Engineered gene transcriptional repression tool and use thereof

Abstract

The present application relates to an engineered gene transcriptional repression tool and a use thereof, in particular to an epigenetic editor, comprising a transcription activator-like effector (TALE) domain, at least one epigenetic modification domain, and at least one transcriptional regulatory domain, wherein the domains can be directly or indirectly linked; or the domains form various fusions and interact by means of recruitment.

Description

Engineered gene transcription repression tools and uses thereof TECHNICAL FIELD

[0001] The present application relates to the field of biological medicine, in particular to an epigenetic editing agent and uses thereof. BACKGROUND

[0002] Abnormalities in genomic epigenetic modifications are closely related to the occurrence and development of many diseases, such as common metabolic disorders, cardiovascular diseases and cancers in life, and the gene epigenetic editing tool can achieve the purpose of transcriptional regulation of corresponding genes without changing the gene sequence, which does not cause permanent DNA damage and does not produce harmful mutations and off-target effects; and the epigenetic therapy can provide better therapeutic effect by simultaneously regulating the activity of multiple genes, making up for the shortcomings of gene therapy, and providing new hope for the treatment of such diseases. On the other hand, the development of gene site-directed modification technology makes it possible to carry out epigenome editing and transcriptional regulation in a targeted manner in the natural chromatin environment. At present, the design of epigenetic modification and transcriptional regulation is mainly based on the combination of nucleases, among which the combination of engineered defective nucleases (dCas9) is more common. The design principle is to fuse various epigenetic regulatory effectors to dCas9, and to achieve the editing of the epigenome at a specific genomic site through the targeting and binding of the target DNA characteristics of the nuclease. These trans-regulation domains and proteins play a role by hindering the binding of RNA polymerase or recruiting endogenous transcription complexes to the dCas9 target site in the promoter region. In addition to the fusion protein design of epigenetic regulatory effectors and dCas9, a dCas-SunTag system has been used in this field in recent years to fuse multiple copies of transcriptional activation or inhibition proteins to achieve the regulation of target gene transcription. For example, Hatada Izuho et al. (PCT / JP2021 / 006498) recruited a fusion containing epigenetic modification factors (such as methyltransferases and histone acetyltransferases), transcriptional inhibition regulatory factors (such as ZIM3), and antibodies through a dCas9-GCN4 fusion, thereby inhibiting the expression of the target gene regulated thereby. At present, the use of transcriptional regulation and epigenetic site-directed modification technology in the in vivo treatment of diseases caused by epigenetic abnormalities is still few and far between, and the existing editing tools have certain problems, such as off-target phenomena caused by the nuclease itself of the CRISPR / Cas system, unsatisfactory recruitment effect of the SunTag system, low transcriptional regulation efficiency, and limited range of target gene modification (such as methylation modification). SUMMARY

[0003] In one aspect, the present application provides an epigenetic editing agent comprising a transcription activator-like effector (TALE) domain, at least one epigenetic modification domain, and at least one transcription regulation domain, wherein: 1) the TALE domain, the at least one epigenetic modification domain, and the at least one transcription regulation domain are directly or indirectly linked; or 2) the TALE domain, the at least one epigenetic modification domain, and at least one recruiting domain A are directly or indirectly linked to form a first fusion, and the at least one transcription regulation domain and at least one recruiting domain A’ are directly or indirectly linked to form a second fusion; or 3) the TALE domain, the at least one transcription regulation domain, and at least one recruiting domain A are directly or indirectly linked to form a first fusion, and the at least one epigenetic modification domain and at least one recruiting domain A’ are directly or indirectly linked to form a second fusion; and 2) and 3) the recruiting domain A and the recruiting domain A’ are capable of interacting to enable the fusion or a portion thereof of one of the first fusion and the second fusion to be recruited in proximity to the other fusion.

[0004] In some embodiments, the epigenetic modification domain is selected from the group consisting of DNA deaminase activity, DNA methyltransferase activity, DNA demethylase activity, DNA aminating activity, DNA oxidizing activity, DNA helicase activity, histone acetyltransferase activity, histone deacetylase activity, histone methyltransferase activity, histone demethylase activity, histone kinase activity, histone phosphatase activity, histone ubiquitin ligase activity, and histone deubiquitinating activity.

[0005] In some embodiments, the epigenetic modification domain comprises a DNA methyltransferase (DNMT) and / or a functionally active fragment thereof.

[0006] In some embodiments, the DNA methyltransferase is selected from the group consisting of DNMT3A, DNMT3B, DNMT3C, DNMT1, DNMT2, and DNMT3L.

[0007] In some embodiments, the epigenetic modification domain comprises a plurality of DNA methyltransferases and / or functionally active fragments thereof, and the plurality of DNA methyltransferases and / or functionally active fragments thereof are linked by a linker sequence.

[0008] In some embodiments, the epigenetic modification domain comprises at least one DNMT3A and at least one DNMT3L.

[0009] In some embodiments, the DNA methyltransferase comprises an amino acid sequence set forth in any one of SEQ ID NOs: 42-47, 131.

[0010] In some embodiments, the epigenetic modification domain comprises DNMT3A and DNMT3L, and the C-terminus of the DNMT3A is linked to the N-terminus of the DNMT3L, or the C-terminus of the DNMT3L is linked to the N-terminus of the DNMT3A.

[0011] In some embodiments, the transcriptional regulation domain is a transcriptional activation domain or a transcriptional repressor domain.

[0012] In some embodiments, the transcription repressor domain is selected from the group consisting of: KRAB, ZIM3 KRAB, ZNF680, ZNF554, ZNF264, ZNF582, ZNF324, ZNF669, ZNF354A, ZNF82, ZNF595, ZNF419, ZNF566, ZIM2, EHMT2, SUV39H1, ZFPM1, TRIM28, EZH2, MXD1, SID, LSD1, HP1a, HDAC3, ZNF436, ZNF257, ZNF675, ZNF490, ZNF320, ZNF331, ZNF816, ZNF41, ZNF189, ZNF528, ZNF543, ZNF140, ZNF610, ZNF350, ZNF8, ZNF30, ZNF98, ZNF677, ZNF596, ZNF214, ZNF37A, ZNF34, ZNF250, ZNF547, ZNF273, ZFP82, ZNF224, ZNF33A, ZNF45, ZNF175, ZNF184, ZFP28-1, ZFP28-2, ZNF18, ZNF213, ZNF394, ZFP1, ZFP14, ZNF416, ZNF557, ZNF729, ZNF254, ZNF764, ZNF785, ZNF10, CBX5, RYBP, YAF2, MGA, CBX1, SCMH1, MPP8, SUMO3, HERC2, BIN1, PCGF2, TOX, FOXA1, FOXA2, IRF2BP1, IRF2BP2, IRF2BP LIRF-2BP1_2 N-terminal domain, HOXA13, HOXB13, HOXC13, HOXA11, HOXC11, HOXC10, HOXA10, HOXB9, HOXA9, ZFP28, ZN334, ZN568, ZN37A, ZN181, ZN510, ZN862, ZN140, ZN208, ZN248, ZN571, ZN699, ZN726, ZIK1, ZNF2, Z705F, ZNF14, ZN471, ZN624, ZNF84, ZNF7, ZN891, ZN337, Z705G, ZN529, ZN729, ZN419, Z705A, ZN302, ZN486, ZN621, ZN688, ZN33A, ZN554, ZN878, ZN772, ZN224, ZN184, ZN544, ZNF57, ZN283, ZN549, ZN211, ZN615, ZN253, ZN226, ZN730, Z585A, ZN732, ZN681, ZN667, ZN649, ZN470, ZN484, ZN431, ZN382,ZN254, ZN124, ZN607, ZN317, ZN620, ZN141, ZN584, ZN540, ZN75D, ZN555, ZN658, ZN684, RBAK, ZN829, ZN582, ZN112, ZN716, HKR1, ZN350, ZN480, ZN416, ZNF92, ZN100, ZN736, ZNF74, ZN443, ZN195, ZN530, ZN782, ZN791, ZN331, Z354C, ZN157, ZN727, ZN550, ZN793, ZN235, ZN724, ZN573, ZN577, ZN789, ZN718, ZN300, ZN383, ZN429, ZN677, ZN850, ZN454, ZN257, ZN264, ZN485, ZN737, ZNF44, ZN596, ZN565, ZN543, ZFP69, SUMO1, ZNF12, ZN169, ZN433, ZN175, ZN347, ZNF25, ZN519, Z585B, ZN517, ZN846, ZN230, ZNF66, ZN713, ZN816, ZN426, ZN674, ZN627, ZNF20, Z587B, ZN316, ZN233, ZN611, ZN556, ZN234, ZN560, ZNF77, ZN682, ZN614, ZN785, ZN445, ZFP30, ZN225, ZN551, ZN610, ZN528, ZN284, ZN418, ZN490, ZN805, Z780B, ZN763, ZN285, ZNF85, ZN223, ZNF90, ZN557, ZN425, ZN229, ZN606, ZN155, ZN222, ZN442, ZNF91, ZN135, ZN778, ZN534, ZN586, ZN567, ZN440, ZN583, ZN441, ZNF43, ZN589, ZN563, ZN561, ZN136, ZN630, ZN527, ZN333, Z324B, ZN786, ZN709, ZN792, ZN599, ZN613, ZF69B, ZN799, ZN569, ZN564, ZN546, ZFP92, ZN723, ZN439, ZFP57, ZNF19, ZN404, ZN274, CBX3, ZN250, ZN570, ZN675, ZN695, ZN548, ZN132, ZN738, ZN420, ZN626, ZN559, ZN460, ZN268, ZN304, ZN605, ZN844, SUMO5, ZN101, ZN783, ZN417, ZN182, ZN823,ZN177, ZN197, ZN717, ZN669, ZN256, ZN251, CBX4, CDY2, CDYL2, ZN562, ZN461, Z324A, ZN766, ID2, ZN214, CBX7, ID1, CREM, SCX, ASCL1, ZN764, SCML2, TWST1, CREB1, TERF1, ID3, CBX8, GSX1, NKX22, ATF1, TWST2, ZNF17, TOX3, TOX4, ZMYM3, I2BP1, RHXF1, SSX2, I2BPL, ZN680, TRI68, HXA13, PHC3, TCF24, HXB13, HEY1, PHC2, ZNF81, FIGLA, SAM11, KMT2B, HEY2, JDP2, HXC13, ASCL4, HHEX, GSX2, ETV7, ASCL3, PHC1, OTP, I2BP2, VGLL2, HXA11, PDLI4, ASCL2, CDX4, ZN860, LMBL4, PDIP3, NKX25, CEBPB, ISL1, CDX2, PROP1, SIN3B, SMBT1, HXC11, HXC10, PRS6A, VSX1, NKX23, MTG16, HMX3, HMX1, KIF22, CSTF2, CEBPE, DLX2, PPARG, PRIC1, UNC4, BARX2, ALX3, TCF15, TERA, VSX2, HXD12, CDX1, TCF23, ALX1, HXA10, RX, CXXC5, SCML1, NFIL3, DLX6, MTG8, CEBPD, SEC13, FIP1, ALX4, LHX3, PRIC2, MAGI3, NELL1, PRRX1, MTG8R, RAX2, DLX3, DLX1, NKX26, NAB1, SAMD7, PITX3, WDR5, MEOX2, NAB2, DHX8, CBX6, EMX2, CPSF6, HXC12, KDM4B, LMBL3, PHX2A, EMX1, NC2B, DLX4, SRY, ZN777, ZN398, GATA3, BSH, SF3B4, TEAD1, TEAD3, RGAP1, PHF1, GATA2, FOXO3, ZN212, IRX4, ZBED6, LHX4, SIN3A, RBBP7, NKX61, R51A1, MB3L1, DLX5, NOTC1, TERF2, ZN282, RGS12, ZN840, SPI2B, PAX7, NKX62, ASXL2, FOXO1, GATA1, ZMYM5, LRP1, MIXL1, SGT1, LMCD1, CEBPA, SOX14,WTIP, PRP19, NKX11, RBBP4, DMRT2, SMCA2, and functionally active fragments thereof.

[0013] In some embodiments, the transcription repressor domain comprises an amino acid sequence set forth in any one of SEQ ID NOs: 48-73, 132.

[0014] In some embodiments, the transcription repressor domain comprises a zinc-finger protein-based transcription factor or a functionally active fragment thereof.

[0015] In some embodiments, the zinc-finger protein-based transcription factor is a Krüppel-associated box (KRAB) or a KRAB domain derived from ZIM3 (ZIM3 KRAB).

[0016] In some embodiments, the transcription regulation domain comprises two or more of the zinc-finger protein-based transcription factors or functionally active fragments thereof, which are of the same species or are of different species.

[0017] In some embodiments, the two or more zinc-finger protein-based transcription factors are connected by a linker sequence.

[0018] In some embodiments, the linker sequence is an XTEN linker sequence.

[0019] In some embodiments, the transcription repressor domain comprises a histone modification domain.

[0020] In some embodiments, the histone modification domain is selected from the group consisting of EZH2, HDAC3, HDAC1, EHMT2, PRMT1, PRMT5, SETDB1, hSIRT1, HP1a, LSD1, and functionally active fragments thereof.

[0021] In some embodiments, the TALE domain comprises an amino acid sequence set forth in any one of SEQ ID NOs: 35-41, 134-136, 142, 144-145, 149-150.

[0022] In some embodiments, the epigenetic editing agent is a fusion peptide.

[0023] In some embodiments, the epigenetic modification domain and the transcription regulation domain are co-located at either the N-terminus or the C-terminus of the TALE domain.

[0024] In some embodiments, the epigenetic modification domain and the transcription regulation domain are located at the N-terminus and the C-terminus of the TALE domain, respectively.

[0025] In some embodiments, the fusion peptide has, in order from N-terminus to C- terminus: 1) the epigenetic modification domain, the transcriptional regulation domain, and the TALE domain; or 2) the transcriptional regulation domain, the epigenetic modification domain, and the TALE domain; or 3) the TALE domain, the epigenetic modification domain, and the transcriptional regulation domain; or 4) the TALE domain, the transcriptional regulation domain, and the epigenetic modification domain; or 5) the epigenetic modification domain, TALE domain, and the transcriptional regulation domain, or 6) the transcriptional regulation domain, TALE domain, and the epigenetic modification domain.

[0026] In some embodiments, the fusion peptide has, in order from N-terminus to C- terminus: 1) one or a combination of DNMT3A and DNMT3L, one or more zinc finger protein-based transcription factors, and a TALE domain; or 2) one or more zinc finger protein-based transcription factors, one or a combination of DNMT3A and DNMT3L, and a TALE domain; or 3) a TALE domain, one or a combination of DNMT3A and DNMT3L, and one or more zinc finger protein-based transcription factors; or 4) a TALE domain, one or more zinc finger protein-based transcription factors, and one or a combination of DNMT3A and DNMT3L; 5) one or a combination of DNMT3A and DNMT3L, a TALE domain, and one or more zinc finger protein-based transcription factors, or 6) one or more zinc finger protein-based transcription factors, a TALE domain, and one or a combination of DNMT3A and DNMT3L.

[0027] In some embodiments, the fusion peptide comprises the following domains: TALE-DNMT3A-DNMT3L-ZIM3 KRAB, TALE-ZIM3 KRAB-DNMT3L-DNMT3A, TALE-ZIM3 KRAB-DNMT3A-DNMT3L, ZIM3 KRAB-DNMT3A-DNMT3L-TALE, DNMT3A-DNMT3L-ZIM3 KRAB-TALE, DNMT3A-DNMT3L-ZNF324-TALE, DNMT3A-DNMT3L-ZNF419-TALE, DNMT3A-DNMT3L-TALE-EZH2, DNMT3A-DNMT3L-TALE-HDAC3, DNMT3A-DNMT3L-TALE-HP1a, DNMT3A-DNMT3L-TALE-KRAB, DNMT3A-DNMT3L-TALE-ZIM3 KRAB, KRAB-DNMT3A-DNMT3L-TALE, DNMT3L-DNMT3A-TALE-KRAB, wherein - indicates that each part domain of the fusion is directly and / or indirectly connected, and the each part domain is in the order from N-terminus to C-terminus.

[0028] In some embodiments, the fusion peptide comprises the amino acid sequence of any one of SEQ ID NOs: 1-10, 15-34, and 137-139.

[0029] In some embodiments, the epigenetic editing agent is a complex peptide comprising the first fusion and the second fusion.

[0030] In some embodiments, the first fusion comprises, in order from N-terminus to C-terminus, an epigenetic modification domain, a TALE domain, and a recruiting domain A.

[0031] In some embodiments, the second fusion comprises, in order from N-terminus to C-terminus, a transcriptional repressor domain and a recruiting domain A’, or in order from N-terminus to C-terminus, a recruiting domain A’ and a transcriptional repressor domain.

[0032] In some embodiments, the first fusion comprises, in order from N-terminus to C-terminus, a recruiting domain A, a TALE domain, and a transcriptional repressor domain.

[0033] In some embodiments, the second fusion comprises, in order from N-terminus to C-terminus, an epigenetic modification domain and a recruiting domain A’, or in order from N-terminus to C-terminus, a recruiting domain A’ and an epigenetic modification domain.

[0034] In some embodiments, the complex peptide comprises the feature that: 1) the first fusion comprises, in order from N- to C-terminus, an epigenetic modification domain, a TALE domain, and a recruiting domain A, and the second fusion comprises, in order from N- to C-terminus, a transcriptional repressor domain and a recruiting domain A'; or 2) the first fusion comprises, in order from N- to C-terminus, an epigenetic modification domain, a TALE domain, and a recruiting domain A, and the second fusion comprises, in order from N- to C-terminus, a recruiting domain A' and a transcriptional repressor domain; or 3) the first fusion comprises, in order from N- to C-terminus, a recruiting domain A, a TALE domain, and a transcriptional repressor domain, and the second fusion comprises, in order from N- to C-terminus, an epigenetic modification domain and a recruiting domain A'; or 4) the first fusion comprises, in order from N- to C-terminus, a recruiting domain A, a TALE domain, and a transcriptional repressor domain, and the second fusion comprises, in order from N- to C-terminus, a recruiting domain A' and an epigenetic modification domain.

[0035] In some embodiments, the recruiting domain A is selected from any one of the two groups of domains, and the recruiting domain A' is selected from the other group of the two groups of domains: 1) a general control non-depressible protein 4 (GCN4), a GFP11 fragment derived from a split green fluorescent protein (GFP), or a GVKESLV polypeptide; and 2) a single-chain antibody (scFv), a GFP1-10 fragment derived from a split green fluorescent protein (GFP), or a PDZ protein domain.

[0036] In some embodiments, wherein: 1) the domain of one of the recruiting domain A and the recruiting domain A' is a GCN4, and the other domain is a scFv; or 2) the domain of one of the recruiting domain A and the recruiting domain A' is a GFP11 fragment, and the other domain is a GFP1-10; or 3) the domain of one of the recruiting domain A and the recruiting domain A' is a GVKESLV, and the other domain is a PDZ protein domain.

[0037] In some embodiments, the complex peptide comprises the features: 1) one of the first fusion and the second fusion comprises DNMT(3A-3L)-TALE-nxGCN4, and the other fusion comprises a transcription repressor domain-scFv; or 2) one of the first fusion and the second fusion comprises DNMT(3A-3L)-TALE-scFv, and the other fusion comprises a transcription repressor domain-GCN4; or 3) one of the first fusion and the second fusion comprises DNMT(3A-3L)-TALE-nxGFP11, and the other fusion comprises a transcription repressor domain-GFP1-10; or 4) one of the first fusion and the second fusion comprises DNMT(3A-3L)-TALE-GFP1-10, and the other fusion comprises a transcription repressor domain-GFP11; or 5) one of the first fusion and the second fusion comprises DNMT(3A-3L)-TALE-nxGCN4, and the other fusion comprises scFv-transcription repressor domain; or 6) one of the first fusion and the second fusion comprises DNMT(3A-3L)-TALE-scFv, and the other fusion comprises GCN4-transcription repressor domain; or 7) one of the first fusion and the second fusion comprises DNMT(3A-3L)-TALE-nxGFP11, and the other fusion comprises GFP1-10-transcription repressor domain; or 8) one of the first fusion and the second fusion comprises DNMT(3A-3L)-TALE-GFP1-10, and the other fusion comprises GFP11-transcription repressor domain; wherein DNMT(3A-3L) means that DNMT3A and DNMT3L are linked directly or indirectly in any order, - means that the domains at its two ends are linked directly or indirectly in the order from N-terminus to C-terminus; nxGCN4 or nxGFP11 means n copies of GCN4 or n copies of GFP11 connected by a linker sequence, respectively, and n is selected from any integer from 1 to 20.

[0038] In some embodiments, the first fusion and / or the second fusion comprises the amino acid sequence set forth in any one of SEQ ID NOs: 11, 12, 102-105, and 110-114.

[0039] In some embodiments, the epigenetic editing agent comprises the amino acid sequence set forth in any one of SEQ ID NOs: 15, 16, and 21-23.

[0040] In some embodiments, the complex peptide comprises the features: 1) one of the first fusion and the second fusion comprises a fusion of n x GCN4-TALE-transcription repressor domain, and the other fusion comprises DNMT(3A-3L)-scFv; or 2) one of the first fusion and the second fusion comprises a fusion of scFv-TALE-transcription repressor domain, and the other fusion comprises DNMT(3A-3L)-GCN4; or 3) one of the first fusion and the second fusion comprises a fusion of n x GFP11-TALE-transcription repressor domain, and the other fusion comprises DNMT(3A-3L)-GFP1-10; or 4) one of the first fusion and the second fusion comprises a fusion of GFP1-10-TALE-transcription repressor domain, and the other fusion comprises DNMT(3A-3L)-GFP11; or 5) one of the first fusion and the second fusion comprises a fusion of n x GCN4-TALE-transcription repressor domain, and the other fusion comprises scFv-DNMT(3A-3L); or 6) one of the first fusion and the second fusion comprises a fusion of scFv-TALE-transcription repressor domain, and the other fusion comprises GCN4-DNMT(3A-3L); or 7) one of the first fusion and the second fusion comprises a fusion of n x GFP11-TALE-transcription repressor domain, and the other fusion comprises GFP1-10-DNMT(3A-3L); or 8) one of the first fusion and the second fusion comprises a fusion of GFP1-10-TALE-transcription repressor domain, and the other fusion comprises GFP11-DNMT(3A-3L); wherein DNMT(3A-3L) represents that DNMT3A and DNMT3L are linked directly or indirectly in any order, - represents that the domains at its two ends are linked directly or indirectly in the order from N-terminus to C-terminus; n x GCN4 or n x GFP11 represents n copies of GCN4 or n copies of GFP11, respectively, linked by a linker sequence, n is selected from any integer from 1 to 20.

[0041] In some embodiments, the first fusion and / or the second fusion comprises the amino acid sequence set forth in any one of SEQ ID NOs: 13, 14, 106-109, and 115-118.

[0042] In some embodiments, the epigenetic editing agent comprises the amino acid sequence set forth in any one of SEQ ID NOs: 17-20, 24, 28, and 31.

[0043] In some embodiments, the epigenetic editing agent further comprises a nuclear localization signal and / or a marker domain.

[0044] In another aspect, the present application provides a nucleic acid encoding the epigenetic editing agent described herein.

[0045] In some embodiments, the nucleic acid comprises a first nucleic acid segment encoding the first fusion, and a second nucleic acid segment encoding the second fusion, the first nucleic acid segment being linked to the second nucleic acid segment by a nucleic acid segment encoding a cleavage peptide.

[0046] In some embodiments, the cleavage peptide is a 2A peptide and / or an IRES.

[0047] In some embodiments, the 2A peptide is selected from P2A, T2A, E2A, and F2A.

[0048] In some embodiments, the nucleic acid is a recombinant vector.

[0049] In some embodiments, the nucleic acid comprises a sequence as set forth in any one of SEQ ID NOs: 151-187.

[0050] In some embodiments, the recombinant vector further comprises a non-coding region.

[0051] In some embodiments, the non-coding region is selected from an intron, a regulatory element, a promoter, an enhancer, a termination sequence, and a 5’ and 3’ untranslated region.

[0052] In another aspect, the present application provides a delivery vehicle comprising the epigenetic editing agent described herein and / or the nucleic acid described herein, and optionally a liposome and / or a lipid nanoparticle.

[0053] In another aspect, the present application provides a composition comprising the epigenetic editing agent described herein, the nucleic acid described herein, and / or the delivery vehicle described herein.

[0054] In another aspect, the present application provides a cell comprising the epigenetic editing agent described herein, the nucleic acid described herein, the delivery vehicle described herein, and / or the composition described herein.

[0055] In another aspect, the present application provides a kit comprising the epigenetic editing agent described herein, the nucleic acid described herein, the delivery vehicle described herein, the composition described herein, and / or the cell described herein.

[0056] On the other hand, this application provides a method for regulating the expression of a target gene, the method comprising administering the epigenetic editing agent described in this application, the nucleic acid described in this application, the delivery vector described in this application, the composition described in this application, the cells described in this application, and / or the kit described in this application.

[0057] In some embodiments, the method includes introducing the epigenetic modifier, the nucleic acid, the delivery vector, the composition, the cell, and / or the kit into a cell containing the target gene.

[0058] In some embodiments, the method includes contacting the epigenetic modifier, the nucleic acid, the delivery vector, and / or the composition with the vicinity of the target gene and / or the regulatory elements of the target gene.

[0059] In some implementations, the regulatory element includes a core promoter, a proximal promoter, a distal enhancer, a silencer, an insulator element, a boundary element, and / or a locus control region.

[0060] On the other hand, this application provides a method for treating or alleviating a disease or condition associated with abnormal target gene expression and / or abnormal target gene activity, the method comprising administering to a subject in need an effective amount of the epigenetic editing agent described in this application, the nucleic acid described in this application, the delivery vector described in this application, the composition described in this application, the cell described in this application, and / or the kit described in this application.

[0061] On the other hand, this application provides the use of the epigenetic editing agent, nucleic acid, delivery vector, composition, cell, and / or kit described in this application for preparing a drug for treating or alleviating a disease or condition associated with abnormal expression and / or activity of a target gene.

[0062] The epigenetic editing agents and their encoded nucleic acids, vectors, compositions, cells, and other products provided in this application have at least one of the following advantages: significant gene transcription regulation efficiency (up to ~96%), rich target gene modification forms (such as DNA methylation modification, histone acetylation modification, etc.) and regulatory range, relatively flexible and diverse connection methods between various regulatory elements, and the significantly improved recruitment effect of the complex peptide based on the SunTag recruitment strategy. Attached Figure Description

[0063] The specific features of the invention involved in this application are shown in the appended claims. The features and advantages of the invention can be better understood by referring to the exemplary embodiments and accompanying drawings described in detail below. A brief description of the drawings is as follows:

[0064] Figure 1 shows the inhibitory effect of the epigenetic inhibitor described herein on PCSK9 gene expression.

[0065] Figures 2-3 show the inhibitory effect of the epigenetic inhibitor described herein on PCSK9 gene expression.

[0066] Figure 4 shows the inhibitory effect of the epigenetic inhibitor described herein on PCSK9 gene expression in mice. DETAILED DESCRIPTION

[0067] The present application will be described by specific example, but one skilled in the art will readily understand from the disclosure herein other advantages and effects of the present application.

[0068] TERMINOLOGY

[0069] In the present application, the term "epigenetic modification domain" generally refers to a domain that is capable of altering gene expression or cellular phenotype of a cell population upon administration. It is understood that such alterations refer to one or more functionally relevant modifications of the genome that do not involve changes in nucleic acid sequence. Examples of such modifications are DNA methylation and histone modification, both of which are important for the regulation of gene expression without changing the underlying DNA sequence.

[0070] In the present application, the term "TALE" is a polypeptide comprising one or more TALE repeat domains / units. Naturally occurring TALEs or "wild-type TALEs" are nucleic acid binding proteins secreted by numerous species of the genus Xanthomonas. TALE polypeptides contain a nucleic acid binding domain composed of tandem repeats of a highly conserved monomeric polypeptide, which is primarily 33, 34, or 35 amino acids in length, and differs from one another primarily in amino acid positions 12 and 13. In preferred embodiments, the nucleic acid is DNA. As used herein, the polypeptide monomer of a TALE is used to refer to the highly conserved repeating polypeptide sequence within the TALE nucleic acid binding domain, and the term "repeat variable diresidue" or "RVD" is used to refer to the highly variable amino acids at positions 12 and 13 of the polypeptide monomer. A general representation of a TALE monomer contained within a DNA binding domain is X 1-11 -(X 12 X 13 )-X 14-33或34或35 where the subscript indicates the amino acid position, and X represents any amino acid. X 12 X 13 indicates the RVD. In some TALE polypeptide monomers, the variable amino acid at position 13 is absent or not present, and in such monomers the RVD consists of a single amino acid. In such cases, the RVD can alternatively be represented as X*, where X represents X12 and (*) indicates X 13 is absent. The DNA binding domain comprises several repeats of TALE monomers and this can be represented as (X 1-11 -(X 12 X 13 )-X 14-33或34或35 ) z wherein in preferred embodiments z is at least 5-40. In further preferred embodiments z is at least 10-26.

[0071] TALE monomers have nucleotide binding affinities determined by the type of amino acid within their RVD. For example, polypeptide monomers with RVDs of NI preferentially bind to adenine (A), polypeptide monomers with RVDs of NG preferentially bind to thymine (T), polypeptide monomers with RVDs of HD preferentially bind to cytosine (C), and monomers with RVDs of NN preferentially bind to both adenine (A) and guanine (G). In other embodiments, monomers with RVDs of IG preferentially bind to T. Thus, the number and order of polypeptide monomer repeats in the nucleic acid binding domain of a TALE determines its nucleic acid target specificity. In further embodiments of the application, monomers with RVDs of NS recognize all four base pairs and can bind to A, T, G, or C. The structure and function of TALEs are further described, for example, in Moscou et al., Science 326: 1501 (2009); Boch et al., Science 326: 1509-1512 (2009); and Zhang et al., Nature Biotechnology 29: 149-153 (2011), each of which is incorporated by reference in its entirety. The repeat domains of TALEs are involved in the binding of TALEs to their cognate target DNA sequences. These repeat units (or "repeat sequences") exhibit at least some sequence homology to other TALE repeat sequences within naturally occurring TALE proteins. See, e.g., U.S. Patent Publication No. 20110301073. The TALE binding domains involved in the present application can be "engineered" to bind to a predetermined nucleotide sequence, for example, via engineering (altering one or more amino acids) of the recognition helix region of naturally occurring TALE proteins. Thus, engineered DNA binding proteins (TALEs) are non-naturally occurring proteins. Non-limiting examples of methods for engineering DNA binding proteins are design and selection. Designed DNA binding proteins are non-naturally occurring proteins whose design and / or composition is derived primarily from rational criteria. Rational design criteria include the application of substitution rules and computational algorithms for processing information in information databases that store existing TALE designs and binding data. See, e.g., U.S. Patents 6,140,081; 6,453,242; and 6,534,261; see also WO 98 / 53058; WO 98 / 53059; WO 98 / 53060; WO 02 / 016536 and WO 03 / 016496 and U.S. Publication No. 20110301073.

