APP-targeting RNA interference method, nucleic acid, and use thereof
By using isolated nucleic acid molecules and vector delivery systems, the expression of the APP gene is specifically inhibited, solving the problems of low efficiency and off-target effects in the delivery of artificial miRNAs in existing technologies, and achieving effective treatment for Alzheimer's disease.
Patent Information
- Application Number
- PCT/CN2025/101751
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-06-18
- Filing Date
- 2025-06-18
- Publication Date
- 2025-12-26
AI Technical Summary
Existing technologies are difficult to deliver artificial miRNAs to target tissues efficiently and safely to specifically inhibit APP gene expression, and there are off-target effects, so they have not been effectively used to treat Alzheimer's disease.
The isolated nucleic acid molecules, containing pri-miRNA sequences encoding the inhibition of APP gene expression, are delivered into cells via vectors for processing into specific miRNAs. These miRNAs are then delivered to target cells using exosomes, avoiding off-target effects.
It achieves efficient and specific inhibition of APP gene expression and significantly reduces APP protein levels, showing potential therapeutic effects for Alzheimer's disease.
Smart Images

Figure PCTCN2025101751-FTAPPB-I100001 
Figure PCTCN2025101751-FTAPPB-I100002 
Figure PCTCN2025101751-FTAPPB-I100003
Abstract
Description
RNA interference methods for targeting APP, nucleic acids and their applications
[0001] This application claims priority to Chinese Patent Application No. 202410789681.8, filed on June 18, 2024, entitled "RNA Interference Method for Targeting APP, Nucleic Acid and Its Application", the entire contents of which are incorporated herein by reference. Technical Field
[0002] This invention relates to the fields of molecular biology and pharmaceuticals. Specifically, this invention relates to systems for delivering precursor miRNAs and their applications in disease treatment. Background Technology
[0003] Alzheimer's disease (AD) is a syndrome characterized by cognitive, behavioral, and personality changes caused by impaired brain function in older adults. Its main symptoms include memory loss, forgetfulness, loss of calculation ability, and eventual disability. Globally, according to the Alzheimer's Disease International (ADI) World Alzheimer's Report 2018, there are at least 50 million people with dementia worldwide, a number projected to reach 152 million by 2050, with approximately 60%–70% of them suffering from Alzheimer's disease. The main pathological changes in Alzheimer's disease include senile plaques, neurofibrillary tangles, and neuronal loss in the brain.
[0004] β-amyloid protein (Aβ) is a major component of senile plaques in the brain. Amyloid precursor protein (APP) is expressed in most tissues. Before immature APP reaches the cell surface, it undergoes a complex metabolic process in the Golgi apparatus, namely O- and N-terminal glycosylation and phosphorylation. Aβ is a fragment produced by cleavage between residues 672 and 711 of APP. It contains the last 28 residues of the extracellular region of Aβ and 14 residues of the transmembrane region (encoded by exons 16 and 17, respectively). Under normal circumstances, APP is mainly cleaved by α-secretase and γ-secretase to produce the non-pathogenic fragment P3, which does not form Aβ. However, when the gene encoding APP is mutated or other reasons lead to abnormally increased β-secretase activity, APP is easily cleaved by β-secretase and γ-secretase to produce Aβ. Aβ mainly includes two molecules, Aβ40 and Aβ42, composed of 39–43 amino acids. Aβ42 is more hydrophobic than Aβ40 and is more prone to aggregation.
[0005] RNA interference (RNAi) is a gene silencing phenomenon at the mRNA level triggered by double-stranded RNA, targeting specific sequences. It is widespread in animals, plants, and viruses, and mainly includes two pathways: small interfering RNA (siRNA) and microRNA (miRNA).
[0006] Endogenous miRNAs are hairpin-shaped secondary structures found in many primary RNA transcripts (pri-miRNAs). In the nucleus, the Drosha / DGCR8 complex binds to and cleaves the basal stem of the pri-miRNA to release stem-loop precursor miRNAs (pre-miRNAs). These pre-miRNAs are then exported from the nucleus, and the loop is cleaved by Dicer / TRBP to form a mature RNA double strand. The guide strand, also known as the target strand, separates from the target strand and loads onto the argonaute protein in the RNA-induced silencing complex (RISC), which then targets complementary mRNA transcripts for degradation or translational repression.
[0007] Artificial miRNA (amiRNA) technology involves replacing the mature sequence of natural miRNA with an artificially designed antisense sequence targeting other genes of interest. This achieves the effect of RNAi (RNAi) through the generation and action pathway of natural miRNA, offering advantages such as significant interference, rapid action, and low toxicity, and possessing broad application prospects. amiRNAs are typically generated intracellularly from expression vectors through transcription and processing, and their mechanism of action is the same as or similar to that of natural miRNAs. However, since the precursor processing mechanisms and action processes of miRNAs in vivo are not fully understood, further research is needed to ensure the expected normal synthesis of amiRNAs and to optimize their production levels. In addition to sequence specificity, factors affecting the silencing effect of amiRNAs include uncertainties such as the amiRNA's backbone sequence, cleavage sites, and synergistic interactions with other small molecules or proteins.
