Composition for preventing or treating liver fibrosis or liver fibrosis-associated diseases, comprising USP10 inhibitor as active ingredient

The use of a USP10 inhibitor, like spautin-1, addresses liver fibrosis by inhibiting USP10 expression and activity, effectively reducing fibrosis progression and associated symptoms.

WO2026005409A1PCT designated stage Publication Date: 2026-01-02UI (UNIVERSITY IND FOUNDATION) YONSEI UNIVERSITY
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2025/008694
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-06-25
Filing Date
2025-06-23
Publication Date
2026-01-02

AI Technical Summary

Technical Problem

Liver fibrosis, caused by chronic inflammation, leads to irreversible cirrhosis and increased mortality, with non-viral hepatitis and metabolic diseases contributing significantly to its incidence and severity, and existing treatments are inadequate.

Method used

A composition comprising a USP10 inhibitor, such as spautin-1, is used to inhibit the expression and activity of USP10, thereby reducing liver fibrosis progression and associated symptoms.

Benefits of technology

The USP10 inhibitor effectively inhibits liver fibrosis and related diseases by suppressing collagen deposition and markers like collagen 1, fibronectin, and alpha smooth muscle actin, offering therapeutic and preventive benefits.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2025008694_02012026_PF_FP_ABST
    Figure KR2025008694_02012026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a composition for preventing or treating liver fibrosis or liver fibrosis-associated diseases, comprising a USP10 inhibitor as an active ingredient. The composition comprising a USP10 inhibitor as an active ingredient, of the present invention, was confirmed to inhibit the activity and / or expression levels of collagen and fibronectin, which are associated with liver fibrosis. Thus, the composition can be used to enhance the effect of treating liver fibrosis and / or liver fibrosis-associated diseases.
Need to check novelty before this filing date? Find Prior Art

Description

Composition for preventing or treating liver fibrosis or liver fibrosis-related diseases, comprising a USP10 inhibitor as an active ingredient

[0001] The present invention relates to a composition for preventing or treating liver fibrosis or a liver fibrosis-related disease, comprising a USP10 inhibitor as an active ingredient.

[0002] When liver tissue is damaged and an inflammatory response occurs, hepatic stellate cells are activated to heal the wounds, secreting large amounts of collagen and the extracellular matrix (ECM). However, if the inflammatory response progresses chronically and this wound healing process becomes excessive, liver fibrogenesis occurs. If liver fibrosis continues, large amounts of collagen are deposited within the liver tissue, and regenerative crystals are surrounded by this collagen, resulting in an abnormal liver structure, which can develop into cirrhosis.

[0003] Liver fibrosis is caused by a chronic inflammatory response in the liver tissue. The causes of this inflammatory response are known to include hepatitis caused by viral infection, alcohol consumption, drug abuse, autoimmune disease, metabolic disorder, cholestasis, and other causes. In particular, in addition to viral hepatitis caused by infection with hepatitis B virus (HBV), the incidence of non-viral hepatitis, mainly caused by non-alcoholic liver disease or metabolic disease, is increasing, and the patient rate and mortality rate of this non-viral liver fibrosis are also increasing.

[0004] When liver fibrosis progresses to cirrhosis, it becomes an irreversible chronic disease in which normal restoration of liver tissue is difficult, and as a result, it progresses to decompensated cirrhosis or liver cancer, and the mortality rate continues to increase.

[0005] Against this backdrop, the inventors of the present invention discovered a compound that can effectively treat diseases related to liver fibrosis, such as liver fibrosis and non-alcoholic steatohepatitis, and confirmed its excellent therapeutic or preventive efficacy, thereby completing the present invention.

[0006] One aspect provides a pharmaceutical composition for preventing or treating liver fibrosis or a liver fibrosis-related disease, comprising a USP10 inhibitor as an active ingredient.

[0007] Another aspect provides a food composition for preventing or improving liver fibrosis or liver fibrosis-related diseases, comprising a USP10 inhibitor as an active ingredient.

[0008] Another aspect provides a feed composition for preventing or improving liver fibrosis or liver fibrosis-related diseases, comprising a USP10 inhibitor as an active ingredient.

[0009] Another aspect provides a method for screening for a therapeutic agent for liver fibrosis or a liver fibrosis-related disease, comprising: 1) treating a candidate substance in an in vitro model expressing USP10; and 2) determining the level of USP10 expression or activity in the model.

[0010] Another aspect provides a composition for diagnosing liver fibrosis or a liver fibrosis-related disease, comprising a preparation capable of measuring the expression level of a USP10 protein, a fragment thereof, or a gene encoding the same.

[0011] One aspect is to provide a pharmaceutical composition for preventing or treating liver fibrosis or a liver fibrosis-related disease, comprising a USP10 inhibitor as an active ingredient.

[0012] The term "USP (Ubiquitin-specific protease)" in this specification refers to one of the deubiquitinating enzymes (DUB), which is an enzyme involved in the deubiquitination reaction.

[0013] The above USP10 inhibitor may inhibit the expression and / or activity of USP10.

[0014] The term "agent capable of inhibiting the expression or activity of USP10" or "inhibitor of the expression or activity of USP10" in this specification refers to a substance capable of inhibiting the expression or activity of USP10 by directly or indirectly binding to a gene, mRNA, or protein encoding USP10. In this specification, the agent capable of inhibiting the expression or activity of USP10 may be used in the same sense as USP10 inhibitor or USP10 inhibitor.

[0015] The agent capable of inhibiting the expression or activity of the above USP10 is not particularly limited thereto, but as a specific example, the agent capable of inhibiting the expression of USP10 may be characterized by being selected from the group consisting of miRNA, siRNA, shRNA, antisense oligonucleotide and combinations thereof that complementarily bind to the mRNA of the gene encoding USP10, and the agent capable of inhibiting the activity of USP10 may be characterized by being selected from the group consisting of antibodies, aptamers, small molecules and combinations thereof that complementarily bind to the protein of USP10.

[0016] The term "miRNA, siRNA or shRNA" as used herein refers to a nucleic acid molecule that primarily binds to mRNA transcribed from a target gene to inhibit translation of said mRNA in order to mediate RNA interference or gene silencing. Since the siRNA or shRNA can inhibit the expression of a target gene at the translation level, it can be used in an efficient gene knockdown method or gene therapy method, and for the purposes of the present specification, it can be used to inhibit the expression of USP10.

[0017] In one embodiment, the USP10 inhibitor may be an siRNA, and the siRNA may comprise one or more sequences selected from the group consisting of SEQ ID NOs: 1 to 2, and specifically, a pair of sequences consisting of SEQ ID NOs: 1 and 2.

[0018] The term "antisense oligonucleotide" as used herein means DNA or RNA or a derivative thereof containing a nucleic acid sequence complementary to the sequence of a specific mRNA, which binds to the complementary sequence in the mRNA and exhibits the effect of inhibiting the translation of the mRNA into protein, and for the purposes of this specification, can be used to inhibit the expression of USP10.