[0072] In the present application, the term “recruitment” generally refers to the recruitment effect between protein molecules, which specifically refers to the recruitment of proteins to other molecules to perform specific biological functions. This recruitment effect mainly depends on the affinity of intermolecular interaction, and its affinity is generally considered to be related to the spatial structure of the protein molecule, which is relatively complex. The interaction mechanism may exemplarily include, but is not limited to, hydrogen bond, ionic interaction, hydrophobic interaction, van der Waals force, etc. non-covalent bond interaction. For example, some proteins can recruit enzymes to catalyze chemical reactions, or recruit other proteins to form complexes. These recruitment effects are essential for many cellular processes, such as signal transduction, DNA replication, and gene expression, etc.

[0073] In the present application, the term “DNA methyltransferase” generally refers to an enzyme that catalyzes the transfer of a methyl group to DNA. Non-limiting examples of DNA methyltransferases include DNMT1, DNMT 3A, DNMT 3B, and DNMT 3L. For example, by DNA methylation, DNA methyltransferases can modify the activity of a DNA fragment (e.g., regulate gene expression) without altering the DNA sequence. As described herein, an epigenetic editing agent can include one or more (e.g., two) DNA methyltransferases. When a DNA methyltransferase is included as part of an epigenetic editing agent (fusion peptide or complex peptide), the DNA methyltransferase can be referred to as a “DNA methyltransferase domain.” In aspects, the DNA methyltransferase domain comprises a variant or homolog of an amino acid sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to DNMT 3A. In aspects, the DNA methyltransferase domain comprises a variant or homolog of an amino acid sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to DNMT3L.

[0074] In the present application, the term “functionally active fragment” generally refers to a fragment having a partial region of a full-length protein or nucleic acid, but retains or partially retains the biological activity or function of the full-length protein or nucleic acid. For example, a functionally active fragment can retain or partially retain the ability of a full-length protein to bind to another molecule. For example, a functionally active fragment of a DNA methyltransferase can retain or partially retain the biological activity function of a full-length DNA methyltransferase to catalyze the transfer of a methyl group to DNA.

[0075] In the present application, the terms "inhibit," "repress," "silence," and the like generally refer to a decrease in gene expression and / or activity. For example, administration of a substance of the present application can negatively affect (e.g., decrease) the activity of a nucleic acid sequence relative to the activity of the nucleic acid sequence in the absence of the substance (e.g., fusion protein, complex, nucleic acid, vector) (control). For example, inhibition can refer to a reduction in a disease or a symptom of a disease. For example, inhibition includes at least partially, partially, or completely blocking activation (e.g., transcription) of a nucleic acid sequence, or decreasing, preventing, or delaying activation of a nucleic acid sequence. For example, the inhibition activity can be 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10% or less of the control.

[0076] In the present application, the term "transcriptional repressor" generally refers to a substance and / or agent, such as a protein (e.g., a transcription factor or fragment thereof), that binds to a target nucleic acid sequence and results in a decrease in the expression level of a gene product associated with the target nucleic acid sequence. For example, the gene product can be an RNA (e.g., mRNA) transcribed from a gene or a polypeptide translated from an mRNA transcribed from a gene. Generally, an increase or decrease in mRNA levels results in an increase or decrease in the level of a polypeptide translated therefrom. Expression levels can be determined using standard techniques for measuring mRNA or protein. Non-limiting examples of transcriptional repressors include: mSin3 interaction domain (SID) protein, methyl-CpG-binding domain 2 (MBD2), MBD3, DNA methyltransferase (DNMT) 1 (DNMT1), DNMT2A, DNMT3A, DNMT3B, DNMT3L, retinoblastoma protein (Rb), methyl CpG binding protein 2 (Mecp2), GATA-1 and its cofactor Fog1, MAT2 regulator (ROM2), Arabidopsis thaliana HD2A protein (AtHD2A), lysine-specific demethylase 1 (LSD1), and / or Krüppel-associated box (KRAB).

[0077] In the present application, the term "KRAB" also referred to as "Krüppel-associated box domain" or "Krüppel-associated box domain," generally refers to a transcriptional repression domain of about 45 to about 75 amino acid residues present in the transcription factor of human zinc finger protein. In aspects, the KRAB domain can include a variant or homolog of an amino acid sequence having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to a ZIM3 KRAB domain or a KOX1 KRAB domain.

[0078] In the present application, the term "split green fluorescent protein" generally refers to a polypeptide that is able to split and form an active green fluorescent protein upon recombination.

[0079] In the present application, the term "GCN4" is a transcription factor in S. cerevisiae, a "master regulator" in the yeast genome, regulating nearly one-tenth of the yeast genome, which is a highly conserved protein, and its homolog in mammals is Activating Transcription factor-4 (ATF4).

[0080] In the present application, the term "PDZ protein" generally refers to a naturally occurring protein containing a PDZ domain. Exemplary PDZ proteins include CASK, MPP1, DLG1, DLG2, PSD95, NeDLG, TIP-33, SYNla, TIP-43, LDP, LIM, LIMK1, LIMK2, MPP2, NOS 1, AF6, PTN_4, prIL16, 41.8kD, KIAA0559, RGS12, KIAA0316, DVL1, TIP-40, TIAMl, MINTl, MAGI-I, MAGI-2, MAGI-3, KIAA0303, CBP, MINT3, TIP-2, KIAA0561, and / or TIP-I.

[0081] In the present application, the term "single chain antibody" or "scFv (Single Chain Antibody)" generally refers to a single chain polypeptide containing one or more antigen binding sites. In addition, although the H and L chains of Fv fragments are encoded by different genes, they can be joined together directly or through a peptide, for example, by recombinant methods, the H and L chains can be linked into a single protein chain (called a single chain antibody, sAb; Bird et al. 1988 Science 242:423-426; and Huston et al. 1988 PNAS 85:5879-5883) with a synthetic linker. The single chain antibody is also included in the term "antibody", can be used as a binding determinant in designing and manufacturing a multispecific binding molecule, and can be prepared by a recombinant technique or enzymatic or chemical cleavage of a whole antibody.

[0082] In the present application, the term "directly or indirectly connected" generally refers to either "directly connected" or "indirectly connected". "Directly connected" generally refers to a direct connection between the connected substances (e.g., amino acid sequence segments). For example, the directly connected amino acid sequence segment X and another amino acid sequence segment Y are directly connected via an amide bond between the C-terminal amino acid of the amino acid sequence segment X and the N-terminal amino acid of the amino acid sequence segment Y. "Indirectly connected" generally refers to a connection between the connected substances (e.g., amino acid sequence segments) via a spacer component (e.g., an amino acid residue or derivative thereof). For example, as used herein, the spacer component is a "linker" or "linker sequence", which generally refers to a linker that connects two or more moieties. In various embodiments, the linker is connected to the amino acid sequence of the remainder of the compound (e.g., the first or second fusion of the fusion peptide or composite peptide provided herein) at the N-terminus and the C-terminus. For example, the term "XTEN", "XTEN linker" or "XTEN polypeptide" as used herein refers to a recombinant polypeptide (e.g., an unstructured recombinant peptide) that lacks hydrophobic amino acid residues. In some embodiments, the XTEN linker sequence comprises one or more fragment sequences taken from the amino acid sequence of SEQ ID NO: 101 (XTEN full-length polypeptide) comprising no less than 16 contiguous amino acids. XTEN 80 refers to a full-length 80 amino acid XTEN linker and fusion proteins derived from the full-length 80 amino acid XTEN linker in the present application. In some embodiments, XTEN 80 can be the sequence set forth in SEQ ID NO 86. Linkers derived from XTEN 80 also fall within the scope of XTEN 80. For example, linker 15-fused XTEN 80 linker 1, in which the last 46 amino acids are from XTEN 80, as shown in the following table. For another example, linker 22-fused XTEN 80 linker 2 or linker 12-XTEN 80 linker 2, which is derived from inserting the XTEN 80 sequence into the interior of XTEN 16.

[0083] In the present application, XTEN 16 refers to a full-length 16 amino acid XTEN linker and fusion proteins derived from a full-length 16 amino acid XTEN linker. In some embodiments, XTEN 16 can be the sequence set forth in SEQ ID NO 93. Linkers derived from XTEN 16 also fall within the scope of XTEN 16. For example, as shown in the table below, linker 11-XTEN 16 linker 1 is a full-length 16 AA XTEN linker. Linker 10-XTEN 16 linker 2 is a linker that adds a DG to the N segment of linker 11-XTEN 16 linker 1, and linker 9-XTEN 16 linker 3 is a linker that adds a G to the N segment of linker 11-XTEN 16 linker 1, and thus linker 10-XTEN 16 linker 2 and linker 9-XTEN 16 linker 3 should be considered as a type of XTEN 16.

[0084] The development and use of XTENs can be found, for example, in Schellenberger et al., Nature Biotechnology 27, 1186-1190 (2009), which is incorporated by reference in its entirety. For example, in some embodiments of the present application, the linker sequence comprises a GS connection peptide comprising the sequence: (GS) a (GGS) b (GGGS) c (GGGGS) d wherein G represents a glycine residue (Gly), S represents a serine residue (Ser), and a, b, c, and d represent integers greater than or equal to 0. For example, the spacer component (linker sequence) used in the present application is selected from the amino acid sequence set forth in any one of SEQ ID NOs: 83-100, 119-127, 146-148 (SEQ ID NO: 84 is GSG).

[0085] The linkers used in the present application are shown in Table 1 below

[0086] Table 1 - List of Linkers

[0087] In the present application, the term "nuclear localization sequence" or "nuclear localization signal" or "NLS" generally refers to a peptide that directs a protein to the nucleus. For example, the NLS comprises five basic positively charged amino acids. For example, the NLS can be located at any position on the peptide chain. For example, the NLS used in the present application is selected from the amino acid sequence set forth in any one of SEQ ID NOs: 128-130.

[0088] The NLS can comprise a sv40 NLS, a c-myc NLS, a BPSV40 NLS. Without being specific, the NLS can be one of any of the three NLSs described above.

[0089] In the present application, the term "marker" refers to a peptide that can be introduced into an expression vector that can be used to allow for the deletion and / or purification of the expression product of one or more vector insert fragments. Such markers are well known in the art and include a radiolabeled amino acid or a polypeptide to which a biotin moiety can be attached that can be detected by labeled avidin (e.g., streptavidin containing a fluorescent label or enzymatic activity that can be detected by optical or colorimetric methods). Affinity markers such as FLAG, glutathione-S-transferase, maltose binding protein, cellulose binding domain, thioredoxin, NusA, mistin, chitin binding domain, cutinase, AGT, GFP and other markers in widespread use such as those used in the ProBond® protein expression and purification system. Further non-limiting examples for polypeptides include, but are not limited to, the following: a histidine tag, a radioisotope or radionuclide (e.g.,3H,14C,35S,90Y,99Tc,111In,125I,177Lu,166Ho or153Sm); a fluorescent marker (e.g., FITC, rhodamine, lanthanide phosphors), an enzymatic marker (e.g., horseradish peroxidase, luciferase, alkaline phosphatase); a chemiluminescent marker; a biotin moiety; an overhanging polypeptide epitope recognized by a second reporter (e.g., leucine zipper pair sequence, binding site for a secondary antibody, metal binding domain, epitope tag); and a magnetic reagent such as a gadolinium chelate.

[0090] In the present application, the specific proteins (e.g., KRAB, TALE, Dnmt3A, Dnmt3L) can include any native form of the protein or a variant or homolog that maintains the activity of the protein (e.g., has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the activity compared to the native protein). In aspects, the variant or homolog has at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% amino acid sequence identity across the entire sequence or a portion of the sequence (e.g., a 50, 100, 150, or 200 continuous amino acid portion) compared to the naturally occurring form.

[0091] In the present application, the terms “nucleic acid” and “polynucleotide,” “nucleotide,” “nucleotide sequence,” and “oligonucleotide” are used interchangeably and generally refer to a polymer of nucleotides (e.g., deoxyribonucleotides or ribonucleotides) and its complements in single-, double-, or multi-stranded form. For example, a nucleotide can be a ribonucleotide, a deoxyribonucleotide, or a modified version thereof. For example, a nucleotide can be single- and double-stranded DNA, single- and double-stranded RNA, and hybrid molecules having a mixture of single- and double-stranded DNA and RNA. For example, a nucleotide can include, but is not limited to, any type of RNA, such as mRNA, siRNA, miRNA, sgRNA, and guide RNA, and any type of DNA, genomic DNA, plasmid DNA, and minicircle DNA, and any fragment thereof. The terms also encompass nucleic acids containing known nucleotide analogs or modified backbone residues or linkages, which are synthetic, naturally occurring, and non-naturally occurring.

[0092] In the present application, the term “a sequence encoding” or “a nucleic acid encoding” generally refers to a nucleic acid (RNA or DNA molecule) comprising a nucleotide sequence that encodes a protein. The coding sequence can also include initiation and termination signals operably linked to regulatory elements, including a promoter and polyadenylation signal capable of directing expression in the cells of an individual or mammal to which the nucleic acid is administered. The coding sequence can be codon optimized.

[0093] In the present application, the term "delivery vehicle" generally refers to a transfer vehicle capable of delivering an agent (e.g., a nucleic acid molecule) to a target cell. The delivery vehicle can deliver the agent to a specific subset of cells. For example, the delivery vehicle is targeted to certain types of cells by virtue of the inherent properties of the delivery vehicle or by virtue of moieties coupled to the vehicle, contained within (or bound to the vehicle such that the moiety and the delivery vehicle remain together, and such that the moiety is sufficient to target the delivery vehicle). The delivery vehicle can also increase the in vivo half-life of the agent to be delivered and / or the bioavailability of the agent to be delivered. The delivery vehicle can include a viral vector, a virus-like particle, a polycationic vector, a peptide vector, a liposome, and / or a hybrid vector. For example, if the target cell is a hepatocyte, the properties of the delivery vehicle (e.g., size, charge, and / or pH) can be effective to deliver the delivery vehicle and / or the molecule encapsulated therein to the target cell, reduce immune clearance, and / or promote residence in the target cell.

[0094] In the present application, the term "liposome" generally refers to a vesicle with an internal space that is isolated from the external medium by one or more bilayered membranes. In some embodiments, the bilayered membrane can be formed by amphiphilic molecules, such as synthetic or naturally derived lipids that contain spatially segregated hydrophilic and hydrophobic domains; in other embodiments, the bilayered membrane can be formed by amphiphilic polymers and surfactants. In some embodiments, the liposome is a spherical vesicular structure consisting of a single or multiple lipid bilayers surrounding an internal aqueous compartment, and an outer, relatively impermeable, lipophilic phospholipid bilayer. In some embodiments, liposomes are biocompatible, non-toxic, can deliver hydrophilic and lipophilic drug molecules, protect their cargo from degradation by plasma enzymes, and transport their load across biological membranes and the blood-brain barrier (BBB). Liposomes can be made from several different types of lipids, e.g., phospholipids. Liposomes can comprise natural phospholipids and lipids such as 1,2-distearoyl-sn-glycero-3-phosphatidylcholine (DSPC), sphingomyelin, egg phosphatidylcholine, monosialic ganglioside, or any combination thereof. To alter the structure and properties of the liposome, several other additives can be added to the liposome. For example, the liposome can also comprise cholesterol, sphingomyelin, and / or 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), e.g., to increase stability and / or prevent leakage of the internal cargo of the liposome.

[0095] The term "lipid nanoparticle (LNP)" generally refers to a particle comprising a plurality (i.e., more than one) of lipid molecules physically associated (e.g., covalently or non-covalently) with one another through intermolecular forces. An LNP can be, for example, a microsphere (including unilamellar and multilamellar vesicles, e.g., liposomes), a dispersed phase in an emulsion, a micelle, or an internal phase in a suspension. An LNP can encapsulate a nucleic acid within a cationic lipid particle (e.g., a liposome), and can be relatively easily delivered to cells. In some examples, a lipid nanoparticle does not contain any viral components, which helps to minimize safety and immunogenicity issues. The lipid particles can be used for in vitro, ex vivo, and in vivo delivery. The lipid particles can also be used for cell populations of various scales. LNP of the present application can be readily prepared by various methods known in the art, for example, by mixing an organic phase with an aqueous phase. Mixing of the two phases can be achieved by microfluidic devices and impinging stream reactors. The more thoroughly the organic and aqueous phases are mixed, the better the entrapment efficiency and particle size distribution of the LNP obtained. Preferably, the particle size of the LNP can be adjusted by varying the speed of mixing of the organic and aqueous phases. The faster the speed of mixing, the smaller the particle size of the LNP prepared will be. The entrapment efficiency can be optimized by adjusting the N / P (ionizable lipid / nucleic acid) ratio of the LNP system. In some examples, LNP can be used to deliver DNA molecules and / or RNA molecules (such as mRNA). In certain instances, LNP can be used to deliver RNP complexes.

[0096] In the present application, the term "recombinant vector" generally refers to a nucleic acid molecule capable of transporting another nucleic acid with it. One type of vector is a "plasmid", which refers to a circular double stranded DNA loop into which additional DNA segments can be ligated. Alternatively, the vector can be linearized. Another type of vector is a viral vector, wherein additional DNA segments can be ligated into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) can be integrated into the genome of a host cell

[0097] In the present application, the term "regulatory element" refers to genetic elements that control the expression of nucleic acid sequences. For example, splicing signals, promoter sequences, polyadenylation signals, transcription termination sequences, upstream regulatory domains, origins of replication, internal ribosome entry sites ("IRES"), enhancers, and the like, which collectively provide for replication, transcription, and translation of a coding sequence in a recipient cell. Not all of these control sequences need to be present. Transcription control signals in eukaryotes generally include "promoter" and "enhancer" elements. Promoters and enhancers are comprised of short arrays of DNA sequences that are regulatory elements that promote the initiation of transcription of operably linked coding regions, and enhancers are regulatory elements that increase the rate of genetic transcription by increasing the activity of the promoter located closest in space on the same DNA molecule, which of these sequences specifically interact with cellular proteins involved in transcription (Maniatis et al., Science 236: 1237 (1987), incorporated by reference in its entirety). Promoter and enhancer elements have been isolated from a variety of eukaryotic sources, including yeast, insect and mammalian cells, and viruses (similar control sequences, i.e., promoters, are also found in prokaryotes). The selection of a particular promoter and enhancer depends on the recipient cell type. Some eukaryotic promoters and enhancers have a wide host range, while other promoters and enhancers are functional within a limited subset of cell types (for reviews, see, e.g., Voss et al., Trends Biochem. Sci., 11: 287 (1986); and Maniatis et al. (ibid.), incorporated by reference in their entireties). For example, the SV40 early gene enhancer is very active in a wide variety of cell types from many mammalian species and has been used to express proteins in many mammalian cells (Dijkema et al., EMBO J. 4: 761 (1985), incorporated by reference in its entirety). Promoter and enhancer elements derived from the human elongation factor 1-alpha gene (Uetsuki et al., J. Biol. Chem., 264: 5791 (1989); Kim et al., Gene 91: 217 (1990); and Mizushima and Nagata, Nucl. Acids. Res., 18: 5322 (1990)), the long terminal repeat of the Rous Sarcoma Virus (Gorman et al., Proc. Natl. Acad. Sci. U.S.A. 79: 6777 (1982)), and the human cytomegalovirus (Boshart et al., Cell 41: 521 (1985)) are also useful for expressing proteins in different mammalian cell types, which references are incorporated by reference in their entireties. Promoters and enhancers can occur naturally or together. For example, the retroviral long terminal repeat contains both promoter and enhancer elements.In general, the action of a promoter and enhancer is independent of the gene being transcribed or translated. Thus, the enhancer and promoter used can be "endogenous," "exogenous," or "heterologous" with respect to the gene to which they are operably linked. An "endogenous" enhancer / promoter is one that is naturally associated with a given gene in the genome. An "exogenous" or "heterologous" enhancer or promoter is one that is placed in juxtaposition to a gene by genetic manipulation (i.e., molecular biology techniques), which manipulation is such that transcription of the gene is directed by the linked enhancer / promoter. The presence of a "splicing signal" on an expression vector generally results in high level expression of the recombinant transcript. In certain embodiments, the "splicing signal" mediates the removal of introns from the primary RNA transcript, consisting of a splice donor and acceptor site (Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nded., Cold Spring Harbor Laboratory Press, New York (1989), pp. 16.7-16.8, incorporated herein by reference in its entirety). A commonly used splice donor and acceptor site is the splice junction of the 16S RNA from SV40. In certain embodiments, a "transcription termination signal" is generally present downstream of the polyadenylation signal, and is several hundred nucleotides in length. For example, the term "poly A signal" or "poly A sequence" denotes a DNA sequence that directs the termination and polyadenylation of a nascent RNA transcript. Efficient polyadenylation of the recombinant transcript is often necessary because transcripts lacking a poly A signal are unstable and are rapidly degraded. The poly A signal used in an expression vector can be "heterologous" or "endogenous." An endogenous poly A signal is one that is naturally present at the 3' end of the coding region of a given gene in the genome. A heterologous poly A signal is one that is isolated from one gene and operably linked to the 3' end of another gene. A commonly used heterologous poly A signal is the SV40 poly A signal. The SV40 poly A signal is contained on a 237 bp BamHI / BcII restriction fragment and directs termination and polyadenylation (Sambrook et al., supra, 16.6-16.7, incorporated herein by reference in its entirety).

[0098] In the present application, the term "subject" generally refers to an animal, typically a mammal, such as a human, a non-human primate (apes, gibbons, gorillas, chimpanzees, orangutans, macaques), a domestic animal (dogs and cats), a farm animal (poultry such as chickens and ducks, horses, cows, goats, sheep, pigs), and a laboratory animal (mice, rats, rabbits, guinea pigs). Human subjects include fetal, neonatal, infant, juvenile, and adult subjects. Subjects include animal disease models, for example, mice and other animal models of blood coagulation diseases (such as HemA), and other animal models known to those skilled in the art.

[0099] In the present application, the term "comprising" generally means including, but not excluding other elements.

[0100] In the present application, the term "consisting of generally means including, by way of reference, only those elements whose inclusion is recited.

[0101] In the present application, the term "about" generally means a range of variation above or below the specified value of 0.5-10%, for example, a range of variation above or below the specified value of 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, or 10%.

[0102] DETAILED DESCRIPTION

[0103] In one aspect, the present application provides an epigenetic editing agent comprising a transcription activator-like effector (TALE) domain, at least one epigenetic modification domain, and at least one transcription regulation domain, wherein: 1) the TALE domain, the at least one epigenetic modification domain, and the at least one transcription regulation domain are directly or indirectly linked; or 2) the TALE domain, the at least one epigenetic modification domain, and at least one recruitment domain A are directly or indirectly linked to form a first fusion, and the at least one transcription regulation domain and at least one recruitment domain A' are directly or indirectly linked to form a second fusion; or 3) the TALE domain, the at least one transcription regulation domain, and at least one recruitment domain A are directly or indirectly linked to form a first fusion, and the at least one epigenetic modification domain and at least one recruitment domain A' are directly or indirectly linked to form a second fusion; and 2) and 3) the recruitment domain A and the recruitment domain A' are capable of interacting to enable the fusion or a portion thereof of one of the first fusion and the second fusion to be recruited in the vicinity of the other fusion.

[0104] In another aspect, the present application provides a nucleic acid encoding the epigenetic editing agent described herein. For example, the nucleic acid comprises DNA and / or mRNA. For example, the nucleic acid can be used to treat or alleviate a disease or a condition thereof associated with abnormal expression of a target gene and / or abnormal activity of a target gene. In some embodiments, the nucleic acid is mRNA; one or more modification techniques can be used to generate a more stable mRNA. Known mRNA modification techniques can be broadly classified into three categories: synthesizing mRNA with artificially synthesized non-natural ribonucleic acid instead of natural ribonucleic acid; adding 5' caps, 3' poly(A) "tails", and UTR (untranslated region) sequences; and using special new formulation techniques to effectively protect mRNA. Among them, the preferred mRNA modification technique can be to synthesize mRNA with artificially synthesized non-natural ribonucleic acid instead of natural ribonucleic acid. Chemical modifications on eukaryotic mRNA can be broadly classified into three categories: methylation, pseudouridine (Ψ), and hypoxanthine. For example, the chemical modification can be selected from the group consisting of: pseudouridine, N1-methylpseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methyluridine, 5-methoxyuridine, and 2'-O-methyluridine. For example, the nucleic acid is a recombinant vector comprising a nucleic acid encoding the complex described herein. For example, a recombinant vector can refer to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. A recombinant vector can include a single-stranded, double-stranded, or partially double-stranded nucleic acid molecule; a nucleic acid molecule comprising one or more free ends, no free ends (e.g., circular); a nucleic acid molecule comprising DNA, RNA, or both; and other kinds of polynucleotides known in the art. For example, a viral vector can be used. A viral vector can comprise a viral-derived DNA or RNA sequence for packaging into a virus (e.g., retrovirus, replication-defective retrovirus, adenovirus, replication-defective adenovirus, and adeno-associated virus AAV). Viruses and viral vectors can be used for delivery in vitro, ex vivo, and / or in vivo.

[0105] In another aspect, the present application provides a delivery vehicle comprising an epigenetic editing agent described herein and / or a nucleic acid described herein, and optionally comprising a liposome and / or a lipid nanoparticle. For example, the delivery vehicle can be introduced into a cell by a physical delivery method. Examples of physical methods include microinjection, electroporation, and hydrodynamic delivery. For example, LNPs can encapsulate nucleic acids in cationic lipid particles (e.g., liposomes) and can be relatively easily delivered to cells. In some examples, the lipid nanoparticles are free of any viral components, which helps to minimize safety and immunogenicity concerns. The lipid particles can be used for in vitro, ex vivo, and in vivo delivery. The components of the LNP can include a cationic lipid, an ionizable lipid, a PEGylated lipid, and / or a supporting lipid, and optionally a cholesterol component.

[0106] In another aspect, the present application provides a composition comprising an epigenetic editing agent described herein, a nucleic acid described herein, and / or a delivery vehicle described herein. For example, the epigenetic editing agent, the nucleic acid (or recombinant vector) encoding the epigenetic editing agent, and the delivery vehicle in the composition can be included in one composition, or separately included in different compositions. For example, the epigenetic editing agent, the nucleic acid (or recombinant vector) encoding the epigenetic editing agent, and / or the delivery vehicle in the composition can be used simultaneously, or separately.

[0107] In another aspect, the present application provides a cell comprising an epigenetic editing agent described herein, a nucleic acid described herein, a delivery vehicle described herein, and / or a composition described herein.

[0108] In another aspect, the present application provides a kit comprising an epigenetic editing agent described herein, a nucleic acid described herein, a delivery vehicle described herein, a composition described herein, and / or a cell described herein. For example, the kit further comprises at least one container holding the above components. For example, the kit comprises more than one of the above components, which further comprises a second, third, and / or other container(s) other than the container(s) holding the above components, in which the more than one of the above components can be separately placed. For example, the kit can comprise various combinations of the above components in the container(s). For example, the kit further comprises a buffer reagent, a device for mixing, a device for measuring, a device for sorting, and / or a device for labeling. For example, the kit further comprises a package for holding the various containers. For example, the kit further comprises an instruction manual for using the components of the kit. For example, the instruction manual comprises a physical form of paper and / or an electronically readable form.

[0109] In another aspect, the present application provides a method of modulating expression of a target gene, the method comprising administering the epigenetic editing agent described herein, the nucleic acid described herein, the delivery vehicle described herein, the composition described herein, the cell described herein, and / or the kit described herein. For example, the method of inhibiting expression of a target gene is introducing the epigenetic editing agent, the nucleic acid, the delivery vehicle, the composition, the cell, and / or the kit into a cell containing the target gene. For example, the introducing into a cell can be introducing into a cell using a non-viral or viral-based transfection method. For example, the non-viral transfection method includes any suitable method of introducing into a cell without using viral DNA or viral particles as a delivery system, non-limiting examples of non-viral transfection methods include nanoparticle encapsulation (e.g., lipid nanoparticle, gold nanoparticle, etc.) of nucleic acid encoding the epigenetic editing agent, calcium phosphate transfection, liposome transfection, nucleofection, sonoporation, transfection by heat shock, magnetic transfection, and electroporation. For example, the viral-based transfection method includes any viral vector suitable for use in the method described herein, non-limiting examples of which include, but are not limited to, retroviral, adenoviral, lentiviral, and / or adeno-associated viral vectors. For example, the method of inhibiting expression of a target gene further comprises introducing the epigenetic editing agent, the nucleic acid, the delivery vehicle, the composition, the cell, and / or the kit into a cell from an external environment. For another example, the method of inhibiting expression of a target gene comprises contacting the epigenetic editing agent, the nucleic acid, the delivery vehicle, and / or the composition with the target gene and / or a transcriptional regulatory element of the target gene. For example, the epigenetic editing agent is a complex peptide comprising a first fusion and a second fusion, the contacting refers to the TALE domain comprised by the epigenetic editing agent specifically recognizing and hybridizing to a specific region in the target gene, while the first fusion and the second fusion are recruited to the vicinity of the target gene or within the transcriptional regulatory region thereof through the direct or indirect interaction of the recruiting domain A and the recruiting domain A’ thereof, thereby modulating the expression of the target nucleic acid.

