Method for analyzing activity of 5'-nuclease

Abstract

The present invention relates to a method for analyzing the activity of 5'-nuclease using two types of oligonucleotides: a dimer-forming primer pair and probes. Compared with conventional methods that use primers, templates, and probes, the present invention has fewer factors to be considered in design, thereby simplifying the design process. In addition, a dimer-primer and probe complex formed by hybridization of the dimer-forming primer pair and probes simulate the environment in which 5'-nuclease operates in PCR, and thus has high reliability and applicability of enzyme activity measured using the present invention. The present invention is simple and quick compared to conventional methods of determining units using radioisotopes, and greatly improves user convenience in terms of low cost and stability.

Description

Method for analyzing the activity of 5′ nuclease

[0001] Cross-reference to related applications

[0002] This patent application claims priority to Republic of Korea Patent Application No. 2024-0083097, filed with the Korean Intellectual Property Office on June 25, 2024, the disclosures of which are incorporated herein by reference.

[0003] Technology field

[0004] The present invention relates to a method for analyzing the activity of 5' nuclease or a composition for assaying the activity of 5' nuclease.

[0005]

[0006] Molecular diagnostics is an in vitro diagnostic technique that analyzes nucleic acids such as DNA or RNA, and is used to identify the presence of specific genes or viruses. The polymerase chain reaction (PCR), the most representative molecular diagnostic method, was invented by Kary B Mullis in 1983 and has undergone continuous development, playing a key role in the recent response to the COVID-19 pandemic. PCR requires a series of temperature fluctuations (mainly between 55°C and 95°C), making the use of enzymes that can maintain stability in these reaction environments crucial. For this reason, polymerases derived from hyperthermophiles that are stable at high temperatures are primarily used, such as Taq DNA polymerase from T. aquaticus. These enzymes facilitate stable reactions even in high-temperature environments, making PCR-based molecular diagnostics more accurate and efficient (Chien A., Edgar DB, Trela ​​JMJ Bacteriol. 1976, 127, 1550-1557).

[0007] Some DNA polymerases, including the TaqDNA polymerase described above, possess an ectohydrolase domain that degrades nucleic acids in addition to the polymerase domain that synthesizes new DNA strands. The ectohydrolase domain is divided into 5'-3' ectohydrolase and 3'-5' ectohydrolase depending on the direction of degradation. Among them, 5' ectohydrolase removes RNA primers present in the lagging strand during DNA replication or removes damaged nucleotides during DNA damage repair (Arthur Kornberg, Tania A. Baker, DNA replication. 1991). In particular, in PCR, this enzyme specifically degrades fluorescent probes, enabling precise and specific target detection in real time (Pamela M. Holland, Proc. Natl. Acad. Sci. USA, Vol. 88, pp. 7276-7280).

[0008] A method for quantitatively analyzing the activity of an exonuclease enzyme is generally based on the release of nucleotides from the end of DNA in a unit time at a unit temperature, resulting in an acid-soluble degradation product. The rate at which nucleotides become acid-soluble degradation products is defined as Unit, a unique property of the enzyme being measured. For example, T7 Exonuclease from New England Biolabs defines 1 Unit as the release of 1 nmol of nucleotides from target DNA in a state of acid-soluble degradation products at 37°C in 30 minutes. Similarly, lambda exonuclease and Exonuclease I define 1 Unit as the release of 10 nmol of nucleotides from target DNA in a state of acid-soluble degradation products under the same temperature and time conditions. Although the definition of Unit may vary depending on the company or product, such as temperature, amount of substrate, and type of material containing radioisotopes, they all use a common method of measuring the reaction rate by measuring substrate consumption or calculating the amount of acid-soluble decomposition product released.

[0009] Similarly, the activity of 5' nucleases could also be confirmed by measuring the rate at which nucleotides at the 5' end of the target DNA were released. Historically, radioactive isotopes have been mainly used to confirm the properties or activities of 5' nucleases (Richard S. Murante. J. Biol. Chem, Vol. 269, No. 2, Issue of January 14, pp. 1191-1196, 1994; Matthew J. Longley. Nucleic Acids Research, Vol. 18, No. 24 7317). Although this method boasts high accuracy, it has drawbacks such as experimental complexity, long operation time, environmental impact, and concerns about the health of the experimenter, so research to develop alternative methods has been actively underway. For example, a method was studied using MALDI-TOF MS to hybridize single-stranded DNA labeled with a fluorophore and a quencher, react with a polymerase, and then measure the rate at which nucleotides are released (Qiuying Huang, Molecular and Cellular Probes, 23, 2009, 188-194). There was also an attempt to measure the activity by analyzing the extent to which fluorescently labeled substrate DNA was degraded by an enzyme at a specific temperature over a certain period of time through electrophoresis, and quantitatively comparing the band areas.

[0010] The above-mentioned methods measure the efficiency of degradation of oligonucleotides complementarily hybridized to single-stranded templates such as M13mp2 and M13mp18 by 5'-nucleotide decomposition, and for this purpose, the amount of oligonucleotide 5'-end degradation per unit time is measured at the optimal activity temperature of the 5'-nucleotide decomposition. However, these methods could not be considered to have replaced the accuracy and quantitation of the existing activity measurement method using radioisotopes, or improved the convenience or efficiency. In addition, they had the disadvantage of not accurately reflecting the characteristics of 5'-nucleotide decomposition.

[0011] As described above, 5' nucleases play a role in degrading RNA primers in vivo and degrade fluorescently labeled probes during PCR, enabling the expression of specific signals in real time. Specifically, 5' nucleases degrade the 5' end of oligonucleotides hybridized to double-stranded nucleic acids. In particular, when 5' nucleases exist as part of nucleic acid polymerases, oligonucleotides must be present upstream of the target oligonucleotide, and they recognize specific structures in which the gap between the two nucleotides is approximately 0 nucleotides (Victor lyamichev. Proc. Natl. Acad. Sci. USA, Vol. 96, pp. 6143-6148). Therefore, in order to accurately measure the activity of 5' nucleases performed in vivo or during PCR, it is necessary to reflect these enzymatic characteristics.

[0012] Accordingly, the inventors of the present invention recognized the need for developing a method for analyzing the activity of 5' nuclease with high accuracy by reflecting these enzymatic characteristics.

[0013]

[0014] Numerous references and patents are cited and cited throughout this specification. The disclosures of these references and patents are incorporated herein by reference in their entirety to further clarify the state of the art and the scope of the present invention.

[0015]

[0016] The present inventors sought to develop a method for analyzing the activity of 5' nuclease, another activity of nucleic acid polymerase used in in vitro diagnostics, particularly molecular diagnostics such as PCR. As a result, they completed the present invention by confirming that the activity of the target 5' nuclease can be easily determined using a combination of dimer-forming primer pairs and probes.

[0017]

[0018] Accordingly, the purpose of the present invention is to provide a method for analyzing the activity of 5' nuclease.

[0019] Another object of the present invention is to provide an activity assay composition for 5' nuclease.

[0020]

[0021] Other objects and advantages of the present invention will become more apparent from the detailed description, claims and drawings below.

[0022]

[0023] Ⅰ. Method for analyzing the activity of 5' nuclease

[0024] According to one aspect of the present invention, the present invention provides a method for analyzing the activity of a 5' nuclease, comprising the following steps:

[0025] (a) providing a composition for activity assay comprising (i) a dimer-forming primer pair and (ii) probes; The dimer-forming primer pair comprises a first primer and a second primer, each of the first primer and the second primer comprising a 5'-probe-hybridizing region and a 3'-dimer-forming region in a 5' to 3' direction, the nucleotide sequence of the 3'-dimer-forming region in the first primer is complementary to the nucleotide sequence of the 3'-dimer-forming region in the second primer, the nucleotide sequence of the 5'-probe-hybridizing region of each of the first primer and the second primer is complementary to the nucleotide sequence of each of the probes, and a dimer-primer is formed through hybridization between the 3'-dimer-forming regions of the first primer and the second primer, and each of the probes is hybridized to the 5'-probe-hybridizing region of each of the first primer and the second primer, which are both strands of the dimer-primer. Forms a dimer-primer and probe complex, and

[0026] (b) adding the 5' nuclease to the active assay composition and incubating the resultant; the 5' ends of the probes of the dimer-primer and probe complex are degraded by the 5' nuclease, thereby providing a detectable signal;

[0027] (c) a step of measuring the signal provided over time; the change in the signal over time indicates the activity of the 5' nuclease.

[0028] The present inventors sought to develop a method for analyzing the activity of 5' nuclease, another nucleic acid polymerase used in in vitro diagnostics, particularly molecular diagnostics such as PCR. As a result, they confirmed that the activity of the target 5' nuclease can be easily determined using a combination of dimer-forming primer pairs and probes.

[0029] According to one embodiment of the present invention, the 5' nuclease is a primer-dependent 5' nuclease. This means that the 5' nuclease exhibits activity in the presence of a primer.

[0030] According to one embodiment of the present invention, the 5' nuclease is an exonuclease or an endonuclease.

[0031] According to one embodiment of the present invention, the 5' nuclease is a DNA polymerase or flap endonuclease (FEN) having 5' nuclease activity. More specifically, it is a thermostable DNA polymerase or flap endonuclease having 5' nuclease activity.

[0032] The DNA polymerase having the activity of 5' nuclease suitable for the present invention is a thermostable DNA polymerase obtained from various bacterial species, and the DNA polymerase is selected from the group consisting of Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis, Thermus antranikianii, Thermus caldophilus, Thermus chliarophilus, Thermus flavus, Thermus igniterrae, Thermus lacteus, Thermus oshimai, Thermus ruber, Thermus rubens, Thermus scotoductus, Thermus silvanus, Thermus speciesZ05, Thermus species sps 17, Thermus thermophilus, Thermotoga maritima, Thermotoga neapolitana, Thermosipho africanus, Thermococcus litoralis, Thermococcus barossi, Thermococcus gorgonarius, Thermotoga maritima, Thermotoga neapolitana, Thermosiphoafricanus, Pyrococcus woesei, Pyrococcus horikoshii, Pyrococcus abyssi, Pyrodictium occultum, Aquifex pyrophilus and Aquifex aeolieus. Most specifically, the thermostable DNA polymerase is Taq polymerase.

[0033] The flap endonuclease used is a 5'flap-specific nuclease.

[0034] Flap endonucleases suitable for the present invention include flap endonucleases obtained from various bacterial species, wherein the flap endonucleases are derived from bacteria selected from the group consisting of Sulfobus solfataricus, Pyrobaculum aerophilum, Thermococcus litoralis, Archaeaglobus veneficus, Archaeaglobus profundus, Acidianus brierlyi, Acidianus ambivalens, Desulfurococcus amylolyticus, Desulfurococcus mobilis, Pyrodictium brockii, Thermococcus gorgonarius, Thermococcus zilligii, Methanopyrus kandleri, Methanococcus igneus, Pyrococcus horikoshii, Aeropyrum pernix and Archaeaglobus veneficus.