[0008] Various delivery systems have been employed in the art to safely and accurately deliver artificial miRNAs or siRNAs to target tissues in the form of pri-miRNAs or pre-miRNAs. However, there is still a need in the art for improved methods and approaches to deliver artificial miRNAs with higher efficiency and fewer off-target effects, and for their use in drugs to treat Alzheimer's disease. Summary of the Invention
[0009] This invention provides nucleic acid molecules and methods for regulating (increasing or decreasing) the level or amount of amyloid precursor protein (APP) mRNA. Specifically, this invention provides nucleic acid molecules for delivering primary microRNAs (pri-miRNA or pri-miR) to form precursors and microRNAs (miRNA or miR) after in vivo processing.
[0010] Specifically, the present invention provides an isolated nucleic acid comprising a nucleic acid sequence encoding RNA that inhibits APP gene expression, wherein the nucleic acid sequence comprises a miRNA sequence that inhibits APP gene expression.
[0011] In one aspect, the nucleic acids provided by the present invention are used to deliver primary microRNAs or precursor microRNAs into the body, which are processed intracellularly to produce highly specific artificial microRNAs or siRNAs that reduce APP expression.
[0012] The term "microRNA (or miRNA or miR)" as used herein refers to a non-coding RNA of 19-25 nucleotides in length that binds to the 3′UTR of a nucleic acid molecule and downregulates gene expression (by reducing the stability of the nucleic acid molecule or by inhibiting translation). The regulatory polynucleotides of this invention may comprise one or more microRNA sequences, microRNA seeds, or artificial microRNAs, for example, sequences that function as microRNAs.
[0013] The term "pre-miRNA" in this article refers to precursor microRNAs. Pre-miRNAs are approximately 70 base pairs long and are generated in the cell nucleus after being cleaved by Drosha. Pre-miRNAs are exported into the cytoplasm via export protein 5, where they are processed by the nuclease Dicer to form mature miRNAs.
[0014] The term "siRNA" in this article refers to small interfering RNA, sometimes also called short interfering RNA or silent RNA. It is a type of double-stranded RNA, typically 17-24 base pairs in length. It interferes with the expression of specific genes by degrading mRNA with a nucleotide sequence complementary to the antisense strand (also known as the guide strand) of the siRNA, thereby preventing translation.
[0015] The polynucleotide provided by this invention can efficiently deliver exogenous nucleotide sequences to exosomes, and after the exosomes reach the target cells, they can specifically inhibit the target genes in the target cells, and can minimize off-target side effects.
[0016] In one aspect of the invention, an isolated nucleic acid is provided, comprising a nucleic acid sequence encoding a pri-miRNA that represses APP gene expression. The pri-miRNA comprises a miRNA sequence that represses the APP gene, and one or more of a compensating sequence comprising a flanking structure sequence, a stem-loop structure, and the RNA sequence. In one embodiment of the invention, the nucleic acid sequence of the pri-miRNA in the nucleic acid comprises, from 5' to 3', a 5' flanking structure sequence, the miRNA sequence that represses the gene expression, a stem-loop sequence, a compensating sequence, and a 3' flanking structure sequence.
[0017] As used in this article, "isolated" means that a substance has been separated from its original environment. For example, nucleic acids and polypeptides in their native state within living cells are not isolated and purified, but the same nucleic acid or polypeptide is isolated if it is separated from other substances present in its native state.
[0018] In one embodiment of the invention, the nucleic acid comprises multiple copies of the nucleic acid sequence of the pri-miRNA. In one embodiment of the invention, the multiple copies are 2-10 copies, preferably 2-5 copies, more preferably 2-3 copies. For example, it includes 2, 3, or 4 copies.
[0019] In one embodiment of the invention, the sequences encoding the pri-miRNAs that suppress gene expression of the plurality of copies in the aforementioned nucleic acids have spacer sequences between them. In another embodiment of the invention, the spacer sequences have 6-50 nucleotides, preferably 10-30 nucleotides. In one embodiment, the spacer sequences have the following nucleotide sequence: AGATCTGGCCGCACTCGACCAGTGGATCC (SEQ ID NO: 16).
[0020] Specifically, in one aspect of the present invention, the pri-miRNA has the structure of Formula I:
[0021] Where "|" represents base pairing (A1A2…A a-1 A a (B) is the first RNA sequence; b B b-1 …B2B1) is the second RNA sequence, (A1A2…A a-1 A a ) and (B b B b-1 …B2B1) completely complementary or substantially completely complementary, wherein a and b are each independent integers of about 15-29, preferably integers of about 18-22;
[0022] [M1M2…M m-1 M m [N] is the 5' end flank structure sequence; n N n-1 …N2N1] is the 3' end flanking structure sequence, where m and n are each independent integers of approximately 25-50, preferably, m <n;
[0023] The septal sequence that forms the stem-loop structure is called the C-stem-loop.