[0110] In another aspect, the present application provides a method of treating or ameliorating a disease or a condition associated with abnormal expression of a target gene and / or abnormal activity of a target gene, the method comprising administering to a subject in need thereof an effective amount of the epigenetic editing agent described herein, the nucleic acid described herein, the delivery vehicle described herein, the composition described herein, the cell described herein, and / or the kit described herein. For example, the method of treatment comprises mixing the epigenetic editing agent, the nucleic acid, the delivery vehicle, the composition, the cell, and / or the kit with a therapeutic agent and performing systemic delivery to a subject in need thereof such that it is widely exposed to a substantial portion of the body, which can be performed by any means known in the art, including but not limited to intravenous, intra-arterial, subcutaneous, intracavitary, and intraperitoneal delivery. For example, the method of treatment comprises mixing the epigenetic editing agent, the nucleic acid, the delivery vehicle, the composition, the cell, and / or the kit with a therapeutic agent and performing local delivery to a subject in need thereof such that it is directly delivered to a target site within an organism, which can be performed by, for example, direct injection into a disease site (e.g., a tumor or an inflammation site) or a target organ (e.g., liver, heart, pancreas, kidney, etc.). For example, the local delivery includes local administration or local injection techniques, including but not limited to intramuscular, subcutaneous, or intradermal injection. For example, the local delivery does not exclude systemic pharmacological effects. For example, the disease includes cardiovascular disease, nonalcoholic steatohepatitis, AMD, age-related maculopathy, type 2 diabetes, obesity, liver failure, dislipidemia, diabetic atherosclerosis, and / or hypertension.

[0111] In another aspect, the present application provides use of the epigenetic editing agent described herein, the nucleic acid described herein, the delivery vehicle described herein, the composition described herein, the cell described herein, and / or the kit described herein for the manufacture of a medicament for treating or ameliorating a disease or a condition associated with abnormal expression of a target gene and / or abnormal activity of a target gene.

[0112] In another aspect, the present application provides the epigenetic editing agent described herein, the nucleic acid described herein, the delivery vehicle described herein, the composition described herein, the cell described herein, or the kit described herein for use in treating or ameliorating a disease or a condition associated with abnormal expression of a target gene and / or abnormal activity of a target gene.

[0113] Fusion peptide

[0114] In some embodiments, the epigenetic modification domain and the transcriptional regulation domain are located at the N-terminus or C-terminus of the TALE domain. For example, the fusion peptide has, from N-terminus to C-terminus, the epigenetic modification domain, the transcriptional regulation domain, and the TALE domain. For example, the fusion peptide has, from N-terminus to C-terminus, the transcriptional regulation domain, the epigenetic modification domain, and the TALE domain. For example, the fusion peptide has, from N-terminus to C-terminus, the TALE domain, the epigenetic modification domain, and the transcriptional regulation domain. For example, the fusion peptide has, from N-terminus to C-terminus, the TALE domain, the transcriptional regulation domain, and the epigenetic modification domain.

[0115] In some embodiments, the epigenetic modification domain and the transcriptional regulation domain are located at the N-terminus and C-terminus of the TALE domain, respectively. For example, the fusion peptide has, from N-terminus to C-terminus, the epigenetic modification domain, the TALE domain, and the transcriptional regulation domain.

[0116] In some specific embodiments, the fusion peptide has, from N-terminus to C-terminus: 1) one or a combination of DNMT3A and DNMT3L, one or more than one zinc-finger protein-based transcription factor, and the TALE domain; or 2) one or more than one zinc-finger protein-based transcription factor, DNMT3A and DNMT3L, or a combination thereof, and the TALE domain; or 3) the TALE domain, DNMT3A and DNMT3L, or a combination thereof, and one or more than one zinc-finger protein-based transcription factor; or 4) the TALE domain, one or more than one zinc-finger protein-based transcription factor, and DNMT3A and DNMT3L, or a combination thereof; 5) one or a combination of DNMT3A and DNMT3L, the TALE domain, and one or more than one zinc-finger protein-based transcription factor; or 6) one or more than one zinc-finger protein-based transcription factor, the TALE domain, and DNMT3A and DNMT3L, or a combination thereof.

[0117] In some embodiments of the above cases, the epigenetic modification domain can comprise DNMT3A and DNMT3L, with the C-terminus of the DNMT3A connected to the N-terminus of the DNMT3L, or the C-terminus of the DNMT3L connected to the N-terminus of the DNMT3A. Also in these cases, the transcriptional regulation domain can comprise a transcriptional repressor domain. For example, the transcriptional regulation domain comprises a zinc-finger protein-based transcription factor or a functionally active fragment thereof. Specifically, the zinc-finger protein-based transcription factor can comprise KRAB. For example, in some embodiments of the present application, the zinc-finger protein-based transcription factor can be selected from the group consisting of ZIM3 KRAB and KOX1 KRAB.

[0118] The following structures can include a TALE-DNMT3A-DNMT3L-ZIM3 KRAB, TALE- ZIM3 KRAB-DNMT3L-DNMT3A, TALE-ZIM3 KRAB-DNMT3A-DNMT3L, ZIM3 KRAB- DNMT3A-DNMT3L-TALE, DNMT3A-DNMT3L-ZIM3 KRAB-TALE, DNMT3A-DNMT3L- ZNF324-TALE, DNMT3A-DNMT3L-ZNF419-TALE, DNMT3A-DNMT3L-TALE-EZH2, DNMT3A-DNMT3L-TALE-HDAC3, DNMT3A-DNMT3L-TALE-HP1a, DNMT3A- DNMT3L-TALE-KRAB, or DNMT3A-DNMT3L-TALE-ZIM3 KRAB structure as described previously.

[0119] Still further, exemplary fusion structures are described in the following schemes: V1 scheme: NLS-TALE HPT15-2xNLS-XTEN80-DNMT3A-DNMT3L-XTEN16-ZIM3, which can include the following components from N- to C-terminus, which can be directly or indirectly linked between the components:

[0120] NLS (e.g., SEQ ID NO: 129), TALE HPT15 (e.g., SEQ ID NO: 35), NLS (e.g., SEQ ID NO: 128), NLS (e.g., SEQ ID NO: 128), DNMT3A (e.g., SEQ ID NO: 131), DNMT3L-CD (e.g., SEQ ID NO: 44), Zim3 Krab (e.g., SEQ ID NO: 132).

[0121] Further, the V1 scheme can further include an XTEN linker, e.g., which can include the following components from N- to C-terminus, which can be directly or indirectly linked between the components:

[0122] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0123] TALE HPT15, e.g., a sequence as set forth in SEQ ID NO: 35;

[0124] one or more (e.g., 2) sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0125] linker4-XTEN 80linker 1, e.g., a sequence as set forth in SEQ ID NO: 86;

[0126] DNMT3A, e.g., a sequence as set forth in SEQ ID NO: 131;

[0127] DNMT3L-CD, e.g., a sequence as set forth in SEQ ID NO: 44;

[0128] linker10-XTEN 16linker 2, e.g., a sequence as set forth in SEQ ID NO: 92;

[0129] Zim3 Krab, e.g., a sequence as set forth in SEQ ID NO: 132.

[0130] V2 scheme: NLS-TALE HPT15-2xNLS-XTEN80-ZIM3-XTEN80-hDNMT3L-DNMT3A, which can include the following components from N-terminus to C-terminus, which can be directly or indirectly connected between the following components:

[0131] NLS (e.g., SEQ ID NO: 129), TALE HPT15 (e.g., SEQ ID NO: 35), NLS (e.g., SEQ ID NO: 128), NLS (e.g., SEQ ID NO: 128), Zim3 Krab (e.g., SEQ ID NO: 132), hDNMT3L (e.g., SEQ ID NO: 45), DNMT3A (e.g., SEQ ID NO: 131).

[0132] Further, the V2 scheme can further include XTEN linkers, e.g., which can include the following components from N-terminus to C-terminus, which can be directly or indirectly connected between the following components:

[0133] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0134] TALE HPT15, e.g., a sequence as set forth in SEQ ID NO: 35;

[0135] one or more (e.g., 2) sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0136] linker4-XTEN 80linker 1, e.g., a sequence as set forth in SEQ ID NO: 86;

[0137] Zim3 Krab, e.g., a sequence as set forth in SEQ ID NO: 132;

[0138] linker12-XTEN 80linker 2, e.g., a sequence as set forth in SEQ ID NO: 94;

[0139] human DNMT3L, e.g., a sequence as set forth in SEQ ID NO: 45;

[0140] linker3-flexible peptide linker, e.g., a sequence as set forth in SEQ ID NO: 85;

[0141] DNMT3A, e.g., a sequence as set forth in SEQ ID NO: 131.

[0142] V3 scheme: NLS-TALE HPT15-2xNLS-XTEN80-ZIM3-XTEN80-DNMT3A-hDNMT3L, which can include the following components from N-terminus to C-terminus, which can be directly or indirectly connected between the following components:

[0143] NLS (e.g., SEQ ID NO: 128), HPT15 (e.g., SEQ ID NO: 35), NLS (e.g., SEQ ID NO: 128), NLS (e.g., SEQ ID NO: 128), Zim3 Krab (e.g., SEQ ID NO: 132), DNMT3A (e.g., SEQ ID NO: 131), hDNMT3L (e.g., SEQ ID NO: 45).

[0144] Further, the V3 scheme can further include XTEN linkers, e.g., which can include the following components from N-terminus to C-terminus, which can be directly or indirectly connected between the following components:

[0145] sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0146] HPT15, e.g., a sequence as set forth in SEQ ID NO: 35;

[0147] one or more (e.g., 2) sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0148] linker4-XTEN 80linker 1, e.g., a sequence as set forth in SEQ ID NO: 86;

[0149] Zim3 Krab, e.g., a sequence as set forth in SEQ ID NO: 132;

[0150] linker 22-fused XTEN80 linker 2, e.g., a sequence as set forth in SEQ ID NO: 126;

[0151] DNMT3A, e.g., a sequence as set forth in SEQ ID NO: 131;

[0152] hDNMT3L, e.g., a sequence as set forth in SEQ ID NO: 45.

[0153] V4 scheme: ZIM3-BFP-DNMT3A-hDNMT3L-XTEN80-NLS-TALE HPT15-2xNLS, which can include the following components from N-terminus to C-terminus, which can be directly or indirectly connected between the following components:

[0154] Zim3 Krab (e.g., SEQ ID NO: 132), BFP (e.g., SEQ ID NO: 143), DNMT3A (e.g., SEQ ID NO: 131), hDNMT3L (e.g., SEQ ID NO: 45), NLS (e.g., SEQ ID NO: 128), HPT15 (e.g., SEQ ID NO: 35), NLS (e.g., SEQ ID NO: 128), NLS (e.g., SEQ ID NO: 128).

[0155] Further, the V4 scheme can further include XTEN linkers, e.g., which can include the following components from N-terminus to C-terminus, which can be directly or indirectly connected between the following components:

[0156] Zim3 Krab, e.g., a sequence as set forth in SEQ ID NO: 132;

[0157] linker 11-XTEN 16linker 1, e.g., a sequence as set forth in SEQ ID NO: 93;

[0158] BFP (blue fluorescent protein), e.g., a sequence as set forth in SEQ ID NO: 143;

[0159] linker 11-XTEN 16linker 1, e.g., a sequence as set forth in SEQ ID NO: 93;

[0160] DNMT3A, e.g., a sequence as set forth in SEQ ID NO: 131;

[0161] hDNMT3L, e.g., a sequence as set forth in SEQ ID NO: 45;

[0162] linker4-XTEN 80linker 1, e.g., a sequence as set forth in SEQ ID NO: 86;

[0163] sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0164] HPT15, e.g., a sequence as set forth in SEQ ID NO: 35;

[0165] one or more (e.g., 2) sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128.

[0166] V5 scheme: NLS-DNMT3A-hDNMT3L-XTEN80-ZIM3-XTEN80-NLS-TALE HPT15-2xNLS, which can include the following components from N- to C-terminus, which can be directly or indirectly linked:

[0167] NLS (e.g., SEQ ID NO: 129), DNMT3A (e.g., SEQ ID NO: 131), hDNMT3L (e.g., SEQ ID NO: 45), Zim3 Krab (e.g., SEQ ID NO: 132), NLS (e.g., SEQ ID NO: 128), TALE HPT15 (e.g., SEQ ID NO: 35), NLS (e.g., SEQ ID NO: 128), NLS (e.g., SEQ ID NO: 128).

[0168] Further, the V5 scheme can further include XTEN linkers, e.g., which can include the following components from N- to C-terminus, which can be directly or indirectly linked:

[0169] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0170] DNMT3A, e.g., a sequence as set forth in SEQ ID NO: 131;

[0171] hDNMT3L, e.g., a sequence as set forth in SEQ ID NO: 45;

[0172] linker4-XTEN 80linker 1, e.g., a sequence as set forth in SEQ ID NO: 86;

[0173] Zim3 Krab, e.g., a sequence as set forth in SEQ ID NO: 132;

[0174] linker 15-fused XTEN80 linker 1, e.g., a sequence as set forth in SEQ ID NO: 119;

[0175] sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0176] TALE HPT15, e.g., a sequence as set forth in SEQ ID NO: 35;

[0177] linker 5-GS linker, e.g., a sequence as set forth in SEQ ID NO: 87;

[0178] one or more (e.g., 2) sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128.

[0179] V6 scheme: NLS-DNMT3A-hDNMT3L-XTEN80-ZNF324-XTEN80-NLS-TALE HPT15-2xNLS, which can include the following components from N-terminus to C-terminus, which can be directly or indirectly connected between the following components:

[0180] NLS (e.g., SEQ ID NO: 129), DNMT3A (e.g., SEQ ID NO: 131), hDNMT3L (e.g., SEQ ID NO: 45), Znf324 (e.g., SEQ ID NO: 54), NLS (e.g., SEQ ID NO: 128), HPT15 (e.g., SEQ ID NO: 35), NLS (e.g., SEQ ID NO: 128), NLS (e.g., SEQ ID NO: 128).

[0181] Further, the V6 scheme can further include XTEN linkers, e.g., which can include the following components from N-terminus to C-terminus, which can be directly or indirectly connected between the following components:

[0182] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0183] DNMT3A, e.g., a sequence as set forth in SEQ ID NO: 131;

[0184] hDNMT3L, e.g., a sequence as set forth in SEQ ID NO: 45;

[0185] linker 4 - XTEN 80 linker 1, e.g., a sequence as set forth in SEQ ID NO: 86;

[0186] Znf324, e.g., a sequence as set forth in SEQ ID NO: 54;

[0187] linker 15 - fused XTEN linker 1, e.g., a sequence as set forth in SEQ ID NO: 119;

[0188] sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0189] HPT15, e.g., a sequence as set forth in SEQ ID NO: 35;

[0190] one or more (e.g., 2) sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128.

[0191] V7 scheme: NLS-DNMT3A-hDNMT3L-XTEN80-ZNF419-GS-XTEN80-NLS-TALE HPT15-2xNLS, which can include the following components from N- to C-terminus, which can be directly or indirectly linked:

[0192] NLS (e.g., SEQ ID NO: 129), DNMT3A (e.g., SEQ ID NO: 131), hDNMT3L (e.g., SEQ ID NO: 45), Znf419 (e.g., SEQ ID NO: 59), NLS (e.g., SEQ ID NO: 128), HPT15 (e.g., SEQ ID NO: 35), NLS (e.g., SEQ ID NO: 128), NLS (e.g., SEQ ID NO: 128).

[0193] Further, the V7 scheme can further include XTEN linkers, e.g., which can include the following components from N- to C-terminus, which can be directly or indirectly linked:

[0194] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0195] DNMT3A, e.g., a sequence as set forth in SEQ ID NO: 131;

[0196] hDNMT3L, e.g., a sequence as set forth in SEQ ID NO: 45;

[0197] linker4-XTEN 80linker 1, e.g., a sequence as set forth in SEQ ID NO: 86;

[0198] Znf419, e.g., a sequence as set forth in SEQ ID NO: 59;

[0199] sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0200] HPT15, e.g., a sequence as set forth in SEQ ID NO: 35;

[0201] one or more (e.g., 2) sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128.

[0202] V8 scheme: NLS-DNMT3A-DNMT3L-XTEN80-NLS-TALE HPT15-2xNLS-XTEN16-EZH2, which can include the following components from N-terminus to C-terminus, which can be directly or indirectly connected between the following components:

[0203] NLS (e.g., SEQ ID NO: 129), DNMT3A (e.g., SEQ ID NO: 131), DNMT3L-CD (e.g., SEQ ID NO: 44), NLS (e.g., SEQ ID NO: 128), HPT15 (e.g., SEQ ID NO: 35), NLS (e.g., SEQ ID NO: 128), NLS (e.g., SEQ ID NO: 128), EZH2 (e.g., SEQ ID NO: 66).

[0204] Further, the V8 scheme can further include XTEN linkers, e.g., which can include the following components from N-terminus to C-terminus, which can be directly or indirectly connected between the following components:

[0205] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0206] DNMT3A, e.g., a sequence as set forth in SEQ ID NO: 131;

[0207] DNMT3L-CD, e.g., a sequence as set forth in SEQ ID NO: 44;

[0208] linker4-XTEN 80linker 1, e.g., a sequence as set forth in SEQ ID NO: 86;

[0209] sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0210] HPT15, e.g., a sequence as set forth in SEQ ID NO: 35;

[0211] one or more (e.g., 2) sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0212] linker 11-XTEN 16linker 1, e.g., a sequence as set forth in SEQ ID NO: 93;

[0213] EZH2, e.g., a sequence as set forth in SEQ ID NO: 66.

[0214] V9 scheme: NLS-DNMT3A-DNMT3L-XTEN80-NLS-TALE HPT15-2xNLS-XTEN16-HDAC3, which can include the following components from N-terminus to C-terminus, which can be directly or indirectly connected between the following components:

[0215] NLS (e.g., SEQ ID NO: 129), DNMT3A (e.g., SEQ ID NO: 131), DNMT3L-CD (e.g., SEQ ID NO: 44), NLS (e.g., SEQ ID NO: 128), HPT15-2 (e.g., SEQ ID NO: 142), NLS (e.g., SEQ ID NO: 128), NLS (e.g., SEQ ID NO: 128), HAtag (e.g., SEQ ID NO: 133), HDAC3 (e.g., SEQ ID NO: 72).

[0216] Further, the V9 scheme can further include XTEN linker, e.g., which can include the following components from N-terminus to C-terminus, which can be directly or indirectly connected between the following components:

[0217] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0218] DNMT3A, e.g., a sequence as set forth in SEQ ID NO: 131;

[0219] DNMT3L-CD, e.g., a sequence as set forth in SEQ ID NO: 44;

[0220] sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0221] HPT15, e.g., a sequence as set forth in SEQ ID NO: 35;

[0222] one or more (e.g., 2) sv40 NLSs, e.g., a sequence as set forth in SEQ ID NO: 128;

[0223] linker 11-XTEN 16linker 1, e.g., a sequence as set forth in SEQ ID NO: 93;

[0224] HDAC3, e.g., a sequence as set forth in SEQ ID NO: 72.

[0225] V10 scheme: NLS-DNMT3A-DNMT3L-XTEN80-NLS-TALE HPT15-2xNLS-XTEN16-HP1a, which can include the following components from N-terminus to C-terminus, which can be directly or indirectly connected between the following components:

[0226] NLS (e.g., SEQ ID NO: 129), DNMT3A (e.g., SEQ ID NO: 131), DNMT3L-CD (e.g., SEQ ID NO: 44), NLS (e.g., SEQ ID NO: 128), HPT15 (e.g., SEQ ID NO: 35), NLS (e.g., SEQ ID NO: 128), NLS (e.g., SEQ ID NO: 128), HP1a (e.g., SEQ ID NO: 70).

[0227] Further, the V10 scheme can further include XTEN linkers, e.g., which can include the following components from N-terminus to C-terminus, which can be directly or indirectly connected between the following components:

[0228] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0229] DNMT3A, e.g., a sequence as set forth in SEQ ID NO: 131;

[0230] DNMT3L-CD, e.g., a sequence as set forth in SEQ ID NO: 44;

[0231] linker 4-XTEN 80linker 1, e.g., a sequence as set forth in SEQ ID NO: 86;

[0232] sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0233] HPT15, e.g., a sequence as set forth in SEQ ID NO: 35;

[0234] one or more (e.g., 2) sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0235] linker 11 -XTEN 16 linker 1, e.g., a sequence as set forth in SEQ ID NO: 93;

[0236] HP1a, e.g., a sequence as set forth in SEQ ID NO: 70.

[0237] V25 scheme: NLS-DNMT3A-DNMT3L-XTEN80-NLS-TALE HPT15-2xNLS-XTEN16-Krab, which can include the following components from N-terminus to C-terminus, which can be directly or indirectly connected between the following components:

[0238] NLS (e.g., SEQ ID NO: 129), DNMT3A (e.g., SEQ ID NO: 131), DNMT3L-CD (e.g., SEQ ID NO: 44), NLS (e.g., SEQ ID NO: 128), HPT15-2 (e.g., SEQ ID NO: 142), NLS (e.g., SEQ ID NO: 128), NLS (e.g., SEQ ID NO: 128), KRAB (e.g., SEQ ID NO: 48).

[0239] Further, the V25 scheme can further include XTEN linkers, e.g., which can include the following components from N-terminus to C-terminus, which can be directly or indirectly connected between the following components:

[0240] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0241] DNMT3A, e.g., a sequence as set forth in SEQ ID NO: 131;

[0242] DNMT3L-CD, e.g., a sequence as set forth in SEQ ID NO: 44;

[0243] linker 4 -XTEN 80 linker 1, e.g., a sequence as set forth in SEQ ID NO: 86;

[0244] sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0245] HPT15, e.g., a sequence as set forth in SEQ ID NO: 35;

[0246] one or more (e.g., 2) sv40 NLSs, e.g., a sequence as set forth in SEQ ID NO: 128;

[0247] linker 11 -XTEN 16 linker 1, e.g., a sequence as set forth in SEQ ID NO: 93;

[0248] KRAB, e.g., a sequence as set forth in SEQ ID NO: 48.

[0249] V26 scheme: NLS-DNMT3A-hDNMT3L-XTEN80-NLS-TALE HPT15-2xNLS-XTEN16-Zim3, which can include, from N- to C-terminal, the following components in direct or indirect linkage:

[0250] NLS (e.g., SEQ ID NO: 129), DNMT3A (e.g., SEQ ID NO: 131), hDNMT3L (e.g., SEQ ID NO: 45), NLS (e.g., SEQ ID NO: 128), HPT15 (e.g., SEQ ID NO: 35), NLS (e.g., SEQ ID NO: 128), NLS (e.g., SEQ ID NO: 128), Zim3 Krab (e.g., SEQ ID NO: 132).

[0251] Further, the V26 scheme can further include XTEN linkers, e.g., which can include, from N- to C-terminal, the following components in direct or indirect linkage:

[0252] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0253] DNMT3A, e.g., a sequence as set forth in SEQ ID NO: 131;

[0254] hDNMT3L, e.g., a sequence as set forth in SEQ ID NO: 45;

[0255] linker 4 -XTEN 80 linker 1, e.g., a sequence as set forth in SEQ ID NO: 86;

[0256] sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0257] HPT15, e.g., a sequence as set forth in SEQ ID NO: 35;

[0258] one or more (e.g., 2) sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0259] linker 11-XTEN 16linker 1, e.g., a sequence as set forth in SEQ ID NO: 93;

[0260] Zim3 Krab, e.g., a sequence as set forth in SEQ ID NO: 132.

[0261] V27 scheme: NLS-DNMT3A-hDNMT3L-XTEN80-ZIM3-XTEN80-NLS-TALE HPT21-2xNLS, which can include the following components from N-terminus to C-terminus, which can be directly or indirectly connected between the following components:

[0262] NLS (e.g., SEQ ID NO: 129), DNMT3A (e.g., SEQ ID NO: 131), hDNMT3L (e.g., SEQ ID NO: 45), Zim3 Krab (e.g., SEQ ID NO: 132), NLS (e.g., SEQ ID NO: 128), TALE HPT21 (e.g., SEQ ID NO: 36), NLS (e.g., SEQ ID NO: 128), NLS (e.g., SEQ ID NO: 128).

[0263] Further, the V27 scheme can further include XTEN linkers, e.g., which can include the following components from N-terminus to C-terminus, which can be directly or indirectly connected between the following components:

[0264] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0265] DNMT3A, e.g., a sequence as set forth in SEQ ID NO: 131;

[0266] hDNMT3L, e.g., a sequence as set forth in SEQ ID NO: 45;

[0267] linker 4-XTEN 80linker 1, e.g., a sequence as set forth in SEQ ID NO: 86;

[0268] Zim3 Krab, e.g., a sequence as set forth in SEQ ID NO: 132.

[0269] linker 15-fused XTEN80 linker 1, e.g., a sequence as set forth in SEQ ID NO: 119;

[0270] sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0271] TALE HPT21, e.g., a sequence as set forth in SEQ ID NO: 36;

[0272] one or more (e.g., 2) sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128.

[0273] V27-N141 scheme: NLS-DNMT3A-hDNMT3L-XTEN80-ZIM3-XTEN80-NLS-TALE HPT21-2xNLS, which can include the following components from N-terminus to C-terminus, which can be directly or indirectly connected between the following components:

[0274] NLS (e.g., SEQ ID NO: 129), DNMT3A (e.g., SEQ ID NO: 131), hDNMT3L (e.g., SEQ ID NO: 45), Zim3 Krab (e.g., SEQ ID NO: 132), NLS (e.g., SEQ ID NO: 128), TALE HPT21 (e.g., SEQ ID NO: 134), NLS (e.g., SEQ ID NO: 128), NLS (e.g., SEQ ID NO: 128).

[0275] Further, the V27-N141 scheme can further include XTEN linkers, e.g., which can include the following components from N-terminus to C-terminus, which can be directly or indirectly connected between the following components:

[0276] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0277] DNMT3A, e.g., a sequence as set forth in SEQ ID NO: 131;

[0278] hDNMT3L, e.g., a sequence as set forth in SEQ ID NO: 45;

[0279] linker4-XTEN 80linker 1, e.g., a sequence as set forth in SEQ ID NO: 86;

[0280] Zim3 Krab, e.g., a sequence as set forth in SEQ ID NO: 132;

[0281] linker 15-fused XTEN80 linker 1, e.g., a sequence as set forth in SEQ ID NO: 119;

[0282] sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0283] TALE HPT21, e.g., a sequence as set forth in SEQ ID NO: 36;

[0284] one or more (e.g., 2) sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128.

[0285] V27-N153 scheme: DNMT3A-hDNMT3L-XTEN80-ZIM3-XTEN80-NLS-TALE HPT21-2xNLS, which can include the following components from N-terminus to C-terminus, which can be directly or indirectly connected between the following components:

[0286] NLS (e.g., SEQ ID NO: 129), DNMT3A (e.g., SEQ ID NO: 131), hDNMT3L (e.g., SEQ ID NO: 45), Zim3 Krab (e.g., SEQ ID NO: 132), NLS (e.g., SEQ ID NO: 128), TALE HPT21 (e.g., SEQ ID NO: 36), NLS (e.g., SEQ ID NO: 128), NLS (e.g., SEQ ID NO: 128).

[0287] Further, the V27-N153 scheme can further include XTEN linkers, e.g., which can include the following components from N-terminus to C-terminus, which can be directly or indirectly connected between the following components:

[0288] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0289] DNMT3A, e.g., a sequence as set forth in SEQ ID NO: 131;

[0290] hDNMT3L, e.g., a sequence as set forth in SEQ ID NO: 45;

[0291] linker4-XTEN 80linker 1, e.g., a sequence as set forth in SEQ ID NO: 86;

[0292] Zim3 Krab, e.g., a sequence as set forth in SEQ ID NO: 132;

[0293] linker 15-fused XTEN80 linker 1, e.g., a sequence as set forth in SEQ ID NO: 119;

[0294] sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0295] TALE HPT21, e.g., a sequence as set forth in SEQ ID NO: 36;

[0296] one or more (e.g., 2) sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128.

[0297] V27-N207 scheme: DNMT3A-hDNMT3L-XTEN80-ZIM3-XTEN80-TALE HPT21, which can include, from N-terminus to C-terminus, the following components connected directly or indirectly between the following components:

[0298] NLS (e.g., SEQ ID NO: 129), DNMT3A (e.g., SEQ ID NO: 131), hDNMT3L (e.g., SEQ ID NO: 45), Zim3 Krab (e.g., SEQ ID NO: 132), NLS (e.g., SEQ ID NO: 128), TALE HPT21 (e.g., SEQ ID NO: 36), NLS (e.g., SEQ ID NO: 128), NLS (e.g., SEQ ID NO: 128).

[0299] Further, the V27-N207 scheme can further include an XTEN linker, e.g., which can include, from N-terminus to C-terminus, the following components connected directly or indirectly between the following components:

[0300] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0301] DNMT3A, e.g., a sequence as set forth in SEQ ID NO: 131;

[0302] hDNMT3L, e.g., a sequence as set forth in SEQ ID NO: 45;

[0303] linker4-XTEN 80linker 1, e.g., a sequence as set forth in SEQ ID NO: 86;

[0304] Zim3 Krab, e.g., a sequence as set forth in SEQ ID NO: 132;

[0305] one or more (e.g., 2) sv40 NLSs, e.g., a sequence as set forth in SEQ ID NO: 128.

[0306] one or more (e.g., 2) sv40 NLSs, e.g., a sequence as set forth in SEQ ID NO: 128.

[0307] TALE HPT21, e.g., a sequence as set forth in SEQ ID NO: 136.

[0308] one or more (e.g., 2) sv40 NLSs, e.g., a sequence as set forth in SEQ ID NO: 128.

[0309] V29 scheme: NLS-DNMT3A-DNMT3L-XTEN80-NLS-TALE HPT21-2xNLS-XTEN16-Krab, which can include the following components from N-terminus to C-terminus, which can be directly or indirectly connected between the following components:

[0310] NLS (e.g., SEQ ID NO: 129), DNMT3A (e.g., SEQ ID NO: 131), DNMT3L-CD (e.g., SEQ ID NO: 44), NLS (e.g., SEQ ID NO: 128), HPT21 (e.g., SEQ ID NO: 36), NLS (e.g., SEQ ID NO: 128), NLS (e.g., SEQ ID NO: 128), KRAB (e.g., SEQ ID NO: 48).

[0311] Further, the V29 scheme can further include an XTEN linker, e.g., which can include the following components from N-terminus to C-terminus, which can be directly or indirectly connected between the following components:

[0312] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0313] DNMT3A, e.g., a sequence as set forth in SEQ ID NO: 131;

[0314] DNMT3L-CD, e.g., a sequence as set forth in SEQ ID NO: 44;

[0315] linker4-XTEN 80linker 1, e.g., a sequence as set forth in SEQ ID NO: 86;

[0316] one or more (e.g., 2) sv40 NLSs, e.g., a sequence as set forth in SEQ ID NO: 128.

