Methods for enriching for methylated nucleic acid molecules

Xenonucleic blockers enhance the detection of low levels of cancer-specific methylation patterns by selectively inhibiting non-methylated sequences in qMSP assays, addressing the challenge of high homology in methylated and unmethylated DNA detection.

WO2026006465A2PCT designated stage Publication Date: 2026-01-02HARBINGER HEALTH INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/035273
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-10-17
Filing Date
2025-06-25
Publication Date
2026-01-02

AI Technical Summary

Technical Problem

Real-time quantitative methylation-specific PCR (qMSP) assays face challenges in detecting rare methylated fragments due to high homology between methylated and unmethylated DNA, limiting widespread application in cancer diagnostics.

Method used

The use of xenonucleic blockers that bind to non-methylated CpG sites to inhibit amplification and detection of these sequences, combined with qMSP, enables selective enrichment and detection of low levels of cancer-specific methylation patterns.

Benefits of technology

Enhances the sensitivity and specificity of detecting low levels of cancer-specific methylation patterns by reducing interference from unmethylated DNA, maintaining high qMSP sensitivity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025035273_02012026_PF_FP_ABST
    Figure US2025035273_02012026_PF_FP_ABST
Patent Text Reader

Abstract

Disclosed are methods for enriching for nucleic acid molecules (e.g., enriching for methylated nucleic acid molecules), thereby enriching for target sequences of interest in a sample (e.g., a sample obtained from a subject). Generally, methods involve use of xenonucleic nucleic acid blockers that block or reduce the amplification of candidate sequences e.g., sequences of non-methylated nucleic acid molecules. Such methods are useful for enriching for a signal in a sample, such as a signal informative for determining presence or absence of cancer in the sample.
Need to check novelty before this filing date? Find Prior Art

Description

Attorney Docket No. HRG-026WO METHODS FOR ENRICHING FOR METHYLATED NUCLEIC ACID MOLECULES CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of and priority to U.S. Provisional Patent Application No.63 / 663,921, filed June 25, 2024 and U.S. Provisional Patent Application No.63 / 708,356, filed October 17, 2024, which are incorporated by reference in their entirety herein. BACKGROUND

[0002] Non-invasive liquid biopsy tests are proving to be the next frontier in cancer diagnostics. There is a rising interest in sensitive, low-cost liquid biopsy assays to detect cancer-specific methylation events. Real-time quantitative methylation-specific PCR (qMSP) allows for the detection of rare methylated fragments, however widespread application has not been achieved. While qMSP achieves high specificity and sensitivity with low cfDNA inputs, assay design is challenged by the mostly three-base genome of bisulfite-converted DNA and the high homology between methylated ctDNA and excessive unmethylated cfDNA background. SUMMARY OF THE INVENTION

[0003] The disclosure relates to methods of enriching target sequences in a nucleic acid sample. The target sequence may be indicative of the risk of developing or the presence of cancer in the subject from whom the sample was taken. Disclosed herein are methods that improve detection of nucleic acids containing a target sequence, e.g., rare target sequences, by isolating and / or enriching such target sequences in a nucleic acid sample. For example, the rare target sequence may be in a nucleic acid sequence from a cfDNA sample, such as a cfDNA sample that has been treated with bisulfite or chemical / enzymatic conversion to convert cytosines to uracils to preserve information regarding the methylation status of a particular nucleic acid sequence (e.g., comprising a CpG site), in a subject. Disclosed herein are blockers (e.g., xenonucleic blockers) that bind to candidate sequences (e.g., sequences derived from non-methylated CpG sites), or to the complementary sequences thereof, to inhibit the amplification and / or detection of such sequences with high specificity, while maintaining qMSP sensitivity in low copies of target DNA (e.g., sequences derived from methylated CpG sites). The combination of qMSP and xenonucleic blockers enables detection of low levels of cancer-specific methylation patterns and estimation of percent methylated DNA.Attorney Docket No. HRG-026WO

[0004] Disclosed herein is a method for performing differential enrichment of nucleic acid molecules, the method comprising: a) providing a mixture of nucleic acid molecules comprising: a first set of nucleic acid molecules comprising a target sequence derived from a sequence comprising one or more methylated CpG sites; and a second set of nucleic acid molecules comprising a candidate sequence derived from a sequence comprising one or more non- methylated CpG sites, b) providing a blocker that binds to the candidate sequence, or a portion thereof, or the complementary sequence thereof, of the second set of nucleic acid molecules, the blocker comprising one or more xenonucleic acids; c) selectively enrich for the first set of nucleic acid molecules comprising the target sequence in comparison to the second set of nucleic acid molecules comprising the candidate sequence, wherein the blocker comprising one or more xenonucleic acids prevents or reduces enrichment of the second set of nucleic acid molecules comprising the candidate sequence; and d) detecting the selectively enriched first set of nucleic acid molecules.

[0005] In various embodiments, the one or more xenonucleic acids comprise one or more of a locked nucleic acid (LNA), hexitol nucleic acid (HNA), threose nucleic acid (TNA), glycol nucleic acid (GNA), cyclohexenyl nucleic acid (CeNA), or peptide nucleic acid (PNA). In various embodiments, the blocker comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 xenonucleic acids. In various embodiments, the blocker comprises between 6 and 12 xenonucleic acids. In various embodiments, the blocker comprises 8 xenonucleic acids. In various embodiments, the blocker comprises a xenonucleic acid at every other nucleoside. In various embodiments, the blocker comprises three consecutive xenonucleic acids at three consecutive positions. In various embodiments, the blocker comprises a xenonucleic acid at a position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site. In various embodiments, the blocker comprises a xenonucleic acid at a position immediately preceding or immediately subsequent to a position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site. In various embodiments, the blocker comprises one or more triplets of xenonucleic acids, wherein a triplet of xenonucleic acids comprises: a first xenonucleic acid at a position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site; a second xenonucleic IPTS / 200027855.1Attorney Docket No. HRG-026WO acid at a position immediately preceding the position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site; and a third xenonucleic acid at a position immediately subsequent to the position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site.

[0006] In various embodiments, the blocker comprises: one or more triplets of xenonucleic acids, wherein a triplet of xenonucleic acids comprises: a first xenonucleic acid at a position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site; a second xenonucleic acid at a position immediately preceding the position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site; a third xenonucleic acid at a position immediately subsequent to the position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site; and a sequence in which every other nucleoside is a xenonucleic acid. In various embodiments, the blocker comprises two triplets of xenonucleic acids, three triplets of xenonucleic acids, four triplets of xenonucleic acids, five triplets of xenonucleic acids, six triplets of xenonucleic acids, seven triplets of xenonucleic acids, eight triplets of xenonucleic acids, nine triplets of xenonucleic acids, or ten triplets of xenonucleic acids. In various embodiments, the blocker, when bound to the candidate sequence, increases the melting temperature to at least 65oC, optionally at least 75oC. In various embodiments, the blocker, when bound to the candidate sequence, achieves a melting temperature that is at least 5oC higher than a melting temperature of the candidate sequence bound to a probe. In various embodiments, the blocker comprises between 15 and 30 nucleosides, optionally between 16-24 nucleosides.

[0007] In various embodiments, methods disclosed herein further comprise: between step (b) and step (c), exposing the blocker and the candidate sequence to one or more temperatures, thereby enabling the blocker to bind to the candidate sequence. In various embodiments, the one or more temperatures comprises a temperature between 50oC and 65oC, optionally about 60oC. In various embodiments, the one or more temperatures comprises two different temperatures, wherein a first temperature is higher than a second temperature. In various embodiments, the first IPTS / 200027855.1Attorney Docket No. HRG-026WO temperature is between 70oC and 90oC, optionally about 80oC, and the second temperature is between 50oC and 65oC, optionally about 60oC.

[0008] In various embodiments, the first set of nucleic acid molecules and / or the second set of nucleic acid molecules are DNA. In various embodiments, the DNA is cell-free DNA. In various embodiments, the first set of nucleic acid molecules and / or the second set of nucleic acid molecules are RNA. In various embodiments, the first set of nucleic acid molecules and / or the second set of nucleic acid molecules have been treated using bisulfite conversion to convert unmethylated cytosines to uracil. In various embodiments, the first set of nucleic acid molecules and / or the second set of nucleic acid molecules have been treated using enzymatic conversion to convert unmethylated cytosines to uracil. In various embodiments, the enzymatic conversion is selected from TET2 oxidation of cytosines and APOBEC conversion of cytosines. In various embodiments, the first set of nucleic acid molecules and / or the second set of nucleic acid molecules were obtained from a sample. In various embodiments, the sample comprises a tissue sample, a blood sample, a stool sample, a urine sample, a mucous sample, or a saliva sample. In various embodiments, the target sequence comprises at least a CpG island, or a portion thereof. In various embodiments, selectively enriching the first set of nucleic acid molecules comprises performing one or more of PCR, RT-PCR, digital PCR, nicking endonuclease amplification (NEAR), transcription-mediated amplification (TMA), loop-mediated isothermal amplification (LAMP), helicase-dependent amplification (HAD), strand displacement amplification (SDA), sequencing library PCR, hybrid capture, or hybrid capture PCR. In various embodiments, selectively enrich for the first set of nucleic acid molecules comprises providing primers for performing nucleic acid amplification. In various embodiments, when a primer is bound to a sequence of the second set of nucleic acid molecules, a nucleobase of the primer is immediately adjacent to a xenonucleic acid of the blocker that is bound to the candidate sequence of the second set of nucleic acid molecules. In various embodiments, when a primer is bound to a sequence of the second set of nucleic acid molecules, a nucleoside of the 3’ end of the primer is complementary to a nucleoside of the nucleic acid molecule of the second set that is adjacent to one or more consecutive nucleosides derived from one or more consecutive CpG sites.