[0019] The term "antibody" as used herein refers to a proteinaceous molecule capable of specifically binding to an antigenic site of a protein or peptide molecule. Such antibodies can be produced by cloning each gene into an expression vector according to a conventional method to obtain a protein encoded by the marker gene, and then producing the obtained protein by a conventional method. In the present specification, the antibody can be interpreted as a means capable of inhibiting the activity of the activated USP10 protein by binding to the protein. As a specific example, a polyclonal antibody, a monoclonal antibody, or a part thereof having antigen binding property capable of specifically binding to USP10 is included in the antibody, and not only all immunoglobulin antibodies can be included, but also special antibodies such as humanized antibodies can be included. In addition, the antibody can be a complete form having two full-length light chains and two full-length heavy chains, as well as a form including a functional fragment of the antibody molecule. A functional fragment of an antibody molecule means a fragment that possesses at least an antigen-binding function, and can be Fab, F(ab'), F(ab') 2, and Fv, etc.

[0020] The term "aptamer" as used herein refers to a nucleic acid molecule having binding activity to a predetermined target molecule. The aptamer may be RNA, DNA, a modified nucleic acid, or a mixture thereof, and may be linear or cyclic. In general, the shorter the nucleotide sequence constituting the aptamer, the easier it is to chemically synthesize and mass-produce, the better the cost-effectiveness, the easier it is to chemically modify, the better the in vivo stability, and the lower the toxicity. In the present specification, the aptamer may be interpreted as a means capable of inhibiting the activity of an activated USP10 protein by binding to the protein.

[0021] The term "small molecule" as used herein refers to a small molecular weight organic compound that binds to a biopolymer such as a protein and modulates its function. It may be naturally derived or artificially synthesized, and may inhibit the function of the protein or interfere with protein-protein interactions, but is not limited thereto. For the purposes of this specification, the small molecule compound includes, without limitation, any molecule that inhibits the activity of the activated USP10 protein, and a specific example thereof includes, but is not limited to, a molecule that binds to activated USP10 and inhibits its activity.

[0022] The above USP10 inhibitor may include at least one selected from the group consisting of Spautin-1, USP10-IN-3, USP10-IN-9, Wu-5, P22077, HBX19818, and Quercetin, and specifically, the USP10 inhibitor may include Spautin-1.

[0023] The term "Spautin-1" in this specification refers to a compound represented by the following chemical formula 1 (IUPAC name: 6-Fluoro-N-[(4-fluorophenyl)methyl]-4-quinazolinamine or 6-Fluoro-N-(4-fluorobenzyl)quinazolin-4-amine) (CAS Number: 1262888-28-7), C 15 H 11 It is expressed by the chemical formula F2N3.

[0024] [Chemical Formula 1]

[0025]

[0026] In one embodiment, the spautin-1 or a composition comprising the same can inhibit the activity and / or expression level of USP10.

[0027] The term "USP10-IN-3" in this specification refers to a compound represented by the following chemical formula 2 (IUPAC name: 9-chloro-N-(3-(dipropylamino)propyl)-5, 6, 7, 8-tetrahydroacridine-3-carboxamide) (CAS Number: 904448-58-4), C 23 H 32 It is expressed by the chemical formula ClN3O.

[0028] [Chemical Formula 2]

[0029]

[0030] The term "USP10-IN-9" in this specification refers to a compound represented by the following chemical formula 3 (IUPAC name: N-(3-(benzyl(ethyl)amino)propyl)-9-chloro-2, 3-dihydro-1H-cyclopenta[b]quinoline-6-carboxamide) (CAS Number: 902281-60-1), C 25 H 28 It is expressed by the chemical formula ClN3O.

[0031] [Chemical Formula 3]

[0032]

[0033] The term "Wu-5" in this specification refers to a compound represented by the following chemical formula 4 (IUPAC name: Ethyl 5-(4-(methoxycarbonyl)phenoxy)-4-nitrothiophene-2-carboxylate) (CAS Number: 2630378-05-9), C 15 H 13 It is expressed by the chemical formula NO7S.

[0034] [Chemical Formula 4]

[0035]

[0036] The term "P22077" in this specification refers to a compound represented by the following chemical formula 5 (IUPAC name: 1-(5-(2,4-Difluorophenylthio)-4-nitrothiophen-2-yl)ethanone) (CAS Number: 1247819-59-5), C 12 It is expressed by the chemical formula H7F2NO3S2.

[0037] [Chemical Formula 5]

[0038]

[0039] The term "HBX19818" in this specification refers to a compound represented by the following chemical formula 6 (IUPAC name: N-(3-(benzyl(methyl)amino)propyl)-9-chloro-5,6,7,8-tetrahydroacridine-2-carboxamide) (CAS Number: 1426944-49-1), C 25 H 28 It is expressed by the chemical formula ClN3O.

[0040] [Chemical Formula 6]

[0041]

[0042] The term "Quercetin" in this specification refers to a compound represented by the following chemical formula 7 (IUPAC name: 3,3`,4`,5,7-Pentahydroxyflavone) (CAS Number: 117-39-5), C 15 H 10 It is expressed by the chemical formula O7.

[0043] [Chemical Formula 7]

[0044]

[0045] The composition may include at least one selected from the group consisting of a compound having USP10 inhibitory activity as the USP10 inhibitor, a stereoisomer thereof, a pharmaceutically acceptable salt thereof, a hydrate thereof, and a solvate thereof, and specifically, the composition may include at least one selected from the group consisting of a spautin-1 compound represented by the chemical formula 1, a stereoisomer thereof, a pharmaceutically acceptable salt thereof, a hydrate thereof, and a solvate thereof.

[0046] The term "pharmaceutically acceptable salt" in this specification refers to a salt that can be used pharmaceutically among salts, which are substances in which cations and anions are bound by electrostatic attraction, and can typically be a metal salt, a salt with an organic base, a salt with an inorganic acid, a salt with an organic acid, a salt with a basic or acidic amino acid, etc. For example, the metal salt can be an alkali metal salt (sodium salt, potassium salt, etc.), an alkaline earth metal salt (calcium salt, magnesium salt, barium salt, etc.), an aluminum salt, etc.; the salt with an organic base can be a salt with triethylamine, pyridine, picoline, 2,6-lutidine, ethanolamine, diethanolamine, triethanolamine, cyclohexylamine, dicyclohexylamine, N,N-dibenzylethylenediamine, etc.; the salt with an inorganic acid can be a salt with hydrochloric acid, hydrobromic acid, nitric acid, sulfuric acid, phosphoric acid, etc. Salts with organic acids include salts with formic acid, acetic acid, trifluoroacetic acid, phthalic acid, fumaric acid, oxalic acid, tartaric acid, maleic acid, citric acid, succinic acid, methanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid, etc.; salts with basic amino acids include salts with arginine, lysine, ornithine, etc.; salts with acidic amino acids include salts with aspartic acid, glutamic acid, etc. Particularly preferred salts include, when the compound has an acidic functional group therein, inorganic salts such as alkali metal salts (e.g., sodium salts, potassium salts, etc.), alkaline earth metal salts (e.g., calcium salts, magnesium salts, barium salts, etc.), and organic salts such as ammonium salts; and, when the compound has a basic functional group therein, salts with inorganic acids such as hydrochloric acid, hydrobromic acid, nitric acid, sulfuric acid, phosphoric acid, etc., and salts with organic acids such as acetic acid, phthalic acid, fumaric acid, oxalic acid, tartaric acid, maleic acid, citric acid, succinic acid, methanesulfonic acid, p-toluenesulfonic acid, etc.

