Methods and compositions for RNA trans-splicing

WO2026006291A3PCT designated stage Publication Date: 2026-02-05AL-SHAYEB BASEM
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/035020
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-06-24
Filing Date
2025-06-24
Publication Date
2026-02-05

AI Technical Summary

Technical Problem

Existing RNA trans-splicing technologies face inefficiencies and lack specificity, particularly in favoring trans-splicing over cis-splicing, leading to incomplete correction of genetic mutations and safety concerns from immunogenic foreign proteins.

Method used

A system comprising targeting polynucleotides, deaminase-recruiting polynucleotides, and trans-splicing donor polynucleotides is used to create a chimeric RNA sequence, utilizing deaminases to edit target RNA sequences and promote trans-splicing by recruiting deaminase polypeptides.

Benefits of technology

Enhances the efficiency and specificity of trans-splicing, allowing for targeted genetic modifications such as insertions, deletions, and substitutions, while minimizing cis-splicing and reducing immunogenic risks.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025035020_05022026_PF_FP_ABST
    Figure US2025035020_05022026_PF_FP_ABST
Patent Text Reader

Abstract

The present disclosure provides methods and compositions for RNA trans-splicing. Also disclosed are methods of treating a condition, disease, or disorder in a subject using the disclosed methods and compositions.
Need to check novelty before this filing date? Find Prior Art

Description

METHODS AND COMPOSITIONS FOR RNA TRANS-SPLICINGCROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of and priority to U.S. Provisional Application No. 63 / 663,611, filed June 24, 2024, the entire disclosure of which is hereby incorporated by reference in its entirety for all purposes.FIELD OF THE INVENTION

[0002] The invention relates generally to methods and compositions for RNA transsplicing, as well as methods of treating a condition, disease, or disorder in a subject using the disclosed methods and compositions.BACKGROUND

[0003] RNA splicing is a critical biological process in eukaryotic cells that typically involves modifying pre-mRNA transcripts into mature mRNA within the same molecule ("in cis") by the spliceosome. However, some organisms exhibit a "trans-splicing" mechanism where two splice sites located on two distinct pre-mRNAs are joined, resulting in a chimeric molecule. Trans-splicing has been developed as an RNA-based technique that reprograms gene expression by splicing together two separate RNA molecules to produce a chimeric transcript, and thus remodel the resulting protein. This technology has shown significant potential for therapeutic applications, particularly in gene correction by replacing or repairing faulty exons in transcripts.

[0004] Trans-splicing approaches have been employed in disease models, achieving RNA and protein correction using an exogenous RNA molecule. However, efficiency and specificity remain severely limited, with no clinical translation to date. One reason efficiency of trans-splicing remains low, especially on endogenous RNA transcripts, is that efficiency of the trans-splicing reaction is often far lower than that of cis-splicing, leading to incomplete correction or low levels of the therapeutic transcript, which limit the technology. Controlling the splicing machinery to favor trans-splicing over cis-splicing is difficult, especially in a complex cellular environment. There is a lack of techniques that limit cis-splicing of the target RNA while promoting or favoring trans-splicing, to facilitate the production of the chimeric RNA over the wildtype mature RNA. Furthermore, traditional RNA and DNA editing techniques often involve foreign proteins that may be immunogenic, raising safety concerns.

[0005] This disclosure offers advancements in RNA editing that may overcome these limitations.SUMMARY OF THE DISCLOSURE

[0006] Disclosed herein are methods and compositions for targeted trans-splicing of a target RNA sequence (e.g., pre-mRNA) in a cell by contacting the cell with a system comprising targeting polynucleotides, deaminase-recruiting polynucleotides, and trans-splicing donor polynucleotides to create a chimeric RNA sequence. Such methods and compositions are advantageous for a variety of genetic modifications, including insertions, deletions, and substitutions of target nucleotides or polynucleotide segments in the target RNA sequence.

[0007] Disclosed herein, in certain embodiments, is a system for targeting a nucleic acid for RNA trans-splicing, the system comprising: (a) a targeting polynucleotide comprising one or more targeting regions with complementarity to a target RNA sequence; (b) a recruiting polynucleotide capable of recruiting at least one deaminase polypeptide; and (c) a trans- splicing donor template nucleic acid comprising a splice donor (SD) and / or splice acceptor (SA), thereby targeting the nucleic acid for interacting with at the least one deaminase polypeptide, and trans-splicing with the target RNA sequence to produce a chimeric RNA polynucleotide.

[0008] In certain embodiments, the targeting polynucleotide is comprised within the trans- splicing donor template. In certain embodiments, the recruiting polynucleotide is comprised within the trans-splicing donor template. In certain embodiments, the recruiting polynucleotide comprises a nucleic acid sequence having at least 40% sequence identity to any one of SEQ ID NO: 2-102. In certain embodiments, the recruiting polynucleotide comprises a nucleic acid sequence having at least 45% sequence identity to any one of SEQ ID NO: 2-102. In certain embodiments, the recruiting polynucleotide comprises a nucleic acid sequence having at least 50% sequence identity to any one of SEQ ID NO: 2-102. In certain embodiments, the recruiting polynucleotide comprises a nucleic acid sequence having at least 55% sequence identity to any one of SEQ ID NO: 2-102. In certain embodiments, the recruiting polynucleotide comprises a nucleic acid sequence having at least 60% sequence identity to any one of SEQ ID NO: 2-102. In certain embodiments, the recruiting polynucleotide comprises a nucleic acid sequence having at least 65% sequence identity to any one of SEQ ID NO: 2-102. In certain embodiments, the recruiting polynucleotide comprises a nucleic acid sequence having at least 70% sequence identity to any one of SEQ ID NO: 2-102. In certain embodiments, the recruiting polynucleotide comprises a nucleic acid sequence having at least 75% sequence identity to any one of SEQ ID NO: 2-102. Incertain embodiments, the recruiting polynucleotide comprises a nucleic acid sequence having at least 80% sequence identity to any one of SEQ ID NO: 2-102. In certain embodiments, the recruiting polynucleotide comprises a nucleic acid sequence having at least 85% sequence identity to any one of SEQ ID NO: 2-102. In certain embodiments, the recruiting polynucleotide comprises a nucleic acid sequence having at least 90% sequence identity to any one of SEQ ID NO: 2-102. In certain embodiments, the recruiting polynucleotide comprises a nucleic acid sequence having at least 95% sequence identity to any one of SEQ ID NO: 2-102. In certain embodiments, the recruiting polynucleotide comprises a nucleic acid sequence having 100% sequence identity to any one of SEQ ID NO: 2-102.

[0009] In certain embodiments, the one or more targeting regions comprises a mismatch or imperfect complementarity to the target RNA.

[0010] In certain embodiments, the system further comprises a protein-recruiting motif.

[0011] In certain embodiments, the trans-splicing donor template comprises a binding region that interacts with an RNA-binding or RNA-modifying polypeptide. In certain embodiments, the trans-splicing donor template comprises any one of: (a) at least one exon sequence comprising coding region comprising a nucleic acid sequence encoding all or a portion of a polypeptide; (b) at least one intron sequence; (c) an internal ribosomal entry site (IRES); (d) a 2A peptide; (e) an untranslated region (UTR); (f) an SD; (g) an SA; (h) a poly(pyrimidine) tract; (i) a branch point; (j) an RNA response element; and / or (k) an aptamer.

[0012] In certain embodiments, the one or more targeting regions contains an adenosine mismatch relative to the target RNA sequence.

[0013] In certain embodiments, upon binding to the target RNA sequence, at least one deaminase polypeptide is recruited. In certain embodiments, the at least one deaminase polypeptide edits one or more adenosines in the target RNA sequence. In certain embodiments, the at least one deaminase polypeptide is an Adenosine Deaminase Acting on RNA (ADAR). In certain embodiments, the ADAR is AD ARI or ADAR2 or ADAR3.

[0014] In certain embodiments, the at least one deaminase polypeptide is endogenous to a cell or subject. In certain embodiments, the at least one deaminase polypeptide is exogenously supplied to a cell or subject. In certain embodiments, the deaminase is TadA or a recombinant ADAR.

[0015] In certain embodiments, the one or more targeting regions contains a cytosine mismatch relative to the target RNA sequence. In certain embodiments, upon binding to the target RNA sequence, at least one cytidine deaminase polypeptide is recruited. In certain embodiments, upon recruitment, the at least one cytidine deaminase polypeptide edits one ormore cytosines in the target RNA sequence. In certain embodiments, the at least one cytidine deaminase polypeptide is an activation-induced cytidine deaminase / apolipoprotein B mRNA- editing enzyme catalytic polypeptide-like (AID / APOBEC) protein. In certain embodiments, the APOBEC protein is selected from the group consisting of an APOBEC1, APOBEC2, APOBEC3A, APOBEC3B, APOBEC3C, APOBEC3E, APOBEC3F, APOBEC3G, APOBEC3H, and APOBEC4 protein.

[0016] In certain embodiments, the targeting polynucleotide comprises one or more wobblebases due to mismatches with one or more complementary bases in the targeted RNA sequence at or near the site to be edited.

[0017] In certain embodiments, the at least one deaminase polypeptide is a deaminase variant comprising a mutation in its catalytic domain. In certain embodiments, the at least one deaminase polypeptide is a deaminase variant with increased or attenuated activity. In certain embodiments, the at least one deaminase polypeptide is a truncated or augmented deaminase variant.

[0018] In certain embodiments, the system further comprises an Alu domain, or GluR2 domain, editing inducer element (EIE), hY domain, an APOBEC-recruiting domain, a stemloop or hairpin secondary structure, or a variant or combination thereof. In certain embodiments, the stem-loop or hairpin secondary structure is selected from the group consisting of MS2, PP7, SLBP, TAR, BoxB, and a variant or combination thereof.

[0019] In certain embodiments, the system further comprises a stabilization motif. In certain embodiments, the stabilization motif forms a secondary structure. In certain embodiments, the secondary structure comprises a pseudoknot, a stem-loop, or a tetraloop. In certain embodiments.

[0020] In certain embodiments, the at least one exon sequence or at least one intron sequence comprises one or more elements that promote localization to the nucleus.

[0021] In certain embodiments, the system further comprises a sequence derived from one or more of BMP2-OP1 -responsive gene (BORG), SINE-derived nuclear RNA Localization (SIRLOIN), or a sequence directing the an RNA to the vicinity of SR proteins and / or nuclear speckles.