[0009] In various embodiments, methods disclosed herein further comprise: either simultaneous with step (b) or after step (b), providing a second blocker that binds to a different candidate IPTS / 200027855.1Attorney Docket No. HRG-026WO sequence, or a portion thereof, of the second set of nucleic acid molecules, the second blocker comprising one or more xenonucleic acids. In various embodiments, methods disclosed herein further comprise: either simultaneous with step (b) or after step (b), providing a probe capable of hybridizing to one or both of the target sequence, or portion thereof, of the first set of nucleic acid molecules and the candidate sequence, or portion thereof, of the second set of nucleic acid molecules. In various embodiments, methods disclosed herein further comprise hybridizing the probe to the target sequence, or portion thereof of the first set of nucleic acid molecules, wherein selectively enrich for the first set of nucleic acid molecules comprises enriching for the first set of nucleic acid molecules using the probe hybridized to the target sequence, or portion thereof, of the first set of nucleic acid molecules. In various embodiments, enriching for the first set of nucleic acid molecules using the probe comprises performing hybrid capture.

[0010] Additionally disclosed herein is a method for performing differential enrichment of nucleic acid molecules, the method comprising: a) providing nucleic acid molecules comprising a target sequence derived from a sequence comprising one or more methylated CpG sites; b) providing a blocker capable of binding to a candidate sequence, or a portion thereof, the candidate sequence only differing from the target sequence at nucleotides corresponding to the one or more methylated CpG sites, wherein the blocker comprises one or more xenonucleic acids; c) enriching for the nucleic acid molecules comprising the target sequence, wherein the blocker comprising one or more xenonucleic acids does not prevent enrichment of the nucleic acid molecules comprising the target sequence; and d) detecting the enriched nucleic acid molecules. In various embodiments, the one or more xenonucleic acids comprise one or more of a locked nucleic acid (LNA), hexitol nucleic acid (HNA), threose nucleic acid (TNA), glycol nucleic acid (GNA), cyclohexenyl nucleic acid (CeNA), or peptide nucleic acid (PNA). In various embodiments, the blocker comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 xenonucleic acids. In various embodiments, the blocker comprises between 6 and 12 xenonucleic acids. In various embodiments, the blocker comprises 8 xenonucleic acids. In various embodiments, the blocker comprises a xenonucleic acid at every other nucleoside. In various embodiments, the blocker comprises three consecutive xenonucleic acids at three consecutive positions. In various embodiments, the blocker comprises a xenonucleic acid at a position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a IPTS / 200027855.1Attorney Docket No. HRG-026WO nucleotide derived from a cytosine of a CpG site. In various embodiments, the blocker comprises a xenonucleic acid at a position immediately preceding or immediately subsequent to a position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site.

[0011] In various embodiments, the blocker comprises one or more triplets of xenonucleic acids, wherein a triplet of xenonucleic acids comprises: a first xenonucleic acid at a position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site; a second xenonucleic acid at a position immediately preceding the position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site; and a third xenonucleic acid at a position immediately subsequent to the position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site. In various embodiments, the blocker comprises: one or more triplets of xenonucleic acids, wherein a triplet of xenonucleic acids comprises: a first xenonucleic acid at a position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site; a second xenonucleic acid at a position immediately preceding the position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site; a third xenonucleic acid at a position immediately subsequent to the position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site; and a sequence in which every other nucleoside is a xenonucleic acid.

[0012] In various embodiments, the blocker comprises two triplets of xenonucleic acids, three triplets of xenonucleic acids, four triplets of xenonucleic acids, five triplets of xenonucleic acids, six triplets of xenonucleic acids, seven triplets of xenonucleic acids, eight triplets of xenonucleic acids, nine triplets of xenonucleic acids, or ten triplets of xenonucleic acids. In various embodiments, the blocker comprises between 15 and 30 nucleosides, optionally between 16-24 nucleosides. In various embodiments, methods disclosed herein further comprise: between step (b) and step (c), exposing the blocker to one or more temperatures. In various embodiments, the one or more temperatures comprises a temperature between 50oC and 65oC, optionally about 60oC. In various embodiments, the one or more temperatures comprises two different IPTS / 200027855.1Attorney Docket No. HRG-026WO temperatures, wherein a first temperature is higher than a second temperature. In various embodiments, the first temperature is between 70oC and 90oC, optionally about 80oC, and the second temperature is between 50oC and 65oC, optionally about 60oC. In various embodiments, the nucleic acid molecules are DNA. In various embodiments, the DNA is cell-free DNA. In various embodiments, the nucleic acid molecules are RNA. In various embodiments, the nucleic acid molecules have been treated using bisulfite conversion to convert unmethylated cytosines to uracil. In various embodiments, the nucleic acid molecules have been treated using enzymatic conversion to convert unmethylated cytosines to uracil. In various embodiments, the enzymatic conversion is selected from TET2 oxidation of cytosines and APOBEC conversion of cytosines. In various embodiments, the nucleic acid molecules were obtained from a sample. In various embodiments, the sample comprises a tissue sample, a blood sample, a stool sample, a urine sample, a mucous sample, or a saliva sample. In various embodiments, the target sequence comprises at least a CpG island, or a portion thereof. In various embodiments, enriching for the nucleic acid molecules comprises performing one or more of one or more of PCR, RT-PCR, digital PCR, nicking endonuclease amplification (NEAR), transcription-mediated amplification (TMA), loop-mediated isothermal amplification (LAMP), helicase-dependent amplification (HAD), strand displacement amplification (SDA), sequencing library PCR, hybrid capture, or hybrid capture PCR. In various embodiments, enriching for the nucleic acid molecules comprises providing primers for performing nucleic acid amplification.

[0013] In various embodiments, methods disclosed herein further comprise either simultaneous with step (b) or after step (b), providing a probe capable of hybridizing to the target sequence, or portion thereof, of the nucleic acid molecules. In various embodiments, methods disclosed herein further comprise hybridizing the probe to the target sequence, or portion thereof of the nucleic acid molecules, wherein selectively enrich for the first set of nucleic acid molecules comprises enriching for the nucleic acid molecules using the probe hybridized to the target sequence, or portion thereof, of the nucleic acid molecules. In various embodiments, enriching for the nucleic acid molecules using the probe comprises performing hybrid capture.

[0014] Additionally disclosed herein is a method for performing differential enrichment of nucleic acid molecules, the method comprising: a) providing nucleic acid molecules comprising a candidate sequence derived from a sequence comprising one or more non-methylated CpG IPTS / 200027855.1Attorney Docket No. HRG-026WO sites; b) providing a blocker capable of binding to the candidate sequence, or a portion thereof, wherein the blocker comprises one or more xenonucleic acids; and c) exposing the nucleic acid molecules comprising the candidate sequence to conditions suitable for nucleic acid enrichment, wherein the blocker comprising one or more xenonucleic acids binds to the candidate sequence, or a portion thereof, and prevents or reduces enrichment of nucleic acid molecules comprising the candidate sequence. In various embodiments, the one or more xenonucleic acids comprise one or more of a locked nucleic acid (LNA), hexitol nucleic acid (HNA), threose nucleic acid (TNA), glycol nucleic acid (GNA), cyclohexenyl nucleic acid (CeNA), or peptide nucleic acid (PNA). In various embodiments, the blocker comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 xenonucleic acids. In various embodiments, the blocker comprises between 6 and 12 xenonucleic acids. In various embodiments, the blocker comprises 8 xenonucleic acids. In various embodiments, the blocker comprises a xenonucleic acid at every other nucleoside. In various embodiments, the blocker comprises three consecutive xenonucleic acids at three consecutive positions. In various embodiments, the blocker comprises a xenonucleic acid at a position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site. In various embodiments, the blocker comprises a xenonucleic acid at a position immediately preceding or immediately subsequent to a position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site.

[0015] In various embodiments, the blocker comprises one or more triplets of xenonucleic acids, wherein a triplet of xenonucleic acids comprises: a first xenonucleic acid at a position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site; a second xenonucleic acid at a position immediately preceding the position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site; and a third xenonucleic acid at a position immediately subsequent to the position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site. In various embodiments, the blocker comprises: one or more triplets of xenonucleic acids, wherein a triplet of xenonucleic acids comprises: a first xenonucleic acid at a position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a IPTS / 200027855.1Attorney Docket No. HRG-026WO nucleotide derived from a cytosine of a CpG site; a second xenonucleic acid at a position immediately preceding the position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site; a third xenonucleic acid at a position immediately subsequent to the position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site; and a sequence in which every other nucleoside is a xenonucleic acid. In various embodiments, the blocker comprises two triplets of xenonucleic acids, three triplets of xenonucleic acids, four triplets of xenonucleic acids, five triplets of xenonucleic acids, six triplets of xenonucleic acids, seven triplets of xenonucleic acids, eight triplets of xenonucleic acids, nine triplets of xenonucleic acids, or ten triplets of xenonucleic acids.

[0016] In various embodiments, the blocker comprises between 15 and 30 nucleosides, optionally between 16-24 nucleosides. In various embodiments, methods disclosed herein further comprise: between step (b) and step (c), exposing the blocker to one or more temperatures, thereby enabling the blocker to bind to the candidate sequence. In various embodiments, the one or more temperatures comprises a temperature between 50oC and 65oC, optionally about 60oC. In various embodiments, the one or more temperatures comprises two different temperatures, wherein a first temperature is higher than a second temperature. In various embodiments, the first temperature is between 70oC and 90oC, optionally about 80oC, and the second temperature is between 50oC and 65oC, optionally about 60oC. In various embodiments, the nucleic acid molecules are DNA. In various embodiments, the DNA is cell-free DNA. In various embodiments, the nucleic acid molecules are RNA. In various embodiments, the nucleic acid molecules have been treated using bisulfite conversion to convert unmethylated cytosines to uracil. In various embodiments, the nucleic acid molecules have been treated using enzymatic conversion to convert unmethylated cytosines to uracil. In various embodiments, the enzymatic conversion is selected from TET2 oxidation of cytosines and APOBEC conversion of cytosines. In various embodiments, the nucleic acid molecules were obtained from a sample. In various embodiments, the sample comprises a tissue sample, a blood sample, a stool sample, a urine sample, a mucous sample, or a saliva sample. In various embodiments, the target sequence comprises at least a CpG island, or a portion thereof. In various embodiments, enriching for the nucleic acid molecules comprises performing one or more of one or more of PCR, RT-PCR, IPTS / 200027855.1Attorney Docket No. HRG-026WO digital PCR, nicking endonuclease amplification (NEAR), transcription-mediated amplification (TMA), loop-mediated isothermal amplification (LAMP), helicase-dependent amplification (HAD), strand displacement amplification (SDA), sequencing library PCR, hybrid capture, or hybrid capture PCR.