[0047] The term "liver fibrosis" or "liver fibrogenesis" in this specification refers to the wound healing process that occurs when collagen, secreted in large quantities by activated hepatic stellate cells, combines with the extracellular matrix (ECM) as an inflammatory response continues due to tissue damage. If liver fibrosis continues to progress, a large amount of collagen is deposited within the liver tissue, and regenerative nodules may develop into cirrhosis, in which they are surrounded by collagen and take on an abnormal structure.

[0048] The term "liver fibrosis-related disease" as used herein may refer to a disease that may develop as liver tissue progresses to fibrosis and / or a disease that causes liver fibrosis. The hepatitis-related disease may include at least one selected from the group consisting of liver fibrosis, liver fibrosis, alcoholic steatohepatitis, non-alcoholic steatohepatitis, cirrhosis, liver cirrhosis, and liver failure. In addition, the liver cirrhosis may include at least one selected from the group consisting of portal cirrhosis, post-necrotic cirrhosis, biliary cirrhosis, nutritional cirrhosis, alcoholic cirrhosis, viral hepatitis cirrhosis, cholestatic cirrhosis, and cardiac cirrhosis.

[0049] A composition comprising the above USP10 inhibitor (specifically, spautin-1) may inhibit the induction or progression of liver fibrosis, or reduce or inhibit fibrosis that has already progressed.

[0050] The composition comprising the above USP10 inhibitor (specifically, spautin-1) may suppress the activity and / or expression level of a liver fibrosis marker. The liver fibrosis marker may include at least one selected from the group consisting of collagen 1, fibronectin, and alpha smooth muscle actin (α-SMA).

[0051] The term “treatment” in this specification means any action that improves or beneficially changes the symptoms of liver fibrosis or a liver fibrosis-related disease by administering the composition of the present invention.

[0052] The term “prevention” in this specification means any action that inhibits or delays the possibility of developing liver fibrosis or a liver fibrosis-related disease by administering the composition of the present invention.

[0053] The composition may contain the USP10 inhibitor at a concentration of 0.1 to 100 μM, specifically 0.1 to 100 μM, 0.1 to 80 μM, 0.1 to 60 μM, 0.1 to 40 μM, 0.1 to 20 μM, 0.1 to 15 μM, 0.1 to 10 μM, 0.1 to 8 μM, 0.1 to 6 μM, 0.1 to 5 μM, 0.5 to 100 μM, 0.5 to 80 μM, 0.5 to 60 μM, 0.5 to 40 μM, 0.5 to 20 μM, 0.5 to 15 μM, 0.5 to 10 μM, 0.5 to 8 μM, 0.5 to 6 μM, 0.5 to 5 μM, 1 to 100 μM, 1 to 80 μM, 1 to 60 μM, 1 to 40 μM, 1 to 20 μM, 1 to 15 μM, 1 to 10 μM, 1 to 8 μM, 1 to 6 μM, 1 to 5 μM. 2 to 100 μM, 2 to 80 μM, 2 to 60 μM, 2 to 40 μM, 2 to 20 μM, 2 to 15 μM, 2 to 10 μM, 2 to 8 μM, 2 to 6 μM, 2 to 5 μM, 2.5 to 100 μM, 2.5 to 80 μM, 2.5 to 60 μM, 2.5 to 40 μM, 2.5 to 20 μM, 2.5 to 15 μM, 2.5 to 10 μM, 2.5 to 8 μM, 2.5 to 6 μM, 2.5 to 5 μM, 4 to 100 μM, 4 to 80 μM, 4 to 60 μM, 4 to 40 μM, 4 to 20 μM, 4 to 15 μM, 4 to 10 μM, 4 to 8 μM, 4 to 6 μM, 4 to 5 μM, 5 to 100 μM, 5 to 80 μM, 5 to 60 μM, 5 to 40 μM, 5 to 20 μM, 5 to 15 μM, 5 to 10 μM, 5 to 8 μM, 5 to 6 μM, 6 to 100 μM, 6 to 80 μM, 6 to 60 μM, 6 to 40 μM, 6 to 20 μM, 6 to 15 μM, 6 to 10 μM, 6 to It may be included at a concentration of 8 μM, 7 to 100 μM, 7 to 80 μM, 7 to 60 μM, 7 to 40 μM, 7 to 20 μM, 7 to 15 μM, 7 to 10 μM, 7 to 8 μM, 7.5 to 100 μM, 7.5 to 80 μM, 7.5 to 60 μM, 7.5 to 40 μM, 7.5 to 20 μM, 7.5 to 15 μM, 7.5 to 10 μM or 7.5 to 8 μM.

[0054] In one embodiment, the composition may further comprise a known agent for treating liver fibrosis or a liver fibrosis-related disease, and specifically, may further comprise at least one selected from the group consisting of Resmetirom, lanifibranor, semaglutide, and Efruxifermin.

[0055] In one embodiment, the USP10 inhibitor or a composition comprising the same may be administered in combination with a known agent for treating liver fibrosis or a liver fibrosis-related disease, and specifically may be administered simultaneously and / or sequentially.

[0056] The pharmaceutical composition may include a pharmaceutically acceptable carrier. The term "pharmaceutically acceptable carrier" may refer to a carrier or diluent that does not stimulate a living organism and does not inhibit the biological activity or properties of the compound being injected. Here, "pharmaceutically acceptable" means that the carrier does not inhibit the activity of the active ingredient and does not exhibit toxicity exceeding the adaptability of the subject of application (prescription). Any carrier commonly used in the art and pharmaceutically acceptable may be used in the pharmaceutical composition. Non-limiting examples of the above carriers include lactose, dextrose, maltodextrin, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, glycerol, ethanol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, saline solution, sterile water, Ringer's solution, buffered saline, albumin injection solution, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, or mineral oil. These may be used alone or in combination of two or more. The pharmaceutical composition may be prepared as an oral formulation or a parenteral formulation according to the route of administration by a conventional method known in the art, including a pharmaceutically acceptable carrier in addition to the active ingredient. The above pharmaceutical composition can be formulated and used in the form of oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, external preparations, suppositories, or sterile injection solutions, each according to a conventional method.