[0035] Figure 1 is a flowchart of processes for implementing the method of the present invention according to one embodiment of the present invention. The method of the present invention is described with reference to Figure 1 as follows:

[0036] Step (a): Providing an active assay composition (110)

[0037] First, the method of the present invention comprises the steps of (a) providing a composition for activity assay comprising (i) a dimer-forming primer pair and (ii) probes. The dimer-forming primer pair comprises a first primer and a second primer, each of the first primer and the second primer comprising a 5'-probe-hybridizing region and a 3'-dimer-forming region in a 5' to 3' direction, the nucleotide sequence of the 3'-dimer-forming region in the first primer is complementary to the nucleotide sequence of the 3'-dimer-forming region in the second primer, the nucleotide sequence of the 5'-probe-hybridizing region of each of the first primer and the second primer is complementary to the nucleotide sequence of each of the probes, and a dimer-primer is formed through hybridization between the 3'-dimer-forming regions of the first primer and the second primer, and each of the probes is hybridized to the 5'-probe-hybridizing region of each of the first primer and the second primer, which are both strands of the dimer-primer. Forms a dimer-primer and probe complex.

[0038] An activity assay composition used in the present invention comprises (i) a dimer-forming primer pair and (ii) probes.

[0039] As used herein, the term "primer" refers to an oligonucleotide that can act as an initiation point for synthesis of a primer extension product complementary to a nucleic acid strand (template) under conditions that induce synthesis, i.e., the presence of nucleotides and a polymerizing agent such as DNA polymerase, and conditions of suitable temperature and pH. In particular, the primer is a single-stranded deoxyribonucleotide molecule. The primer used in the present invention may include naturally occurring dNMPs (i.e., dAMP, dGMP, dCMP, and dTMP), modified nucleotides, or non-natural nucleotides. In addition, a typical primer may include ribonucleotides.

[0040] The primer must be sufficiently long to prime the synthesis of an extension product in the presence of a polymerization agent. The appropriate primer length depends on several factors, including, for example, temperature, the application, and the source of the primer. As used herein, the terms "annealing" or "priming" refer to the juxtaposition of an oligodeoxynucleotide or nucleic acid to a template nucleic acid, which causes a polymerase to polymerize the nucleotides to form a nucleic acid molecule complementary to the template nucleic acid or a portion thereof.

[0041] The term "dimer-forming primer" as used herein means a primer that can partially hybridize with another dimer-forming primer, other than a template, under certain conditions and be extended in the presence of a nucleic acid polymerase.

[0042] However, the present invention analyzes the activity of a 5' nuclease by utilizing the formation of a dimer-forming primer pair and probes into a dimer-primer and probe complex, and the 5' nuclease degrading the 5' ends of the probes of the complex. Therefore, according to the present invention, primer extension is not required.

[0043] According to one embodiment of the present invention, the active assay composition does not contain dNTPs or NTPs.

[0044] Since the present invention does not require primer extension in analyzing the activity of a 5' nuclease, the activity assay composition does not contain dNTPs or NTPs.

[0045] The term "dimer-forming primer pair" as used herein means a pair of two primers that partially hybridize to each other, such as a first primer and a second primer.

[0046] The term "annealing" or "hybridization" as used in the context of dimer-forming primers means the apposition of the 3'-dimer forming region of the second primer to the 3'-dimer forming region of the first primer.

[0047] The dimer-forming primer pair used in the method of the present invention has the following characteristics:

[0048] (a) comprising a first primer and a second primer;

[0049] (b) each of the first primer and the second primer comprises a 5'-probe-hybridizing region and a 3'-dimer-forming region in the 5' to 3' direction; and

[0050] (c) The nucleotide sequence of the 3'-dimer-forming region in the first primer is complementary to the nucleotide sequence of the 3'-dimer-forming region in the second primer, and the nucleotide sequence of the 5'-probe-hybridizing region of each of the first primer and the second primer is complementary to the nucleotide sequence of each of the probes.

[0051] The dimer-forming primer pair used in the present invention comprises two primers, namely a first primer and a second primer. According to one embodiment of the present invention, the dimer-forming primer pair is composed of a first primer and a second primer.

[0052] As used herein, the terms "first primer" and "second primer" are intended to specify two distinct primers. It should be understood that these terms do not refer to specific primers and do not impart any particular order, meaning, preference, or the like to the primers. Furthermore, unless otherwise indicated, the terms "first primer" and "second primer" may be used interchangeably with "first dimer-forming primer" and "second dimer-forming primer."

[0053] In the dimer-forming primer pair used in the present invention, each of the first primer and the second primer includes a 5'-probe-hybridizing region and a 3'-dimer-forming region in the 5' to 3' direction.

[0054] As used herein, the term "5'-probe-hybridization region" refers to a region located at the 5' end of a dimer-forming primer, excluding the 3'-dimer-forming region, to which a probe can hybridize under specific hybridization conditions. The 5'-probe-hybridization region of a dimer-forming primer has a nucleotide sequence that is non-complementary to the 3'-dimer-forming region of another dimer-forming primer.

[0055] The term "non-complementary" means that the primer or probe is sufficiently non-complementary that it will not selectively hybridize to a target nucleic acid sequence under given annealing conditions or stringent conditions, and includes both "substantially non-complementary" and "perfectly non-complementary," and in particular means perfectly non-complementary. For example, with respect to the 5'-probe-hybridized region of a dimer-forming primer, the term "non-complementary" means that the 5'-probe-hybridized region of the dimer-forming primer is sufficiently non-complementary that it will not selectively hybridize to the entire sequence of another dimer-forming primer under given annealing conditions or stringent conditions, and includes both "substantially non-complementary" and "perfectly non-complementary," and in particular means perfectly non-complementary.

[0056] The term "3'-dimer forming region" as used herein refers to a region located at the 3' end of a dimer-forming primer, which can form a dimer by hybridizing with the 3'-dimer forming region of another dimer-forming primer under specific hybridization conditions. That is, the 3'-dimer forming region refers to a region at the 3' end of a dimer-forming primer having a nucleotide sequence that can hybridize with the 3'-dimer forming region of another dimer-forming primer.

[0057] As used herein, the term "hybridizing" refers to the formation of a double-stranded nucleic acid from complementary single-stranded nucleic acids. Hybridization can occur between two nucleic acid strands that are completely identical or substantially identical with some mismatch. The degree of complementarity for hybridization may vary depending on hybridization conditions, particularly temperature.

[0058] Hybridization between dimer-forming primers or hybridization with a probe in the 5'-probe-hybridization region of a dimer-forming primer can be performed under suitable hybridization conditions, which are generally determined by optimization procedures. Conditions such as temperature, concentration of components, number of hybridization and washing cycles, buffer components, and their pH and ionic strength can vary depending on various factors, including the length and GC content of the dimer-forming primer or probe. For example, when using a dimer-forming primer pair with a relatively short dimer-forming region, it is preferable to select low stringency conditions. Detailed hybridization conditions can be found in the literature [Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001); and M. L. M. Anderson, Nucleic Acid Hybridization, Springer-Verlag New York Inc. NY (1999)].

[0059] There is no difference between the terms "annealing" and "hybridization" and they will be used interchangeably.

[0060] According to the present invention, the first primer has a 3'-dimer-forming region at the 3' end, the second primer has a 3'-dimer-forming region at the 3' end, and the nucleotide sequence of the 3'-dimer-forming region of the first primer is complementary to the nucleotide sequence of the 3'-dimer-forming region of the second primer.

[0061] The term "complementary" or "complementarity" when used in reference to the 3'-dimer-forming region of the first primer and the second primer means that the 3'-dimer-forming region of the first primer is sufficiently complementary to selectively hybridize to the 3'-dimer-forming region of the second primer under certain annealing conditions or stringent conditions, and encompasses the terms "substantially complementary" and "perfectly complementary", specifically perfectly complementary.

[0062] In one embodiment of the present invention, the 3'-dimer-forming regions of the first primer and the second primer have nucleotide sequences that are substantially complementary to each other.

[0063] According to one embodiment of the present invention, each of the 3'-dimer-forming regions of the first primer and the second primer has at least one non-complementary nucleotide, as long as the non-complementary nucleotide does not significantly affect hybridization between the 3'-dimer-forming regions. For example, each of the 3'-dimer-forming regions of the first primer and the second primer may have 5, 4, 3, 2, or 1 non-complementary nucleotide, depending on its length.

[0064] According to the present invention, the first primer has a 5'-probe-hybridization region at the 5' end, the second primer has a 5'-probe-hybridization region at the 5' end, and the nucleotide sequence of the 5'-probe-hybridization region of each of the first primer and the second primer is complementary to the nucleotide sequence of each of the probes.

[0065] The term "complementary" or "complementarity" when used in reference to the 5'-probe-hybridizing regions of the first primer and the second primer means that the probes are sufficiently complementary to selectively hybridize to the 5'-probe-hybridizing regions of each of the first primer and the second primer under specific annealing conditions or stringent conditions, and encompasses the terms "substantially complementary" and "perfectly complementary", specifically perfectly complementary.

[0066] In one embodiment of the present invention, the 5'-probe-hybridizing region of each of the first primer and the second primer and each of the probes have nucleotide sequences that are substantially complementary to each other.

[0067] According to one embodiment of the present invention, the 5'-probe-hybridization region and the probe of each of the first primer and the second primer have at least one non-complementary nucleotide, as long as the non-complementary nucleotide does not significantly affect hybridization between the 5'-probe-hybridization region and the probe. For example, the 5'-probe-hybridization region and the probe of each of the first primer and the second primer may have 5, 4, 3, 2, or 1 non-complementary nucleotide, depending on its length.

[0068] The 5'-probe-hybridizing region of the first primer may be any sequence, as long as it has a sequence non-complementary to the 3'-dimer-forming region of the second primer. Similarly, the 5'-probe-hybridizing region of the second primer may be any sequence, as long as it has a sequence non-complementary to the 3'-dimer-forming region of the first primer.

[0069] The first primer and the second primer constituting the dimer-forming primer pair of the present invention do not require any specific length. In one embodiment, each of the first primer and the second primer is 7 to 100 nucleotides in length. In a specific embodiment, the length of the first primer and the second primer ranges from at least 7, 10, 15, 20, 30, 50, 60, or 80 nucleotides to at most 100, 80, 70, 60, 50, 40, 35, 30, 25, 20, 15, or 10 nucleotides. For example, each of the first primer and the second primer can be 7-40, 7-60, 7-80, 7-100, 10-40, 10-60, 10-80, 10-100, 15-40, 15-60, 15-80, 15-100, 20-40, 20-60, 20-80, 20-100, 30-40, 30-60, 30-80 or 30-100 nucleotides in length.

[0070] According to one embodiment of the present invention, each of the 5'probe-hybridizing regions of the first primer and the second primer is 3 to 50 nucleotides in length.

[0071] According to one embodiment of the present invention, each of the 3'-dimer-forming regions of the first primer and the second primer is 3 to 50 nucleotides in length.