[0017] These and other aspects and features of the disclosure are described in the following detailed description and claims. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] The foregoing and other objects, features and advantages of the invention will become apparent from the following description of preferred embodiments, as illustrated in the accompanying drawings. Like referenced elements identify common features in the corresponding drawings. The drawings are not necessarily to scale, with emphasis instead being placed on illustrating the principles of the present invention, in which:

[0019] It is noted that wherever practicable similar or like reference numbers may be used in the figures and may indicate similar or like functionality. For example, a letter after a reference numeral, such as “nucleic acid molecule 415A,” indicates that the text refers specifically to the element having that particular reference numeral. A reference numeral in the text without a following letter, such as “nucleic acid molecule 415” refers to any or all of the elements in the figures bearing that reference numeral (e.g. “nucleic acid molecule 415” in the text refers to reference numerals “nucleic acid molecule 415A” and / or “nucleic acid molecule 415B” in the figures).

[0020] Figure (FIG) 1 shows an example flow diagram for differentially enriching for nucleic acid molecules, in accordance with an embodiment.

[0021] FIG.2A depicts an example conversion of nucleic acids, in accordance with an embodiment.

[0022] FIG.2B shows the results of nitrite conversion on select nucleotides, in accordance with a second embodiment. Figure adapted from Li et al. (2022) Genome Biology 23:122.

[0023] FIGs.3A-3C show example designs of xenonucleic blocker sequences, in accordance with an embodiment.

[0024] FIG.4A depict diagrams involving blockers, in accordance with an embodiment. IPTS / 200027855.1Attorney Docket No. HRG-026WO

[0025] FIG.4B depicts a diagram involving provision of probes, in accordance with a first embodiment.

[0026] FIG.4C depicts a diagram involving provision of primers, in accordance with a second embodiment.

[0027] FIG.4D depicts a diagram involving provision of probes and primers, in accordance with a third embodiment.

[0028] FIG.5A shows an example depiction of blocker-induced enrichment.

[0029] FIG.5B shows changes in cycle threshold (Ct) for methylated DNA does not change in the presence or absence of blockers. FIG.5C shows a shift in the Ct value for unmethylated DNA in the presence of blockers. FIG. 5D depicts a scenario in which unmethylated DNA is not amplified, thereby resulting in a significant change in Ct value.

[0030] FIGs.6A and 6B show that a xenonucleic acid blocker (including LNAs), successfully differentiates between 0% methylated DNA and 1% methylated DNA based on qPCR Ct values.

[0031] FIG.7A shows a comparison between blocker 1 (LNA at every other position) and blocker 2 (triplet LNAs at positions immediately preceding, immediately subsequent to, and corresponding to a CpG site).

[0032] FIG.7B shows a comparison between blocker 4 (LNA at every other position) and blocker 5 (triplet LNAs at positions immediately preceding, immediately subsequent to, and corresponding to a CpG site and further LNA at every other position).

[0033] FIG.8 shows a comparison between blocker 5 (8 total LNAs) and blocker 6 (11 total LNAs).

[0034] FIG.9 shows a comparison between blocker 1 (3 CpG mismatches, with all 3 CpG mismatches located towards the center of the blocker sequence) and blocker 3 (2 CpG mismatches, with only 1 CpG mismatch located towards the center of the blocker sequence).

[0035] FIGs.10A-10B show that all blockers achieve Ct differences in unmethylated sequences due to probe displacement.

[0036] FIGs.10C and 10D show exemplary gels following the use of blocker 3 and blocker 6.

[0037] FIG.11 shows that increasing blocker concentrations increases blocking but can also reduce blocking specificity. 11 IPTS / 200027855.1Attorney Docket No. HRG-026WO

[0038] FIG.12 shows the results of a 2-step annealing process in comparison to a 1 step annealing process.

[0039] FIG.13 shows that combining multiple blockers can improve blocking efficiency and specificity.

[0040] FIG.14 shows that three blockers specifically inhibit unmethylated DNA in patient-like samples down to 15 copies of tumor DNA (e.g., 1% methylation).

[0041] FIG.15 shows the average EPF (RFU) of methylated DNA and unmethylated DNA of each qMSP reaction of the indicated target region with no LNA blockers.

[0042] FIG.16 show exemplary gels following the use of the indicated blockers. The gel for S03 is the result using 5X blocker. The gel of S05 is the result using 1X blocker. The gel for S10 is the result using 1X blocker. The other gels are the result without using a blocker. The qPCR reactions that showed inhibition of amplification of unmethylated DNA have the DNA products circled in green, while the reactions that did not results in inhibition have the DNA products circled in orange. A table summarizes the number of CpG sites in one of the primers of the qPCR reaction and the distance of the CpG sites from the 3’ end for the qPCR reactions that showed amplification inhibition.

[0043] FIG.17 shows an exemplary gel and an exemplary graph of the EPF (RFU) of methylated and unmethylated DNA following the use of blocker S01 & S06.

[0044] FIG.18 shows an exemplary gel and an exemplary graph of the EPF (RFU) of methylated and unmethylated DNA following the use of blocker S02.

[0045] FIG.19 shows an exemplary gel and an exemplary graph of the EPF (RFU) of methylated and unmethylated DNA following the use of blocker S03.

[0046] FIG.20 shows an exemplary gel and an exemplary graph of the EPF (RFU) of methylated and unmethylated DNA following the use of blocker S04.

[0047] FIG.21 shows an exemplary gel and an exemplary graph of the EPF (RFU) of methylated and unmethylated DNA following the use of blocker S05.

[0048] FIG.22 shows an exemplary gel and an exemplary graph of the EPF (RFU) of methylated and unmethylated DNA following the use of blocker S07.

[0049] FIG.23 shows an exemplary gel and an exemplary graph of the EPF (RFU) of methylated and unmethylated DNA following the use of blocker S08. IPTS / 200027855.1Attorney Docket No. HRG-026WO

[0050] FIG.24 shows an exemplary gel and an exemplary graph of the EPF (RFU) of methylated and unmethylated DNA following the use of blocker S10. DETAILED DESCRIPTION Definitions

[0051] The articles “a” and “an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element.

[0052] As used herein, the term “about” or “approximately” can mean within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which can depend in part on how the value is measured or determined, e.g., the limitations of the measurement system. For example, “about” can mean within 1 or more than 1 standard deviation, per the practice in the art. “About” can mean a range of ±20%, ±10%, ±5%, or ±1% of a given value. The term “about” or “approximately” can mean within an order of magnitude, within 5-fold, or within 2-fold, of a value. Where a particular value is described in the application and claims, unless otherwise stated the term “about” meaning within an acceptable error range for the particular value can be assumed. The term “about” can have the meaning as commonly understood by one of ordinary skill in the art. The term “about” can refer to ±10%. The term “about” can refer to ±5%.

[0053] It should be understood that the expression of “at least one of” includes individually each of the recited objects after the expression and the various combinations of two or more of the recited objects unless otherwise understood from the context and use. The expression “and / or” in connection with three or more recited objects should be understood to have the same meaning unless otherwise understood from the context.

[0054] As used herein, the term “biological sample,” or “sample” refers to any sample taken from a subject, which can reflect a biological state associated with the subject, and that includes cell free DNA. A biological sample can take any of a variety of forms, such as a liquid biopsy (e.g., blood, urine, stool, saliva, or mucous), or a tissue biopsy, or other solid biopsy. Examples of biological samples include, but are not limited to, blood, whole blood, plasma, serum, urine, cerebrospinal fluid, fecal, saliva, sweat, tears, pleural fluid, pericardial fluid, or peritoneal fluid 13 IPTS / 200027855.1Attorney Docket No. HRG-026WO of the subject. A biological sample can include any tissue or material derived from a living or dead subject. A biological sample can be a cell-free sample. A biological sample can comprise a nucleic acid (e.g., DNA or RNA) or a fragment thereof. The term “nucleic acid” can refer to deoxyribonucleic acid (DNA), ribonucleic acid (RNA) or any hybrid or fragment thereof. The nucleic acid in the sample can be a cell-free nucleic acid. A sample can be a liquid sample or a solid sample (e.g., a cell or tissue sample). A biological sample can be a bodily fluid, such as blood, plasma, serum, urine, vaginal fluid, fluid from a hydrocele (e.g., of the testis), vaginal flushing fluids, pleural fluid, ascitic fluid, cerebrospinal fluid, saliva, sweat, tears, sputum, bronchoalveolar lavage fluid, discharge fluid from the nipple, aspiration fluid from different parts of the body (e.g., thyroid, breast), etc. A biological sample can be a stool sample. In various embodiments, the majority of DNA in a biological sample that has been enriched for cell-free DNA (e.g., a plasma sample obtained via a centrifugation protocol) can be cell-free (e.g., greater than 50%, 60%, 70%, 80%, 90%, 95%, or 99% of the DNA can be cell-free). A biological sample can be treated to physically disrupt tissue or cell structure (e.g., centrifugation and / or cell lysis), thus releasing intracellular components into a solution which can further contain enzymes, buffers, salts, detergents, and the like which can be used to prepare the sample for analysis.

