processes like mRNA decay and gene silencing. Variations in CNOT3 have been linked to several neurodevelopmental disorder such as Intellectual Developmental Disorder with Speech Delay, Autism, and Dysmorphic Facies (IDDSADF). Additionally, CNOT3 is also implicated in cancer including T- cell acute lymphoblastic leukemia. The wild type sequences of CNOT3 are well known in the art and may be obtained from publicly available databases. For e.g., nucleotide sequence for human CNOT3 isoform 1 mRNA is available at NCBI database under accession number NM_014516.4 and the corresponding protein sequence under accession number NP_055331.1. In an exemplary aspect, CNOT3 polypeptide comprises the amino acid sequence of SEQ ID NO: 327.

[0068] The terms “treat,” "treating," or "treatment" as used herein, refer to both therapeutic treatment and prophylactic or preventative measures, wherein the object is to prevent or slow down (lessen) an undesired physiological change or disease / disorder. Beneficial or desired clinical results include, but are not limited to, alleviation of or reducing one or more symptoms, diminishment of extent of disease, stabilized (i.e. , not worsening) state of disease, a delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable. “Treatment” can also mean prolonging survival as compared to expected survival if not receiving treatment. Those in need of treatment include those already with the disease, condition, or disorder as well as those prone to have the disease, condition or disorder or those in which the disease, condition or disorder is to be prevented.

[0069] As used herein, “effective amount” and “amount effective” can refer to an amount that is sufficient to achieve the desired result such as, for example, the treatment and / or prevention of a disease or disorder (e.g., mRNA-decay associated disease). As used herein, the terms “effective amount” and “amount effective” can refer to an amount that is sufficient to achieve the desired an effect on an undesired condition (e.g., mRNA-decay associated disease).

[0070] In an aspect, “therapeutically effective amount” means an amount of the disclosed composition that (i) treats a disease or disorder (for. e.g., mRNA-decay associated disease), (ii) attenuates, ameliorates, or eliminates one or more symptoms associated with a disease or disorder (for e.g., cancer), or (iii) delays the onset of one or more symptoms of a disease or disorder (for e.g., cancer). The specific therapeutically effective dose level for any particular patient will depend upon a variety of factors including the type of cancer being treated; the disclosed compositions employed; the disclosed methods employed; the age, body weight, general health, sex and diet of the patient; the time of administration; the route of administration; the rate of excretion of the disclosed compositions employed; the duration of the treatment; drugs used in combination or coincidental with the disclosed compositions employed, and other like factors well known in the medical arts. For example, it is well within the skill of the art to start doses of the disclosed compositions at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved. If desired, then the effective daily dose can be divided into multiple doses for purposes of administration. Consequently, a single dose of the disclosed compositions, disclosed viral vectors, disclosed pharmaceutical formulations, disclosed therapeutic agents, or a combination thereof can contain such amounts or submultiples thereof to make up the daily dose. The dosage can be adjusted by the individual physician in the event of any contraindications. Dosage can vary, and can be administered in one or more dose administrations daily, for one or several days. Guidance can be found in the literature for appropriate dosages for given classes of pharmaceutical products. In further various aspects, a preparation can be administered in a “prophylactically effective amount”; that is, an amount effective for prevention of a sign or symptom associated with a disease or disorder (for e.g., mRNA-decay associated disease).

[0071] As used herein, the term “wild type” as is understood in the art refers to a polypeptide or polynucleotide sequence that occurs in a native population without genetic modification.II. Isolated nucleotide

[0072] In one aspect, the disclosure encompasses an isolated nucleotide sequence encoding a tRNA. The nucleotide sequence, in certain aspect comprises a U13:A22:A46. Inanother aspect, the nucleotide sequence comprises an extra nucleotide preceding the 18:19 GG motif, or an extra nucleotide in a D-loop a element of the tRNA. In an alternative aspect, the nucleotide sequence comprises chemical modifications to the tRNA D-arm or the anticodon stem of the tRNA.

[0073] The isolated nucleotide sequence of the present application comprising a U13:A22:A46 can enhance decay of a target mRNA decay and / or reduce half-life of the target mRNA. In another aspect, nucleotide sequence comprising an extra nucleotide preceding the 18:19 GG motif enhances the stability of a target mRNA and / or increase half-life of the target mRNA.

[0074] In some aspects, the isolated nucleotide sequence encoding a tRNA disclosed herein may comprise a sequence comprising nucleic acid sequence listed in Table 1 F. The isolated nucleotide sequence encoding the tRNA may be a polynucleotide comprising a sequence that has at least 60%, 70%, 75%, 80%, 85%, 90%, 95, or 99% sequence identity with nucleic acid sequences listed in Table 1F.

[0075] In one aspect, the isolated nucleotide sequence encoding the tRNA enhance decay of a target mRNA decay and / or reduce half-life of a target mRNA. In such aspects, the isolated nucleotide sequence encoding the tRNA may be a polynucleotide comprising a sequence that has at least 60%, 70%, 75%, 80%, 85%, 90%, 95, or 99% sequence identity to sequence set forth in SEQ ID NOs: 55, 58, 59, 60, 64, 65, 66, 68, and any combinations thereof. The isolated nucleotide sequence encoding the tRNA may be a polynucleotide comprising a sequence with 100% sequence identity to sequence set forth in SEQ ID NOs: 55, 58, 59, 60, 64, 65, 66, 68, and any combinations thereof.

[0076] The enhancement of decay of the target mRNA or reduction in the half-life of the target mRNA by the isolated nucleotide sequence encoding the tRNA may be about 5% to about 99% (e.g., about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%) compared to wildtype tRNA or a control not treated with the isolated nucleotide sequence encoding the tRNA.

[0077] In another aspect, the isolated nucleotide sequence encoding the tRNA enhance the stability of a target mRNA and / or increase the half-life of a target mRNA. In such aspects, the isolated nucleotide sequence encoding the tRNA may be a polynucleotide comprising a sequence that has at least 60%, 70%, 75%, 80%, 85%, 90%, 95, or 99% sequence identity to sequence set forth in SEQ ID NOs: 57, 62, 63, and any combinations thereof. The isolated nucleotide sequence encoding the tRNA may be a polynucleotide comprising a sequence with 100% sequence identity to sequence set forth in SEQ ID NOs: 57, 62, 63, and anycombinations thereof.

[0078] The enhancement of stability of the target mRNA or increase in the half-life of the target mRNA by the isolated nucleotide sequence encoding the tRNA may be about 5% to about 99% (e.g., about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%) compared to wildtype tRNA or a control not treated with the isolated nucleotide sequence encoding the tRNA.

[0079] A target mRNA may be selected from any target mRNA, abnormal levels of which may cause a dysfunction or disorder in a subject. The dysfunction or disorder may be selected from mRNA-decay associated disease such cystic fibrosis, muscular dystrophy, autosomal dominant polycystic kidney disease (ADOKD), ataxia telangiectasia, beta-thalassemia, factor VII deficiency, familial atrial fibrillation, hemophilia B, hepatic carnitine palmitoyltransferase 1A deficiency (CPT1A), heritable pulmonary arterial hypertension (HPAH), late infantile neuronal ceroid lipofuscinosis (LNCL), leukocyte adhesion deficiency 1 (LAD1), methylmalonic acidemia (MMA), Hurler syndrome, nephropathic cystinosis, obesity, peroxisome biogenesis disorder (PBD), renal tubular acidosis (RTA), retinitis pigmentosa (RP), Rett syndrome (RTT), spinal muscular atrophy (SMA), Stuve-Wiedemann syndrome (SMS), X-linked nephrogenic diabetes insipidus (XNDI), or Usher syndrome (USH1), and nonsense mutation associated disease such as beta-thalassemia, Marfan synfrome, Duchenne Muscular Dystrophy, Becker Muscular Dystrophy, Ullrich disease, Hurler syndrome, cancer, cystic fibrosis, Spinal muscular atrophy, amylosis, LINCL (Late Infantile Neuronal Ceroid Lipofuscinosis), Haemophilia, Alzheimer's disease, Atherosclerosis, Gigantism, Dwarfism, Hypothyroidism, Hyperthyroidism, Obesity, Parkinson's disease, Niemann Pick disease, Family hypercholesterolemia, and retinitis pigmentosa.

[0080] In an aspect, the nucleotide sequence disclosed herein may have one or more chemical modifications. Non-limiting examples of chemical modifications can include terminal cap moieties, phosphate backbone modifications, and the like. Examples of classes of terminal cap moieties include, without limitation, inverted deoxy abasic residues, glyceryl modifications, 4',5'-methylene nucleotides, 1-([3-D-erythrofuranosyl) nucleotides, 4 '-thio nucleotides, carbocyclic nucleotides, 1 ,5-anhydrohexitol nucleotides, L-nucleotides, a-nucleotides, modified base nucleotides, threo pentofuranosyl nucleotides, acyclic 3',4'-seco nucleotides, acyclic 3,4-dihydroxybutyl nucleotides, acyclic 3,5-dihydroxypentyl nucleotides, 3'-3'-inverted nucleotide moieties, 3'-3'-inverted abasic moieties, 3'-2'-inverted nucleotide moieties, 3'-2'- inverted abasic moieties, 5'-5'-inverted nucleotide moieties, 5'-5'-inverted abasic moieties, 3 - 5'-inverted deoxy abasic moieties, 5'-amino-alkyl phosphate, 1 ,3-diamino-2-propyl phosphate, 3 aminopropyl phosphate, 6-aminohexyl phosphate, 1 ,2-aminododecyl phosphate,hydroxypropyl phosphate, 1 ,4-butanediol phosphate, 3'-phosphoramidate, 5' phosphoramidate, hexylphosphate, aminohexyl phosphate, 3'-phosphate, 5'-amino, 3 - phosphorothioate, 5'-phosphorothioate, phosphorodithioate, and bridging or non-bridging methylphosphonate or 5'-mercapto moieties. Non-limiting examples of phosphate backbone modifications (i.e., resulting in modified internucleotide linkages) include phosphorothioate, phosphorodithioate, methylphosphonate, phosphotriester, morpholino, amidate, carbamate, carboxymethyl, acetamidate, polyamide, sulfonate, sulfonamide, sulfamate, formacetal, thioformacetal, and alkylsilyl substitutions. Such chemical modifications can occur at the 5'- end and / or 3'-end of the sense strand, antisense strand, or both strands of the nucleic acid inhibitor or activator. In an aspect, the nucleic acid may comprise a locked nucleic acid (LNA) or a bridged nucleic acid. A locked nucleic acid (LNA), also known as bridged nucleic acid (BNA), is a modified RNA nucleotide in which the ribose moiety is modified with an extra bridge connecting the 2' oxygen and 4' carbon. The bridge "locks" the ribose in the 3'-endo (North) conformation, which is often found in the A-form duplexes. This structure provides for increased stability against enzymatic degradation. LNA also offers improved specificity and affinity in base-pairing as a monomer or a constituent of an oligonucleotide. LNA nucleotides can be mixed with DNA or RNA residues in a nucleic acid sequence.

[0081] Chemical modification of the nucleotide sequence disclosed herein may comprise modification of at least one ribosugar or deoxyribose sugar moiety of its nucleotide sequence. The ribosugar or deoxy sugar moiety may be modified with 2 2'-O-methyl (2'OMe), 2'-deoxy- 2'-fluoro (2'F), 2'-deoxy, 5-C-methyl, 2’-O-(2-methoxyethyl) (MOE), 4 -thio, 2'-amino, 2'-C-allyl, or any combination thereof. In an aspect, the chemical modification may comprise highly nuclease resistant 2',4'-constrained MOE (cMOE) or ethyl bicyclic nucleic acids (cET BNA). In some aspects, the nucleotide sequence disclosed herein may have less than about 10% to about 70% (e.g., about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%) of ribosugar moieties of the total nucleotide sequence modified.

[0082] Chemical modification of the nucleotide sequence disclosed herein may comprise attaching a conjugate to the nucleotide sequence molecule. The type of conjugate used and the extent of conjugation to the nucleotide sequence can be evaluated for improved pharmacokinetic profiles, bioavailability, and / or stability of the nucleic acid inhibitor or activator while retaining activity. As such, one skilled in the art can screen the nucleotide sequence having various conjugates attached thereto to identify the nucleotide sequence conjugates having improved properties using any of a variety of well-known in vitro cell culture or in vivo animal models including the negative-controlled expression studies described above. The conjugate can be attached at the 5'- and / or the 3'-end of the sense and / or the antisense strand of the nucleotide sequence via a covalent attachment such as a nucleic acid or non-nucleicacid linker. The conjugate can be attached to the nucleotide sequence through a carbamate group or other linking group (see, e.g., U.S. Patent Publication Nos. 20050074771 , 20050043219, and 20050158727, the content of each of which is incorporated by reference herein in its entirety). A conjugate may be added to the nucleotide sequence for any of a number of purposes. For example, the conjugate may be a molecular entity that facilitates the delivery of the nucleotide sequence into a cell or may be a molecule that comprises a drug or label. Examples of conjugate molecules suitable for attachment to the nucleotide sequence of the present disclosure include, without limitation, steroids such as cholesterol, glycols such as polyethylene glycol (PEG), human serum albumin (HSA), fatty acids, carotenoids, terpenes, bile acids, folates (e.g., folic acid, folate analogs and derivatives thereof), sugars (e.g., galactose, galactosamine, N-acetyl galactosamine, glucose, mannose, fructose, fucose, etc.), phospholipids, peptides, ligands for cellular receptors capable of mediating cellular uptake, and combinations thereof. Other examples include the lipophilic moiety, vitamin, polymer, peptide, protein, nucleic acid, small molecule, oligosaccharide, carbohydrate cluster, intercalator, minor groove binder, cleaving agent, and cross-linking agent conjugate molecules described in e.g., U.S. Patent Publication Nos. 20050119470 and 20050107325, the content of each of which is incorporated by reference herein in its entirety. Other examples include the 2'-O-alkyl amine, 2'-O-alkoxyalkyl amine, polyamine, C5-cationic modified pyrimidine, cationic peptide, guanidinium group, amidininium group, cationic amino acid conjugate molecules, and the like. Additional examples of conjugate molecules include a hydrophobic group, a membrane active compound, a cell penetrating compound, a cell targeting signal, an interaction modifier, or a steric stabilizer as described in U.S. Patent Publication No. 20040167090, incorporated by reference herein in its entirety.III. Synthetic tRNA

[0083] The disclosure further encompasses a synthetic tRNA. The synthetic tRNA comprises a nucleotide sequence and can further comprise a modification relative to a wildtype tRNA sequence. The modification can be a modification to the sequence of the tRNA relative to a wild-type tRNA sequence. In some aspects, the modification can be chemical modification to one or more residues in the tRNA. These modifications may modify the ability of the tRNA to recruit CNOT3 to a cell ribosome and / or modify the stability or half-life of a target mRNA in the cell.

[0084] In some aspects, the synthetic tRNA can comprise a nucleotide sequence of a length up to 70 nucleotides, 75 nucleotides, 80 nucleotides, 85 nucleotides, 90 nucleotides, 95 nucleotides, 100 nucleotides, 105 nucleotides, 110 nucleotides, 115 nucleotides, or 120 nucleotides in length. In certain aspect, the synthetic tRNA comprises a nucleotide sequence of a length up to 100 nucleotides.

[0085] In some aspects, the synthetic tRNA comprises a modification to the nucleic acid sequence. In such aspects, the synthetic tRNA comprises a sequence modification relative to a wild-type tRNA sequence, wherein the sequence modification modifies the ability of the tRNA to recruit CNOT3 to a cell ribosome and / or modifies the stability of a target mRNA in the cell. The synthetic tRNA may further comprise a nucleotide sequence of a length up to 100 nucleotides.

[0086] In one aspect, the synthetic tRNA comprises a sequence modification that increases CNOT3 recruitment to the ribosome and / or increases the decay of the target mRNA. In such aspects, the nucleotide sequence comprises a U13:A22:A46 triplet.

[0087] In an alternative aspect, the synthetic tRNA comprises a sequence modification that decreases CNOT3 recruitment to the ribosome and / or stabilizes the translated target mRNA. In such aspects, the sequence modification comprises an extra nucleotide in a D-loop a element of the tRNA, an extra nucleotide preceding a GG motif at position 18:19, or a modification to a D-arm or anticodon stem of the tRNA.

[0088] In some aspects, the synthetic tRNA may comprise a sequence comprising nucleic acid sequence listed in Table 1F. The isolated nucleotide sequence encoding the synthetic tRNA may comprise a polynucleotide comprising a sequence that has at least 60%, 70%, 75%, 80%, 85%, 90%, 95, or 99% sequence identity with nucleic acid sequences listed in Table 1F.

[0089] In one aspect, the synthetic tRNA enhance decay of a target mRNA decay and / or reduce half-life of a target mRNA. In such aspects, the isolated nucleotide sequence encoding the synthetic tRNA may comprise a polynucleotide comprising a sequence that has at least 60%, 70%, 75%, 80%, 85%, 90%, 95, or 99% sequence identity to sequence set forth in SEQ ID NOs: 55, 58, 59, 60, 64, 65, 66, 68, and any combinations thereof. The synthetic tRNA may comprise a polynucleotide comprising a sequence with 100% sequence identity to sequence set forth in SEQ ID NOs: 55, 58, 59, 60, 64, 65, 66, 68, and any combinations thereof.

[0090] The enhancement of decay of the target mRNA or reduction in the half-life of the target mRNA by the isolated nucleotide sequence encoding the tRNA may be about 5% to about 99% (e.g., about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%) compared to wildtype tRNA or a control not treated with the synthetic tRNA.

[0091] In another aspect, the synthetic tRNA enhance the stability of a target mRNA and / or increase the half-life of a target mRNA. In such aspects, the synthetic tRNA may comprise a polynucleotide with a sequence that has at least 60%, 70%, 75%, 80%, 85%, 90%, 95, or 99%sequence identity to sequence set forth in SEQ ID NOs: 57, 62, 63, and any combinations thereof. The synthetic tRNA may comprise a polynucleotide with 100% sequence identity to sequence set forth in SEQ ID NOs: 57, 62, 63, and any combinations thereof.

[0092] The enhancement of stability of the target mRNA or increase in the half-life of the target mRNA by the isolated nucleotide sequence encoding the tRNA may be about 5% to about 99% (e.g., about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%) compared to wildtype tRNA or a control not treated with the synthetic tRNA.

[0093] In another aspect, the sequence modification to the tRNA comprise a chemical modification of one or more nucleotides in the sequence. The modifications can be one or more nucleotide modifications described above.IV. Inhibitors

[0094] The present application, in some aspects provides an inhibitor of a mammalian CNOT3. In some aspects, further provided is an engineered nucleic acid comprising a nucleotide sequence recognizing a nucleic acid sequence encoding a mammalian CNOT3, the engineered nucleic acid molecule selected from an antisense oligonucleotide (ASO), siRNA, miRNA, a cluster regularly interspaced short palindromic repeats (CRISPR) related nucleic acid, a single guide RNA (sgRNA), a CRISPR-RNA (crRNA), a trans-activating crRNA (tracrRNA), and an aptamer, wherein the engineered nucleic acid modifies the ability of a tRNA to recruit CNOT3 to a cell ribosome and / or modifies the stability of a target mRNA in the cell.