[0024] Where c is an integer of approximately 10-30, preferably an integer of approximately 16-20.
[0025] The pri-miRNA provided by this invention, after biological processing (in vivo, in tissues, or in cells, etc.) (hereinafter referred to as "processing"), generates pre-miRNA or miRNA, ultimately producing an RNA sequence targeting the target mRNA. In this invention, the 5' flanking structural sequence (such as [M1M2…M...M...) in Formula I... m-1 M m ]) and the first RNA sequence (such as A1A2…A in Formula I) a-1 A a The structure composed of 3' flanking structures (such as [N in Formula I]) is also called the 5' arm, and the first RNA sequence in it is called the 5' arm RNA sequence or 5' arm miRNA. Correspondingly, the structure is composed of 3' flanking sequences (such as [N in Formula I]). n N n-1 …N2N1]) and the second RNA sequence (as shown in Formula I, B) b B b-1 The structure consisting of …B2B1) is also called the 3' arm, and the second RNA sequence therein is called the 3' arm RNA sequence or 3' arm miRNA. The pre-miRNA provided by this invention contains an RNA sequence targeting the target mRNA, which can be located or situated on the 5' arm or 3' arm of the stem-loop structure of the regulatory polynucleotide, i.e., the first miRNA sequence or the second miRNA sequence. The pre-miRNA provided by this invention can generate one or two single-stranded mature miRNAs. Based on processing from the 5' and 3' arms of the precursor, the corresponding first miRNA sequence (A1A2…A…B1) is... a-1 A a The single-stranded mature miRNA can be called miRNA-5p, corresponding to the second miRNA sequence (B). b B b-1 Mature miRNAs of …B2B1 can be called miRNA-3p.
[0026] miRNAs can be substantially complementary to at least a portion of the sequence of the mRNA encoding a gene. "Substantially complementary" means that the nucleotide sequences are sufficiently complementary to interact in a predictable manner, such as forming secondary structures. Typically, two "substantially complementary" nucleotide sequences have at least 70% complementary nucleotides; preferably, at least 80%; more preferably, at least 90%; and even more preferably, at least 95%; such as 98%, 99%, or 100%. Functionally, miRNAs interfere with the post-transcriptional degradation of mRNA expressing a specific gene with a complementary nucleotide sequence, thereby preventing translation.
[0027] In one aspect of the invention, the miRNA is 15-29 nucleotides (nt) in length, preferably 18-22 nt, such as 18 nt, 19 nt, 20 nt, 21 nt, or 22 nt. Extensive testing has shown that RNA sequences shorter than 18 nt, especially less than 15 nt, are mostly ineffective. Conversely, RNA sequences longer than 22 nt, especially greater than 25 nt, not only significantly increase circuit costs but also do not outperform 18-22 nt sequences, resulting in poor economic efficiency. Therefore, miRNA sequences with a length of 15-25 nt, particularly 18-22 nt, are most effective.
[0028] In one aspect of the present invention, the pri-miRNA provided by the present invention, after biological processing, essentially yields only miRNAs with the sequence of the first miRNA, while the other RNA sequence does not form or hardly forms miRNA. In one embodiment of the present invention, the miRNA with the sequence of the first miRNA obtained after in vivo processing of the pri-miRNA provided by the present invention is active, that is, the 5' arm miRNA is active, while the miRNA with the sequence of the second miRNA is almost impossible to obtain, that is, the 3' arm miRNA is inactive or almost inactive.
[0029] In one aspect of the invention, the almost non-formed miRNA obtained after biological processing of the pri-miRNA provided by the invention accounts for less than 40% of the total miRNA obtained after processing the pri-miRNA, preferably less than 10%, more preferably less than 5%, for example less than or equal to 2%.
[0030] In one aspect of the invention, the target knockdown (KD) of the target mRNA that inhibits the miRNA sequence of the gene obtained by in vivo processing of the pri-miRNA of the nucleic acid provided by the invention is at least higher than about 30%, about 40%, 50%, 90%, 95%, or up to 99%.
[0031] In one aspect of the invention, the miRNA sequence of the nucleic acid pri-miRNA provided by the invention, after in vivo processing, inhibits the expression of the gene by a protein target knockdown of at least 40%, 50%, 90%, 95%, or up to 99%.
[0032] In one aspect of the invention, the target knockdown achieved by the pri-miRNA provided by the invention, which is almost non-formed after biological processing, is less than about 40%, 10%, 5%, or close to 0%.
[0033] In one aspect of the present invention, the pri-miRNA provided by the present invention, after biological processing, essentially produces miRNA without off-target effects.