[0055] As used herein, the terms “nucleic acid” and “nucleic acid molecule” are used interchangeably. The terms refer to nucleic acids of any composition form, such as deoxyribonucleic acid (DNA, e.g., complementary DNA (cDNA), genomic DNA (gDNA) and the like), and / or DNA analogs (e.g., containing base analogs, sugar analogs and / or a non-native backbone and the like), all of which can be in single- or double-stranded form. Unless otherwise limited, a nucleic acid can comprise known analogs of natural nucleotides, some of which can function in a similar manner as naturally occurring nucleotides. A nucleic acid can be in any form useful for conducting processes herein (e.g., linear, circular, supercoiled, single-stranded, double-stranded and the like). A nucleic acid in some embodiments can be from a single chromosome or fragment thereof (e.g., a nucleic acid sample may be from one chromosome of a sample obtained from a diploid organism). In certain embodiments nucleic acids comprise nucleosomes, fragments or parts of nucleosomes or nucleosome-like structures. Nucleic acids can comprise protein (e.g., histones, DNA binding proteins, and the like). Nucleic acids IPTS / 200027855.1Attorney Docket No. HRG-026WO analyzed by processes described herein can be substantially isolated and are not substantially associated with protein or other molecules. Nucleic acids can also include derivatives, variants and analogs of DNA synthesized, replicated or amplified from single-stranded (“sense” or “antisense,” “plus” strand or “minus” strand, “forward” reading frame or “reverse” reading frame) and double-stranded polynucleotides. Deoxyribonucleotides can include deoxyadenosine, deoxycytidine, deoxyguanosine and deoxythymidine. A nucleic acid may be prepared using a nucleic acid obtained from a subject as a template.

[0056] As used herein, the terms “template nucleic acid” and “template nucleic acid molecule(s)” are used interchangeably. The terms refer to nucleic acid that has been obtained from a sample and processed to form an immortalized library. The template nucleic acid can be nucleic acid obtained directly from the sample, or nucleic acid that is derived from that obtained directly from the sample. Examples of nucleic acid derived from a sample include DNA that has been reverse-transcribed from RNA obtained directly from a sample, or DNA that has be amplified from DNA obtained directly from a sample, for example, by PCR.

[0057] As used herein, the term “cell-free nucleic acids” refers to nucleic acid molecules that can be found outside cells, in bodily fluids such as blood, whole blood, plasma, serum, urine, cerebrospinal fluid, fecal, saliva, sweat, sweat, tears, pleural fluid, pericardial fluid, or peritoneal fluid of a subject. Cell-free nucleic acids originate from one or more healthy cells and / or from one or more cancer cells, or from non-human sources such bacteria, fungi, viruses. Examples of the cell-free nucleic acids include but are not limited to cell-free DNA (“cfDNA”), including mitochondrial DNA or genomic DNA, and cell-free RNA. In certain embodiments herein, instruments for assessing the quality of the cell-free nucleic acids, such as the TapeStation System from Agilent Technologies (Santa Clara, CA) can be used. Concentrating low- abundance cfDNA can be accomplished, for example using a Qubit™ Fluorometer from Thermofisher Scientific (Waltham, MA).

[0058] As used herein, the term “methylation” refers to a modification of a nucleic acid where a hydrogen atom on the pyrimidine ring of a cytosine base is converted to a methyl group, forming 5-methylcytosine. Methylation can occur at dinucleotides of cytosine and guanine referred to herein as “CpG sites”. Methylation of cytosine can occur in cytosines in other sequencecontexts, for example, 5 -CHG-3 and 5 -CHH-3 , where H is adenine, cytosine or thymine.IPTS / 200027855.1Attorney Docket No. HRG-026WO Cytosine methylation can also be in the form of 5-hydroxymethylcytosine. Methylation of DNA can include methylation of non-cytosine nucleotides, such as N6-methyladenine. Anomalous cfDNA methylation can be identified as hypermethylation or hypomethylation, both of which may be indicative of cancer status. As is well known in the art, DNA methylation anomalies (compared to healthy controls) can cause different effects, which may contribute to cancer.

[0059] Certain portions of a genome comprise regions with a high frequency of CpG sites. A CpG site is portion of a genome that has cytosine and guanine separated by only one phosphate group and is often denoted as “5'—C—phosphate—G—3'”, or “CpG” for short. Regions with a high frequency of CpG sites are commonly referred to as “CG islands” or “CGIs”. It has been found that certain CGIs and certain features of certain CGIs in tumor cells tend to be different from the same CGIs or features of the CGIs in healthy cells. Herein, such CGIS and features of the genome are referred to herein as “cancer informative CGIs”, which is defined and described in more detail below. An “informative CpG” can be specified by reference to a specific CpG site, or to a collection of one or more CpG sites by reference to a CG island that contains the collection. These cancer informative CGIs tend to have methylation patterns in tumor cells that are different from the methylation patterns in healthy cells. DNA fragments from other CGIs may not express such differences.

[0060] As used herein, “DNA methylation” in mammalian genomes can refer to the addition of a methyl group to position 5 of the heterocyclic ring of cytosine (e.g., to produce 5- methylcytosine) among CpG dinucleotides. Methylation of cytosine can occur in cytosines inother sequence contexts, for example, 5 -CHG-3 and 5 -CHH-3 , where H is adenine, cytosine orthymine. Cytosine methylation can also be in the form of 5-hydroxymethylcytosine. Methylation of DNA can include methylation of non-cytosine nucleotides, such as N6- methyladenine.

[0061] The phrase “target sequence” refers to a sequence of a nucleic acid derived from a sequence comprising one or more methylated CpG sites. For example, the target sequence may be a sequence of a converted nucleic acid (e.g., where unmethylated cytosines have been converted to uracil and / or where methylated cytosines remain cytosines). In various embodiments, a target sequence includes one, two, three, four, five, six, seven, eight, nine, or ten CpG sites. In various embodiments, a target sequence includes one or more CpG sites within a IPTS / 200027855.1Attorney Docket No. HRG-026WO region disclosed in Table 1 or Table 2. In particular embodiments, a target sequence includes five CpG sites within a region disclosed in Table 1 or Table 2. In particular embodiments, a target sequence includes five sequential CpG sites within a region disclosed in Table 1 or Table 2.

[0062] The phrase “candidate sequence” refers to a sequence of a nucleic acid derived from a sequence comprising one or more non-methylated CpG sites. For example, the candidate sequence may be a sequence of a converted nucleic acid (e.g., where unmethylated cytosines have been converted to uracil and / or where methylated cytosines remain cytosines). In various embodiments, a candidate sequence includes one, two, three, four, five, six, seven, eight, nine, or ten CpG sites. In various embodiments, a candidate sequence includes one or more CpG sites within a region disclosed in Table 1 or Table 2. In particular embodiments, a candidate sequence includes five CpG sites within a region disclosed in Table 1 or Table 2. In particular embodiments, a candidate sequence includes five sequential CpG sites within a region disclosed in Table 1 or Table 2.

[0063] The phrase “sequential CpG sites” refers to CpG sites within a range of genomic locations in which all CpG sites within the range of genomic locations are part of the sequential CpG sites. Sequential CpG sites include a neighboring CpG site i.e., a previous contiguous or next contiguous CpG site.

[0064] The phrase “unmethylated nucleic acid molecules” is broadly used to encompass nucleic acid molecules comprising sequences that include one or more unmethylated CpG sites and / or nucleic acid sequences derived from nucleic acid sequences that include one or more unmethylated CpG sites. For example, “unmethylated nucleic acid molecules” can refer to converted nucleic acid sequences (e.g., bisulfite-converted nucleic acid sequences) that are derived from cell-free DNA that include sequences with one or more unmethylated CpG sites.

[0065] As used herein, the term “amplifying” means performing an amplification reaction. In one aspect, an amplification reaction is “template-driven” in that base pairing of reactants, either nucleotides or oligonucleotides, have complements in a template polynucleotide that are required for the creation of reaction products. In one aspect, template-driven reactions are primer extensions with a nucleic acid polymerase, or oligonucleotide ligations with a nucleic acid ligase. Such reactions include, but are not limited to, polymerase chain reactions (PCRs), bisulfite- IPTS / 200027855.1Attorney Docket No. HRG-026WO specific qPCR (qBSP), methylation-specific qPCR (qMSP), linear polymerase reactions, nucleic acid sequence-based amplification (NASBAs), rolling circle amplifications, and the like, disclosed in the following references, each of which are incorporated herein by reference herein in their entirety: Mullis et al., U.S. Pat. Nos. 4,683,195; 4,965,188; 4,683,202; 4,800,159 (PCR); Gelfand et al., U.S. Pat. No.5,210,015 (real-time PCR with “taqman” probes); Wittwer et al., U.S. Pat. No.6,174,670; Kacian et al., U.S. Pat. No.5,399,491 (“NASBA”); Lizardi, U.S. Pat. No.5,854,033; Aono et al., Japanese patent publ. JP 4-262799 (rolling circle amplification); and the like. As used herein, bisulfite-specific PCR refers to PCR that amplifies converted DNA with no or limited methylation bias. As used herein, methylation-specific PCR refers to PCR that is methylation-specific and bi-sulfite specific, which amplifies converted methylated DNA. In one aspect, the amplification reaction is PCR. An amplification reaction may be a “real-time” amplification if a detection chemistry is available that permits a reaction product to be measured as the amplification reaction progresses, e.g., “real-time PCR”, or “real-time NASBA” as described in Leone et al., Nucleic Acids Research, 26: 2150-2155 (1998), and like references.

[0066] The terms “fragment” or “segment”, as used interchangeably herein, refer to a portion of a larger polynucleotide molecule. A polynucleotide, for example, can be broken up, or fragmented into, a plurality of segments. Various methods of fragmenting nucleic acid are well known in the art. These methods may be, for example, either chemical or physical or enzymatic in nature. Enzymatic fragmentation may include partial degradation with a DNase; partial depurination with acid; the use of restriction enzymes; intron-encoded endonucleases; DNA- based cleavage methods, such as triplex and hybrid formation methods, that rely on the specific hybridization of a nucleic acid segment to localize a cleavage agent to a specific location in the nucleic acid molecule; or other enzymes or compounds which cleave a polynucleotide at known or unknown locations. Physical fragmentation methods may involve subjecting a polynucleotide to a high shear rate. High shear rates may be produced, for example, by moving DNA through a chamber or channel with pits or spikes, or forcing a DNA sample through a restricted size flow passage, e.g., an aperture having a cross sectional dimension in the micron or submicron range. Other physical methods include sonication and nebulization. Combinations of physical and chemical fragmentation methods may likewise be employed, such as fragmentation by heat and ion-mediated hydrolysis. See, e.g., Sambrook et al., “Molecular Cloning: A Laboratory IPTS / 200027855.1Attorney Docket No. HRG-026WO Manual,” 3rd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2001) (“Sambrook et al.) which is incorporated herein by reference for all purposes. These methods can be optimized to digest a nucleic acid into fragments of a selected size range.