[0095] As used herein, the term “inhibitor” includes an agent that disrupts the CNOT3 gene, disrupts gene expression of CNOT3, directly inhibits CNOT3 activity, indirectly inhibits CNOT3 activity, or a combination thereof. As used herein the terms “disrupt,” “disruption,” “disrupting,” or “disrupted” gene refers to genetic modifications that alter the level of expression of a target gene. In some aspects, the disruption can be due to a deletion of at least one nucleotide within or near the target gene or a deletion of part or all of a target gene, as described above. In other aspects, the disruption can be due to a substitution of at least one nucleotide and / or an insertion of at least one nucleotide within or near the target gene. In further aspects, the disruption can be due to an insertion of one or more exogenous polynucleotides within or near the target gene. In general, as used herein, disrupted expression refers to reduced or eliminated expression of the target gene. In some aspects, the disruption can be a reduced level of expression (e.g., express less than 30%, less than 25%, less than 20%, less than 10%, or less than 5% of the level of an unmodified cell). In some aspect, the disruption canbe eliminated expression (e.g., no expression or an undetectable level of RNA). Expression can be measured directly using any standard RNA-based assay, or indirectly using proteinbased, and / or antibody-based detection method (e.g., RT-PCR, ELISA, flow cytometry, immunocytochemistry, and the like). Methods known in the art for the detection and quantification of RNA expression suitable for use herein can include, but are not limited to northern blotting and in situ hybridization, RNAse protection assays, polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), real-time quantitative reverse transcription PCR (RT-qPCR or qPCR), sequencing-based gene expression analysis (e.g., Serial Analysis of Gene Expression (SAGE)), gene expression analysis by massively parallel signature sequencing (MPSS), and the like. Detectable levels are defined as being higher that the limit of detection (LOD), which is the lowest concentration that can be measured (detected) with statistical significance by means of a given detection method.

[0096] In an aspect, the inhibitor comprises a small molecule inhibitor of CNOT3. In an aspect, the inhibitor comprises a nucleic acid inhibitor of CNOT3. In an aspect, the inhibitor comprises a polynucleotide encoding a nucleic acid inhibitor of CNOT3. In an aspect, the inhibitor comprises a polynucleotide that encodes a polypeptide that directly or indirectly disrupts the expression or function of CNOT3.

[0097] In an aspect, the inhibitor of CNOT3 is a nucleic acid inhibitor. The term “nucleic acid inhibitor” as used herein refers to a molecule having nucleotides and capable of disrupting CNOT3 gene in a cell. The nucleic acid inhibitor can be single, double, or multiple stranded and may comprise modified or unmodified nucleotides or non-nucleotides or various mixtures and combinations thereof. In an aspect, the nucleic acid inhibitor is a DNA. In an aspect, the nucleic acid inhibitor is an RNA. In some instances, the nucleic acid inhibitor is a single stranded RNA. In an aspect, the nucleic acid inhibitor is a single stranded RNA. Examples of nucleic acids suitable for use herein can be small temporal RNA, small nuclear RNA, small nucleolar RNA, short hairpin RNA, microRNA, an anti-sense oligonucleotide (ASO), a ribozyme, an aptamer, a cluster regularly interspaced short palindromic repeats (CRISPR) related nucleic acid, a single guide RNA (sgRNA), a CRISPR-RNA (crRNA), a trans-activating crRNA (tracrRNA).

[0098] In an aspect, the nucleic acid inhibitor is a cluster regularly interspaced short palindromic repeats (CRISPR) related nucleic acid for example a single guide RNA (sgRNA), a CRISPR-RNA (crRNA), or a trans-activating crRNA (tracrRNA) or combination thereof. In an aspect, the CRISPR related nucleic disrupts or is designed to disrupt the CNOT3 gene. In an aspect, the CRISPR related nucleic disrupts or is designed to disrupt the CNOT3 gene. In an aspect, the CRISPR related nucleic acid is a sgRNA or a crRNA. In an aspect, the sgRNAor crRNA comprises a nucleic acid sequence having at least 80% (e.g., about 80%, about 85%, about 90%, about 95%, or about 99%) identity with GAGGGACCAAATCAAGACAT (SEQ ID NO: 1) or TCTTGCGGATGGCGTCAACG (SEQ ID NO: 2).

[0099] In an aspect, the nucleic acid inhibitor is a ribozyme. Ribozymes are catalytic RNA molecules capable of cleaving other RNA molecules in a sequence-specific manner. They can be engineered to target and cleave specific RNA sequences, leading to the degradation of the target RNA molecule. In an aspect, the nucleic acid inhibitor is an aptamer. Aptamers are single-stranded RNA or DNA molecules that can bind to specific target molecules with high affinity and specificity. RNA aptamers can be designed to target specific RNA molecules and interfere with their function.

[0100] The nucleic acid inhibitor of the present disclosure may specifically disrupt gene expression of CNOT3. The term disrupting may be interchangeably expressed as reducing, inhibiting, preventing, blocking or silencing. Here, the phrase “disrupting gene expression” refers to any reduced level of gene expression comparing with an ordinary expression level. For example, the reduced level of gene expression can be from about 70% to 0% of the ordinary expression level. In other words, about 30% to 100% gene expression is downregulated, reduced, blocked, inhibited, prevented or silenced, comparing to the ordinary expression level. Specifically, the reduced level of gene expression is about 70%, 65%, 60%, 55%, 50%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 8%, 5%, 4%, 3%, 2%, 1 % or 0% of the ordinary expression level of CNOT3. The reduced level of gene expression can also be any percentage or range as recited above. On the other hand, the term “specific” or “specifically” used in combination with disrupting refers to downregulation of a target gene's expression with minimal or no binding or downregulation of other nucleic acids or their expressions.

[0101] In some aspects, the current disclosure also encompasses use of gene editing systems for example CRISPR based systems for inhibiting gene expression of CNOT3. As such, the current disclosure also encompasses compositions comprising a nucleic acid sequence related to a cluster regularly interspaced short palindromic repeats (CRISPR) system, for example a single guide RNA (sgRNA), a CRISPR-RNA (crRNA), a trans-activating crRNA (tracrRNA), and further a plasmid DNA (pDNA) or a viral vector encoding nucleic acid sequence related to a cluster regularly interspaced short palindromic repeats (CRISPR) system, that specifically target CNOT3 or variants thereof. In some aspects, the gene editing system comprises at least an sgRNA targeting CNOT3 as provided herein and an RNA guided endonuclease for example Cas9.

[0102] In an aspect, the current disclosure also encompasses small molecule inhibitors ofCN0T3. In an aspect, a small molecule inhibitor can be a known drug. In an aspect, the small molecule inhibitor can be a novel drug. In an aspect, the small molecule inhibitor specifically binds to CNOT3. In an aspect, the small molecule inhibitor indirectly impacts the synthesis, level or activity of CNOT3.

[0103] In an aspect, the disclosure further encompasses a nucleic acid sequence that encodes a nucleic acid inhibitor of CNOT3. In an aspect the current disclosure also encompasses a polynucleotide comprising a nucleic acid sequence encoding an effector (protein or RNA). In an aspect, the polynucleotide encoding the nucleic acid sequence may be a vector, for example a plasmid vector, a viral vector, or a transposon. In some aspects the current disclosure also encompasses vectors that facilitate transfer of nucleic acids encoding the activators or inhibitors disclosed herein, such as, but not limited to, plasmids, transposons, cosmids, chromosomes, artificial chromosomes, viruses, virions, and the like.V. CNOT3 variant

[0104] Further provided herein is a variant or a modified CNOT3. The variant of CNOT3 may increased or decreased tRNA-mediated recruitment of CNOT3 to ribosome compared to a wild-type CNOT3.

[0105] In one aspect, the variant CNOT3 may have decreased tRNA-mediated recruitment of CNOT3 to ribosome compared to wild-type CNOT3. In such instances, the CNOT3 variant enhances the stability or increases half-life of a target mRNA. A CNOT3 variant comprising decreased tRNA-mediated recruitment of CNOT3 to ribosome may comprise a modification at one or more amino acids relative to wild type CNOT3. For example, variant CNOT3 may comprise a modification at an amino acid residue 59, 95,105, or any combinations thereof relative to the amino acid sequence set forth in SEQ ID NO: 327. The variant, for example may comprise a substitution selected from K105S R59S, and E95A relative to the amino acid sequence set forth in SEQ ID NO: 327. In such aspects, the variant CNOT3 may comprise an amino acid sequence at least 80% identical to the sequence set forth in SEQ ID NO: 327.

[0106] In one aspect, the variant CNOT3 enhances the stability of a target mRNA or increase in the half-life of the target mRNA by about 5% to about 99% (e.g., about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%) compared to wild-type CNOT3 or a control not treated with the variant CNOT3.

[0107] In another aspect, the variant CNOT3 may have increased tRNA-mediated recruitment of CNOT3 to ribosome compared to wild-type CNOT3. In such instances, the CNOT3 variant enhances mRNA decay, and reduces the stability or half-life of a target mRNA.A CN0T3 variant comprising increased tRNA-mediated recruitment of CNOT3 to ribosome may comprise a modification at one or more amino acids relative to wild type CNOT3.

[0108] In one aspect, the variant CNOT3 decreases the stability of a target mRNA or decrease the half-life of the target mRNA by about 5% to about 99% (e.g., about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%) compared to wild-type CNOT3 or a control not treated with the variant CNOT3.

[0109] Also provided herein is a polynucleotide comprising a nucleic acid sequence encoding the variant CNOT3, a derivative, or a fragment thereof.

[0110] The CNOT3 variants may be engineered, produced, and tested using any well- known techniques in the art. The CNOT3 variants may be used to treat or reduce one or more symptoms associated with a mRNA-decay associated disease such cystic fibrosis, muscular dystrophy, autosomal dominant polycystic kidney disease (ADOKD), ataxia telangiectasia, beta-thalassemia, factor VI I deficiency, familial atrial fibrillation, hemophilia B, hepatic carnitine palmitoyltransferase 1A deficiency (CPT1A), heritable pulmonary arterial hypertension (HPAH), late infantile neuronal ceroid lipofuscinosis (LNCL), leukocyte adhesion deficiency 1 (LAD1), methylmalonic acidemia (MMA), Hurler syndrome, nephropathic cystinosis, obesity, peroxisome biogenesis disorder (PBD), renal tubular acidosis (RTA), retinitis pigmentosa (RP), Rett syndrome (RTT), spinal muscular atrophy (SMA), Stuve-Wiedemann syndrome (SMS), X-linked nephrogenic diabetes insipidus (XNDI), or Usher syndrome (USH1), or a nonsense mutation associated disease such as beta-thalassemia, Marfan synfrome, Duchenne Muscular Dystrophy, Becker Muscular Dystrophy, Ullrich disease, Hurler syndrome, cancer, cystic fibrosis, Spinal muscular atrophy, amylosis, LINCL (Late Infantile Neuronal Ceroid Lipofuscinosis), Haemophilia, Alzheimer's disease, Atherosclerosis, Gigantism, Dwarfism, Hypothyroidism, Hyperthyroidism, Obesity, Parkinson's disease, Niemann Pick disease, Family hypercholesterolemia, and retinitis pigmentosa.VI. Vector

[0111] The present disclosure further comprises a vector comprising a nucleic acid comprising the isolated nucleotide sequence or encoding the synthetic tRNA, the inhibitors, or the CNTO3 variant. The vector may be a plasmid vector, viral vector, retrotransposon, a phagemid, a phage derivative, an animal virus, a cosmid, a site directed insertion vector (e.g. CRISPR, Zn finger nucleases, TALEN), or suicide expression vector. Alternatively, a polynucleotide, for example, comprising the isolated nucleotide sequence or encoding the synthetic tRNA, the inhibitors, or the CNTO3 variant may be introduced into a cell usingphysical or chemical means. Physical methods for introducing a polynucleotide into a host cell include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like. Chemical means for introducing a polynucleotide into a host cell include colloidal dispersion systems, such as macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. An exemplary colloidal system for use as a delivery vehicle in vitro and in vivo may be a liposome (e.g., an artificial membrane vesicle).

[0112] In one example, the vector may be a viral vector. As used herein, the term “viral vector” can refer to a nucleic acid vector construct that includes at least one element of viral origin and has the capacity to be packaged into a viral vector particle and encodes at least an exogenous polynucleotide. In certain aspects, the vector and / or particle can be utilized for the purpose of transferring any nucleic acids into cells either in vitro or in vivo. Numerous viral vectors are known in the art. The term virion can refer to a single infective viral particle. “Viral vector,” “viral vector particle,” and “viral particle” also refer to a complete virus particle with its DNA or RNA core and protein coat as it exists outside the cell. Non-limiting examples of viral vectors for use herein can include adenoviruses, adeno-associated viruses (AAV), herpesviruses, retroviruses, lentiviruses, integrase defective lentiviruses (IDLV), and the like. In some aspects, a viral vector disclosed herein can be a lentiviral vector. Examples of lentiviruses include, but are not limited to, human lentiviruses such as HIV (in particular HIV- 1 or HIV-2), simian immunodeficiency virus (SIV), equine infectious anemia virus (EIAV), feline immunodeficiency virus (FIV), Caprine Arthritis Encephalitis Virus (CAEV), visna and progressive pneumonia viruses of sheep, baboon pseudotype viruses, bovine immunodeficiency virus (BIV), and the like. In some aspects, nucleic acid molecules and / or vectors described herein can be prepared by conventional recombinant technology known to one of skill in the art. In other aspects, nucleic acid molecules and / or vectors described herein can be prepared by a gene editing method known in the art (e.g., by CRISPR). Viral vector for use herein may also include Moloney Murine Leukemia virus (MuLV), other retroviruses, lentiviruses, adenoviruses, adeno-associated viruses (AAV), or herpes viruses. AAV may comprise an AAV capsid protein of an AAV serotype selected from the group consisting of AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAV9, AAV10, AAV9.hr, AAVrh8, AAVrhIO, AAVrh39, AAVrh43, and AAV. PHP. A vector may also be a chemical vector, such as a lipid complex or naked DNA. In some aspects the vector may be a viral vector. A viral vector may comprise an expression construct or the engineered nucleic acid as described herein. The vector may further comprise other regulatory elements. The vector may contain transcription and translation terminators, initiation sequences, and promoters useful for regulation of the expression of the nucleic acid sequence comprising the isolated nucleotidesequence or encoding the synthetic tRNA, the inhibitors, or the CNTO3 variants. The vector may further comprise an origin of replication functional in at least one organism, a promoter sequence, convenient restriction endonuclease sites, and one or more selectable markers.

[0113] The promoter may be a constitutive or inducible promoter. Non-limiting examples of constitutive promoters include, without limitation, the retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with the RSV enhancer), the cytomegalovirus (CMV) promoter (optionally with the CMV enhancer), the SV40 promoter, the dihydrofolate reductase promoter, the 0- actin promoter, the phosphoglycerol kinase (PGK) promoter, EFla promoter, and a CB6 promoter. Non-limiting examples of inducible promoters include the zinc-inducible sheep metallothionine (MT) promoter, the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter, the T7 polymerase promoter system; the ecdysone insect promoter, the tetracycline-repressible system, the tetracycline-inducible system, the RU486-inducible system and the rapamycin-inducible system. Still other types of inducible promoters which may be useful in this context are those which are regulated by a specific physiological state, for e.g., temperature, acute phase, a particular differentiation state of the cell, or in replicating cells only can also be used. In another aspect, a native promoter for the transgene will be used. The native promoter may be preferred when it is desired that expression of the transgene should mimic the native expression. The native promoter may be used when expression of the transgene must be regulated temporally or developmentally, or in a tissuespecific manner, or in response to specific transcriptional stimuli. In a further aspect, other native expression control elements, such as enhancer elements, polyadenylation sites or Kozak consensus sequences may also be used to mimic the native expression. In yet another aspect, the regulatory sequences impart tissue-specific gene expression capabilities. In some cases, the tissue-specific regulatory sequences bind tissue-specific transcription factors that induce transcription in a tissue specific manner. Such tissue-specific regulatory sequences (e.g., promoters, enhancers, etc..) are well known in the art. In some embodiments, the tissuespecific promoter is a CNS-specific promoter. Examples of CNS- specific promoters include but are not limited to neuron-specific enolase (NSE) promoter, neurofilament light-chain gene promoter, and the neuron-specific vgf gene promoter. The methods used to construct any aspect of this disclosure are known to those with skill in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques.

[0114] A cell comprising a nucleic acid comprising the isolated nucleotide sequence or encoding the synthetic tRNA, the inhibitors, or the CNTO3 variants or a vector encoding the same is further provided. The cells may be prepared using any suitable method know in the art.

[0115] The cell disclosed herein may be engineered to express any of the nucleic acidmolecules and / or vectors described herein. In an aspect, the cell can be engineered in vitro, ex vivo, or in vitro. In some aspects, vectors, viral particles, and the like as contemplated herein may be encapsulated into a suitable delivery system for delivery to a subject. In one aspect, the cell is a mammalian cell, for example a human cell. Cells may be obtained autologously or sourced from allogeneic or universal donors.

[0116] Delivery systems may include but are not restricted to liposomes, a lipidoid, a lipoplex, a nanoparticle, a lipid nanoparticle, a polymeric compound, a peptide, a protein, a cell, a nanoparticle mimic, a nanotube, or a conjugate.VII. Compositions

[0117] Further provided herein are composition comprising the disclosed isolated nucleotide sequence, a synthetic tRNA, an engineered nucleic acid, a vector, a CNTO3 variant, or a cell of the present disclosure.

[0118] In another aspect, the current disclosure encompasses a composition that comprises an agent that changes the levels of CNOT3 in a cell or impacts CNOT3 function. In an aspect, a disclosed agent can be a small molecule, non-limiting example of which include a drug, a metal, an ion, a sugar, a nucleotide, a nucleoside, or an amino acid. In an aspect, a disclosed agent is a biomolecule, non-limiting examples of which include a polynucleotide, or a polypeptide, or derivatives thereof. In an aspect, the agent is an inhibitor that can decrease the level of CNOT3 or negatively impact its function in a cell. In an aspect, the agent is an activator, that enhances the level, or positively impacts the function of CNOT3.

[0119] In an aspect, a disclosed composition can comprise an agent that can decrease CNOT3 gene expression, or activity, or both.

[0120] The composition disclosed herein may comprise the synthetic tRNA. In another aspect, the composition may comprise the CNOT3 variant disclosed herein. In other aspects, the composition may comprise the vector comprising a nucleic acid comprising the isolated nucleotide sequence or encoding the synthetic tRNA, the inhibitors, or the CNTO3 variant. The composition may be a pharmaceutical composition, comprising isolated nucleotide sequence, a synthetic tRNA, an engineered nucleic acid, a vector, a CNTO3 variant, or a cell, and an excipient.Pharmaceutical composition(i) Pharmaceutically acceptable carriers and excipients

[0121] As used herein a “pharmaceutical composition” refers to a preparation of a disclosed composition with one or more other chemical components such as physiologically suitable carriers and excipients. The purpose of a pharmaceutical composition is to facilitateadministration of a compound to an organism.

[0122] Hereinafter, the phrases “physiologically acceptable carrier” and “pharmaceutically acceptable carrier” are interchangeably used herein to refer to a carrier or a diluent that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered compound. An adjuvant is included under these phrases.

[0123] In certain aspects, compositions disclosed herein may further compromise one or more pharmaceutically acceptable diluent(s), excipient(s), and / or carrier(s). As used herein, a pharmaceutically acceptable diluent, excipient, or carrier, refers to a material suitable for administration to a subject without causing undesirable biological effects or interacting in a deleterious manner with any of the components of the composition in which it is contained. Pharmaceutically acceptable diluents, carriers, and excipients can include, but are not limited to, physiological saline, Ringer’s solution, phosphate solution or buffer, buffered saline, and other carriers known in the art.

[0124] In some aspects, the pharmaceutical composition may comprise a delivery agent. The delivery agent is selected from a lipidoid, a liposome, a lipoplex, a nanoparticle, a lipid nanoparticle, a polymeric compound, a peptide, a protein, a cell, a nanoparticle mimic, a nanotube, and a conjugate.

[0125] In some aspects, pharmaceutical compositions herein may also include stabilizers, anti-oxidants, colorants, other medicinal or pharmaceutical agents, carriers, adjuvants, preserving agents, stabilizing agents, wetting agents, emulsifying agents, solution promoters, salts, solubilizers, antifoaming agents, antioxidants, dispersing agents, surfactants, or any combination thereof. Herein, the term “excipient” refers to an inert substance added to a pharmaceutical composition to further facilitate administration of an active ingredient. Examples, without limitation, of excipients include calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils and polyethylene glycols. Techniques for formulation and administration of drugs may be found in “Remington's Pharmaceutical Sciences,” Mack Publishing Co., Easton, Pa., latest edition, which is incorporated herein by reference.