[0057] The above pharmaceutical composition may be formulated and used in the form of oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc., external preparations, suppositories, or sterile injectable solutions, respectively, according to conventional methods. When formulating the above pharmaceutical composition, it may be prepared by adding diluents or excipients such as fillers, bulking agents, binders, wetting agents, disintegrants, or surfactants that are commonly used.

[0058] When the above pharmaceutical composition is manufactured into an oral dosage form, it can be manufactured into a dosage form such as powder, granules, tablets, pills, dragees, capsules, liquids, gels, syrups, suspensions, wafers, etc., using a suitable carrier according to a method known in the art. At this time, examples of suitable pharmaceutically acceptable carriers include sugars such as lactose, glucose, sucrose, dextrose, sorbitol, mannitol, and xylitol; starches such as corn starch, potato starch, and wheat starch; cellulosics such as cellulose, methylcellulose, ethylcellulose, sodium carboxymethylcellulose, and hydroxypropylmethylcellulose; polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, magnesium stearate, mineral oil, malt, gelatin, talc, polyols, and vegetable oils. In case of formulation, the formulation may include diluents and / or excipients such as fillers, bulking agents, binders, wetting agents, disintegrants, and surfactants, as needed.

[0059] When the above pharmaceutical composition is prepared as a parenteral dosage form, it can be formulated in the form of injections, transdermal administration, nasal inhalation, and suppositories using a suitable carrier according to a method known in the art. When formulated as an injection, suitable carriers include sterile water, ethanol, polyols such as glycerol or propylene glycol, or mixtures thereof, and preferably, Ringer's solution, phosphate buffered saline (PBS) containing triethanolamine, sterile water for injection, and isotonic solutions such as 5% dextrose can be used. When formulated as a transdermal dosage form, it can be formulated in the form of ointments, creams, lotions, gels, external solutions, pastes, liniments, aerosols, etc. In the case of nasal inhalation, it can be formulated in the form of an aerosol spray using a suitable propellant such as dichlorofluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, or carbon dioxide, and in the case of formulating it as a suppository, the base can be witepsol, tween 61, polyethylene glycol, cacao butter, laurin butter, polyoxyethylene sorbitan fatty acid ester, polyoxyethylene stearate, sorbitan fatty acid ester, etc.

[0060] The above pharmaceutical composition may be administered in a pharmaceutically effective amount, wherein the term "pharmaceutically effective amount" means an amount sufficient to treat or prevent a disease at a reasonable benefit / risk ratio applicable to medical treatment or prevention, and the effective dosage level may be determined according to factors including the severity of the disease, the activity of the drug, the patient's age, weight, health, sex, the patient's sensitivity to the drug, the time of administration of the composition of the present invention used, the route of administration and the excretion rate, the treatment period, drugs used in combination or simultaneously with the composition of the present invention used, and other factors well known in the medical field. The pharmaceutical composition may be administered alone or in combination with a component known to exhibit a therapeutic effect on known liver fibrosis or liver fibrosis-related diseases. It is important to take all of the above factors into consideration and administer an amount that can achieve the maximum effect with the minimum amount without side effects.

[0061] The dosage of the pharmaceutical composition may be determined by a person skilled in the art in consideration of the intended use, degree of toxicity of the disease, age, weight, sex, medical history of the patient, or the type of substance used as the active ingredient. For example, the pharmaceutical composition of the present invention may be administered at about 0.1 ng to about 1,000 mg / kg, preferably 1 ng to about 100 mg / kg, per adult, and the frequency of administration of the composition of the present invention is not particularly limited thereto, but may be administered once a day or administered in divided doses several times. The dosage or frequency of administration does not limit the scope of the present invention in any way.

[0062]

[0063] Another aspect provides a method for treating or preventing liver fibrosis or a liver fibrosis-related disease, comprising administering to a subject a pharmaceutical composition for the prevention or treatment of liver fibrosis or a liver fibrosis-related disease. The same portions described above also apply to the method.

[0064] The term "subject" as used herein may include, without limitation, mammals, birds, reptiles, farmed fish, etc., including rats, livestock, humans, etc., that develop or are at risk of developing liver fibrosis or a liver fibrosis-related disease, and the subject may exclude humans.

[0065] The pharmaceutical composition described above may be administered in single or multiple doses in a pharmaceutically effective amount. The composition may be formulated and administered in the form of a liquid, powder, aerosol, injection, infusion solution (Ringel), capsule, pill, tablet, suppository, or patch. The pharmaceutical composition for preventing or treating liver fibrosis or liver fibrosis-related diseases may be administered via any conventional route, as long as it can reach the target tissue.

[0066] The pharmaceutical composition may be administered, but is not particularly limited thereto, via routes such as intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, transdermal patch administration, oral administration, intranasal administration, intrapulmonary administration, and rectal administration, depending on the intended purpose. However, when administered orally, it may be administered in an unformulated form, and since the active ingredient of the pharmaceutical composition may be denatured or decomposed by gastric acid, the oral composition may be administered orally in a form that coats the active agent or is formulated to protect it from decomposition in the stomach, or in the form of an oral patch. In addition, the composition may be administered by any device that allows the active ingredient to move to the target cell.

[0067] In one embodiment, the method may further comprise a step of administering to the subject a known agent for treating liver fibrosis or a liver fibrosis-related disease, specifically, a step of administering at least one selected from the group consisting of Resmetirom, lanifibranor, semaglutide, and Efruxifermin.

[0068] In one embodiment, the method comprises a step of co-administering a USP10 inhibitor or a composition comprising the same and a known treatment for liver fibrosis or a liver fibrosis-related disease, and specifically, the USP10 inhibitor or a composition comprising the same and the known treatment for liver fibrosis or a liver fibrosis-related disease may be administered simultaneously and / or sequentially.

[0069]

[0070] Another aspect provides a food composition for preventing or improving liver fibrosis or a liver fibrosis-related disease, comprising a USP10 inhibitor as an active ingredient. The same provisions as described above also apply to the composition.

[0071] The term “improvement” in this specification means any act of improving or beneficially altering the symptoms of liver fibrosis or a liver fibrosis-related disease by administration of the composition of the present invention.

[0072] The term "food" in this specification includes meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, dairy products including ice cream, various soups, beverages, tea, drinks, alcoholic beverages, vitamin complexes, health functional foods, and health foods, and includes all foods in the conventional sense.

[0073] The above food can be manufactured by a method commonly used in the art, and can be manufactured by adding raw materials and ingredients commonly added in the art during the manufacturing process. In addition, the formulation of the food can be manufactured without limitation as long as it is a formulation recognized as a food. The food composition can be manufactured in various forms of formulations, and unlike general drugs, it has the advantage of not having side effects that may occur with long-term use of drugs because it uses food as a raw material, and is highly portable, so the food composition of the present invention can be taken as a supplement to enhance the effect of improving bone-related diseases.

[0074] The above food composition may be a health functional food composition.