[0067] The terms “polymerase chain reaction” or “PCR”, as used interchangeably herein, mean a reaction for the in vitro amplification of specific DNA sequences by the simultaneous primer extension of complementary strands of DNA. In other words, PCR is a reaction for making multiple copies or replicates of a target nucleic acid flanked by primer binding sites, such reaction comprising one or more repetitions of the following steps: (i) denaturing the target nucleic acid, (ii) annealing primers to the primer binding sites, and (iii) extending the primers by a nucleic acid polymerase in the presence of nucleoside triphosphates. Usually, the reaction is cycled through different temperatures optimized for each step in a thermal cycler instrument. Particular temperatures, durations at each step, and rates of change between steps depend on many factors that are well-known to those of ordinary skill in the art, e.g., exemplified by the following references: McPherson et al., editors, PCR: A Practical Approach and PCR2: A Practical Approach (IRL Press, Oxford, 1991 and 1995, respectively). For example, in a conventional PCR using Taq DNA polymerase, a double stranded target nucleic acid may be denatured at a temperature>90° C, primers annealed at a temperature in the range 50-75°C, and primers extended at a temperature in the range 72-78°C. The term “PCR” encompasses derivative forms of the reaction, including, but not limited to, RT-PCR, real-time PCR, nested PCR, quantitative PCR, multiplexed PCR, and the like. The particular format of PCR being employed is discernible by one skilled in the art from the context of an application. Reaction volumes can range from a few hundred nanoliters, e.g., 200 nL, to a few hundred L, e.g., 200 L. “Reverse transcription PCR,” or “RT-PCR,” means a PCR that is preceded by a reverse transcription reaction that converts a target RNA to a complementary single stranded DNA, which is then amplified, an example of which is described in Tecott et al., U.S. Pat. No. 5,168,038, the disclosure of which is incorporated herein by reference in its entirety. “Real-time PCR” means a PCR for which the amount of reaction product, i.e., amplicon, is monitored as the reaction proceeds. There are many forms of real-time PCR that differ mainly in the detection chemistries used for monitoring the reaction product, e.g., Gelfand et al., U.S. Pat. No.5,210,015 (“taqman”); Wittwer et al., U.S. Pat. Nos.6,174,670 and 6,569,627 (intercalating dyes); Tyagi et IPTS / 200027855.1Attorney Docket No. HRG-026WO al., U.S. Pat. No.5,925,517 (molecular beacons); the disclosures of which are hereby incorporated by reference herein in their entireties. Detection chemistries for real-time PCR are reviewed in Mackay et al., Nucleic Acids Research, 30: 1292-1305 (2002), which is also incorporated herein by reference. “Nested PCR” means a two-stage PCR wherein the amplicon of a first PCR becomes the sample for a second PCR using a new set of primers, at least one of which binds to an interior location of the first amplicon. As used herein, “initial primers” in reference to a nested amplification reaction mean the primers used to generate a first amplicon, and “secondary primers” mean the one or more primers used to generate a second, or nested, amplicon. “Asymmetric PCR” means a PCR wherein one of the two primers employed is in great excess concentration so that the reaction is primarily a linear amplification in which one of the two strands of a target nucleic acid is preferentially copied. The excess concentration of asymmetric PCR primers may be expressed as a concentration ratio. Typical ratios are in the range of from 10 to 100. “Multiplexed PCR” means a PCR wherein multiple target sequences (or a single target sequence and one or more reference sequences) are simultaneously carried out in the same reaction mixture, e.g., Bernard et al., Anal. Biochem., 273: 221-228 (1999) (two- color real-time PCR). Usually, distinct sets of primers are employed for each sequence being amplified. Typically, the number of target sequences in a multiplex PCR is in the range of from 2 to 50, or from 2 to 40, or from 2 to 30. In particular embodiments, the number of target sequences in a multiplex PCR is about 4. “Quantitative PCR” means a PCR designed to measure the abundance of one or more specific target sequences in a sample or specimen. Quantitative PCR includes both absolute quantitation and relative quantitation of such target sequences. Quantitative measurements are made using one or more reference sequences or internal standards that may be assayed separately or together with a target sequence. The reference sequence may be endogenous or exogenous to a sample or specimen, and in the latter case, may comprise one or more competitor templates. Typical endogenous reference sequences include segments of transcripts of the following genes: -actin, GAPDH, 2-microglobulin, ribosomal RNA, and the like. Techniques for quantitative PCR are well-known to those of ordinary skill in the art, as exemplified in the following references, which are incorporated by reference herein in their entireties: Freeman et al., Biotechniques, 26: 112-126 (1999); Becker-Andre et al., Nucleic Acids Research, 17: 9437-9447 (1989); Zimmerman et al., Biotechniques, 21: 268-279 (1996); IPTS / 200027855.1Attorney Docket No. HRG-026WO Diviacco et al., Gene, 122: 3013-3020 (1992); and Becker-Andre et al., Nucleic Acids Research, 17: 9437-9446 (1989).

[0068] The term “primer” as used herein means an oligonucleotide, either natural or synthetic, that is capable, upon forming a duplex with a polynucleotide template, of acting as a point ofinitiation of nucleic acid synthesis and being extended from its 3 end along the template so thatan extended duplex is formed. Extension of a primer is usually carried out with a nucleic acid polymerase, such as a DNA or RNA polymerase. The sequence of nucleotides added in the extension process is determined by the sequence of the template polynucleotide. Usually, primers are extended by a DNA polymerase. Primers usually have a length in the range of from 14 to 40 nucleotides, or in the range of from 18 to 36 nucleotides. Primers are employed in a variety of nucleic amplification reactions, for example, linear amplification reactions using a single primer, or polymerase chain reactions, employing two or more primers. Guidance for selecting the lengths and sequences of primers for particular applications is well known to those of ordinary skill in the art, as evidenced by the following reference that is incorporated by reference herein in its entirety: Dieffenbach, editor, PCR Primer: A Laboratory Manual, 2nd Edition (Cold Spring Harbor Press, New York, 2003).

[0069] As used herein, the term “subject” refers to any living or non-living organism, including but not limited to a human (e.g., a male human, female human, fetus, pregnant female, child, or the like), a non-human animal, a plant, a bacterium, a fungus or a protist. Any human or non- human animal can serve as a subject, including but not limited to mammal, reptile, avian, amphibian, fish, ungulate, ruminant, bovine (e.g., cattle), equine (e.g., horse), caprine and ovine (e.g., sheep, goat), swine (e.g., pig), camelid (e.g., camel, llama, alpaca), monkey, ape (e.g., gorilla, chimpanzee), ursid (e.g., bear), poultry, dog, cat, mouse, rat, fish, dolphin, whale and shark. In some embodiments, a subject is a male or female of any age (e.g., a man, a women or a child).

[0070] As used herein, “nucleoside” refers to a nucleobase linked to a sugar. The term “nucleoside” also includes a “modified nucleoside” which has independently, a modified sugar moiety and / or modified nucleobase. In various embodiments, a nucleoside refers to a xenonucleic acid, examples of which include a locked nucleic acid (LNA), hexitol nucleic acid IPTS / 200027855.1Attorney Docket No. HRG-026WO (HNA), threose nucleic acid (TNA), glycol nucleic acid (GNA), cyclohexenyl nucleic acid (CeNA), or peptide nucleic acid (PNA).

[0071] As used herein “selective enrichment of nucleic acid molecules” refers to the increased enrichment of nucleic acid molecules in relation to other nucleic acids. In various embodiments, selective enrichment refers to at least a fold enrichment of nucleic acid molecules relative to other nucleic acid molecules. Thus, in scenarios involving amplification and / or hybrid capture, selective enrichment of nucleic acid molecules does not require complete abatement or elimination of amplification and / or hybrid capture of other nucleic acid molecules. Rather, at least a fold increase in the amplification and / or hybrid capture of nucleic acid molecules is achieved in comparison to other nucleic acid molecules. In various embodiments, selective enrichment of nucleic acid molecules refers to at least a 2-fold increase, at least a 3-fold increase, at least a 4-fold increase, at least a 5-fold increase, at least a 6-fold increase, at least a 7-fold increase, at least a 8-fold increase, at least a 9-fold increase, at least a 10-fold increase, at least a 15-fold increase, at least a 20-fold increase, at least a 25 fold increase, at least a 50-fold increase, at least a 100-fold increase, at least a 200-fold increase, at least a 500-fold increase, or at least a 1000-fold increase of the nucleic acid molecules relative to other nucleic acids.

[0072] Unless otherwise defined herein, scientific and technical terms used in this application shall have the meanings that are commonly understood by those of ordinary skill in the art.

[0073] The practice of the present disclosure will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are within the skill of the art. Such techniques are explained fully in the literature, such as, Molecular Cloning: A Laboratory Manual, second edition (Sambrook et al., 1989) Cold Spring Harbor Press; Oligonucleotide Synthesis (M.J. Gait, ed., 1984); Methods in Molecular Biology, Humana Press; Cell Biology: A Laboratory Notebook (J.E. Cellis, ed., 1998) Academic Press; Animal Cell Culture (R.I. Freshney, ed., 1987); Introduction to Cell and Tissue Culture (J. P. Mather and P.E. Roberts, 1998) Plenum Press; Cell and Tissue Culture: Laboratory Procedures (A. Doyle, J.B. Griffiths, and D.G. Newell, eds., 1993-1998) J. Wiley and Sons; Methods in Enzymology (Academic Press, Inc.); Gene Transfer Vectors for Mammalian Cells (J.M. Miller and M.P. Calos, eds., 1987); Current Protocols in Molecular Biology (F.M. Ausubel et al., eds., 1987); PCR: The IPTS / 200027855.1Attorney Docket No. HRG-026WO Polymerase Chain Reaction, (Mullis et al., eds., 1994); Sambrook and Russell, Molecular Cloning: A Laboratory Manual, 3rd. ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001); Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, NY (2002); Harlow and Lane Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1998); Coligan et al., Short Protocols in Protein Science, John Wiley & Sons, NY (2003); Short Protocols in Molecular Biology (Wiley and Sons, 1999).