[0126] In certain aspects, pharmaceutical compositions described herein may be formulated in conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries to facilitate processing of genetically modified endothelial progenitor cells into preparations which can be used pharmaceutically. In some aspects, any of the well- known techniques, carriers, and excipients may be used as suitable and / or as understood in the art.

[0127] In certain aspects, pharmaceutical compositions described herein may be anaqueous suspension comprising one or more polymers as suspending agents. In some aspects, polymers that may comprise pharmaceutical compositions described herein include: water-soluble polymers such as cellulosic polymers, e.g., hydroxypropyl methylcellulose; water-insoluble polymers such as cross-linked carboxyl-containing polymers; mucoadhesive polymers, selected from, for example, carboxymethylcellulose, carbomer (acrylic acid polymer), poly(methylmethacrylate), polyacrylamide, polycarbophil, acrylic acid / butyl acrylate copolymer, sodium alginate, and dextran; or a combination thereof. In some aspects, pharmaceutical compositions disclosed herein may comprise at least about 5%, at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, or at least about 50% total amount of polymers as suspending agent(s) by total weight of the composition. In some aspects, pharmaceutical compositions disclosed herein may comprise about 5% to about 99%, about 10%, about 95%, or about 15% to about 90% total amount of polymers as suspending agent(s) by total weight of the composition.

[0128] In certain aspects, pharmaceutical compositions disclosed herein may comprise a viscous formulation. In some aspects, viscosity of composition herein may be increased by the addition of one or more gelling or thickening agents. In some aspects, compositions disclosed herein may comprise one or more gelling or thickening agents in an amount to provide a sufficiently viscous formulation to remain on treated tissue. In some aspects, pharmaceutical compositions disclosed herein may comprise at least about 5%, at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, or at least about 50% total amount of gelling or thickening agent(s) by total weight of the composition. In some aspects, pharmaceutical compositions disclosed herein may comprise about 5% to about 99%, about 10%, about 95%, or about 15% to about 90% total amount of gelling or thickening agent(s) by total weight of the composition. In some aspects, suitable thickening agents for use herein can be hydroxypropyl methylcellulose, hydroxyethyl cellulose, polyvinylpyrrolidone, carboxymethyl cellulose, polyvinyl alcohol, sodium chondroitin sulfate, sodium hyaluronate. In other aspects, viscosity enhancing agents can be acacia (gum arabic), agar, aluminum magnesium silicate, sodium alginate, sodium stearate, bladderwrack, bentonite, carbomer, carrageenan, Carbopol, xanthan, cellulose, microcrystalline cellulose (MCC), ceratonia, chitin, carboxymethylated chitosan, chondrus, dextrose, furcellaran, gelatin, Ghatti gum, guar gum, hectorite, lactose, sucrose, maltodextrin, mannitol, sorbitol, honey, maize starch, wheat starch, rice starch, potato starch, gelatin, sterculia gum, xanthum gum, gum tragacanth, ethyl cellulose, ethylhydroxyethyl cellulose, ethylmethyl cellulose, methyl cellulose, hydroxyethyl cellulose, hydroxyethylmethyl cellulose, hydroxypropyl cellulose, poly(hydroxyethyl methacrylate),oxypolygelatin, pectin, polygeline, povidone, propylene carbonate, methyl vinyl ether / maleic anhydride copolymer (PVM / MA), poly(methoxyethyl methacrylate), poly(methoxyethoxyethyl methacrylate), hydroxypropyl cellulose, hydroxypropylmethyl-cellulose (HPMC), sodium carboxymethyl-cellulose (CMC), silicon dioxide, polyvinylpyrrolidone (PVP: povidone), Splenda® (dextrose, maltodextrin and sucralose), or any combination thereof.

[0129] In certain aspects, pharmaceutical compositions disclosed herein may comprise additional agents or additives selected from a group including surface-active agents, detergents, solvents, acidifying agents, alkalizing agents, buffering agents, tonicity modifying agents, ionic additives effective to increase the ionic strength of the solution, antimicrobial agents, antibiotic agents, antifungal agents, antioxidants, preservatives, electrolytes, antifoaming agents, oils, stabilizers, enhancing agents, and the like. In some aspects, pharmaceutical compositions disclosed herein may comprise at least about 5%, at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, or at least about 50% total amount of one or more agents by total weight of the composition. In some aspects, pharmaceutical compositions disclosed herein may comprise about 5% to about 99%, about 10%, about 95%, or about 15% to about 90% total amount of one or more agents by total weight of the composition. In some aspects, one or more of these agents may be added to improve the performance, efficacy, safety, shelflife and / or other property of the muscarinic antagonist composition of the present disclosure. In some aspects, additives may be biocompatible, without being harsh, abrasive, and / or allergenic.

[0130] In certain aspects, pharmaceutical compositions disclosed herein may comprise one or more acidifying agents. As used herein, “acidifying agents” refers to compounds used to provide an acidic medium. Such compounds include, by way of example and without limitation, acetic acid, amino acid, citric acid, fumaric acid and other alpha hydroxy acids, such as hydrochloric acid, ascorbic acid, and nitric acid and others known to those of ordinary skill in the art. In some aspects, any pharmaceutically acceptable organic or inorganic acid may be used. In some aspects, pharmaceutical compositions disclosed herein may comprise at least about 5%, at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50% total amount of one or more acidifying agents by total weight of the composition. In some aspects, pharmaceutical compositions disclosed herein may comprise about 5% to about 99%, about 10%, about 95%, or about 15% to about 90% total amount of one or more acidifying agents by total weight of the composition.

[0131] In certain aspects, pharmaceutical compositions disclosed herein may comprise one or more alkalizing agents. As used herein, “alkalizing agents” are compounds used to providealkaline medium. Such compounds include, by way of example and without limitation, ammonia solution, ammonium carbonate, diethanolamine, monoethanolamine, potassium hydroxide, sodium borate, sodium carbonate, sodium bicarbonate, sodium hydroxide, triethanolamine, and trolamine and others known to those of ordinary skill in the art. In some aspects, any pharmaceutically acceptable organic or inorganic base can be used. In some aspects, pharmaceutical compositions disclosed herein may comprise at least about 5%, at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50% total amount of one or more alkalizing agents by total weight of the composition. In some aspects, pharmaceutical compositions disclosed herein may comprise about 5% to about 99%, about 10%, about 95%, or about 15% to about 90% total amount of one or more alkalizing agents by total weight of the composition.

[0132] In certain aspects, pharmaceutical compositions disclosed herein may comprise one or more antioxidants. As used herein, “antioxidants” are agents that inhibit oxidation and thus can be used to prevent the deterioration of preparations by the oxidative process. Such compounds include, by way of example and without limitation, ascorbic acid, ascorbyl palmitate, butylated hydroxyanisole, butylated hydroxytoluene, hypophophorous acid, monothioglycerol, propyl gallate, sodium ascorbate, sodium bisulfite, sodium formaldehyde sulfoxylate, sodium metabisulfite and other materials known to one of ordinary skill in the art. In some aspects, pharmaceutical compositions disclosed herein may comprise at least about 5%, at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50% total amount of one or more antioxidants by total weight of the composition. In some aspects, pharmaceutical compositions disclosed herein may comprise about 5% to about 99%, about 10%, about 95%, or about 15% to about 90% total amount of one or more antioxidants by total weight of the composition.

[0133] In certain aspects, pharmaceutical compositions disclosed herein may comprise a buffer system. As used herein, a “buffer system” is a composition comprised of one or more buffering agents wherein “buffering agents” are compounds used to resist change in pH upon dilution or addition of acid or alkali. Buffering agents include, by way of example and without limitation, potassium metaphosphate, potassium phosphate, monobasic sodium acetate and sodium citrate anhydrous and dihydrate and other materials known to one of ordinary skill in the art. In some aspects, any pharmaceutically acceptable organic or inorganic buffer can be used. In some aspects, pharmaceutical compositions disclosed herein may comprise at least about 5%, at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50% total amount ofone or more buffering agents by total weight of the composition. In some aspects, pharmaceutical compositions disclosed herein may comprise about 5% to about 99%, about 10%, about 95%, or about 15% to about 90% total amount of one or more buffering agents by total weight of the composition.

[0134] In some aspects, the amount of one or more buffering agents may depend on the desired pH level of a composition. In some aspects, pharmaceutical compositions disclosed herein may have a pH of about 6 to about 9. In some aspects, pharmaceutical compositions disclosed herein may have a pH greater than about 8, greater than about 7.5, greater than about 7, greater than about 6.5, or greater than about 6.

[0135] In certain aspects, pharmaceutical compositions disclosed herein may comprise one or more preservatives. As used herein, “preservatives” refers to agents or combination of agents that inhibits, reduces or eliminates bacterial growth in a pharmaceutical dosage form. Non-limiting examples of preservatives include Nipagin, Nipasol, isopropyl alcohol and a combination thereof. In some aspects, any pharmaceutically acceptable preservative can be used. In some aspects, pharmaceutical compositions disclosed herein may comprise at least about 5%, at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50% total amount of one or more preservatives by total weight of the composition. In some aspects, pharmaceutical compositions disclosed herein may comprise about 5% to about 99%, about 10%, about 95%, or about 15% to about 90% total amount of one or more preservatives by total weight of the composition.

[0136] In certain aspects, pharmaceutical compositions disclosed herein may comprise one or more surface-acting reagents or detergents. In some aspects, surface- acting reagents or detergents may be synthetic, natural, or semi-synthetic. In some aspects, compositions disclosed herein may comprise anionic detergents, cationic detergents, zwitterionic detergents, ampholytic detergents, amphoteric detergents, nonionic detergents having a steroid skeleton, or a combination thereof. In some aspects, pharmaceutical compositions disclosed herein may comprise at least about 5%, at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50% total amount of one or more surface-acting reagents or detergents by total weight of the composition. In some aspects, pharmaceutical compositions disclosed herein may comprise about 5% to about 99%, about 10%, about 95%, or about 15% to about 90% total amount of one or more surface-acting reagents or detergents by total weight of the composition.

[0137] In certain aspects, pharmaceutical compositions disclosed herein may comprise oneor more stabilizers. As used herein, a “stabilizer” refers to a compound used to stabilize an active agent (for example a composition as disclosed herein) against physical, chemical, or biochemical process that would otherwise reduce the therapeutic activity of the agent. Suitable stabilizers include, by way of example and without limitation, succinic anhydride, albumin, sialic acid, creatinine, glycine and other amino acids, niacinamide, sodium acetyltryptophonate, zinc oxide, sucrose, glucose, lactose, sorbitol, mannitol, glycerol, polyethylene glycols, sodium caprylate and sodium saccharin and others known to those of ordinary skill in the art. In some aspects, pharmaceutical compositions disclosed herein may comprise at least about 5%, at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50% total amount of one or more stabilizers by total weight of the composition. In some aspects, pharmaceutical compositions disclosed herein may comprise about 5% to about 99%, about 10%, about 95%, or about 15% to about 90% total amount of one or more stabilizers by total weight of the composition.

[0138] In some aspects, pharmaceutical compositions disclosed herein may comprise one or more tonicity agents. As used herein, a “tonicity agents” refers to a compound that can be used to adjust the tonicity of the liquid formulation. Suitable tonicity agents include, but are not limited to, glycerin, lactose, mannitol, dextrose, sodium chloride, sodium sulfate, sorbitol, trehalose and others known to those or ordinary skill in the art. Osmolarity in a composition may be expressed in milliosmoles per liter (mOsm / L). Osmolarity may be measured using methods commonly known in the art. In some aspects, a vapor pressure depression method is used to calculate the osmolarity of the compositions disclosed herein. In some aspects, the amount of one or more tonicity agents comprising a pharmaceutical composition disclosed herein may result in a composition osmolarity of about 150 mOsm / L to about 500 mOsm / L, about 250 mOsm / L to about 500 mOsm / L, about 250 mOsm / L to about 350 mOsm / L, about 280 mOsm / L to about 370 mOsm / L or about 250 mOsm / L to about 320 mOsm / L. In some aspects, a composition herein may have an osmolality ranging from about 100 mOsm / kg to about 1000 mOsm / kg, from about 200 mOsm / kg to about 800 mOsm / kg, from about 250 mOsm / kg to about 500 mOsm / kg, or from about 250 mOsm / kg to about 320 mOsm / kg, or from about 250 mOsm / kg to about 350 mOsm / kg or from about 280 mOsm / kg to about 320 mOsm / kg. In some aspects, a pharmaceutical composition described herein may have an osmolarity of about 100 mOsm / L to about 1000 mOsm / L, about 200 mOsm / L to about 800 mOsm / L, about 250 mOsm / L to about 500 mOsm / L, about 250 mOsm / L to about 350 mOsm / L, about 250 mOsm / L to about 320 mOsm / L, or about 280 mOsm / L to about 320 mOsm / L. In some aspects, pharmaceutical compositions disclosed herein may comprise at least about 5%, at least about 10%, at least about 20%, at least about 25%, at least about 30%, at leastabout 35%, at least about 40%, at least about 45%, at least about 50% total amount of one or more tonicity modifiers by total weight of the composition. In some aspects, pharmaceutical compositions disclosed herein may comprise about 5% to about 99%, about 10%, about 95%, or about 15% to about 90% total amount of one or more tonicity modifiers by total weight of the composition.(it) Dosage formulations

[0139] In certain aspects, the present disclosure provides compositions formulated for one or more routes of administration. Suitable routes of administration may, for example, include oral, rectal, transmucosal, transnasal, intestinal, and / or parenteral delivery. In some aspects, compositions herein formulated can be formulated for parenteral delivery. In some aspects, compositions herein formulated can be formulated intramuscular, subcutaneous, intramedullary, intravenous, intraperitoneal, and / or intranasal injections.

[0140] In certain aspects, one may administer a composition herein in a local or systemic manner, for example, via local injection of the pharmaceutical composition directly into a tissue region of a patient. In some aspects, a pharmaceutical composition disclosed herein can be administered parenterally, e.g., by intravenous injection, intracerebroventricular injection, intra-cisterna magna injection, intra-parenchymal injection, or a combination thereof. In some aspects, a pharmaceutical composition disclosed herein can administered to subject as disclosed herein. In some aspects, a pharmaceutical composition disclosed herein can administered to human patient. In some aspects, a pharmaceutical composition disclosed herein can administered to a human patient via at least two administration routes. In some aspects, the combination of administration routes by be intracerebroventricular injection and intravenous injection; intrathecal injection and intravenous injection; intra-cisterna magna injection and intravenous injection; and / or intra-parenchymal injection and intravenous injection.

[0141] In certain aspects, pharmaceutical compositions of the present disclosure may be manufactured by processes well known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.

[0142] In certain aspects, pharmaceutical compositions for use in accordance with the present disclosure thus may be formulated in conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries, which facilitate processing of the active ingredients into preparations which, can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen. For injection, the active ingredients of a pharmaceutical composition herein may be formulated in aqueoussolutions, preferably in physiologically compatible buffers such as Hank's solution, Ringer's solution, physiological salt buffer, or any combination thereof.

[0143] In certain aspects, pharmaceutical compositions described herein may be formulated in the form of a nanoparticle. The nanoparticle may have a monolayer enclosing the nanoparticle core, wherein the siRNA molecule is disposed within the nanoparticle core. In an aspect, the nanoparticle core includes a solid lipid (i.e., lipid that remains solid at room temperature and body temperature) or a liquid lipid (i.e., oil, which remains liquid at room temperature and body temperature, for example, vegetable oil or a lipid extracted from human adipose tissue). In particular, aspects of the present disclosure include nanoparticles and compositions for the controlled and / or sustained release (e.g., release at a predetermined rate to maintain a certain concentration for a certain period of time) of an agent, such as a tRNA from the nanoparticle.

[0144] In certain aspects, pharmaceutical compositions described herein may be formulated for parenteral administration, e.g., by bolus injection or continuous infusion. Formulations for injection herein may be presented in unit dosage form, e.g., in ampoules or in multidose containers with optionally, an added preservative. In some aspects, compositions herein may be suspensions, solutions or emulsions in oily or aqueous vehicles, and / or may contain formulatory agents such as suspending, stabilizing and / or dispersing agents.

[0145] In certain aspects, pharmaceutical compositions herein formulated for parenteral administration may include aqueous solutions of the active preparation (e.g., a tRNA molecule) in water-soluble form. In some aspects, compositions herein comprising suspensions of the active preparation may be prepared as oily or water-based injection suspensions. Suitable lipophilic solvents and / or vehicles for use herein may include, but are not limited to, fatty oils such as sesame oil, or synthetic fatty acids esters such as ethyl oleate, triglycerides or liposomes. In some aspects, compositions herein comprising aqueous injection suspensions may contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, and / or dextran. In some aspects, compositions herein comprising a suspension may also contain one or more suitable stabilizers and / or agents which increase the solubility of the active ingredients (e.g., a tRNA molecule) to allow for the preparation of highly concentrated solutions.

[0146] In some aspects, compositions herein may comprise the active ingredient in a powder form for constitution with a suitable vehicle, e.g., sterile, pyrogen-free water-based solution, before use.

[0147] Pharmaceutical compositions suitable for use in context of the present disclosure may include compositions wherein the active ingredients can be contained in an amounteffective to achieve the intended purpose. In some aspects, a therapeutically effective amount means an amount of active ingredients (e.g., a tRNA molecule) effective to prevent, slow, alleviate or ameliorate symptoms of a disorder (e.g., liver disease) or prolong the survival of the subject being treated.

[0148] Determination of a therapeutically effective amount is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein.

[0149] For any preparation used in the methods of the present disclosure, the therapeutically effective amount or dose can be estimated initially from in vitro and cell culture assays and or screening platforms disclosed herein. For example, a dose can be formulated in animal models to achieve a desired concentration or titer. Such information can be used to more accurately determine useful doses in humans.

[0150] In some aspects, toxicity and therapeutic efficacy of the active ingredients disclosed herein can be determined by standard pharmaceutical procedures in vitro, in cell cultures or experimental animals. In some aspects, data obtained from these in vitro and cell culture assays and animal studies can be used in formulating a range of dosage for use in a human subject. In some aspects, a dosage for use herein may vary depending upon the dosage form employed and the route of administration utilized. The exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. (See e.g., Fingl, et al., 1975, in “The Pharmacological Basis of Therapeutics,” Ch. 1).

[0151] In certain aspects, dosage amounts and / or dosing intervals may be adjusted individually to brain or blood levels of the active ingredient that are sufficient to induce or suppress the biological effect (minimal effective concentration, MEC). In some aspects, the MEC for an active ingredient (e.g., a nucleic acid molecule or composition disclosed herein) may vary for each preparation but can be estimated from in vitro data. In some aspects, dosages necessary to achieve the MEC herein may depend on individual characteristics and route of administration. Detection assays can be used to determine plasma concentrations.

[0152] In certain aspects, depending on the severity and responsiveness of the condition to be treated, dosing with compositions herein can be of a single or a plurality of administrations, with course of treatment lasting from several days to several weeks or until cure is affected or diminution of the disease state is achieved.

[0153] In certain aspects, amounts of a composition herein to be administered will be dependent on the subject being treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, and the like. In some aspects, effective doses may be extrapolated from dose-responsive curves derived from in vitro or invivo test systems.