[0022] In certain embodiments, the system further comprises one or more small RNA (sRNA) polynucleotides in the targeting polynucleotide, recruiting polynucleotide, or transsplicing donor template. In certain embodiments, the one or more sRNA polynucleotides comprise one or more microRNA (miRNA) polynucleotides or variants thereof. In certain embodiments, the one or more miRNA polynucleotides bind to the target RNA. In certainembodiments, the one or more sRNA polynucleotides comprise an archaeal-derived sRNA polynucleotide. In certain embodiments, the archaeal-derived sRNA polynucleotide is selected from the group consisting of sR-h45, sRl 1, sR38, sR7, or sR21 or a variant thereof. In certain embodiments, the one or more archaeal-derived sRNA polynucleotides comprise a single long hairpin sequence and an ACA box sequence. In certain embodiments, the one or more sRNA polynucleotides comprise up to three hairpin sequences. In certain embodiments, the one or more sRNA polynucleotides comprise a C / D box sequence. In certain embodiments, the one or more sRNA polynucleotides comprise a protein-binding motif. In certain embodiments, the one or more sRNA polynucleotides comprise a kink-(k)-tum sequence. In certain embodiments, the one or more sRNA polynucleotides comprise an H box (consensus ANANNA) in at least one stem -loop sequence. In certain embodiments, the one or more sRNA polynucleotides comprise a human telomerase (hTR) RNA sequence or a segment or variant thereof in the targeting polynucleotide, recruiting polynucleotide, or the trans-splicing donor template. In certain embodiments, the one or more sRNA polynucleotides comprise a yeast snRNA sequence. In certain embodiments, the yeast snRNA sequence is selected from the group consisting of snR4 (e.g., SEQ ID NO: 94), snR45, snR30, snR40, snR41, snR57, snR51, and snR55. In certain embodiments, the one or more sRNA polynucleotides comprise a plant or metazoan snoRNA sequence. In certain embodiments, the plant or metazoan snoRNA sequence is an H / ACA or C / D box RNA sequence or U13 snoRNA sequence. In certain embodiments, the plant or metazoan snoRNA sequence comprises two hairpin sequences followed by a single-stranded H (AnAnnA) and ACA box motif. In certain embodiments, the plant or metazoan snoRNA sequence is an ACA 19 RNA sequence. In certain embodiments, the one or more sRNA polynucleotides comprise one or more regions that are partially complementary to the target RNA sequence. In certain embodiments, the one or more regions that are partially complementary to the target RNA sequence are between 3 to about 40 nucleotides in length. In certain embodiments, the one or more regions that are partially complementary to the target RNA allow for hybridization with the target RNA sequence via Watson-Crick or wobble base pairing. In certain embodiments, binding of the sRNA to the target RNA results in one or more nucleotides in the target RNA sequence to be acetylated. In certain embodiments, binding of the sRNA to the target RNA results in one or more nucleotides in the target RNA sequence to be pseudouridylated. In certain embodiments, binding of the sRNA to the target RNA results in one or more nucleotides in the target RNA sequence to be methylated. In certain embodiments, binding of the sRNA to the target RNA results in one or morenucleotides in the target RNA sequence to be deaminated. In certain embodiments, binding of the sRNA to the target RNA results in one or more nucleotides in target RNA sequence cleavage. In certain embodiments, the system further comprises at least one snRNA or snoRNA secondary structure that assembles into a ribonucleoprotein particle (RNP). In certain embodiments, the snRNA or snoRNA comprises a guiding region that targets RNA. In certain embodiments, the guiding region targets RNA in tandem with the RNA targeting and modification by the one or more deaminase polypeptides.

[0023] In certain embodiments, the system further comprises a CRISPR gRNA that assembles into an RNP.

[0024] In certain embodiments, the targeting polynucleotide and / or the trans-splicing donor template recruits an RNA-binding or RNA-modifying polypeptide, thereby assembling into an RNP.

[0025] In certain embodiments, the system further comprises a CRISPR-Cas system.

[0026] In certain embodiments, the targeting polynucleotide and / or the trans-splicing donor template comprises a region that binds spliceosome polypeptides.

[0027] In certain embodiments, the trans-splicing donor nucleic acid template comprises a translation-enhancing motif that enhances translation of the chimeric RNA polynucleotide. In certain embodiments, the translation-enhancing motif comprises a sequence derived from one or more of triplex from MALAT1, Woodchuck Hepatitis Virus (WHV) Posttranscriptional Regulatory Element (WPRE), the PRE of Hepatitis B virus (HPRE), or NEAT 1.

[0028] In certain embodiments, the targeting polynucleotide comprises a hairpin that recruits one or more Argonaute (AGO) proteins.

[0029] In certain embodiments, the one or more exogenous deaminase polypeptides is overexpressed or under-expressed to modulate activity of the system.

[0030] In certain embodiments, at least one component comprising the system is regulated by a small molecule.

[0031] In certain embodiments, the trans-splicing donor template comprises a splicemodifying region comprising any one of: (a) an intronic splice enhancer (ISE); (b) an intronic splice silencer (ISS); (c) an exonic splice enhancer (ESE); or (d) an exonic splice silencer (ESS).

[0032] In certain embodiments, the recruiting polynucleotide and the trans-splicing donor template are unlinked polynucleotides and supplied in-trans.

[0033] In certain embodiments, deamination of the target RNA sequence inhibits cis-splicing of target RNA sequence. In certain embodiments, deamination of the target RNA sequence promotes trans-splicing of the donor nucleic acid template.

[0034] In certain embodiments, the trans-splicing donor nucleic acid template has a length of between 2 nucleotides and 20,000 nucleotides.

[0035] In certain embodiments, the system is comprised in a recombinant expression vector. In certain embodiments, the system is operably linked to a transcriptional control element. In certain embodiments, the transcriptional control element is a promoter. In certain embodiments, the promoter is a regulatable promoter.

[0036] In certain embodiments, the chimeric RNA sequence comprises a polynucleotide encoding a degradation or degron peptide that marks a protein for degradation by a cell's protein recycling machinery. In certain embodiments, the chimeric RNA sequence comprises a polynucleotide encoding a degradation or degron peptide that marks a protein for degradation by a cell's protein recycling machinery. In certain embodiments, the chimeric RNA sequence comprises a polynucleotide encoding a fluorescent or marker peptide that marks a protein for display or detection for diagnostic applications.

[0037] In certain embodiments, the target RNA sequence is a pre-mRNA, a circular RNA, a partially spliced RNA, a non-coding RNA, a non-host cell RNA, a regulatory RNA, a coding RNA, a transfer RNA (tRNA), a pre-ribosomal RNA, a ribosomal RNA, a mature RNA with cryptic splice sites, or a long non-coding RNA (IncRNA).

[0038] Disclosed herein, in certain embodiments, is a nucleic acid encoding at least a portion of the system of the aforementioned embodiments.

[0039] Disclosed herein, in certain embodiments, is as an expression vector comprising the nucleic acid of the foregoing embodiment.

[0040] Disclosed herein, in certain embodiments, is a nanoparticle comprising the nucleic acid or the vector of the foregoing embodiments.

[0041] Disclosed herein, in certain embodiments, is a host cell comprising the nucleic acid, the expression vector, or the nanoparticle of the foregoing embodiments.

[0042] Disclosed herein, in certain embodiments, is a pharmaceutical composition comprising: (a) the system of any of the foregoing embodiments; and (b) one or more of a lipid, a polymer, a nanoparticle, a buffer, and a nuclease inhibitor.

[0043] Disclosed herein, in certain embodiments, is a method for modifying a target RNA sequence, wherein the method comprises contacting the target RNA sequence or a cell comprising the target RNA sequence with the system, the nucleic acid, the expression vector,the nanoparticle, or the pharmaceutical composition of the foregoing embodiments. In certain embodiments, the target RNA sequence is a pre-mRNA, a circular RNA, a partially spliced RNA, a non-coding RNA, a non-host cell RNA, a regulatory RNA, a coding RNA, a transfer RNA (tRNA), a pre-ribosomal RNA, a ribosomal RNA, a mature RNA with cryptic splice sites, or a long non-coding RNA (IncRNA). In certain embodiments, the modifying comprises modifying a splice junction, a splice acceptor, a splice donor, a cryptic splice site, a splicing signal, a splicing regulatory element, an intronic splicing enhancer, an intronic splicing silencer, an exonic splicing enhancer, an exonic splicing silencer.

[0044] In certain embodiments, the contacting results in the modification of the target RNA. In certain embodiments, the modification comprises insertion of a segment of the transsplicing donor nucleic acid template into the target RNA. In certain embodiments, the modification comprises replacement of a segment of the target RNA sequence with a segment of the trans-splicing donor nucleic acid template. In certain embodiments, the modification comprises replacing one or more endogenous nucleotides in the target RNA sequence with a segment of the trans-splicing donor nucleic acid template.

[0045] In certain embodiments, the target RNA sequence is comprised in a eukaryotic cell. In certain embodiments, the eukaryotic cell is a mammalian cell. In certain embodiments, the eukaryotic cell is in vitro. In certain embodiments, the eukaryotic cell is in vivo.

[0046] Disclosed herein, in certain embodiments, is a method of treating a nucleotide expansion disease in subject, comprising administering to the subject the system, the nucleic acid, the expression vector, the nanoparticle, or the pharmaceutical composition of the foregoing embodiments.

[0047] Disclosed herein, in certain embodiments, is a method of inhibiting, reducing, slowing, or preventing the aging of a subject or an age-related disease in the subject, comprising administering to the subject the system, the nucleic acid, the expression vector, the nanoparticle, or the pharmaceutical composition of the foregoing embodiments.

[0048] Disclosed herein, in certain embodiments, is a method of treating a subject with a disease or disorder associated with a mutation in a pre-mRNA comprising administering to the subject the system, the nucleic acid, the expression vector, the nanoparticle, or the pharmaceutical composition of the foregoing embodiments.

[0049] In certain embodiments, trans-splicing results in a chimeric RNA sequence that treats or alleviates the disease or does not cause or exacerbate the disease.

[0050] Disclosed herein, in certain embodiments, is a kit comprising a container comprising the system, the nucleic acid, the expression vector, the nanoparticle, or the pharmaceuticalcomposition of the foregoing embodiments and instructions for use in correcting a mutation in a pre-mRNA.BRIEF DESCRIPTION OF THE DRAWINGS

[0051] FIG. 1 is a schematic showing the mechanism of RNA cis-splicing within a eukaryotic cell, and mechanism of trans-splicing to create a chimeric transcript with the 5 ’ end of the wild-type RNA and the 3’ end of the provided RNA.