[0072] In one embodiment of the present invention, the 5'-probe-hybridizing region or the 3'-dimer-forming region of each of the first primer and the second primer is 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 40 or 50 nucleotides in length.For example, the 5'-probe-hybridizing region or 3'-dimer-forming region of each of the first primer and the second primer may be 3-50, 3-40, 3-35, 3-30, 3-25, 3-20, 3-17, 3-15, 3-12, 3-10, 3-9, 3-8, 3-7, 3-6, 3-5, 3-4, 4-50, 4-40, 4-35, 4-30, 4-25, 4-20, 4-17, 4-15, 4-12, 4-10, 4-9, 4-8, 4-7, 4-6, 4-5, 5-50, 5-40, 5-35, 5-30, 5-25, 5-20, 5-17, 5-15, 5-12, 5-10, 5-9, 5-8, 5-7, 5-6, 6-50, 6-40, 6-35, 6-30, 6-25, 6-20, 6-17, 6-15, 6-14, 6-13, 6-12, 6-11, 6-10, 6-9, 6-8, 6-7, 7-50, 7-40, 7-35, 7-30, 7-25, 7-20, 7-19, 7-18, 7-17, 7-16, 7-15, 7-14, 7-13, 7-12, 7-11, 7-10, 7-9, 7-8, 8-50, 8-40, 8-35, 8-30, 8-25, 8-20, 8-17, 8-15, 8-12, 8-10, 8-9, 9-50, 9-40, 9-35, 9-30, 9-25, 9-20, 9-17, 9-15, 9-12, 9-10, 10-50, 10-40, 10-35, 10-30, 10-25, 10-20, 10-17, 10-15, 10-12, 12-50, 12-40, 12-35, 12-30, 12-25, 12-20, 12-17, It may be 12-15, 15-50, 15-40, 15-35, 15-30, 15-25, 15-20, 15-17 or 17-20 nucleotides in length. In certain embodiments, the 5'-probe-hybridizing region or the 3'-dimer-forming region of each of the first primer and the second primer is 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides or 10 nucleotides in length.

[0073] The length of the 5'-probe-hybridization region of the first primer and the second primer described above refers to the range from the nucleotide at the 5' end (including the nucleotide at the 5' end) to a specific nucleotide in the 3' direction. For example, when the 5'-probe-hybridization region is 5 nucleotides in length, the 5'-probe-hybridization region ranges from the first nucleotide at the 5' end to the fifth nucleotide (including the first and fifth nucleotides).

[0074] The length of the 3'-dimer-forming region of the first primer and the second primer described above refers to the range from the nucleotide at the 3' end (including the nucleotide at the 3' end) to a specific nucleotide in the 5' direction. For example, if the 3'-dimer-forming region is 5 nucleotides in length, the 3'-dimer-forming region is the range from the first nucleotide at the 3' end to the fifth nucleotide (including the first and fifth nucleotides).

[0075] The first primer and the second primer constituting the dimer-forming primer pair may be composed of naturally occurring dNMPs. Alternatively, the first primer and the second primer may comprise modified nucleotides or non-natural nucleotides, such as Peptide Nucleic Acid (PNA, see PCT Application No. WO 92 / 20702) and Locked Nucleic Acid (LNA, see PCT Application Nos. WO 98 / 22489, WO 98 / 39352, and WO 99 / 14226). The first primer and the second primer may comprise universal bases such as deoxyinosine, inosine, 1-(2'-deoxy-beta-D-ribofuranosyl)-3-nitropyrrole, and 5-nitroindole. The term "universal base" means that it can form base pairs with each of the natural DNA / RNA bases almost indiscriminately.

[0076] The modified nucleotide, non-natural nucleotide, or universal base may be present continuously or non-continuously within the dimer-forming primer. The number of the modified nucleotide, non-natural nucleotide, or universal base may be 1-8, 1-5, 1-3, or 1-2. The modified nucleotide, non-natural nucleotide, or universal base may be present at any position within the dimer-forming primer. In one embodiment of the present invention, the modified nucleotide, non-natural nucleotide, or universal base may be located in the 5'-probe-hybridizing region, the 3'-dimer-forming region, or both. The sequences located on the left and right of the modified nucleotide, non-natural nucleotide, or universal base are complementary to each other and can hybridize with each other to form a stem structure.

[0077] The first primer and / or the second primer constituting the dimer-forming primer pair used in the present invention may comprise a labeling system suitable for the selected signaling method.

[0078] The signaling scheme and labeling system for the first primer and / or the second primer are described in detail in step (b).

[0079] An activity assay composition used in the present invention comprises probes.

[0080] The term "probe" as used herein refers to a single-stranded nucleic acid molecule comprising a portion or portions complementary to a target nucleic acid sequence. In particular, according to the present invention, the probes included in the active assay composition represent single-stranded nucleic acid molecules that hybridize to the 5'probe-hybridization region of each of the first primer and the second primer.

[0081] The probe used in the present invention may have a conventional probe structure consisting of a sequence that hybridizes to the 5'probe-hybridization region of each of the first primer and the second primer.

[0082] Alternatively, the probe used in the present invention may have a unique structure. For example, the probe used in the present invention may have the structure of a molecular beacon probe, a high-beacon probe, a tagging probe, and a PTO probe (see WO 2012 / 096523).

[0083] The probe used in the present invention may be a conventional probe or a modified probe such as a degenerate base-containing probe and / or a universal base-containing probe. The term "conventional probe" as used herein refers to a general probe that does not introduce a degenerate base or an unnatural base.

[0084] Degenerate bases that can be introduced into the primer as well as the probe include various degenerate bases known in the art: R: A or G; Y: C or T; S: Gor C; W: A or T; K: G or T; M: A or C; B: C or G or T; D: A or G or T; H: A or C or T; V: A or C or G; N: A or C or G or T. Universal bases that can be introduced into the primer as well as the probe include various universal bases known in the art: deoxyinosine, inosine, 7-diaza-2'-deoxyinosine, 2-aza-2'-deoxyinosine, 2'-OMe inosine, 2'-F inosine, deoxy 3-nitropyrrole, 3-nitropyrrole, 2'-OMe 3-nitropyrrole, 2'-F 3-nitropyrrole, 1-(2'-deoxy-beta-D-ribofuranosyl)-3-nitropyrrole, deoxy 5-nitropyrrole, 5-nitroindole, 2'-OMe 5-nitroindole, 2'-F 5-nitroindole, deoxy 4-nitrobenzimidazole, 4-nitrobenzimidazole, deoxy 4-Aminobenzimidazole, 4-Aminobenzimidazole, Deoxynebularine, 2'-F nebularine, 2'-F 4-nitrobenzimidazole, PNA-5-introindole, PNA-nebularine, PNA-inosine, PNA-4-nitrobenzimidazole, PNA-3-nitropyrrole, Morpholino-5-nitroindole, Morpholino-nebularine, Morpholino-inosine, Morpholino-4-nitrobenzimidazole, Morpholino-3-nitropyrrole, Phosphoramidate-5-nitroindole, Phosphoramidate-nebularine, Phosphoramidate-inosine, Phosphoramidate-4-nitrobenzimidazole, Phosphoramidate-3-nitropyrrole, 2'-0-methoxyethylinosine, 2'-0-methoxyethyl nebularine, 2'-0-methoxyethyl 5-nitroindole, 2'-0-methoxyethyl 4-nitro-benzimidazole, 2'-0-methoxyethyl 3-nitropyrrole, and combinations of the above bases. More specifically, the universal base is deoxyinosine, inosine, or a combination thereof.

[0085] According to one embodiment of the present invention, the probes are 3 to 50 nucleotides in length. In one embodiment of the present invention, the probes are 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 40, or 50 nucleotides in length. For example, the probes are 3-50, 3-40, 3-35, 3-30, 3-25, 3-20, 3-17, 3-15, 3-12, 3-10, 3-9, 3-8, 3-7, 3-6, 3-5, 3-4, 4-50, 4-40, 4-35, 4-30, 4-25, 4-20, 4-17, 4-15, 4-12, 4-10, 4-9, 4-8, 4-7, 4-6, 4-5, 5-50, 5-40, 5-35, 5-30, 5-25, 5-20, 5-17, 5-15, 5-12, 5-10, 5-9, 5-8, 5-7, 5-6, 6-50, 6-40, 6-35, 6-30, 6-25, 6-20, 6-17, 6-15, 6-14, 6-13, 6-12, 6-11, 6-10, 6-9, 6-8, 6-7, 7-50, 7-40, 7-35, 7-30, 7-25, 7-20, 7-19, 7-18, 7-17, 7-16, 7-15, 7-14, 7-13, 7-12, 7-11, 7-10, 7-9, 7-8, 8-50, 8-40, 8-35, 8-30, 8-25, 8-20, 8-17, 8-15, 8- 12, 8-10, 8-9, 9-50, 9-40, 9-35, 9-30, 9-25, 9-20, 9-17, 9-15, 9-12, 9-10, 10-50, 10-40, 10-35, 10-30, 10-25, 10-20, 10-17, 10-15, 10-12, 12-50, 12-40, 12-35, 12-30, 12-25, 12-20, 12-17, 12-15, 15-50, 15-40, 15-35, It can be 15-30, 15-25, 15-20, 15-17 or 17-20 nucleotides in length.In certain embodiments, the probe is 5 nucleotides, 6 nucleotides, 7 nucleotides, 8 nucleotides, 9 nucleotides, or 10 nucleotides in length.

[0086] Dimer-forming primers and probes can be blocked at their 3'-ends to prevent extension. Blocking can be achieved using conventional methods. For example, blocking can be achieved by adding a chemical moiety, such as biotin, a label, a phosphate group, an alkyl group, a non-nucleotide linker, a phosphorothioate, or an alkane-diol moiety, to the 3'-hydroxyl group of the last nucleotide. Alternatively, blocking can be achieved by removing the 3'-hydroxyl group of the last nucleotide or by using a nucleotide without a 3'-hydroxyl group, such as a dideoxynucleotide.

[0087] According to the present invention, the first primer and the second primer form a dimer-primer in which a dimer is formed through hybridization between the 3'-dimer forming regions of the first primer and the second primer, and each of the probes hybridizes to the 5'-probe-hybridizing regions of the first primer and the second primer, which are both strands of the dimer-primer, to form a dimer-primer and probe complex.

[0088] The dimer-primer and probe complex formed from the dimer-forming primer pair and probes included in the active assay composition comprises (i) formation of a dimer-primer by hybridization of the dimer-forming primer pair; and (ii) formation of a dimer-primer and probe complex by hybridization of the dimer-primer and probe (see FIGS. 2 and 3 ).

[0089] (i) Formation of dimer-primer

[0090] A pair of dimer-forming primers hybridizes with each other. Specifically, the first primer and the second primer hybridize with each other due to complementarity between their 3'-dimer-forming regions to form a dimer-forming primer.

[0091] Each of the first primer and the second primer comprises (i) a 5'-probe-hybridizing region and (ii) a 3'-dimer-forming region in the 5' to 3' direction, such that in the hybridization process to form a dimer-primer, the 3'-dimer-forming region is involved in hybridization, but the 5'-probe-hybridizing region is not involved in hybridization (see Figures 2 and 3).

[0092] The dimer-primer formed by hybridization between the 3'-dimer forming regions of the first primer and the second primer is as follows:

[0093] [Correction pursuant to Rule 91, July 28, 2025][Deleted]

[0094] This dimer form represents a form in which the first primer and the second primer are partially hybridized (partially overlapped) through the 3'-dimer-forming regions of the two primers. This dimer form may be referred to as a partial dimer.