[0154] In some aspect, the pharmaceutical composition may comprise one or more active agents in addition to the compositions disclosed herein. Non limiting examples of additional active agents include but are not restricted to antibiotics, anti-pyrectics, antimicrobials, antifungals, NSAIDs, chemotherapeutic and anticancer agents.VIII. Method of treatment

[0155] The current disclosure also encompasses a method of using the disclosed isolated nucleotide, synthetic tRNA, inhibitors, CNTO3 variant, vector, cell, compositions or any combinations thereof for treatment of various diseases, disorders, or conditions in a subject in need thereof. In one aspect, the method comprises treating an mRNA-decay associated disease, obesity, a mitochondrial- associated disorder, or a metabolic disorder in a subject using compositions disclosed herein. In certain aspect, the subject is diagnosed with or is at risk of developing an mRNA-decay associated disease, obesity, a mitochondrial- associated disorder, or a metabolic disorder. The method comprises administering to a subject in need thereof an effective amount of the isolated nucleotide sequence, the synthetic tRNA, the engineered nucleic acid, the vector, the CNTO3 variant, the cell, or compositions disclosed herein.

[0156] Non-limiting examples of mRNA-decay associated disease include cystic fibrosis, muscular dystrophy, autosomal dominant polycystic kidney disease (ADOKD), ataxia telangiectasia, beta-thalassemia, factor VII deficiency, familial atrial fibrillation, hemophilia B, hepatic carnitine palmitoyltransferase 1A deficiency (CPT1A), heritable pulmonary arterial hypertension (HPAH), late infantile neuronal ceroid lipofuscinosis (LNCL), leukocyte adhesion deficiency 1 (LAD1), methylmalonic acidemia (MMA), Hurler syndrome, nephropathic cystinosis, obesity, peroxisome biogenesis disorder (PBD), renal tubular acidosis (RTA), retinitis pigmentosa (RP), Rett syndrome (RTT), spinal muscular atrophy (SMA), Stuve- Wiedemann syndrome (SMS), X-linked nephrogenic diabetes insipidus (XNDI), and Usher syndrome (USH1). Non-limiting examples of mitochondrial-associated disorder, include Leigh syndrome, MELAS syndrome, and NARP syndrome.

[0157] Non-limiting examples of nonsense-mutation associated diseases include cancer, nonsense-mutation-mediated beta-thalassemia, Nonsense-Mutation-Mediated Ehlers-Danlos syndrome, Nonsense-Mutation-Mediated Severe myoclonic epilepsy of infancy, Nonsense- Mutation-Mediated achromatopsia, Nonsense-Mutation-Mediated retinitis pigmentosa, Nonsense-Mutation-Mediated Usher Syndrome Type 1C, Nonsense-Mutation- Mediated Adducted thumb-clubfoot syndrome, Nonsense-Mutation-Mediated Alagille syndrome, Nonsense-Mutation-Mediated Alstrdm syndrome, Nonsense-Mutation-Mediated antithrombin deficiency, Nonsense-Mutation-Mediated Carney complex, Nonsense-Mutation-Mediated Currarino syndrome, Nonsense-Mutation-Mediated Diamond-Blackfan anemia, Nonsense-Mutation-Mediated erythropoietic protoporphyria, Nonsense-Mutation-Mediated Fabry disease, Nonsense-Mutation-Mediated factor XIII deficiency, Nonsense-Mutation-Mediated Fanconi-Bickel syndrome, Nonsense-Mutation-Mediated fish odor syndrome, Nonsense-Mutation- Mediated Gaucher disease, Nonsense-Mutation-Mediated Hereditary hemorrhagic telangiectasia, Nonsense-Mutation-Mediated homocystinuria, Nonsense-Mutation-Mediated Joubert syndrome and related disorders, Nonsense-Mutation- Mediated Krabbe disease, Nonsense-Mutation-Mediated L-2-hydroxyglutaric aciduria, Nonsense-Mutation-Mediated MethylMalonic academia, Nonsense-Mutation- Mediated Niemann-Pick disease, Nonsense-Mutation-Mediated Peters plus syndrome, Nonsense-Mutation-Mediated Townes-Brocks disease, Nonsense-Mutation- Mediated von Willebrand disease, Nonsense-Mutation-Mediated Wiskott-Aldrich syndrome, Nonsense-Mutation-Mediated Kabuki syndrome, Nonsense-Mutation-Mediated Chanarin-Dorfman syndrome, Nonsense-Mutation-Mediated Lecithimcholesterol acyltransferase deficiency / fish-eye disease, Nonsense-Mutation-Mediated MarfanSyndrome, Nonsense-Mutation-Mediated Mucopolysaccharidiosis, Nonsense-Mutation- mediated Amyloidiosis, Nonsense-Mutation-Mediated Late Infantile Neuronal Ceroid Lipofuscinosis, Nonsense-Mutation-Mediated coenzyme Q10 Deficiency, Nonsense- Mutation-Mediated Peroxisome biogenesis disorders, Nonsense-Mutation-Mediated lysosomal storage disorders, Nonsense-Mutation-Mediated colorectal cancer, Nonsense-Mutation-Mediated congenital enteropeptidase deficiency, Nonsense- Mutation-Mediated Cystic Fibrosis, Nonsense-Mutation-Mediated Hungarian Peutz-Jeghers Syndrome, Nonsense-Mutation-Mediated Jervell and Lange-Nielsen syndrome, Nonsense- Mutation-Mediated Lynch syndrome, Nonsense-Mutation-Mediated microvillus inclusion disease, Nonsense-Mutation-Mediated Peutz-Jeghers syndrome, Nonsense- Mutation-Mediated xanthinuria, Nonsense-Mutation-Mediated Acidosis, Nonsense-Mutation- Mediated Alport syndrome, Nonsense-Mutation-Mediated Bardet-Biedl syndrome, Nonsense-Mutation-Mediated Birt-Hogg-Dube syndrome, Nonsense-Mutation- Mediated Dent's disease, Nonsense-Mutation-Mediated Gitelman syndrome, Nonsense- Mutation-Mediated Hereditary leiomyomatosis and renal cell cancer, Nonsense-Mutation- Mediated hereditary spherocytosis, Nonsense-Mutation-Mediated leber congenital amaurosis, Nonsense-Mutation-Mediated Lysinuric protein intolerance, Nonsense-Mutation- Mediated Nephronophthisis, Nonsense-Mutation-Mediated polycystic kidney disease, Nonsense-Mutation-Mediated pseudohypoaldosteronism, Nonsense- Mutation-Mediated renal hypodysplasia, Nonsense-Mutation-Mediated Sporadic clear cellrenal cell carcinoma, Nonsense-Mutation-Mediated type 2 papillary renal cell cancers, Nonsense-Mutation-Mediated Urofacial syndrome, Nonsense-Mutation-Mediated von Hippel-Lindau disease, Nonsense-Mutation-Mediated Wilms' tumor, Nonsense-Mutation-Mediated X-linked Alport syndrome, Nonsense-Mutation- Mediated X-linked hypophosphatemic rickets, Nonsense-Mutation-Mediated Hyperuricaemic nephropathy (juvenile / medullary cystic kidney disease), Nonsense-Mutation- Mediated Tuberous sclerosis, Nonsense-Mutation-Mediated Nephrotic syndrome / congenital nephrotic syndrome, Finnish type Nonsense-Mutation-Mediated Nephrotic syndrome, steroid resistant Nonsense-Mutation-Mediated Nephrotic syndrome 3, early onset Nonsense- Mutation-Mediated Nephrotic syndrome / Pierson syndrome, Nonsense-Mutation- Mediated Denys-Drash syndrome, Nonsense-Mutation-Mediated Nephrotic syndrome / Schimke immuno-osseous dysplasia, Nonsense-Mutation-Mediated Primary glucocorticoid resistance, Nonsense-Mutation-Mediated X-linked hypophosphatemia, Nonsense-Mutation-Mediated Primary hyperoxaluria type 1, Nonsense- Mutation-Mediated pseudohypoaldosteronism type 1 , Nonsense-Mutation-Mediated proximal renal tubular acidosis, Nonsense-Mutation-Mediated Abetalipoproteinemia and Homozygous Familial Hypobetalipoproteinemia, Nonsense-Mutation-Mediated Alpers syndrome, Nonsense-Mutation-Mediated carbamyl phosphate synthetase I deficiency, Nonsense-Mutation-Mediated Cholesteryl Ester Storage Disease, Nonsense- Mutation-Mediated citrin deficiency, Nonsense-Mutation-Mediated Dubin-Johnson syndrome, Nonsense-Mutation-Mediated erythropoietic protoporphyria, Nonsense-Mutation- Mediated Factor V deficiency, Nonsense-Mutation-Mediated Glycogen storage disease, Nonsense-Mutation-Mediated Hemophilia A (factor VIII Deficiency), Nonsense-Mutation-Mediated Hemophilia B (factor IX Deficiency), Nonsense- Mutation-Mediated hepatocellular carcinoma, Nonsense-Mutation-Mediated Hepatoerythropoietic porphyria, Nonsense-Mutation-Mediated hereditary spastic paraplegias, Nonsense-Mutation-Mediated Hypobetalipoproteinemia, Nonsense-Mutation- Mediated Inherited factor XI deficiency, Nonsense-Mutation-Mediated Maturity-onset diabetes of the young, Nonsense-Mutation-Mediated microcytic anemia and iron deficiency, Nonsense-Mutation-Mediated mitochondrial DNA depletion, Nonsense-Mutation- Mediated mitochondrial DNA depletion syndrome, Nonsense-Mutation- Mediated phenylketonuria, Nonsense-Mutation-Mediated polycystic liver disease, Nonsense- Mutation-Mediated porphyria cutanea tarda, Nonsense-Mutation-Mediated progressive familial intrahepatic cholestasis, Nonsense-Mutation-Mediated Wilson Disease, Nonsense- Mutation-Mediated autosomal dominant hypercholesterolemia, Nonsense-Mutation- Mediated factor XII Deficiency, Nonsense-Mutation-Mediated factor X Deficiency, Nonsense- Mutation-Mediated hypofibrinogenaemia, Nonsense-Mutation-Mediated Afibrinogenaemia, Nonsense-Mutation-Mediated factor VII deficiency, Nonsense- Mutation-Mediated agammaglobulinemia, Nonsense-Mutation-Mediated amegakaryocytic thrombocytopenia, Nonsense-Mutation-Mediated dyserythropoietic anemia type II, Nonsense-Mutation-Mediated Duchenne and Becker Muscular Dystrophy, Nonsense- Mutation-Mediated Centronuclear myopathies, Nonsense-Mutation-Mediated limb girdle muscular dystrophy or Miyoshi myopathy, Nonsense-Mutation- Mediated Ullrich disease, Nonsense-Mutation-mediated Spinal muscular atrophy, Nonsense- Mutation-Mediated dystrophic epidermolysis bullosa, Nonsense-Mutation-Mediated Hailey- Hailey Disease, Nonsense-Mutation-Mediated Herlitz junctional epidermolysis bullosa, and Nonsense-Mutation-Mediated Netherton syndrome.

[0158] Thus, aspects of the present disclosure encompass a method for treating a subject in need thereof. The terms “treat,” "treating," or "treatment" as used herein, refers to the provision of medical care by a trained and licensed professional to a subject in need thereof. The medical care may be a therapeutic treatment, and / or a prophylactic or preventative measure. The object of therapeutic and prophylactic treatments is to prevent or slow down (lessen) an undesired physiological change or disease / disorder. Beneficial or desired clinical results of therapeutic or prophylactic treatments include, but are not limited to, alleviation of symptoms, diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, a delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable. “Treatment” can also mean prolonging survival as compared to expected survival if not receiving treatment. Those in need of treatment include those already with the disease, condition, or disorder as well as those prone to have the disease, condition or disorder or those in which the disease, condition or disorder is to be prevented.

[0159] The actual dosage amount of a composition of the present disclosure administered to an animal or a patient can be determined by physical and physiological factors such as body weight, severity of condition, the type of disease being treated, previous or concurrent therapeutic interventions, idiopathy of the patient and on the route of administration. The practitioner responsible for administration will, in any event, determine the concentration of active ingredient(s) in a composition and appropriate dose(s) for the individual subject. The effective dose may be either one or multiple doses, and are sufficient to produce the desired therapeutic effect.

[0160] Any suitable mode of administration can be used to administer the compositions provided herein in a subject in need thereof. Exemplary modes include, but are not limited to, intravenous injection. Other modes include, without limitation, intratumoural, intradermal, subcutaneous, intramuscular (i.m.), intraperitoneal (i.p.), intraarterial, intramedullary,intracardiac, intra-articular (joint), intrasynovial (joint fluid area), intracranial, intraspinal, and intrathecal (spinal fluids). Any known device useful for parenteral injection of infusion of the formulations can be used to affect such administration.

[0161] Methods described herein are generally performed on a subject in need thereof. A subject in need of the therapeutic methods described herein can be a subject having, diagnosed with, suspected of having, or at risk for developing for example a mRNA decay associated disorder, or condition. A determination of the need for treatment will typically be assessed by a history, physical exam, or diagnostic tests consistent with the disease or condition at issue. Diagnosis of the various conditions treatable by the methods described herein is within the skill of the art.

[0162] The subject can be an animal subject, including a mammal, such as horses, cows, dogs, cats, sheep, pigs, mice, rats, monkeys, hamsters, guinea pigs, and humans or chickens. For example, the subject can be a human subject.

[0163] The amount of a composition described herein that can be combined with a pharmaceutically acceptable carrier to produce a single dosage form will vary depending upon the host treated and the particular mode of administration. It will be appreciated by those skilled in the art that the unit content of agent contained in an individual dose of each dosage form need not in itself constitute a therapeutically effective amount, as the necessary therapeutically effective amount could be reached by administration of a number of individual doses.

[0164] Toxicity and therapeutic efficacy of compositions described herein can be determined by standard pharmaceutical procedures in cell cultures or experimental animals for determining the LD50 (the dose lethal to 50% of the population) and the ED50, (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index that can be expressed as the ratio LD50 / ED50, where larger therapeutic indices are generally understood in the art to be optimal.

[0165] The specific therapeutically effective dose level for any particular subject will depend upon a variety of factors including the disorder being treated and the severity of the disorder; the activity of the specific compound employed; the specific composition employed; the age, body weight, general health, sex and diet of the subject; the time of administration; the route of administration; the rate of excretion of the composition employed; the duration of the treatment; drugs used in combination or coincidental with the specific compound employed; and like factors well known in the medical arts. For example, it is well within the skill of the art to start doses of the composition at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved. Ifdesired, the effective daily dose may be divided into multiple doses for purposes of administration. Consequently, single dose compositions may contain such amounts or submultiples thereof to make up the daily dose. It will be understood, however, that the total daily usage of the compounds and compositions of the present disclosure will be decided by an attending physician within the scope of sound medical judgment.

[0166] In some aspects, the administration of the isolated nucleotide sequence, the synthetic tRNA, the engineered nucleic acid, the vector, the CNTO3 variant, the cell, or compositions disclosed herein results in reduction of one or more symptoms in the subject by at least about 10%, e.g., 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or above, as compared to subject before administration (baseline) or a control subject not receiving the treatment.

[0167] The method disclosed herein may further comprise administering additional active agents to the subject. Non limiting examples of additional active agents include but are not restricted to antibiotics, anti-pyrectics, antimicrobials, antifungals, NSAIDs, and drugs related to treatment of neurodegenerative disorder.IX. Method of modulating mRNA stability or half-life

[0168] The disclosure further encompasses a method of modulating half-life of a target mRNA in a cell. In one aspect the method comprising delivering an inhibitor of that reduces the expression, level or activity of CNOT3. In one aspect, the inhibitor is an sgRNA. The sgRNA has a sequence at least 80% identical to any one of GAGGGACCAAATCAAGACAT (SEQ ID NO: 1) or TCTTGCGGATGGCGTCAACG (SEQ ID NO: 2). In further aspects, the method comprises delivering a synthetic tRNA. The synthetic tRNA comprises a U13:A22:A46 triplet, an extra nucleotide preceding the GG motif at positions 18:19, or an extra nucleotide in a D-loop a element of the tRNA.

[0169] In certain aspects, the disclosure further provides a method of modulating half-life of a target mRNA in a cell. The method comprises engineering the cell to express a modified target mRNA having a sequence modification relative to a wild-type target mRNA, wherein the sequence modification adds at least one subsequence to the DNA sequence encoding the target mRNA, that modifies the half-life of a target mRNA in the cell. Any suitably methods generally known in the art can be used for modifying the target mRNA.

[0170] Modification can enhance the half-life or the stability of a target mRNA. In such aspects, specific one or more arginine codons CGC, AGA, or CGU are added to the DNA sequence encoding the target mRNA to decrease CNOT3 recruitment and / or mRNA degradation. In another aspect, one or more codons encoding asparagine, lysine, isoleucine,tyrosine, phenylalanine, methionine, and threonine (ACU) are added to at least one subsequence to the DNA sequence encoding the target mRNA, to enhance the stability or half-life of the target mRNA. The codons encoding asparagine, lysine, isoleucine, tyrosine, phenylalanine, methionine, and threonine include AAT, AAC, AAA, AAG, ATT, ATC, ATA, TAT, TAG, TTT, TTC, ATG, or ACU.

[0171] In another aspect, the method of enhancing half-life of a target mRNA or stability of a target mRNA comprises using a synthetic tRNA. The method may comprise modifying a cell to express the synthetic tRNA. The synthetic tRNA comprises a sequence modification comprising an extra nucleotide in a D-loop a element of the tRNA, an extra nucleotide preceding a GG motif at position 18:19, or a modification to a D-arm or anticodon stem of the tRNA.

[0172] The method of enhancing half-life of a target mRNA or stability of a target mRNA, in alternative aspect, comprises using the isolated nucleotide sequence encoding the tRNA disclosed herein. The method may comprise modifying a cell to express the isolated nucleotide sequence encoding the tRNA. In such aspects, the isolated nucleotide sequence encoding the tRNA may be a polynucleotide comprising a sequence that has at least 60%, 70%, 75%, 80%, 85%, 90%, 95, or 99% sequence identity to sequence set forth in SEQ ID NOs: 57, 62, 63, and any combinations thereof. The isolated nucleotide sequence encoding the tRNA may be a polynucleotide comprising a sequence with 100% sequence identity to sequence set forth in SEQ ID NOs: 57, 62, 63, and any combinations thereof.

[0173] The method to enhance half-life of a target mRNA or stability of a target mRNA may comprise using an inhibitor of CNOT3. The method may comprise modifying a cell to express the inhibitor. The nucleic acid inhibitor may be a cluster regularly interspaced short palindromic repeats (CRISPR) related nucleic acid for example a single guide RNA (sgRNA), a CRISPR- RNA (crRNA), or a trans-activating crRNA (tracrRNA) or combination thereof. In an aspect, the CRISPR related nucleic disrupts or is designed to disrupt the CNOT3 gene. In an aspect, the CRISPR related nucleic disrupts or is designed to disrupt the CNOT3 gene. In an aspect, the CRISPR related nucleic acid is a sgRNA or a crRNA. In an aspect, the sgRNA or crRNA comprises a nucleic acid sequence having at least 80% (e.g., about 80%, about 85%, about 90%, about 95%, or about 99%) identity with GAGGGACCAAATCAAGACAT (SEQ ID NO: 1) or TCTTGCGGATGGCGTCAACG (SEQ ID NO: 2).

[0174] The method to enhance half-life of a target mRNA or stability of a target mRNA, in another aspect, comprises using the variant CNOT3 disclosed herein. The method may comprise modifying a cell to express the variant CNOT3. The variant CNOT3 may comprise a modification at amino acid residue 105 relative to the amino acid sequence set forth in SEQID NO: 327. In a specific aspect, the variant may comprise a substitution selected from the group consisting of K105S, R59S, and E95A relative to the amino acid sequence set forth in SEQ ID NO: 327. The variant CNOT3 may comprise an amino acid sequence at least 80% identical to the sequence set forth in SEQ ID NO: 327.

[0175] The method disclosed herein may result in enhancement of stability of the target mRNA or increase in the half-life of the target mRNA by about 5% to about 99% (e.g., about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%).