[0052] FIGS. 2A-2B are schematics depicting a representative mechanism of 5 ’ replacement using a deaminase-recruiting sequences, such as an deaminase binding sequence (DBS), where the DBS facilitates recruitment of a deaminase. One or more nearby sequences guide the hybridization of the donor RNA molecule to the target RNA. A mismatch position within the antisense targeting motif and the target RNA, such as a mismatched adenine or cytosine, can promote deamination of the target RNA. The DBS may be positioned 5’ (FIG. 2A) or 3’ (FIG. 2B) relative to a hybridizing region. The deamination site can be in a splice site such as a splice donor, thereby affecting cis-splicing and further promoting trans-splicing. Elements such as a nuclear localization motif (NLM), Exonic splicing enhancer (ESE), Exonic splicing silencer (ESS), Intronic splicing enhancer (ISE), Intronic splicing silencer (ISS) may be used. In this example, the 5’ end of the target RNA is replaced with a segment of the donor RNA.

[0053] FIG. 3 is a schematic depicting a representative mechanism of 5 ’ replacement using deaminase-recruiting sequences, such as a DBS, where the DBS sequences flank an antisense motif and facilitates recruitment of a deaminase to the RNA duplex. One or more nearby sequences can guide the hybridization of the donor RNA molecule to the target RNA. A mismatch position within the antisense targeting motif and the target RNA, such as a mismatched adenine or cytosine, can promote deamination of the target RNA. The deamination site can be in a splice site such as a splice donor, thereby affecting cis-splicing and further promoting trans-splicing. Elements such as a nuclear localization motif (NLM), Exonic splicing enhancer (ESE), Exonic splicing silencer (ESS), Intronic splicing enhancer (ISE), Intronic splicing silencer (ISS) can be used. In this example, the 5’ end of the target RNA is replaced with a segment of the donor RNA.

[0054] FIG. 4 is a schematic showing a representative mechanism of 3 ’ replacement using a deaminase-recruiting sequences, such as a DBS, wherein the DBS facilitates recruitment of a deaminase. One or more nearby sequences can guide the hybridization of the donor RNA molecule to the target RNA. A mismatch position within the targeting region and the target RNA can promote deamination of the target RNA. The deamination site is in a splice sitesuch as a splice acceptor, thereby affecting cis-splicing and further promoting trans-splicing. In this example, the 3’ end of the target RNA is replaced with a segment of the donor RNA.

[0055] FIG. 5 is a schematic showing a representative mechanism of 5’ replacement using one or more deaminase-recruiting sequences, such as an Alu-derived sequence, where the DBS facilitates recruitment of a deaminase. One or more nearby sequences can guide the hybridization of the donor RNA molecule to the target RNA. A mismatch position within the targeting region and the target RNA can promote deamination of the target RNA. The deamination site can be in a splice site such as a splice donor, thereby affecting cis-splicing and further promoting trans-splicing. In this example, the 5’ end of the target RNA is replaced with a segment of the donor RNA.

[0056] FIG. 6 is a schematic showing a representative mechanism of 5’ replacement using one or more deaminase-recruiting sequences, such as a stem loop that facilitates recruitment of one or more RNA-binding proteins. The RNA-binding protein may be fused to an exogenous deaminase can or facilitate the recruitment of an endogenous deaminase. One or more nearby sequences can guide the hybridization of the donor RNA molecule to the target RNA. A mismatch position within the targeting region and the target RNA can promote deamination of the target RNA. The deamination site can be in a splice site such as a splice donor, thereby affecting cis-splicing and further promoting trans-splicing. In this example, the 5 ’ end of the target RNA is replaced with a segment of the donor RNA

[0057] FIG. 7 is a schematic showing a representative mechanism of 5 ’ trans-splicing using one or more deaminase-recruiting sequences. A linear or a circular RNA may be provided (in trans) containing a stem loop, where the stem loop facilitates recruitment of one or more deaminases, along with the donor RNA template containing a targeting region (BD) to the target RNA to deaminate the target RNA while providing an alternative donor RNA to replace exons in the target. The RNA may be covalently linked to an endogenous or exogenous deaminase or can facilitate the recruitment of an endogenous deaminase. One or more nearby sequences can guide the hybridization of the donor RNA molecule to the target RNA. One or more sequences can hybridize to, and guide the deamination of, the target RNA. A mismatch position within the targeting region and the target RNA can promote deamination of the target RNA. The deamination site can be in a splice site such as a splice donor, thereby affecting cis-splicing and further promoting trans-splicing. In this example, the 5’ end of the target RNA is replaced with a segment of the donor RNA.

[0058] FIG. 8 is a schematic illustrating a representative archaeal -derived single-hairpin small RNA (sRNA) encoding a single long hairpin and an ACA box in complex with one or more RNA-binding proteins (RBP).

[0059] FIG. 9 is a schematic illustrating a representative yeast-derived sRNA, snR4 (e.g., SEQ ID NO: 94), in complex with a target RNA sequence. The interaction between the sRNA and the target RNA sequence is mediated by hybridization between the guide regions on the sRNA and the complementary regions on the target RNA sequence.

[0060] FIG. 10 is a schematic illustrating a resplicing assay described in Example 1, which may be used to assess trans-splicing efficiency. Successful trans-splicing of an RNA Donor (comprising a splice donor (SD) and 3’ fragment of green fluorescent protein (GFP)) to an RNA template (comprising a splice acceptor (SA), an intron, and a 5 ’ fragment of GFP) produces full-length GFP. The RNA donor further comprises a Binding Domain that hybridizes to the intron in the template RNA. A recruiting polynucleotide capable of recruiting at least one deaminase polypeptide may also be provided to promote trans-splicing, and may either be present in the same nucleic acid as the RNA donor (e.g., as illustrated) or may be provided as a discrete polynucleotide.

[0061] FIG. 11 is a pair of fluorescence micrographs demonstrating trans-splicing of an RNA donor to an RNA template, measured using the resplicing assay described in Example 1. Cells were transfected with vectors for expression of a template RNA and a donor RNA comprising a binding domain, and GFP+ cells indicate successful trans-splicing (right). The cells were not transfected with a recruitment polynucleotide. Transfection with a vector expressing a cis-splicing GFP construct was used as a positive control (left).

[0062] FIGS. 12A-12B summarize the ability of recruitment polynucleotides to enhance trans-splicing of an RNA donor to an RNA template, measured using the resplicing assay described in Example 1. Cells were transfected with vectors for the expression of a template RNA and a donor RNA (comprising a binding domain) alone as a baseline (“SMaRT” or “binding domain only”), or in combination with a guide RNA (“guide design #” or “dartRNA guide described in detail in Example 2). FIG. 12A depicts exemplary fluorescence micrographs for the indicated conditions, and schematics illustrating the expressed polynucleotides and the trans-splicing reaction. FIG. 12B is a bar graph summarizing the percentage of cells exhibiting successful RNA editing (measured as %GFP cells).

[0063] FIGS. 13A-13B summarize the ability of recruitment polynucleotides to enhance trans-splicing of an RNA donor to an RNA template, measured using the resplicing assay described in Example 1. Cells were transfected with vectors for the expression of a templateRNA and a donor RNA (comprising a binding domain) alone as a baseline (“SMaRT (Binding domain only)”), or in combination with a guide RNA (“dartRNA guide #” or “RNA design described in detail in Example 2). FIG. 13A depicts exemplary fluorescence micrographs for the indicated conditions. FIG. 13B is a bar graph summarizing the percentage of cells transduced with the vector encoding the RNA Donor (RFP+ cells) exhibiting successful RNA editing (measured as %GFP+ cells).DETAILED DESCRIPTIONDefinitions

[0064] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of skill in the art to which the claimed subject matter belongs. Generally, nomenclatures utilized in connection with, and techniques of cell and tissue culture, molecular biology, and protein and oligo- or polynucleotide chemistry and hybridization described herein are those well-known and commonly used in the art. It is to be understood that the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of any subject matter claimed. The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.

[0065] As used herein, singular forms “a,” “and,” and “the” include plural referents unless the context clearly indicates otherwise. Thus, e.g., reference to “a polynucleotide” includes a single polynucleotide and a plurality of polynucleotides.

[0066] As used herein, all numerical values or numerical ranges include whole integers within or encompassing such ranges and fractions of the values or the integers within or encompassing ranges unless the context clearly indicates otherwise. Thus, e.g., reference to a range of 90-100%, includes 91%, 92%, 93%, 94%, 95%, 95%, 97%, etc., as well as 91.1%, 91.2%, 91.3%, 91.4%, 91.5%, etc., 92.1%, 92.2%, 92.3%, 92.4%, 92.5%, etc., and so forth. In another example, reference to a range of 1-5,000 fold includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 fold, etc., as well as 1.1, 1.2, 1.3, 1.4, 1.5 fold, etc., 2.1, 2.2, 2.3, 2.4, 2.5 fold, etc., and so forth.

[0067] “About” a number, as used herein, refers to range including the number and ranging from 10% below that number to 10% above that number. “About” a range refers to 10% below the lower limit of the range, spanning to 10% above the upper limit of the range.

[0068] As used herein, the term “include” and its variations are intended to be non- restrictive. Thus, listing items does not exclude other similar items that may also beapplicable in the materials, compositions, devices, and methods of this technology. Likewise, the terms “can” and “may” and their variations are intended to be non-restrictive, indicating that mentioning certain elements or features in an embodiment does not exclude other embodiments of this technology that do not have those elements or features. Although the term “comprising” is used here as an open-ended term synonymous with “including,” “containing,” or “having,” the technology or its embodiments may also be described using more restrictive terms such as “consisting of’ or “consisting essentially of’ the listed ingredients.

[0069] The terms “patient,” “subject,” and “individual” refer interchangeably to any animal suitable for the methods described, including humans.

[0070] It is understood that, throughout the description, in each instance where an RNA is described as comprising, consisting essentially of, or consisting of a nucleotide sequence comprising one or more thymines (T), a uracil (U) may be in place of one or more of the T’s, or a U may be in place of all the T’s. Similarly, it is understood that in each instance where the nucleotide sequence of an RNA is described herein, the disclosure contemplates a polynucleotide (e.g., a DNA) that encodes that RNA, for example, a DNA comprising, consisting essentially of, or consisting of the nucleotide sequence of the RNA, wherein a T may be in place of one or more of the U’s or a T may be in place of all the U’s.Targeted trans-Splicing Systems

[0071] The present disclosure provides compositions and methods for the targeted replacement of specific RNA sequences within target RNAs.

[0072] Deaminases are enzymes that catalyze the removal of an amino group from a molecule, such as converting cytosine to uracil or adenosine to inosine (interpreted as guanine during translation) in RNA or DNA. By facilitating the recruitment of deaminases to a splice (or splice -modifying) site in the target RNA, it is possible to disfavor or ablate cissplicing, while enabling and promoting trans-splicing.