[0095] A primer-dimer formed by partial hybridization between a first primer and a second primer has a distinct tripartite structure comprising (i) a single-stranded portion comprising the first primer; (ii) a double-stranded portion comprising the first primer and the second primer; and (iii) a single-stranded portion comprising the second primer, wherein the single-stranded portions of the first primer and the second primer include a 5'-probe-hybridization region.

[0096] Hybridization of the aforementioned dimer-forming primer pair can be performed under conditions that allow hybridization of the first primer and the second primer.

[0097] (ii) Formation of dimer-primer and probe complexes;

[0098] Each of the probes hybridizes to the 5'-probe-hybridization region of each of the first primer and the second primer, which are both strands of the above dimer-primer, to form a dimer-primer and probe complex, specifically as follows:

[0099] [Correction pursuant to Rule 91, July 28, 2025][Deleted]

[0100] Each of the first primer and the second primer comprises (i) a 5'-probe-hybridization region and (ii) a 3'-dimer-forming region in the 5' to 3' direction, such that in the hybridization process to form a dimer-primer and probe complex, the 5'-probe-hybridization region is involved in hybridization (see Figures 2 and 3).

[0101] Hybridization of the 5'-probe-hybridization region of each of the first primer and the second primer and the probe described above can be performed under conditions that allow hybridization of the single-stranded region of each of the first primer and the second primer and the probe.

[0102] The most significant feature of the present invention is that the activity of a 5' nuclease can be analyzed through the mechanism of degrading the 5' end of the probe of the complex by forming a dimer-primer and probe complex, which is a structure recognizable by a 5' nuclease, through hybridization of a dimer-forming primer pair and a probe. Specifically, Fig. 3 illustrates the operating mechanism of a self-dimer primer-probe complex according to one embodiment of the present invention.

[0103] According to one embodiment of the present invention, in the dimer-primer and probe complex, the interval between the 3' end of the primer and the 5' end of the probe adjacent to the 3' end of the primer is 0 to 15 nucleotides in length. Specifically, the interval may be 0-13 nucleotides in length, 0-11 nucleotides in length, 0-9 nucleotides in length, 0-7 nucleotides in length, 0-5 nucleotides in length, 0-3 nucleotides in length, 0-1 nucleotide in length, or 0 nucleotide in length.

[0104] According to one embodiment of the present invention, the dimer-forming primer pair is a self-dimer-forming primer pair, each of the first primer and the second primer is a self-dimer-forming primer, the 3'-dimer-forming region is a 3'-hairpin-forming region, the dimer-formed dimer-primer is a self-dimer-formed self-dimer-primer, and the dimer-primer and probe complex is a self-dimer-primer and probe complex.

[0105] The term “self-dimer-forming primer” as used herein means a primer that can partially hybridize two self-dimer-forming primers of identical sequence to each other to form a self-dimer under certain conditions.

[0106] The term "self-dimer" as used herein means a dimer formed by partial hybridization, i.e., inter-strand hybridization, of two self-dimer-forming primers of identical sequence.

[0107] While conventional primers initiate extension after hybridizing to a nucleic acid strand (template), self-dimer-forming primers initiate extension after hybridizing to another self-dimer-forming primer of the same sequence. However, according to the present invention, the active assay composition does not contain dNTPs or NTPs, or the 3'-end of the self-dimer-forming primer is blocked, so the self-dimer-forming primer does not extend.

[0108] In the present embodiment, the self-dimer-forming primer comprises (i) a 5'-probe-hybridizing region and (ii) a 3'-hairpin-forming region in the 5' to 3' direction. That is, the 3'-dimer-forming region of the dimer-forming primer is a 3'-hairpin-forming region in the self-dimer-forming primer (see FIG. 2).

[0109] According to one embodiment of the present invention, the 5'-probe-hybridizing region of the self-dimer-forming primer has a nucleotide sequence that is substantially non-complementary to the 5'-probe-hybridizing region and 3'-hairpin-forming region of another self-dimer-forming primer of the same sequence. Therefore, the 5'-probe-hybridizing region of the self-dimer-forming primer does not substantially hybridize to the 5'-probe-hybridizing region or 3'-hairpin-forming region of another self-dimer-forming primer of the same sequence.

[0110] The term “non-complementary” in relation to the 5'-probe-hybridizing region of a self-dimer-forming primer means that the 5'-probe-hybridizing region of the self-dimer-forming primer is sufficiently non-complementary that it will not selectively hybridize to any region of a self-dimer-forming primer of the same sequence under given annealing conditions or stringent conditions, and encompasses both “substantially non-complementary” and “perfectly non-complementary,” and in particular means perfectly non-complementary.

[0111] The 5'-probe-hybridizing region of the self-dimer-forming primer does not have a self-complementary sequence. Therefore, the 5'-probe-hybridizing region does not form a hairpin (hairpin dimer).

[0112] The term “3'-hairpin-forming region” used herein in relation to a self-dimer-forming primer refers to a region located at the 3' end of a self-dimer-forming primer. The term refers to a region capable of forming a hairpin (hairpin dimer) at a first temperature and forming a self-dimer at a second temperature (see FIG. 2 ).

[0113] In one embodiment, the 3'-hairpin-forming region of the self-dimer-forming primer forms a hairpin dimer at a first temperature.

[0114] The term "hairpin" or "hairpin dimer" as used herein refers to a structure having a double-stranded portion formed through intra-hybridization due to self-complementary sequences in the 3'-hairpin-forming region at a first temperature. The term refers to a structure having a double-stranded portion formed by a single self-dimer-forming primer. The structure of the hairpin dimer is illustrated in FIG. 2.

[0115] As shown in Fig. 2, at the first temperature, the 3'-hairpin-forming region of the self-dimer-forming primer forms a hairpin dimer having a double-stranded portion through intrastrand hybridization.

[0116] The first temperature is determined by considering the melting temperature (Tm) of the hairpin dimer. Specifically, the first temperature may be equal to or lower than the Tm of the hairpin dimer. At a temperature equal to or lower than the Tm of the hairpin dimer, the 3'-hairpin-forming region of the self-dimer-forming primer may form a hairpin dimer as in FIG. 2 or may form a self-dimer as in FIG. 2.

[0117] Since the length of the double-stranded portion of the hairpin dimer is approximately half that of the self-dimer, the Tm of the hairpin dimer is lower than that of the self-dimer. Therefore, at temperatures below the Tm of the hairpin dimer, a self-dimer can be formed in addition to the hairpin dimer.

[0118] In one embodiment, the 3'-hairpin-forming region of the self-dimer-forming primer forms a self-dimer at a second temperature.

[0119] The term “self-dimer” as used herein refers to a structure having a double-stranded portion formed through hybridization, i.e., inter-hybridization, between the 3'-hairpin-forming regions of two self-dimer-forming primers at a second temperature. The structure of the self-dimer is illustrated in FIG. 2.

[0120] As shown in Fig. 2, at the second temperature, the 3'-hairpin-forming region of the self-dimer-forming primer forms a self-dimer having a double-stranded portion through strand hybridization.

[0121] In one embodiment, the second temperature is determined by considering the Tm of the self-dimer. Specifically, the second temperature may be equal to or lower than the Tm of the self-dimer. At a temperature equal to or lower than the Tm of the self-dimer, the 3'-hairpin-forming region of the self-dimer-forming primer can form a self-dimer, as illustrated in FIG. 2.

[0122] In a specific embodiment, the second temperature is determined by considering the Tm of the self-dimer and the Tm of the hairpin dimer. Specifically, the second temperature may be a temperature higher than the Tm of the hairpin dimer and equal to or lower than the Tm of the self-dimer. At a temperature higher than the Tm of the hairpin dimer, the 3'-hairpin-forming region of the self-dimer-forming primer does not form a hairpin dimer as in FIG. 2, but at a temperature equal to or lower than the Tm of the self-dimer, the 3'-hairpin-forming region of the self-dimer-forming primer can form a self-dimer as in FIG. 2.

[0123] In certain embodiments, the second temperature is higher than the first temperature.

[0124] For the formation of a hairpin dimer or self-dimer as described above, the 3'-hairpin-forming region of the self-dimer-forming primer may have a nucleotide sequence that can hybridize with the 3'-hairpin-forming region of another self-dimer-forming primer of the same sequence.

[0125] The self-dimer-forming primer may be composed of naturally occurring dNMPs. Alternatively, the self-dimer-forming primer may include modified nucleotides or non-natural nucleotides, such as Peptide Nucleic Acid (PNA, see PCT Application No. WO 92 / 20702) and Locked Nucleic Acid (LNA, see PCT Application Nos. WO 98 / 22489, WO 98 / 39352, and WO 99 / 14226). Additionally, the self-dimer-forming primer may include universal bases, such as deoxyinosine, inosine, 1-(2'-deoxy-beta-D-ribofuranosyl)-3-nitropyrrole, and 5-nitroindole. The term “universal base” means one that can form base pairs with each of the natural DNA / RNA bases with almost no distinction.

[0126] The modified nucleotides, non-natural nucleotides, or universal bases may be present consecutively or discontinuously within the self-dimer-forming primer. The number of the modified nucleotides, non-natural nucleotides, or universal bases may be 1-5, 1-3, or 1-2. The modified nucleotides, non-natural nucleotides, or universal bases may be present at any position within the self-dimer-forming primer. In one embodiment, the modified nucleotides, non-natural nucleotides, or universal bases may be located in the 5'-probe-hybridizing region, the 3'-hairpin-forming region, or both.

[0127] A self-dimer-forming primer may include any additional sequence in addition to the 5'-probe-hybridizing region and the 3'-hairpin-forming region. In one embodiment, the additional sequence is located 5' to the 5'-probe-hybridizing region, does not serve as a template, and does not hybridize with another self-dimer-forming primer. The additional sequence may include a blocker to prevent primer extension.

[0128] (ⅲ) Formation of self-dimer-primer

[0129] A self-dimer-primer is formed by hybridization between the 3'-dimer forming regions of the above self-dimer-forming primer pair.

[0130] The contents of the Korean Patent Application No. 10-2023-0166983 filed by the present applicant regarding self-dimer-forming primers and self-dimer-primers are incorporated herein by reference.

[0131] (ⅳ) Formation of self-dimer-primer and probe complexes

[0132] Each probe hybridizes to the 5'-probe-hybridization region of each of the self-dimer-forming primers, which are both strands of the self-dimer-primer, to form a self-dimer-primer and probe complex.

[0133] According to one embodiment of the present invention, the dimer-primer and probe complex is formed by heating the active assay composition to a high temperature and then cooling it.

[0134] By heating the active assay composition to a high temperature, the dimer-forming primer pairs and probes included in the active assay composition used in the present invention can be converted into single-stranded states. Thereafter, the heated resultant can be cooled to a temperature lower than the incubation temperature to induce the formation of dimer-primer and probe complexes.

[0135] The above high temperature is a temperature that can make the dimer-forming primer pair and probes into a single-stranded state as described above. The above high temperature is a temperature higher than the incubation temperature. In one embodiment, the above high temperature is a temperature selected from 90-100°C, and more specifically selected from 90°C, 91°C, 92°C, 93°C, 94°C, 95°C, 96°C, 97°C, 98°C, 99°C, 100°C, and any value therebetween. The above cooling temperature is a temperature lower than the incubation temperature, and is a temperature selected from 15-70°C, specifically a temperature selected from 15-50°C, and more specifically a temperature selected from 15-30°C.