[0176] In an alternative aspect, modification can decrease the half-life or the stability of a target mRNA. In such aspects, specific arginine codons CGG, CGA, and AGG is added to the DNA sequence encoding the target mRNA to promote CNOT3 recruitment and / or mRNA degradation. The method comprises engineering a cell to express a modified target mRNA having a sequence modification relative to a wild-type target mRNA, wherein the sequence modification adds at least one subsequence to the DNA sequence encoding the target mRNA, that decreases the half-life of a target mRNA in the cell, wherein the modifications comprise adding arginine codons CGG, CGA, and AGG.

[0177] The method of decreasing half-life or the stability of the target mRNA may comprise using a synthetic tRNA comprising a sequence modification that increases CNOT3 recruitment to the ribosome and / or increases the decay of the target mRNA. In such aspects, the nucleotide sequence comprises a U13:A22:A46 triplet. The method comprise modifying a cell to express the synthetic tRNA.

[0178] In some aspects, the method of decreasing half-life orthe stability of the target mRNA may comprise using isolated nucleotide sequence encoding a polynucleotide comprising a sequence that has at least 60%, 70%, 75%, 80%, 85%, 90%, 95, or 99% sequence identity to sequence set forth in SEQ ID NOs: 55, 58, 59, 60, 64, 65, 66, 68, and any combinations thereof. The synthetic tRNA may comprise a polynucleotide comprising a sequence with 100% sequence identity to sequence set forth in SEQ ID NOs: 55, 58, 59, 60, 64, 65, 66, 68, and any combinations thereof. The method may comprise modifying a cell to express the isolated nucleotide sequence.

[0179] The method of decreasing the half-life orthe stability of a target mRNA may decrease the half-life or the stability of a target mRNA by about 5% to about 99% (e.g., about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%).

[0180] In some aspects, the isolated nucleotide sequence, the synthetic tRNA, the engineered nucleic acid, the vector, the CNTO3 variant, or the cell of the present disclosure can further used in an in vitro system for modulating the half-life or the stability of a target mRNA. Such systems may also be used for determining a drug efficacy or toxicity. In such aspects, the methods and / or in vitro culture systems comprising the isolated nucleotide sequence, the synthetic tRNA, the engineered nucleic acid, the vector, the CNTO3 variant, or the cell as described herein may be used to determine whether a candidate molecule (e.g., a compound, or a drug) is capable of altering the stability or half-life of a target mRNA in the in vitro system.X. Kits

[0181] Described herein is a kit comprising the isolated nucleotide sequence, the synthetic tRNA, the engineered nucleic acid, the vector, the CNTO3 variant, or the cell. The kit may further comprise instructions to perform the methods described herein.

[0182] The kit may include one or more containers comprising the the isolated nucleotide sequence, the synthetic tRNA, the engineered nucleic acid, the vector, the CNTO3 variant, or the cell described herein. The kit may further include a second therapeutic agent. The kit may further comprise suitable administration means like syringes, intravenous drip apparatus etc. Suitable containers include, for example, bottles, vials, syringes, assay plates, strips, matrices etc. The containers may be formed from a variety of materials such as glass, plastic, paper etc. The kit may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, and syringes.

[0183] The kit may further include a label or a package insert. The label or the package insert may comprise instructions for use and other information customarily included in commercial packages. Instructions may be printed on paper or other substrate, and / or may be supplied as an electronic-readable medium or video. Detailed instructions may not be physically associated with the kit; instead, a user may be directed to an Internet web site specified by the manufacturer or distributor of the kit. Said instructions may be derived from any of the methods as described herein

[0184] The kit may also include reagents in separate containers such as, for example, sterile water or saline to be added to a lyophilized active component packaged separately. For example, sealed glass ampules may contain a lyophilized component and in a separate ampule, sterile water, sterile saline or sterile each of which has been packaged under a neutral non-reacting gas, such as nitrogen. Ampules may consist of any suitable material, such as glass, organic polymers, such as polycarbonate, polystyrene, ceramic, metal or any othermaterial typically employed to hold reagents. Other examples of suitable containers include bottles that may be fabricated from similar substances as ampules, and envelopes that may consist of foil-lined interiors, such as aluminum or an alloy. Other containers include test tubes, vials, flasks, bottles, syringes, and the like. Containers may have a sterile access port, such as a bottle having a stopper that can be pierced by a hypodermic injection needle. Other containers may have two compartments that are separated by a readily removable membrane that upon removal permits the components to mix. Removable membranes may be glass, plastic, rubber, and the like.EXAMPLES

[0185] The present invention has multiple aspects, illustrated by the following non-limiting examples.

[0186] Selective ribosome profiling was undertaken in human cells to determine the features of mRNAs whose translation leads to CNOT3 recruitment to ribosomes. It was found that the strongest determinant of CNOT3 recruitment was not the decoding efficiency of the codon in the ribosomal A-site, but rather the identity of the codon in the P-site. The presence of select arginine codons in the P-site were particularly strong signals for CNOT3 association, while codons specifying several other amino acids were depleted from the P-site of CNOT3-bound ribosomes. High-resolution cryo-electron microscopy (cryo-EM) structures of CNOT3-bound human ribosomes revealed that these effects were attributable to direct interactions between CNOT3 and the D-arm of the P-site tRNA, which promote or prevent accommodation of CNOT3 in the vacant ribosomal E-site. These findings demonstrate that, in addition to their canonical role in decoding, tRNAs recruit post-transcriptional regulators to translating ribosomes, uncovering a P-site tRNA-mediated mRNA decay (PTMD) pathway.Methods and materials

[0187] Cell culture: Cell lines were obtained from American Type Culture Collection (ATCC). HEK293T cells were cultured in Dulbecco's Modified Eagle's Medium (DM EM) (Invitrogen) supplemented with 10% (v / v) fetal bovine serum (Sigma) and 1 xAntibiotic- Antimycotic (Invitrogen). Jurkat cells were cultured in RPMI1640 (Invitrogen) supplemented with 10% (v / v) fetal bovine serum (Sigma) and I xAntibiotic-Antimycotic (Invitrogen). Cell lines were confirmed to be free of mycoplasma contamination.

[0188] Sucrose gradient fractionation of ribosomes: 2x 1 Q7HEK293T cells were lysed in 500 pL ice-cold lysis buffer [20 mM Tris-HCI (pH 7.5), 150 mM KCI, 15 mM MgCI2, 1 mM DTT, 1 % Triton X-100, 200 U / rnL RNase inhibitor (RNasin, Promega, N2515), I xprotease inhibitor cocktail (complete, EDTA-free, Roche)]. Lysate was clarified by centrifugation at 16,000 g at4° C for 10 minutes. 400 pL lysate was loaded onto a 5- 50% sucrose gradient containing 20 mM Tris-HCI (pH 7.5), 150 mM KCI, 5 mM MgCI2, and 1 xEDTA-free Protease Inhibitor Cocktail, followed by centrifugation at 40,000 rpm at 4° C for 2 hours using a TH-641 rotor (ThermoFisher Scientific). For RNase-treated samples, 500 pL lysate containing 200 pg RNA was digested with 2 pg RNase A at room temperature for 15 minutes prior to loading onto the gradient. For sucrose gradient fractionation of in vitro translation reactions, 5-50% sucrose gradients containing 20 mM HEPES (PH7.5), 100 mM KCI, 5 mM MgCI2, and 1 xEDTA-free protease inhibitor cocktail were used. Samples were fractionated on a Piston Fractionator (BioComp).

[0189] CNOT3-monosome immunoprecipitation: Sucrose gradient fractionation of RNase A-treated HEK293T lysate was performed as described above. The monosome fractions were collected and combined. 10 pg CNOT3 antibody (ProteinTech, 11135-1-AP) or M2 flag antibody (Sigma, F3165) was coupled with 100 pL DynaBeads protein G (ThermoFisher Scientific, 10003D). The combined monosome fraction was incubated with the antibody-coupled beads at 4° C with slow rotation for 1 hour. Rabbit or mouse normal IgG was used as the IP negative control. Beads were washed 4 times with ice-cold wash buffer [20 mM Tris-HCI (pH 7.5), 150 mM KCI, 15 mM MgCI2, 1% Triton-X100, and 1 xEDTA-free protease inhibitor], followed by elution with I xNuPAGE LDS Sample Buffer (ThermoFisher Scientific, NP0008), and analysis by western blotting. RPS25 antibody (Novus Biologicals, NBP1- 80802), RPL5 antibody (Abeam, ab157099), CNOT3 antibody (ProteinTech, 11135-1-AP), and M2 Flag antibody (Sigma, F3165) were used for western blotting.

[0190] CNOT3-selective ribosome profiling: Approximately 6x107HEK293T cells in 15- cm dishes were harvested by scraping, washed with ice-cold PBS, and incubated in 3 mL of lysis buffer [20 mM Tris-HCI (pH 7.5), 150 mM KCI, 15 mM MgCI2, 1 mM DTT, 1% Triton- Xi 00, and 1 xEDTA-free protease inhibitor] on ice for 15 minutes. Lysate was clarified by centrifugation at 20,000 g at 4° C for 5 minutes and RNA concentration was measured by Nanodrop. 3 mL lysate containing 2 mg total RNA was incubated with 1660 U RNase I (ThermoFisher Scientific, AM2295) at 4° C with gentle shaking for 5 minutes. Digested lysate was loaded on a 10%-35% sucrose gradient containing 20 mM Tris-HCI (pH 7.5), 150 mM KCI, 5 mM MgCI2, and 1 xEDTA-free Protease Inhibitor Cocktail, and centrifuged in a TH-641 rotor at 40,000 rpm at 4° C for 2 hours. Monosome fractions were collected and combined. 600 U SUPERasedn RNase Inhibitor (ThermoFisher Scientific, AM2694) and 400U RNase inhibitor RNasin (Promega) were added to the monosome fraction. 100 pL of the monosome fraction was saved for isolation of total ribosome footprints (input), and 3 mL of the monosome fraction was used for CNOT3-IP.

[0191] 20 pg of CNOT3 antibody (ProteinTech, 11135-1-AP) was incubated with themonosome fraction at 4° C for 2 hours with gentle nutation, followed by addition of 200 pL DynaBead- Protein G and incubation at 4° C for 2 hours. Beads were washed 4 times with wash buffer [20 mM Tris-HCI (pH 7.5), 150 mM KCI, 15 mM MgCI2, 1% Triton-X100, and 1 xEDTA-free protease inhibitor]. During the last wash, resuspended beads were transferred to a new microcentrifuge tube. Ribosomal footprints were isolated using the Direct-zol RNA miniprep cleanup kit (Zymo Research, R2050). The footprint library was generated and sequenced as described previously with the following modifications:(1) Ribosome footprints were size selected by gel electrophoresis as described previously and fragments between 17-35 nt were excised for library preparation.(2) Samples were not pooled after linker ligation, and the subsequent steps were performed individually for each sample.(3) 3' linker-ligated RNA fragments were purified using gel extraction as previously described.(4) Ribosomal RNA was depleted as described previously.(5) n=2 biological replicates were performed.

[0192] The significantly enriched footprints in CNOT3-IP samples (FDR<0.01), mapped to -7000 loci of human genome, were used to calculate the enrichment (relative to all input footprints) of each codon at E, P, or A-site.

[0193] CRISPR-Cas9 mediated gene knockout. The sgRNAs targeting human CNOT3, as well as non-target (NT) sgRNAs (sequences provided in Table 1B), were cloned into the lentiCRISPR_v2 vector (Addgene #52961) as previously described. Lentivirus was packaged in HEK293T cells as described previously. Two days after lentiviral transduction, cells were selected in medium containing 0.5 pg / mL puromycin for 6 days before analysis.Table 1A: PCR primer sequencesTable 1B: sgRNA sequencesTable 1C: Probes for Northern BlottingTable 1D: Oligonucleotide sequences for generation of 41Xrepeat or 73X repeat mRNAsTable 1E: Synthesized DNA fragmentsTable 1F: tRNA oligonucleotides

[0194] Measurement of mRNA half-life by SLAM-seq: SLAMseq Kinetics Kit-Catabolic Kinetics Module (Lexogen, 062.24) was used for SLAM-seq. Cells were transduced with lentiCRISPR_v2 expressing negative control guides (sgNT1 and sgNT2) or guides targeting CNOT3 (sgCNOTS- and sgCNOT3-2), selected in puromycin for four days, and seeded into 6- well plates coated with poly-D-lysine. 24 hours later, cells were incubated with 75 pM 4-Sll for 24 hours, during which media was exchanged every 3 hours, to label newly synthesized RNA. Cells were then washed 2 times with PBS, and fresh medium containing 10 mM UTP was added to stop labelling. Cells were harvested at 0, 1 , 2, 4, 8, 12 hours after UTP addition. Total RNA was isolated and treated with IAA according to the SLAMseq Kinetics Kit manufacturer’s instructions. SLAM-seq libraries were constructed using the QuantSeq 3' mRNA-Seq V2 Library Prep Kit FWD with UDI 12 nt Set B1 (Lexogen, 192.24). Reads were aligned to human genome assembly GRCh38 and analyzed as described previously.

[0195] Measurement of reporter mRNA stability. The 42xRCGG / CGA / AGG and 42xcontrol gene fragments were synthesized by IDT (sequences provided in Table 1 D). The EGFP sequence in tetOFF-EGFPf37035between the Kpnl and Pmll sites was excised and replaced with the 42XRCGG / CGA / AGG or 42xcontrol fragments. The resulting plasmids, together with pCMV- hyPBase plasmid which encodes the piggyBac transposase, were co-transfected into HEK293T cells, and cells were selected in medium with 5 pg / mL blasticidin (ThermoFisher Scientific) for 21 days to generate stable cell lines. To measure mRNA stability, cells were treated with 1 pg / mL doxycycline (Sigma) for 0, 2, 4, or 6 hours. qRT-PCR was performed to assess reporter mRNA abundance relative to GAPDH mRNA at each time point.

[0196] qRT-PCR: Total RNA was isolated with the RNeasy Mini kit (QIAGEN). cDNA was synthesized from 1 pg total RNA using PrimeScript RT Master Mix (Clontech). qRT-PCR was performed with the Power SYBR™ Green Master Mix (ThermoFisher Scientific). mRNA expression was normalized to GAPDH mRNA. The sequences of all qRT-PCR primers are from PrimerBank. Primer sequences are provided in Table 1A.

[0197] Western blotting: Cells were lysed in RIPA buffer. Lysate was cleared by centrifugation and supplemented with I XNUPAGE LDS Sample Buffer. For analysis of proteins in sucrose gradient fractions from cell lysates, proteins were precipitated using trichloroacetic acid (TCA) and resuspended in I xNuPAGE LDS Sample Buffer (Invitrogen). For analysis of proteins in sucrose gradient fractions from in vitro translation reactions, proteins were precipitated using the High Efficiency Protein Precipitation Kit (Invent, WA-006). Proteins were separated by SDS-PAGEelectrophoresis, transferred to nitrocellulose membranes (0.25 pm, ThermoFisher Scientific), and detected using an infrared fluorescent antibody detection system (LI-COR).

[0198] Measurement of mitochondrial translation. The 1 xio6Jurkat cells were washed 3 times with methionine-free medium, followed by incubation in methionine-free medium containing 10% FBS and 100 pg / mL anisomycin for 30 minutes to block cytosolic translation. 500 pM HPG (ThermoFisher Scientific, C10186) was then added, followed by an additional 30 minute incubation. Media was then replaced with ice-cold buffer A containing 10 mM HEPES, 10 mM NaCI, 5 mM KCI, 10% sucrose, and 0.005% digitonin, for 2 minutes on ice, followed by 15 seconds in buffer A without digitonin. Cells were fixed by adding 4% PFA in PBS for 30 minutes at room temperature. After fixation, cells were washed with PBS for 5 minutes, then quenched with 150 mM glycine in PBS for 15 minutes. Cells were blocked and permeabilized in staining solution (5% BSA and 0.1 % Triton X-100 in PBS) (three solution changes, 5 minutes for each). After a brief wash with 3% BSA in PBS, cells were click labeled with 5 pM ATTO 488-azide (sigma) for 20 minutes using Click-iT Cell Reaction Buffer Kit (ThermoFisher Scientific). After a quick wash with Intercept (PBS) blocking buffer (LI-COR), cells were incubated with TOM20 antibody [Santa Cruz, 1 :200 dilution in Intercept (PBS) blocking buffer] at 4° C for 1 hour, and then anti-mouse AF647 (ThermoFisher Scientific, 1 :1000 dilution in Intercept (PBS) blocking buffer] at 4° C for 30 minutes. Cells were then stained with DAPI diluted in Intercept (PBS) blocking buffer for 5 minutes at room temperature. After three washes with 3% BSA in PBS, cells were resuspended in 20 pl mounting medium (SlowFade™ Diamond Antifade Mountant with DAPI, ThermoFisher Scientific, S36968), and transferred to a slide, and imaged on a Zeiss LSM980 confocal microscope.

[0199] Measurement of mitochondrial content by Mito Tracker. 1 x106cells were collected in a microcentrifuge tube and washed with PBS twice. Cells were resuspended in 1 mL PBS, stained with Mito Tracker (ThermoFisher Scientific, M7574) according to the manufacturer’s instructions, and analyzed using and Accuri C6 Flow Cytometer (BD Biosciences).

[0200] Preparation of mRNAs for in vitro translation: Method of generation of DNA template for in vitro transcription is as follows:(1) The plasmid XLone-GFP (Addgene #96930) was modified such that it carried a cassette consisting of a T7 promoter and Kozak sequence, followed by Drain and Blpl sites, creating plasmid XLone-T7. A similar plasmid with a T7 promoter, Kozak sequence, and HA-tag, followed by Drain and Blpl sites, termed XLone-T7-HA, was also generated. Sequences of T7 and T7-HA cassettes provided in Table 1A-1 F.(2) 41 x|_RCGGD, 41 x|_RCGAD, 41 x|_RCGUD, 41 xLKAAAD, 41 xLKAAGD, and 41 XLMAUGD DNA templates were generated using a method we developed, called “repeat PCR- ligation extension”. Briefly, oligos containing a BsrD1 site, followed by six copies of each repeat, followed by a BseR1 site, were synthesized. Each oligo was cloned into the Drain and Blpl sites in XLone-T7 using the NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs, E2621 L). The sequence from the T7 promoter to 31 bp downstream of the Blp1 site was amplified by PCR with Q5 High-Fidelity DNA Polymerase (New England Biolabs, M0491 L) using primers T7-F1 and T7-R1 (all oligonucleotide sequences provided in Tables 1A-1F). Half of the PCR product was digested with BsrD1 followed by purification of the 3' fragment, and the other half of the PCR product was digested with BseR1 followed by purification of the 5' fragment. The purified 3' and 5' fragments were ligated using the Quick Ligation™ Kit (New England Biolabs, M2200L). The ligation product was purified using the QIAquick PCR Purification Kit (Qiagen, 28106) and size- selected on an agarose gel. The resulting H xRepeats was PCR amplified, using primers T7-F1 and T7-R1 , and used for another round of repeat extension following the same strategy. Three rounds of extension produced 41 x Repeats. A poly(A) tail was added to the DNA template by PCR using primers T7-F1 and poly T-R1. The final PCR product was purified using the QIAquick Gel Extraction Kit (Qiagen, 28706), followed by further purification using a DNA Clean&Concentrator-5 kit (Zymo Research, D4003). The sequence of the final PCR product was confirmed by Sanger sequencing. As the amplification error rate of Q5 High-Fidelity DNA Polymerase is 5x1 O'7, the percentage of correct DNA copies is estimated to be greater than 99%.(3) 73xR-CGG / CGA / AGG and 73xcontrol DNA templates were generated using the same “repeat PCR-ligation extension” strategy, with two modifications: oligos containing nineteen CGG / CGA / AGG or nineteen l / K / N / F / M / Y codons were synthesized (sequences provided in Table 1E), and the oligos were cloned into the Drain and Blpl sites of Xlone-T7-HA. Two rounds of extension were performed to generate 73x Repeats.