[0317] HPT21, e.g., a sequence as set forth in SEQ ID NO: 36;

[0318] one or more (e.g., 2) sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0319] linker 11-XTEN 16linker 1, e.g., a sequence as set forth in SEQ ID NO: 93;

[0320] KRAB, e.g., a sequence as set forth in SEQ ID NO: 48.

[0321] V30 scheme: NLS-DNMT3A-hDNMT3L-XTEN80-ZIM3-XTEN80-NLS-TALE HPT25-2xNLS, which can include the following components from N-terminus to C-terminus, which can be directly or indirectly connected between the following components:

[0322] NLS (e.g., SEQ ID NO: 129), DNMT3A (e.g., SEQ ID NO: 131), hDNMT3L (e.g., SEQ ID NO: 45), Zim3 Krab (e.g., SEQ ID NO: 132), NLS (e.g., SEQ ID NO: 128), TALE HPT25 (e.g., SEQ ID NO: 39), NLS (e.g., SEQ ID NO: 128), NLS (e.g., SEQ ID NO: 128).

[0323] Further, the V30 scheme can further include XTEN linkers, e.g., which can include the following components from N-terminus to C-terminus, which can be directly or indirectly connected between the following components:

[0324] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0325] DNMT3A, e.g., a sequence as set forth in SEQ ID NO: 131;

[0326] hDNMT3L, e.g., a sequence as set forth in SEQ ID NO: 45;

[0327] linker 4-XTEN 80linker 1, e.g., a sequence as set forth in SEQ ID NO: 86;

[0328] Zim3 Krab, e.g., a sequence as set forth in SEQ ID NO: 132;

[0329] linker 15-fused XTEN80 linker 1, e.g., a sequence as set forth in SEQ ID NO: 119;

[0330] sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0331] TALE HPT25, e.g., a sequence as set forth in SEQ ID NO: 39;

[0332] linker 5-GS linker, e.g., a sequence as set forth in SEQ ID NO: 87;

[0333] sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0334] sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128.

[0335] V32 scheme: NLS-DNMT3A-DNMT3L-XTEN80-NLS-TALE HPT25-2xNLS-XTEN16-Krab, which can include, from N-terminus to C-terminus, the following components in direct or indirect linkage:

[0336] NLS (e.g., SEQ ID NO: 129), DNMT3A (e.g., SEQ ID NO: 131), DNMT3L-CD (e.g., SEQ ID NO: 44), NLS (e.g., SEQ ID NO: 128), HPT25 (e.g., SEQ ID NO: 39), NLS (e.g., SEQ ID NO: 128), NLS (e.g., SEQ ID NO: 128), KRAB (e.g., SEQ ID NO: 48).

[0337] Further, the V32 scheme can further include an XTEN linker, e.g., which can include, from N-terminus to C-terminus, the following components in direct or indirect linkage:

[0338] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0339] DNMT3A, e.g., a sequence as set forth in SEQ ID NO: 131;

[0340] DNMT3L-CD, e.g., a sequence as set forth in SEQ ID NO: 44;

[0341] linker4-XTEN 80linker 1, e.g., a sequence as set forth in SEQ ID NO: 86;

[0342] sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0343] HPT25, e.g., a sequence as set forth in SEQ ID NO: 39;

[0344] one or more (e.g., 2) sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0345] linker11-XTEN 16linker 1, e.g., a sequence as set forth in SEQ ID NO: 93;

[0346] KRAB, e.g., a sequence as set forth in SEQ ID NO: 48.

[0347] V33 scheme: NLS-DNMT3A-DNMT3L-XTEN80-NLS-TALE HPT11-2xNLS-XTEN16-Krab, which can include the following components from N- to C-terminus, which can be directly or indirectly linked between components:

[0348] NLS (e.g., SEQ ID NO: 129), DNMT3A (e.g., SEQ ID NO: 131), DNMT3L-CD (e.g., SEQ ID NO: 44), NLS (e.g., SEQ ID NO: 128), TALE HPT11 (e.g., SEQ ID NO: 149), NLS (e.g., SEQ ID NO: 128), NLS (e.g., SEQ ID NO: 128), KRAB (e.g., SEQ ID NO: 48).

[0349] V34 scheme: NLS-DNMT3A-DNMT3L-XTEN80-NLS-TALE HPT13-2xNLS-XTEN16-Krab, which can include the following components from N- to C-terminus, which can be directly or indirectly linked between components:

[0350] NLS (e.g., SEQ ID NO: 129), DNMT3A (e.g., SEQ ID NO: 131), DNMT3L-CD (e.g., SEQ ID NO: 44), NLS (e.g., SEQ ID NO: 128), TALE HPT13 (e.g., SEQ ID NO: 150), NLS (e.g., SEQ ID NO: 128), NLS (e.g., SEQ ID NO: 128), KRAB (e.g., SEQ ID NO: 48).

[0351] Further, the V34 scheme can further comprise an XTEN linker, for example, the following components can be included from N-terminus to C-terminus, which can be directly or indirectly connected between the following components:

[0352] c-myc NLS, for example, a sequence as set forth in SEQ ID NO: 129;

[0353] DNMT3A, for example, a sequence as set forth in SEQ ID NO: 131;

[0354] DNMT3L-CD, for example, a sequence as set forth in SEQ ID NO: 44;

[0355] linker4-XTEN 80linker 1, for example, a sequence as set forth in SEQ ID NO: 86;

[0356] sv40 NLS, for example, a sequence as set forth in SEQ ID NO: 128;

[0357] TALE HPT13, for example, a sequence as set forth in SEQ ID NO: 150;

[0358] HAtag, for example, a sequence as set forth in SEQ ID NO: 133;

[0359] linker5-GS linker, for example, a sequence as set forth in SEQ ID NO: 87;

[0360] one or more (e.g., 2) sv40 NLS, for example, a sequence as set forth in SEQ ID NO: 128;

[0361] linker11-XTEN 16linker 1, for example, a sequence as set forth in SEQ ID NO: 93;

[0362] KRAB, for example, a sequence as set forth in SEQ ID NO: 48.

[0363] The sequence composition of the above scheme is as follows:

[0364] The following are example fusions of the present application, with the components of the amino acid sequence shown below:

[0365] 1) NLS-TALE HPT15-2xNLS-XTEN80-DNMT3A-DNMT3L-XTEN16-ZIM3 KRAB (Vl scheme, SEQ ID NO: 1):

[0366] 2) NLS-TALE HPT15-2xNLS-XTEN80-ZIM3 KRAB-XTEN80-(human)DNMT3L-DNMT3A (V2 scheme, SEQ ID NO: 2):

[0367] 3) NLS-TALE HPT15-2xNLS-XTEN80-ZIM3 KRAB-XTEN80-DNMT3A-(human)DNMT3L (V3 scheme, SEQ ID NO: 3):

[0368] 4) ZIM3 KRAB-BFP-DNMT3A-(human)DNMT3L-XTEN80-NLS-TALE HPT15-2xNLS (V4 scheme, SEQ ID NO: 4):

[0369] 5) NLS-DNMT3A-(human)DNMT3L-XTEN80-ZIM3 KRAB-XTEN80-NLS-TALE HPT15-2xNLS (V5 scheme, SEQ ID NO: 5):

[0370] 6) NLS-DNMT3A-(human)DNMT3L-XTEN80-ZNF324-XTEN80-NLS-TALE HPT15-2xNLS (V6 scheme, SEQ ID NO: 6):

[0371] 7) NLS-DNMT3A-(human)DNMT3L-XTEN80-ZNF419-GS-XTEN80-NLS-TALE HPT15-2xNLS (V7 scheme, SEQ ID NO: 7):

[0372] 8) NLS-DNMT3A-DNMT3L-XTEN80-NLS-TALE HPT15-2xNLS-XTEN16-EZH2 (V8 scheme, SEQ ID NO: 8):

[0373] 9) NLS-DNMT3A-DNMT3L-XTEN80-NLS-TALE HPT15-2xNLS-XTEN16-HDAC3 (V9 scheme, SEQ ID NO: 9):

[0374] 10) NLS-DNMT3A-DNMT3L-XTEN80-NLS-TALE HPT15-2xNLS-XTEN16-HP1a (V10 scheme, SEQ ID NO: 10):

[0375] 11) NLS-DNMT3A-DNMT3L-XTEN80-NLS-TALE HPT15-2xNLS-XTEN16-KRAB (V25 scheme, SEQ ID NO: 25):

[0376] 12) NLS-DNMT3A-(human)DNMT3L-XTEN80-NLS-TALE HPT15-2xNLS-XTEN16-ZIM3 KRAB (V26 scheme, SEQ ID NO: 26):

[0377] 13) NLS-DNMT3A-(human)DNMT3L-XTEN80-ZIM3 KRAB-XTEN80-NLS-TALE HPT21-2xNLS (V27 scheme, SEQ ID NO: 27):

[0378] 14) NLS-DNMT3A-DNMT3L-XTEN80-NLS-TALE HPT21-2xNLS-XTEN16-KRAB (V29 protocol, SEQ ID NO: 29):

[0379] 15) NLS-DNMT3A-(human)DNMT3L-XTEN80-ZIM3 KRAB-XTEN80-NLS-TALE HPT25-2xNLS (V30 protocol, SEQ ID NO: 30):

[0380] 16) NLS-DNMT3A-DNMT3L-XTEN80-NLS-TALE HPT25-2xNLS-XTEN16-KRAB (V32 protocol, SEQ ID NO: 32):

[0381] 17) NLS-DNMT3A-DNMT3L-XTEN80-NLS-TALE HPT11-2xNLS-XTEN16-KRAB (V33 protocol, SEQ ID NO: 33):

[0382] 18) NLS-DNMT3A-DNMT3L-XTEN80-NLS-TALE HPT13-2xNLS-XTEN16-KRAB (V34 protocol, SEQ ID NO: 34):

[0383] 19) (V27-N141) NLS-DNMT3A-(human)DNMT3L-XTEN80-ZIM3 KRAB-XTEN80-NLS-TALE HPT21-2xNLS (V27-N141 protocol, SEQ ID NO: 137):

[0384] 20) (V27-N153) NLS-DNMT3A-(human)DNMT3L-XTEN80-ZIM3 KRAB-XTEN80-TALE HPT21 (V27-N153 protocol, SEQ ID NO: 138):

[0385] 21) (V27-N207) NLS-DNMT3A-(human) DNMT3L-XTEN80-ZIM3 KRAB-XTEN80-NLS-TALE HPT21-2xNLS (V27-N207 protocol, SEQ ID NO: 139):

[0386] Composite peptides and first and second fusion thereof

[0387] In some embodiments, the first and second fusion of the epigenetic editing agent (composite peptide) of the present application can be generally classified into two cases: (1) one of the two fusions comprises a TALE domain, an epigenetic modification domain, and a recruiting domain A, and the other fusion comprises a transcription repressor domain and a recruiting domain A', or (2) one of the two fusions comprises a TALE domain, a transcription repressor, and a recruiting domain A, and the other fusion comprises an epigenetic modification domain and a recruiting domain A'.

[0388] Specifically, in some embodiments of the above case (1), one of the two fusions can comprise, in order from N-terminus to C-terminus, an epigenetic modification domain, a TALE domain, and a recruiting domain A. For example, in some embodiments of the above case (2), one of the two fusions can comprise, in order from N-terminus to C-terminus, a recruiting domain A, a TALE domain, and a transcription repressor domain. For example, in some embodiments of the above case (1), the other of the two fusions can comprise, in order from N-terminus to C-terminus, a transcription repressor domain and a recruiting domain A', or a recruiting domain A' and a transcription repressor domain, i.e., the transcription repressor domain and the recruiting domain A' can be connected in an interchangeable order. For example, in some embodiments of the above case (2), the other of the two fusions can comprise, in order from N-terminus to C-terminus, an epigenetic modification domain and a recruiting domain A', or a recruiting domain A' and an epigenetic modification domain, i.e., the epigenetic modification domain and the recruiting domain A' can be connected in an interchangeable order.

[0389] In some more specific embodiments, the TALE domain can comprise, but is not limited to, an amino acid sequence set forth in any one of SEQ ID NOs: 35-41, 134-136, 142, 144-145, 149-150.

[0390] In some more specific embodiments, the transcriptional repressor is selected from one or more of the following domains: KRAB, ZIM3 KRAB, ZNF680, ZNF554, ZNF264, ZNF582, ZNF324, ZNF669, ZNF354A, ZNF82, ZNF595, ZNF419, ZNF566, ZIM2, EHMT2, SUV39H1, ZFPM1, TRIM28, EZH2, MXD1, SID, LSD1, HP1a, HDAC3, HDAC1, PRMT1, SETDB1, hSIRT1, ZNF436, ZNF257, ZNF675, ZNF490, ZNF320, ZNF331, ZNF816, ZNF41, ZNF189, ZNF528, ZNF543, ZNF140, ZNF610, ZNF350, ZNF8, ZNF30, ZNF98, ZNF677, ZNF596, ZNF214, ZNF37A, ZNF34, ZNF250, ZNF547, ZNF273, ZFP82, ZNF224, ZNF33A, ZNF45, ZNF175, ZNF184, ZFP28-1, ZFP28-2, ZNF18, ZNF213, ZNF394, ZFP1, ZFP14, ZNF416, ZNF557, ZNF729, ZNF254, ZNF764, ZNF785, ZNF10, CBX5, RYBP, YAF2, MGA, CBX1, SCMH1, MPP8, SUMO3, HERC2, BIN1, PCGF2, TOX, FOXA1, FOXA2, IRF2BP1, IRF2BP2, IRF2BPL IRF-2BP1_2 N-terminal domain, HOXA13, HOXB13, HOXC13, HOXA11, HOXC11, HOXC10, HOXA10, HOXB9, HOXA9, ZFP28, ZN334, ZN568, ZN37A, ZN181, ZN510, ZN862, ZN140, ZN208, ZN248, ZN571, ZN699, ZN726, ZIK1, ZNF2, Z705F, ZNF14, ZN471, ZN624, ZNF84, ZNF7, ZN891, ZN337, Z705G, ZN529, ZN729, ZN419, Z705A, ZN302, ZN486, ZN621, ZN688, ZN33A, ZN554, ZN878, ZN772, ZN224, ZN184, ZN544, ZNF57, ZN283, ZN549, ZN211, ZN615, ZN253, ZN226, ZN730, Z585A, ZN732,ZN681, ZN667, ZN649, ZN470, ZN484, ZN431, ZN382, ZN254, ZN124, ZN607, ZN317, ZN620, ZN141, ZN584, ZN540, ZN75D, ZN555, ZN658, ZN684, RBAK, ZN829, ZN582, ZN112, ZN716, HKR1, ZN350, ZN480, ZN416, ZNF92, ZN100, ZN736, ZNF74, ZN443, ZN195, ZN530, ZN782, ZN791, ZN331, Z354C, ZN157, ZN727, ZN550, ZN793, ZN235, ZN724, ZN573, ZN577, ZN789, ZN718, ZN300, ZN383, ZN429, ZN677, ZN850, ZN454, ZN257, ZN264, ZN485, ZN737, ZNF44, ZN596, ZN565, ZN543, ZFP69, SUMO1, ZNF12, ZN169, ZN433, ZN175, ZN347, ZNF25, ZN519, Z585B, ZN517, ZN846, ZN230, ZNF66, ZN713, ZN816, ZN426, ZN674, ZN627, ZNF20, Z587B, ZN316, ZN233, ZN611, ZN556, ZN234, ZN560, ZNF77, ZN682, ZN614, ZN785, ZN445, ZFP30, ZN225, ZN551, ZN610, ZN528, ZN284, ZN418, ZN490, ZN805, Z780B, ZN763, ZN285, ZNF85, ZN223, ZNF90, ZN557, ZN425, ZN229, ZN606, ZN155, ZN222, ZN442, ZNF91, ZN135, ZN778, ZN534, ZN586, ZN567, ZN440, ZN583, ZN441, ZNF43, ZN589, ZN563, ZN561, ZN136, ZN630, ZN527, ZN333, Z324B, ZN786, ZN709, ZN792, ZN599, ZN613, ZF69B, ZN799, ZN569, ZN564, ZN546, ZFP92, ZN723, ZN439, ZFP57, ZNF19, ZN404, ZN274, CBX3, ZN250, ZN570, ZN675, ZN695, ZN548, ZN132, ZN738, ZN420, ZN626, ZN559, ZN460, ZN268, ZN304, ZN605,ZN844, SUMO5, ZN101, ZN783, ZN417, ZN182, ZN823, ZN177, ZN197, ZN717, ZN669, ZN256, ZN251, CBX4, CDY2, CDYL2, ZN562, ZN461, Z324A, ZN766, ID2, ZN214, CBX7, ID1, CREM, SCX, ASCL1, ZN764, SCML2, TWST1, CREB1, TERF1, ID3, CBX8, GSX1, NKX22, ATF1, TWST2, ZNF17, TOX3, TOX4, ZMYM3, I2BP1, RHXF1, SSX2, I2BPL, ZN680, TRI68, HXA13, PHC3, TCF24, HXB13, HEY1, PHC2, ZNF81, FIGLA, SAM11, KMT2B, HEY2, JDP2, HXC13, ASCL4, HHEX, GSX2, ETV7, ASCL3, PHC1, OTP, I2BP2, VGLL2, HXA11, PDLI4, ASCL2, CDX4, ZN860, LMBL4, PDIP3, NKX25, CEBPB, ISL1, CDX2, PROP1, SIN3B, SMBT1, HXC11, HXC10, PRS6A, VSX1, NKX23, MTG16, HMX3, HMX1, KIF22, CSTF2, CEBPE, DLX2, PPARG, PRIC1, UNC4, BARX2, ALX3, TCF15, TERA, VSX2, HXD12, CDX1, TCF23, ALX1, HXA10, RX, CXXC5, SCML1, NFIL3, DLX6, MTG8, CEBPD, SEC13, FIP1, ALX4, LHX3, PRIC2, MAGI3, NELL1, PRRX1, MTG8R, RAX2, DLX3, DLX1, NKX26, NAB1, SAMD7, PITX3, WDR5, MEOX2, NAB2, DHX8, CBX6, EMX2, CPSF6, HXC12, KDM4B, LMBL3, PHX2A, EMX1, NC2B, DLX4, SRY, ZN777, ZN398, GATA3, BSH, SF3B4, TEAD1, TEAD3, RGAP1, PHF1, GATA2, FOXO3, ZN212, IRX4, ZBED6, LHX4, SIN3A, RBBP7, NKX61, R51A1, MB3L1, DLX5, NOTC1, TERF2, ZN282, RGS12, ZN840, SPI2B, PAX7, NKX62, ASXL2, FOXO1,GATA1, ZMYM5, LRP1, MIXL1, SGT1, LMCD1, CEBPA, SOX14, WTIP, PRP19, NKX11, RBBP4, DMRT2, SMCA2, and functionally active fragments thereof.

[0391] In some more specific embodiments, the epigenetic modification domain comprises at least one DNA methyltransferase or a functionally active fragment thereof. For example, the DNA methyltransferase is selected from the group consisting of DNMT3A, DNMT3B, DNMT3c, DNMT1, DNMT2, and DNMT3L. For example, the DNA methylation domain comprises at least one DNMT3A and at least one DNMT3L. For example, the at least one DNMT3A and the at least one DNMT3L are linked in an interchangeable order. For example, the DNA methylation domain comprises one DNMT3A and one DNMT3L, and they are linked in an interchangeable order. For example, the DNA methyltransferase comprises an amino acid sequence as set forth in any one of SEQ ID NOs: 42-47, 131.

[0392] The first fusion and the second fusion of the complex peptides described herein are formed into an aggregated complex through the interaction between the recruiting domains comprised in each. Accordingly, the present disclosure provides non-limiting examples of combinations of the recruiting domain A and the recruiting domain A': (1) one of the domains of the recruiting domain A and the recruiting domain A' is GCN4, and the other domain is scFv; or (2) one of the domains of the recruiting domain A and the recruiting domain A' is GFP11 fragment, and the other domain is GFP1-10; or (3) one of the domains of the recruiting domain A and the recruiting domain A' is GVKESLV, and the other domain is PDZ protein domain. The same applies to the case where GFP11 and GFP1-10 are derived from split GFP (SEQ ID NO: 79) to form the recruiting domain A and the recruiting domain A', respectively, which is also applicable to other types of fluorescent proteins, such as mCherry (SEQ ID NO: 80), eYFP (SEQ ID NO: 82), eCFP (SEQ ID NO: 81), etc., i.e., different sets of recruiting domain A and recruiting domain A' can be obtained by splitting mCherry, splitting eYFP, or splitting eCFP, respectively, for use in the complex peptides provided herein. In some embodiments, one of the first fusion and the second fusion of the complex peptides of the present disclosure can comprise two or more recruiting domains, which are linked by a linker sequence. Exemplary amino acid sequences of the recruiting domains can comprise any one of SEQ ID NOs: 74-78.

[0393] The following structures can include a TALE-DNMT3A-DNMT3L-ZIM3 KRAB, TALE-ZIM3 KRAB-DNMT3L-DNMT3A, TALE-ZIM3 KRAB-DNMT3A-DNMT3L, ZIM3 KRAB-DNMT3A-DNMT3L-TALE, DNMT3A-DNMT3L-ZIM3 KRAB-TALE, DNMT3A-DNMT3L-ZNF324-TALE, DNMT3A-DNMT3L-ZNF419-TALE, DNMT3A-DNMT3L-TALE-EZH2, DNMT3A-DNMT3L-TALE-HDAC3, DNMT3A-DNMT3L-TALE-HP1a, DNMT3A-DNMT3L-TALE-KRAB, or DNMT3A-DNMT3L-TALE-ZIM3 KRAB, KRAB-DNMT3A-DNMT3L-TALE, DNMT3L-DNMT3A-TALE-KRAB structure as described previously.

[0394] Still further, exemplary fusion structures are described in the following schemes:

[0395] V11 scheme: NLS-scFv-KRAB, which can include the following components from N-terminus to C-terminus, which can be directly or indirectly connected between the following components:

[0396] NLS (e.g., SEQ ID NO: 129), scFv (e.g., SEQ ID NO: 140), KRAB (e.g., SEQ ID NO: 48).

[0397] Further, the V11 scheme can include the following components from N-terminus to C-terminus, which can be directly or indirectly connected between the following components:

[0398] c-myc NLS, for example, a sequence as set forth in SEQ ID NO: 129;

[0399] scFv, for example, a sequence as set forth in SEQ ID NO: 140;

[0400] KRAB, for example, a sequence as set forth in SEQ ID NO: 48.

[0401] V12 scheme: NLS-DNMT3A-DNMT3L-NLS-TALE HPT15-2xNLS-4xGCN4-NLS, which can include the following components from N-terminus to C-terminus, which can be directly or indirectly connected between the following components:

[0402] NLS (e.g., SEQ ID NO: 129), DNMT3L-CD (e.g., SEQ ID NO: 44), NLS (e.g., SEQ ID NO: 128), TALE HPT15 (e.g., SEQ ID NO: 35), NLS (e.g., SEQ ID NO: 128), NLS (e.g., SEQ ID NO: 128), multiple GCN4 (e.g., SEQ ID NO: 74), NLS (e.g., SEQ ID NO: 130), e.g., scheme V12 can have 2, 3, or 4 GCN4, each GCN4 is directly or indirectly connected to each other.

[0403] Further, V12 scheme can include the following components from N-terminus to C- terminus, the following components can be directly or indirectly connected to each other:

[0404] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0405] DNMT3A, e.g., a sequence as set forth in SEQ ID NO: 131;

[0406] DNMT3L-CD, e.g., a sequence as set forth in SEQ ID NO: 44;

[0407] linker4-XTEN 80linker 1, e.g., a sequence as set forth in SEQ ID NO: 86;

[0408] sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0409] TALE HPT15, e.g., a sequence as set forth in SEQ ID NO: 35;

[0410] sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0411] sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0412] multiple (e.g., 4) GCN4, e.g., SEQ ID NO: 74, each GCN4 is connected to each other by a linker (e.g., SEQ ID NO: 89);

[0413] BPSV40 NLS, e.g., a sequence as set forth in SEQ ID NO: 130.

[0414] V13 scheme: NLS-DNMT3A-DNMT3L-scFv, which can include the following components from N-terminus to C-terminus, which can be directly or indirectly connected between the following components:

[0415] NLS (e.g., SEQ ID NO: 129), DNMT3A (e.g., SEQ ID NO: 131), DNMT3L-CD (e.g., SEQ ID NO: 44), scFv (e.g., SEQ ID NO: 140).

[0416] Further, the V13 scheme can include the following components from N-terminus to C-terminus, which can be directly or indirectly connected between the following components:

[0417] c-myc NLS, for example, a sequence as set forth in SEQ ID NO: 129;

[0418] DNMT3A, for example, a sequence as set forth in SEQ ID NO: 131;

[0419] DNMT3L-CD, for example, a sequence as set forth in SEQ ID NO: 44;

[0420] linker4-XTEN 80linker 1, for example, a sequence as set forth in SEQ ID NO: 86;

[0421] scFv, for example, a sequence as set forth in SEQ ID NO: 140.

[0422] V14 scheme: NLS-3xGCN4-NLS-TALE HPT15-2xNLS-KRAB, which can include the following components from N-terminus to C-terminus, which can be directly or indirectly connected between the following components:

[0423] NLS (e.g., SEQ ID NO: 129), multiple GCN4 (e.g., SEQ ID NO: 74), NLS (e.g., SEQ ID NO: 128), TALE HPT15 (e.g., SEQ ID NO: 35), NLS (e.g., SEQ ID NO: 128), NLS (e.g., SEQ ID NO: 128), KRAB (e.g., SEQ ID NO: 48), for example, the scheme V14 can have 2, 3, or 4 GCN4s, each of which is directly or indirectly connected.

[0424] Further, the V14 scheme can include the following components from N-terminus to C-terminus, which can be directly or indirectly connected between the following components:

[0425] c-myc NLS, for example, a sequence as set forth in SEQ ID NO: 129;

[0426] multiple (e.g., 3) GCN4s, for example, SEQ ID NO: 74, each GCN4 is connected by a linker (e.g., SEQ ID NO: 89);

[0427] sv40 NLS, for example, a sequence as set forth in SEQ ID NO: 128;

[0428] TALE HPT15, for example, a sequence as set forth in SEQ ID NO: 35;

[0429] multiple (e.g., two) sv40 NLSs, for example, a sequence as set forth in SEQ ID NO: 128;

[0430] linker10-XTEN 16linker 2, for example, a sequence as set forth in SEQ ID NO: 92;

[0431] KRAB, for example, a sequence as set forth in SEQ ID NO: 48.

[0432] V15 scheme: NLS-scFv-ZIM3-2a-NLS-DNMT3A-hDNMT3L-NLS-TALE HPT15-2xNLS-10xGCN4-NLS (SEQ ID NO: 15), which can include the following components from N-terminus to C-terminus, which can be directly or indirectly connected between the following components:

[0433] NLS (e.g., SEQ ID NO: 129), scFv (e.g., SEQ ID NO: 140), Zim3 Krab (e.g., SEQ ID NO: 132), NLS (e.g., SEQ ID NO: 129), DNMT3A (e.g., SEQ ID NO: 131), hDNMT3L (e.g., SEQ ID NO: 45), NLS (e.g., SEQ ID NO: 128), TALE HPT15 (e.g., SEQ ID NO: 35), NLS (e.g., SEQ ID NO: 128), NLS (e.g., SEQ ID NO: 128), GCN4 (e.g., SEQ ID NO: 74), multiple GCN4s (e.g., SEQ ID NO: 74), NLS (e.g., SEQ ID NO: 130), for example, scheme V15 can have 2, 3, 4, 5, 6, 7, 8, 9, or 10 GCN4s, each GCN4 is directly or indirectly connected, respectively.

[0434] Further, a V15 scheme can comprise, from N-terminal to C-terminal, the following components, which can be directly or indirectly connected:

[0435] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0436] scFv, e.g., a sequence as set forth in SEQ ID NO: 140;

[0437] Zim3 Krab, e.g., a sequence as set forth in SEQ ID NO: 132;

[0438] P2A, e.g., a sequence as set forth in SEQ ID NO: 141;

[0439] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0440] DNMT3A, e.g., a sequence as set forth in SEQ ID NO: 131;

[0441] hDNMT3L, e.g., a sequence as set forth in SEQ ID NO: 45;

[0442] linker4-XTEN 80linker 1, e.g., a sequence as set forth in SEQ ID NO: 86;

[0443] sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0444] TALE HPT15, e.g., a sequence as set forth in SEQ ID NO: 35;

[0445] multiple (e.g., two) sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0446] multiple (e.g., 10) GCN4, e.g., SEQ ID NO: 74, each GCN4 connected by a linker (e.g., SEQ ID NO: 89);

[0447] BPSV40 NLS, e.g., a sequence as set forth in SEQ ID NO: 130.

[0448] A first fusion of a V15 scheme (SEQ ID NO: 102) can comprise, from N-terminal to C-terminal, the following components, which can be directly or indirectly connected: NLS (e.g., SEQ ID NO: 129), scFv (e.g., SEQ ID NO: 140), Zim3 Krab (e.g., SEQ ID NO: 132).

[0449] Further, the first fusion of the V15 regimen (SEQ ID NO: 102) can include, from N- to C-terminus, the following components, which can be directly or indirectly linked:

[0450] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0451] scFv, e.g., a sequence as set forth in SEQ ID NO: 140;

[0452] Zim3 Krab, e.g., a sequence as set forth in SEQ ID NO: 132.

[0453] The second fusion of the V15 regimen (SEQ ID NO: 103) can include, from N- to C-terminus, the following components, which can be directly or indirectly linked: NLS (e.g., SEQ ID NO: 129), DNMT3A (e.g., SEQ ID NO: 131), hDNMT3L (e.g., SEQ ID NO: 45), NLS (e.g., SEQ ID NO: 128), TALE HPT15 (e.g., SEQ ID NO: 35), NLS (e.g., SEQ ID NO: 128), NLS (e.g., SEQ ID NO: 128), GCN4 (e.g., SEQ ID NO: 74), multiple GCN4 (e.g., SEQ ID NO: 74).