[0073] In one aspect, a targeted trans-splicing system comprises: i) an endogenous or exogenous deaminase; ii) a polynucleotide guide or deaminase-recruiting nucleic acid; iii) a trans-splicing donor nucleic acid template comprising a splice donor and / or acceptor, one or more intronic sequences, and an exon or set of exons to replace a segment of nucleic acids in the target RNA. In embodiments, a trans-splicing nucleic acid template includes the deaminase-recruiting sequence. In some aspects, one or more additional RNA binding regions are provided. In some aspects, an engineered RNA molecule or a DNA encoding the RNA molecule is provided comprising the system. In embodiments, the system comprisesone or more than one trans-splicing RNA donors. In embodiments, the composition or system comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 exons to be inserted into, or replacing, a segment of the target RNA. In some aspects, a catalytically inactive deaminase is recruited by the system but does not deaminate the target RNA.

[0074] It is understood that a nucleotide sequence does not need to be completely complementary to its target nucleic acid to achieve hybridization. It is further recognized that hybridization may occur over one or more regions of the nucleotide sequence, allowing for non-hybridizing segments within, between, or next to the hybridized regions, such as hairpins, bulges, or loops.

[0075] This disclosure provides a method for targeting trans-splicing of a target RNA (e.g., pre-mRNA) in a cell by contacting the cell with the composition, system, or nucleic acids comprising or encoding the system. When the cell interacts with these components, the binding domains of the nucleic acids bind to the target RNA, RNA-modifying proteins are recruited to the nucleic acid duplex, resulting in the preferential ligation of exons from the target RNA to exons from the nucleic acids over exons from the host RNA.

[0076] In some embodiments, this method targets trans-splicing of pre-mRNA in cells with a disease-causing mutation. By contacting the cells with the described nucleic acids, the antisense binding domains attach to the pre-mRNA, RNA-modifying proteins are recruited to the nucleic acid duplex, leading to exon ligation that removes the mutation (preferentially over host exons), resulting in an mRNA free from the disease-causing mutation.

[0077] Additionally, the method includes targeting trans-splicing of pre-mRNA in cells derived from a patient with a disease. Contacting these cells with the nucleic acids, viral vector, or pharmaceutical composition leads to the binding of the nucleic acids to the target RNA, enabling trans-splicing and exon ligation, followed by reintroduction of the cells into the patient, thereby treating or ameliorating the disease.

[0078] In various embodiments, expression and / or activity of at least one portion of the trans -splicing system is transient. In various embodiments, the activity of at least one portion of the trans-splicing system is regulated by a small molecule. In various embodiments, the small molecule is selected from abscisic acid (ABA), rapamycin (or rapalog), FK506, Cyclosporine A, FK1012, Gibberellin3-AM, FKCsA, API 903 / AP20187, and Auxin. In various embodiments, at least one portion is a deaminase polypeptide. In various embodiments, polypeptide further comprises a small molecule binding domain. In various embodiments, the polypeptide and the small molecule binding domain are linked by a peptide linker such as aglycine -serine linker. In various embodiments, the small molecule binding domain is an ABA -binding domain. In various embodiments, the ABA-binding domain comprises an ABI1 polypeptide.

[0079] In some embodiments, the targeted trans-splicing system further comprises a viral protein.

[0080] In some embodiments, the viral protein further comprises a small molecule binding domain. In some embodiments, the viral protein and the small molecule binding domain are linked by a glycine-serine linker. In various embodiments, the small molecule binding domain is an ABA- binding domain. In various embodiments, the ABA-binding domain comprises a PYL1 polypeptide. In various embodiments, the addition of ABA induces targeted trans-splicing of a target pre-mRNA.

[0081] In various embodiments, delivery of at least one portion of the trans-splicing system to the cell is viral. In various embodiments, the virus is a retrovirus, adenovirus, adeno- associated virus, herpes simplex virus, anellovirus, or baculovirus. In various embodiments, delivery of at least one portion of the trans-splicing system to a cell is non-viral. In various embodiments, the non-viral delivery system is selected from a cationic lipid vehicle, electroporation, calcium phosphate transfection, mechanical transfection, and nanoparticle delivery.Splice-Modifying Motifs

[0082] In embodiments, at least one intronic sequence comprises one or more splicemodifying motifs that modify splicing efficiency. In embodiments, the splice-modifying motif is selected from a polypyrimidine tract, a branch point, intronic splicing enhancer (ISE), intronic splicing silencer (ISS), exonic splicing enhancer (ESE), exonic splicing silencer (ESS), and / or a combination or variant thereof.Nuclear Localization Motif

[0083] In embodiments, at least one intronic or exonic sequence comprises one or more elements that enhance localization to the nucleus. In embodiments, the element comprises a sequence derived from BMP2-OP1 -responsive gene (BORG), SINE-derived nuclear RNA Localization (SIRLOIN). In some embodiments, the element comprises a sequence that enhances RNA localization to the vicinity of SR proteins.Pseudoknots

[0084] In embodiments, a trans-splicing donor nucleic acid template molecule comprises one or more a motif that further stabilizes the RNA. In some cases, the stabilization motif may form a secondary structure. Examples of such structured motifs include but are not limited to, e.g., pseudoknots, stem -loops, and tetraloops. In embodiments, the stabilization motif sequence is selected or derived from MS2, PP7, SLBP, TAR, BoxB, mpknot, fmpknot, evopreq, Zika, Dengue, AsCpflBB. a pseudoknot. In embodiments, the stabilization motif is a toehold switch. In embodiments, the pseudoknot is a naturally-occurring pseudoknot or a synthetic pseudoknot.Ribozymes

[0085] In embodiments, the trans-splicing donor nucleic acid template molecule comprises a RNA-cleaving RNA site (RCRS). In embodiments, the site is a self-cleaving ribozyme. In embodiments, the site selected from a hairpin, Hepatitis Delta Virus (HDV), hammerhead, twister, twister-sister, Varkud satellite (VS), glmS, pistol, hatchet ribozyme site or a combination or variant thereof. In embodiments, the site is a trans-cleaving ribozyme. In embodiments, the site is downstream of the one or more exons and / or introns of the trans- splicing donor nucleic acid template. In some embodiments, the site is upstream of one or more exons and / or introns of the trans-splicing donor nucleic acid template. In embodiments, the site is upstream of a poly-A sequence. In embodiments, the site is downstream from a 5’ cap. In embodiments, the site is upstream of the splice site in the trans-splicing donor nucleic acid template. In embodiments, the site is downstream of the splice donor and / or splice acceptor the trans-splicing donor nucleic acid template. In embodiments, the ribozyme cleaves the target.Enhancing Translation

[0086] In embodiments, the donor RNA comprises a motif to enhance translation of the resulting chimeric RNA. In embodiments, the motif comprises a sequence derived from triplex from MALAT1, Woodchuck Hepatitis Virus (WHV) Posttranscriptional Regulatory Element (WPRE), the PRE of Hepatitis B virus (HPRE), or NEAT 1.RNA-Binding Proteins

[0087] In embodiments, the composition comprises an RNA-binding protein (RBP) that further bolsters the interaction between the RNA donor molecule and the target RNA molecule and increases trans-splicing efficiency.

[0088] In embodiments, the composition comprises a nucleic acid motif that recruits an RBP to modify the target RNA via deamination. In some cases, the composition comprises an RBP that promotes deamination of the target RNA molecule. In embodiments, target deamination disfavors cis-splicing efficiency and / or enhances trans-splicing efficiency. In embodiments, the RBP is a deaminase.

[0089] In embodiments, the RBP binds to one or more hairpins in the RNA donor molecule. In embodiments, the hairpins are selected from one or more of: MS2, PP7, SLBP, TAR, BoxB, an Alu domain encoding sequence, a GluR2 domain encoding sequence, an editing inducer element (EIE), an hY domain encoding sequence, an Apolipoprotein B mRNA Editing Catalytic Polypeptide-like (APOBEC) recruiting domain encoding sequence, and any combination thereof. In embodiments, the hairpin is a naturally-occurring sequence or a synthetic hairpin. In embodiments, the RBP-binding hairpins are encoded adjacent to (e.g. 5’, or 3’, or both 5’ and 3’ to) one or more nucleic acid hybridizing sequences (NAHS) that hybridize to the target RNA. In embodiments, the NAHS promotes deamination of one or more sites in the complementary target RNA or the region upstream or downstream of the target RNA region.

[0090] In embodiments, the deaminated site is a splice donor or splice acceptor to promote trans-splicing. In embodiments, the deaminated site is a splice-modifying motif and is selected from a polypyrimidine tract, a branch point, intronic splicing enhancer (ISE), intronic splicing silencer (ISS), exonic splicing enhancer (ESE), exonic splicing silencer (ESS), and / or a combination thereof. In embodiments, the RBP is fused to a deaminase.

[0091] In embodiments, an RBP is selected from a Sm, or LSm. In embodiments, a ncRNA is added to the system, such as U1 snRNA, a U2 snRNA, a U4 snRNA, a U4atac snRNA, a U5 snRNA, a U6 snRNA, a U6atac snRNA, a U11 snRNA, a U12 snRNA, and a U7 snRNA. In some embodiments, the ncRNA sequence is a snoRNA. In some embodiments, the snoRNA comprises an H / ACA box or C / D box. In embodiments,

[0092] In embodiments, the RBP is an RNA-targeting Cas protein. In embodiments, the Cas protein is a type VI polypeptide. In some aspects, the type VI polypeptide is a Cas 13a polypeptide, a Casl3b polypeptide, a Casl3c polypeptide, a Casl3d polypeptide, a Casl3e polypeptide, a Casl3f polypeptide, a Casl3X polypeptide, or a Casl3Y polypeptide. Inembodiments, the Cas protein is a type II polypeptide, such as Cas9. In embodiments, the Cas protein is a type III polypeptide, such as a Cas7-11 polypeptide.

[0093] In some cases, a linear or a circular RNA may be provided (in trans) containing a stem loop wherein the stem loop facilitates recruitment of one or more deaminases, along with the donor RNA template containing a targeting region (BD) to the target RNA, to deaminate the target RNA while providing an alternative donor RNA to replace exons in the target. In some cases, the RNA may be covalently linked to an endogenous or exogenous deaminase, or facilitate the recruitment of an endogenous deaminase. In some cases, one or more nearby sequences guide the hybridization of the donor RNA molecule to the target RNA. In some cases, one or more sequences hybridize to, and guide the deamination of, the target RNA. In some cases, a mismatch position within the targeting region and the target RNA promotes deamination of the target RNA. In some cases, the deamination site is in a splice site such as a splice donor, thereby affecting cis-splicing and further promoting transsplicing.Delivery

[0094] The current disclosure pertains to an RNA molecule comprising the compositions described herein, and a DNA molecule that contains a nucleotide sequence encoding RNA molecules as outlined herein. In certain embodiments, this nucleotide sequence is optimized for codon usage to facilitate production in specific organisms. Additionally, the nucleic acid molecule may be linked to a transcriptional control element, such as a heterologous promoter or a promoter functional in eukaryotic cells. The current disclosure also pertains to a nucleic acid encoding at least a portion of the system of the aforementioned embodiments (e.g., wherein the nucleic acid encodes the targeting polynucleotide, the recruiting polynucleotide, and / or the trans-splicing donor template nucleic acid).