[0136]

[0137] Step (b): Addition of 5' nuclease to the active assay composition and incubation (120)

[0138] Next, the method of the present invention comprises the step of (b) adding the 5' nuclease to the active assay composition and incubating the resultant. The 5' ends of the probes of the dimer-primer and probe complex are degraded by the 5' nuclease, thereby providing a detectable signal.

[0139] The term “incubation” as used herein means placing the provided active assay composition under conditions in which the 5' nuclease whose activity is to be assayed can recognize and degrade the structure of the target.

[0140] Before the incubation according to the present invention, the dimer-forming primer pair and probes included in the active assay composition may exist in a single-stranded state depending on the temperature, or (ii) may exist as a dimer-primer and probe complex formed by hybridization between the 3'-dimer forming regions of the first primer and the second primer, which are the dimer-forming primer pair, as shown in FIGS. 2 and 3, and each of the probes hybridizing to the 5'-probe-hybridization regions of each of the first primer and the second primer, which are both strands of the dimer-primer. Specifically, before the incubation according to the present invention, the dimer-primer and probe complex exists.

[0141] Thereafter, during the incubation according to the present invention, the 5' ends of the probes of the dimer-primer and probe complex are degraded by the added 5' nuclease, thereby providing a detectable signal.

[0142] According to one embodiment of the present invention, the incubation is performed isothermally, in which a 5' nuclease operates to degrade the 5' ends of the probes of the formed dimer-primer and probe complex.

[0143] According to one embodiment of the present invention, the 5' nuclease operates and the dimer-forming primer hybridizes the probe to the 5'-probe hybridization region under isothermal conditions without forming a hairpin dimer by intra-strand hybridization.

[0144] According to one embodiment of the present invention, the incubation is performed isothermally so that the dimer-forming primer pair and probes do not exist in a single-stranded state.

[0145] As described above, the operation of the 5' nuclease and the maintenance of the structure of the dimer primer and probe complex for the operation of the 5' nuclease can be achieved by controlling the temperature of the incubation.

[0146] The temperature for incubation to achieve the above purpose can be selected by considering the temperature for the operation of the 5' nuclease and the Tm value of the 3'-dimer-forming region of the dimer-forming primer and the Tm value of the 5'-probe-hybridization region of the primer to maintain the structure of the dimer primer and probe complex.

[0147] The temperature for incubation may be within the optimal activity temperature of the 5' nuclease to be analyzed for its operation. Therefore, the incubation temperature may vary depending on the optimal activity temperature of the 5' nuclease to be analyzed.

[0148] In one embodiment, the temperature for incubation is higher than the Tm of the hairpin dimer for non-formation of the hairpin dimer.

[0149] In one embodiment, the temperature for incubation is lower than the Tm of the 3'dimer-forming region of the dimer-forming primer for formation of dimers between the 3'dimer-forming regions.

[0150] In one embodiment, the temperature for incubation is lower than the Tm of the 5'-probe-hybridization region of each of the dimer-forming primer pairs, which are both strands of the dimer-primer, such that each of the probes hybridizes to the 5'-probe-hybridization region.

[0151] According to one embodiment of the present invention, the isotherm for incubation is a temperature selected from 65 to 80°C. In a specific embodiment, the isotherm for incubation is about 65°C. In a specific embodiment, the isotherm for incubation is about 72°C.

[0152] According to one embodiment of the present invention, the incubation is performed for 30 to 60 minutes.

[0153] However, the incubation time may be adjusted in consideration of the time it takes for the function of time versus signal (or the function of signal versus time) to reach a plateau, or the time it takes for the function of time versus signal to exhibit a linear function. For example, if the time it takes for the function (plot) of time versus signal to reach a plateau for a specific 5' nuclease exceeds 60 minutes, the incubation time may be set to exceed 60 minutes for a 5' nuclease of the same or similar type. Conversely, if the time it takes for the function (plot) of time versus signal to reach a plateau for a specific 5' nuclease is within 30 minutes, the incubation time may be set to within 30 minutes for a 5' nuclease of the same or similar type.

[0154] According to one embodiment, the incubation can be performed in various known incubators.

[0155] In another embodiment, the incubator is performed in a variety of amplification devices used in nucleic acid amplification reactions. The amplification devices may include a temperature-controlled thermocycler and a detector capable of detecting a signal. Typical amplification devices are programmed to continuously vary the temperature, for example, to perform PCR, but the amplification devices can be used in the method of the present invention by programming them to maintain the temperature isothermally. Examples of amplification devices that can be used include CFX (Bio-Rad), iCycler (Bio-Rad), LightCycler (Roche), StepOne (ABI), 7500 (ABI), ViiA7 (ABI), QuantStudio (ABI), and AriaMx (Agilent).

[0156] According to the present invention, in the incubation step, the 5' end of the probe of the dimer-primer and probe complex is degraded by the 5' nuclease, thereby providing a detectable signal.

[0157] The term “signal” as used herein means any signal, particularly a fluorescent signal, that can indicate the occurrence of degradation of the 5' end of a probe. For example, the signal includes the generation (or disappearance) of a signal from a label, or a change (increase or decrease) in a signal.

[0158] The detectable signal may be generated by a label(s) or label system.

[0159] Detectable signals can be generated using a variety of signal-generating means (i.e., labeling systems) well known in the art.

[0160] According to one embodiment of the present invention, the detectable signal is provided by (i) a dual label linked to each of the probes, or (ii) a label linked to the first primer and / or the second primer and a label linked to each of the probes.

[0161] A labeling system useful in the present invention can be described in detail as follows.

[0162] (i) Dual labels linked to each probe

[0163] The above double label is an intrastrand interactive double label.

[0164] An interactive labeling system refers to a signal generating system in which energy is non-radioactively transferred between a donor molecule and an acceptor molecule. A representative example of an interactive labeling system is a fluorescence resonance energy transfer (FRET) labeling system, which includes a fluorescent reporter molecule (donor molecule) and a quencher molecule (acceptor molecule). In FRET, the energy donor is fluorescent, while the energy acceptor can be either fluorescent or non-fluorescent. In another example of an interactive labeling system, the energy donor is non-fluorescent, such as a chromophore, and the energy acceptor is fluorescent. In yet another example of an interactive labeling system, the energy donor is luminescent, such as bioluminescent, chemiluminescent, or electrochemiluminescent, and the energy acceptor is fluorescent. In the present invention, the donor molecule and the acceptor molecule may be the reporter molecule and the quencher molecule, respectively, described above.

[0165] Specifically, the signal indicating the occurrence of degradation of the 5' end of the probe (cleavage of the 5' end of the probe) is generated by the interactive labeling system, more specifically, by the FRET labeling system (i.e., the interactive dual labeling system).

[0166] According to one embodiment of the present invention, a probe is coupled to an interactive dual label comprising a reporter molecule and a quencher molecule, and when the 5'-ends of the probes of the dimer-primer and probe complex are cleaved by the 5'-nuclease in step (b), a change in a signal from the interactive dual label is caused, thereby providing a detectable signal. Before the 5'-ends of the probes of the dimer-primer and probe complex are cleaved, the reporter molecule and the quencher molecule on the probe are brought into close proximity to each other, so that the quencher molecule quenches the signal from the reporter molecule, and when the 5'-ends of the probes are cleaved, the reporter molecule and the quencher molecule are separated from each other, so that the quencher molecule unquenches the signal from the reporter molecule, thereby causing a change in the signal from the interactive dual label.

[0167] Alternatively, before the 5' ends of the probes of the dimer-primer and probe complex are cleaved, the reporter molecule and the quencher molecule on the probe are spaced apart from each other so that the quencher molecule unquenches the signal from the reporter molecule, and the resulting signal is background-corrected, and when the 5' ends of the probes are cleaved, the reporter molecule and the quencher molecule are spaced apart so that the quencher molecule unquenches the signal from the reporter molecule, resulting in a signal change from the interactive dual label.

[0168] Figure 3 illustrates an embodiment of the present invention using an interactive dual label. In a dimer-primer and probe complex formed before incubation, a quencher molecule on the probe in close proximity quenches a signal from a reporter molecule, and when the 5' ends of the probes of the dimer-primer and probe complex are cleaved by the 5' nuclease during the incubation step, the reporter molecule and the quencher molecule bound to the probe become separated from each other, causing the quencher molecule to unquench a signal from the reporter molecule, resulting in a change in the signal from the interactive dual label (e.g., an increase in the signal from the reporter molecule).

[0169] According to one embodiment of the present invention, the reporter molecule and the quencher molecule are located at the 5'-end (or 3'-end) and the 3'-end (or 5'-end) of the probe. According to a more specific embodiment of the present invention, one of the reporter molecule and the quencher molecule bound to the probe is located at the 5'-end or at a position 1-5 nucleotides apart from the 5'-end, and the other is located at a position that quenches or unquenches the signal of the reporter molecule depending on the conformation of the probe or the distance between the reporter molecule and the quencher molecule on the probe.

[0170] According to a more specific embodiment of the present invention, one of the reporter molecule and the quencher molecule bound to the probe is positioned at the 3'-terminus or at a position 1-5 nucleotides apart from the 3'-terminus, and the other is positioned at a position that quenches or unquenches the signal of the reporter molecule depending on the shape of the probe or the distance between the reporter molecule and the quencher molecule on the probe.

[0171] In a more specific embodiment of the present invention, the reporter molecule and the quencher molecule are spaced apart from each other by no more than 50 nucleotides, more specifically by no more than 40 nucleotides, even more specifically by no more than 30 nucleotides, and even more specifically by no more than 20 nucleotides. In a more specific embodiment of the present invention, the reporter molecule and the quencher molecule are spaced apart by at least 4 nucleotides, more specifically by at least 6 nucleotides, even more specifically by at least 10 nucleotides, and even more specifically by at least 15 nucleotides.

[0172] The reporter molecule and quencher molecule used in the present invention may include any molecule known in the art. Specific examples of the fluorescent labels are as follows: Cy2™ (506), YO-PRO™-1 (509), YOYO™-1 (509), Calcein (517), FITC (518), FluorX™ (519), Alexa™ (520), Rhodamine 110 (520), Oregon Green™ 500 (522), Oregon Green™ 488 (524), RiboGreen™ (525), Rhodamine Green™ (527), Rhodamine 123 (529), Magnesium Green™ (531), Calcium Green™ (533), TO-PRO™-1 (533), TOTO1 (533), JOE (548), BODIPY530 / 550 (550), Dil (565), BODIPY TMR (568), BODIPY558 / 568 (568), BODIPY564 / 570 (570), Cy3™ (570), Alexa™ 546 (570), TRITC (572), Magnesium Orange™ (575), Phycoerythrin R&B (575), Rhodamine Phalloidin (575), Calcium Orange™ (576), Pyronin Y (580), Rhodamine B (580), TAMRA (582), Rhodamine Red™ (590), Cy3.5™ (596), ROX (608), Calcium Crimson™ (615), Alexa™ 594 (615), Texas Red (615), Nile Red (628), YO-PRO™-3 (631), YOYO™-3 (631), R-phycocyanin (642), C-Phycocyanin (648), TO-PRO™-3 (660), TOTO3 (660), DiD DilC(5) (665), Cy5™ (670), Thiadicarbocyanine (671), Cy5.5 (694), HEX (556), TET (536), Biosearch Blue (447), CAL Fluor Gold 540 (544), CAL Fluor Orange 560 (559), CAL Fluor Red 590 (591), CAL Fluor Red 610 (610), CAL Fluor Red 635 (637), FAM (520), Fluorescein (520), Fluorescein-C3 (520), Pulsar 650 (566), Quasar 570 (667), Quasar 670 (705), and Quasar 705 (610). The numbers in parentheses are the maximum emission wavelengths in nanometers. Specifically, the reporter molecules and quencher molecules include HEX, JOE, FAM, TAMRA, ROX, or a fluorescein-based label.