[0454] Further, the second fusion of the V15 regimen (SEQ ID NO: 103) can include, from N- to C-terminus, the following components, which can be directly or indirectly linked:

[0455] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0456] DNMT3A, e.g., a sequence as set forth in SEQ ID NO: 131;

[0457] hDNMT3L, e.g., a sequence as set forth in SEQ ID NO: 45;

[0458] linker4-XTEN 80linker 1, e.g., a sequence as set forth in SEQ ID NO: 86;

[0459] sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0460] TALE HPT15, e.g., a sequence as set forth in SEQ ID NO: 35;

[0461] multiple (e.g., two) sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0462] multiple (e.g., 10) GCN4, e.g., SEQ ID NO: 74, each GCN4 linked by a linker (e.g., SEQ ID NO: 89);

[0463] BPSV40 NLS, e.g., a sequence as set forth in SEQ ID NO: 130.

[0464] V16 scheme: NLS-KRAB-scFv-2a-NLS-DNMT3A-DNMT3L-NLS-TALE HPT15-2xNLS-2xGCN4-NLS (SEQ ID NO: 16), which can include the following components from N-terminus to C-terminus, which can be directly or indirectly linked:

[0465] NLS (e.g., SEQ ID NO: 129), KRAB (e.g., SEQ ID NO: 48), scFv (e.g., SEQ ID NO: 140), NLS (e.g., SEQ ID NO: 129), DNMT3A (e.g., SEQ ID NO: 131), hDNMT3L (e.g., SEQ ID NO: 45), NLS (e.g., SEQ ID NO: 128), TALE HPT15 (e.g., SEQ ID NO: 35), NLS (e.g., SEQ ID NO: 128), NLS (e.g., SEQ ID NO: 128), GCN4 (e.g., SEQ ID NO: 74), GCN4 (e.g., SEQ ID NO: 74), NLS (e.g., SEQ ID NO: 130).

[0466] Further, the V16 scheme can include the following components from N-terminus to C-terminus, which can be directly or indirectly linked:

[0467] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0468] KRAB, e.g., a sequence as set forth in SEQ ID NO: 48;

[0469] scFv, e.g., a sequence as set forth in SEQ ID NO: 140;

[0470] P2A, e.g., a sequence as set forth in SEQ ID NO: 141;

[0471] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0472] DNMT3A, e.g., a sequence as set forth in SEQ ID NO: 131;

[0473] hDNMT3L, e.g., a sequence as set forth in SEQ ID NO: 45;

[0474] linker4-XTEN 80linker 1, e.g., a sequence as set forth in SEQ ID NO: 86;

[0475] sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0476] TALE HPT15, e.g., a sequence as set forth in SEQ ID NO: 35;

[0477] multiple (e.g., two) sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0478] multiple (e.g., two) GCN4, e.g., a sequence as set forth in SEQ ID NO: 74, each GCN4 linked by a linker (e.g., SEQ ID NO: 89);

[0479] BPSV40 NLS, e.g., a sequence as set forth in SEQ ID NO: 130.

[0480] A first fusion of the V16 regimen (SEQ ID NO: 104) can include, from N-terminus to C-terminus, the following components, which can be directly or indirectly linked:

[0481] Further, a first fusion of the V16 regimen can include, from N-terminus to C-terminus, the following components, which can be directly or indirectly linked:

[0482] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0483] KRAB, e.g., a sequence as set forth in SEQ ID NO: 48;

[0484] scFv, e.g., a sequence as set forth in SEQ ID NO: 140.

[0485] The second fusion of the V16 regimen (SEQ ID NO: 105) can include, from N- terminus to C-terminus, the following components which can be directly or indirectly linked: NLS (e.g., SEQ ID NO: 129), DNMT3A (e.g., SEQ ID NO: 131), hDNMT3L (e.g., SEQ ID NO: 45), NLS (e.g., SEQ ID NO: 128), TALE HPT15 (e.g., SEQ ID NO: 35), NLS (e.g., SEQ ID NO: 128), NLS (e.g., SEQ ID NO: 128), GCN4 (e.g., SEQ ID NO: 74), GCN4 (e.g., SEQ ID NO: 74), NLS (e.g., SEQ ID NO: 130).

[0486] Further, the second fusion of the V16 regimen can include, from N-terminus to C- terminus, the following components which can be directly or indirectly linked:

[0487] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0488] DNMT3A, e.g., a sequence as set forth in SEQ ID NO: 131;

[0489] hDNMT3L, e.g., a sequence as set forth in SEQ ID NO: 45;

[0490] linker4-XTEN 80linker 1, e.g., a sequence as set forth in SEQ ID NO: 86;

[0491] sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0492] TALE HPT15, e.g., a sequence as set forth in SEQ ID NO: 35;

[0493] multiple (e.g., two) sv40 NLSs, e.g., a sequence as set forth in SEQ ID NO: 128;

[0494] multiple (e.g., two) GCN4s, e.g., a sequence as set forth in SEQ ID NO: 74, each GCN4 linked by a linker (e.g., SEQ ID NO: 89);

[0495] BPSV40 NLS, e.g., a sequence as set forth in SEQ ID NO: 130.

[0496] V17 scheme: NLS-DNMT3A-DNMT3L-scFv-2a-NLS-1xGCN4-NLS-TALE HPT15- 2xNLS-KRAB, which can include the following components from N-terminus to C- terminus, which can be directly or indirectly connected between the following components:

[0497] NLS (e.g., SEQ ID NO: 129), DNMT3L-CD (e.g., SEQ ID NO: 44), scFv (e.g., SEQ ID NO: 140), NLS (e.g., SEQ ID NO: 129), GCN4 (e.g., SEQ ID NO: 74), NLS (e.g., SEQ ID NO: 128), TALE HPT15 (e.g., SEQ ID NO: 35), NLS (e.g., SEQ ID NO: 128), NLS (e.g., SEQ ID NO: 128), KRAB (e.g., SEQ ID NO: 48).

[0498] Further, the V17 scheme can include the following components from N-terminus to C- terminus, which can be directly or indirectly connected between the following components:

[0499] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0500] DNMT3A, e.g., a sequence as set forth in SEQ ID NO: 131;

[0501] DNMT3L-CD, e.g., a sequence as set forth in SEQ ID NO: 44;

[0502] linker4-XTEN 80linker 1, e.g., a sequence as set forth in SEQ ID NO: 86;

[0503] scFv, e.g., a sequence as set forth in SEQ ID NO: 140;

[0504] P2A, e.g., a sequence as set forth in SEQ ID NO: 141;

[0505] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0506] GCN4, e.g., a sequence as set forth in SEQ ID NO: 74;

[0507] sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0508] TALE HPT15, e.g., a sequence as set forth in SEQ ID NO: 35;

[0509] multiple (e.g., 2) sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0510] linker10-XTEN 16linker 2, e.g., a sequence as set forth in SEQ ID NO: 92;

[0511] KRAB, e.g., a sequence as set forth in SEQ ID NO: 48.

[0512] The first fusion of the V17 protocol can include, from N- to C-terminus, the following components, which can be directly or indirectly linked:

[0513] Further, the first fusion of the V17 protocol can include, from N- to C-terminus, the following components, which can be directly or indirectly linked:

[0514] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0515] DNMT3A, e.g., a sequence as set forth in SEQ ID NO: 131;

[0516] DNMT3L-CD, e.g., a sequence as set forth in SEQ ID NO: 44;

[0517] linker4-XTEN 80linker 1, e.g., a sequence as set forth in SEQ ID NO: 86;

[0518] scFv, e.g., a sequence as set forth in SEQ ID NO: 140.

[0519] The second fusion of the V17 protocol can include, from N- to C-terminus, the following components, which can be directly or indirectly linked: NLS (e.g., SEQ ID NO: 129), GCN4 (e.g., SEQ ID NO: 74), NLS (e.g., SEQ ID NO: 128), TALE HPT15 (e.g., SEQ ID NO: 35), NLS (e.g., SEQ ID NO: 128), NLS (e.g., SEQ ID NO: 128), KRAB (e.g., SEQ ID NO: 48).

[0520] Further, the second fusion of the V17 scheme can include, from N- to C-terminus, the following components, which can be directly or indirectly linked:

[0521] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0522] GCN4, e.g., a sequence as set forth in SEQ ID NO: 74;

[0523] sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0524] TALE HPT15, e.g., a sequence as set forth in SEQ ID NO: 35;

[0525] multiple (e.g., 2) sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0526] linker 10-XTEN 16linker 2, e.g., a sequence as set forth in SEQ ID NO: 92;

[0527] KRAB, e.g., a sequence as set forth in SEQ ID NO: 48.

[0528] V18 scheme: NLS-DNMT3A-hDNMT3L-NLS-scFv-2a-NLS-3xGCN4-NLS-TALE HPT15- 2xNLS-ZIM3, which can include, from N- to C-terminus, the following components, which can be directly or indirectly linked:

[0529] NLS (e.g., SEQ ID NO: 129), DNMT3A (e.g., SEQ ID NO: 131), hDNMT3L (e.g., SEQ ID NO: 45), NLS (e.g., SEQ ID NO: 128), scFv (e.g., SEQ ID NO: 140), NLS (e.g., SEQ ID NO: 129), multiple GCN4 (e.g., SEQ ID NO: 74) (e.g., 3, 4, 5, 6, 7 GCN4), NLS (e.g., SEQ ID NO: 128), TALE HPT15 (e.g., SEQ ID NO: 35), NLS (e.g., SEQ ID NO: 128), NLS (e.g., SEQ ID NO: 128), Zim3 Krab (e.g., SEQ ID NO: 132).

[0530] Further, the V18 scheme can include, from N- to C-terminus, the following components, which can be directly or indirectly linked:

[0531] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0532] DNMT3A, e.g., a sequence as set forth in SEQ ID NO: 131;

[0533] hDNMT3L, e.g., a sequence as set forth in SEQ ID NO: 45;

[0534] linker4-XTEN 80linker 1, e.g., a sequence as set forth in SEQ ID NO: 86;

[0535] sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0536] scFv, e.g., a sequence as set forth in SEQ ID NO: 140;

[0537] P2A, e.g., a sequence as set forth in SEQ ID NO: 141;

[0538] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0539] multiple (e.g., 3) GCN4s, e.g., a sequence as set forth in SEQ ID NO: 74, each GCN4 linked by a linker (e.g., SEQ ID NO: 89);

[0540] sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0541] TALE HPT15, e.g., a sequence as set forth in SEQ ID NO: 35;

[0542] multiple (e.g., 2) sv40 NLSs, e.g., a sequence as set forth in SEQ ID NO: 128;

[0543] linker10-XTEN 80linker 2, e.g., a sequence as set forth in SEQ ID NO: 92;

[0544] Zim3 Krab, e.g., a sequence as set forth in SEQ ID NO: 132.

[0545] The first fusion of the V18 protocol can include, from N- to C-terminus, the following components, which can be directly or indirectly linked: a NLS (e.g., SEQ ID NO: 129), a DNMT3A (e.g., SEQ ID NO: 131), a hDNMT3L (e.g., SEQ ID NO: 45), a NLS (e.g., SEQ ID NO: 128), a scFv (e.g., SEQ ID NO: 140).

[0546] Further, the first fusion of the V18 protocol can include, from N- to C-terminus, the following components, which can be directly or indirectly linked:

[0547] a c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0548] a DNMT3A, e.g., a sequence as set forth in SEQ ID NO: 131;

[0549] a hDNMT3L, e.g., a sequence as set forth in SEQ ID NO: 45;

[0550] a linker4-XTEN 80linker 1, e.g., a sequence as set forth in SEQ ID NO: 86;

[0551] a sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0552] a scFv, e.g., a sequence as set forth in SEQ ID NO: 140;

[0553] The second fusion of the V18 protocol can include, from N- to C-terminus, the following components, which can be directly or indirectly linked: a plurality of GCN4s (e.g., SEQ ID NO: 74) (e.g., 3, 4, 5, 6, 7 GCN4s), a TALE HPT15 (e.g., SEQ ID NO: 35), a Zim3 Krab (e.g., SEQ ID NO: 132).

[0554] Further, the second fusion of the V18 protocol can include, from N- to C-terminus, the following components, which can be directly or indirectly linked:

[0555] a c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0556] a plurality (e.g., 3) of GCN4s, e.g., a sequence as set forth in SEQ ID NO: 74, each GCN4 linked by a linker (e.g., SEQ ID NO: 89);

[0557] sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0558] TALE HPT15, e.g., a sequence as set forth in SEQ ID NO: 35;

[0559] multiple (e.g., 2) sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0560] linker 10-XTEN 16linker 2, e.g., a sequence as set forth in SEQ ID NO: 92;

[0561] Zim3 Krab, e.g., a sequence as set forth in SEQ ID NO: 132.

[0562] V19 scheme: NLS-3xGCN4-NLS-TALE HPT15-2xNLS-ZIM3-2a-NLS-DNMT3A- hDNMT3L-NLS-scFv, which can include the following components from N-terminus to C-terminus, which can be directly or indirectly connected between the following components:

[0563] NLS (e.g., SEQ ID NO: 129), multiple GCN4 (e.g., SEQ ID NO: 74), NLS (e.g., SEQ ID NO: 128), TALE HPT15 (e.g., SEQ ID NO: 35), NLS (e.g., SEQ ID NO: 128), NLS (e.g., SEQ ID NO: 128), Zim3 Krab (e.g., SEQ ID NO: 132), NLS (e.g., SEQ ID NO: 129), DNMT3A (e.g., SEQ ID NO: 131), hDNMT3L (e.g., SEQ ID NO: 45), NLS (e.g., SEQ ID NO: 128), scFv (e.g., SEQ ID NO: 140), e.g., scheme V19 can have 2, 3, or 4 GCN4, each GCN4 is directly or indirectly connected between each GCN4.

[0564] Further, V19 scheme can further include XTEN linker, e.g., which can include the following components from N-terminus to C-terminus, which can be directly or indirectly connected between the following components:

[0565] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0566] a plurality of GCN4s (e.g., 3), e.g., a sequence as set forth in SEQ ID NO: 74, connected by a GS linker (e.g., a sequence as set forth in SEQ ID NO: 89) between the plurality of GCN4s;

[0567] a sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0568] a TALE HPT15, e.g., a sequence as set forth in SEQ ID NO: 35;

[0569] one or more (e.g., 2) sv40 NLSs, e.g., a sequence as set forth in SEQ ID NO: 128;

[0570] a linker10-XTEN 16linker 2, e.g., a sequence as set forth in SEQ ID NO: 92;

[0571] a Zim3 Krab, e.g., a sequence as set forth in SEQ ID NO: 132;

[0572] a P2A, e.g., a sequence as set forth in SEQ ID NO: 141;

[0573] a c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0574] a DNMT3A, e.g., a sequence as set forth in SEQ ID NO: 131;

[0575] a linker3-flexible peptide linker, e.g., a sequence as set forth in SEQ ID NO: 85;

[0576] a hDNMT3L, e.g., a sequence as set forth in SEQ ID NO: 45;

[0577] a linker4-XTEN 80linker 1, e.g., a sequence as set forth in SEQ ID NO: 86;

[0578] a sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0579] a scFv, e.g., a sequence as set forth in SEQ ID NO: 140.

[0580] The first fusion of the V19 protocol can include, from N- to C-terminus, the following components, which can be directly or indirectly connected:

[0581] Further, the first fusion of the V19 protocol can include, from N- to C-terminus, the following components, which can be directly or indirectly connected:

[0582] a c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0583] a plurality of GCN4s (e.g., 3), e.g., a sequence as set forth in SEQ ID NO: 74, connected by a GS linker (e.g., a sequence as set forth in SEQ ID NO: 89) between GCN4s;

[0584] an sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0585] a TALE HPT15, e.g., a sequence as set forth in SEQ ID NO: 35;

[0586] one or more (e.g., 2) sv40 NLSs, e.g., a sequence as set forth in SEQ ID NO: 128;

[0587] a linker10-XTEN 16linker 2, e.g., a sequence as set forth in SEQ ID NO: 92;

[0588] a Zim3 Krab, e.g., a sequence as set forth in SEQ ID NO: 132.

[0589] The second fusion of the V19 protocol can include, from N- to C-terminus, the following components, which can be directly or indirectly connected: a NLS (e.g., SEQ ID NO: 129), a DNMT3A (e.g., SEQ ID NO: 131), a hDNMT3L (e.g., SEQ ID NO: 45), a NLS (e.g., SEQ ID NO: 128), a scFv (e.g., SEQ ID NO: 140).

[0590] Further, the second fusion of the V19 scheme can include, from N- to C-terminus, the following components, which can be directly or indirectly linked:

[0591] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0592] DNMT3A, e.g., a sequence as set forth in SEQ ID NO: 131;

[0593] linker3 -flexible peptide linker, e.g., a sequence as set forth in SEQ ID NO: 85;

[0594] hDNMT3L, e.g., a sequence as set forth in SEQ ID NO: 45;

[0595] linker4 -XTEN 80linker 1, e.g., a sequence as set forth in SEQ ID NO: 86;

[0596] sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0597] scFv, e.g., a sequence as set forth in SEQ ID NO: 140.

[0598] V20 scheme: NLS-scFV-hDNMT3L-DNMT3A-2a-NLS-3xGCN4-NLS-TALE HPT15-2xNLS-KRAB, which can include, from N- to C-terminus, the following components, which can be directly or indirectly linked:

[0599] NLS (e.g., SEQ ID NO: 129), scFv (e.g., SEQ ID NO: 140), hDNMT3L (e.g., SEQ ID NO: 45), DNMT3A (e.g., SEQ ID NO: 131), NLS (e.g., SEQ ID NO: 129), multiple GCN4 (e.g., SEQ ID NO: 74), NLS (e.g., SEQ ID NO: 128), TALE HPT15 (e.g., SEQ ID NO: 35), NLS (e.g., SEQ ID NO: 128), NLS (e.g., SEQ ID NO: 128), KRAB (e.g., SEQ ID NO: 48), e.g., scheme V20 can have 2, 3, or 4 GCN4, each directly or indirectly linked.

[0600] Further, the V20 scheme can comprise, from N-terminal to C-terminal, the following components, which can be directly or indirectly connected:

[0601] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0602] scFv, e.g., a sequence as set forth in SEQ ID NO: 140;

[0603] hDNMT3L, e.g., a sequence as set forth in SEQ ID NO: 45;

[0604] DNMT3A, e.g., a sequence as set forth in SEQ ID NO: 131;

[0605] P2A, e.g., a sequence as set forth in SEQ ID NO: 141;

[0606] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0607] multiple (e.g., 3) GCN4s, e.g., a sequence as set forth in SEQ ID NO: 74, each GCN4 connected by a linker (e.g., SEQ ID NO: 89);

[0608] sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0609] TALE HPT15, e.g., a sequence as set forth in SEQ ID NO: 35;

[0610] multiple sv40 NLSs (e.g., 2), e.g., a sequence as set forth in SEQ ID NO: 128;

[0611] linker10-XTEN 16linker 2, e.g., a sequence as set forth in SEQ ID NO: 92;

[0612] KRAB, e.g., a sequence as set forth in SEQ ID NO: 48.

[0613] The first fusion of the V20 scheme can comprise, from N-terminal to C-terminal, the following components, which can be directly or indirectly connected: NLS (e.g., SEQ ID NO: 129), scFv (e.g., SEQ ID NO: 140), hDNMT3L (e.g., SEQ ID NO: 45), DNMT3A (e.g., SEQ ID NO: 131).

[0614] Further, the first fusion of the V20 protocol can include, from N- to C-terminus, the following components, which can be directly or indirectly linked:

[0615] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0616] scFv, e.g., a sequence as set forth in SEQ ID NO: 140;

[0617] hDNMT3L, e.g., a sequence as set forth in SEQ ID NO: 45;

[0618] DNMT3A, e.g., a sequence as set forth in SEQ ID NO: 131;

[0619] The second fusion of the V20 protocol can include, from N- to C-terminus, the following components, which can be directly or indirectly linked: NLS, e.g., a sequence as set forth in SEQ ID NO: 129; multiple (e.g., 3) GCN4, e.g., a sequence as set forth in SEQ ID NO: 74, each GCN4 linked by a linker (e.g., SEQ ID NO: 89); NLS, e.g., a sequence as set forth in SEQ ID NO: 128; TALE HPT15, e.g., a sequence as set forth in SEQ ID NO: 35; multiple sv40 NLS (e.g., 2), e.g., a sequence as set forth in SEQ ID NO: 128; KRAB, e.g., a sequence as set forth in SEQ ID NO: 48.

[0620] Further, the second fusion of the V20 protocol can include, from N- to C-terminus, the following components, which can be directly or indirectly linked:

[0621] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0622] multiple (e.g., 3) GCN4, e.g., a sequence as set forth in SEQ ID NO: 74, each GCN4 linked by a linker (e.g., SEQ ID NO: 89);

[0623] sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0624] TALE HPT15, e.g., a sequence as set forth in SEQ ID NO: 35;

[0625] multiple sv40 NLS (e.g., 2), e.g., a sequence as set forth in SEQ ID NO: 128;

[0626] linker 10 - XTEN 16 linker 2, e.g., a sequence as set forth in SEQ ID NO: 92;

[0627] KRAB, e.g., a sequence as set forth in SEQ ID NO: 48.

[0628] V21 scheme: NLS-1 x GCN4-ZIM3-2a-NLS-DNMT3A-hDNMT3L-NLS-TALE HPT15-2xNLS-scFv, which can include the following components from N- to C-terminus, which can be directly or indirectly linked between the following components:

[0629] NLS (e.g., SEQ ID NO: 129), GCN4 (e.g., SEQ ID NO: 74), Zim3 Krab (e.g., SEQ ID NO: 132), NLS (e.g., SEQ ID NO: 129), DNMT3A (e.g., SEQ ID NO: 131), hDNMT3L (e.g., SEQ ID NO: 45), NLS (e.g., SEQ ID NO: 128), TALE HPT15 (e.g., SEQ ID NO: 35), NLS (e.g., SEQ ID NO: 128), NLS (e.g., SEQ ID NO: 128), scFv (e.g., SEQ ID NO: 140).

[0630] Further, the V21 scheme can include the following components from N- to C-terminus, which can be directly or indirectly linked between the following components:

[0631] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0632] GCN4, e.g., a sequence as set forth in SEQ ID NO: 74;

[0633] Zim3 Krab, e.g., a sequence as set forth in SEQ ID NO: 132;

[0634] P2A, e.g., a sequence as set forth in SEQ ID NO: 141;

[0635] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0636] DNMT3A, e.g., a sequence as set forth in SEQ ID NO: 131;

[0637] hDNMT3L, e.g., a sequence as set forth in SEQ ID NO: 45;

[0638] linker4-XTEN 80linker 1, e.g., a sequence as set forth in SEQ ID NO: 86;

[0639] sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0640] TALE HPT15, e.g., a sequence as set forth in SEQ ID NO: 35;

[0641] multiple (e.g., 2) sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0642] sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0643] scFv, e.g., a sequence as set forth in SEQ ID NO: 140.

[0644] The first fusion of the V21 protocol can include, from N- to C-terminus, the following components, which can be directly or indirectly linked:

[0645] Further, the first fusion of the V21 protocol can include, from N- to C-terminus, the following components, which can be directly or indirectly linked:

[0646] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0647] GCN4, e.g., a sequence as set forth in SEQ ID NO: 74;

[0648] Zim3 Krab, e.g., a sequence as set forth in SEQ ID NO: 132.

[0649] The second fusion of the V21 protocol can include, from N- to C-terminus, the following components, which can be directly or indirectly linked: NLS (e.g., SEQ ID NO: 129), DNMT3A (e.g., SEQ ID NO: 131), hDNMT3L (e.g., SEQ ID NO: 45), NLS (e.g., SEQ ID NO: 28), TALE HPT15 (e.g., SEQ ID NO: 35), NLS (e.g., SEQ ID NO: 28), NLS (e.g., SEQ ID NO: 28), scFv (e.g., SEQ ID NO: 140).

[0650] Further, the second fusion of the V21 scheme can include, from N- to C-terminus, the following components, which can be directly or indirectly linked:

[0651] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0652] DNMT3A, e.g., a sequence as set forth in SEQ ID NO: 131;

[0653] hDNMT3L, e.g., a sequence as set forth in SEQ ID NO: 45;

[0654] linker4-XTEN 80linker 1, e.g., a sequence as set forth in SEQ ID NO: 86;

[0655] sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0656] TALE HPT15, e.g., a sequence as set forth in SEQ ID NO: 35;

[0657] multiple (e.g., 2) sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0658] sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0659] scFv, e.g., a sequence as set forth in SEQ ID NO: 140.

[0660] V22 scheme: GFP1-10-KRAB-NLS-2a-NLS-DNMT3A-DNMT3L-NLS-TALE HPT15-2xNLS-7xGFP11-NLS, which can include, from N- to C-terminus, the following components, which can be directly or indirectly linked:

[0661] GFP1-10 (e.g., SEQ ID NO: 78), KRAB (e.g., SEQ ID NO: 48), NLS (e.g., SEQ ID NO: 130), NLS (e.g., SEQ ID NO: 129), DNMT3A (e.g., SEQ ID NO: 131), DNMT3L-CD (e.g., SEQ ID NO: 44), NLS (e.g., SEQ ID NO: 128), TALE HPT15 (e.g., SEQ ID NO: 35), NLS (e.g., SEQ ID NO: 128), NLS (e.g., SEQ ID NO: 128), multiple GFP11 (e.g., SEQ ID NO: 75), e.g., 2, 3, 4, 5, 6, 7, or 8 GFP11, each of which is directly or indirectly linked to each other, NLS (e.g., SEQ ID NO: 130).

[0662] Further, V22 can comprise, from N- to C-terminus, the following components, which can be directly or indirectly linked to each other:

[0663] GFP1-10, e.g., a sequence set forth in SEQ ID NO: 78;

[0664] KRAB, e.g., a sequence set forth in SEQ ID NO: 48;

[0665] BPSV40 NLS, e.g., a sequence set forth in SEQ ID NO: 130;

[0666] P2A, e.g., a sequence set forth in SEQ ID NO: 141;

[0667] c-myc NLS, e.g., a sequence set forth in SEQ ID NO: 129;

[0668] DNMT3A, e.g., a sequence set forth in SEQ ID NO: 131;

[0669] DNMT3L-CD, e.g., a sequence set forth in SEQ ID NO: 44;

[0670] linker4-XTEN 80linker 1, e.g., a sequence set forth in SEQ ID NO: 86;

[0671] sv40 NLS, e.g., a sequence set forth in SEQ ID NO: 128;

[0672] TALE HPT15, e.g., a sequence set forth in SEQ ID NO: 35;

[0673] a plurality (e.g., 2) sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0674] a plurality (e.g., 7) GFP11, e.g., a sequence as set forth in SEQ ID NO: 75, each GFP11 linked by a linker (e.g., a sequence as set forth in SEQ ID NO: 127);

[0675] a BPSV40 NLS, e.g., a sequence as set forth in SEQ ID NO: 130.

[0676] The first fusion of the V22 protocol can include, from N-terminus to C-terminus, the following components, which can be directly or indirectly linked:

[0677] Further, the first fusion of the V22 protocol can include, from N-terminus to C-terminus, the following components, which can be directly or indirectly linked:

[0678] a GFP1-10, e.g., a sequence as set forth in SEQ ID NO: 78;

[0679] a KRAB, e.g., a sequence as set forth in SEQ ID NO: 48;

[0680] a BPSV40 NLS, e.g., a sequence as set forth in SEQ ID NO: 130.

[0681] The second fusion of the V22 protocol can include, from N-terminus to C-terminus, the following components, which can be directly or indirectly linked: a NLS (e.g., SEQ ID NO: 129), a DNMT3A (e.g., SEQ ID NO: 131), a DNMT3L-CD (e.g., SEQ ID NO: 44), a NLS (e.g., SEQ ID NO: 128), a TALE HPT15 (e.g., SEQ ID NO: 35), a NLS (e.g., SEQ ID NO: 128), a NLS (e.g., SEQ ID NO: 128), a plurality of GFP11 (e.g., SEQ ID NO: 75), e.g., there can be 2, 3, 4, 5, 6, 7, or 8 GFP11, each GFP11 directly or indirectly linked to the next, a NLS (e.g., SEQ ID NO: 130).

[0682] Further, the second fusion of the V22 protocol can include, from N-terminus to C-terminus, the following components, which can be directly or indirectly linked:

[0683] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0684] DNMT3A, e.g., a sequence as set forth in SEQ ID NO: 131;

[0685] DNMT3L-CD, e.g., a sequence as set forth in SEQ ID NO: 44;

[0686] linker4-XTEN 80linker 1, e.g., a sequence as set forth in SEQ ID NO: 86;

[0687] sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0688] TALE HPT15, e.g., a sequence as set forth in SEQ ID NO: 35;

[0689] multiple (e.g., 2) sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0690] multiple (e.g., 7) GFP11, e.g., a sequence as set forth in SEQ ID NO: 75, each GFP11 linked by a linker (e.g., a sequence as set forth in SEQ ID NO: 127);

[0691] BPSV40 NLS, e.g., a sequence as set forth in SEQ ID NO: 130.

[0692] V23 scheme: GFP1-10-KRAB-NLS-2a-NLS-DNMT3A-DNMT3L-NLS-TALE HPT15-2xNLS-1xGFP11-NLS, which can include the following components from N- to C-terminus, which can be directly or indirectly linked between the following components:

[0693] GFP1-10 (e.g., SEQ ID NO: 78), KRAB (e.g., SEQ ID NO: 48), NLS (e.g., SEQ ID NO: 130), NLS (e.g., SEQ ID NO: 129), DNMT3A (e.g., SEQ ID NO: 131), DNMT3L-CD (e.g., SEQ ID NO: 44), NLS (e.g., SEQ ID NO: 128), TALE HPT15 (e.g., SEQ ID NO: 35), NLS (e.g., SEQ ID NO: 128), NLS (e.g., SEQ ID NO: 128), GFP11 (e.g., SEQ ID NO: 75), NLS (e.g., SEQ ID NO: 130).

[0694] Further, the V23 scheme can include, from N- to C-terminus, the following components, which can be directly or indirectly linked:

[0695] GFP1-10, e.g., a sequence set forth in SEQ ID NO: 78;

[0696] KRAB, e.g., a sequence set forth in SEQ ID NO: 48;

[0697] BPSV40 NLS, e.g., a sequence set forth in SEQ ID NO: 130;

[0698] P2A, e.g., a sequence set forth in SEQ ID NO: 141;

[0699] c-myc NLS, e.g., a sequence set forth in SEQ ID NO: 129;

[0700] DNMT3A, e.g., a sequence set forth in SEQ ID NO: 131;

[0701] DNMT3L-CD, e.g., a sequence set forth in SEQ ID NO: 44;

[0702] linker4-XTEN 80linker 1, e.g., a sequence set forth in SEQ ID NO: 86;

[0703] sv40 NLS, e.g., a sequence set forth in SEQ ID NO: 128;

[0704] TALE HPT15, e.g., a sequence set forth in SEQ ID NO: 35;

[0705] a plurality (e.g., 2) of sv40 NLS, e.g., a sequence set forth in SEQ ID NO: 128;

[0706] GFP11, e.g., a sequence as set forth in SEQ ID NO: 75;

[0707] BPSV40 NLS, e.g., a sequence as set forth in SEQ ID NO: 130.