[0095] In various embodiments, the compositions, systems, and / or nucleic acids containing one or more nucleotide sequences described in this disclosure are delivered via a recombinant expression vector. This vector can be non-viral (e.g., a plasmid, synthetic polymers, lipid nanoparticles) or viral (e.g., adeno-associated virus [AAV]). Delivery may also be accomplished through a combination of these methods. The vector can be selected from a group that includes adeno-associated virus, adenovirus, retrovirus, lentivirus, liposome, micelle, lipoplex, polymersome, polyplex, and dendrimer.

[0096] In some embodiments, the disclosed composition is administered to a patient requiring a therapeutically effective treatment amount. Furthermore, a method is describedfor correcting a genetic defect in a subject by administering the disclosed composition or vector. Additionally, a method for treating a disease is outlined, which involves providing a patient in need with a therapeutically effective treatment amount of the composition or vector. Finally, a method for genetic defect correction in a subject through the administration of the disclosed composition or vector is described.

[0097] In various embodiments, this disclosure provides vectors incorporating the described compositions, systems, and / or nucleic acids with specified nucleotide sequences. A "vector" herein refers to a nucleic acid capable of transporting another linked nucleic acid. These vectors can be DNA-based and may be circular or linear. Examples include plasmids, phagemids, cosmids, artificial chromosomes, minichromosomes, transposons, viral vectors, and expression vectors.

[0098] Some embodiments focus on expression vectors, capable of directing the expression of attached nucleic acids. An "expression vector" or "recombinant expression vector" is a replicon (such as a plasmid, phage, virus, or cosmid) that carries another DNA segment ("insert") to enable its replication in a cell.

[0099] Specific embodiments describe plasmid vectors, which are circular double-stranded DNA loops into which additional nucleic acid segments are integrated. Others discuss viral vectors where nucleic acids are inserted into a viral genome, including vectors based on viruses such as vaccinia, poliovirus, adenovirus, adeno-associated virus (AAV), SV40, herpes simplex, HIV, and retroviruses like Murine Leukemia Virus or Rous Sarcoma Virus. These vectors may target eukaryotic cells and include examples like pXTl, pSG5, pSVK3, pBPV, pMSG, and pSVLSV40.

[0100] In some embodiments, vectors contain transcription and / or translation control elements suited to the target cell population and vector system. These elements may include constitutive or inducible promoters, transcription enhancers, and terminators.

[0101] Vectors with the described nucleotide sequences may be operably linked to control elements like promoters. These transcriptional control elements are functional in eukaryotic cells, such as mammalian or human cells. Vectors might also include inducible promoters (e.g., heat shock, tetracycline-regulated, or metal-regulated promoters) or constitutive promoters (e.g., CMV, UBC). Additionally, spatially or temporally restricted promoters can be used to direct expression in specific tissues or stages of development.

[0102] Promoters suitable for this disclosure range from viral promoters to those derived from prokaryotic or eukaryotic organisms. Examples include SV40 early promoter, mouse mammary tumor virus LTR promoter, adenovirus major late promoter, andcytomegalovirus promoters. Other eukaryotic promoters include the human elongation factor- 1 promoter and murine stem cell virus promoter.

[0103] In embodiments, the vectors include RNA polymerase III promoters (e.g., U6, Hl) for efficient transcription. Some vectors also contain ribosome binding sites for translation initiation and transcription terminators. Sequences for amplification of expression or tags (e.g., histidine, hemagglutinin, green fluorescent protein) may be included as well.

[0104] Methods to introduce these vectors into host cells are well-established and include transfection techniques and RNA delivery, with considerations for stability and efficiency of uptake. Delivery may involve viral vectors, lipid nanoparticles (LNPs), synthetic polymers, or combinations thereof.

[0105] In various embodiments, the vectors or compositions are administered as DNA or RNA, potentially formulated in LNPs or polymeric nanoparticles. Delivery methods can include non-viral vehicles such as nanoparticles, liposomes, ribonucleoproteins, peptides, or small molecule conjugates.Viral Delivery

[0106] For some embodiments, the compositions are introduced using viral vectors like AAV. Recombinant AAV (rAAV) vectors are frequently used, with rAAV production involving packaging cells that provide necessary viral components.

[0107] Methods to produce rAAV involve introducing rAAV genomes, AAV rep and cap genes, and helper functions into a packaging cell. Production can use adenovirus or herpesvirus or baculovirus instead of plasmids. Techniques for rAAV production are well- documented, involving stable cell lines expressing necessary components or using helper viruses.

[0108] Other viral vectors such as adenovirus, lentivirus, and herpes simplex virus can also be employed for delivery. These vectors can carry compositions with nucleic acids targeting specific sequences for various applications.Nanoparticles

[0109] In some embodiments, the disclosed nucleic acids or expression vectors are delivered via nanoparticles (e.g., lipid nanoparticles). These nanoparticles can include avariety of lipids like cationic, anionic, or amphipathic lipids. Nanoparticles facilitate cellular uptake and protect the nucleic acids from degradation.

[0110] Nanoparticles may be formulated as lipid vesicles or lipoplexes, with liposomes being an example. They can include various lipid bilayers, potentially functionalized with ligands, proteins, or channels.Pharmaceutical Compositions

[0111] Pharmaceutical compositions in this disclosure comprise vectors, viral vectors, or nanoparticles along with a pharmaceutically acceptable carrier. These compositions may be formulated for systemic or localized administration and can be designed for immediate or sustained release of the active components.

[0112] Excipients used in these formulations include carrier molecules, antioxidants, chelating agents, liquids like oils or water, and buffering substances. These are chosen based on the desired mode of administration and therapeutic application.

[0113] In some embodiments, the pharmaceutical composition includes: (1) an expression vector containing one or more nucleic acids with the described nucleotide sequences, and (2) a pharmaceutically acceptable carrier or diluent. Other embodiments include a composition with nucleic acids featuring the described nucleotide sequences or a recombinant expression vector (e.g., AAV) containing these nucleic acids, formulated as a lipid composition (e.g., LNP), alongside a pharmaceutically acceptable carrier or diluent. Further embodiments provide a therapeutically effective amount of these nucleic acids or recombinant expression vectors.

[0114] Exemplary pharmaceutically acceptable excipients may consist of carriers, solvents, stabilizers, adjuvants, and diluents, chosen based on the administration mode and dosage form. The pharmaceutical compositions can be formulated to maintain a physiologically compatible pH, tailored to the formulation and administration route. In some embodiments, these compositions contain a therapeutically effective amount of the nucleic acids or recombinant expression vectors, combined with pharmaceutically acceptable excipients.

[0115] Suitable excipients can include large, slowly metabolized macromolecules as carrier molecules, as well as antioxidants, chelating agents, carbohydrates, stearic acid, and liquids such as oils, water, saline, glycerol, and ethanol. Wetting or emulsifying agents and pH buffering substances are also examples.

[0116] Pharmaceutical compositions may be prepared in forms like solutions, suppositories, or injections. They can be designed for systemic administration (e.g., enteral or parenteral) orlocalized administration (e.g., regional administration or implantation), and can be formulated for either immediate activity or sustained release of the composition, system, or nucleic acids described herein, as well as viral vectors or recombinant expression vectors.

[0117] Typically, an effective amount of the composition, system, or nucleic acids described herein, or viral vector, is provided for treating a disease or disorder in a subject. Methods for determining the effective amount or dose are within the knowledge of one skilled in the art. The final dosage depends on the administration route and the nature of the disorder. A qualified clinician will determine the effective amount needed to halt or reverse the disorder's progression.

[0118] In some embodiments, based on animal data and other available information about the trans-splicing system, a clinician can determine the maximum safe dose for an individual, considering the administration route. For instance, a dose administered intravenously might be higher than one administered intrathecally, due to the larger fluid volume into which the therapeutic composition is distributed. Similarly, compositions that are rapidly cleared from the body may be administered in higher or repeated doses to maintain therapeutic concentration. With routine clinical trial practice, a skilled clinician can optimize the dosage.

[0119] For use in medicaments, the composition, system, or nucleic acids described herein, including the viral vector, can be sourced from suitable commercial providers. Therapeutic administration of these components typically requires sterility. Therapeutic compositions are generally placed in containers with sterile access ports, such as intravenous solution bags or vials with stoppers that can be pierced by hypodermic needles. In some embodiments, the therapeutic components are stored in unit or multi-dose containers, like sealed ampules or vials, as either an aqueous solution or a lyophilized formulation for reconstitution.

[0120] In some embodiments, the disclosure includes cellular, ex vivo, and in vivo methods using the composition, system, or nucleic acids described herein to target trans-splicing of a target RNA (e.g., pre-mRNA) in a cell. Some methods involve using these components to correct a mutation in a target RNA (e.g., pre-mRNA). Additional methods for treating a patient with a disease or disorder involve administering a composition, system, nucleic acids, or pharmaceutical composition to target trans-splicing of a target RNA in a target cell population or tissue, thus treating the disease or disorder.RNA Editing in Cells

[0121] In some embodiments, the method involves introducing a composition, system, or nucleic acids containing the described nucleotide sequences, viral vector, or pharmaceuticalcomposition into a cell or cell population. This can be done by contacting the cell with these components. The cell may be eukaryotic, such as a mammalian cell, rodent cell, human cell, or a patient-derived cell.

[0122] Introduction into the cell can be achieved through various techniques known in the art, including viral or bacteriophage infection, transfection methods (e.g., conjugation, protoplast fusion, lipofection, electroporation, calcium phosphate precipitation, polyethyleneimine (PEI)-mediated transfection, DEAE-dextran-mediated transfection, liposome-mediated transfection), particle gun technology, shear-driven cell permeation, cellpenetrating peptides, microinjection, or nanoparticle-mediated delivery. The vector system may also be introduced via viral infection.Methods of Treatment

[0123] The disclosure outlines methods for treating a patient with a disease or disorder using the described composition, system, or nucleic acids. For diseases associated with RNA mutations, the method targets trans-splicing to remove these mutations.

[0124] The method involves administering the composition, system, or nucleic acids to the patient. When administered, the nucleic acids bind to the target RNA, RNA-modifying proteins are recruited, resulting in trans-splicing that joins exons from the target RNA to exons from the administered nucleic acids, thus treating or alleviating the disease.