[0034] In one embodiment of the present invention, the miRNA sequence that inhibits APP gene expression has the following nucleotide sequence: ATGAGTTTCGCAAACATCCAT (SEQ ID NO: 17); TAGTCATGCAAGTTGGTACTC (SEQ ID NO: 19); TAGGCAAGTTCTTTGCTTGAC (SEQ ID NO: 21); TGATTCTGTACAATCATCCTG (SEQ ID NO: 23); TTGGCTTCTACCACATTGGTG (SEQ ID NO: 25); TATGACAACACCGCCCACCAT (SEQ ID NO: 27); ATAGAATACATTACTGATGTG (SEQ ID NO: 29); or ATGTCATAAGCAATGATTCTG (SEQ ID NO: 31).
[0035] In one embodiment of the present invention, the combination of the RNA sequence that inhibits APP gene expression and its compensating sequence is a sequence group having the following nucleotide sequences:
[0036] In one embodiment of the present invention, the RNA that inhibits APP gene expression is pri-miRNA, which has a stem-loop structure. In one embodiment of the present invention, the sequence of the stem-loop structure has the following nucleotide sequence: GTTTTGGCCTCTGACTGAC (SEQ ID NO: 13).
[0037] In one embodiment of the present invention, the RNA that inhibits APP gene expression is pri-miRNA, which has a 5' flanking sequence (such as [M1M2…M in Formula I). m-1 M m ]) and the 3' end flank structure sequence (as shown in Equation I [N n N n-1 …N2N1]. In one embodiment of the invention, the 5' end flanking structure sequence and the 3' end flanking structure sequence each independently or simultaneously share greater than 80% identity with the pri-miR sequence of mammals (especially humans), preferably greater than 90%, preferably greater than 95%, and preferably 100%. In one embodiment of the invention, the pri-miR is pri-miR155.
[0038] In one embodiment of the present invention, the 5' flanking structure sequence of the pri-miRNA has the following nucleotide sequence: TGGAGGCTTGCTGAAGGCTGTATGCTG (SEQ ID NO: 14).
[0039] In one embodiment of the present invention, the 3' flanking structure sequence of the pri-miRNA has the following nucleotide sequence: CAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCCCAGATCTGGCCGCA (SEQ ID NO: 15).
[0040] In one aspect of the invention, the invention also provides a pre-miRNA, which is processed from the pri-miRNA of the invention described above.
[0041] The present invention also provides isolated nucleic acids encoding a combination of RNAs that inhibit the expression of one or more target genes. The nucleic acids comprise (1) a nucleic acid sequence encoding RNA that inhibits the expression of the APP gene, and (2) a nucleic acid sequence encoding RNA that inhibits the expression of a second gene.
[0042] In one aspect of the present invention, the second gene includes the TAU gene, LRRK2 gene, EGFR gene, KRAS gene, VEGFR gene, mTOR gene, TNF-α gene, integrin-α gene, B7 gene, TGF-β1 gene, HER2 gene, H2-K gene, H2-D gene, H2-L gene, HLA gene, GDF15 gene, miRNA-21, miRNA-214, TNC gene, PTP1B gene, PD-1, PD-L1, CTLA4, PTGS2 gene, TTR gene, SNCA gene, FUS gene, FGFR4 gene, FGF19 gene, CTNNB1 gene, KHK gene, mHTT gene, and α-synuclein gene, etc.
[0043] In one embodiment of the present invention, the second gene is the TAU gene.
[0044] In one embodiment of the invention, in the isolated nucleic acid of the combination encoding RNA that inhibits the expression of one or more target genes, a spacer sequence is provided between the sequence encoding the RNA that inhibits the expression of the APP gene and the sequence encoding the RNA that inhibits the expression of the second gene. In another embodiment of the invention, the spacer sequence has 6-50 nucleotides, preferably 10-30 nucleotides.
[0045] In another aspect of the invention, a vector is provided comprising isolated nucleic acids comprising the aforementioned nucleic acid sequences of the invention, including RNA encoding repressive APP gene expression and repressive APP and second gene expression. In yet another aspect of the invention, the vector is an expression vector. The nucleic acids of the invention may be located downstream of a promoter of the vector (e.g., but not limited to, CMV, U6, CBA, or a CBA promoter having SV40 introns).
[0046] In one embodiment of the invention, the vector is a plasmid. In one embodiment of the invention, after administration to a mammal, the plasmid can be enriched in tissues (including: liver, lungs, gastrointestinal tract, mammary glands, kidneys, brain, spleen, lymph nodes, thyroid gland, reproductive organs, blood cells or lymphocytes, especially the liver), transcribe and / or express the RNA fragment of the invention, and the RNA fragment is encapsulated in exosomes within the cells of the tissue.