[0075] The term "health functional food" in this specification refers to a food manufactured and processed using raw materials or ingredients with functionality useful to the human body as defined in Act No. 6727 on Health Functional Foods, and "functionality" refers to obtaining a useful effect for health purposes, such as regulating nutrients or physiological effects for the structure and function of the human body.

[0076] The above health food refers to a food that has a more active health maintenance or promotion effect than general food, and health supplement food refers to a food for the purpose of health supplementation. In some cases, the terms health functional food, health food, and health supplement may be used interchangeably. Specifically, the above health functional food refers to a food that is made by adding a composition to food materials such as beverages, teas, spices, gum, and confectionery, or by manufacturing it in the form of capsules, powder, suspension, etc., and means that when consumed, it brings about a specific health effect. However, unlike general drugs, it has the advantage of not having the side effects that can occur with long-term use of drugs because it is made from food.

[0077] The above food composition can be used very usefully because it can be consumed on a daily basis and is expected to be highly effective in improving liver fibrosis or liver fibrosis-related diseases.

[0078] The food composition may further comprise a physiologically acceptable carrier, and the type of the carrier is not particularly limited, and any carrier commonly used in the art may be used. Specifically, the food composition may comprise additional ingredients commonly used in food compositions to improve odor, taste, sight, etc. For example, the food composition may comprise vitamins A, C, D, E, B1, B2, B6, B12, niacin, biotin, folate, pantothenic acid, etc. In addition, the food composition may comprise minerals such as zinc (Zn), iron (Fe), calcium (Ca), chromium (Cr), magnesium (Mg), manganese (Mn), copper (Cu), and chromium (Cr). In addition, the food composition may comprise amino acids such as lysine, tryptophan, cysteine, and valine.

[0079] In addition, the food composition may include food additives such as preservatives (potassium sorbate, sodium benzoate, salicylic acid, sodium dehydroacetate, etc.), bactericides (bleaching powder and high-purity bleaching powder, sodium hypochlorite, etc.), antioxidants (butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), etc.), colorants (tar colorants, etc.), color developers (sodium nitrite, sodium nitrite, etc.), bleaching agents (sodium sulfite), seasonings (MSG, monosodium glutamate, etc.), sweeteners (dulcin, cyclamate, saccharin, sodium, etc.), flavorings (vanillin, lactones, etc.), leavening agents (alum, D-potassium hydrogen tartrate, etc.), reinforcing agents, emulsifiers, thickeners (glucose fillers), film-forming agents, gum-forming agents, foam suppressants, solvents, and improvers. The above additives can be selected according to the type of food and used in an appropriate amount.

[0080] The above food composition can be added as is or used together with other foods or food ingredients, and can be used appropriately according to a conventional method. The amount of the active ingredient mixed can be appropriately determined depending on its purpose of use (prevention, health, or therapeutic treatment). Generally, when manufacturing a food or beverage, the food composition of the present invention can be added to the food or beverage in an amount of 50 parts by weight or less, specifically 20 parts by weight or less. However, when consumed for a long period of time for health and hygiene purposes, the content below the above range can be included, and since there is no problem in terms of safety, the active ingredient can also be used in an amount above the above range.

[0081] As an example of the food composition, the above-mentioned food composition may be used as a health beverage composition, and in this case, various flavoring agents or natural carbohydrates may be contained as additional ingredients, as in a conventional beverage. The above-mentioned natural carbohydrates may be monosaccharides such as glucose and fructose; disaccharides such as maltose and sucrose; polysaccharides such as dextrin and cyclodextrin; and sugar alcohols such as xylitol, sorbitol, and erythritol. The sweetener may be a natural sweetener such as thaumatin and stevia extract; or a synthetic sweetener such as saccharin and aspartame. The proportion of the natural carbohydrate may be generally about 0.01 to 0.04 g, specifically about 0.02 to 0.03 g, per 100 mL of the health beverage composition of the present invention.

[0082] In addition to the above, the health beverage composition may contain various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid, salts of pectic acid, alginic acid, salts of alginic acid, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, or carbonating agents. In addition, it may contain fruit pulp for the production of natural fruit juice, fruit juice drinks, or vegetable drinks. These ingredients may be used independently or in combination. The proportion of these additives is not particularly important, but is typically selected within the range of 0.01 to 0.1 parts by weight per 100 parts by weight of the health beverage composition of the present invention.

[0083] The above food composition may contain the compound of the present invention in various weight % if it can exhibit an effect of improving or preventing liver fibrosis or a disease related to liver fibrosis, and specifically, may contain the compound in an amount of 0.00001 to 100 wt % or 0.01 to 80 wt % relative to the total weight of the food composition, but is not limited thereto.

[0084]

[0085] Another aspect provides a feed composition for preventing or improving liver fibrosis or liver fibrosis-related diseases, comprising a USP10 inhibitor as an active ingredient. The same provisions as described above also apply to the composition.

[0086] The term "feed" in this specification may mean any natural or artificial diet, meal, etc. or a component of said meal, intended for or suitable for eating, ingesting and digesting by an animal.

[0087] The type of the above feed is not particularly limited, and feed commonly used in the relevant technical field can be used. Non-limiting examples of the above feed include plant-based feed such as grains, roots, food processing by-products, algae, fiber, pharmaceutical by-products, oils, starches, meal, or grain by-products; and animal-based feed such as proteins, inorganic substances, oils, minerals, oils, single-cell proteins, zooplankton, or food. These may be used alone or in combination of two or more types.

[0088] The above feed composition may further include known additives that can be added to improve or prevent liver fibrosis or liver fibrosis-related diseases, depending on the formulation. The feed composition may be in the form of a highly concentrated solution, powder, or granules. The feed composition may further include any protein-containing organic grain meal commonly used to meet the dietary needs of animals. The feed composition may be used by being added to animal feed by immersion, spraying, or mixing.

[0089] The above feed composition may additionally contain substances that have various effects, such as nutrient supplementation and weight loss prevention, increased digestibility and availability of fiber in feed, improved milk quality, prevention of reproductive disorders and improved conception rate, and prevention of summer heat stress. For example, the feed composition may additionally contain mineral preparations such as sodium bicarbonate, bentonite, magnesium oxide, and complex minerals; trace mineral preparations such as zinc, copper, cobalt, and selenium; vitamins such as carotene, vitamin E, vitamins A, D, and E, nicotinic acid, and vitamin B complex; protected amino acids such as methionine and lysate; protected fatty acids such as fatty acid calcium salts; probiotics (lactic acid bacteria), yeast cultures, and mold fermentations; and yeast agents.

[0090] The above feed composition can be applied to a number of animal diets, i.e., feed and drinking water, including mammals and poultry.

[0091] The above feed composition may include all of a substance added to the feed (i.e., a feed additive), a feed raw material, or the feed itself to be fed to the individual.