[0074] Enzymatic reactions and purification techniques are performed according to manufacturer’s specifications, as commonly accomplished in the art or as described herein. The nomenclatures used in connection with, and the laboratory procedures and techniques of, analytical chemistry, biochemistry, immunology, molecular biology, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well-known and commonly used in the art. Standard techniques are used for chemical syntheses, and chemical analyses.

[0075] Throughout this specification and embodiments, the word “comprise,” or variations such as “comprises” or “comprising,” will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers.

[0076] It is understood that wherever embodiments are described herein with the language “comprising,” otherwise analogous embodiments described in terms of “consisting of” and / or “consisting essentially of” are also provided.

[0077] Any example(s) following the term “e.g.” or “for example” is not meant to be exhaustive or limiting.

[0078] Unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular.

[0079] Notwithstanding that the numerical ranges and parameters setting forth the broad scope of the disclosure are approximations, the numerical values set forth in the specific examples are reported as precisely as possible. Any numerical value, however, inherently contains certain errors necessarily resulting from the standard deviation found in their respective testing measurements. Moreover, all ranges disclosed herein are to be understood to be inclusive of the numbers defining the range and to encompass any and all subranges subsumed therein. For IPTS / 200027855.1Attorney Docket No. HRG-026WO example, a stated range of “1 to 10” should be considered to include any and all subranges between (and inclusive of) the minimum value of 1 and the maximum value of 10; that is, all subranges beginning with a minimum value of 1 or more, e.g., 1 to 6.1, and ending with a maximum value of 10 or less, e.g., 5.5 to 10.

[0080] Where aspects or embodiments of the disclosure are described in terms of a Markush group or other grouping of alternatives, the present disclosure encompasses not only the entire group listed as a whole, but each member of the group individually and all possible subgroups of the main group, but also the main group absent one or more of the group members. The present disclosure also envisages the explicit exclusion of one or more of any of the group members in an embodiment of the disclosure.

[0081] Exemplary methods and materials are described herein, although methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present disclosure. The materials, methods, and examples are illustrative only and not intended to be limiting. Overview

[0082] Disclosed herein are methods for performing differential enrichment of nucleic acid molecules e.g., enriching for nucleic acid molecules comprising a target sequence. Such methods are useful for enriching for a signal in a sample, such as a signal informative for determining presence or absence of cancer in the sample. In various embodiments, methods disclosed herein are useful for enriching for hypermethylation sites by inhibiting or blocking non-methylated sites. For example, this enrichment technology can be used for methylation detection from bisulfite-converted DNA in qPCR, dPCR, hybridization capture, etc. The blockers outcompete the probe or primer by having a higher Tm, which allows for binding to targeted non-methylated DNA prior to the probe and / or primers, subsequently inhibiting hybridization of the probe or steps of PCR.

[0083] In various embodiments, methods for performing differential enrichment of nucleic acid molecules involve providing a mixture of nucleic acid molecules comprising: a first set of nucleic acid molecules comprising a target sequence derived from a sequence comprising one or more methylated CpG sites; and a second set of nucleic acid molecules comprising a candidate sequence derived from a sequence comprising one or more non-methylated CpG sites. Given the IPTS / 200027855.1Attorney Docket No. HRG-026WO differentially methylated CpG sites in the first and second set of nucleic acid molecules, methods involve providing a blocker that selectively binds to the candidate sequence, or a portion thereof, of the second set of nucleic acid molecules, the blocker comprising one or more xenonucleic acids. The blocker may contain a sequence that is at least 90%, at least 95%, or 100% complementary to the candidate sequence, or a portion thereof of the second set of nucleic acid molecules. Additionally, given that the first set of nucleic acid molecules was derived from a sequence comprising one or more methylated CpG sites, the blocker contains a sequence that contains one or more mismatches relative to the target sequence of the first set of nucleic acid molecules. Thus, the blocker does not bind to the first set of nucleic acid molecules (or binds to the first set of nucleic acid molecules at a rate that is less than a rate at which the blocker binds to the candidate sequence, or portion thereof, of the second set of nucleic acid molecules).

[0084] Methods disclosed herein further comprise selectively enriching for the first set of nucleic acid molecules comprising the target sequence in comparison to the second set of nucleic acid molecules comprising the candidate sequence, wherein the blocker comprising one or more xenonucleic acids prevents or reduces enrichment of the second set of nucleic acid molecules comprising the candidate sequence. As one example, methods may involve providing a probe that is capable of hybridizing to one or both of the target sequence of the first set of nucleic acid molecules and the candidate sequence of the second set of nucleic acid molecules. However, the presence of the bound blocker may outcompete the binding of the probe to the candidate sequence, or portion thereof, of the second set of nucleic acid molecules. In contrast, given the lack of the blocker bound to the target sequence of the first set of nucleic acid molecules, the probe can readily hybridize with the target sequence, or portion thereof, of the first set of nucleic acid molecules. In various embodiments, the first set of nucleic acid molecules can be enriched using the probe (e.g., through hybrid capture of the probe). As another example, methods may involve providing primers (e.g., forward / reverse primers) for amplification. The presence of the bound blocker to the candidate sequence, or portion thereof, of the second set of nucleic acid molecules prevents or reduces amplification of the second set of nucleic acid molecules. In contrast, given the lack of the blocker bound to the target sequence of the first set of nucleic acid molecules, the amplification of the first set of nucleic acid molecules using the primers can IPTS / 200027855.1Attorney Docket No. HRG-026WO readily occur. Methods further include detecting the selectively enriched first set of nucleic acid molecules.

[0085] In various embodiments, a blocker includes a sequence that shares at least 80% identity, at least 85% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or 100% identity with any one of SEQ ID NOs: 1-6 or 14-21.

[0086] In various embodiments, the disclosed blocker includes one or more xenonucleic acids, examples of which include a locked nucleic acid (LNA), hexitol nucleic acid (HNA), threose nucleic acid (TNA), glycol nucleic acid (GNA), cyclohexenyl nucleic acid (CeNA), or peptide nucleic acid (PNA). Generally, xenonucleic acids (XNA) refer to synthetic nucleic acid analogues that have a different backbone from the ribose and deoxyribose found in the nucleic acids of naturally occurring RNA and DNA. The different backbone confers different structural stability and can be beneficial for e.g., stabilizing a blocker – nucleic acid molecule complex. Various blockers including one or more xenonucleic acids can be designed. In various embodiments, a blocker includes a xenonucleic acid at every other position. In various embodiments, a blocker includes one or more triplets of xenonucleic acids (e.g., three consecutive xenonucleic acids). The different positioning of xenonucleic acids within a blocker can confer different desirable properties (e.g., blocking specificity and / or blocking efficiency) to the blocker. In various embodiments, a blocker includes a sequence of any one of SEQ ID NOs: 7-13 or 22-29.

[0087] Reference is now made to FIG.1, which shows an example flow diagram for differentially enriching for nucleic acid molecules, in accordance with an embodiment. As shown in FIG.1, step 115 involves obtaining a sample (e.g., a sample from a subject). In various embodiments, a sample is any of a tissue sample, a blood sample, a stool sample, a urine sample, a mucous sample, or a saliva sample. In particular embodiments, a sample is a blood sample or a serum sample. In particular embodiments, a sample is a tissue sample. The sample can be obtained by the subject or by a third party, e.g., a medical professional. Examples of medical professionals include physicians, emergency medical technicians, nurses, first responders, psychologists, phlebotomists, medical physics personnel, nurse practitioners, surgeons, dentists, IPTS / 200027855.1Attorney Docket No. HRG-026WO and any other medical professional as would be known to one skilled in the art. In various embodiments, the one or more samples can be obtained from the subject by a reference lab.

[0088] In various embodiments, the sample obtained from the subject is a liquid biopsy sample. In various embodiments, the liquid biopsy sample includes nucleic acid molecules. Example nucleic acid molecules include DNA or RNA. In particular embodiments, the nucleic acid molecules include cell-free DNA (cfDNA). In various embodiments, the cfDNA includes genomic sequences corresponding to CpG islands (CGIs) for which methylation states are informative for presence or absence of cancer. In various embodiments, the cfDNA can be derived from tumor cells and is referred to herein as circulating tumor DNA (ctDNA). In various embodiments, the nucleic acid molecules include a mixture of nucleic acid molecules that contain either methylated CpG sites or non-methylated CpG sites. For example, for a particular genomic region containing one or more CpG sites, the mixture of nucleic acid molecules includes a subset of nucleic acid molecules in which the one or more CpG sites are unmethylated and in a different subset of nucleic acid molecules in which the one or more CpG sites are partially or fully methylated.

[0089] Step 120 involves converting the nucleic acid molecules from the sample obtained from the subject. In various embodiments, converting the nucleic acid involves converting unmethylated nucleotides (e.g., cytosines) to another nucleotide (a “converted nucleotide”, as used herein). In various embodiments, methylated cytosines are protected from conversion (e.g., deamination) during the conversion step. Further details of performing conversion of nucleic acid molecules (e.g., step 120) are described herein.

[0090] Although not shown in FIG.1, in various embodiments, after conversion of nucleic acids, the converted nucleic acids undergo library construction. In various embodiments, converted nucleic acids can undergo end-repairing, tailing of 3’ ends, and / or addition of library or sequencing adapters. In various embodiments, converted nucleic acids can undergo biotinylation (e.g., addition of biotin moieties to converted nucleic acids). In various embodiments, barcodes can be incorporated into converted nucleic acids, thereby enabling subsequent sample demultiplexing (e.g., demultiplexing to identify sources of converted nucleic acids or demultiplexing to identify a common source from converted nucleic acids). In various embodiments, one or more washes and / or selections can be performed to remove unwanted DNA IPTS / 200027855.1Attorney Docket No. HRG-026WO fragments, such as single stranded DNA fragments, excess adapters, and other molecules. In particular embodiments, a solid-phase reversible immobilization (SPRI) selection is performed. As used herein, a “nucleic acid template” refers to a nucleic acid derived from the converted nucleic acid (e.g., any of a nucleic acid derived from a converted nucleic acid that underwent library construction, end-repairing, addition of library or sequencing adapters, barcode addition, or any combination thereof).