[0708] A first fusion of the V23 protocol can include, from N- to C-terminus, the following components, which can be directly or indirectly linked:

[0709] Further, a first fusion of the V23 protocol can include, from N- to C-terminus, the following components, which can be directly or indirectly linked:

[0710] GFP1-10, e.g., a sequence as set forth in SEQ ID NO: 78;

[0711] KRAB, e.g., a sequence as set forth in SEQ ID NO: 48;

[0712] BPSV40 NLS, e.g., a sequence as set forth in SEQ ID NO: 130.

[0713] A second fusion of the V23 protocol can include, from N- to C-terminus, the following components, which can be directly or indirectly linked:

[0714] Further, a second fusion of the V23 protocol can include, from N- to C-terminus, the following components, which can be directly or indirectly linked:

[0715] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0716] DNMT3A, e.g., a sequence as set forth in SEQ ID NO: 131;

[0717] DNMT3L-CD, e.g., a sequence as set forth in SEQ ID NO: 44;

[0718] linker4-XTEN 80linker 1, e.g., a sequence as set forth in SEQ ID NO: 86;

[0719] sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0720] TALE HPT15, e.g., a sequence as set forth in SEQ ID NO: 35;

[0721] multiple (e.g., 2) sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0722] GFP11, e.g., a sequence as set forth in SEQ ID NO: 75;

[0723] BPSV40 NLS, e.g., a sequence as set forth in SEQ ID NO: 130.

[0724] V24 scheme: NLS-7xGFP11-NLS-NLS-TALE HPT15-2xNLS-ZIM3-2a-NLS-DNMT3A- hDNMT3L-NLS-GFP1-10, which can include the following components from N-terminus to C-terminus, which can be directly or indirectly connected between the following components:

[0725] NLS (e.g., SEQ ID NO: 129), multiple GFP11 (e.g., SEQ ID NO: 75) (e.g., 2, 3, 4, 5, 6, 7, or 8 GFP11, each GFP11 being directly or indirectly connected between each other), NLS (e.g., SEQ ID NO: 130), NLS (e.g., SEQ ID NO: 128), TALE HPT15 (e.g., SEQ ID NO: 35), NLS (e.g., SEQ ID NO: 128), NLS (e.g., SEQ ID NO: 128), Zim3 Krab (e.g., SEQ ID NO: 132), NLS (e.g., SEQ ID NO: 129), DNMT3A (e.g., SEQ ID NO: 131), hDNMT3L (e.g., SEQ ID NO: 45), NLS (e.g., SEQ ID NO: 128), GFP1-10 (e.g., SEQ ID NO: 78).

[0726] Further, the V24 scheme can include the following components from N-terminus to C-terminus, which can be directly or indirectly connected between the following components:

[0727] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0728] a plurality (e.g., 7) of GFP11, e.g., a sequence as set forth in SEQ ID NO: 75, each of which is connected by a linker (e.g., a sequence as set forth in SEQ ID NO: 127);

[0729] BPSV40 NLS, e.g., a sequence as set forth in SEQ ID NO: 130;

[0730] Linker 26 - GS linker, e.g., a sequence as set forth in SEQ ID NO: 148;

[0731] sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0732] TALE HPT15, e.g., a sequence as set forth in SEQ ID NO: 35;

[0733] a plurality (e.g., two) of sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0734] linker10 - XTEN 16 linker 2, e.g., a sequence as set forth in SEQ ID NO: 92;

[0735] Zim3 Krab, e.g., a sequence as set forth in SEQ ID NO: 132;

[0736] P2A, e.g., a sequence as set forth in SEQ ID NO: 141;

[0737] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0738] DNMT3A, e.g., a sequence as set forth in SEQ ID NO: 131;

[0739] hDNMT3L, e.g., a sequence as set forth in SEQ ID NO: 45;

[0740] linker4 - XTEN 80 linker 1, e.g., a sequence as set forth in SEQ ID NO: 86;

[0741] sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0742] GFP1-10, e.g., a sequence as set forth in SEQ ID NO: 78.

[0743] The first fusion of the V24 scheme can include, from N-terminal to C-terminal, the following components connected directly or indirectly between them: NLS (e.g., SEQ ID NO: 129), multiple GFP11 (e.g., SEQ ID NO: 75) (e.g., 2, 3, 4, 5, 6, 7, or 8 GFP11, each connected directly or indirectly between them), NLS (e.g., SEQ ID NO: 130), NLS (e.g., SEQ ID NO: 128), TALE HPT15 (e.g., SEQ ID NO: 35), NLS (e.g., SEQ ID NO: 128), NLS (e.g., SEQ ID NO: 128), Zim3 Krab (e.g., SEQ ID NO: 132).

[0744] Further, the first fusion of the V24 scheme can include, from N-terminal to C-terminal, the following components connected directly or indirectly between them:

[0745] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0746] multiple (e.g., 7) GFP11, e.g., a sequence as set forth in SEQ ID NO: 75, each connected by a linker (e.g., a sequence as set forth in SEQ ID NO: 127) between them;

[0747] BPSV40 NLS, e.g., a sequence as set forth in SEQ ID NO: 130;

[0748] Linker 26 - GS linker, e.g., a sequence as set forth in SEQ ID NO: 148;

[0749] sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0750] TALE HPT15, e.g., a sequence as set forth in SEQ ID NO: 35;

[0751] multiple (e.g., two) sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0752] linker10 - XTEN 16 linker 2, e.g., a sequence as set forth in SEQ ID NO: 92;

[0753] Zim3 Krab, e.g., a sequence as set forth in SEQ ID NO: 132.

[0754] The second fusion of the V24 scheme can include, from N- to C-terminus, the following components in direct or indirect linkage: DNMT3A (e.g., SEQ ID NO: 131), hDNMT3L (e.g., SEQ ID NO: 45), GFP1-10 (e.g., SEQ ID NO: 78).

[0755] Further, the second fusion of the V24 scheme can include, from N- to C-terminus, the following components in direct or indirect linkage:

[0756] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0757] DNMT3A, e.g., a sequence as set forth in SEQ ID NO: 131;

[0758] hDNMT3L, e.g., a sequence as set forth in SEQ ID NO: 45;

[0759] linker4-XTEN 80linker 1, e.g., a sequence as set forth in SEQ ID NO: 86;

[0760] sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0761] GFP1-10, e.g., a sequence as set forth in SEQ ID NO: 78.

[0762] V28 scheme: NLS-DNMT3A-DNMT3L-scFv-2a-NLS-1xGCN4-NLS-TALE HPT21-NLS-NLS- KRAB, which can include, from N- to C-terminus, the following components in direct or indirect linkage:

[0763] NLS (e.g., SEQ ID NO: 129), DNMT3A (e.g., SEQ ID NO: 131), DNMT3L-CD (e.g., SEQ ID NO: 44), scFv (e.g., SEQ ID NO: 140), NLS (e.g., SEQ ID NO: 129), GCN4 (e.g., SEQ ID NO: 74), NLS (e.g., SEQ ID NO: 128), TALE HPT21 (e.g., SEQ ID NO: 36), NLS (e.g., SEQ ID NO: 128), NLS (e.g., SEQ ID NO: 128), KRAB (e.g., SEQ ID NO: 48).

[0764] Further, the V28 scheme can comprise, from N- to C-terminus, the following components, which can be directly or indirectly linked:

[0765] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0766] DNMT3A, e.g., a sequence as set forth in SEQ ID NO: 131;

[0767] DNMT3L-CD, e.g., a sequence as set forth in SEQ ID NO: 44;

[0768] linker4-XTEN 80linker 1, e.g., a sequence as set forth in SEQ ID NO: 86;

[0769] scFv, e.g., a sequence as set forth in SEQ ID NO: 140;

[0770] P2A, e.g., a sequence as set forth in SEQ ID NO: 141;

[0771] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0772] GCN4, e.g., a sequence as set forth in SEQ ID NO: 74;

[0773] sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0774] TALE HPT21, e.g., a sequence as set forth in SEQ ID NO: 36;

[0775] multiple (e.g., 2) sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0776] linker10-XTEN 16linker 2, e.g., a sequence as set forth in SEQ ID NO: 92;

[0777] KRAB, e.g., a sequence as set forth in SEQ ID NO: 48.

[0778] The first fusion of the V28 scheme can comprise, from N- to C-terminus, the following components, which can be directly or indirectly linked: NLS (e.g., SEQ ID NO: 129), DNMT3A (e.g., SEQ ID NO: 131), hDNMT3L-CD (e.g., SEQ ID NO: 44), scFv (e.g., SEQ ID NO: 140).

[0779] Further, the first fusion of the V28 protocol can include, from N- to C-terminus, the following components, which can be directly or indirectly connected:

[0780] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0781] DNMT3A, e.g., a sequence as set forth in SEQ ID NO: 131;

[0782] DNMT3L-CD, e.g., a sequence as set forth in SEQ ID NO: 44;

[0783] linker4-XTEN 80linker 1, e.g., a sequence as set forth in SEQ ID NO: 86;

[0784] scFv, e.g., a sequence as set forth in SEQ ID NO: 140.

[0785] The second fusion of the V28 protocol can include, from N- to C-terminus, the following components, which can be directly or indirectly connected: NLS (e.g., SEQ ID NO: 129), GCN4 (e.g., SEQ ID NO: 74), NLS (e.g., SEQ ID NO: 128), TALE HPT21 (e.g., SEQ ID NO: 36), NLS (e.g., SEQ ID NO: 128), NLS (e.g., SEQ ID NO: 128), KRAB (e.g., SEQ ID NO: 48).

[0786] Further, the second fusion of the V28 protocol can include, from N- to C-terminus, the following components, which can be directly or indirectly connected:

[0787] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0788] GCN4, e.g., a sequence as set forth in SEQ ID NO: 74;

[0789] sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0790] TALE HPT21, e.g., a sequence as set forth in SEQ ID NO: 36;

[0791] multiple (e.g., 2) sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0792] linker 10 - XTEN 16 linker 2, e.g., a sequence as set forth in SEQ ID NO: 92;

[0793] KRAB, e.g., a sequence as set forth in SEQ ID NO: 48.

[0794] V31 regimen: NLS-DNMT3A-DNMT3L-scFv-2a-NLS-lxGCN4-NLS-TALE HPT25-NLS-NLS-KRAB, which can include the following components from N-terminus to C-terminus, which can be directly or indirectly connected between the following components:

[0795] NLS (e.g., SEQ ID NO: 129), DNMT3A (e.g., SEQ ID NO: 131), DNMT3L-CD (e.g., SEQ ID NO: 44), scFv (e.g., SEQ ID NO: 140), NLS (e.g., SEQ ID NO: 129), GCN4 (e.g., SEQ ID NO: 74), NLS (e.g., SEQ ID NO: 128), TALE HPT25 (e.g., SEQ ID NO: 39), NLS (e.g., SEQ ID NO: 128), NLS (e.g., SEQ ID NO: 128), KRAB (e.g., SEQ ID NO: 48).

[0796] Further, V31 regimen can include the following components from N-terminus to C-terminus, which can be directly or indirectly connected between the following components:

[0797] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0798] DNMT3A, e.g., a sequence as set forth in SEQ ID NO: 131;

[0799] DNMT3L-CD, e.g., a sequence as set forth in SEQ ID NO: 44;

[0800] linker 4 - XTEN 80 linker 1, e.g., a sequence as set forth in SEQ ID NO: 86;

[0801] scFv, e.g., a sequence as set forth in SEQ ID NO: 140;

[0802] P2A, e.g., a sequence as set forth in SEQ ID NO: 141;

[0803] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0804] GCN4, e.g., the sequence set forth in SEQ ID NO: 74;

[0805] sv40 NLS, e.g., the sequence set forth in SEQ ID NO: 128;

[0806] TALE HPT25, e.g., the sequence set forth in SEQ ID NO: 39;

[0807] HA tag, e.g., the sequence set forth in SEQ ID NO: 133;

[0808] linker5-GS linker, e.g., the sequence set forth in SEQ ID NO: 87;

[0809] multiple (e.g., 2) sv40 NLS, e.g., the sequence set forth in SEQ ID NO: 128;

[0810] sv40 NLS, e.g., the sequence set forth in SEQ ID NO: 128;

[0811] linker10-XTEN 16linker 2, e.g., the sequence set forth in SEQ ID NO: 92;

[0812] KRAB, e.g., the sequence set forth in SEQ ID NO: 48.

[0813] The first fusion of the V31 regimen can include, from N-terminus to C-terminus, the following components, which can be directly or indirectly connected between them: NLS (e.g., SEQ ID NO: 129), DNMT3A (e.g., SEQ ID NO: 131), hDNMT3L-CD (e.g., SEQ ID NO: 44), scFv (e.g., SEQ ID NO: 140).

[0814] Further, the first fusion of the V31 regimen can include, from N-terminus to C-terminus, the following components, which can be directly or indirectly connected between them:

[0815] c-myc NLS, e.g., the sequence set forth in SEQ ID NO: 129;

[0816] DNMT3A, e.g., the sequence set forth in SEQ ID NO: 131;

[0817] DNMT3L-CD, e.g., the sequence set forth in SEQ ID NO: 44;

[0818] linker4-XTEN 80linker 1, e.g., a sequence as set forth in SEQ ID NO: 86;

[0819] scFv, e.g., a sequence as set forth in SEQ ID NO: 140.

[0820] A second fusion of the V31 scheme can include, from N- to C-terminus, the following components, which can be directly or indirectly linked:

[0821] Further, a second fusion of the V31 scheme can include, from N- to C-terminus, the following components, which can be directly or indirectly linked:

[0822] c-myc NLS, e.g., a sequence as set forth in SEQ ID NO: 129;

[0823] GCN4, e.g., a sequence as set forth in SEQ ID NO: 74;

[0824] sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0825] TALE HPT25, e.g., a sequence as set forth in SEQ ID NO: 39;

[0826] HA tag, e.g., a sequence as set forth in SEQ ID NO: 133;

[0827] linker5-GS linker, e.g., a sequence as set forth in SEQ ID NO: 87;

[0828] multiple (e.g., 2) sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0829] sv40 NLS, e.g., a sequence as set forth in SEQ ID NO: 128;

[0830] linker10-XTEN 16linker 2, e.g., a sequence as set forth in SEQ ID NO: 92;

[0831] KRAB, e.g., a sequence as set forth in SEQ ID NO: 48.

[0832] In light of the above, the present application can provide the amino acid sequence of the first fusion or the second fusion as set forth below

[0833] 1) NLS-scFv-KRAB (V11 scheme, SEQ ID NO: 11):

[0834] 2) NLS-DNMT3A-DNMT3L-NLS-TALE HPT15-2xNLS-4xGCN4-NLS (V12 scheme, SEQ ID NO: 12):

[0835] 3) NLS-DNMT3A-DNMT3L-scFv (V13 scheme, SEQ ID NO: 13):

[0836] 4) NLS-3xGCN4-NLS-TALE HPT15-2xNLS-KRAB (V14 scheme, SEQ ID NO: 14):

[0837] 5) NLS-scFv-ZIM3 KRAB (first fusion of V15 scheme, SEQ ID NO: 102):

[0838] 6) NLS-DNMT3A-(human)DNMT3L-NLS-TALE HPT15-2xNLS-10xGCN4-NLS (second fusion of V15 scheme, SEQ ID NO: 103):

[0839] 7) NLS-KRAB-scFv (first fusion of V16 scheme, SEQ ID NO: 104):

[0840] 8) NLS-DNMT3A-DNMT3L-NLS-TALE HPT15-2xNLS-2xGCN4-NLS (second fusion of V16 scheme, SEQ ID NO: 105):

[0841] 9) NLS-1 x GCN4-NLS-TALE HPT15-2 x NLS-KRAB (second fusion of V17 protocol, SEQ ID NO: 106):

[0842] 10) NLS-DNMT3A-(human)DNMT3L-NLS-scFv (first fusion of V18 protocol, SEQ ID NO: 107):

[0843] 11) NLS-3 x GCN4-NLS-TALE HPT15-2 x NLS-ZIM3 KRAB (second fusion of V18 protocol, SEQ ID NO: 108):

[0844] 12) NLS-scFv-(human)DNMT3L-DNMT3A (first fusion of V20 protocol, SEQ ID NO: 109):

[0845] 13) NLS-1 x GCN4-ZIM3 KRAB (first fusion of V21 protocol, SEQ ID NO: 110):

[0846] 14) NLS-DNMT3A-(human)DNMT3L-NLS-TALE HPT15-2 x NLS-scFv (second fusion of V21 protocol, SEQ ID NO: 111):

[0847] 15) GFP1-10-KRAB-NLS (first fusion of V22 protocol, SEQ ID NO: 112):

[0848] 16) NLS-DNMT3A-DNMT3L-NLS-TALE HPT15-2 x NLS-7 x GFP11-NLS (second fusion of V22 protocol, SEQ ID NO: 113):

[0849] 17) NLS-DNMT3A-DNMT3L-NLS-TALE HPT15-2 x NLS-1 x GFP11-NLS (second fusion of V23 protocol, SEQ ID NO: 114):

[0850] 18) NLS-7xGFP11-NLS-NLS-TALE HPT15-2xNLS-ZIM3 KRAB (first fusion of V24 protocol, SEQ ID NO: 115):

[0851] 19) NLS-DNMT3A-(human)DNMT3L-NLS-GFP1-10 (second fusion of V24 protocol, SEQ ID NO: 116):

[0852] 20) NLS-1xGCN4-NLS-TALE HPT21-2xNLS-KRAB (second fusion of V28 protocol, SEQ ID NO: 117):

[0853] 21) NLS-1xGCN4-NLS-TALE HPT25-2xNLS-KRAB (second fusion of V31 protocol, SEQ ID NO: 118):

[0854] The following is the arrangement of components from N- to C-terminus for the sequences of the above protocols:

[0855] V1_TALE HPT15-XTEN80-DNMT3A-DNMT3L-XTEN16-ZIM3 (SEQ ID NO: 1)

[0856] c-myc NLS, a sequence as set forth in SEQ ID NO: 129; TALE HPT15, a sequence as set forth in SEQ ID NO: 35; HA tag, a sequence as set forth in SEQ ID NO: 133; linker5 - GS linker, a sequence as set forth in SEQ ID NO: 87; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; linker4 - XTEN 80linker 1, a sequence as set forth in SEQ ID NO: 86; DNMT3A, a sequence as set forth in SEQ ID NO: 131; linker3 - flexible peptide linker, a sequence as set forth in SEQ ID NO: 85; DNMT3L-CD, a sequence as set forth in SEQ ID NO: 44; linker10 - XTEN 16linker 2, a sequence as set forth in SEQ ID NO: 92; Zim3 Krab, a sequence as set forth in SEQ ID NO: 132.

[0857] V2_TALE HPT15-XTEN80-ZIM3-XTEN80-hDNMT3L-DNMT3A (SEQ ID NO: 2)

[0858] c-myc NLS, a sequence as set forth in SEQ ID NO: 129; TALE HPT15, a sequence as set forth in SEQ ID NO: 35; HA tag, a sequence as set forth in SEQ ID NO: 133; linker5 - GS linker, a sequence as set forth in SEQ ID NO: 87; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; linker4 - XTEN 80linker 1, a sequence as set forth in SEQ ID NO: 86; Zim3 Krab, a sequence as set forth in SEQ ID NO: 132; linker12 - XTEN 80linker 2, a sequence as set forth in SEQ ID NO: 94; hDNMT3L, a sequence as set forth in SEQ ID NO: 45; linker3 - flexible peptide linker, a sequence as set forth in SEQ ID NO: 85; DNMT3A, a sequence as set forth in SEQ ID NO: 131.

[0859] V3_TALE HPT15-XTEN80-ZIM3-XTEN80-DNMT3A-hDNMT3L (SEQ ID NO: 3)

[0860] sv40 NLS, a sequence as set forth in SEQ ID NO: 128; HPT15, a sequence as set forth in SEQ ID NO: 35; HA tag, a sequence as set forth in SEQ ID NO: 133; linker5 - GS linker, a sequence as set forth in SEQ ID NO: 87; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; linker4 - XTEN 80 linker 1, a sequence as set forth in SEQ ID NO: 86; Zim3 Krab, a sequence as set forth in SEQ ID NO: 132; linker22 - fused XTEN linker 2, a sequence as set forth in SEQ ID NO: 126; DNMT3A, a sequence as set forth in SEQ ID NO: 131; linker3 - flexible peptide linker, a sequence as set forth in SEQ ID NO: 85; hDNMT3L, a sequence as set forth in SEQ ID NO: 45.

[0861] V4_ZIM3-BFP-DNMT3A-hDNMT3L-XTEN80-TALE HPT15 (SEQ ID NO: 4)

[0862] Zim3 Krab, a sequence as set forth in SEQ ID NO: 132; linker11 - XTEN 16 linker 1, a sequence as set forth in SEQ ID NO: 93; BFP, a sequence as set forth in SEQ ID NO: 143; linker11 - XTEN 16 linker 1, a sequence as set forth in SEQ ID NO: 93; DNMT3A, a sequence as set forth in SEQ ID NO: 131; linker3 - flexible peptide linker, a sequence as set forth in SEQ ID NO: 85; hDNMT3L, a sequence as set forth in SEQ ID NO: 45; linker4 - XTEN 80 linker 1, a sequence as set forth in SEQ ID NO: 86; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; HPT15, a sequence as set forth in SEQ ID NO: 35; HA c-myc NLS, a sequence as set forth in SEQ ID NO: 129; DNMT3A, a sequence as set forth in SEQ ID NO: 131; linker3-flexible peptide linker, a sequence as set forth in SEQ ID NO: 85; hDNMT3L, a sequence as set forth in SEQ ID NO: 45; linker4-XTEN 80 linker 1, a sequence as set forth in SEQ ID NO: 86; Zim3 Krab, a sequence as set forth in SEQ ID NO: 132; linker 15-fused XTEN linker 1, a sequence as set forth in SEQ ID NO: 119; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; TALE HPT15, a sequence as set forth in SEQ ID NO: 35; HA tag, a sequence as set forth in SEQ ID NO: 133; linker5-GS linker, a sequence as set forth in SEQ ID NO: 87; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; sv40 NLS, a sequence as set forth in SEQ ID NO: 128.

[0863] V5_DNMT3A-hDNMT3L-XTEN80-ZIM3-XTEN80-TALE HPT15 (SEQ ID NO: 5)

[0864] c-myc NLS, a sequence as set forth in SEQ ID NO: 129; DNMT3A, a sequence as set forth in SEQ ID NO: 131; linker3-flexible peptide linker, a sequence as set forth in SEQ ID NO: 85; hDNMT3L, a sequence as set forth in SEQ ID NO: 45; linker4-XTEN 80 linker 1, a sequence as set forth in SEQ ID NO: 86; Zim3 Krab, a sequence as set forth in SEQ ID NO: 132; linker 15-fused XTEN linker 1, a sequence as set forth in SEQ ID NO: 119; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; TALE HPT15, a sequence as set forth in SEQ ID NO: 35; HA tag, a sequence as set forth in SEQ ID NO: 133; linker5-GS linker, a sequence as set forth in SEQ ID NO: 87; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; sv40 NLS, a sequence as set forth in SEQ ID NO: 128.

[0865] V6_DNMT3A-hDNMT3L-XTEN80-ZNF324-XTEN80-TALE HPT15 (SEQ ID NO: 6)

[0866] c-myc NLS, a sequence as set forth in SEQ ID NO: 129; DNMT3A, a sequence as set forth in SEQ ID NO: 131; linker3 - flexible peptide linker, a sequence as set forth in SEQ ID NO: 85; hDNMT3L, a sequence as set forth in SEQ ID NO: 45; linker4 - XTEN80linkerl, a sequence as set forth in SEQ ID NO: 86; Znf324, a sequence as set forth in SEQ ID NO: 54; linkerl5 - fused XTEN linkerl, a sequence as set forth in SEQ ID NO: 119; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; HPT15, a sequence as set forth in SEQ ID NO: 35; HA tag, a sequence as set forth in SEQ ID NO: 133; linker5 - GS linker, a sequence as set forth in SEQ ID NO: 87; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; sv40 NLS, a sequence as set forth in SEQ ID NO: 128.

[0867] V7_DNMT3A-hDNMT3L-XTEN80-ZNF419-GS-XTEN80-TALE HPT15 (SEQ ID NO: 7)

[0868] c-myc NLS, a sequence as set forth in SEQ ID NO: 129; DNMT3A, a sequence as set forth in SEQ ID NO: 131; linker3 - flexible peptide linker, a sequence as set forth in SEQ ID NO: 85; hDNMT3L, a sequence as set forth in SEQ ID NO: 45; linker4 - XTEN80linkerl, a sequence as set forth in SEQ ID NO: 86; Znf419, a sequence as set forth in SEQ ID NO: 59; linker2l - GS linker, a sequence as set forth in SEQ ID NO: 125; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; HPT15, a sequence as set forth in SEQ ID NO: 35; HA tag, a sequence as set forth in SEQ ID NO: 133; linker5 - GS linker, a sequence as set forth in SEQ ID NO: 87; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; sv40 NLS, a sequence as set forth in SEQ ID NO: 128.

[0869] V8_DNMT3A-DNMT3L-XTEN80-TALE HPT15-XTEN16-EZH2 (SEQ ID NO: 8)

[0870] c-myc NLS, a sequence as set forth in SEQ ID NO: 129; DNMT3A, a sequence as set forth in SEQ ID NO: 131; linker3 -flexible peptide linker, a sequence as set forth in SEQ ID NO: 85; DNMT3L-CD, a sequence as set forth in SEQ ID NO: 44; linker4 -XTEN 80 linker 1, a sequence as set forth in SEQ ID NO: 86; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; HPT15, a sequence as set forth in SEQ ID NO: 35; HA tag, a sequence as set forth in SEQ ID NO: 133; linker5 -GS linker, a sequence as set forth in SEQ ID NO: 87; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; linker11 -XTEN 16 linker 1, a sequence as set forth in SEQ ID NO: 93; EZH2, a sequence as set forth in SEQ ID NO: 66.

[0871] V9_DNMT3A-DNMT3L-XTEN80-TALE HPT15-XTEN16-HDAC3 (SEQ ID NO: 9)

[0872] c-myc NLS, a sequence as set forth in SEQ ID NO: 129; DNMT3A, a sequence as set forth in SEQ ID NO: 131; linker3 - flexible peptide linker, a sequence as set forth in SEQ ID NO: 85; DNMT3L-CD, a sequence as set forth in SEQ ID NO: 44; linker4 - XTEN80linkerl, a sequence as set forth in SEQ ID NO: 86; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; HPT15, a sequence as set forth in SEQ ID NO: 35; HA tag, a sequence as set forth in SEQ ID NO: 133; linker5 - GS linker, a sequence as set forth in SEQ ID NO: 87; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; linkerll - XTEN16linkerl, a sequence as set forth in SEQ ID NO: 93; HP1a(long), a sequence as set forth in SEQ ID NO: 70.

[0873] V10_DNMT3A-DNMT3L-XTEN80-TALE HPT15-XTEN16-HP1a (SEQ ID NO: 10)

[0874] c-myc NLS, a sequence as set forth in SEQ ID NO: 129; DNMT3A, a sequence as set forth in SEQ ID NO: 131; linker3 - flexible peptide linker, a sequence as set forth in SEQ ID NO: 85; DNMT3L-CD, a sequence as set forth in SEQ ID NO: 44; linker4 - XTEN80linkerl, a sequence as set forth in SEQ ID NO: 86; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; HPT15, a sequence as set forth in SEQ ID NO: 35; HA tag, a sequence as set forth in SEQ ID NO: 133; linker5 - GS linker, a sequence as set forth in SEQ ID NO: 87; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; linkerll - XTEN16linkerl, a sequence as set forth in SEQ ID NO: 93; HP1a(long), a sequence as set forth in SEQ ID NO: 70.

[0875] V11_scFv-KRAB (SEQ ID NO: 11)

[0876] c-myc NLS, a sequence as set forth in SEQ ID NO: 129; scFv, a sequence as set forth in SEQ ID NO: 140; HA tag, a sequence as set forth in SEQ ID NO: 133; linker 16 - GS linker, a sequence as set forth in SEQ ID NO: 120; KRAB, a sequence as set forth in SEQ ID NO: 48.

[0877] V12_DNMT3A-DNMT3L-TALE HPT15-4xGCN4 (SEQ ID NO: 12)

[0878] c-myc NLS, a sequence as set forth in SEQ ID NO: 129; DNMT3A, a sequence as set forth in SEQ ID NO: 131; linker3 - flexible peptide linker, a sequence as set forth in SEQ ID NO: 85; DNMT3L-CD, a sequence as set forth in SEQ ID NO: 44; linker4 - XTEN 80 linker 1, a sequence as set forth in SEQ ID NO: 86; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; TALE HPT15, a sequence as set forth in SEQ ID NO: 35; HA tag, a sequence as set forth in SEQ ID NO: 133; linker5 - GS linker, a sequence as set forth in SEQ ID NO: 87; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; linker6 - GS linker, a sequence as set forth in SEQ ID NO: 88; GCN4, a sequence as set forth in SEQ ID NO: 74; linker7 - GS linker, a sequence as set forth in SEQ ID NO: 89; GCN4, a sequence as set forth in SEQ ID NO: 74; linker7 - GS linker, a sequence as set forth in SEQ ID NO: 89; GCN4, a sequence as set forth in SEQ ID NO: 74; linker7 - GS linker, a sequence as set forth in SEQ ID NO: 89; GCN4, a sequence as set forth in SEQ ID NO: 74; linker8 - GS linker, a sequence as set forth in SEQ ID NO: 90; BPSV40 NLS, a sequence as set forth in SEQ ID NO: 130.