[0092]

[0093] Another aspect provides a method for screening for a therapeutic agent for liver fibrosis or a liver fibrosis-related disease, comprising: 1) treating a candidate substance with an in vitro model expressing USP10; and 2) determining the level of USP10 expression or activity in the model or a sample obtained therefrom. The same portions described above also apply to the method.

[0094] The in vitro model expressing the above USP10 may include a tissue, organ, or cell expressing USP10, and specifically, may be an adipocyte expressing USP10.

[0095] The above sample refers to a material derived from an in vitro model expressing the USP10, and specifically may include, but is not limited to, tissues, cells, whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid, urine, cell culture, etc. In addition, gene and / or protein samples may be obtained from these samples, and the gene sample may include nucleic acids such as DNA, mRNA, or cDNA synthesized from mRNA, and the type thereof is not limited thereto, as long as the expression level of a specific gene / protein can be confirmed therefrom.

[0096] The above candidate substance refers to an unknown substance used in screening to determine whether it affects the expression or activity of USP10. The test substance includes, but is not limited to, compounds, nucleotides, antibodies, antisense RNA, siRNA (small interference RNA), and natural product extracts.

[0097] The step of confirming the above USP10 expression or activity level may include a step of measuring the expression level of mRNA and / or protein of USP10.

[0098] The mRNA expression level of the above USP10 may be measured by any one method selected from the group consisting of RT-PCR, quantitative or semi-quantitative RT-PCR, quantitative or semi-quantitative real-time RT-PCR, northern blot, and DNA or RNA chip.

[0099] The protein expression level of the above USP10 may be measured by any one method selected from the group consisting of tissue immunostaining, enzyme-linked immunosorbent assay (ELISA), and immunoblot (Western Blot).

[0100] The above method may further include a step of determining the candidate substance as a treatment for liver fibrosis or a liver fibrosis-related disease when the expression or activity level of USP10 is reduced according to the treatment of the candidate substance.

[0101] A decrease in the expression or activity level of USP10 due to the treatment with the above candidate substance may mean that the expression or activity level of USP10 is decreased compared to the control group not treated with the candidate substance, and specifically, may mean a state in which the activity or expression amount is decreased by 20% or more compared to the control group, more specifically, a state in which the activity or expression amount is decreased by 40% or more, and even more specifically, a state in which the activity or expression amount is decreased by 60% or more.

[0102]

[0103] Another aspect provides a composition for diagnosing liver fibrosis or a liver fibrosis-related disease, comprising a formulation capable of measuring the expression level of the USP10 protein, a fragment thereof, or a gene encoding the same. The same provisions as described above also apply to the composition.

[0104] The composition can diagnose and / or predict the prognosis of liver fibrosis or a liver fibrosis-related disease in a specific individual by detecting or measuring the expression level of the USP10 protein, a fragment thereof, or a gene encoding the same.

[0105] The term "diagnosis" as used herein refers to confirming the presence or characteristics of a pathological condition. For the purposes of the present invention, "diagnosis" may refer to determining whether liver fibrosis or a liver fibrosis-related disease has developed.

[0106] The term "prognosis" in this specification refers to a prediction regarding the progression or recovery of a disease, and refers to a prospect or preliminary assessment. For the purpose of the present invention, prognosis means determining whether treatment success, survival, recurrence, metastasis, drug responsiveness, resistance, etc., are present in a subject after treatment for liver fibrosis or a liver fibrosis-related disease. In other words, it refers to an expectation regarding medical outcomes (e.g., long-term survival possibility, disease-free survival rate, etc.), and includes a positive prognosis (positive prognosis) or a negative prognosis (negative prognosis). The negative prognosis includes disease progression or mortality such as recurrence or drug resistance, and the positive prognosis includes disease improvement or stabilization such as disease remission or regression, such as a disease-free state.

[0107] The term "prediction" in this specification means to guess in advance about the medical outcome, and for the purpose of the present invention, it may mean to guess in advance the course of a patient diagnosed with liver fibrosis or a liver fibrosis-related disease (progression, improvement, relapse, drug resistance).

[0108] The term "measuring expression level" in this specification refers to measuring the presence, expression, or degree of expression of a specific protein (peptide) or a gene encoding the protein, and may specifically be measuring the expression level of the USP10 protein, a fragment thereof, or an mRNA or gene encoding the same.

[0109] Methods for measuring the expression level of the above protein may include Western blotting, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), radical immunodiffusion, Ouchterlony immunodiffusion, rocket immunoeletrophoresis, immunohistochemical staining, immunoprecipitation assay, complement fixation assay, immunofluorescence, immunochromatography, fluorescence activated cell sorter analysis (FACS), protein chip technology, or biosensor.

[0110] The method for measuring the expression level of the mRNA or gene may be reverse transcriptase polymerase chain reaction (RT-PCR), competitive RT-PCR, real-time quantitative RT-PCR, quantitative RT-PCR, RNase protection method, Northern blotting, DNA chip technology, or biosensor.

[0111] The term "agent capable of measuring expression level" in this specification means a molecule that can be used to determine the expression level of a specific protein or a gene encoding the same, and may specifically include, but is not limited to, an agent capable of detecting and / or amplifying the protein or the gene.

[0112] The above "agent capable of detecting a specific protein or a gene encoding the same" means an agent capable of specifically binding to and recognizing the specific gene or protein, or detecting and amplifying the same, and the "agent capable of amplifying a specific gene or protein" means an agent capable of increasing the number of copies of the specific gene or protein by repeating the replication thereof, and may refer to, for example, a primer capable of specifically amplifying a polynucleotide including the gene, or a probe capable of specifically binding, but is not limited thereto.

[0113] The diagnostic composition may comprise a primer, probe, nucleotide, antibody, antibody fragment or antigen-binding fragment thereof, ligand, receptor, protein or a combination thereof that specifically binds to the USP10 protein, a fragment thereof or an mRNA or gene encoding the same.

[0114]

[0115] Another aspect provides a kit for diagnosing liver fibrosis or a liver fibrosis-related disease, comprising the composition for diagnosing liver fibrosis or a liver fibrosis-related disease. The same parts described above also apply to the kit.

[0116] The above kit can diagnose liver fibrosis or liver fibrosis-related diseases by detecting the expression of USP10 protein, a fragment thereof, or mRNA or gene encoding the same or measuring the expression level.

[0117] The kit may include primers, probes or optionally antibodies recognizing a marker or fragment thereof retaining antigen binding ability for detecting the expression or measuring the expression level of the USP10 protein, fragments thereof or mRNA or gene encoding the same, as well as one or more other component compositions or devices suitable for the measurement or analysis method.

[0118] For example, a kit for diagnosing liver fibrosis or liver fibrosis-related diseases for detecting or measuring the expression level of a polynucleotide or gene may include one or more oligonucleotides that specifically bind to a polynucleotide or gene encoding the USP10 protein or a fragment thereof, and may include a primer corresponding to the gene or a partial sequence thereof, a reverse transcriptase enzyme, a Taq polymerase, a PCR primer, and dNTP, and a kit using a measurement method described in relation to the expression level of the mRNA or gene may be used to measure the expression level of the polynucleotide.