[0201] In vitro transcription and capping of mRNA. mRNA was generated by in vitro transcription using the HiScribe® T7 High Yield RNA Synthesis Kit (New England Biolabs, E2040S). mRNA was purified using the Monarch® RNA Cleanup Kit (New England Biolabs, T2050S), capped with Faustovirus Capping Enzyme (New England Biolabs, M2081 L) at 42° C for 1 hour, and purified using the Monarch® RNA Cleanup Kit. mRNA was stored in -80° C.

[0202] Generation oftRNAs by in vitro transcription. Each tRNA used for in vitro translation or mutagenesis represented the most abundant isodecoder expressed in HEK293T cells for a given codon. DNA oligos containing a T7 promoter and mature tRNA sequence (with CCA at the3' end) were synthesized (sequences provided in Table 1 E) and used as templates for PCR with a forward primer annealing to the T7 promoter and a reverse primer annealing to the 3' end of the tRNA. The first two nucleotides of the reverse primer were 2'-O-methylated to improve the homogeneity of the tRNA 3' end. PCR products were purified using the QIAquick Gel Extraction Kit (Qiagen, 28706) followed by further purification using the DNA Clean&Concentrator-5 kit (Zymo Research, D4003). In vitro transcription was performed using the HiScribe® T7 High Yield RNA Synthesis Kit and RNA was purified using the Monarch® RNA Cleanup Kit (New England Biolabs, T2050S). Typically, 80-150 pg tRNA was produced from one 20 pL reaction. tRNA was aliquoted and stored at -80° C.

[0203] Expression and purification of RARS-6xHis and HA-MARS Rosetta™ 2(DE3) pLysS Competent Cells were transformed with plasmid RARS_pNIC-Bio3 (Addgene #153055) and plated onto LB plate containing kanamycin (100 pg / mL) and chloramphenicol (33 pg / mL). Clones were picked and grown in 5 mL LB medium at 37° C overnight. 2 mL culture was inoculated into 1 liter LB medium and shaken at 37° C for 1-2 hours. When the QD600 of the culture reached 0.06 (measured by Nanodrop), culture was placed on ice for 30 minutes, followed by overnight shaking at 37° C in the presence of 0.2 mM IPGT.

[0204] Cells were harvested by centrifugation at 3,000 g for 5 minutes, washed with ice-cold PBS, and then resuspended and sonicated in 20 mL lysis buffer [0.5 M NaCI, 1 mM MgCI2, 50 mM Tris- HCI (pH 7.5), 10 mM p-mercaptoethanol, 5 mM imidazole, and 1mM PMSF]. Lysate was cleared by centrifugation at 22,000 g for 30 minutes. The resulting supernatant was sequentially filtered through 5 pm and 0.2 pm filters. RARS-6xHis protein was captured by incubating the precleared lysate with 1 mL Ni-NTA resin (ThermoFisher Scientific, 88221) at 4° C with rotation for 1 hour. Resin was collected by centrifugation, resuspended in 20 mL wash buffer [1 M NaCI, 1 mM MgCI2, 50 mM Tris-HCI (pH 7.5), 10 mM P-mercaptoethanol, and 25 mM imidazole], and transferred to a gravity column. 10 mL elution buffer [0.5 M NaCI, 1 mM MgCI2, 50 mM Tris (pH 7.5), 10 mM P-mercaptoethanol, and 0.5 M imidazole] was added to the gravity column to elute RARS-6xHis protein. Protein was concentrated with a protein concentrator (30K MWCO, ThermoFisher Scientific, 88529) and stored at -80° C.

[0205] HA-MARS was expressed and purified from HEK293T cells. HEK293T cells growing in a 15- cm dish were transfected with 10 pg pcDNA3-HA-MARS plasmid (A gift from William Sellers, Addgene #10716) using FuGENE HD (Promega). Two days after transfection, cells were harvested by scraping and washed with ice-cold PBS. Cells were resuspended in PBS supplemented with 1 xEDTA-free protease inhibitor cocktail (Roche) and 1 % NP-40, andsonicated. Lysate was cleared by centrifugation at 22,000 g for 30 minutes. The resulting supernatant was sequentially filtered through 5 pm and 0.2 pm filters. Cleared lysate was incubated with anti-HA Magnetic Beads (ThermoFisher Scientific, 88836) at room temperature with rotation for 1 hour. Beads were washed with PBST. HA-MARS protein was eluted from beads using 2 pg / pL HA peptide in PBS. HA-MARS protein was concentrated with a Amicon Ultra Centrifugal Filter (30K MWCO, Millipore, UFC503008) and stored at -80° C.

[0206] tRNA aminoacylation assay. tRNA aminoacylation efficiency was measured by biotinylation-streptavidin conjugation to the a-amine of the aminoacyl group followed by gel electrophoresis to separate the aminoacyl-tRNA and tRNA as described (68). Briefly, in vitro transcribed tRNAs were refolded by incubating at 95° C for 2 minutes, 22° C for 3 minutes, and 37° C for 5 minutes. 30 pL reactions [3 pg refolded tRNA, 3 pg recombinant RARS-6xHis or HA- MARS, 3.3 mM ATP, 100 pM (L)- Arginine or (L)-Methionine, 50 mM HEPES (pH 7.3), 25 mM KCI, 15 mM MgCI2, 0.1 mM DTT, 0.75 pL RNasin (Promega)] were incubated at 37° C for 1 hour. Total tRNA was purified with the RNA Clean & Concentrator-5 kit (Zymo Research, R1016) and eluted in 30 pL ddH2O. To biotinylate the a-amine of aminoacyl-tRNA with sulfo-NHS-biotin (ThermoFisher Scientific, 21217), the 30 pL aminoacyl-tRNA was combined with 30 pL 120 mM HEPES (pH 8.0) containing 600 pg sulfo-NHS-biotin, followed by incubation at 4° C for 1 hour. Total tRNA was again purified with the RNA Clean & Concentrator-5 kit and eluted in 30 pL ddH2O. 1 pg of the purified reacted tRNA was combined with 20 pL streptavidin (1 pg / pL, New England Biolabs, N7021S), and incubated at room temperature for 20 minutes, followed by separation on a 2% agarose gel. Ethidium bromide staining was used to visualize charged and uncharged tRNA on the gel.

[0207] Preparation of translation-competent cell lysate. Twenty 15 cm plates of 90-95% confluent HEK293T cells were treated with 200 nM ISRIB (Sigma, SML0843) for 90 minutes. Cells then were dissociated from dishes by scraping in media and centrifuged at 800 g at 4° C for 3 minutes, followed by four washes in ice-cold PBS containing 200 nM ISRIB. Thereafter, all handling was performed in a 4° C cold room. Cells were resuspended in an equal volume of ice- cold hypotonic lysis buffer with 10 mM HEPES (pH 7.3), 10 mM KAc, 0.5 mM MgAc2, 1 mM DTT, 2 mM D-glucose, 200 nM ISRIB, and I xprotease inhibitor cocktail (e.g. 1 mL lysis buffer for a 1 mL cell pellet). Cells were placed on ice for 10 minutes and homogenized with ten strokes of a Wheaton homogenizer. The lysis process was monitored by trypan blue staining until 90-95% of the cells were lysed (excessive homogenization compromises the translational activity of the lysate). Lysate was centrifuged at 16,000 g at 4° C for 10 minutes. The supernatant wastransferred to a new tube and incubated with 1 mM CaCI2 and 0.8 u / pL Micrococcal Nuclease (ThermoFisher Scientific, 88216) at 20° C for 10 minutes. Micrococcal Nuclease was quenched by addition of EGTA to a final concentration of 10 mM and mixing by gentle inversion. Nuclease- treated lysate was centrifuged at 16,000 g at 4° C for 5 minutes to remove precipitates. The lysate was aliquoted, snap frozen, and stored at -80° C.

[0208] Generation of HEK293T cell lysate expressing WT or mutant CNOT3. The BSD gene in plasmid pLenti-CMV-Blast (w263-1) (Addgene #17486) was replaced by the PuroR gene to generate pLenti-CMV-Puro. WT or mutant CNOT3-3xFlag was then cloned into pLenti-CMV- Puro using the Esp3l and BamH1 sites. Lentivirus was generated using HEK293T cells as described previously. HEK293T cells were transduced with lentivirus in the presence of 8 pg / mL of polybrene (Sigma, S2667). Two-days post-transduction, cells were selected with 0.5 pg / mL puromycin for 6 days. Cells then were collected, and translation-competent lysate was prepared as described above.

[0209] In vitro translation. In vitro translation conditions were optimized using luciferase mRNA to determine the optimal concentration of K+, Mg2+, Spermidine, and mRNA, as well as the optimal incubation time and temperature. Translation reactions were most efficient when assembled as follows: 40% HEK293T lysate, 10% CNOT3-3xFlag expressing HEK293T lysate, 15 mM HEPES (pH 7.3), 0.2 mM MgCI2, 70 mM KCI, 28 mM KAc, 6 mM Creatine phosphate (Sigma, 10621714001), 102 ng / pL Creatine Kinase (Sigma, 10127566001), 0.4 mM amino acids mixture (Promega, L4461), 1 LI / pL RNasin (Promega), 0.2 mM spermidine (Sigma, S2626), and 80 ng / pL mRNA. Reaction was incubated at 30° C for 40 minutes.

[0210] For in vitro translation reactions supplemented with in vitro transcribed tRNA, the creatine phosphate concentration was increased to 18 mM. Before adding to the in vitro translation reactions, in vitro transcribed tRNAs were refolded by incubating at 95° C for 2 minutes, 22° C for 3 minutes, and 37° C for 5 minutes. 10 pg tRNAMetor mutants derived thereof was added to 100 pL reactions. For other tRNAs, 2 pg tRNA was added to 100 pL reactions, unless otherwise specified.

[0211] Purification of CNOT3-bound ribosomes translating 41*LRCGGD mRNA. 2 mL / n vitro translation reaction, containing 80 ng / pL 41 x|_RCGGD mRNA, 10% CNOT3-3xFlag expressing HEK293T lysate, and 40% WT HEK293T lysate, was used for the purification of CNOT3-bound ribosomes for structural studies. Reactions were separated on a 5- 50% sucrose gradient containing 20 mM HEPES (pH 7.5), 100 mM KCI, 5 mM MgCI2, and 1 xEDTA-free protease inhibitor cocktail. Polysome fractions were collected and combined. To remove sucrose,3 mL I xGradient buffer [20 mM HEPES (pH 7.5), 100 mM KCI, 5 mM MgCI2, 1 xEDTA-free protease inhibitor cocktail] was added to the polysome sample. A protein concentrator (30K MWCO, ThermoFisher Scientific, 88529) was then used reduce sample volume to 2 mL. 2 mL I xGradient buffer was then added to the sample, and further concentration to 1.5 mL was performed. 100 pL anti-DYKDDDDK Magnetic beads (ThermoFisher Scientific, A36797) were added to the concentrated polysome sample, followed by incubation at 4° C for 1.5 hours with slow rotation. Beads were washed with ice-cold wash buffer (1 xGradient buffer containing 0.01 % N P-40) four times. CNOT3-3x Flag-Ribosome complex was eluted from beads with 200 pL elution buffer (I xGradient buffer containing 0.01% NP-40, 1 mM DTT, and 1.5 mg / mL 3xFlag peptide) at 16 °C for 30 minutes with 300 RPM shaking. The 200 pL eluate was transferred to a new microcentrifuge tube and combined with 200 pL I xgradient buffer supplemented with 0.01% NP- 40 and 1 mM DTT. Sample was concentrated to 100 pL using a protein concentrator (Millipore, 30KD, 0.5 mL). Then 200 pL I xgradient buffer supplemented with 0.01% NP-40 and 1 mM DTT was added to sample, and sample was concentrated to 50 pL. The concentration of the purified ribosome complex was estimated to be -174 nM, as determined by absorbance at 260 nm measured by Nanodrop.

[0212] Cryo-EM grid preparation and Data Collection. Cryo- EM grids were prepared by applying 3.5 pL of the CNOT3-80S ribosome complex sample at a concentration of 8.7 A260ml- 1 to glow-discharged continuous carbon coated Quantifoil R2 / 1 300-mesh grids. Grids were blotted and frozen in liquid ethane using a Mark IV Vitrobot (FEI) set at 4 °C and 100% humidity. Micrographs were acquired on a Titan Krios (FEI) operated at 300 kV using a Falcon 4i direct electron detector equipped with a cold-field emission gun (cold- FEG) and a slit width of 10 eV on a GIF-Quantum energy filter with fringe free illumination. Automated data collection, totaling 11907 movies was performed using SerialEM (70) with a defocus range of -0.6 to -1.9 pm and a pixel size of 0.936 A. Micrographs were dose fractionated into 496 frames each under a dose rate of 8.39 e- / pixel / s with a total exposure time of 2 seconds and a total dose of approximately 16.78 e- / pixel.

[0213] Cryo-EM data processing. Data were processed using Relion 4.0. During motion correction using RELION's own implementation we collapsed 496 frames into 20 frames and CTF estimation was performed using CTFIND-4.1. About 300 particles were picked to generate initial 2D classes to serve as templates for automated particle picking from the 11154 micrographs selected after CTF correction. 81 OK particles were picked and extracted, binned 4 times, and used for 2D classification. Of these, 645K particles were selected for 3D classification. Classesrepresenting intact 80S particles were combined and re-extracted at the original pixel size of 0.936 A, resulting in a total of 378K particles. CTF and 3D refinement was performed with an imposed C1 symmetry and resulted in a reconstruction with a resolution of 2.54 A without postprocessing. Local skip-align 3D classification (T-factor of 65) was performed using a mask surrounding the CNOT3 / tRNA region. From this, 276K particles with the best local resolution were selected for final refinement and post-processing to an overall resolution of 2.00 A. The final resolution was estimated by applying a soft mask and was calculated using the gold-standard Fourier shell correlation (FSC) = 0.143. Local resolution was generated using the ResMap wrapper within Relion 4.0. Cryo-EM data collection, refinement, and validation statistics is provided in Table 2.Table 2. Cryo-EM data collection, refinement, and validation statistics80S-CNOT3-tRNAArg CGG'1CNOT3-tRNALeu’UAA 1PDB 9C3H PDB 9C3IEMD-45170 Ref. Map EM D-16052Data collection / processingMagnification 135,000xVoltage (kV) 300Electron exposure (e- / A2) 45Defocus range (pm) -0.6 - (-1 .9)Pixel size (A) 0.936Symmetry imposed C1Initial particle images (no.) 810,464Final particle images (no.) 276,339Map resolution (A) 2.0FSC threshold 0.143Map resolution range (A) 1 .88 - 10RefinementModel resolution (A) 2.69FSC threshold 0.5Map sharpening B factor (A2) 74Model compositionNon-hydrogen atoms 222228 6186Protein residues 8913 231Nucleotides 2223 72Ligands 19 0Mg 326 0K 94 0Zn 8 0Waters 9485 0B factors (A2)Protein 15.45 53.30Nucleotides 25.41 32.99Ligand 17.41 n / aWater 15.13 n / aR.m.s. deviationsBond lengths (A) 0.005 0.002Bond angles (°) 0.750 0.411ValidationMolProbity score 1.72 1.15Clashscore 5.64 3.55Poor rotamers (%) 1 .56 0.47Ramachandran plotFavored (%) 96.97 98.69Allowed (%) 2.97 1 .31Disallowed (%) 0.06 0

[0214] Cryo-EM model building and refinement: PDBs 6QZP (75), 8GLP and 8G5Y were used to generate a starting model for the 80S, tRNAArg’CCG-1was built de-novo using the tRNA from PDB 8ISS as a guide. The CNOT3 Alphafold model was rigid-body fitted into the final map density. The positions of rRNA and tRNA modifications were individually checked in the initial models and corrected if necessary. The final model was refined in PHENIX using phenix. real_space_refine. Restraints for the connection between the P-site tRNA and the nascent chain were generated using Acedrg. Restraint files for the isoaspartate residue in uS17 were kindly provided by Amos Nissley and Jamie Cate (UC Berkeley). The CNOT3 / tRNA complex from PDB 8BHF was rebuilt in COOT using the HsCNOT3 model and tRNAs from PDBs 8JOZ and 7080 as guides. The original tRNA sequence from 8BHF (ACCAGGAUGGCCUAGUGGUUAAGGCGUUGGACUUAAGAUCCAAUGGACAUGUGUCCGC GUCGGUUUUCGAACCCCA) (SEQ ID NO: 3) was replaced with the sequence for rabbit tRNALeu’UAA'1'1(ACCAGGAUGGCCGAGUGGUUAAGGCGUUGGACUUAAGAUCCAAUGGACAUGUGUCCGC GUGGGUUCGAACCCCACUCCUGGUA) (SEQ ID NO: 4). The final model lacks D-loop nucleotides 19, 20 and the variable loop nucleotides 46-57) and fixes the register shift in the original model. The updated model was refined in PHENIX against map EMD-16052 using phenix. real_space_refine. Figures were generated with LICSF Chimera X (85) and the PyMOL Molecular Graphics System (Version 2.0 Schbdinger, LLC.).Example 1: The ribosomal P-site codon is a major determinant of CNOT3 recruitment to human ribosomes

[0215] Whether human CNOT3 associates with translating ribosomes was examined using sucrose density gradient ultracentrifugation of HEK293T cell lysates. Similar to the behavior of Not5, the CNOT3 ortholog in Saccharomyces cerevisiae, endogenous CNOT3, or recombinantlyexpressed Flag-tagged CN0T3, co-sedimented with higher order polysomes in human cells (FIG.1A and FIG. 2A). Polysome association of CNOT3 could be due to a direct interaction with translating ribosomes, or could occur as a consequence of indirect recruitment to translated mRNAs via RBPs or miRNAs. To distinguish between these possibilities, lysates were treated with RNase prior to sucrose gradient fractionation and CNOT3 was immunoprecipitated from the resulting monosome fraction (FIG. 1B-1C and FIG. 2B-2C). CNOT3 co-sedimented with monosomes and stably associated with large and small ribosomal subunit proteins, consistent with direct binding of CNOT3 to ribosomes.

[0216] A selective ribosome profiling was performed to identify the features of mRNAs that were associated with CNOT3-bound ribosomes. Monosomes were prepared by RNase treatment and sucrose gradient fractionation, followed by immunoprecipitation (IP) of CNOT3 (FIG. 1D). Sequencing of the enriched ribosomal footprints confirmed the expected triplet periodicity within open reading frames (ORFs) (FIG. 1E and FIG. 2D-2E), consistent with the stepwise translation of each codon and enabling assignment of the A-, P-, and E-site codons in each footprint.

[0217] In Saccharomyces cerevisiae, the CNOT3 homolog Not5 preferentially associates with ribosomes with non-optimal codons in the A site. Codon optimality can be quantified using the tRNA adaptation index (tAI), a metric of cognate tRNA abundance. Re-analysis of published selective ribosome profiling data from yeast confirmed that non-optimal codons with a low tAI are highly enriched in the A-site of Ccr4-Not-bound ribosomes (FIG. 2F-2H). In contrast, no preferential enrichment of non-optimal codons in the A-site of CNOT3-bound human ribosomes was observed and, accordingly, no correlation between tAI and A-site codon enrichment (FIG. 2I- 2K). In addition to tRNA availability, the rate of decoding is also impacted by additional parameters, such as amino acid concentration and tRNA charging. The relative decoding rate, which accounts for these additional variables, is approximated by the A-site dwell time of each codon, a parameter that can be estimated using ribosome profiling data. A modest, but statistically-significant, correlation between A-site dwell time and codon enrichment in the A-site of CNOT3-bound ribosomes was observed (FIG. 2L). Nevertheless, no specific A-site codons were strongly enriched in the dataset, with only a single codon exhibiting greater than two-fold enrichment (FIG. 1F).