[0879] V13_DNMT3A-DNMT3L-scFv (SEQ ID NO: 13)

[0880] c-myc NLS, the sequence set forth in SEQ ID NO: 129; DNMT3A, the sequence set forth in SEQ ID NO: 131; linker3-flexible peptide linker, the sequence set forth in SEQ ID NO: 85; DNMT3L-CD, the sequence set forth in SEQ ID NO: 44; linker4-XTEN 80linker 1, the sequence set forth in SEQ ID NO: 86; scFv, the sequence set forth in SEQ ID NO: 140; HA tag, the sequence set forth in SEQ ID NO: 133; linker20-GS linker, the sequence set forth in SEQ ID NO: 124.

[0881] V14_3xGCN4-TALE HPT15-KRAB (SEQ ID NO: 14)

[0882] c-myc NLS, the sequence set forth in SEQ ID NO: 129; GCN4, the sequence set forth in SEQ ID NO: 74; linker7-GS linker, the sequence set forth in SEQ ID NO: 89; GCN4, the sequence set forth in SEQ ID NO: 74; linker7-GS linker, the sequence set forth in SEQ ID NO: 89; GCN4, the sequence set forth in SEQ ID NO: 74; linker7-GS linker, the sequence set forth in SEQ ID NO: 89; sv40 NLS, the sequence set forth in SEQ ID NO: 128; TALE HPT15, the sequence set forth in SEQ ID NO: 35; HA tag, the sequence set forth in SEQ ID NO: 133; linker5-GS linker, the sequence set forth in SEQ ID NO: 87; sv40 NLS, the sequence set forth in SEQ ID NO: 128; sv40 NLS, the sequence set forth in SEQ ID NO: 128; linker10-XTEN 16linker 2, the sequence set forth in SEQ ID NO: 92; KRAB, the sequence set forth in SEQ ID NO: 48.

[0883] V15_scFv-ZIM3-2a-DNMT3A-hDNMT3L-TALE HPT15-10xGCN4 (SEQ ID NO: 15)

[0884] c-myc NLS, a sequence as set forth in SEQ ID NO: 129; scFv, a sequence as set forth in SEQ ID NO: 140; HA tag, a sequence as set forth in SEQ ID NO: 133; linker 16 - GS linker, a sequence as set forth in SEQ ID NO: 120; Zim3 Krab, a sequence as set forth in SEQ ID NO: 132; linker2 - GS linker, a sequence as set forth in SEQ ID NO: 84; P2A, a sequence as set forth in SEQ ID NO: 141; c-myc NLS, a sequence as set forth in SEQ ID NO: 129; DNMT3A, a sequence as set forth in SEQ ID NO: 131; linker3 - flexible peptide linker, a sequence as set forth in SEQ ID NO: 85; hDNMT3L, a sequence as set forth in SEQ ID NO: 45; linker4 - XTEN 80 linker 1, a sequence as set forth in SEQ ID NO: 86; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; TALE HPT15, a sequence as set forth in SEQ ID NO: 35; HA tag, a sequence as set forth in SEQ ID NO: 133; linker5 - GS linker, a sequence as set forth in SEQ ID NO: 87; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; linker6 - GS linker, a sequence as set forth in SEQ ID NO: 88; GCN4, a sequence as set forth in SEQ ID NO: 74; linker7 - GS linker, a sequence as set forth in SEQ ID NO: 89; GCN4, a sequence as set forth in SEQ ID NO: 74; linker7 - GS linker, a sequence as set forth in SEQ ID NO: 89; GCN4, a sequence as set forth in SEQ ID NO: 74; linker7 - GS linker, a sequence as set forth in SEQ ID NO: 89; GCN4, a sequence as set forth in SEQ ID NO: 74; linker7 - GS linker, a sequence as set forth in SEQ ID NO: 89; GCN4, a sequence as set forth in SEQ ID NO: 74; linker7 - GS linker, a sequence as set forth in SEQ ID NO: 89; GCN4, a sequence as set forth in SEQ ID NO: 74; linker7 - GS linker, a sequence as set forth in SEQ ID NO: 89; GCN4, a sequence as set forth in SEQ ID NO: 74;linker7 - GS linker, a sequence as set forth in SEQ ID NO: 89; GCN4, a sequence as set forth in SEQ ID NO: 74; linker7 - GS linker, a sequence as set forth in SEQ ID NO: 89; GCN4, a sequence as set forth in SEQ ID NO: 74; linker7 - GS linker, a sequence as set forth in SEQ ID NO: 89; GCN4, a sequence as set forth in SEQ ID NO: 74; linker7 - GS linker, a sequence as set forth in SEQ ID NO: 89; GCN4, a sequence as set forth in SEQ ID NO: 74; linker8 - GS linker, a sequence as set forth in SEQ ID NO: 90; BPSV40 NLS, a sequence as set forth in SEQ ID NO: 130.

[0885] V16_KRAB-scFv-2a-DNMT3A-DNMT3L-TALE HPT15-2xGCN4 (SEQ ID NO: 16)

[0886] c-myc NLS, a sequence set forth in SEQ ID NO: 129; KRAB, a sequence set forth in SEQ ID NO: 48; scFv, a sequence set forth in SEQ ID NO: 140; HA tag, a sequence set forth in SEQ ID NO: 133; linkerl -GS linker, a sequence set forth in SEQ ID NO: 121; P2A, a sequence set forth in SEQ ID NO: 141; c-myc NLS, a sequence set forth in SEQ ID NO: 129; DNMT3A, a sequence set forth in SEQ ID NO: 131; linker3 -flexible peptide linker, a sequence set forth in SEQ ID NO: 85; hDNMT3L, a sequence set forth in SEQ ID NO: 45; linker4-XTEN 80linkerl, a sequence set forth in SEQ ID NO: 86; sv40 NLS, a sequence set forth in SEQ ID NO: 128; TALE HPT15, a sequence set forth in SEQ ID NO: 35; HA tag, a sequence set forth in SEQ ID NO: 133; linker5-GS linker, a sequence set forth in SEQ ID NO: 87; sv40 NLS, a sequence set forth in SEQ ID NO: 128; sv40 NLS, a sequence set forth in SEQ ID NO: 128; linker6-GS linker, a sequence set forth in SEQ ID NO: 88; GCN4, a sequence set forth in SEQ ID NO: 74; linker7-GS linker, a sequence set forth in SEQ ID NO: 89; GCN4, a sequence set forth in SEQ ID NO: 74; linker8-GS linker, a sequence set forth in SEQ ID NO: 90; BPSV40 NLS, a sequence set forth in SEQ ID NO: 130.

[0887] V17_DNMT3A-DNMT3L-scFv-2a-1xGCN4-TALE HPT15-KRAB (SEQ ID NO: 17)

[0888] c-myc NLS, a sequence set forth in SEQ ID NO: 129; DNMT3A, a sequence set forth in SEQ ID NO: 131; linker3 -flexible peptide linker, a sequence set forth in SEQ ID NO: 85; DNMT3L-CD, a sequence set forth in SEQ ID NO: 44; linker4 -XTEN 80linker 1, a sequence set forth in SEQ ID NO: 86; scFv, a sequence set forth in SEQ ID NO: 140; HA tag, a sequence set forth in SEQ ID NO: 133; linker 17-GS linker, a sequence set forth in SEQ ID NO: 121; P2A, a sequence set forth in SEQ ID NO: 141; c-myc NLS, a sequence set forth in SEQ ID NO: 129; linker 18-GS linker, a sequence set forth in SEQ ID NO: 122; GCN4, a sequence set forth in SEQ ID NO: 74; linker7 -GS linker, a sequence set forth in SEQ ID NO: 89; sv40 NLS, a sequence set forth in SEQ ID NO: 128; TALE HPT15, a sequence set forth in SEQ ID NO: 35; HA tag, a sequence set forth in SEQ ID NO: 133; linker5 -GS linker, a sequence set forth in SEQ ID NO: 87; sv40 NLS, a sequence set forth in SEQ ID NO: 128; sv40 NLS, a sequence set forth in SEQ ID NO: 128; linker10 -XTEN 16linker 2, a sequence set forth in SEQ ID NO: 92; KRAB, a sequence set forth in SEQ ID NO: 48.

[0889] V18_DNMT3A-hDNMT3L-scFv-2a-3xGCN4-TALE HPT15-ZIM3 (SEQ ID NO: 18)

[0890] c-myc NLS, a sequence as set forth in SEQ ID NO: 129; DNMT3A, a sequence as set forth in SEQ ID NO: 131; linker3 -flexible peptide linker, a sequence as set forth in SEQ ID NO: 85; hDNMT3L, a sequence as set forth in SEQ ID NO: 45; linker4 -XTEN 80linker 1, a sequence as set forth in SEQ ID NO: 86; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; scFv, a sequence as set forth in SEQ ID NO: 140; HA tag, a sequence as set forth in SEQ ID NO: 133; linker 17-GS linker, a sequence as set forth in SEQ ID NO: 121; P2A, a sequence as set forth in SEQ ID NO: 141; c-myc NLS, a sequence as set forth in SEQ ID NO: 129; GCN4, a sequence as set forth in SEQ ID NO: 74; linker7 -GS linker, a sequence as set forth in SEQ ID NO: 89; GCN4, a sequence as set forth in SEQ ID NO: 74; linker7 -GS linker, a sequence as set forth in SEQ ID NO: 89; GCN4, a sequence as set forth in SEQ ID NO: 74; linker7 -GS linker, a sequence as set forth in SEQ ID NO: 89; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; TALE HPT15, a sequence as set forth in SEQ ID NO: 35; HA tag, a sequence as set forth in SEQ ID NO: 133; linker5 -GS linker, a sequence as set forth in SEQ ID NO: 87; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; linker10 -XTEN 16linker 2, a sequence as set forth in SEQ ID NO: 92; Zim3 Krab, a sequence as set forth in SEQ ID NO: 132.

[0891] V19_3xGCN4-TALE HPT15-ZIM3-2a-DNMT3A-hDNMT3L-scFv (SEQ ID NO: 19)

[0892] c-myc NLS, a sequence as set forth in SEQ ID NO: 129; GCN4, a sequence as set forth in SEQ ID NO: 74; linker7 - GS linker, a sequence as set forth in SEQ ID NO: 89; GCN4, a sequence as set forth in SEQ ID NO: 74; linker7 - GS linker, a sequence as set forth in SEQ ID NO: 89; GCN4, a sequence as set forth in SEQ ID NO: 74; linker7 - GS linker, a sequence as set forth in SEQ ID NO: 89; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; TALE HPT15, a sequence as set forth in SEQ ID NO: 35; HA tag, a sequence as set forth in SEQ ID NO: 133; linker5 - GS linker, a sequence as set forth in SEQ ID NO: 87; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; linker10 - XTEN 16linker 2, a sequence as set forth in SEQ ID NO: 92; Zim3 Krab, a sequence as set forth in SEQ ID NO: 132; P2A, a sequence as set forth in SEQ ID NO: 141; c-myc NLS, a sequence as set forth in SEQ ID NO: 129; DNMT3A, a sequence as set forth in SEQ ID NO: 131; linker3 - flexible peptide linker, a sequence as set forth in SEQ ID NO: 85; hDNMT3L, a sequence as set forth in SEQ ID NO: 45; linker4 - XTEN 80linker 1, a sequence as set forth in SEQ ID NO: 86; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; scFv, a sequence as set forth in SEQ ID NO: 140; HA tag, a sequence as set forth in SEQ ID NO: 133; linker20 - GS linker, a sequence as set forth in SEQ ID NO: 124.

[0893] V20_scFV-hDNMT3L-DNMT3A-2a-3xGCN4-TALE HPT15-KRAB (SEQ ID NO: 20)

[0894] c-myc NLS, a sequence as set forth in SEQ ID NO: 129; scFv, a sequence as set forth in SEQ ID NO: 140; HA tag, a sequence as set forth in SEQ ID NO: 133; linker 20 - GS linker, a sequence as set forth in SEQ ID NO: 124; hDNMT3L, a sequence as set forth in SEQ ID NO: 45; linker 3 - flexible peptide linker, a sequence as set forth in SEQ ID NO: 85; DNMT3A, a sequence as set forth in SEQ ID NO: 131; linker 2 - GS linker, a sequence as set forth in SEQ ID NO: 84; P2A, a sequence as set forth in SEQ ID NO: 141; c-myc NLS, a sequence as set forth in SEQ ID NO: 129; GCN4, a sequence as set forth in SEQ ID NO: 74; linker 7 - GS linker, a sequence as set forth in SEQ ID NO: 89; GCN4, a sequence as set forth in SEQ ID NO: 74; linker 7 - GS linker, a sequence as set forth in SEQ ID NO: 89; GCN4, a sequence as set forth in SEQ ID NO: 74; linker 7 - GS linker, a sequence as set forth in SEQ ID NO: 89; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; TALE HPT15, a sequence as set forth in SEQ ID NO: 35; HA tag, a sequence as set forth in SEQ ID NO: 133; linker 5 - GS linker, a sequence as set forth in SEQ ID NO: 87; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; linker 10 - XTEN 16 linker 2, a sequence as set forth in SEQ ID NO: 92; KRAB, a sequence as set forth in SEQ ID NO: 48.

[0895] V21_1 x GCN4-ZIM3-2a-DNMT3A-hDNMT3L-TALE HPT15-scFv (SEQ ID NO: 21)

[0896] c-myc NLS, a sequence set forth in SEQ ID NO: 129; GCN4, a sequence set forth in SEQ ID NO: 74; linker7 - GS linker, a sequence set forth in SEQ ID NO: 89; Zim3 Krab, a sequence set forth in SEQ ID NO: 132; linker2 - GS linker, a sequence set forth in SEQ ID NO: 84; P2A, a sequence set forth in SEQ ID NO: 141; c-myc NLS, a sequence set forth in SEQ ID NO: 129; DNMT3A, a sequence set forth in SEQ ID NO: 131; linker3 - flexible peptide linker, a sequence set forth in SEQ ID NO: 85; hDNMT3L, a sequence set forth in SEQ ID NO: 45; linker4 - XTEN 80linker 1, a sequence set forth in SEQ ID NO: 86; sv40 NLS, a sequence set forth in SEQ ID NO: 128; TALE HPT15, a sequence set forth in SEQ ID NO: 35; HA tag, a sequence set forth in SEQ ID NO: 133; linker5 - GS linker, a sequence set forth in SEQ ID NO: 87; sv40 NLS, a sequence set forth in SEQ ID NO: 128; sv40 NLS, a sequence set forth in SEQ ID NO: 128; scFv, a sequence set forth in SEQ ID NO: 140; HA tag, a sequence set forth in SEQ ID NO: 133; linker 20 - GS linker, a sequence set forth in SEQ ID NO: 124.

[0897] V22_GFP1-10-KRAB-2a-DNMT3A-DNMT3L-TALE HPT15-7xGFP11 (SEQ ID NO: 22)

[0898] GFP1-10, the sequence set forth in SEQ ID NO: 78; linker 19 - GS linker, the sequence set forth in SEQ ID NO: 123; KRAB, the sequence set forth in SEQ ID NO: 48; linker2 - GS linker, the sequence set forth in SEQ ID NO: 84; BPSV40 NLS, the sequence set forth in SEQ ID NO: 130; linker2 - GS linker, the sequence set forth in SEQ ID NO: 84; P2A, the sequence set forth in SEQ ID NO: 141; c-myc NLS, the sequence set forth in SEQ ID NO: 129; DNMT3A, the sequence set forth in SEQ ID NO: 131; linker3 - flexible peptide linker, the sequence set forth in SEQ ID NO: 85; DNMT3L-CD, the sequence set forth in SEQ ID NO: 44; linker4 - XTEN 80 linker 1, the sequence set forth in SEQ ID NO: 86; sv40 NLS, the sequence set forth in SEQ ID NO: 128; TALE HPT15, the sequence set forth in SEQ ID NO: 35; HA tag, the sequence set forth in SEQ ID NO: 133; linker5 - GS linker, the sequence set forth in SEQ ID NO: 87; sv40 NLS, the sequence set forth in SEQ ID NO: 128; sv40 NLS, the sequence set forth in SEQ ID NO: 128; Linker 25 - dCas9-NLS and GFP11), the sequence set forth in SEQ ID NO: 147; GFP11, the sequence set forth in SEQ ID NO: 75; linker 23 - GS linker, the sequence set forth in SEQ ID NO: 127; GFP11, the sequence set forth in SEQ ID NO: 75; linker 23 - GS linker, the sequence set forth in SEQ ID NO: 127; GFP11, the sequence set forth in SEQ ID NO: 75; linker 23 - GS linker, the sequence set forth in SEQ ID NO: 127; GFP11, the sequence set forth in SEQ ID NO: 75; linker 23 - GS linker, the sequence set forth in SEQ ID NO: 127; GFP11, the sequence set forth in SEQ ID NO: 75; linker 23 - GS linker, the sequence set forth in SEQ ID NO: 127; GFP11, the sequence set forth in SEQ ID NO: 75;GFP1-10, a sequence as set forth in SEQ ID NO: 78; linker 19 - GS linker, a sequence as set forth in SEQ ID NO: 123; KRAB, a sequence as set forth in SEQ ID NO: 48; linker 2 - GS linker, a sequence as set forth in SEQ ID NO: 84; BPSV40 NLS, a sequence as set forth in SEQ ID NO: 130; linker 2 - GS linker, a sequence as set forth in SEQ ID NO: 84; P2A, a sequence as set forth in SEQ ID NO: 141; c-myc NLS, a sequence as set forth in SEQ ID NO: 129; DNMT3A, a sequence as set forth in SEQ ID NO: 131; linker 3 - flexible peptide linker, a sequence as set forth in SEQ ID NO: 85; DNMT3L-CD, a sequence as set forth in SEQ ID NO: 44; linker 4 - XTEN 80 linker 1, a sequence as set forth in SEQ ID NO: 86; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; TALE HPT15, a sequence as set forth in SEQ ID NO: 35; HA tag, a sequence as set forth in SEQ ID NO: 133; linker 5 - GS linker, a sequence as set forth in SEQ ID NO: 87; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; Linker 25 - dCas9-NLS and GFP11), a sequence as set forth in SEQ ID NO: 147; GFP11, a sequence as set forth in SEQ ID NO: 75; Linker 24 - GFP11 and NLS), a sequence as set forth in SEQ ID NO: 146; BPSV40 NLS, a sequence as set forth in SEQ ID NO: 130.

[0899] V23_GFP1-10-KRAB-2a-DNMT3A-DNMT3L-TALE HPT15-1xGFP11 (SEQ ID NO: 23)

[0900] GFP1-10, a sequence as set forth in SEQ ID NO: 78; linker 19 - GS linker, a sequence as set forth in SEQ ID NO: 123; KRAB, a sequence as set forth in SEQ ID NO: 48; linker 2 - GS linker, a sequence as set forth in SEQ ID NO: 84; BPSV40 NLS, a sequence as set forth in SEQ ID NO: 130; linker 2 - GS linker, a sequence as set forth in SEQ ID NO: 84; P2A, a sequence as set forth in SEQ ID NO: 141; c-myc NLS, a sequence as set forth in SEQ ID NO: 129; DNMT3A, a sequence as set forth in SEQ ID NO: 131; linker 3 - flexible peptide linker, a sequence as set forth in SEQ ID NO: 85; DNMT3L-CD, a sequence as set forth in SEQ ID NO: 44; linker 4 - XTEN 80 linker 1, a sequence as set forth in SEQ ID NO: 86; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; TALE HPT15, a sequence as set forth in SEQ ID NO: 35; HA tag, a sequence as set forth in SEQ ID NO: 133; linker 5 - GS linker, a sequence as set forth in SEQ ID NO: 87; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; Linker 25 - dCas9-NLS and GFP11), a sequence as set forth in SEQ ID NO: 147; GFP11, a sequence as set forth in SEQ ID NO: 75; Linker 24 - GFP11 and NLS), a sequence as set forth in SEQ ID NO: 146; BPSV40 NLS, a sequence as set forth in SEQ ID NO: 130.

[0901] V24_7xGFP11-TALE HPT15-ZIM3-2a-DNMT3A-hDNMT3L-GFP1-10 (SEQ ID NO: 24)

[0902] c-myc NLS, a sequence as set forth in SEQ ID NO: 129; GFP11, a sequence as set forth in SEQ ID NO: 75; linker 23 - GS linker, a sequence as set forth in SEQ ID NO: 127; GFP11, a sequence as set forth in SEQ ID NO: 75; linker 23 - GS linker, a sequence as set forth in SEQ ID NO: 127; GFP11, a sequence as set forth in SEQ ID NO: 75; linker 23 - GS linker, a sequence as set forth in SEQ ID NO: 127; GFP11, a sequence as set forth in SEQ ID NO: 75; linker 23 - GS linker, a sequence as set forth in SEQ ID NO: 127; GFP11, a sequence as set forth in SEQ ID NO: 75; linker 23 - GS linker, a sequence as set forth in SEQ ID NO: 127; GFP11, a sequence as set forth in SEQ ID NO: 75; linker 23 - GS linker, a sequence as set forth in SEQ ID NO: 127; GFP11, a sequence as set forth in SEQ ID NO: 75; Linker 24 - GFP11 and NLS), a sequence as set forth in SEQ ID NO: 146; BPSV40 NLS, a sequence as set forth in SEQ ID NO: 130; Linker 26 - GS linker, a sequence as set forth in SEQ ID NO: 148; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; TALE HPT15, a sequence as set forth in SEQ ID NO: 35; HAtag, a sequence as set forth in SEQ ID NO: 133; linker 5 - GS linker, a sequence as set forth in SEQ ID NO: 87; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; linker 10 - XTEN 16 linker 2, a sequence as set forth in SEQ ID NO: 92; Zim3 Krab, a sequence as set forth in SEQ ID NO: 132; P2A, a sequence as set forth in SEQ ID NO: 141; c-myc NLS, a sequence as set forth in SEQ ID NO: 129; DNMT3A, a sequence as set forth in SEQ ID NO: 131; linker 3 - flexible peptide linker, a sequence as set forth in SEQ ID NO: 85; hDNMT3L, a sequence as set forth in SEQ ID NO: 45;c-myc NLS, a sequence as set forth in SEQ ID NO: 129; DNMT3A, a sequence as set forth in SEQ ID NO: 131; linker3-flexible peptide linker, a sequence as set forth in SEQ ID NO: 85; DNMT3L-CD, a sequence as set forth in SEQ ID NO: 44; linker4-XTEN 80linker 1, a sequence as set forth in SEQ ID NO: 86; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; GFP1-10, a sequence as set forth in SEQ ID NO: 78.

[0903] V25_DNMT3A-DNMT3L-XTEN80-TALE HPT15-XTEN16-Krab (SEQ ID NO: 25)

[0904] c-myc NLS, a sequence as set forth in SEQ ID NO: 129; DNMT3A, a sequence as set forth in SEQ ID NO: 131; linker3-flexible peptide linker, a sequence as set forth in SEQ ID NO: 85; DNMT3L-CD, a sequence as set forth in SEQ ID NO: 44; linker4-XTEN 80linker 1, a sequence as set forth in SEQ ID NO: 86; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; HPT15, a sequence as set forth in SEQ ID NO: 35; HA tag, a sequence as set forth in SEQ ID NO: 133; linker5-GS linker, a sequence as set forth in SEQ ID NO: 87; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; linker11-XTEN 16linker 1, a sequence as set forth in SEQ ID NO: 93; KRAB, a sequence as set forth in SEQ ID NO: 48.

[0905] V26_DNMT3A-hDNMT3L-XTEN80-TALE HPT15-XTEN16-Zim3 (SEQ ID NO: 26)

[0906] c-myc NLS, a sequence as set forth in SEQ ID NO: 129; DNMT3A, a sequence as set forth in SEQ ID NO: 131; linker3 - flexible peptide linker, a sequence as set forth in SEQ ID NO: 85; hDNMT3L, a sequence as set forth in SEQ ID NO: 45; linker4 - XTEN80linkerl, a sequence as set forth in SEQ ID NO: 86; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; HPT15, a sequence as set forth in SEQ ID NO: 35; HAtag, a sequence as set forth in SEQ ID NO: 133; linker5 - GS linker, a sequence as set forth in SEQ ID NO: 87; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; linkerll - XTEN16linkerl, a sequence as set forth in SEQ ID NO: 93; Zim3 Krab, a sequence as set forth in SEQ ID NO: 132.

[0907] V27_DNMT3A-hDNMT3L-XTEN80-ZIM3-XTEN80-TALE HPT21 (SEQ ID NO: 27)

[0908] c-myc NLS, a sequence as set forth in SEQ ID NO: 129; DNMT3A, a sequence as set forth in SEQ ID NO: 131; linker3 - flexible peptide linker, a sequence as set forth in SEQ ID NO: 85; hDNMT3L, a sequence as set forth in SEQ ID NO: 45; linker4 - XTEN80linkerl, a sequence as set forth in SEQ ID NO: 86; Zim3 Krab, a sequence as set forth in SEQ ID NO: 132; linkerl5 - fused XTENlinkerl, a sequence as set forth in SEQ ID NO: 119; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; TALE HPT21, a sequence as set forth in SEQ ID NO: 36; HAtag, a sequence as set forth in SEQ ID NO: 133; linker5 - GS linker, a sequence as set forth in SEQ ID NO: 87; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; sv40 NLS, a sequence as set forth in SEQ ID NO: 128.

[0909] V28_DNMT3A-DNMT3L-scFv-2a-1xGCN4-TALE HPT21-KRAB (SEQ ID NO: 28)

[0910] c-myc NLS, the sequence set forth in SEQ ID NO: 129; DNMT3A, the sequence set forth in SEQ ID NO: 131; linker3 -flexible peptide linker, the sequence set forth in SEQ ID NO: 85; DNMT3L-CD, the sequence set forth in SEQ ID NO: 44; linker4 -XTEN 80linker 1, the sequence set forth in SEQ ID NO: 86; scFv, the sequence set forth in SEQ ID NO: 140; HA tag, the sequence set forth in SEQ ID NO: 133; linker 17-GS linker, the sequence set forth in SEQ ID NO: 121; P2A, the sequence set forth in SEQ ID NO: 141; c-myc NLS, the sequence set forth in SEQ ID NO: 129; linker 18-GS linker, the sequence set forth in SEQ ID NO: 122; GCN4, the sequence set forth in SEQ ID NO: 74; linker7 -GS linker, the sequence set forth in SEQ ID NO: 89; sv40 NLS, the sequence set forth in SEQ ID NO: 128; TALE HPT21, the sequence set forth in SEQ ID NO: 36; HA tag, the sequence set forth in SEQ ID NO: 133; linker5 -GS linker, the sequence set forth in SEQ ID NO: 87; sv40 NLS, the sequence set forth in SEQ ID NO: 128; sv40 NLS, the sequence set forth in SEQ ID NO: 128; linker10 -XTEN 16linker 2, the sequence set forth in SEQ ID NO: 92; KRAB, the sequence set forth in SEQ ID NO: 48.

[0911] V29_DNMT3A-DNMT3L-XTEN80-TALE HPT21-XTEN16-Krab (SEQ ID NO: 29)

[0912] c-myc NLS, a sequence as set forth in SEQ ID NO: 129; DNMT3A, a sequence as set forth in SEQ ID NO: 131; linker3 - flexible peptide linker, a sequence as set forth in SEQ ID NO: 85; DNMT3L-CD, a sequence as set forth in SEQ ID NO: 44; linker4 - XTEN 80linker 1, a sequence as set forth in SEQ ID NO: 86; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; HPT21, a sequence as set forth in SEQ ID NO: 36; HA tag, a sequence as set forth in SEQ ID NO: 133; linker5 - GS linker, a sequence as set forth in SEQ ID NO: 87; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; linker11 - XTEN 16linker 1, a sequence as set forth in SEQ ID NO: 93; KRAB, a sequence as set forth in SEQ ID NO: 48.

[0913] V30_DNMT3A-hDNMT3L-XTEN80-ZIM3-XTEN80-TALE HPT25 (SEQ ID NO: 30)

[0914] c-myc NLS, a sequence as set forth in SEQ ID NO: 129; DNMT3A, a sequence as set forth in SEQ ID NO: 131; linker3 - flexible peptide linker, a sequence as set forth in SEQ ID NO: 85; hDNMT3L, a sequence as set forth in SEQ ID NO: 45; linker4 - XTEN 80linker 1, a sequence as set forth in SEQ ID NO: 86; Zim3 Krab, a sequence as set forth in SEQ ID NO: 132; linker 15 - fused XTEN linker 1, a sequence as set forth in SEQ ID NO: 119; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; TALE HPT25, a sequence as set forth in SEQ ID NO: 39; HA tag, a sequence as set forth in SEQ ID NO: 133; linker5 - GS linker, a sequence as set forth in SEQ ID NO: 87; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; sv40 NLS, a sequence as set forth in SEQ ID NO: 128.

[0915] V31_DNMT3A-DNMT3L-scFv-2a-lxGCN4-TALE HPT25-KRAB (SEQ ID NO: 31)

[0916] c-myc NLS, a sequence as set forth in SEQ ID NO: 129; DNMT3A, a sequence as set forth in SEQ ID NO: 131; linker3 -flexible peptide linker, a sequence as set forth in SEQ ID NO: 85; DNMT3L-CD, a sequence as set forth in SEQ ID NO: 44; linker4 -XTEN 80linker 1, a sequence as set forth in SEQ ID NO: 86; scFv, a sequence as set forth in SEQ ID NO: 140; HA tag, a sequence as set forth in SEQ ID NO: 133; linker 17-GS linker, a sequence as set forth in SEQ ID NO: 121; P2A, a sequence as set forth in SEQ ID NO: 141; c-myc NLS, a sequence as set forth in SEQ ID NO: 129; linker 18-GS linker, a sequence as set forth in SEQ ID NO: 122; GCN4, a sequence as set forth in SEQ ID NO: 74; linker7-GS linker, a sequence as set forth in SEQ ID NO: 89; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; TALE HPT25, a sequence as set forth in SEQ ID NO: 39; HA tag, a sequence as set forth in SEQ ID NO: 133; linker5-GS linker, a sequence as set forth in SEQ ID NO: 87; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; linker10-XTEN 16linker 2, a sequence as set forth in SEQ ID NO: 92; KRAB, a sequence as set forth in SEQ ID NO: 48.