[0047] In one embodiment of the present invention, the vector is a viral vector. For example, it may be a baculovirus expression vector, an adenovirus vector, a retrovirus vector, a herpesvirus vector, or a lentivirus vector. In one embodiment of the present invention, the vector is an adenovirus vector, such as adenovirus-associated virus type 5, adenovirus-associated virus type 8, or adenovirus-associated virus type 9.
[0048] In one embodiment of the invention, the plasmid or viral vector is enriched and expressed in the liver of a mammal after administration, and its product is encapsulated in large quantities in exosomes.
[0049] In one aspect of the invention, a cell comprising the isolated nucleic acid of the invention as described above is provided. Cells comprising the nucleic acid of the invention as described above can be obtained by transfecting cells with plasmids or viral vectors. Transfection of cells with nucleic acid constructs can be performed using various methods. These methods include, but are not limited to, cationic lipid transfection, electroporation, viral transfection, and calcium phosphate transfection.
[0050] In one aspect of the invention, an exosome is provided containing RNA that inhibits APP gene expression, comprising the pri-miRNA, pre-miRNA, or RNA molecule of the present invention as described above. In one embodiment of the invention, the exosome is an exosome derived from human tissue or cells. The tissue includes the liver, lungs, gastrointestinal tract, mammary gland, kidney, brain, spleen, lymph nodes, thyroid gland, reproductive organs, blood cells, or lymphocytes. In one embodiment of the invention, the exosome is an exosome derived from the liver or liver cells.
[0051] The exosomes of the present invention can be purified using known exosome purification techniques. For example, exosomes can be purified by tangential flow filtration (TFF) or ultracentrifugation, for example, at 100,000 x g for 1-2 hours. Alternative or additional purification methods can be used, such as antibody-based methods, such as immunoprecipitation using specific antibodies, magnetic bead purification, or resin-based purification. The exosomes can then be quantified and characterized.
[0052] The RNA provided by this invention can be delivered to different tissues to inhibit specific target genes and treat related diseases. For example, siRNA targeting the APP and / or TAU genes can be used to treat Parkinson's disease in the brain.
[0053] In one aspect of the invention, a pharmaceutical composition is provided comprising the nucleic acid, carrier, or cell as described above. The pharmaceutical composition further includes a pharmaceutically acceptable carrier or excipient for delivering the nucleic acid, carrier, or cell to a subject.
[0054] The drug can be administered orally, by inhalation, subcutaneously, intramuscularly, or intravenously. The dosage form of the drug can be tablets, capsules, powders, granules, pills, suppositories, ointments, solutions, suspensions, lotions, gels, pastes, etc. After administration to mammals, the plasmids or viral vectors in the drug accumulate in tissues (including the liver, lungs, gastrointestinal tract, mammary glands, kidneys, brain, spleen, lymph nodes, thyroid gland, reproductive organs, blood cells or lymphocytes, especially the liver). The products expressed are encapsulated in large quantities in exosomes within the cells of these tissues and delivered to the target tissue to exert a therapeutic effect.
[0055] The pharmaceutical composition can be used to treat amyloidosis, for example, from the group consisting of rheumatoid arthritis, juvenile chronic arthritis, ankylosing spondylitis, psoriasis, psoriatic arthritis, Leter syndrome, adult Still's disease, Bechtel syndrome, Crohn's disease, leprosy, tuberculosis, bronchiectasis, bedsores, chronic pyelonephritis, osteomyelitis, Whipple's disease, Hodgkin's lymphoma, kidney cancer, cancers of the digestive tract, cancers of the lung, cancers of the genitourinary tract, basal cell carcinoma, hairy cell leukemia, familial Mediterranean fever, and Kassman's disease.
[0056] In one aspect of the invention, the pharmaceutical composition can be used to treat amyloidosis. Examples of amyloidosis include AA type amyloidosis, AL type amyloidosis, Alzheimer's disease, mild cognitive impairment, amyloid polyneuropathy, Mediterranean fever, Mueller-Weil syndrome, reactive systemic amyloidosis associated with systemic inflammatory diseases, myeloma or macroglobulinemia-related amyloidosis, amyloidosis associated with immune cell humoral imbalances, monoclonal amyloidosis, occult humoral imbalances, or focal nodular amyloidosis associated with chronic inflammatory diseases.
[0057] The pharmaceutical composition can be used to treat a variety of diseases, including tumors, acute and chronic infectious diseases, or other acute and chronic illnesses. The acute and chronic infectious diseases include viral influenza, viral hepatitis, AIDS, viral diseases such as SARS, bacterial diseases (e.g., tuberculosis, bacterial pneumonia), and other acute and chronic infectious diseases caused by various pathogenic microorganisms. The other acute and chronic diseases include respiratory diseases, immune system diseases, blood and hematopoietic system diseases such as cardiovascular diseases, endocrine and metabolic diseases, digestive system diseases, nervous system diseases, urinary system diseases, reproductive system diseases, and musculoskeletal system diseases. For example, these diseases include cancer, pulmonary fibrosis, colitis, obesity, cardiovascular diseases caused by obesity, type 2 diabetes, Huntington's disease, Parkinson's disease, myasthenia gravis, Alzheimer's disease, or graft-versus-host disease.