[0173] Suitable reporter-quencher pairs are described in many references: Pesce et al., editors, FLUORESCENCE SPECTROSCOPY (Marcel Dekker, New York, 1971); White et al., FLUORESCENCE ANALYSIS: A PRACTICAL APPROACH (Marcel Dekker, New York, 1970); Berlman, HANDBOOK OF FLUORESCENCE SPECTRA OF AROMATIC MOLECULES, 2 ndEDITION (Academic Press, New York, 1971); Griffiths, COLOUR AND CONSTITUTION OF ORGANIC MOLECULES (Academic Press, New York, 1976); Bishop, editor, INDICATORS (Pergamon Press, Oxford, 1972); Haugland, HANDBOOK OF FLUORESCENT PROBES AND RESEARCH CHEMICALS (Molecular Probes, Eugene, 1992); Pringsheim, FLUORESCENCE AND PHOSPHORESCENCE (Interscience Publishers, New York, 1949); Haugland, RP, HANDBOOK OF FLUORESCENT PROBES AND RESEARCH CHEMICALS, Sixth Edition, Molecular Probes, Eugene, Oreg., 1996; U.S. Patent Nos. 3,996,345 and 4,351,760.

[0174] It is also noteworthy that the present invention may utilize non-fluorescent black quencher molecules (or dark quencher molecules) capable of quenching fluorescence over a wide range of wavelengths or specific wavelengths. Examples include BHQ and DABCYL.

[0175] In FRET labeling applied to a probe, the reporter contains the FRET donor, and the quencher contains the other partner (acceptor) of FRET. For example, fluorescein dye is used as a reporter, and rhodine dye is used as a quencher.

[0176] (ⅱ) a label linked to the first primer and / or the second primer and a label linked to each of the probes;

[0177] According to one embodiment, in the dimer-primer and probe complex, the first primer has one of the interactive dual labels comprising a reporter molecule and a quencher molecule, and a probe adjacent to the 3' end of the first primer has the other of the interactive dual labels. In the dimer-primer and probe complex, the second primer has one of the interactive dual labels comprising a reporter molecule and a quencher molecule, and a probe adjacent to the 3' end of the second primer has the other of the interactive dual labels.

[0178] The principle of interactive dual labeling using a primer and a probe is as follows: In the dimer-primer and probe complex, since the first primer and the probe are hybridized in close proximity to the second primer, the reporter molecule and the quencher molecule in the first primer and the probe are adjacent, and the quencher molecule quenches a signal from the reporter molecule, and when the 5' end of the probe is cleaved by the 5' nuclease, the reporter molecule and the quencher molecule in the first primer and the probe are separated from each other, and a signal is generated from the reporter molecule.

[0179] In addition, in the dimer-primer and probe complex, since the second primer and the probe hybridize in close proximity to the first primer, the reporter molecule and the quencher molecule in the second primer and the probe are adjacent to each other, and the quencher molecule quenches a signal from the reporter molecule, and when the 5' end of the probe is degraded by the 5' nuclease, the reporter molecule and the quencher molecule in the second primer and the probe are separated from each other, and a signal is generated from the reporter molecule.

[0180] According to one embodiment of the present invention, the first primer and the probe (or the second primer and the probe) may be positioned immediately adjacent to the second primer (or the first primer) or 1-5 nucleotides apart from the second primer (or the first primer), as long as the first primer and the probe (or the second primer and the probe) hybridize to the second primer such that the quencher molecule can quench a signal from the reporter molecule.

[0181] According to a specific embodiment of the present invention, when the first primer and the probe (or the second primer and the probe) are hybridized adjacent to the second primer (or the first primer), the reporter molecule and the quencher molecule can bind to any position of the first primer and the probe (or the second primer and the probe) as long as the quencher molecule can quench a signal from the reporter molecule. For example, the reporter molecule or the quencher molecule can be bound to the 5'-end or a position 1-5 nucleotides apart from the 5'-end of the probe, and the quencher molecule or the reporter molecule can be bound to the 3'-end or a position 1-5 nucleotides apart from the 3'-end of the first primer that is hybridized adjacent to the probe.

[0182]

[0183] Step (c): Measure the signal provided over time (130)

[0184] Finally, the method of the present invention includes the step of (c) measuring the signal provided over time. The change in the signal over time indicates the activity of the 5' nuclease.

[0185] Measurement of the above signal is performed in real time or at predetermined time intervals during incubation at one temperature, i.e. isothermally.

[0186] When analyzing the activity of a 5' nuclease according to the method of the present invention, the signal intensity (fluorescence value) increases steadily during the initial incubation period, i.e., a constant signal change rate over time is observed. However, as the incubation time elapses, the signal change rate gradually decreases, and eventually reaches 0.

[0187] That is, according to the present invention, when the activity of 5' nuclease is present, it represents a function of time versus signal intensity (or signal intensity versus time) in which the signal intensity increases over time and then no longer increases, that is, a function of time versus signal change rate (or signal change rate versus time) in which the signal change rate has a constant value exceeding 0 and then gradually decreases to 0 as time passes.

[0188] This is because, in the initial time period of incubation, a continuous increase in signal intensity, i.e., a constant signal change rate, occurs as the 5' nuclease degrades the 5' ends of the probes in the dimer-primer and probe complex during incubation, but after a certain period of time, the probes to be degraded are gradually consumed (depleted), resulting in a decreased signal change rate.

[0189] The rate of change in the constant signal in the early time interval of incubation may vary depending on the activity of the 5′ nuclease used. For example, a 5′ nuclease with high activity will exhibit a high rate of change in the signal in the early time interval of incubation at the same concentration, whereas a 5′ nuclease with low activity will exhibit a low rate of change in the signal in the early time interval of incubation at the same concentration. Therefore, the level or extent of the constant signal change in the early time interval of incubation may indicate the activity of the nucleic acid polymerase.

[0190] In one embodiment, the results of the measurement of the signal in step (c) are displayed as a plot of signal intensity (fluorescence value) versus incubation time (or signal intensity (fluorescence value) versus incubation time).

[0191] Examples of the above plots are shown in Figures 4, 6, and 7. As can be seen in each of the above figures, the signal intensity continues to increase in the early time interval of the incubation, but as the late time interval of the incubation approaches, the increase in signal intensity plateaus.

[0192] According to one embodiment of the present invention, the change in the signal is measured for an initial time period of incubation.

[0193] As mentioned above, in the initial time interval of incubation, the function of incubation time versus signal intensity (or signal intensity versus incubation time) exhibits a linear correlation, i.e. a first-order function.

[0194] Accordingly, according to one embodiment of the present invention, the change in the signal is measured over a time period at which the function of the incubation time versus the signal intensity exhibits a linear function.

[0195] In one embodiment, the change in signal over time is obtained by calculating the slope or first derivative (differentiation) of the linear function of signal intensity versus incubation time for the initial time interval of the incubation described above.

[0196] According to a more specific embodiment of the present invention, the activity of the 5' nuclease is provided as a slope measured in a range where the signal intensity increases linearly with respect to the incubation time depending on the concentration or mass of the 5' nuclease. More specifically, the signal intensity is converted into the amount of the digested probe. The activity provided according to the present embodiment can be confirmed in FIGS. 5 and 8.

[0197] Since the total amount of probes contained in the active assay composition is known, the value of the maximum signal appearing when the 5' ends of the probes in the dimer-primer and probe complex are cleaved is proportional to the total amount of probes contained in the active assay composition, and thus the value of the signal can be converted into the amount of cleaved probe (more specifically, the amount of free fluorescently labeled 5'-end nucleotide). Therefore, the change in signal over time can be converted into the amount of cleaved probe over time.

[0198] The amount of probe degraded during the unit time of the aforementioned incubation can indicate the activity of the 5' nuclease. For example, when the activity of two types of 5' nucleases at the same concentration is analyzed by the method of the present invention, the 5' nuclease that degraded a greater amount of probe during the unit time can be said to have greater activity than the 5' nuclease that degraded a lesser amount of probe during the unit time.

[0199] Specifically, referring to FIGS. 4 and 5, first, the fluorescence intensity at the initial time for each concentration of 5' nuclease is calculated from the results of measuring the fluorescence value for each incubation time for each concentration of 5' nuclease, and then a graph is drawn for the change in the fluorescence intensity per unit time for each concentration of 5' nuclease, and then the fluorescence intensity is converted into the amount of probe, and the slope measured in the range where the change in the amount of the digested probe per unit time for each concentration of 5' nuclease increases linearly is provided as the activity (Unit) of 5' nuclease.

[0200] In this case, the activity (Unit) of the 5' nuclease means the amount of probe degraded per unit time at a given temperature (incubation temperature) per unit concentration (mass) of the 5' nuclease.

[0201] According to the method of the present invention, TaqDNA polymerase (M0267S, NEB) has a 5' nuclease activity that degrades 1.36 pmole of probe at 72°C for 30 minutes, and DreamTaq DNA polymerase (Thermo Scientific TM ) was confirmed to have the activity of a 5' nuclease that degrades a probe of 1.28 pmole for TaqDNA polymerase (Qiagen), 0.80 pmole for TaqDNA polymerase (Qiagen), and 1.77 pmole for rTth DNA polymerase (TOYOBO) at 72°C for 30 minutes through the examples described below.

[0202] The concentration of the above 5' nuclease can be determined by various methods known in the art. For example, the concentration of the above 5' nuclease can be determined by the Bradford method, the BCA method, or A280 absorbance.

[0203]

[0204] Ⅱ. 5'nuclease activity assay composition

[0205] According to another aspect of the present invention, the present invention provides an activity assay composition of a 5' nuclease comprising:

[0206] (a) a dimer-forming primer pair; the dimer-forming primer pair comprises a first primer and a second primer, each of the first primer and the second primer comprising a 5'-probe-hybridizing region and a 3'-dimer-forming region in a 5' to 3' direction, the nucleotide sequence of the 3'-dimer-forming region in the first primer being complementary to the nucleotide sequence of the 3'-dimer-forming region in the second primer, and a dimer-primer formed by hybridization between the 3'-dimer-forming regions of the first primer and the second primer, and

[0207] (b) probes; the nucleotide sequence of the 5'-probe-hybridization region of each of the first primer and the second primer is complementary to the nucleotide sequence of each of the probes, and each of the probes hybridizes to the 5'-probe-hybridization region of each of the first primer and the second primer, which are both strands of the dimer-primer, to form a dimer-primer and probe complex.

[0208] The composition of the present invention is used to carry out the method of the present invention described above, and any description common between the two is omitted to avoid excessive complexity of the present specification.