[0917] V32_DNMT3A-DNMT3L-XTEN80-TALE HPT25-XTEN16-Krab (SEQ ID NO: 32)

[0918] c-myc NLS, a sequence as set forth in SEQ ID NO: 129; DNMT3A, a sequence as set forth in SEQ ID NO: 131; linker3 - flexible peptide linker, a sequence as set forth in SEQ ID NO: 85; DNMT3L-CD, a sequence as set forth in SEQ ID NO: 44; linker4 - XTEN80linkerl, a sequence as set forth in SEQ ID NO: 86; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; TALE HPT11, a sequence as set forth in SEQ ID NO: 149; HA tag, a sequence as set forth in SEQ ID NO: 133; linker5 - GS linker, a sequence as set forth in SEQ ID NO: 87; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; linkerl l - XTEN16linkerl, a sequence as set forth in SEQ ID NO: 93; KRAB, a sequence as set forth in SEQ ID NO: 48.

[0919] V33_DNMT3A-DNMT3L-XTEN80-TALE HPT11-XTEN16-Krab (SEQ ID NO: 33)

[0920] c-myc NLS, a sequence as set forth in SEQ ID NO: 129; DNMT3A, a sequence as set forth in SEQ ID NO: 131; linker3 - flexible peptide linker, a sequence as set forth in SEQ ID NO: 85; DNMT3L-CD, a sequence as set forth in SEQ ID NO: 44; linker4 - XTEN80linkerl, a sequence as set forth in SEQ ID NO: 86; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; TALE HPT11, a sequence as set forth in SEQ ID NO: 149; HA tag, a sequence as set forth in SEQ ID NO: 133; linker5 - GS linker, a sequence as set forth in SEQ ID NO: 87; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; linkerl l - XTEN16linkerl, a sequence as set forth in SEQ ID NO: 93; KRAB, a sequence as set forth in SEQ ID NO: 48.

[0921] V34_DNMT3A-DNMT3L-XTEN80-TALE HPT13-XTEN16-Krab (SEQ ID NO: 34)

[0922] c-myc NLS, a sequence as set forth in SEQ ID NO: 129; DNMT3A, a sequence as set forth in SEQ ID NO: 131; linker3-flexible peptide linker, a sequence as set forth in SEQ ID NO: 85; DNMT3L-CD, a sequence as set forth in SEQ ID NO: 44; linker4-XTEN 80linker 1, a sequence as set forth in SEQ ID NO: 86; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; TALE HPT13, a sequence as set forth in SEQ ID NO: 150; HAtag, a sequence as set forth in SEQ ID NO: 133; linker5-GS linker, a sequence as set forth in SEQ ID NO: 87; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; sv40 NLS, a sequence as set forth in SEQ ID NO: 128; linker11-XTEN 16linker 1, a sequence as set forth in SEQ ID NO: 93; KRAB, a sequence as set forth in SEQ ID NO: 48.

[0923] Without wishing to be bound by any theory, the following examples are merely intended to illustrate the epigenetic editing agents, the preparation methods and uses of the present application, and are not intended to limit the scope of the present application.

[0924] Examples

[0925] Example 1

[0926] Animal experiments of the inhibitory effect of the epigenetic editing agents of the present application on PCSK9 gene expression

[0927] Different versions of epigenetic editing tools were transcribed into mRNA in vitro, and prepared into LNP according to the reference (LNP is from the literature: Musunuru, K., Chadwick, A. C., Mizoguchi, T. et al. In vivo CRISPR base editing of PCSK9 durably lowers cholesterol in primates. Nature 593, 429-434 (2021).). The prepared LNP was injected into mice through the tail vein, with a dose of 3 mg per kg of body weight, and after 4 days of injection, blood was taken from the mouse cheek, and the content of PCSK9 protein in the blood was determined by Elisa. The PBS group is the control group injected with the same volume of PBS. As can be seen from the results shown in Figure 1, compared with the control group, the epigenetic editing agent provided by the present application has a very significant inhibitory effect on the expression of the PCSK9 gene, with a maximum inhibition rate of about 96%.

[0928] Example 2

[0929] Cellular experiment of the inhibitory effect of the epigenetic editing agent of the present application on the expression of the PCSK9 gene

[0930] Different versions of tools were transcribed into mRNA in vitro, and transfected into Huh7 cells by Lipofectamine TM MessengerMAX TM Transfection reagent (item number LMRNA015) was transfected into Huh7 cells according to the product manual. Cell RNA was extracted 72 hours after transfection and qPCR was performed, and by comparing with the expression amount of the internal reference gene GAPDH, the expression amount of PCSK9 of different versions relative to the group only adding transfection reagent (NC) was calculated.

[0931] As can be seen from the results shown in Figures 2-3, compared with the control group, the epigenetic editing agent provided by the present application has a very significant inhibitory effect on the expression of the PCSK9 gene. (The primers used are GAPDH-F

[0932] GGAGCGAGATCCCTCCAAAAT (SEQ ID NO: 188)

[0933] GAPDH-R GGCTGTTGTCATACTTCTCATGG (SEQ ID NO: 189)

[0934] PCSK9-F AGACCCACCTCTCGCAGTC (SEQ ID NO: 190)

[0935] PCSK9-R GGAGTCCTCCTCGATGTAGTC (SEQ ID NO: 191)

[0936] Example 3

[0937] Animal experiment of the epigenetic editing agent of the present application on the inhibition of PCSK9 gene expression

[0938] Different versions of the tool were transcribed into mRNA in vitro, and LNP was prepared according to the reference (Musunuru, K., Chadwick, A. C., Mizoguchi, T. et al. In vivo CRISPR base editing of PCSK9 durably lowers cholesterol in primates. Nature 593, 429-434 (2021).). The prepared LNP was injected into the mouse body through the tail vein, and the injection dose was 1 mg per kg of body weight. After 7 days of injection, blood was taken from the mouse cheek, and the content of PCSK9 protein in the blood was determined by Elisa. The NC group is the control group injected with the same volume of PBS.

[0939] As can be seen from Figure 4, in mice, compared with the control group, the epigenetic editing agent provided by the present application has a very significant inhibitory effect on the expression of the PCSK9 gene.

Claims

1. An epigenetic editing agent comprising a transcription activator-like effector (TALE) domain, at least one epigenetic modification domain, and at least one transcriptional regulatory domain, wherein: 1) The TALE domain, the at least one epigenetic modification domain, and the at least one transcriptional regulatory domain are directly or indirectly connected; or 2) The TALE domain, the at least one epigenetic modification domain, and at least one recruitment domain A are directly or indirectly connected to form a first fusion, and the at least one transcriptional regulatory domain is directly or indirectly connected to at least one recruitment domain A' to form a second fusion; or 3) The TALE domain, the at least one transcriptional regulatory domain, and the at least one recruitment domain A are directly or indirectly connected to form a first fusion, and the at least one epigenetic modification domain is directly or indirectly connected to the at least one recruitment domain A' to form a second fusion; Furthermore, recruitment domains A and A' described in 2) and 3) can interact to enable a fusion of the first fusion and the second fusion, or a portion thereof, to be recruited to the vicinity of the other fusion.

2. The epigenetic editing agent according to claim 1, wherein the epigenetic modification domain is selected from: DNA deamination activity, DNA methyltransferase activity, DNA demethylase activity, DNA amination activity, DNA oxidation activity, DNA helicase activity, histone acetyltransferase activity, histone deacetylase activity, histone methyltransferase activity, histone demethylase activity, histone kinase activity, histone phosphatase activity, histone ubiquitin ligase activity, and histone deubiquitination activity.

3. The epigenetic editing agent according to claim 1 or 2, wherein the epigenetic modification domain comprises DNA methyltransferase (DNMT) and / or its functionally active fragment.

4. The epigenetic editing agent according to claim 3, wherein the DNA methyltransferase is selected from DNMT3A, DNMT3B, DNMT3C, DNMT1, DNMT2 and DNMT3L.

5. The epigenetic editing agent according to any one of claims 1-4, wherein the epigenetic modification domain comprises a plurality of DNA methyltransferases and / or their functionally active fragments, and the plurality of DNA methyltransferases and / or their functionally active fragments are linked by adapter sequences.

6. The epigenetic editing agent according to any one of claims 1-5, wherein the epigenetic modification domain comprises at least one DNMT3A and at least one DNMT3L.

7. The epigenetic editing agent according to any one of claims 3-5, wherein the DNA methyltransferase comprises the amino acid sequence shown in any one of SEQ ID NOs:42-47, 131.

8. The epigenetic editing agent according to any one of claims 1-7, wherein the epigenetic modification domain comprises DNMT3A and DNMT3L, and the C-terminus of DNMT3A is connected to the N-terminus of DNMT3L, or the C-terminus of DNMT3L is connected to the N-terminus of DNMT3A.

9. The epigenetic editing agent according to any one of claims 1-8, wherein the transcriptional regulatory domain is a transcriptional activation domain or a transcriptional repressor domain.

10. The epigenetic editing agent according to claim 9, wherein the transcriptional repressor domain is selected from: KRAB, ZIM3 KRAB, ZNF680, ZNF554, ZNF264, ZNF582, ZNF324, ZNF669, ZNF354A, ZNF82, ZNF595, ZNF419, ZNF566, ZIM2, EHMT2, SUV39H1, ZFPM1, TRIM28, EZH2, MXD1, SID, LSD1, HP1a, HDAC3, ZNF436, ZNF257, ZNF675, ZNF490, ZNF320, ZNF331, ZNF816, ZNF41, ZNF189, ZNF528, ZNF543, ZNF140, ZNF610, ZNF350, ZNF8, ZNF30, ZNF98, ZNF677, ZNF596, ZNF214, ZNF37A, ZNF34, ZNF250, ZNF547, ZNF273, ZFP82, ZNF224, ZNF33A, ZNF45, ZNF175, ZNF184, ZFP28-1, ZFP28-2, ZNF18, ZNF213, ZNF394, ZFP1, ZFP14, ZNF416, ZNF557, ZNF729, ZNF254, ZNF764, ZNF785, ZNF10, CBX5, RYBP, YAF2, MGA, CBX1, SCMH1, MPP8, SUMO3, HERC2, BIN1, PCGF2, TOX, FOXA1, FOXA2, IRF2BP1, IRF2BP2, IRF2BPLIRF-2BP1_2N-terminal domain, HOXA13, HOXB13, HOXC13, HOXA11, HOXC11, HOXC10, HOXA10, HOXB9, HOXA9, ZFP28, ZN334, ZN568, ZN37A, ZN181, ZN510, ZN862, ZN140, ZN208, ZN248, ZN571, ZN699, ZN726, ZIK1, ZNF2, Z705F, ZNF14, ZN471, ZN624, ZNF84, ZNF7, ZN891, ZN337, Z705G, ZN529, ZN729, ZN419, Z705A, ZN302, ZN486, ZN621, ZN688, ZN33A, ZN554, ZN878, ZN772, ZN224, ZN184, ZN544, ZNF57, ZN283, ZN549, ZN211, ZN615, ZN253, ZN226, ZN730, Z585A, ZN732, ZN681, ZN667, ZN649, ZN470, ZN484,ZN431,ZN382,ZN254,ZN124,ZN607,ZN317,ZN620,ZN141,ZN584,ZN540,ZN75D,ZN555,ZN658,ZN684,RBAK,ZN829,ZN582,ZN112,ZN716,HKR1,ZN350,ZN480,ZN416,ZNF92,ZN100,ZN736,ZNF74,ZN443,ZN195,ZN530,ZN782,ZN791,ZN331,Z354C,ZN157,ZN727,ZN550,ZN793,ZN235,ZN724,ZN573,ZN577,ZN789,ZN718,ZN300,ZN383,ZN429,ZN677,ZN850,ZN454,ZN257,ZN264,ZN485,ZN737,ZNF44,ZN596,ZN565,ZN543,ZFP69,SUMO1,ZNF12,ZN169,ZN433,ZN175,ZN347,ZNF25,ZN519,Z585B,ZN517,ZN846,ZN230,ZNF66,ZN713,ZN816,ZN426,ZN674,ZN627,ZNF20,Z587B,ZN316,ZN233,ZN611,ZN556,ZN234,ZN560,ZNF77,ZN682,ZN614,ZN785,ZN445,ZFP30,ZN225,ZN551,ZN610,ZN528,ZN284,ZN418,ZN490,ZN805,Z780B,ZN763,ZN285,ZNF85,ZN223,ZNF90,ZN557,ZN425,ZN229,ZN606,ZN155,ZN222,ZN442,ZNF91,ZN135,ZN778,ZN534,ZN586,ZN567,ZN440,ZN583,ZN441,ZNF43,ZN589,ZN563,ZN561,ZN136,ZN630,ZN527,ZN333,Z324B,ZN786,ZN709,ZN792,ZN599,ZN613,ZF69B,ZN799,ZN569,ZN564,ZN546,ZFP92,ZN723,ZN439,ZFP57,ZNF19,ZN404,ZN274,CBX3,ZN250,ZN570,ZN675,ZN695,ZN548,ZN132,ZN738,ZN420,ZN626,ZN559,ZN460,ZN268,ZN304,ZN605,ZN844,SUMO5,ZN101,ZN783,ZN417,ZN182,ZN823,ZN177,ZN197,ZN717,ZN669,ZN256,ZN251,CBX4,CDY2,CDYL2,ZN562,ZN461,Z324A,ZN766,ID2,ZN214,CBX7,ID1,CREM,SCX,ASCL1,ZN764,SCML2,TWST1,CREB1,TERF1,ID3,CBX8,GSX1,NKX22,ATF1,TWST2,ZNF17,TOX3,TOX4,ZMYM3,I2BP1,RHXF1,SSX2,I2BPL,ZN680,TRI68,HXA13,PHC3,TCF24,HXB13,HEY1,PHC2,ZNF81,FIGLA,SAM11,KMT2B,HEY2,JDP2,HXC13,ASCL4,HHEX,GSX2,ETV7,ASCL3,PHC1,OTP,I2BP2,VGLL2,HXA11,PDLI4,ASCL2,CDX4,ZN860,LMBL4,PDIP3,NKX25,CEBPB,ISL1,CDX2,PROP1,SIN3B,SMBT1,HXC11,HXC10,PRS6A,VSX1,NKX23,MTG16,HMX3,HMX1,KIF22,CSTF2,CEBPE,DLX2,PPARG,PRIC1,UNC4,BARX2,ALX3,TCF15,TERA,VSX2,HXD12,CDX1,TCF23,ALX1,HXA10,RX,CXXC5,SCML1,NFIL3,DLX6,MTG8,CEBPD,SEC13,FIP1,ALX4,LHX3,PRIC2,MAGI3,NELL1,PRRX1,MTG8R,RAX2,DLX3,DLX1,NKX26,NAB1,SAMD7,PITX3,WDR5,MEOX2,NAB2,DHX8,CBX6,EMX2,CPSF6,HXC12,KDM4B,LMBL3,PHX2A,EMX1,NC2B,DLX4,SRY,ZN777,ZN398,GATA3,BSH,SF3B4,TEAD1,TEAD3,RGAP1,PHF1,GATA2,FOXO3,ZN212,IRX4,ZBED6,LHX4,SIN3A,RBBP7,NKX61,R51A1,MB3L1,DLX5,NOTC1,TERF2,ZN282,RGS12,ZN840,SPI2B,PAX7,NKX62,ASXL2,FOXO1,GATA1,ZMYM5,LRP1,MIXL1,SGT1,LMCD1,CEBPA, SOX14, WTIP, PRP19, NKX11, RBBP4, DMRT2, SMCA2, and their functionally active fragments.

11. The epigenetic editing agent according to claim 9 or 10, wherein the transcriptional repressor domain comprises the amino acid sequence shown in any one of SEQ ID NOs:48-73, 132.

12. The epigenetic editing agent according to any one of claims 9-11, wherein the transcriptional repressor domain comprises a zinc finger-based transcription factor or a functionally active fragment thereof.

13. The epigenetic editing agent according to claim 12, wherein the zinc finger protein-based transcription factor is Related inhibitors (KRAB) or KRAB domains derived from ZIM3 (ZIM3 KRAB).

14. The epigenetic editing agent according to any one of claims 1-13, wherein the transcriptional regulatory domain comprises two or more of the zinc finger protein-based transcription factors or their functionally active fragments, wherein the two or more zinc finger protein-based transcription factors are of the same type or different types.

15. The epigenetic editing agent of claim 14, wherein the two or more zinc finger-based transcription factors are linked by a linker sequence.

16. The epigenetic editing agent according to claim 15, wherein the adapter sequence is an XTEN adapter sequence.

17. The epigenetic editing agent of claim 9, wherein the transcriptional repressor domain comprises a histone modification domain.

18. The epigenetic editing agent according to claim 9 or 17, wherein the histone modification domain is selected from: EZH2, HDAC3, HDAC1, EHMT2, PRMT1, PRMT5, SETDB1, hSIRT1, HP1a, LSD1, and their functionally active fragments.

19. The epigenetic editing agent according to any one of claims 1-18, wherein the TALE domain comprises the amino acid sequence of any one of SEQ ID NO: 35-41, 134-136, 142, 144-145, 149-150.

20. The epigenetic editing agent according to any one of claims 1-19, wherein it is a fusion peptide.

21. The epigenetic editing agent according to any one of claims 1-20, wherein the epigenetic modification domain and the transcriptional regulatory domain are both located at the N-terminus or C-terminus of the TALE domain.

22. The epigenetic editing agent according to any one of claims 1-20, wherein the epigenetic modification domain and the transcriptional regulatory domain are located at the N-terminus and C-terminus of the TALE domain, respectively.

23. The epigenetic editing agent according to any one of claims 1-22, wherein the fusion peptide is sequentially linked from the N-terminus to the C-terminus to: 1) The epigenetic modification domain, the transcriptional regulatory domain, and the TALE domain; or 2) The transcriptional regulatory domain, the epigenetic modification domain, and the TALE domain; or 3) The TALE domain, the epigenetic modification domain, and the transcriptional regulatory domain; or 4) The TALE domain, the transcriptional regulatory domain, and the epigenetic modification domain; or 5) The epigenetic modification domain, the TALE domain, and the transcriptional regulatory domain; or 6) The transcriptional regulatory domain, the TALE domain, and the epigenetic modification domain.

24. The epigenetic editing agent according to any one of claims 1-23, wherein the fusion peptide is sequentially linked from the N-terminus to the C-terminus to: 1) One or a combination of DNMT3A and DNMT3L, one or more zinc finger-based transcription factors, and the TALE domain; or 2) One or more zinc finger protein-based transcription factors, one or a combination of DNMT3A and DNMT3L, and the TALE domain; or 3) One or a combination of the TALE domain, DNMT3A, and DNMT3L, and one or more zinc finger-based transcription factors; or 4) The TALE domain, one or more zinc finger-based transcription factors, and one or a combination of DNMT3A and DNMT3L; or 5) One or a combination of DNMT3A and DNMT3L, the TALE domain, and one or more zinc finger-based transcription factors; or 6) One or more zinc finger protein-based transcription factors, TALE domains, and one or a combination of DNMT3A and DNMT3L.

25. The epigenetic editing agent according to any one of claims 20-24, wherein the fusion peptide comprises the following domains: TALE-DNMT3A-DNMT3L-ZIM3 KRAB, TALE-ZIM3 KRAB-DNMT3L-DNMT3A, TALE-ZIM3 KRAB-DNMT3A-DNMT3L, ZIM3 KRAB-DNMT3A-DNMT3L-TALE, DNMT3A-DNMT3L-ZIM3 KRAB-TALE, DNMT3A-DNMT3L-ZNF324-TALE, DNMT3A-DNMT3L-ZNF419-TALE, DNMT3A-DNMT3L-TALE-EZH2, DNMT3 A-DNMT3L-TALE-HDAC3, DNMT3A-DNMT3L-TALE-HP1a, DNMT3A-DNMT3L-TALE-KRAB, DNMT3A-DNMT3L-TALE-ZIM3 KRAB, KRAB-DNMT3A-DNMT3L-TALE, DNMT3L-DNMT3A-TALE-KRAB, among which, - indicates that the structural domains of the fusion are directly and / or indirectly connected, and that the structural domains are arranged in order from the N end to the C end.

26. The epigenetic editing agent according to any one of claims 20-25, wherein the fusion peptide comprises the amino acid sequence of any one of SEQ ID NO: 1-10, 15-34 and 137-139.

27. The epigenetic editing agent according to any one of claims 1-19, wherein it is a complex peptide comprising the first fusion compound and the second fusion compound.

28. The epigenetic editing agent according to any one of claims 1-19 and 27, wherein the first fusion comprises, from the N-terminus to the C-terminus, an epigenetic modification domain, a TALE domain, and a recruitment domain A.

29. The epigenetic editing agent according to claim 28, wherein the second fusion comprises, from the N-terminus to the C-terminus, a transcriptional repressor domain and a recruitment domain A', or from the N-terminus to the C-terminus, a recruitment domain A' and a transcriptional repressor domain.

30. The epigenetic editing agent according to any one of claims 1-19 and 27, wherein the first fusion comprises, from the N-terminus to the C-terminus, a recruitment domain A, a TALE domain, and a transcriptional repressor domain.

31. The epigenetic editing agent according to claim 30, wherein the second fusion comprises, from the N-terminus to the C-terminus, an epigenetic modification domain and a recruitment domain A', or from the N-terminus to the C-terminus, a recruitment domain A' and an epigenetic modification domain.

32. The epigenetic editing agent according to any one of claims 27-31, wherein the complex peptide comprises the following characteristics: 1) The first fusion compound contains, from N-terminus to C-terminus, an epigenetic modification domain, a TALE domain, and a recruitment domain A; the second fusion compound contains, from N-terminus to C-terminus, a transcriptional repressor domain and a recruitment domain A'; or 2) The first fusion compound contains, from N-terminus to C-terminus, an epigenetic modification domain, a TALE domain, and a recruitment domain A; the second fusion compound contains, from N-terminus to C-terminus, a recruitment domain A' and a transcriptional repressor domain; or 3) The first fusion compound contains, from N-terminus to C-terminus, a recruitment domain A, a TALE domain, and a transcriptional repressor domain; the second fusion compound contains, from N-terminus to C-terminus, an epigenetic modification domain and a recruitment domain A'; or 4) The first fusion contains, from N-terminus to C-terminus, a recruitment domain A, a TALE domain, and a transcriptional repressor domain, while the second fusion contains, from N-terminus to C-terminus, a recruitment domain A' and an epigenetic modification domain.

33. The epigenetic editing agent according to any one of claims 1-32, wherein the recruitment domain A is selected from one of two groups of domains, and the recruitment domain A' is selected from the other of two groups of domains: 1) Universally controlled non-derepressor protein 4 (GCN4), a GFP11 fragment derived from splitting green fluorescent protein (GFP), or a GVKESLV polypeptide; and 2) Single-chain antibody (scFv), GFP1-10 fragments derived from split green fluorescent protein (GFP), or PDZ protein domain.

34. The epigenetic editing agent according to any one of claims 1-33, wherein: 1) One of the recruitment domains A and A' is a domain GCN4, and the other is a domain scFv; or 2) One of the recruitment domains A and A' is a GFP11 fragment, and the other domain is GFP1-10; or 3) One of the recruitment domains A and A' is GVKESLV, and the other of the domains is the PDZ protein domain.

35. The epigenetic editing agent according to any one of claims 27-34, wherein the complex peptide comprises the following characteristics: 1) One of the first fusion and the second fusion contains DNMT(3A-3L)-TALE-n×GCN4, and the other fusion contains a transcriptional repressor domain -scFv; or 2) One of the first fusion and the second fusion contains DNMT(3A-3L)-TALE-scFv, and the other fusion contains a transcriptional repressor domain -GCN4; or 3) One of the first fusion and the second fusion contains DNMT(3A-3L)-TALE-n×GFP11, and the other fusion contains a transcriptional repressor domain -GFP1-10; or 4) One of the first fusion and the second fusion contains DNMT(3A-3L)-TALE-GFP1-10, and the other fusion contains a transcriptional repressor domain-GFP11; or 5) One of the first fusion and the second fusion contains DNMT(3A-3L)-TALE-n×GCN4, and the other fusion contains an scFv-transcriptional repressor domain; or 6) One of the first fusion and the second fusion contains DNMT(3A-3L)-TALE-scFv, and the other fusion contains a GCN4-transcriptional repressor domain; or 7) One of the first fusion and the second fusion contains DNMT(3A-3L)-TALE-n×GFP11, and the other fusion contains a GFP1-10-transcriptional repressor domain; or 8) One of the first fusion and the second fusion contains DNMT(3A-3L)-TALE-GFP1-10, and the other fusion contains a GFP11-transcriptional repressor domain; in, DNMT(3A-3L) indicates that DNMT3A and DNMT3L are directly or indirectly connected in any order, and - indicates that the domains at both ends are directly or indirectly connected in order from the N end to the C end; n×GCN4 or n×GFP11 represent n copies of GCN4 connected by the adapter sequence or n copies of GFP11 connected by the adapter sequence, respectively, where n is selected from any integer from 1 to 20.

36. The epigenetic editing agent according to any one of claims 27-35, wherein the first fusion and / or the second fusion comprises the amino acid sequence of any one of SEQ ID NO: 11, 12, 102-105 and 110-114.

37. The epigenetic editing agent according to any one of claims 27-36, comprising the amino acid sequence shown in any one of SEQ ID NO: 15, 16 and 21-23.

38. The epigenetic editing agent according to any one of claims 27-34, wherein the complex peptide comprises the following characteristics: 1) One of the first fusion and the second fusion contains an n×GCN4-TALE-transcriptional repressor domain, and the other fusion contains DNMT(3A-3L)-scFv; or 2) One of the first fusion compound and the second fusion compound contains the scFv-TALE-transcriptional repressor domain, and the other fusion compound contains DNMT(3A-3L)-GCN4; or 3) One of the first fusion and the second fusion contains an n×GFP11-TALE-transcriptional repressor domain, and the other fusion contains DNMT(3A-3L)-GFP1-10; or 4) One of the first fusion and the second fusion contains a GFP1-10-TALE-transcriptional repressor domain, and the other fusion contains DNMT(3A-3L)-GFP11; or 5) One of the first fusion and the second fusion contains an n×GCN4-TALE-transcriptional repressor domain, and the other fusion contains scFv-DNMT(3A-3L); or 6) One of the first fusion and the second fusion contains the scFv-TALE-transcriptional repressor domain, and the other fusion contains GCN4-DNMT(3A-3L); or 7) One of the first fusion and the second fusion contains an n×GFP11-TALE-transcriptional repressor domain, and the other fusion contains GFP1-10-DNMT(3A-3L); or 8) One of the first fusion and the second fusion contains a GFP1-10-TALE-transcriptional repressor domain, and the other fusion contains a GFP11-DNMT(3A-3L); in, DNMT(3A-3L) indicates that DNMT3A and DNMT3L are directly or indirectly connected in any order, and - indicates that the domains at both ends are directly or indirectly connected in order from the N end to the C end; n×GCN4 or n×GFP11 represent n copies of GCN4 connected by the adapter sequence or n copies of GFP11 connected by the adapter sequence, respectively, where n is selected from any integer from 1 to 20.

39. The epigenetic editing agent according to any one of claims 27-34 and 38, wherein the first fusion and / or the second fusion comprises the amino acid sequence of any one of SEQ ID NO: 13, 14, 106-109 and 115-118.

40. The epigenetic editing agent according to any one of claims 27-34, 38 and 39, comprising the amino acid sequence shown in any one of SEQ ID NO: 17-20, 24, 28 and 31.

41. The epigenetic editing agent according to any one of claims 1-40, further comprising a nuclear localization signal and / or marker domain.

42. A nucleic acid encoding the epigenetic editing agent of any one of claims 1-41.

43. The nucleic acid of claim 42, comprising a first nucleic acid fragment encoding the first fusion compound and a second nucleic acid fragment encoding the second fusion compound, wherein the first nucleic acid fragment and the second nucleic acid fragment are linked by a nucleic acid fragment encoding a cleavage peptide.

44. The nucleic acid according to claim 43, wherein the cleavage peptide is a 2A peptide and / or IRES.

45. The nucleic acid according to claim 44, wherein the 2A peptide is selected from P2A, T2A, E2A and F2A.

46. ​​The nucleic acid according to any one of claims 42-45, wherein it is a recombinant vector.

47. The nucleic acid according to any one of claims 42-46, comprising the sequence shown in any one of SEQ ID NO:151-187.

48. The nucleic acid according to any one of claims 46-47, wherein the recombinant vector further comprises a non-coding region.

49. The nucleic acid according to claim 48, wherein the non-coding region is selected from introns, regulatory elements, promoters, enhancers, termination sequences, and 5' and 3' untranslated regions.

50. A delivery vector comprising an epigenetic editing agent according to any one of claims 1-41 and / or a nucleic acid according to any one of claims 42-49, and optionally comprising liposomes and / or lipid nanoparticles.

51. A composition comprising the epigenetic editing agent of any one of claims 1-41, the nucleic acid of any one of claims 42-49, and / or the delivery vector of claim 50.

52. A cell comprising the epigenetic editing agent of any one of claims 1-41, the nucleic acid of any one of claims 42-49, the delivery vector of claim 50, and / or the composition of claim 51.

53. A kit comprising the epigenetic editing agent of any one of claims 1-41, the nucleic acid of any one of claims 42-49, the delivery vector of claim 50, the composition of claim 51, and / or the cells of claim 52.

54. A method for regulating the expression of a target gene, the method comprising administering an epigenetic editing agent according to any one of claims 1-41, a nucleic acid according to any one of claims 42-49, a delivery vector according to claim 50, a composition according to claim 51, a cell according to claim 52, and / or a kit according to claim 53.

55. The method of claim 54, wherein the method comprises introducing the epigenetic modifier, the nucleic acid, the delivery vector, the composition, the cell, and / or the kit into a cell containing the target gene.

56. The method of claim 54, the method comprising contacting the epigenetic modifier, the nucleic acid, the delivery vector, and / or the composition with the vicinity of the target gene and / or the regulatory element of the target gene.

57. The method according to claim 56, wherein the regulatory element comprises a core promoter, a proximal promoter, a distal enhancer, a silencer, an insulator element, a boundary element, and / or a locus control region.

58. A method for treating or alleviating a disease or symptom thereof associated with abnormal expression and / or abnormal activity of a target gene, the method comprising administering to a subject in need an effective amount of any one of claims 1-41, any one of claims 42-49, any one of claims 50, the delivery vector of claim 51, the composition of claim 51, the cell of claim 52, and / or the kit of claim 53.

59. Use of the epigenetic editing agent of any one of claims 1-41, the nucleic acid of any one of claims 42-49, the delivery vector of claim 50, the composition of claim 51, the cell of claim 52, and / or the kit of claim 53 for the preparation of a medicament for the treatment or relief of a disease or condition associated with abnormal expression and / or abnormal activity of a target gene.

Images