[0091] Step 125 involves enriching for a subset of nucleic acid molecules. As shown in FIG.1, step 125 can include substeps 130 and 140. Generally, enriching for a subset of nucleic acid molecules comprises providing one or more blockers comprising one or more xenonucleic acids. The blocker binds to candidate sequences of converted nucleic acid molecules, the candidate sequences derived from sequences comprising one or more non-methylated CpG sites. For example, a candidate sequence may contain nucleotides that were converted from corresponding non-methylated CpG sites and / or subsequently amplified. Thus, following conversion, a non- methylated CpG site would be converted to a “UG” sequence. Subsequent amplification may generate a corresponding “TG” sequence that is present in the candidate sequence.

[0092] Specifically, step 130 involves providing a blocker that binds to a candidate sequence, or portion thereof. In various embodiments, the blocker comprises between 10 and 50 nucleosides. In various embodiments, the blocker comprises between 11 and 45 nucleosides, between 12 and 40 nucleosides, between 13 and 35 nucleosides, between 14 and 30 nucleosides, between 15 and 25 nucleosides, or between 16 and 20 nucleosides. In various embodiments, the blocker comprises between 16 and 24 nucleosides. In various embodiments, the blocker comprises 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleosides. In particular embodiments, the blocker comprises 16 nucleosides. In particular embodiments, the blocker comprises 18 nucleosides. In particular embodiments, the blocker comprises 20 nucleosides.

[0093] In various embodiments, the blocker comprises one or more xenonucleic acids. Example xenonucleic acids include a locked nucleic acid (LNA), hexitol nucleic acid (HNA), threose nucleic acid (TNA), glycol nucleic acid (GNA), cyclohexenyl nucleic acid (CeNA), or peptide nucleic acid (PNA). In various embodiments, a blocker comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 xenonucleic acids. In various embodiments, the blocker comprises between 1 and 20 xenonucleic acids, between 2 and 19 xenonucleic acids, between 3 IPTS / 200027855.1Attorney Docket No. HRG-026WO and 18 xenonucleic acids, between 4 and 17 xenonucleic acids, between 5 and 16 xenonucleic acids, between 6 and 15 xenonucleic acids, between 7 and 14 xenonucleic acids, between 8 and 13 xenonucleic acids, between 9 and 12 xenonucleic acids, or between 10 and 11 xenonucleic acids, inclusive. In particular embodiments, the blocker comprises between 6 and 12 xenonucleic acids. In particular embodiments, the blocker comprises 6 xenonucleic acids. In particular embodiments, the blocker comprises 7 xenonucleic acids. In particular embodiments, the blocker comprises 8 xenonucleic acids. In particular embodiments, the blocker comprises 9 xenonucleic acids. In particular embodiments, the blocker comprises 10 xenonucleic acids. In particular embodiments, the blocker comprises 11 xenonucleic acids. In particular embodiments, the blocker comprises 12 xenonucleic acids.

[0094] In various embodiments, a blocker comprises a xenonucleic acid at position 1 of the blocker (as measured from the 5’ end of the blocker). In various embodiments, a blocker comprises a xenonucleic acid at position 2 of the blocker. In various embodiments, a blocker comprises a xenonucleic acid at position 3 of the blocker. In various embodiments, a blocker comprises a xenonucleic acid at position 4 of the blocker. In various embodiments, a blocker comprises a xenonucleic acid at position 5 of the blocker. In various embodiments, a blocker comprises a xenonucleic acid at position 6 of the blocker. In various embodiments, a blocker comprises a xenonucleic acid at position 7 of the blocker. In various embodiments, a blocker comprises a xenonucleic acid at position 8 of the blocker. In various embodiments, a blocker comprises a xenonucleic acid at position 9 of the blocker. In various embodiments, a blocker comprises a xenonucleic acid at position 10 of the blocker. In various embodiments, a blocker comprises a xenonucleic acid at position 11 of the blocker. In various embodiments, a blocker comprises a xenonucleic acid at position 12 of the blocker. In various embodiments, a blocker comprises a xenonucleic acid at position 13 of the blocker. In various embodiments, a blocker comprises a xenonucleic acid at position 14 of the blocker. In various embodiments, a blocker comprises a xenonucleic acid at position 15 of the blocker. In various embodiments, a blocker comprises a xenonucleic acid at position 16 of the blocker. In various embodiments, a blocker comprises a xenonucleic acid at position 17 of the blocker. In various embodiments, a blocker comprises a xenonucleic acid at position 18 of the blocker. In various embodiments, a blocker IPTS / 200027855.1Attorney Docket No. HRG-026WO comprises a xenonucleic acid at position 19 of the blocker. In various embodiments, a blocker comprises a xenonucleic acid at position 20 of the blocker.

[0095] In particular embodiments, the blocker comprises a xenonucleic acid at every other nucleoside (e.g., at odd positions of the blocker e.g., positions 1, 3, 5, 7, 9, 11 and so on, or at even positions of the blocker e.g., positions 2, 4, 6, 8, 10, 12 and so on). In various embodiments, the blocker comprises three consecutive xenonucleic acids at three consecutive positions. For example, the blocker may comprise xenonucleic acids at positions x, x+1, and x+2, where x represents any of positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20. In various embodiments, the final two nucleosides of the blocker (final nucleosides at the 3’ end of the blocker) are not xenonucleic acids.

[0096] In various embodiments, the blocker comprises a xenonucleic acid at a position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site. For example, the corresponding CpG site may have been unmethylated. Therefore, following conversion and / or amplification, the resulting nucleotides of the candidate sequence may be “TG.” The blocker may comprise a xenonucleic acid at a position complementary to the “T” (which is derived from the cytosine of the CpG site) or complementary to “A” (the complement of “T”). In various embodiments, the blocker comprises a xenonucleic acid at a position immediately preceding the position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site. In various embodiments, the blocker comprises a xenonucleic acid at a position immediately subsequent to the position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site. In various embodiments, the blocker comprises a xenonucleic acid at a position immediately preceding the position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site and at a position immediately subsequent to the position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site.

[0097] In various embodiments, the blocker comprises one or more triplets of xenonucleic acids, each triplet of xenonucleic acids corresponding to a CpG site. For example, each triplet of xenonucleic acids may comprise: a first xenonucleic acid at a position complementary to a IPTS / 200027855.1Attorney Docket No. HRG-026WO nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site; a second xenonucleic acid at a position immediately preceding the position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site; and a third xenonucleic acid at a position immediately subsequent to the position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site. In various embodiments, a blocker comprises two triplets of xenonucleic acids, three triplets of xenonucleic acids, four triplets of xenonucleic acids, five triplets of xenonucleic acids, six triplets of xenonucleic acids, seven triplets of xenonucleic acids, eight triplets of xenonucleic acids, nine triplets of xenonucleic acids, or ten triplets of xenonucleic acids.

[0098] In various embodiments, the blocker comprises one or more triplets of xenonucleic acids and further includes a sequence in which every other nucleoside is a xenonucleic acid. For example, a blocker may include a triplet of xenonucleic acids at positions 3 through 5 (as measured from the 5’ end of the blocker). Then, for positions 8 and onward, the blocker includes a xenonucleic acid at every other nucleoside (e.g., even positions 8, 10, 12, 14 and so on include a xenonucleic acid, or odd positions 9, 11, 13, 15 and so on include a xenonucleic acid position).

[0099] Reference is now made to FIGs.3A-3C, which show example designs of xenonucleic blocker sequences, in accordance with an embodiment. FIG.3A shows a first embodiment in which a xenonucleic acid (e.g., a locked nucleic acid (LNA)) is placed at every other nucleoside. Specifically, as shown in FIG.3A, positions 2, 4, 6, 8, 10, 12, 14, and 16 of the blocker are xenonucleic acids.

[0100] FIG.3B shows a second embodiment including multiple triplets of xenonucleic acids. Here, a first triplet of xenonucleic acids is found at positions 5-7, denoted as “GTG” of the blocker (measured from the 5’ end). The highlighted “T” corresponds to the “C” of the original CpG site. The second triplet of xenonucleic acids is found at positions 9-11 (denoted as “TTG” of the blocker). Similarly, the highlighted “T” corresponds to the “C” of a second CpG site. The third triplet of xenonucleic acids is found at positions 11-13 (denoted as “GTG” of the blocker). Similarly, the highlighted “T” corresponds to the “C” of a third CpG site.

[0101] FIG.3C shows a third embodiment including a triplet of xenonucleic acids and a sequence where every other nucleoside is a xenonucleic acid. Here, a triplet of xenonucleic IPTS / 200027855.1Attorney Docket No. HRG-026WO acids is found at positions 3-5, denoted as “GTG” of the blocker (measured from the 5’ end). The highlighted “T” corresponds to the “C” of the original CpG site. Next, the blocker includes a sequence starting at position 8 and onward (e.g., “TGGTTTTGAGA”) in which every other nucleoside is a xenonucleic acid (e.g., positions 8, 10, 12, 14, and 16 are xenonucleic acids). The final two nucleosides are not xenonucleic acids.

[0102] In various embodiments, methods involve exposing the blocker and the candidate sequence to one or more temperatures to facilitate the binding between the blocker and the candidate sequence. In various embodiments, methods involve exposing the blocker and the candidate sequence to a temperature above 50oC, above 55oC, above 60oC, above 65oC, above 70oC, above 75oC, above 80oC, above 85oC, above 90oC, above 91oC, above 92oC, above 93oC, above 94oC, or above 95oC to facilitate the binding between the blocker and the candidate sequence. In various embodiments, methods involve exposing the blocker and the candidate sequence to a temperature between 50oC and 65oC to facilitate the binding between the blocker and the candidate sequence. In various embodiments, methods involve exposing the blocker and the candidate sequence to a temperature of about 50oC, about 51oC, about 52oC, about 53oC, about 54oC, about 55oC, about 56oC, about 57oC, about 58oC, about 59oC, about 60oC, about 61oC, about 62oC, about 63oC, about 64oC, or about 65oC. In particular embodiments, methods involve exposing the blocker and the candidate sequence to a temperature of about 60oC.