[0218] Overall, these data suggested that slow decoding of the A-site codon measurably promotes CNOT3 recruitment to translating ribosomes, but also raised the possibility that other determinants play a more dominant role in co-translational CNOT3 recruitment in mammalian cells.

[0219] To more broadly explore a possible connection between codon content and CNOT3 recruitment, codon enrichment in the ribosomal P- and E-sites in the selective ribosome profiling data was examined (FIG. 1F). Assessment revealed that the most enriched codons in CNOT3- bound ribosomes were located in the P-site. In particular, select P-site arginine codons (CGG, CGA, and AGG) were the most enriched codons observed in any position within CNOT3-bound ribosomes, while other arginine codons (CGG, AGA, and CGU) exhibited weak enrichment. Analysis of the amino acids encoded by CNOT3-bound ribosomal footprints further documented a robust enrichment of arginine-centered tripeptides (FIG. 1G), with 18 of the top 20 enriched tripeptides containing arginine at the P-site (FIG. 2M). Altogether, these data demonstrated that P-site codon identity is strongly associated with co-translational CNOT3 recruitment in human cells, with select arginine codons at the P-site providing the strongest detectable signal for CNOT3 binding.Example 2: CGG, CGA, and AGG arginine codons promote CNOT3-mediated mRNA decay

[0220] To examine the relationship between codon enrichment in CNOT3-bound ribosomes and mRNA decay, SLAM-seq was used to globally measure mRNA half-lives in control and CNOT3-deficient HEK293T cells (FIG. 3A). The impact of P-site codon identity on CNOT3- mediated decay was assessed by calculating a metric termed the P-site score. Each codon was assigned a value equal to its enrichment in the P-site of CNOT3-bound ribosomes in the selective ribosome profiling data (FIG. 1F). The P-site enrichment values for all codons in a given ORF were averaged to calculate the overall P-site score for that mRNA. Consistent with the finding that specific P-site codons are strongly associated with co-translational CNOT3 recruitment, it was observed that transcripts with high P-site scores were preferentially stabilized in CNOT3-deficient cells (FIG. 4A).

[0221] Because P-site CGG, CGA, and AGG arginine codons were most strongly associated with recruitment of CNOT3 to translating ribosomes, we further stratified mRNAs by calculating a weighted CGG / CGA / AGG score. Each of these codons was assigned a value equal to its enrichment in the P-site of CNOT3-bound ribosomes (FIG. 1 F). The score for each mRNA was defined as the sum of the weighted values of these codons, normalized to the total number of codons, in the ORF. As observed for mRNAs with high P-site scores, transcripts with high weighted CGG / CGA / AGG scores were strongly stabilized upon loss of CNOT3 (FIG. 4A). Transcripts rich in other arginine codons (CGC, AGA, and CGU) did not exhibit this behavior (FIG. 4A). Analysis of mRNA decay rates in CNOT3-depleted Jurkat cells or steady-state mRNA levelsin pro-B cells from Cnot3 knockout mice further confirmed that transcripts rich in CGG, CGA, or AGG arginine codons, but not arginine encoded by CGG, AGA, or CGU, were preferentially stabilized in CNOT3-deficient cells (FIG. 3B-3C).

[0222] To further assess whether select arginine codons are sufficient to promote CNOT3- mediated mRNA decay, a doxycycline- regulated reporter transcript encoding 42 tripeptides, each centered on a CGG, CGA, or AGG arginine codon was constructed (FIG. 4B). A control mRNA, with each arginine codon replaced with a codon that was not enriched in the P-site of CNOT3- bound ribosomes, was also generated. Consistent with the transcriptome-wide analyses, the arginine-encoding reporter was decayed significantly faster than the control reporter and was selectively stabilized upon CNOT3 depletion. Together, these data provided strong evidence that CNOT3 recruitment to translating ribosomes by CGG, CGA, and AGG arginine codons results in accelerated mRNA degradation.Example 3: Mitochondrial ribosomal protein mRNAs are enriched in CGG / CGA / AGG codons and regulated by CNOT3

[0223] The endogenous mRNAs that are most strongly regulated by CNOT3 due to the presence of destabilizing arginine codons were further investigated. Gene set enrichment analysis (GSEA) of mRNA decay rate data from HEK293T and Jurkat cells, as well as steady-state mRNA levels from Cnot3 knockout pro-B cells, revealed that gene sets containing mitochondrial ribosomal proteins were highly upregulated upon CNOT3 depletion and were the only significantly upregulated gene sets detected in all three datasets (FIG. 4C and FIGs. 3D-3F). To determine whether these effects were related to an enrichment of destabilizing arginine codons, genes were ranked according to their weighted CGG / CGA / AGG scores. Indeed, gene sets containing mitochondrial ribosomal proteins were the most highly enriched gene sets according to this metric (FIG. 4D and FIG. 3G).

[0224] These findings indicated that mitochondrial ribosomal proteins are regulated by CNOT3. It was confirmed that depletion of CNOT3 in HEK293T or Jurkat cells resulted in a strong increase in the steady-state abundance of these transcripts (FIGs. 4E-4F) and a corresponding increase in mitochondrial mass (FIGs. 4G-4H). Furthermore, fluorescent labeling of nascent mitochondrial peptides demonstrated an increase in mitochondrial translation (FIGs. 4I-4J).

[0225] Thus, regulation of mitochondrial ribosomal proteins, which are rich in arginines encoded by CGG, CGA, and AGG codons, by CNOT3 impacts mitochondrial homeostasis in mammalian cells.Example 4: Structural analysis of co-translational CN0T3 recruitment by P-site arginine codons

[0226] To further corroborate the finding that select P-site arginine codons stimulate co- translational CNOT3 recruitment and to investigate the underlying mechanism, a highly efficient human in vitro translation system was established from HEK293T lysates. Endogenous mRNAs were removed by micrococcal nuclease, enabling assembly of polysomes on exogenously added mRNAs of any desired sequence (FIG. 5A). To determine whether co-translational CNOT3 recruitment was recapitulated in this system, an mRNA encoding 41 repeats of leucine-arginine- aspartic acid (LRD) was constructed, the most significantly enriched tripeptide in CNOT3-bound ribosomes (FIG. 2M), with arginine encoded by CGG (41 X LRCGGD). AS a control, the arginine codon was replaced with a lysine codon (41 X LKAAGD) . AS predicted from the selective ribosome profiling data, in vitro translation of 41 X LRCGGD, but not 41 X LKAAGD, resulted in robust recruitment of Flag-tagged CNOT3 to polysomes (FIG. 6A). Other CCR4-NOT complex components were also selectively recruited to the 41 X LRCGGD mRNA (FIG. 6B). Moreover, the hierarchy of P-site arginine codon-mediated recruitment of CNOT3 was recapitulated in this system, as 41 X LRCGGD recruited the most CNOT3 to polysomes, followed by 41 X |_RCGAD and 41 X |_RCGUD, while no detectable CNOT3 association was observed upon translation of 41 X LKAAGD and 41 X |_KAAAD mRNAs (FIG. 6C). Translation of an additional arginine-rich mRNA containing 73 CGG, CGA, or AGG codons also stimulated recruitment of CNOT3 to polysomes, while replacement of the arginine codons with codons that were not enriched in the P-site of CNOT3-bound ribosomes abolished recruitment (FIG. 5B).

[0227] This system was then leveraged to determine the structural basis of CNOT3 recruitment to ribosomes with P-site arginine codons. Polysomes actively translating 41 X LRCGGD mRNA transcripts were enriched for CNOT3-bound ribosomes by Flag IP and analyzed by cryo-EM (FIG. 5C). The single particle reconstruction of these ribosomes yielded a homogeneous structure with an overall resolution of 2k (FIG. 6D and FIGs. 7A-7F). Density interpretation and model building revealed an empty A-site, a tRNA in the P-site, and CNOT3 occupying the E-site (FIGs. 6E-6F). As observed in previous yeast and rabbit structures, the N-terminal 3-helix bundle (aa 1-111) of CNOT3 bridges the two ribosomal subunits and contacts the D-loop, Dstem, and anticodon stem of the P-site tRNA (FIGs.6F-6G). An additional helical domain of CNOT3, composed of amino acids 112-231 , contacts uS7 and eS25, and extends out of the Esite. The C-terminal portion of CNOT3, which mediates interactions with other CNOT components and is connected to the N- terminal modules via a disordered linker, is not visible in the reconstruction. The codon-anticodonpairing (FIGs. 6H-6I) and defined CCA-RLD density connecting the P-site tRNA and the nascent peptide chain (FIGs. 6H-6J) unambiguously identified the arginine-encoding CGG codon in the P-site, as predicted from the selective ribosome profiling data. The CGG codon present in the transcript can be recognized by the two tRNAArg CCGisodecoders or, due to wobble base-pairing, by one of the five tRNAArg UCGisodecoders present in HEK293T cells. Northern blot analysis revealed that all of these tRNAs are present in the CNOT3-enriched sample (FIGs. 8A-8B). For model building, the most abundant isodecoder, tRNAArg CCG'1was chosen, including its post- transcriptional modifications, which are clearly identifiable in the reconstruction (FIG. 8C). This structural model provided an opportunity to investigate the molecular interactions that promote CNOT3 recruitment when select arginine codons occupy the ribosomal P-site.Example 5: The P-site tRNA D-arm is a key determinant of co-translational CN0T3 recruitment

[0228] It has previously been reported that select codon pairs in the ribosomal P- and A-sites can distort the A-site mRNA configuration, resulting in impaired decoding. This could potentially lead to CNOT3 recruitment as a consequence of ribosomal stalling. Unlike previous reconstructions of Not5 and CNOT3-bound ribosomes, the A-site mRNA was modeled. The mRNA geometry in the structure was compared to the structure of mRNA in a GA state translating ribosome (i.e. after A-site recognition by a tRNA but before eEF1A GTP hydrolysis) (FIG. 9A). The conformation of the A-site mRNA, as well as the overall structure of CNOT3-bound ribosomes, were compatible with decoding, suggesting that recruitment of CNOT3 was not a consequence of ribosomal stalling due to mRNA distortion.

[0229] The possibility that the specific interactions between the N-terminal domain of CNOT3 and arginyl-tRNA visualized in the structure play a role in CNOT3 recruitment, was considered. The second and third N-terminal helices of CNOT3 contact the arginyl-tRNA D-loop and D-stem, while a short element named the tRNA clamp motif (tCM) interacts with the tRNA anticodon stem (FIG. 6G). It was hypothesized that sequence and structural differences among tRNAs could impact these interactions and thereby influence CNOT3 recruitment when distinct codons, and consequently distinct tRNAs, occupy the P-site.

[0230] The selective association of CGG, CGA, and AGG arginine codons with CNOT3 recruitment, in contrast to CGC, AGA, and CGU arginine codons, provided a framework for investigating tRNA sequence features that may impact CNOT3 binding. In human cells, the six arginine codons are decoded by five distinct tRNAs (FIG. 10A and FIG. 9B). The D-loops of all arginine tRNAs are identical due to their essential role in recognition by arginyl tRNA synthetase(RARS). tRNAArg CCGand tRNAArg UCGdecode the most enriched P-site codons in CNOT3-bound ribosomes (CGG and CGA) and, in addition to the conserved D-loop, also share identical D-stem and anticodon stem sequences (FIG. 10A and FIG. 9B). The third most enriched arginine codon (AGG) is decoded by tRNAArg CCU, which shares the D-arm sequence with tRNAArg’CCG / UCG, but possesses a distinct anticodon stem. The least enriched arginine codons (CGG, AGA, and CGU) are decoded by tRNAArg ACGand tRNAArg UCU, which have different D-stems compared to tRNAArg’CCG / UCG / CGU. Most notably, the D-stemsOf tRNAArg’CCG / UCG / CGU, tRNAArg’ACG, and tRNAArg’ucuengage in distinct triplet base interactions involving tRNA positions 13, 22 and 46 (FIG. 10B). These observations suggested that variation in the D-stems and anticodon stems of arginine tRNAs may alter their affinity for CNOT3 in the context of a translating ribosome. The possibility that differences in tRNA nucleotide modifications, particularly the absence of m7G at nucleotide 46 in tRNAArg,CCG / UCG / CCU, which participates in the aforementioned D-stem triplet base interaction, could impact CNOT3 recruitment was also considered.

[0231] To examine these possibilities, in vitro transcription was used to generate a panel of arginine tRNA mutants. In vitro transcribed tRNAs, which lack nucleotide modifications, can efficiently participate in translation when introduced into cells or cell-free translation reactions, providing an efficient system for assessing the role of sequence features and modifications in CNOT3 recruitment. In vitro aminoacylation assays confirmed that none of the mutations impaired tRNA charging compared to each respective parental tRNA (FIG. 11 A). In vitro translation assays were then performed using the 41 X |_RCGUD mRNA, which is decoded by tRNAArg ACGand weakly recruits CNOT3 (FIG. 6C). As expected, addition of excess tRNAArg ACG'1to these reactions had no effect on CNOT3 recruitment (FIG. 10C and FIG. 11 B). In contrast, addition of a variant of tRNAArg CCG'1, reprogrammed to decode the CGU codon by mutating the anticodon to ACG (tRNAArg CCG'm1), promoted CNOT3 recruitment in a dose dependent manner (FIG. 10C, FIG 10G, and FIG. 11C). These data demonstrated that the sequence of the Psite tRNA plays a key role in co-translational CNOT3 recruitment and showed that this effect is not dependent on specific tRNA nucleotide modifications.

[0232] Further, it was tested whether the distinct D-stem sequences of tRNAArg ACGand tRNAArg CCGwere responsible for the contrasting abilities of these tRNAs to recruit CNOT3. These D-stems differ by three nucleotides (FIG. 10C, C13 vs. U13; base-pair G12:C23 vs. C12:G23). Swapping the Darm of tRNAArg’CCG-m1(tRNAArg CCGreprogrammed to decode the CGU arginine codon) with the D-arm of tRNAArg ACG(generating tRNAArg CCG'm2) abrogated CNOT3 recruitment to the 41 X LRCGUD mRNA (FIG. 4D and FIG. 11 D, compare ml to m2). Moreover, mutation of U13to C13 (tRNAArg CCG'm3) was sufficient to impair CN0T3 recruitment, while reversing the C12:G23 to a G12:C23 base-pair had no effect (tRNAArg CCG-m4). It was further showed that addition of the D-stem sequence from tRNAArg CCGto tRNAArg ACG(tRNAArg ACG'm5), or the single C13LI mutation enabling formation of the I113: A22 base pair in tRNAArg ACG(tRNAArg ACG'm6) was sufficient to enable CNOT3 recruitment (FIG. 10E and FIG. 11 E, compare WT to m5 and m6). Again, flipping the G12:C23 base-pair (tRNAArg ACG'm7) had no effect in this context. Altogether, these results pinpoint position U13 in the tRNAArg’CCG / UCG / CGUD-arm, which forms a triplet base interaction with A22 and A46 (FIG. 10B), as a critical feature associated with CNOT3 recruitment to ribosomes.

[0233] In tRNAArg UCU, the triplet interaction is C13:G22:m7G46 (FIG. 10B), a frequent configuration of nucleotides at these positions among all tRNAs (FIG. 12), whereas tRNAArg ACGhas an unusual C13:A22:A46 triplet. To further probe how this triplet base interaction influences CNOT3 recruitment, tRNAArg.ACG was mutated at positions 22 and 46 to introduce the common C13:G22:G46 triplet (tRNAArg ACG'm8). These mutations did not increase CNOT3 recruitment (FIG. 10F and FIG. 11F, compare WT to m8). Thus, the U13:A22:A46 triplet, present in tRNAArg CCG / UCG / ccu, appears to be optimally configured to recruit CNOT3.

[0234] To determine why the U13:A22:A46 triplet favors CNOT3 recruitment, the structural model was further examined. Residues E95 and K49 of CNOT3 make direct or water-mediated H-bonding interactions with A22, respectively (FIG. 10H). Supporting the importance of these interactions, an E95A substitution in CNOT3 greatly reduced co-translational recruitment to a CGG / CGA / AGGrich transcript (FIG. 10K and FIG. 11 J). To analyze how alternative nucleotide 13:22:46 triplet configurations affect CNOT3 / Not5 binding, the configuration of the S. cerevisiae Not5 / tRNAiMet,CAU and CNOT3 / tRNALeu,UAA interaction interfaces were examined. tRNAiMet has the most common triplet combination (C13:G22:m7G46), while tRNALeu.UAA has a transHoogsteen G13-A22 pairing characteristic of type-ll tRNAs. The distinct base configurations in tRNAiMet and tRNALeu.UAA increase the intermolecular distance to Not5 and CNOT3 in their respective complexes. This prevents the formation of the hydrogen-bonding network observed in the CNOT3 / tRNAArg CCGstructure (FIGs. 10I-10J). Because the C13:G22:m7G46 triplet of tRNAArg UCU, visualized in a structure of this tRNA with a splicing endonuclease, is structurally similar to tRNAiMet (FIG. 101, inset), it was expected that interactions between tRNAArg UCUand CNOT3 are similarly disrupted. These observations provided a structural basis for the enhanced recruitment of CNOT3 by arginyl-tRNAs containing the U13:A22:A46 triplet base interaction.Example 6: Impact of the P-site tRNA anticodon stem on co-translational CN0T3 recruitment

[0235] The CNOT3-ribosome structure, as well as previously reported structures, also revealed interactions between CNOT3 and the anticodon stem of the P-site tRNA. These interactions are mediated by a structural element termed the tRNA clamp motif (tCM), which forms several direct backbone interactions as well as water-bridged interactions with bases G42 and A43 of the P-site tRNA (FIG. 11 H). Supporting the importance of these interactions, a K105S substitution in the tCM abrogated recruitment of CNOT3 to a CGG / CGA / AGG-rich transcript (FIGs. 111-11 J). It was hypothesized that these interactions might explain why tRNAArg CCGand tRNAArg UCG, which share an anticodon stem, recruit more CNOT3 compared to tRNAArg CCU’ which has a distinct anticodon stem but the same D-stem and D-loop structure (FIG. 10A and FIG. 9B). The unique anticodon stem of tRNAArg UCUmay also contribute to the poor CNOT3 recruitment associated with this tRNA. To test whether the anticodon stem contributes to differential CNOT3 recruitment by these tRNAs, the anticodon stem of tRNAArg ACGbearing the tRNAArg CCGD-arm was replaced (FIG. 10F, tRNAArg ACG'm5) with the anticodon stem from tRNAArg UCU(FIG. 10F, tRNAArg ACG'm9). Consistent with the hypothesis, this greatly reduced, but did not eliminate, CNOT3 binding (FIG. 10F and FIG. 11 F, compare m5 to m9). In addition, tRNAArg UCLMwas reprogrammed to recognize the CGU arginine codon (FIG. 10G, tRNAArg UCU'm1°), which allowed demonstration that addition of the tRNAArg CCGU13:A22:A46 triplet (FIG. 10G, tRNAArg UCUm11), but not the tRNAArg CCGanticodon stem (FIG. 10G, tRNAArg UCU'm12), was sufficient to increase CNOT3 recruitment (FIG. 10G and FIG. 11G). Thus, the presence of the U13:A22:A46 triplet is the major determinant of CNOT3 recruitment by arginine tRNAs, while the anticodon stems play a lesser, but measurable, role. Although the structural information lacks to precisely determine how sequence variation in the anticodon stem impacts CNOT3 interactions, it was hypthesized that different base-pairing configurations may alter the tCM-tRNA affinity. In keeping with this concept, the anticodon stems of tRNAArg UCUand tRNAArg CCUboth contain G:ll wobble base pairs, which can locally alter the twist of the RNA backbone (FIG. 11K), potentially affecting interactions with the CNOT3 tCM element.Example 7.- An extra nucleotide upstream of the D-loop GG motif prevents CNOT3 recruitment

[0236] The structural studies revealed that select arginine tRNAs possess distinct sequence and structural features that promote CNOT3 recruitment. To determine whether other tRNAs have features that inhibit recruitment of CNOT3, the codons that were most depleted from the P-site ofCNOT3-bound ribosomes were examined (FIG. 14A). Interestingly, it was noticed that many of the most depleted codons, including codons for asparagine (N), lysine (K), isoleucine (I), tyrosine (Y), methionine (M), phenylalanine (F), and threonine (T), are decoded by tRNAs with an extra nucleotide in the a element of the D-loop, immediately preceding the universally conserved GG D-loop motif (FIG. 15A-15B, and FIG. 12). The GG motif forms a key interaction with the T-arm to stabilize the “elbow” structure of all tRNAs. a and b D-loop elements flank the GG motif and often contain modified dihydrouridine nucleotides. In the structure, CNOT3 contacts the a element of the D-loop, but not the b element (FIGs. 15B, 15D, and 15G), mirroring the interface between yeast Not5 / tRNAiMet and CNOT3 / tRNALeu,UAA (FIGs. 15E and 15H, and data not shown). This interaction is critical for CNOT3 recruitment, as demonstrated by mutating the key CNOT3 residue (R59) that contacts this site in the tRNA (FIG. 15C and FIG. 14B). A structural overlay of a tRNA with an extra nucleotide in the a element (tRNALys UUU) bound in the P-site shows that the a expansion creates a steric clash with CNOT3 (FIG. 15F and FIG. 151). The same D-loop orientation is also observed in the crystal structure of isolated bovine tRNALys UUU, suggesting that it represents a structurally rigid bulge within the a-element (FIG. 14C). These observations suggested that depletion of select P-site codons may result from a steric clash between CNOT3 and the cognate tRNAs for these amino acids that prevents effective CNOT3 binding in the E- site. Consistent with this hypothesis, it was observed that mRNAs rich in N, K, I, Y, M, F, and T codons decoded by tRNAs with an extra nucleotide in the a element were less sensitive to CNOT3-mediated decay compared to other transcripts (FIG. 15J and FIG. 14D-14E). Notably, cytosolic ribosomal proteins represented the class of transcripts most enriched for these codons (FIG. 14F-14G), providing a possible explanation for the finding that depletion of CNOT3 selectively upregulated mitochondrial, but not cytosolic, ribosomal proteins.