[0058] In one aspect of the invention, a method of treating a disease is provided, comprising administering to a subject a nucleic acid, vector, or exosome as described above. The disease includes tumors, acute or chronic infectious diseases, or other acute or chronic illnesses.
[0059] Those skilled in the art will understand that the actual dose administered varies depending on a variety of factors, such as the carrier, target cells or tissue, the general condition of the subject to be treated, the degree of transformation / modification sought, the route of administration, the manner of administration, the type of transformation / modification sought, and so on. Detailed Implementation
[0060] The following will further illustrate the essence and beneficial effects of the present invention with reference to embodiments. These embodiments are only used to illustrate the present invention and are not intended to limit the present invention.
[0061] Example 1: Materials and Methods
[0062] Table 1. Cells, Materials, and Reagents:
[0063] Example 2 Nucleic Acid Synthesis and Plasmid Preparation
[0064] 1. Suzhou Hongxun Biotechnology Co., Ltd. was commissioned to synthesize or prepare the nucleic acid fragments listed in Table 2 below. The sequence of the pri-miRNA is shown in the table below.
[0065] Table 2. Sequence and structure of single-copy pri-miRNA
[0066] Among them, miAPP-1 to miAPP-8 are nucleic acid fragments of pri-miRNA encoding a protein that represses the expression of a single pri-miRNA of the APP gene, which contain RNA sequences of mRNA targeting APP. miAPP-4.m3bp and miAPP-4.match are nucleic acid fragments encoding pri-miRNA in another embodiment.
[0067] The structure of the single pri-miRNA sequence from 5' to 3' includes: 5' flanking sequence TGGAGGCTTGCTGAAGGCTGTATGCTG (SEQ ID NO: 14); miRNA sequence; stem-loop structure sequence GTTTTGGCCTCTGACTGAC (SEQ ID NO: 13); compensation sequence; 3' flanking sequence CAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCCCAGATCTGGCCGCA (SEQ ID NO: 15).
[0068] miAPP-2-scramble and miAPP-4-scramble are control nucleic acid fragments, which do not have fragments that are largely complementary to APP.
[0069] Among them, the combinations of miRNA sequences and compensation sequences of miAPP-1 to miAPP-8, miAPP-4.m3bp and miAPP-4.match, and the corresponding sequence fragments in the control nucleic acid are as follows:
[0070] Table 3. miRNA sequences of pri-miRNA
[0071] 2. Construct a pri-miRNA nucleic acid fragment containing the above-mentioned APP-inhibiting agent and a plasmid expressing the contained miRNA.
[0072] The above-mentioned nucleic acid fragments encoding pri-miRNA were inserted into the pcDNA6.2-EmGFP-mir9 vector to prepare plasmids carrying the pri-miRNA sequence targeting APP. The resulting plasmids were named miAPP-1 to miAPP-8, miAPP-4.m3bp and miAPP-4.match, as well as miAPP-2-scramble and miAPP-4-scramble.
[0073] Example 3: Preparation and Analysis of Cells and Exosomes
[0074] The plasmid prepared in Example 2 was transfected into HEK293T cells, and exosomes in the cell culture medium were observed. Nanoparticle tracking analysis (NTA) showed that the number and size distribution of secreted exosomes were similar in each group, with peak values between 128-131 nm. Transmission electron microscopy (TEM) confirmed that the purified exosomes exhibited typical round vesicle morphology and were of the correct size. Furthermore, the enrichment of specific exon markers (CD63, TSG101, and CD9) was detected only in the purified exosomes and not in the cell culture medium. Exosomal RNA was extracted and miRNAs were analyzed to determine the miRNA composition, including the amount and ratio of 5' arm miRNA (i.e., the first miRNA) and 3' arm miRNA (i.e., the second miRNA) in the exosomal RNA.
[0075] The results are shown in Table 4 below.
[0076] Table 4. Detection of miRNA composition.
[0077] Example 4 miRNA activity
[0078] 1. Reporter gene assay for relative miRNA activity
[0079] The miRNA target sequence was inserted into the pmirGLO vector (Promega) to prepare APP_pmirGLO, and the resulting plasmid was named APP_pmirGLO.
[0080] The pmirGLO vector (Promega) can simultaneously express firefly and reniform luciferase. An APP gene target sequence is inserted into the 3'UTR downstream of the firefly luciferin gene in the pmirGLO vector to construct APP_pmirGLO, which is used to detect miRNA activity targeting APP.