[0125] For patients with diseases linked to pre-mRNA mutations in specific tissues or cell populations, the method involves administering the composition to the patient. The nucleic acids bind to the pre-mRNA, RNA-modifying proteins are recruited, leading to trans-splicing and exon ligation that creates an mRNA lacking the mutation, treating or ameliorating the disease.

[0126] The administration route should effectively deliver the composition, system, or nucleic acids to the target tissue or cell population as determined by skilled practitioners. Administration results in the correction of a pre-mRNA mutation in the patient’s target tissue or cell population.

[0127] Treatment refers to applying methods described herein to ameliorate a disease, including the administration of a composition, system, or nucleic acids. Treatment can be preventative or following a pathological event or exposure to an etiologic agent, aiming for any beneficial effect on disease symptoms or pathology, which can include even minimal improvements.Packages, Kits, and Pre-Filled Containers

[0128] Also provided herein are kits containing one or more compositions described herein. The kit comprises, in some embodiments, a composition as described herein in suitable container means. In some embodiments, the container means is any suitable container which houses, e.g., a liquid or lyophilized composition including, but not limited to, a vial, syringe, bottle, and an intravenous (IV) bag or ampoule. A syringe holds any volume of liquid suitable for injection into a subject, including, but not limited to, 0.5 cc, 1 cc, 2 cc, 5 cc, 10 cc, or more. In some embodiments, the container means of the kits will generally include at least one vial, test tube, flask, bottle, ampule, syringe, an intravenous (IV) bag, and / or other container means, into which at least one composition of the disclosure is placed, and / or preferably, suitably aliquoted. Provided herein is a container means comprising a composition described herein.

[0129] In some embodiments, packages and kits additionally include a buffering agent, a preservative, and / or a stabilizing agent in a pharmaceutical formulation. In some embodiments, each component of the kit is enclosed within an individual container and all of the various containers are within a single package. In some embodiments, disclosure kits are designed for cold storage or room temperature storage.

[0130] Additionally, in some embodiments, the preparations contain stabilizers to increase the shelf-life of the kits. Where the compositions are lyophilized, the kit contains, in some embodiments, further preparations of solutions to reconstitute the lyophilized preparations. Acceptable reconstitution solutions are well known in the art and include, e.g., pharmaceutically acceptable phosphate buffered saline (PBS).

[0131] In some embodiments, provided herein is a kit for treating a condition, disease, or disorder as described herein comprising a disclosed composition and a label attached to or packaged with the container, the label describing use of the composition, optionally, in combination with an additional therapeutic agent. In some embodiments, packages and kits further include a label specifying information required by US FDA or similar regulatory authority, e.g. , a product description, amount and mode of administration, and / or indication of treatment. In some embodiments, the label or packaging insert includes appropriate written instructions (e.g. , instructing the user of the kit to perform one or more methods disclosed herein). Kits, in some embodiments, additionally include labels or instructions for using the kit components in any method of the disclosure. In some embodiments, a kit includes a compound in a pack or dispenser together with instructions for administering a composition in a method described herein.

[0132] In some embodiments, instructions include instructions for practicing any of the methods described herein including treatment methods. In some embodiments, instructions additionally include indications of a satisfactory clinical endpoint or any adverse symptoms that occur, or additional information required by regulatory agencies such as the Food and Drug Administration for use on a human subject.EXAMPLESExample 1

[0133] This example describes a resplicing assay and its use to evaluate RNA trans-splicing efficiency.Resplicing Assay

[0134] A DNA plasmid was constructed such that an RNA target is expressed in HEK293 cells containing the 5’ end of Green Fluorescent protein (GFP) and intron 13 of SCN1A. RNA trans-splicing molecules (donor RNAs) were designed to be expressed under the control of a CMV promoter. Each donor RNA included a Binding Domain antisense region complementary to intron 13 of SCN1A, which allows the molecule to hybridize with the target RNA and promote spliceosome recruitment. Each donor RNA further comprised a splice acceptor site, a branch point, a polypyrimidine tract, and a 3 ’ GFP fragment with a poly A signal. When the donor RNA hybridizes with intron 13, the endogenous spliceosomal machinery would splice the 3 ’ end of GFP onto the 5 ’ end in the target RNA, producing a full-length GFP mRNA and, subsequently, full-length GFP protein see FIG. 10).

[0135] Briefly, HEK-293 cells were seeded in 24-well plates and cultured until reaching -80% confluency. Transfections were performed 24 hours post-seeding using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s protocol. Each well received the following plasmid amounts: 0.25 pg pCB-NGFP-il3NL (template construct; SEQ ID NO: 103), 0.375 pg pCB-3GI-13m (trans-splicing donor RNA construct; SEQ ID NO: 104), and 0.375 pg pU6-ADARs (ADAR-binding RNA expression plasmids, where appropriate; SEQ ID NOs: 105-107) or a control plasmid such as pcDNA3 or pUC19 when ADAR-related plasmids were not added. The template and trans-splicing constructs were expressed under a constitutive promoter composed of the CMV enhancer and the chicken [3-actin promoter. ADAR-binding guide RNAs were transcribed from a U6 promoter. Forty-eight hours after transfection, cell monolayers were imaged using a fluorescence microscope under UV illumination. Subsequently, cells were trypsinized and analyzed by flow cytometry to quantify GFP expression. Data were reported as the percentage of GFP -positive cells, or asthe percentage of IRFP-positive (IRES-driven) cells that also express GFP.1Notably, IRFP is expressed independently of trans-splicing due to its placement downstream of an internal ribosome entry site (IRES). lie splicing Assay

[0136] The resplicing assay was used to assess trans-splicing efficiency when cells were transfected with a construct configured to express an RNA donor molecule, as described above.2This trans-splicing strategy has been referred to as “SMaRT,” or “spliceosome- mediated RNA trans-splicing. As shown in FIG. 11, trans-splicing in a system where the cells are configured to express a donor RNA (without expression of other polynucleotides to enhance or promote splicing) resulted in detectable trans-splicing, but at relatively low efficiency. Trans-splicing efficiency following transfection with this RNA donor was used as a benchmark for further studies described below.Example 2

[0137] This example describes making and testing directed Adenosine Deaminase Acting on RNA (ADAR)-recruiting trans-splicing RNAs (dartRNAs) which promote trans-splicing.

[0138] To promote efficient and specific 3' exon replacement of SCN1A, a novel ‘resplicing’ strategy was developed that integrates programmable ADAR-mediated editing directly into the trans-splicing design. Unlike traditional trans-splicing systems (e.g., SMaRT) that rely solely on binding domain affinity and splice acceptor competition to redirect the spliceosome, this novel approach actively integrates trans-splicing with disabling the endogenous splice acceptor site through site-specific A-to-I RNA editing, thereby reducing competition and increasing the likelihood of splicing into the therapeutic payload.Construction of Exemplary dartRNAs

[0139] To enhance the efficiency of trans-splicing at SCN1A intron 13, ADAR-recruiting guide RNAs were designed which specifically target the 3' splice acceptor site of the intron in the target RNA, in order to promote the functional inactivation of the 3' splice acceptor site and favor redirection of splicing toward the synthetic acceptor site encoded in the donor RNA. These engineered ADAR guide RNAs may be integrated within the same polynucleotide as the donor RNA, or they may be co-expressed or co-transfected as ADAR- recruiting guide RNAs (gRNAs) that base-pair with the intronic region immediately upstream of the endogenous SCN1A exon 14 splice acceptor site. The rationale for this strategy is to1IRFP was not included in transduced constructs for assays where the overall percentage of GFP+ cells was the readout.2The Binding Domain is identified within SEQ ID NO: 104.suppress the use of the native SCN1A splice acceptor — thereby reducing competition for the spliceosome — and to shift splicing preferentially to the exogenous donor RNA splice donoracceptorjunction. Furthermore, these guides exploit the endogenous ADAR enzymes’ ability to bind long double -stranded RNA structures, which can in turn alter local RNA structure, increase transcript accessibility, enhance recruitment of RNA-binding proteins involved in splicing, and improve donor RNA stability within the cell both structurally and as protection from nucleases. Within the antisense region of the ADAR-recruiting guide RNAs, a strategically placed A-C mismatch within the AG dinucleotide of the splice acceptor motif was incorporated, thereby facilitating ADAR-mediated A-to-I editing and disrupting the splice acceptor motif in the target RNA.

[0140] One of the ADAR guides that was constructed (referred to herein as dartRNA guide 1) comprised a GluR2 domain sequence (corresponding to SEQ ID NO: 2), an antisense region (e.g., corresponding to SEQ ID NO: 95), and an EIE sequence (corresponding to SEQ ID NO: 96). An example of a guide RNA design utilizing these components is encoded by the nucleic acid sequence of SEQ ID NO: 97 (wherein “N” corresponds to any nucleotide, e.g., A, T, G, or C, wherein the Ns collectively correspond to the antisense region of the ADAR-recruiting guide RNA). An exemplary dartRNA utilizing this design (and comprising the antisense region set forth in SEQ ID NO: 95) comprises the nucleotide sequence of SEQ ID NO: 98.

[0141] A further ADAR guide that was constructed (referred to herein as dartRNA guide 2) comprised two Alu sequences (corresponding to SEQ ID NOs: 99 and 100) flanking an antisense region (e.g., corresponding to SEQ ID NO: 101). An example of a guide RNA design utilizing these components is encoded by the nucleic acid sequence set forth as SEQ ID NO: 13 (wherein “N” corresponds to any nucleotide, e.g., A, T, G, or C, and the “C” corresponds to a position that is complementary to an I (inosine) of a target sequence that was modified from an A by a deaminase disclosed herein). An exemplary dartRNA utilizing this design (and comprising the antisense region encoded by SEQ ID NO: 101) comprises the nucleotide sequence of SEQ ID NO: 102.

[0142] A further ADAR guide that was constructed (referred to herein as dartRNA guide 3) comprised an antisense region complementary to the intron 13 sequence, with multiple mismatches (corresponding to the nucleic acid sequence of SEQ ID NO: 101). In this system, the targeting polynucleotide itself functions as the sequence that recruits the ADAR, due to the mismatches between the antisense sequence in the target.dartRNAs Improve trans-Splicing Efficiency

[0143] The three exemplary dartRNA guides were tested for the ability to enhance transsplicing at SCN1A intron 13, using the protocol described in Example 1. As summarized in FIGs. 12A-12B, expression of any of the three dartRNA guides improved RNA exon replacement and GFP production by 3-5 fold (FIG. 12B, “dartRNA guide #”), as compared to expression of the RNA donor construct alone (FIG. 12B, “SMaRT”).