[0119] In addition, a kit for diagnosing liver fibrosis or liver fibrosis-related diseases for detecting or measuring the expression level of a polypeptide or protein may include an antibody or antibody fragment that specifically binds to the USP10 protein or a fragment thereof, and a kit using a measurement method described in relation to the expression level of the protein may be used to measure the expression level of the polypeptide.

[0120]

[0121] Another aspect provides a method for providing information for diagnosing liver fibrosis or a liver fibrosis-related disease, comprising a step of measuring the expression level of the USP10 protein, a fragment thereof, or a gene encoding the same from a biological sample isolated from an individual. The same portions described above also apply to the method.

[0122] The term "subject" in this specification means any living organism that has developed or is likely to develop liver fibrosis or a liver fibrosis-related disease, and may include, but is not limited to, mammals including dogs, cats, mice, rats, monkeys, cows, pigs, mini-pigs, livestock, humans, farmed fish, etc.

[0123] The term "sample" in this specification refers to a material derived from the individual, and specifically may include, but is not limited to, tissues, cells, whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid, urine, etc. In addition, gene and / or protein samples may be obtained from these samples, and the gene sample may include nucleic acids, for example, DNA, mRNA, or cDNA synthesized from mRNA, etc., and the type thereof is not limited thereto, as long as the expression level of a specific gene / protein can be confirmed therefrom.

[0124] The method may further include a step of measuring the expression level of the USP10 protein, a fragment thereof, or a gene encoding the same from a biological sample isolated from a control group; and a step of comparing the expression levels of the subject and the control group.

[0125] The term "control group" in this specification may mean a normal individual who has not developed liver fibrosis or a liver fibrosis-related disease, a non-liver fibrosis patient group, a non-patient group, etc.

[0126] The method may further include a step of determining that the subject has developed liver fibrosis or a liver fibrosis-related disease or predicting a high risk of developing the disease, if the expression level of the USP10 protein, a fragment thereof, or a gene encoding the same in the subject is higher than that of the control group.

[0127]

[0128] Another aspect provides a use for the prevention or treatment of liver fibrosis or liver fibrosis-related diseases using a USP10 inhibitor or a composition containing the same as an active ingredient. The same portions described above also apply to the above use.

[0129]

[0130] Another aspect provides the use of the USP10 inhibitor or a composition comprising the same in the manufacture of a medicament for preventing or treating liver fibrosis or a disease related to liver fibrosis. The same portions described above also apply to the above use.

[0131] It has been confirmed that a composition comprising the USP10 inhibitor of the present invention suppresses the activity and / or expression levels of collagen and fibronectin associated with liver fibrosis, and thus the composition can be used to enhance the therapeutic effect of liver fibrosis and / or diseases associated with liver fibrosis.

[0132] Figure 1 is a diagram showing the expression levels of USP10 and a-SMA according to treatment with USP10 siRNA.

[0133] Figure 2 is a drawing showing the results of confirming the effect of suppressing the expression level of USP10 according to treatment with spautin-1.

[0134] Figure 3 is a drawing showing the results of confirming the effect of suppressing the expression level of COL1A or fibronectin according to spautin-1 treatment.

[0135] Figure 4 is a diagram showing the level of body weight change after administering spautin-1 to a NASH animal model.

[0136] Figure 5 is a diagram showing the level of change in liver weight after administering spautin-1 to a NASH animal model.

[0137] Figure 6 is a drawing showing the level of hepatic steatosis and collagen expression by staining the liver after administering spautin-1 to a NASH animal model.

[0138] The present invention will be described in more detail through the following examples. However, these examples are provided for illustrative purposes only and the scope of the present invention is not limited to these examples.

[0139]

[0140] Example 1: Evaluation of the level of inhibition of liver fibrosis according to inhibition of USP10 expression or activity.

[0141] To evaluate the level of inhibition of liver fibrosis by suppressing USP10 expression or activity, the following experiments were performed.

[0142] Specifically, LX2 cells, which are hepatic fibroblasts, were cultured in DMEM (Welgene, Korea) supplemented with 2% FBS (Corning, NY, USA) and 1% antibiotics (Invitrogen, Carlsbad, CA, USA) at 37°C and 5% CO2. Next, human USP10 siRNA (25 nM) was treated using Lipofectamine RNAimax (Invitrogen), and after 48 h, the medium was replaced, starvation was induced with serum-free medium for 2 h, and then the cells were stimulated with 20 ng / ml TGF-β1 (PeproTech, Rehovot, Israel). The cells were collected 48 h after treatment. Next, total RNA was obtained by treating the collected cells with RNA lysis reagent (Intron), and cDNA (1 μg) was synthesized using quantitative RT-PCR master mix (TOYOBO, Osaka, Japan). Next, real-time PCR reactions were performed using SYBR Premix Ex Taq (Clontech Laboratories, Mountain View, CA, USA) equipped with ABI equipment (Applied Biosystems Inc, Foster City, CA, USA), and all results were normalized using β-actin.

[0143] Meanwhile, the sequence of USP10 siRNA is described in Table 1 below, and the primer sequence for real-time PCR reaction is described in Table 2.

[0144] USP10 siRNA sequence (5`-3`) Sequence number Forward CCUGUGGACUUGGAAAUUATT1 Reverse UAAUUUCCAAGUCCACAGGTT2

[0145] Primer sequence (5`-3`) Sequence number USP10 Forward ATTGAGTTTGGTGTCGATGAAGT3 Reverse ATTGAGTTTGGTGTCGATGAAGT4 α-SMA Forward CTGGCATCGTGCTGGACTCT5 Reverse GATCTCGGGCCAGCCAGATC6

[0146]

[0147] As a result, first, it was confirmed that the USP10 siRNA could effectively suppress the expression level of USP10. Next, in the case of α-SMA (Alpha Smooth Muscle Actin), which is known to be secreted from hepatic fibroblasts and induce fibrosis in liver tissue, the expression level increased when liver fibrosis was induced by treatment with TGF-β, and it was confirmed that it was significantly reduced by treatment with USP10 siRNA (Fig. 1).

[0148] Based on the above results, it can be seen that when the expression or activity of USP10 is inhibited, the expression level of proteins or genes related to liver fibrosis can be inhibited.

[0149]

[0150] Example 2: Confirmation of USP10 inhibitory activity of spautin-1

[0151] To determine whether Spautin-1, one of the USP10 inhibitors, can inhibit USP10 under conditions that induce liver fibrosis, the following experiments were performed.

[0152] Specifically, LX-2 cells, which are hepatic fibroblasts, were treated with TGF-β to induce hepatic fibrosis, and then cultured with 20 uM of spautin-1. Thereafter, the expression level of USP10 in the cells was confirmed by the method described in Example 1.