[0081] 293T cells (Chinese Academy of Sciences Cell Bank) were seeded overnight in 96-well plates at a density of 20,000 cells per well. A mixture of 20 μL optiMEM, 100 ng APP_pmirGLO plasmid, 300 ng miRNA plasmid, 0.8 μL Lipofectamin 3000 (Thermo Fisher), and 0.8 μL P3000 (Thermo Fisher) was incubated at room temperature for 10 minutes per well. The entire transfection complex was then added to the 96-well plates, with three replicates per group. After 24 hours, a reporter gene substrate (Promega) was added, and the luminescence signal was detected. The relative activity of the miRNA was calculated using the Firefly / Renilla ratio.
[0082] The results are shown in Table 5 below.
[0083] Table 5 Reporter gene activity detection
[0084] 2. Changes in APP mRNA and protein levels
[0085] 293T cells were seeded overnight in 6-well plates at a density of 1.2E6 cells per well. The cells were then transfected with Lipofectamin 3000 at a density of 2.5ug miRNA plasmid per well. Cells were harvested 48 hours after transfection.
[0086] APP mRNA changes were detected by qPCR after cellular mRNA extraction. RNA was extracted using a total RNA extraction kit (UE) according to the manufacturer's instructions, and reverse transcription was performed using a Takara reagent. qPCR was then performed using APP / GAPDH / β-actin primers. The primer sequences are as follows:
[0087] The results are shown in Table 6 below.
[0088] Table 6 miRNA activity assay - mRNA target knockdown (KD)
[0089] In addition, Western blotting was used to detect changes in cellular APP protein. A portion of cells were lysed using RIPA (Beyotime), and the total protein concentration was measured using the BCA method (Adamas Life). BSA standard was diluted, and 20 μL of sample or standard was added to each well, along with 200 μL of reaction reagent. The mixture was incubated at 37°C for 30 minutes, and the OD value was measured using a Thermo Fisher microplate reader (562m). The total protein concentration of the sample was calculated based on the standard curve.
[0090] After adding 4X LDS (Thermo Fisher) to the sample, heat at 70℃ for 10 min, load the sample onto an SDS-PAGE gel for transfer, add APP (Abcam) and Vinculin (Abcam) antibodies for incubation, and image and perform grayscale analysis of the APP and Vinculin bands on a TANON 5200multi imager and software.
[0091] The results are shown in Table 7 below.
[0092] Table 7 miRNA activity assay - protein target knockdown (KD)
[0093] Example 5: In vivo animal experiments
[0094] Wild-type C57 mice were divided into three groups of three mice each. The mice were administered saline, miAPP-4 (a pri-miRNA plasmid carrying APP targeting vector prepared as in Example 2 using pcDNA6.2-EmGFP-mir9), and 10 mg / kg of saline, pr, seven times at two-day intervals. Brain tissue was collected 24 hours after the last administration to detect APP mRNA. The results are shown in Table 8 below.
[0095] Table 8: miAPP-4 downregulates mRNA expression in mouse brain
[0096] The results showed that miAPP-4 could reduce the mRNA expression of APP in the mouse brain.
[0097] The foregoing description of the present invention should not be construed as limiting it. Unless otherwise indicated, the present invention will be practiced using conventional techniques such as organic chemistry, polymer chemistry, and biotechnology, and it is obvious that the invention can be implemented in other ways besides those specifically described in the foregoing description and examples. Other aspects and modifications within the scope of the invention will be apparent to those skilled in the art. Many changes and variations are possible based on the teachings of the present invention, and therefore fall within its scope.
Claims
1. An isolated nucleic acid comprising a nucleic acid sequence encoding RNA that represses APP gene expression, said nucleic acid sequence comprising a miRNA sequence that represses the APP gene.
2. The nucleic acid of claim 1, wherein the RNA is pri-miRNA, which comprises, from 5' to 3', a 5' flanking structure sequence, a miRNA sequence that inhibits APP gene expression, a stem-loop sequence, a compensation sequence, and a 3' flanking structure sequence.
3. The nucleic acid of claim 2, comprising a plurality of copies of the nucleic acid sequence of the pri-miRNA, wherein the plurality of copies is 2 to 10 copies, for example, 2, 3 or 4 copies.
4. The nucleic acid according to any one of claims 1-3, further comprising a nucleic acid sequence encoding RNA that inhibits the expression of a second gene, wherein the second gene is selected, for example, from the TAU gene, LRRK2 gene, EGFR gene, KRAS gene, VEGFR gene, mTOR gene, TNF-α gene, integrin-α gene, B7 gene, TGF-β1 gene, HER2 gene, H2-K gene, H2-D gene, H2-L gene, HLA gene, GDF15 gene, miRNA-21, miRNA-214, TNC gene, PTP1B gene, PD-1, PD-L1, CTLA4, PTGS2 gene, TTR gene, SNCA gene, FUS gene, FGFR4 gene, FGF19 gene, CTNNB1 gene, KHK gene, mHTT gene, and α-synuclein gene.