[0209] According to one embodiment of the present invention, the composition does not contain dNTPs or NTPs.

[0210] According to one embodiment of the present invention, the dimer-forming primer pair is a self-dimer-forming primer pair, each of the first primer and the second primer is a self-dimer-forming primer, the 3'-dimer-forming region is a 3'-hairpin-forming region, the dimer-formed dimer-primer is a self-dimer-formed self-dimer-primer, and the dimer-primer and probe complex is a self-dimer-primer and probe complex.

[0211] According to one embodiment of the present invention, the composition further comprises (i) a dual label linked to each of the probes, or (ii) a label linked to the first primer and / or the second primer and a label linked to each of the probes.

[0212]

[0213] The features and advantages of the present invention are summarized as follows:

[0214] (a) The present invention utilizes two types of oligonucleotides, a dimer-forming primer pair and probes, thereby facilitating design since fewer factors need to be considered during design compared to conventional methods using primers, templates, and probes. In addition, the dimer-primer and probe complex formed by hybridization of the dimer-forming primer pair and probes utilizes an environment in which 5' nucleases are active within PCR, thereby increasing the reliability and applicability of enzyme activity measured using the present invention.

[0215] (b) The present invention significantly improves user convenience in terms of simplicity, speed, low cost and stability compared to the conventional method of determining a unit using a radioactive isotope.

[0216] (c) The present invention can be applied to various nucleic acid polymerases including a 5' nuclease domain, and can be applied to analyzing the activity and purity during the production process of the polymerase and monitoring quality control, and can also be used as a basis for improving enzymes applied to PCR through research on the characteristics of 5' nucleases.

[0217]

[0218] Figure 1 is a flowchart of processes for implementing the method of the present invention according to one embodiment of the present invention.

[0219] Figure 2 illustrates the formation of a self-dimer primer-probe complex according to one embodiment of the present invention.

[0220] Figure 3 shows the operating mechanism of a self-dimer primer-probe complex according to one embodiment of the present invention.

[0221] FIG. 4 shows a real-time fluorescence measurement graph for measuring the activity of a 5' nuclease of TaqDNA polymerase according to one embodiment of the present invention.

[0222] Figure 5 shows a plot of fluorescence signal versus time for TaqDNA polymerase according to one embodiment of the present invention.

[0223] Figure 6 shows a real-time fluorescence measurement graph according to the presence or absence of a self-dimer primer according to one embodiment of the present invention.

[0224] Figure 7 shows a real-time fluorescence measurement graph for measuring the activity of various types of decomposition enzymes according to one embodiment of the present invention.

[0225] Figure 8 shows an activity profile analysis of various types of decomposition enzymes according to one embodiment of the present invention.

[0226]

[0227] Hereinafter, the present invention will be described in more detail through examples. These examples are intended solely to illustrate the present invention more specifically, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples, in accordance with the gist of the present invention.

[0228] Example

[0229] Example 1: Design of self-dimer-forming primers and dual-labeled probes

[0230] Self-dimer-forming primers are designed to form dimers with identical sequences, and to allow dual-labeled probes to hybridize to form a specific structure that can be recognized by 5'-nucleotide dehydrogenase. Since the 3'-hairpin-forming region of an oligonucleotide has a palindromic structure, a nucleic acid structure with a primer attached can be formed simply through dimerization without the introduction of an additional primer or template nucleic acid. The 5'-probe hybridization region of the self-dimer-forming primers formed in this way is designed to allow a dual-labeled probe to bind to form a self-dimer-primer and probe complex (Fig. 2). The region where the self-dimer-forming primers hybridize with each other or with the probe is designed to have a melting temperature (Tm) higher than 72℃, which is the activity measurement temperature of 5'-nucleotide dehydrogenase.

[0231] The gap between the 3' end of the self-dimer-forming primer and the 5' end of the dual-labeled probe can be designed to be 0 nucleotides or longer. In addition, the 5' end of the dual-labeled probe may not necessarily hybridize but may form an overhang structure. However, in this case, it is preferable that the remaining hybridizing portion of the probe, excluding the 5'-terminal overhang, have a melting temperature (Tm) higher than 72°C, which is the activity measurement temperature of the 5' nuclease.

[0232] The structure and Tm analysis of the above self-dimer-forming primer were performed using an OligoAnalyzer from IDT.

[0233] The sequence information used in the experiment is shown in Table 1 below:

[0234] Sequence number Name Sequence (5' to 3') Length (nt) * Tm1 (℃) ** Tm2 (℃) 1 Self-dimer-forming primer #1 GGCGTTACCCAACTTAATCGCCTTGCAGCAGTACACGACGGCCAGCTGGCCGTCGTGTAC60 75.87 3.82 Dual-labeled probe #1 HEX-TGCTGCAAGGCGATTAAGTTGGGTAACGCC-BHQ130-73.8

[0235] Underline: 3'-hairpin-forming region

[0236] Italics: 5'-probe-hybridized region

[0237] *Tm1: Melting temperature of self-dimer

[0238] **Tm2: Melting temperature of the 5'-probe-hybridized region

[0239]

[0240] Example 2: Preparation of a composition for enzyme activity analysis

[0241] The self-dimer-forming primer #1, dual-labeled probe #1, 10X Ready buffer, and ultrapure water designed in Example 1 above were mixed, heated at 95°C for 3 minutes, and then cooled to room temperature for 20 minutes to prepare a 0.2 pmole / μL self-dimer-primer and probe complex reagent.

[0242] Afterwards, a final 10 μL composition for activity analysis was prepared including 0.8 pmole of the self-dimer-primer and probe complex reagent, 1X 5'-Exo buffer, and ultrapure water.

[0243]

[0244] Example 3: Measurement of 5' nuclease activity of TaqDNA polymerase

[0245] To determine whether the composition for activity analysis prepared in Example 2 can be used to measure the activity of a 5' nuclease, it was analyzed against a commercially available TaqDNA polymerase (M0267S, NEB) as a 5' nuclease.

[0246] The above TaqDNA polymerase (5 U / μL) was diluted to concentrations of 1000 mU / μL, 125 mU / μL, 62.5 mU / μL, 31.3 mU / μL, 15.6 mU / μL, and 7.8 mU / μL using 10X ThermoPol reaction buffer and ultrapure water, respectively.

[0247] Thereafter, the composition for activity analysis prepared in Example 2, TaqDNA polymerase at each concentration, and ultrapure water were mixed in a volume ratio of 10:1:9. All processes were performed at low temperature using ice.

[0248] 20 μL of each of the above mixtures was placed in an 8-strip PCR tube and incubated at 72°C in a CFX96 (Bio-Rad), a temperature-controlled instrument capable of real-time fluorescence measurement. Fluorescence signals were measured at 30-second intervals during the incubation.

[0249] The above measurement results are shown in Fig. 4. Fig. 5 shows a plot of the fluorescence signal versus time for different concentrations of TaqDNA polymerase.

[0250] As shown in Fig. 4, the fluorescence signal gradually increased over time and eventually reached an equilibrium state (stationary phase). This indicates that at the beginning of the incubation, fluorescence was emitted from the fluorophore that escaped the influence of the quencher as the 5' nuclease degraded the substrate, the dual-labeled probe, resulting in an increase in the fluorescence signal. However, once the substrate was completely degraded, the fluorescence signal stopped increasing. Therefore, the change in the fluorescence signal over time will indicate the amount of the dual-labeled probe degraded in the reaction.

[0251] According to the present embodiment, when the self-dimer-primer and probe complex is targeted by the 5' nuclease and the 5' end of the probe is cleaved, the fluorophore that has escaped the influence of the quencher provides a detectable signal, thereby generating a plot of the fluorescence signal versus time as shown in FIG. 4. In the plot, for the initial time period of the incubation where no substrate depletion occurs, the time and the fluorescence signal exhibit a linear correlation, i.e., a first-order function, and the rate of signal change can be calculated by differentiating this. Since the maximum fluorescence signal appears when the substrate added to the reaction is depleted, the amount of the degraded probe can be calculated proportionally to the increase rate of each fluorescence signal, and the amount of the degraded probe for a polymerase concentration (polymerase unit) per specific time, for example, 30 minutes, can be obtained.

[0252] The amount of probe degraded for 30 minutes per TaqDNA polymerase concentration determined as above is shown in Table 2 below.

[0253] Enzyme concentration (mU) Probe degradation (pmole) 125.00 1.72 62.50 0.84 31.25 0.40 15.63 0.20 7.8 10.110.000.00

[0254] Based on the results calculated in Table 2 above, the amount of degraded probe according to the concentration of TaqDNA polymerase is plotted and shown in Fig. 5. As seen in Fig. 5, since the concentration of polymerase and the amount of degraded probe show a linear correlation of a first-order function, the amount of probe degraded for 30 minutes according to the unit concentration of polymerase could be confirmed by the slope of the function.

[0255] The unit concentration of TaqDNA polymerase used in this example follows the activity unit of the polymerase determined by analysis using a radioisotope (the enzyme unit that consumes 15 nmole of dNTP in 30 minutes at 75°C as measured by a radioisotope). That is, this is a unit unrelated to the activity of the 5' nuclease, and was used as a standard for concentration in this example. In the above Fig. 5, the concentration at which the activity of 1 unit of polymerase is observed can be defined as the unit of the enzyme that degrades 1.36 pmole of probe in 30 minutes at 72°C according to this example.

[0256] The above results show that commercially available TaqDNA polymerase has a 5' nuclease activity that degrades 1.36 pmole of probe at 72°C in 30 minutes according to the present example.

[0257]

[0258] Example 4: Differences in degradation activity depending on the presence or absence of a self-dimer-forming primer

[0259] To determine whether the self-dimer-forming primer is an essential element for confirming the activity of the 5' nuclease, a final 10 μL activity assay composition was prepared in the same manner as in Example 2. Each activity assay composition either contained a self-dimer-forming primer or did not contain one.

[0260] Each of the above-mentioned compositions for activity analysis was mixed with various concentrations of TaqDNA polymerase (NEB, M0267S) prepared in Example 3 and ultrapure water in a volume ratio of 10:1:9. All processes were performed at low temperature using ice.

[0261] 20 μL of each of the above mixtures was placed in an 8-strip PCR tube and incubated at 72°C in a CFX96. Fluorescence signals were measured at 30-second intervals during the incubation.

[0262] The above measurement results are shown in Fig. 6. Fig. 6 (a) shows a plot of the time versus fluorescence signal obtained by adding self-dimer-forming primer #1, and Fig. 6 (b) shows a plot of the time versus fluorescence signal obtained without adding self-dimer-forming primer #1.

[0263] As can be seen in Figure 6, it was confirmed that a self-dimer-forming primer is an essential element for confirming the activity of 5' nuclease.

[0264]

[0265] Example 5: Measurement of various types of diagnostic enzyme activities

[0266] In addition to the TaqDNA polymerase tested in Example 3, the activity of various types of 5' nucleases used in the diagnostic field was measured.