[0237] T o directly test the effect of the a element insertion on CNOT3 recruitment, further tRNA mutagenesis experiments were performed. It was noted that, among tRNAs that decode methionine codons, the initiator tRNAiMet has a single residue in the a element, while all elongator tRNAMet isodecoders have an additional nucleotide preceding the GG motif (FIG. 15A and FIG. 12). Furthermore, structural analyses in yeast revealed that Not5 bound to initiating ribosomes with tRNAiMet in the P-site. The structural similarity between the Not5 / tRNA and CNOT3 / tRNA interfaces suggested that CNOT3 recruitment may also be compatible with the presence of a similar tRNA in the P-site. Importantly, mutations in the D-arm of elongator tRNAMet that remove the extra a element nucleotide are expected to be compatible with tRNA charging and decoding of internal AUG codons.

[0238] Confirming the inhibitory effect predicted from the structural studies, deletion of the extra a nucleotide upstream of the GG motif in elongator tRNAMet,CAU-3 (tRNAMet-m13) was sufficient to stimulate recruitment of CNOT3 to ribosomes translating a 41 xLMAUGD mRNA (FIG. 15K and 15L, and FIG. 14H and 141, compare WT to m13). Consistent with the structural analyses, changes to the D-loop b element did not impact CNOT3 recruitment, since introducing C20A (tRNAMet-m14) or C20LI (tRNAMet-m15) mutations had no effect on CNOT3 binding (FIG. 15L and FIG. 14H-14I, compare m13 to m14 or m15). Taken together, the results demonstrate that a D-stem U13:A20:A46 triplet and a short, single-nucleotide D-loop a element in the P-site tRNA are major determinants of CNOT3 co-translational recruitment, providing a structural basis to explain predominant patterns of P-site codon enrichment and depletion in CNOT3-bound ribosomes.Example 8: Slow decoding enables P-site tRNA-mediated CNOT3 recruitment to ribosomes

[0239] Notably, it was observed that the A-site of human CNOT3-bound ribosomes was not occupied by tRNA (FIG. 6F). This configuration, indicative of slow decoding, was similar to the structure of Not5-bound ribosomes in yeast and CNOT3-bound rabbit ribosomes stalled on a highly nonoptimal codon. As discussed above, a weak, but significant, correlation between A-site dwell time and CNOT3 recruitment was detected in the selective ribosome profiling data (FIG. 2L), indicating that slow decoding measurably promotes CNOT3 recruitment in human cells. Interestingly, it was found that the correlation between A-site dwell time and CNOT3 association was greatly enhanced when the P-site was occupied by a CGG, CGA, or AGG arginine codon (FIGs. 16A-16B). In contrast, when any other codon was present in the P-site, the dwell time correlation was undetectable (FIG. 16C). These data suggest that, like in yeast, slow decoding increases the probability that the ribosomal A- and E-sites will be simultaneously vacant, providing an opportunity for CNOT3 to enter the E-site. The results demonstrate that CNOT3 subsequently probes the D-arm of the P-site tRNA, which ultimately determines whether CNOT3 will stably associate with the ribosome and initiate mRNA decay.Example 9: Discussion

[0240] The CCR4-NOT complex can associate with translating ribosomes to accelerate mRNA turnover. In yeast, a major trigger for Ccr4-Not recruitment to ribosomes is slow decoding, which is sensed by entry of the N-terminal domain of the Not5 subunit into a vacated E-site when the A- site codon is non-optimal and therefore lacks a cognate tRNA. Disclosed herein, in mammalian cells, is the identity of the P-site tRNA that plays a critical role in determining how efficiently theNot5 ortholog CN0T3 is recruited to ribosomes. Specifically, it was observed that the presence of select arginine codons (CGG, CGA, and AGG) in the P-site provided the strongest detectable signal for CNOT3 binding, while codons specifying amino acids N, K, I, Y, M, F, and T were depleted from the P-site of CNOT3-bound ribosomes. Accordingly, mRNAs rich in CGG, CGA, and AGG codons were relatively sensitive, while mRNAs rich in codons specifying N, K, I, Y, M, F, and T were relatively resistant, to regulation by CCR4-NOT in human cells. High-resolution structural studies, coupled with tRNA mutagenesis, established that these effects were attributable to direct interactions between the Psite tRNA and the N-terminal domain of CNOT3, when the latter occupies the E-site. Two key features of the tRNA that impact the interaction with CNOT3 were identified. First, a rare U13:A22:A46 base triplet, present in the tRNAs that decode CGG / CGA / AGG arginine codons, forms stabilizing hydrogen bonds with CNOT3 that promote its recruitment. Second, an extra nucleotide in the D-loop a element, present in the tRNAs that decode N, K, I, Y, M, F, and T, sterically clashes with CNOT3, blocking its recruitment when these codons occupy the P-site. These two tRNA features are major drivers of the observed pattern of codon enrichment and depletion in human CNOT3-bound ribosomes. It was also found that interactions with the anticodon stem influence CNOT3 recruitment, but does not have sufficient structural information to predict whether a specific anticodon stem will have a positive or negative effect.

[0241] Based on the results disclosed herein, the following model for co-translational CNOT3 recruitment in mammalian cells (FIG. 17) is proposed. As in yeast, slow decoding, resulting in a ribosomal conformation with empty A- and E-sites, appears to be a pre-requisite for CNOT3 entry into the E-site, enabling it to probe the P-site tRNA. At this stage, three outcomes are possible, (i) If the P-site tRNA has the U13:A22:A46 triplet and lacks the extended a-element (i.e., tRNAs that decode CGG / CGA / AGG arginine codons), CNOT3 binding will be stabilized and mRNA decay will be favored, (ii) If the P-site tRNA is neutral, lacking both the extended D-loop a element and the I113: A22: A46 triplet, CNOT3 binding may be transient. However, if an extended ribosomal stall occurs due to scarcity of a charged tRNA that can enter the A-site, CCR4-NOT-mediated decay may ensue, (iii) If the P-site tRNA has the extended D-loop a element (e.g., tRNAs that decode N, K, I, Y, M, F, and T), CNOT3 accommodation will be sterically blocked, CNOT3 will exit, and translation will resume. Because of the central role played by the P-site tRNA indicating the outcome of CNOT3 recruitment, the term P-site tRNA-mediated decay (PTMD) as disclosed herein refer to this mechanism of accelerated mRNA degradation.

[0242] These findings expand the understanding of how codon content influences post-transcriptional regulation. Prior to this disclosure, the impact of specific codons on rates of co- translational mRNA turnover were largely attributed to their effect on decoding efficiency. The results disclosed here show that specific codons can also modulate the rate of mRNA decay due to the ability of their cognate tRNAs to promote or inhibit association of the CCR4-NOT complex. Thus, in addition to their canonical role in decoding, tRNAs can directly recruit post-transcriptional regulators to translating ribosomes. This discovery raises the intriguing possibility that other regulatory complexes that engage ribosomes may be similarly impacted by tRNA identity.

[0243] The presence of the U13:A22:A46 triplet and absence of the extra nucleotide in the a element is a conserved feature of metazoan tRNAs that decode arginine codons CGG, CGA, and AGG (FIG. 18), suggesting that PTMD is operative across animal species. Nevertheless, it is less clear whether this mechanism is active in yeast, where codon optimality appears to be the dominant signal for Ccr4-Not recruitment. The high level of sequence and structural conservation between CNOT3 and Not5 (57% amino acid identity and 0.75 A Ca RMSD), coupled with the presence of a U13:A22:A46 triplet and a short a element in arginine tRNAs that decode AGG and AGA (FIG. 19A; tRNAArg,CCU / UCU), raise the possibility of a functional PTMD pathway in yeast. Indeed, codons with cognate tRNAs possessing an extra nucleotide in the D-loop a element were generally depleted from the P-site of Not4-bound ribosomes (FIGs. 19B-19C). Nevertheless, P- site AGG and AGA arginine codons were only marginally enriched. Instead, non-optimal codons were unexpectedly enriched, not only in the A-site as reported, but also to a similar extent in the P- and E-sites, whereas no such enrichment was observed in human cells (FIGs. 19D-19E). These differences in codon enrichment patterns between yeast and humans may be a consequence of distinct mechanisms of binding of CCR4-NOT to ribosomes between these species. Specifically, the E3 ubiquitin ligase Not4, which interacts with and ubiquitylates ribosomal protein eS7, is a constitutive subunit of Ccr4-Not in yeast and is required for recruitment of Not5 to ribosomes. In contrast, the metazoan Not4 homolog CNOT4 does not stably associate with CCR4-NOT and is dispensable for ribosomal recruitment of CNOT3. These findings suggested that when Not5 is recruited to the E-site of a slowly decoding ribosome in yeast, the associated Ccr4-Not complex may become tethered to the ribosome via Not4. If Not5 does not remain stably bound within the E-site, the ribosome may continue further cycles of elongation while remaining associated with Ccr4-Not, thereby moving the non-optimal codon to the P- or E-site. Importantly, this mechanism would render Ccr4-Not association with the ribosome less dependent upon the stable accommodation of Not5 within the E-site, and therefore less reliant upon specific Not5:P- site tRNA interactions. In agreement with this hypothesis, deletion of the N-terminal domain of Not5 reduced but did not eliminate its binding to ribosomes. Unlike the behavior of Not5 in yeast,it was found that the R59S mutation of human CNOT3 that disrupted interaction with the P-site tRNA abolished its recruitment to ribosomes. Thus, mammalian ribosomes require CNOT3 accommodation within the E-site, which depends upon specific P-site tRNA interactions, to stably recruit CCR4-NOT, enabling the PTMD mechanism to dominate in this setting.

[0244] It was observed that mitochondrial ribosomal proteins, whose mRNAs are rich in CGG, CGA, and AGG arginine codons, are strongly regulated by this mechanism across diverse cell types. Cytosolic ribosomal proteins, in contrast, are rich in N, K, I, Y, M, F, and T codons, whose cognate tRNAs oppose CNOT3-mediated decay. As a consequence of this regulation, it was observed that CNOT3 is a strong repressor of mitochondrial translation and mitochondrial mass. In keeping with these findings, mice with reduced CNOT3 expression exhibit increased respiration and are resistant to obesity, consistent with an increase in mitochondrial energy expenditure. Moreover, expression of CNOT3, but not other subunits of the CCR4-NOT complex, is upregulated in obese mice and downregulated after fasting, suggesting that regulation of mitochondrial activity by PTMD affects the physiological response to nutrient availability. Interestingly, in yeast, mitochondrial ribosomal protein mRNAs are rich in non-optimal codons, while cytosolic ribosomal proteins are mostly encoded by mRNAs with high levels of optimal codons. Accordingly, loss of the Ccr4-Not complex also increases mitochondrial mass in yeast. Thus, regulation of mitochondrial homeostasis by CCR4-NOT appears to be highly conserved, although the underlying mechanism of recruitment of Not5 / CNOT3 to target transcripts occurs through distinct mechanisms across species.

Claims

CLAIMSWhat is claimed is:

1. A synthetic tRNA comprising a nucleotide sequence of a length up to 100 nucleotides and comprising a sequence modification relative to a wild-type tRNA sequence, wherein the sequence modification modifies the ability of the tRNA to recruit CNOT3 to a cell ribosome and / or modifies the stability of a target mRNA in the cell.

2. The synthetic tRNA of claim 1 , wherein the sequence modification increases CNOT3 recruitment to the ribosome and / or increases the decay of the target mRNA.

3. The synthetic tRNA of claim 2, wherein the nucleotide sequence comprises a U13:A22:A46 triplet.

4. The synthetic tRNA of claim 1 , wherein the sequence modification decreases CNOT3 recruitment to the ribosome and / or stabilizes the translated target mRNA.

5. The synthetic tRNA of claim 4, wherein the sequence modification comprises an extra nucleotide in a D-loop a element of the tRNA.

6. The synthetic tRNA of claim 4, wherein the nucleotide sequence comprises an extra nucleotide preceding a GG motif at position 18:19.

7. The synthetic tRNA of any one of claims 2 or 4, wherein the sequence modification is a modification to a D-arm or anticodon stem of the tRNA.

8. The synthetic tRNA of claim 1 , wherein the sequence modification is a chemical modification of one or more nucleotides in the sequence.

9. An engineered nucleic acid comprising a nucleotide sequence recognizing a nucleic acid sequence encoding a mammalian CNOT3, the engineered nucleic acid molecule selected from an antisense oligonucleotide (ASO), siRNA, miRNA, a cluster regularly interspaced short palindromic repeats (CRISPR) related nucleic acid, a single guide RNA (sgRNA), a CRISPR- RNA (crRNA), a trans-activating crRNA (tracrRNA), and an aptamer, wherein the engineered nucleic acid modifies the ability of a tRNA to recruit CNOT3 to a cell ribosome and / or modifies the stability of a target mRNA in the cell.

10. The engineered nucleic acid of claim 9, wherein the nucleic acid is an sgRNA having a nucleotide sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to GAGGGACCAAATCAAGACAT (SEQ ID NO: 1) or TCTTGCGGATGGCGTCAACG (SEQ ID NO: 2).

11. A vector comprising the engineered nucleic acid of claim 9 or claim 10.

12. The vector of claim 11 , wherein the vector is a viral vector.

13. A cell comprising the vector of claim 11 or claim 12.

14. The cell of claim 14, wherein the cell is a mammalian cell.

15. A method of modifying a half-life of a target mRNA in a cell, the method comprising: delivering to the cell at least one nucleic acid capable of modifying recruitment of CNOT3 to a ribosome in the cell.

16. The method of claim 15, wherein the nucleic acid is an sgRNA.

17. The method of claim 16, wherein the sgRNA has a nucleotide sequence at least at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to any one of GAGGGACCAAATCAAGACAT (SEQ ID NO: 1) or TCTTGCGGATGGCGTCAACG (SEQ ID NO: 2).

18. A method of modulating half-life of a target mRNA in a cell, the method comprising modifying the cell to express a target mRNA having a sequence modification relative to a wild-type target mRNA, wherein the mRNA sequence modification adds at least one subsequence to the DNA sequence encoding the target mRNA and modifies the half-life of the target mRNA in the cell.

19. The method of claim 18, wherein the modification enhances the half-life of the target mRNA.

20. The method of claim 19, wherein the modification comprises adding one or more codons selected from CGC, AGA, and CGU.

21. The method of claim 19, wherein the modification comprises adding one or more codons selected from AAT, AAC, AAA, AAG, ATT, ATC, ATA, TAT, TAG, TTT, TTC, ATG, and ACU.

22. The method of claim 18, wherein the modification decreases the half-life of the target mRNA.

23. The method of claim 22, wherein the modification comprises adding one or more codons selected from CGG, CGA, and AGG.

24. The method of claim 15, wherein the nucleic acid is a tRNA comprising a U13:A22:A46 triplet.

25. The method of claim 15, wherein the nucleic acid is a tRNA comprising an extra nucleotide preceding the GG motif at positions 18:19.

26. A synthetic tRNA comprising a nucleic acid sequence set forth in any one of SEQ ID NOs. 55-66 or 68-70.

27. A CN0T3 variant comprising an amino acid substitution selected from the group consisting of K105S, R59S, and E95A relative to the amino acid sequence set forth in SEQ ID NO: 327.

28. A pharmaceutical composition comprising the synthetic tRNA of any one of claims 1-8, the engineered nucleic acid of any one of claim 9 or 10, the vector of claim 11 or 12, or the cell of claim 13 or 14, and at least one pharmaceutically acceptable carrier, excipient or delivery agent.

29. The pharmaceutical composition of claim 28, wherein the delivery agent is selected from a lipidoid, a liposome, a lipoplex, a nanoparticle, a lipid nanoparticle, a polymeric compound, a peptide, a protein, a cell, a nanoparticle mimic, a nanotube, and a conjugate.

30. Use of the pharmaceutical composition claim 28 or claim 29, for the treatment of an mRNA- decay associated disease, obesity, a mitochondrial-associated disorder, or a metabolic disorder.

31. A method of treating a subject suffering from or at risk of developing an mRNA-decay associated disease, nonsense mutation associated diseases, obesity, mitochondrial- associated disorder, or a metabolic disorder comprising administering to the subject a pharmaceutical composition of claim 28 or claim 29.

32. The method of claim 31 , wherein the mRNA-decay associated disease is cystic fibrosis, muscular dystrophy, autosomal dominant polycystic kidney disease (ADOKD), ataxia telangiectasia, beta-thalassemia, factor VII deficiency, familial atrial fibrillation, hemophilia B, hepatic carnitine palmitoyltransferase 1A deficiency (CPT1A), heritable pulmonary arterial hypertension (HPAH), late infantile neuronal ceroid lipofuscinosis (LNCL), leukocyte adhesion deficiency 1 (LAD1), methylmalonic acidemia (MMA), Hurler syndrome, nephropathic cystinosis, obesity, peroxisome biogenesis disorder (PBD), renal tubular acidosis (RTA), retinitis pigmentosa (RP), Rett syndrome (RTT), spinal muscular atrophy (SMA), Stuve- Wiedemann syndrome (SMS), X-linked nephrogenic diabetes insipidus (XNDI), or Usher syndrome (USH1).

33. The method of claim 31 , wherein the nonsense mutation associated disease is betathalassemia, Marfan synfrome, Duchenne Muscular Dystrophy, Becker Muscular Dystrophy, Ullrich disease, Hurler syndrome, cancer, cystic fibrosis, Spinal muscular atrophy, amylosis, LINCL (Late Infantile Neuronal Ceroid Lipofuscinosis), Haemophilia, Alzheimer's disease, Atherosclerosis, Gigantism, Dwarfism, Hypothyroidism, Hyperthyroidism, Obesity, Parkinson's disease, Niemann Pick disease, Family hypercholesterolemia, and retinitispigmentosa.

Images