5. The nucleic acid according to claim 1, wherein the miRNA sequence for inhibiting APP gene expression has the following nucleotide sequence: ATGAGTTTCGCAAACATCCAT (SEQ ID NO: 17); TAGTCATGCAAGTTGGTACTC (SEQ ID NO: 19); TAGGCAAGTTCTTTGCTTGAC (SEQ ID NO: 21); TGATTCTGTACAATCATCCTG (SEQ ID NO: 23); TTGGCTTCTACCACATTGGTG (SEQ ID NO: 25); TATGACAACACCGCCCACCAT (SEQ ID NO: 27); ATAGAATACATTACTGATGTG(SEQ ID NO: 29); or ATGTCATAAGCAATGATTCTG (SEQ ID NO: 31).
6. The nucleic acid according to claim 5, wherein the combination of the miRNA sequence that inhibits APP gene expression and its compensating sequence constitutes a sequence group having the following nucleotide sequences:
7. The nucleic acid according to claim 1, wherein the RNA that inhibits APP gene expression has a stem-loop structure and its sequence has the following nucleotide sequence: GTTTTGGCCTCTGACTGAC (SEQ ID NO: 13).
8. The nucleic acid according to claim 1, wherein the RNA that inhibits APP gene expression has a 5' flanking structure sequence and a 3' flanking structure sequence, each of which independently or simultaneously shares greater than 80% identity with the pri-miR sequence of mammals or humans, preferably greater than 95%, more preferably 100%.
9. The nucleic acid according to claim 8, wherein the 5' flanking structure sequence has the following nucleotide sequence: TGGAGGCTTGCTGAAGGCTGTATGCTG (SEQ ID NO: 14), and / or the 3' flanking structure sequence has the following nucleotide sequence: CAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCCCAGATCTGGCCGCA (SEQ ID NO: 15).
10. The nucleic acid of claim 3, wherein the nucleic acid sequences encoding the RNA that inhibits the expression of the APP gene, and the nucleic acid sequences encoding the RNA that inhibits the expression of the second gene, have spacer sequences between them and between them.
11. A vector comprising encoding the isolated nucleic acid of any one of claims 1-10.
12. A cell comprising the nucleic acid of any one of claims 1-10 or the vector of claim 11. Preferably, the exosomes in the cells contain RNA obtained by in vivo processing of the pri-miRNA.
13. An exosome comprising the RNA according to claim 25.
14. A method for regulating gene activity in target cells, comprising administering a nucleic acid according to any one of claims 1-10 or a vector according to claim 11, a cell according to claim 12 or an exosome secreted by said cell, or an exosome according to claim 13.
15. A pharmaceutical composition comprising the nucleic acid of any one of claims 1-10 or the carrier of claim 11, the cell of claim 12 or the exosome secreted by the cell, or the exosome of claim 13.
16. A method of treating a disease, comprising administering a nucleic acid according to any one of claims 1-10 or a vector according to claim 11, a cell according to claim 12 or an exosome secreted by said cell, or an exosome according to claim 13.
17. Use of the nucleic acid of any one of claims 1-10, or the vector of claim 11, the cell of claim 12, or the exosomes secreted by the cell, or the exosomes of claim 13, in the preparation of a medicament for treating a disease.
18. The use of claim 17, wherein the disease is an amyloidosis, such as selected from rheumatoid arthritis, juvenile chronic arthritis, ankylosing spondylitis, psoriasis, psoriatic arthritis, Leter syndrome, adult Still's disease, Bechtel syndrome, Crohn's disease, leprosy, tuberculosis, bronchiectasis, bedsores, chronic pyelonephritis, osteomyelitis, Whipple's disease, Hodgkin's lymphoma, renal cell carcinoma, cancers of the digestive tract, cancers of the lungs, cancers of the genitourinary tract, basal cell carcinoma, hairy cell leukemia, familial Mediterranean fever, and Kassman's disease.
19. The use of claim 18, wherein the disease is amyloidosis, such as AA amyloidosis, AL amyloidosis, Alzheimer's disease, mild cognitive impairment, amyloid polyneuropathy, Mediterranean fever, Muller-Weil syndrome, reactive systemic amyloidosis associated with systemic inflammatory diseases, myeloma or macroglobulinemia-associated amyloidosis, amyloidosis associated with immune cell humoral dysregulation, monoclonal amyloidosis, occult humoral dysregulation, or focal nodular amyloidosis associated with chronic inflammatory diseases.
Citation Information
Patent Citations
Vector for expressing miRNA and / or protein and application of vector
CN102517313A
Double-stranded nucleotide sequence, recombinant plasmid containing the same and construction method thereof
CN102533742A
Compositions and methods for making engineered t cells
US20210155941A1
Compounds and methods for reducing APP expression
US20220380773A1
APP irna compositions and methods of use thereof for treating or preventing diseases characterized by enlarged endosomes
WO2023039503A2