[0267] Commercially available DreamTaq DNA polymerase (Thermo Scientific TM, EP0705), TaqDNA polymerase (Qiagen, 201203), and rTth DNA polymerase (TOYOBO, TTH-301) were diluted to concentrations of 1000 mU / μL, 125 mU / μL, 62.5 mU / μL, 31.3 mU / μL, 15.6 mU / μL, and 7.8 mU / μL, respectively. Similarly, commercially available Bst DNA polymerase, large fragment (NEB, M075S) was diluted to concentrations of 10 mU / μL, 5 mU / μL, 2.5 mU / μL, 1.25 mU / μL, 0.63 mU / μL, and 0.31 mU / μL, and KlenTaq1 (DNA POLYMERASE TECHNOLOGY, 100) and Hemo KlenTaq (NEB, M0332S) were diluted to 1 / 40, 1 / 160, 1 / 320, 1 / 640, 1 / 1280, 1 / 2560, and 1 / 5120 of the stock solution. All of the above concentrations are the concentrations at which polymerase activity was normally observed in the polymerase activity evaluation using the EvaEZ™ Fluorometric Polymerase Activity Assay Kit (Biotium, #29051).

[0268] Thereafter, the composition for activity analysis prepared in Example 2, the DNA polymerase at each concentration, and ultrapure water were mixed in a volume ratio of 10:1:9. All processes were performed at low temperature using ice.

[0269] Then, 20 μL of each of the above mixtures was placed in an 8-strip PCR tube and incubated at 72°C (65°C for Bst DNA polymerase) in a CFX96 (Bio-Rad). Fluorescence signals were measured at 30-second intervals during the incubation.

[0270] The above measurement results are shown in Fig. 7. Fig. 7 (a) shows the results obtained by using DreamTaq DNA polymerase (Thermo Scientific TM) shows a plot of the time versus fluorescence signal obtained using (b) of Fig. 7, (c) of Fig. 7 shows a plot of the time versus fluorescence signal obtained using rTth DNA polymerase (TOYOBO), (d) of Fig. 7 shows a plot of the time versus fluorescence signal obtained using Bst DNA polymerase, large fragment (NEB), (e) of Fig. 7 shows a plot of the time versus fluorescence signal obtained using KlenTaq1 (DNA POLYMERASE TECHNOLOGY), and (f) of Fig. 7 shows a plot of the time versus fluorescence signal obtained using Hemo KlenTaq (NEB).

[0271] Thereafter, the amount of probe degradation over 30 minutes was calculated for each polymerase concentration as described in Example 3.

[0272] The above results are shown in Table 3 below.

[0273] DreamTag DNA Polymerase (Thermo Scientific TM)Taq DNA polymerase (Qiagen)Enzyme concentration (mU)Probe resolution (pmole)Enzyme concentration (mU)Probe resolution (pmole)125.001.61125.001.0262.500.7962.500.4831.250.3831.250.2415.630.1815.630.137.810.097.810.070.000.000.000rTth DNA polymerase (TOYOBO)Bst DNA polymerase, large fragment (NEB)Enzyme concentration (mU)Probe resolution (pmole)Enzyme concentration (mU)Probe Dissolution (pmole) 125.00 2.23 100.00-62.50 1.07 50.00-31.25 0.5 125.00-15.6 30.28 12.50-7.8 10.14 6.25-0.0000.00-KlenTaq1 (DNA POLYMERASE TECH.) Hemo KlenTaq (NEB) Enzyme concentration (dilution ratio) Probe dissolution (pmole) Enzyme concentration (mU) Probe dissolution (pmole) 1 / 40-1 / 40-1 / 160-1 / 160-1 / 320-1 / 320-1 / 640-1 / 640-1 / 1280-1 / 1280-1 / 2560-1 / 2560-1 / 5120-1 / 5120-No enzyme added-Enzyme No additives-

[0274] At this time, Bst DNA polymerase, large fragment (NEB), KlenTaq1 (DNA POLYMERASE TECHNOLOGY), and Hemo KlenTaq (NEB) did not show any fluorescence expression, so the amount of probe degradation could not be calculated (Fig. 7 (d)-(f)). This could be inferred that the 5' nuclease located at the N terminus of the enzyme was removed, so the probe was not degraded. In addition, based on the results calculated in Table 3, the amount of probe degradation according to the concentration of polymerase was plotted and shown in Fig. 8.

[0275] As shown in Fig. 8, the concentration at which the activity of 1 unit of polymerase (consuming 10 nmole of dNTP for 30 minutes at 75°C) was observed through radioisotope measurement of each enzyme was determined using DreamTaq DNA polymerase (Thermo Scientific) at 72°C for 30 minutes according to this example. TM ) was confirmed to correspond to the level of degrading 1.28 pmole of probe for TaqDNA polymerase (Qiagen), 0.80 pmole of probe for TaqDNA polymerase (Qiagen), and 1.77 pmole of probe for rTth DNA polymerase (TOYOBO) at 72°C for 30 minutes.

[0276] The above results demonstrate that the method of this example can be used to compare the activities of polymerases.

[0277]

[0278] While specific aspects of the present invention have been described in detail above, it should be apparent to those skilled in the art that these specific descriptions are merely preferred embodiments and do not limit the scope of the present invention. Therefore, the substantial scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A method for analyzing the activity of 5' nuclease comprising the following steps: (a) providing a composition for activity assay comprising (i) a dimer-forming primer pair and (ii) probes; The dimer-forming primer pair comprises a first primer and a second primer, each of the first primer and the second primer comprising a 5'-probe-hybridizing region and a 3'-dimer-forming region in a 5' to 3' direction, the nucleotide sequence of the 3'-dimer-forming region in the first primer is complementary to the nucleotide sequence of the 3'-dimer-forming region in the second primer, the nucleotide sequence of the 5'-probe-hybridizing region of each of the first primer and the second primer is complementary to the nucleotide sequence of each of the probes, and a dimer-primer is formed through hybridization between the 3'-dimer-forming regions of the first primer and the second primer, and each of the probes is hybridized to the 5'-probe-hybridizing region of each of the first primer and the second primer, which are both strands of the dimer-primer. Forming a dimer primer and probe complex, and (b) adding the 5' nuclease to the active assay composition and incubating the resultant; the 5' ends of the probes of the dimer-primer and probe complex are degraded by the 5' nuclease, thereby providing a detectable signal; (c) a step of measuring the signal provided over time; the change in the signal over time indicates the activity of the 5' nuclease.

2. A method according to claim 1, characterized in that the 5' nuclease is an exonuclease or an endonuclease.

3. A method according to claim 1, characterized in that the 5' nuclease is a DNA polymerase or flap endonuclease (FEN) having 5' nuclease activity.

4. A method according to claim 1, characterized in that the active assay composition does not contain dNTPs or NTPs.

5. A method according to claim 1, wherein each of the first primer and the second primer has a length of 7 to 100 nucleotides.

6. A method according to claim 1, wherein each of the 3'-dimer forming regions of the first primer and the second primer is 3 to 50 nucleotides in length.

7. A method according to claim 1, wherein each of the 5'-probe-hybridizing regions of the first primer and the second primer is 3 to 50 nucleotides in length.

8. A method according to claim 1, wherein the dimer-forming primer pair is a self-dimer-forming primer pair, each of the first primer and the second primer is a self-dimer-forming primer, the 3'-dimer-forming region is a 3'-hairpin-forming region, the dimer-forming dimer-primer is a self-dimer-forming self-dimer-primer, and the dimer-primer and probe complex is a self-dimer-primer and probe complex.

9. A method according to claim 8, wherein the 5'-probe-hybridizing region of the self-dimer-forming primer has a nucleotide sequence that is substantially non-complementary to the 5'-probe-hybridizing region and 3'-hairpin-forming region of another self-dimer-forming primer of the same sequence.

10. A method according to claim 8, wherein the 3'-hairpin-forming region of the self-dimer-forming primer has a nucleotide sequence substantially complementary to the 3'-hairpin-forming region of another self-dimer-forming primer of the same sequence.

11. A method according to claim 8, wherein the 3'-hairpin-forming region of the self-dimer-forming primer has a substantially palindromic sequence.

12. A method according to claim 1, characterized in that when the 3'-hairpin-forming region of the self-dimer-forming primer is n nucleotides long, the m-th nucleotide base from the 3'-end is complementary to the n-m+1-th nucleotide base (wherein n is an integer from 5 to 50, and m is an integer greater than or equal to 1).

13. A method according to claim 1, characterized in that the length of the 5'-probe-hybridizing region of the self-dimer-forming primer and the length of the 3'-hairpin-forming region of the self-dimer-forming primer are in a ratio of about 1:

1.

14. A method according to claim 1, wherein the probes are 5 to 50 nucleotides in length.

15. A method according to claim 1, wherein, in the dimer-primer and probe complex, the interval between the 3' end of the primer and the 5' end of the probe adjacent to the 3' end of the primer is 0 to 15 nucleotides in length.

16. A method according to claim 1, characterized in that the incubation is performed isothermally, wherein a 5' nuclease operates to degrade the 5' end of the probe of the formed dimer-primer and probe complex.

17. A method according to claim 1, characterized in that the isotherm is a temperature selected from 65 to 80°C.

18. A method according to claim 1, wherein the detectable signal is provided by (i) a dual label linked to each of the probes, or (ii) a label linked to the first primer and / or the second primer and a label linked to each of the probes.

19. A method according to claim 1, wherein the active assay composition does not contain any additional oligonucleotides other than the dimer-forming primer pair and probes.

20. A method according to claim 1, characterized in that the change in the signal is measured for a time at which a function of the incubation time versus the signal intensity exhibits a linear function.

21. A method according to claim 20, characterized in that the activity of the 5' nuclease is provided as a slope measured in a range in which the intensity of the signal increases linearly with respect to the incubation time depending on the concentration or mass of the 5' nuclease.

22. A method according to claim 21, characterized in that the intensity of the signal is converted into the amount of the decomposed probe.

23. A composition for assaying the activity of 5' nuclease comprising: (a) a dimer-forming primer pair; the dimer-forming primer pair comprises a first primer and a second primer, each of the first primer and the second primer comprising a 5'-probe-hybridizing region and a 3'-dimer-forming region in a 5' to 3' direction, the nucleotide sequence of the 3'-dimer-forming region in the first primer being complementary to the nucleotide sequence of the 3'-dimer-forming region in the second primer, and a dimer-primer formed by hybridization between the 3'-dimer-forming regions of the first primer and the second primer, and (b) probes; the nucleotide sequence of the 5'-probe-hybridization region of each of the first primer and the second primer is complementary to the nucleotide sequence of each of the probes, and each of the probes hybridizes to the 5'-probe-hybridization region of each of the first primer and the second primer, which are both strands of the dimer-primer, to form a dimer-primer and probe complex.

24. A composition according to claim 23, characterized in that the composition does not contain dNTPs or NTPs.

25. A composition according to claim 23, wherein the dimer-forming primer pair is a self-dimer-forming primer pair, each of the first primer and the second primer is a self-dimer-forming primer, the 3'-dimer-forming region is a 3'-hairpin-forming region, the dimer-forming dimer-primer is a self-dimer-forming self-dimer-primer, and the dimer-primer and probe complex is a self-dimer-primer and probe complex.

26. A composition according to claim 23, characterized in that the composition further comprises (i) a dual label linked to each of the probes, or (ii) a label linked to the first primer and / or the second primer and a label linked to each of the probes.

Images