[0144] The editing efficiencies quantified in FIG. 12B were an underestimate, because transfection efficiency of the donor was a limiting factor. Accordingly, the study was repeated with a donor-RNA vector configured for splicing-independent RFP expression, as a marker of successful transfection. By measuring the performance of dartRNA guides only in cells that were successfully transfected with the vector encoding the donor RNA construct (indicated by RFP expression), editing efficiencies of >75-80% were observed, depending on the guide sequence (FIGs. 13A-13B).

[0145] These results demonstrate that the inclusion of ADAR-recruiting guides in a transsplicing system allowed for a substantial improvement in RNA exon replacement and GFP production in human cells over using a trans-splicing RNA alone. These results also demonstrate that the addition of GluR2 / EIE or Alu sequences improved trans-splicing efficiency, relative to a guide with only the antisense region.OTHER EMBODIMENTS

[0146] Various modifications and variations of the described disclosure will be apparent to those skilled in the art without departing from the scope and spirit of the disclosure. Although the disclosure has been described in connection with specific embodiments, it should be understood that the disclosure as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the disclosure that are obvious to those skilled in the art are intended to be within the scope of the disclosure. Other embodiments are in the claims.SEQUENCES

[0147] >BORG-derived Nuclear Localization MotifWNNNNSNNAGCCC(SEQ ID NO: 1)“W” at position -8 relative to the first nucleotide of the pentamer AGCCC = T or A; “S” at position -3 relative to the first nucleotide of the pentamer AGCCC = G or C.OS(9J0‘9 ‘1 ‘V ‘'s'd) appoapnu XUE = os(9J0‘9 ‘1 ‘V ‘ appoapnu Aire = gg(oi ON CII Oas)NNNNNNNNNNNNN^OS g L(9J0‘9 ‘1 ‘V appoapnu Aire = OL = gSxS p9UIP0UISHnI9< [£SIOO]

[0206] (SEQ ID NO: 60)AGCAAAUUACUGCGCACUACGCAAAAUUGUGCGCAAAUACCGCGC

[0207] (SEQ ID NO: 61)ACCAAAUUCUUGCACACCCGGCCAAAUUGUGCACAUAUACCUGGC

[0208] (SEQ ID NO: 62)GCCAAAUUAUUCCCAUCUCCGCCACAUUGUGCGUAAAUACUCCGC

[0209] (SEQ ID NO: 63)GCCAACUUAUUGCGCACUAGGCCAACUUGUGCGCAAAUACCUGGC

[0210] (SEQ ID NO: 64)GCCAAAUUAUUAUGCCCUAUGCAAAAUUGUGCAUAAAUACCUGCC

[0211] (SEQ ID NO: 65)GCCAAAUUAUUGCGCACUAGGCAAACUUGUGCGCAAGUACCCGCC

[0212] (SEQ ID NO: 66)AAGGUUUUCUAGUACAGUAUAGUGGUCUGUAAACGAGCGGGUUCA

[0213] (SEQ ID NO: 67)GCCAAAUUAUUGCGCACUAGGCAAACUUGUGCGUAAGUACCCGCC

[0214] (SEQ ID NO: 68)GCCGAGUUACUGCCCACUCCGCCACCUUCUGCGAAAGUGCCCAGC

[0215] (SEQ ID NO: 69)GGGCGCUUGCUGCGCUCUGCAAAAAGCUGUGCGCAAGCAGCGCCC

[0216] (SEQ ID NO: 70)GCCAAAUUAUUGCGCACUAGGCCAACUUGUGCGCAAGUACCCCGC

Claims

CLAIMSWhat is claimed is:

1. A system for targeting a nucleic acid for RNA trans-splicing, the system comprising:(a) a targeting polynucleotide comprising one or more targeting regions with complementarity to a target RNA sequence;(b) a recruiting polynucleotide capable of recruiting at least one deaminase polypeptide; and(c) a trans-splicing donor template nucleic acid comprising a splice donor (SD) and / or splice acceptor (SA), thereby targeting the nucleic acid for interacting with at the least one deaminase polypeptide, and trans-splicing with the target RNA sequence to produce a chimeric RNA polynucleotide.

2. The system of claim 1, wherein the targeting polynucleotide is comprised within the trans-splicing donor template.

3. The system of claim 1 or 2, wherein the recruiting polynucleotide is comprised within the trans-splicing donor template.

4. The system of any one of claims 1-3, wherein the recruiting polynucleotide comprises a nucleic acid sequence having at least 70% sequence identity to any one of SEQ ID NOs: 2- 102.

5. The system of any one of claims 1-3, wherein the recruiting polynucleotide comprises a nucleic acid sequence having at least 75% sequence identity to any one of SEQ ID NOs: 2- 102.

6. The system of any one of claims 1-3, wherein the recruiting polynucleotide comprises a nucleic acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 2- 102.

7. The system of any one of claims 1-3, wherein the recruiting polynucleotide comprises a nucleic acid sequence having at least 85% sequence identity to any one of SEQ ID NOs: 2-8. The system of any one of claims 1-3, wherein the recruiting polynucleotide comprises a nucleic acid sequence having at least 90% sequence identity to any one of SEQ ID NOs: 2- 102.

9. The system of any one of claims 1-3, wherein the recruiting polynucleotide comprises a nucleic acid sequence having at least 95% sequence identity to any one of SEQ ID NOs: 2- 102.

10. The system of any one of claims 1-3, wherein the recruiting polynucleotide comprises a nucleic acid sequence having 100% sequence identity to any one of SEQ ID NOs: 2-102.

11. The system of any one of claims 1-10, wherein the one or more targeting regions comprises a mismatch or imperfect complementarity to the target RNA.

12. The system of any one of claims 1-11, further comprising a protein-recruiting motif.

13. The system of any one of claims 1-12, wherein the trans-splicing donor template comprises a binding region that interacts with an RNA-binding or RNA-modifying polypeptide.

14. The system of any one of claims 1-13, wherein the trans-splicing donor template comprises any one of:(a) at least one exon sequence comprising coding region comprising a nucleic acid sequence encoding all or a portion of a polypeptide;(b) at least one intron sequence;(c) an internal ribosomal entry site (IRES);(d) a 2 A peptide;(e) an untranslated region (UTR);(f) an SD;(g) an SA;(h) a poly(pyrimidine) tract;(i) a branch point;(j) an RNA response element; and / or(k) an aptamer.

15. The system of any one of claims 1-14, wherein the one or more targeting regions contains an adenosine mismatch relative to the target RNA sequence.

16. The system of claim 15, wherein, upon binding to the target RNA sequence, at least one deaminase polypeptide is recruited.

17. The system of claim 15 or 16, wherein upon recruitment, the at least one deaminase polypeptide edits one or more adenosines in the target RNA sequence.

18. The system of any one of claims 1-17, wherein the at least one deaminase polypeptide is an Adenosine Deaminase Acting on RNA (ADAR).

19. The system of claim 18, wherein the ADAR is AD ARI or AD ART or ADAR3.

20. The system of any one of claims 1-19, wherein the at least one deaminase polypeptide is endogenous to a cell or subject.

21. The system of any one of claims 1-19, wherein the at least one deaminase polypeptide is exogenously supplied to a cell or subject.

22. The system of claim 21, wherein the deaminase is TadA or a recombinant ADAR.

23. The system of any one of claims 1-22, wherein the one or more targeting regions contains a cytosine mismatch relative to the target RNA sequence.

24. The system of claim 23, wherein, upon binding to the target RNA sequence, at least one cytidine deaminase polypeptide is recruited.

25. The system of claim 23 or 24, wherein upon recruitment, the at least one cytidine deaminase polypeptide edits one or more cytosines in the target RNA sequence.

26. The system of any one of claims 1-25, wherein the at least one cytidine deaminase polypeptide is an activation-induced cytidine deaminase / apolipoprotein B mRNA-editing enzyme catalytic polypeptide-like (AID / APOBEC) protein.

27. The system of claim 26, wherein the APOBEC protein is selected from the group consisting of an APOBEC1, APOBEC2, AP0BEC3A, APOBEC3B, APOBEC3C, APOBEC3E, APOBEC3F, AP0BEC3G, AP0BEC3H, and APOBEC4 protein.

28. The system of any one of claims 1-27, wherein the targeting polynucleotide comprises one or more wobble-bases due to mismatches with one or more complementary bases in the targeted RNA sequence at or near the site to be edited.

29. The system of any one of claims 1-28, wherein the at least one deaminase polypeptide is a deaminase variant comprising a mutation in its catalytic domain.

30. The system of any one of claims 1-29, wherein the at least one deaminase polypeptide is a deaminase variant with increased or attenuated activity.

31. The system of any one of claims 1-30, wherein the at least one deaminase polypeptide is a truncated or augmented deaminase variant.

32. The system of any one of claims 1-31, further comprising an Alu domain, or GluR2 domain, editing inducer element (EIE), hY domain, an APOBEC-recruiting domain, a stemloop or hairpin secondary structure, or a variant or combination thereof.

33. The system of claim 32, wherein the stem-loop or hairpin secondary structure is selected from the group consisting of MS2, PP7, SLBP, TAR, BoxB, and a variant or combination thereof.

34. The system of any one of claims 1-33, further comprising a stabilization motif.

35. The system of claim 34, where the stabilization motif forms a secondary structure.

36. The system of claim 35, wherein the secondary structure comprises a pseudoknot, a stem-loop, or a tetraloop.

37. The system of claims 14-36, wherein at least one exon sequence or at least one intron sequence comprises one or more elements that promote localization to the nucleus.

38. The system of any one of claims 1-37, further comprising a sequence derived from one or more of BMP2-OP1 -responsive gene (BORG), SINE-derived nuclear RNA Localization (SIRLOIN), or a sequence directing the an RNA to the vicinity of SR proteins and / or nuclear speckles.

39. The system of any one of claims 1-38, further comprising one or more small RNA (sRNA) polynucleotides in the targeting polynucleotide, recruiting polynucleotide, or transsplicing donor template.

40. The system of claim 39, wherein the one or more sRNA polynucleotides comprise one or more microRNA (miRNA) polynucleotides or variants thereof.

41. The system of claim 40, wherein the one or more miRNA polynucleotides bind to the target RNA.

42. The system of claim 39, wherein the one or more sRNA polynucleotides comprise an archaeal -derived sRNA polynucleotide.

43. The system of claim 42, wherein the archaeal-derived sRNA polynucleotide is selected from the group consisting of sR-h45, sRl 1, sR38, sR7, or sR21 or a variant thereof.

44. The system of claim 42, wherein the one or more archaeal-derived sRNA polynucleotides comprise a single long hairpin sequence and an ACA box sequence.