[0153] As a result, it was confirmed that the expression level of USP10 was increased by TGF-β treatment, and when spautin-1 was treated, the increased expression level of USP10 was significantly suppressed and lowered to a level similar to the control group (Fig. 2).

[0154] Based on the above results, it can be seen that the expression or activity level of USP10 is increased under conditions inducing liver fibrosis, and that the increased activity / expression can be suppressed by spautin-1, one of the USP10 inhibitors.

[0155]

[0156] Example 3: Confirmation of the anti-hepatic fibrosis activity of spautin-1.

[0157] To determine whether Spautin-1, one of the USP10 inhibitors, can inhibit liver fibrosis, the following experiments were performed.

[0158] Meanwhile, collagen 1 (COL1A) and fibronectin are known to be proteins secreted from hepatic fibroblasts and induce fibrosis in liver tissue. Therefore, we aimed to confirm the anti-hepatic fibrosis efficacy through the expression / activity levels of COL1A and fibronectin.

[0159] Specifically, LX-2 cells, which are hepatic fibroblasts, were treated with TGF-β to induce hepatic fibrosis, and then cultured with 20 uM spautin-1. Thereafter, the expression levels of COL1A and fibronectin in the cells were confirmed by the method described in Example 1.

[0160] As a result, it was confirmed that the expression levels of COL1A and fibronectin were increased by TGF-β treatment, and when spautin-1 was treated, the increased expression levels of COL1A and fibronectin were significantly suppressed and lowered to a level similar to that of the control group (Fig. 3).

[0161] Based on the above results, it can be seen that spautin-1, a USP10 inhibitor, can effectively treat or improve liver fibrosis.

[0162]

[0163] Example 4: Confirmation of the therapeutic efficacy of spautin-1 in liver fibrosis-related diseases.

[0164] To evaluate the therapeutic efficacy of spautin-1, one of the USP10 inhibitors, for liver fibrosis-related diseases, the following experiments were conducted.

[0165] Specifically, to secure an animal model of non-alcoholic steatohepatitis (NASH), a disease related to liver fibrosis, 13-week-old male C57BL / 6 mice were fed a Methionine and Choline Deficient L-Amino Acid Diet for 8 weeks. The mice were maintained under a specific pathogen free (SPF) 12-h light / dark cycle, and the body weights of the mice were measured at the end of each time point and finally sacrificed under anesthesia. Next, spautin-1 was dissolved in DMSO, polyethylene glycol, and distilled water, and the vehicle or spautin-1 (50 mg / kg) was administered to the NASH animal model.

[0166] Meanwhile, the above animal study was approved by the Animal Care and Use Committee of Yonsei University Health Care Institution (Animal Experiment Permit Number: 2022-0339).

[0167] First, the body weight of the NASH animal model administered with the above-mentioned spautin-1 was checked, and it was confirmed that there was no difference in the body weight between the vehicle-administered group and the spautin-1-administered group (Fig. 4). Next, the weight of the liver extracted from the animal model administered with the above-mentioned spautin-1 was compared, and it was confirmed that the liver weight of the animal model administered with spautin-1 was significantly lower (Fig. 5).

[0168] Next, to determine the degree of improvement in hepatic steatosis and the level of collagen expression, H&E and Sirius red staining were performed on the livers extracted from the animal model administered with the above-mentioned spautin-1. First, the mouse livers were isolated under anesthesia and fixed in cold 4% paraformaldehyde for 24 hours. After fixation, the liver tissues were embedded in paraffin, sectioned at 4 μm thickness, and stained with H&E for morphological analysis. In addition, for Sirius red staining, the deparaffinized liver sections were soaked in Picro Sirius Red solution for 2 hours at room temperature using the Picro Sirius Red Stain Kit (Abcam, Cambridge, UK), washed twice with 5% acidified water, and then washed twice with absolute alcohol. After staining, the sections were mounted using a hydrophilic mounting solution and analyzed using a microscope.

[0169] As a result, in the animal model administered with spautin-1, hepatic steatosis was significantly reduced, and the collagen expression level (Sirius red staining - red area) was also significantly reduced (Fig. 6).

[0170] Based on the above results, it can be seen that spautin-1, a USP10 inhibitor, can effectively treat or improve nonalcoholic steatohepatitis, one of the diseases related to liver fibrosis, and based on this, it can also be seen that it can effectively treat liver fibrosis and diseases related to it.

[0171]

[0172] The foregoing description of the present invention is provided for illustrative purposes only. Those skilled in the art will readily appreciate that the present invention can be readily modified into other specific forms without altering the technical spirit or essential characteristics of the present invention. Therefore, the embodiments described above should be understood as illustrative in all respects and not restrictive.

Claims

1. A pharmaceutical composition for preventing or treating liver fibrosis or liver fibrosis-related diseases, comprising a USP10 inhibitor as an active ingredient.

2. A pharmaceutical composition according to claim 1, wherein the USP10 inhibitor inhibits the activity or expression of USP10 or a gene encoding it.

3. A pharmaceutical composition according to claim 1, wherein the USP10 inhibitor comprises at least one selected from the group consisting of Spautin-1, USP10-IN-3, USP10-IN-9, Wu-5, P22077, HBX19818, and Quercetin.

4. A pharmaceutical composition according to claim 1, wherein the composition inhibits the expression or activity of at least one selected from the group consisting of collagen 1 and fibronectin.

5. A pharmaceutical composition according to claim 1, wherein the composition inhibits liver fibrosis.

6. A pharmaceutical composition according to claim 1, wherein the liver fibrosis-related disease comprises at least one selected from the group consisting of alcoholic steatohepatitis, non-alcoholic steatohepatitis, cirrhosis, liver cirrhosis, and liver failure.

7. A pharmaceutical composition according to claim 1, wherein the composition further comprises at least one selected from the group consisting of Resmetirom, lanifibranor, semaglutide, and efruxifermin.

8. A food composition for preventing or improving liver fibrosis or liver fibrosis-related diseases, comprising a USP10 inhibitor as an active ingredient.

9. A feed composition for preventing or improving liver fibrosis or liver fibrosis-related diseases, comprising a USP10 inhibitor as an active ingredient. 10.1) Step of treating the candidate substance to an in vitro model expressing USP10; and 2) Step of confirming the USP10 expression or activity level of the above model A method for screening for a treatment agent for liver fibrosis or a liver fibrosis-related disease, comprising:

11. In claim 10, the method 3) If the expression or activity level of USP10 is reduced as a result of the treatment of the above candidate substance, the step of determining the candidate substance as a treatment agent for liver fibrosis or liver fibrosis-related diseases A screening method comprising:

Citation Information

Patent Citations

  • Composition for treating hepatic cirrhosis

    JP2021075487A

  • Integrated circuit device

    KR1020250174391A

  • Composition comprising icaritin and quercetin for preventing or treating nonalcoholic fatty liver disease

    KR102354293B1