45. The system of any one of claims 39-44, wherein the one or more sRNA polynucleotides comprise up to three hairpin sequences.

46. The system of any one of claims 39-45, wherein the one or more sRNA polynucleotides comprise a C / D box sequence.

47. The system of any one of claims 39-46, wherein the one or more sRNA polynucleotides comprise a protein-binding motif.

48. The system of any one of claims 39-47, wherein the one or more sRNA polynucleotides comprise a kink-(k)-tum sequence.

49. The system of any one of claims 39-47, wherein the one or more sRNA polynucleotides comprise an H box (consensus ANANNA) in at least one stem-loop sequence.

50. The system of any one of claims 1-49, wherein the one or more sRNA polynucleotides comprise a human telomerase (hTR) RNA sequence or a segment or variant thereof in the targeting polynucleotide, recruiting polynucleotide, or the trans-splicing donor template.

51. The system of any one of claims 1-50, wherein the one or more sRNA polynucleotides comprise a yeast snRNA sequence.

52. The system of claim 51, wherein the yeast snRNA sequence is selected from the group consisting of snR4, snR45, snR30, snR40, snR41, snR57, snR51, and snR55.

53. The system of any one of claims 1-52, wherein the one or more sRNA polynucleotides comprise a plant or metazoan snoRNA sequence.

54. The system of claim 53, wherein the plant or metazoan snoRNA sequence is an H / ACA or C / D box RNA sequence or a U13 snoRNA sequence.

55. The system of claim 53 or 54, wherein the plant or metazoan snoRNA sequence comprises two hairpin sequences followed by a single -stranded H (AnAnnA) and ACA box motif.

56. The system of claim 53 or 54, wherein the plant or metazoan snoRNA sequence is anACAI 9 RNA sequence.

57. The system of any one of claims 39-56, wherein the one or more sRNA polynucleotides comprise one or more regions that are partially complementary to the target RNA sequence.

58. The system of claim 57, wherein the one or more regions that are partially complementary to the target RNA sequence are between 3 to about 40 nucleotides in length.

59. The system of claim 57 or 58, wherein the one or more regions that are partially complementary to the target RNA allow for hybridization with the target RNA sequence via Watson-Crick or wobble base pairing.

60. The system of any one of claims 39-59, wherein binding of the sRNA to the target RNA results in one or more nucleotides in the target RNA sequence to be acetylated.

61. The system of any one of claims 39-59, wherein binding of the sRNA to the target RNA results in one or more nucleotides in the target RNA sequence to be pseudouridylated.

62. The system of any one of claims 39-59, wherein binding of the sRNA to the target RNA results in one or more nucleotides in the target RNA sequence to be methylated.

63. The system of any one of claims 39-59, wherein binding of the sRNA to the target RNA results in one or more nucleotides in the target RNA sequence to be deaminated.

64. The system of any one of claims 39-59, wherein binding of the sRNA to the target RNA results in one or more nucleotides in target RNA sequence cleavage.

65. The system of any one of claims 39-64, wherein the one or more sRNA polynucleotides comprise at least one snRNA or snoRNA secondary structure that assembles into a ribonucleoprotein particle (RNP).

66. The system of claim 65, wherein the snRNA or snoRNA comprises a guiding region that targets RNA.

67. The system of claim 66, wherein the guiding region targets RNA in tandem with the RNA targeting and modification by the one or more deaminase polypeptides.

68. The system of any one of claims 1-67, further comprising a CRISPR gRNA that assembles into an RNP.

69. The system of any one of claims 1-68, wherein the targeting polynucleotide and / or the trans-splicing donor template recruits an RNA-binding or RNA-modifying polypeptide, thereby assembling into an RNP.

70. The system of any one of claims 1-69, further comprising a CRISPR-Cas system.

71. The system of any one of claims 1-70, wherein the targeting polynucleotide and / or the trans-splicing donor nucleic acid template comprises a region that binds spliceosome polypeptides.

72. The system of any one of claims 1-71, wherein the trans-splicing donor nucleic acid template comprises a translation-enhancing motif that enhances translation of the chimeric RNA polynucleotide.

73. The system of any one of claims 1-72, wherein the targeting polynucleotide comprises a hairpin that recruits one or more Argonaute (AGO) proteins.

74. The system of any one of claims 21-73, wherein the one or more exogenous deaminase polypeptides is overexpressed or under-expressed to modulate activity of the system.

75. The system of any one of claims 1-74, wherein at least one component comprising the system is regulated by a small molecule.

76. The system of any one of claims 46-75, wherein the translation-enhancing motif comprises a sequence derived from one or more of triplex from MALAT1, Woodchuck Hepatitis Virus (WHV) Posttranscriptional Regulatory Element (WPRE), the PRE of Hepatitis B virus (HPRE), or NEAT 1.

77. The system of any one of claims 1-76, wherein the trans-splicing donor template comprises a splice -modifying region comprising any one of:(a) an intronic splice enhancer (ISE);(b) an intronic splice silencer (ISS);(c) an exonic splice enhancer (ESE);(d) an exonic splice silencer (ESS).

78. The system of any one of claims 1-77, wherein the recruiting polynucleotide and the trans-splicing donor template are unlinked polynucleotides and supplied in-trans.

79. The system of any one of claims 1-78, wherein deamination of the target RNA sequence inhibits cis-splicing of target RNA sequence.

80. The system of any one of claims 1-79, wherein deamination of the target RNA sequence promotes trans-splicing of the donor nucleic acid template.

81. The system of any one of claims 1-80, wherein the trans-splicing donor nucleic acid template has a length of between 2 nucleotides and 20,000 nucleotides.

82. The system of any one of claims 1-81, wherein the system is comprised in a recombinant expression vector.

83. The system of any one of claims 1-82, wherein the system is operably linked to a transcriptional control element.

84. The system of claim 83, wherein the transcriptional control element is a promoter.

85. The system of claim 84, wherein the promoter is a regulatable promoter.

86. The system if any one of claims 1-85, wherein the chimeric RNA sequence comprises a polynucleotide encoding a degradation or degron peptide that marks a protein for degradation by a cell's protein recycling machinery.

87. The system if any one of claims 1-85, wherein the chimeric RNA sequence comprises a polynucleotide encoding a degradation or degron peptide that marks a protein for degradation by a cell's protein recycling machinery.

88. The system if any one of claims 1-85, wherein the chimeric RNA sequence comprises a polynucleotide encoding a fluorescent or marker peptide that marks a protein for display or detection for diagnostic applications.

89. A nucleic acid encoding at least a portion of the system of any one of claims 1-88.

90. An expression vector comprising the nucleic acid of claim 89.

91. A nanoparticle comprising the nucleic acid of claim 89 or the expression vector of claim 90.

92. A host cell comprising the nucleic acid of claim 89, the expression vector of claim 90, or the nanoparticle of claim 91.

93. A pharmaceutical composition comprising:(a) the system of any one of claims 1-88; and(b) one or more of a lipid, a polymer, a nanoparticle, a buffer, and a nuclease inhibitor.

94. A method for modifying a target RNA sequence, wherein the method comprises contacting the target RNA sequence or a cell comprising the target RNA sequence with the system of any one of claims 1-88, the nucleic acid of claim 89, the expression vector of claim 90, the nanoparticle of claim 91, or the pharmaceutical composition of claim 93.

95. The method of claim 94, wherein the target RNA sequence is a pre-mRNA, a circular RNA, a partially spliced RNA, a non-coding RNA, a non-host cell RNA, a regulatory RNA, acoding RNA, a transfer RNA (tRNA), a pre-ribosomal RNA, a ribosomal RNA, a mature RNA with cryptic splice sites, or a long non-coding RNA (IncRNA).

96. The method of claim 94 or 95, wherein the modifying comprises modifying a splice junction, a splice acceptor, a splice donor, a cryptic splice site, a splicing signal, a splicing regulatory element, an intronic splicing enhancer, an intronic splicing silencer, an exonic splicing enhancer, an exonic splicing silencer.

97. The method of any one of claims 94-96, wherein the contacting results in the modification of the target RNA.

98. The method of claim 97, wherein the modification comprises insertion of a segment of the trans-splicing donor nucleic acid template into the target RNA.

99. The method of claim 97, wherein the modification comprises replacement of a segment of the target RNA sequence with a segment of the trans-splicing donor nucleic acid template.

100. The method of claim 97, wherein the modification comprises replacing one or more endogenous nucleotides in the target RNA sequence with a segment of the trans-splicing donor nucleic acid template.

101. The method of any one of claims 94-100, wherein the target RNA sequence is comprised in a eukaryotic cell.

102. The method of claim 101, wherein the eukaryotic cell is a mammalian cell.

103. The method of claim 101 or 102, wherein the eukaryotic cell is in vitro.

104. The method of claim 101 or 102, wherein the eukaryotic cell is in vivo.

105. A method of treating a nucleotide expansion disease in subject, comprising administering to the subject the system of any one of claims 1-88, the nucleic acid of claim 89, the expression vector of claim 90, the nanoparticle of claim 91, or the pharmaceuticalcomposition of claim 93, wherein the administering results in the generation of a modified mRNA that does not include a pathological number of nucleotide repeats.

106. A method of inhibiting, reducing, slowing, or preventing the aging of a subject or an age-related disease in the subject, or increasing the lifespan of a subject, comprising administering to the subject the system of any one of claims 1-88, the nucleic acid of claim 89, the expression vector of claim 90, the nanoparticle of claim 91, or the pharmaceutical composition of claim 93.

107. A method of treating a subject with a disease or disorder associated with a mutation in a pre-mRNA, comprising administering to the subject the system of any one of claims 1-88, the nucleic acid of claim 89, the expression vector of claim 90, the nanoparticle of claim 91, or the pharmaceutical composition of claim 93, wherein trans-splicing replaces one or more exons in a target RNA sequence comprising the mutation in the subject, thereby correcting the mutation in the subject.

108. The method of claims 107, wherein trans-splicing results in a chimeric RNA sequence that treats or alleviates the disease or does not cause or exacerbate the disease.

109. A kit comprising a container comprising the system of any one of claims 1-88, the nucleic acid of claim 89, the expression vector of claim 90, the nanoparticle of claim 91, or the pharmaceutical composition of claim 93, and instructions for use in correcting a mutation in a pre-mRNA.

Citation Information

Patent Citations

  • RNA trans-splicing molecule (RTM) for use in the treatment of cancer

    US20150250901A1

  • Artificial nucleic acids for RNA editing

    WO2022078995A1

  • RNA-guided trans-splicing of RNA

    WO2023064895A1

  • Methods and compositions for targeted trans-splicing

    WO2024118946A1