[0103] In various embodiments, the one or more temperatures comprises two different temperatures, wherein a first temperature is higher than a second temperature. In various embodiments, the first temperature may be above 70oC, above 75oC, above 80oC, above 85oC, above 90oC, above 91oC, above 92oC, above 93oC, above 94oC, or above 95oC. In various embodiments, the first temperature is between about 70oC and 90oC. In various embodiments, the first temperature is between about 70oC and 90oC, between about 75oC and 85oC, or between about 75oC and 80oC. In various embodiments, the first temperature is about 75oC, about 76oC, about 77oC, about 78oC, about 79oC, or about 80oC. In various embodiments, the second temperature is between 50oC and 65oC, between 55oC and 62oC, between 58oC and 61oC, or between 59oC and 60oC. In various embodiments, the second temperature is about 58oC, about 59oC, about 61oC, or about 61oC. IPTS / 200027855.1Attorney Docket No. HRG-026WO

[0104] In various embodiments, methods further include providing a second blocker in addition to the first blocker. The second blocker can be provided simultaneously with the first blocker, or provided after the first blocker. Here, the second blocker binds to a different candidate sequence, or a portion thereof, of the second set of nucleic acid molecules. For example, the first blocker and the second blocker bind to different, non-overlapping candidate sequences, or portions thereof, of the second set of nucleic acid molecules. In these embodiments, the two blockers may bind to the different candidate sequences of the second set of nucleic acid molecules and can further improve the subsequent differential enrichment of nucleic acid molecules.

[0105] Returning to FIG. 1, step 140 involves selectively enriching for a first set of nucleic acid molecules comprising a target sequence (e.g., target sequence derived from one or more methylated CpG sites). Here, the first of nucleic acid molecules are selectively enriched in comparison to a second set of nucleic acid molecules comprising a candidate sequence (e.g., candidate sequence derived from one or more non-methylated CpG sites). Here, the presence of the blocker bound to the candidate sequence, or portion thereof, prevents or reduces enrichment of the second set of nucleic acid molecules comprising the candidate sequence. For example, the blocker can prevent or reduce amplification of the second set of nucleic acid molecules comprising the candidate sequence. As another example, the blocker can outcompete binding of a probe, thereby preventing subsequent detection methods (e.g., qPCR) that rely on the probe for detection. As another example, the blocker can outcompete binding of a probe, thereby preventing subsequent enrichment methods (e.g., hybrid capture) that target the probe for enrichment.

[0106] In various embodiments, selectively enriching for a first set of nucleic acid molecules comprises providing a probe capable of hybridizing to the target sequence, or portion thereof, of the first set of nucleic acid molecules. In various embodiments, the probe can be provided simultaneously with the blocker or can be provided after the blocker. Here, the probe hybridizes with the target sequence, or portion thereof of the first set of nucleic acid molecules, thereby enabling subsequent enrichment of the first set of nucleic acid molecules. For example, a subsequent enrichment can involve performing a hybrid capture. In hybrid capture, solid supports, such as solid beads, can capture the probe, thereby enriching for the first set of nucleic IPTS / 200027855.1Attorney Docket No. HRG-026WO acid molecules bound to the probe. In various embodiments, solid beads can be streptavidin coated beads that capture biotinylated probes that are bound to the first set of nucleic acid molecules.

[0107] In various embodiments, the probe is unable to hybridize with the candidate sequence of a second set of nucleic acids due to presence of a bound blocker. In various embodiments, the probe is complementary to a portion of the candidate sequence that is bound by the blocker. For example, the probe may be complementary to at least one nucleoside, at least two nucleosides, at least three nucleosides, at least four nucleosides, at least five nucleosides, at least six nucleosides, at least seven nucleosides, at least eight nucleosides, at least nine nucleosides, at least ten nucleosides, at least eleven nucleosides, at least twelve nucleosides, at least thirteen nucleosides, at least fourteen nucleosides, at least fifteen nucleosides, at least sixteen nucleosides, at least seventeen nucleosides, at least eighteen nucleosides, at least nineteen nucleosides, or at least twenty nucleosides that are bound by the blocker. The blocker may outcompete the probe for binding to the candidate sequence, or portion thereof. The blocker prevents the probe from binding to the candidate sequence, or portion thereof, of the second set of nucleic acids and therefore prevents subsequent enrichment of the second set of nucleic acids.

[0108] In various embodiments, a blocker outcompetes the probe for binding to the candidate sequence if the blocker, when bound to the candidate sequence, achieves a threshold melting temperature. In various embodiments, the threshold melting temperature is at least 65oC, at least 66oC, at least 67oC, at least 67oC, at least 69oC, at least 70oC, at least 71oC, at least 72oC, at least 73oC, at least 74oC, or at least 75oC. In particular embodiments, the threshold melting temperature is about 75oC. In various embodiments, the blocker, when bound to the candidate sequences, increases the melting temperature to 70oC, 71oC, 72oC, 73oC, 74oC, 75oC, 76oC, 77oC, 78oC, 79oC, 80oC, 81oC, 82oC, 83oC, 84oC, 85oC, 86oC, 87oC, 88oC, 89oC, or 90oC. In various embodiments, a blocker outcompetes the probe for binding to the candidate sequence if the blocker, when bound to the candidate sequence, achieves a melting temperature that is at least 1oC higher, at least 2oC higher, at least 3oC higher, at least 4oC higher, at least 5oC higher, at least 6oC higher, at least 7oC higher, at least 8oC higher, at least 9oC higher, at least 10oC higher, at least 11oC higher, at least 12oC higher, at least 13oC higher, at least 14oC higher, or at least 15oC higher than a melting temperature of the candidate sequence bound to the probe. In IPTS / 200027855.1Attorney Docket No. HRG-026WO particular embodiments, a blocker outcompetes the probe for binding to the candidate sequence if the blocker, when bound to the candidate sequence, achieves a melting temperature that is at least 5oC higher than a melting temperature of the candidate sequence bound to the probe.

[0109] In various embodiments, selectively enriching for a first set of nucleic acid molecules comprises providing primers for performing nucleic acid amplification. In various embodiments, primers can be provided simultaneously with the blocker or can be provided after the blocker. In various embodiments, the primers comprise a primer pair (e.g., a forward primer and a reverse primer). In various embodiments, the primers may be capable of hybridizing to complementary sequences on the first set of nucleic acid molecules. Thus, nucleic acid amplification of the first set of nucleic acid molecules can occur. In some embodiments, the primers may be capable of hybridizing to complementary sequences on the second set of nucleic acid molecules. In this scenario, the presence of a bound blocker to a candidate sequence of the second set of nucleic acid molecules does not affect the binding of primers to the second set of nucleic acid molecules. In various embodiments, a nucleobase of the primer when hybridized to a nucleic acid of a second set of nucleic acid molecules is immediately adjacent to a xenonucleic acid of the blocker that is bound to the candidate sequence of the second set of nucleic acid molecules. The presence of the blocker may prevent subsequent amplification of the second set of nucleic acid molecules as the blocker prevents extension along the nucleic acid molecule.

[0110] In some embodiments, the primers are incapable of hybridizing to complementary sequences of the second set of nucleic acid molecules due to the presence of the bound blocker to a candidate sequence of the second set of nucleic acid molecules. For example, the blocker may be bound to a portion of the second set of nucleic acid molecules that is complementary to a sequence of a primer. Thus, as the primers are unable to bind to complementary sequences of the second set of nucleic acid molecules, performing nucleic acid amplification does not amplify the second set of nucleic acid molecules. In various embodiments, the blocker and a primer may both be complementary to an overlapping sequence of at least 1 nucleoside. In various embodiments, the blocker and a primer may both be complementary to an overlapping sequence of at least 2 nucleosides, at least 3 nucleosides, at least 4 nucleosides, at least 5 nucleosides, at least 6 nucleosides, at least 7 nucleosides, at least 8 nucleosides, at least 9 nucleosides, at least 10 IPTS / 200027855.1Attorney Docket No. HRG-026WO nucleosides, at least 11 nucleosides, at least 12 nucleosides, at least 13 nucleosides, at least 14 nucleosides, or at least 15 nucleosides.

[0111] In various embodiments, selectively enriching for a first set of nucleic acid molecules comprises providing both 1) a probe capable of hybridizing to the target sequence, or portion thereof, of the first set of nucleic acid molecules and 2) primers for performing nucleic acid amplification. In various embodiments, the probe and primers can each be provided simultaneously with the blocker or can be provided after the blocker.

[0112] Although not shown in FIG.1, in various embodiments, after step 140, the enriched nucleic acids undergo one or more washes and / or selections to remove unwanted DNA fragments, such as single stranded DNA fragments, excess primers, excess adapters, and other molecules. In particular embodiments, a solid-phase reversible immobilization (SPRI) selection is performed.

[0113] Step 150 involves detecting the selectively enriched first set of nucleic acid. In various embodiments, detecting the selectively enriched nucleic acids involves performing sequencing to determine the sequences of the first set of nucleic acids. In various embodiments, sequencing data can be demultiplexed e.g., using barcode sequences. In various embodiments, sequencing data can be aligned to a reference genome and / or trimmed. In various embodiments, sequencing data can be further analyzed to determine the enriched signal in the sample e.g., for determining presence or absence of cancer in the sample. In various embodiments, detecting the selectively enriched nucleic acids involves quantifying a signal from the first set of nucleic acids. For example, the signal may be a fluorescent signal. Thus, quantifying the fluorescent signal can be informative for determining a total quantity of the first set of nucleic acid molecules (or nucleic acids, such as amplicons, derived from the first set of nucleic acid molecules. Detecting the selectively enriched nucleic acids by quantifying a signal from the first set of nucleic acids can be performed e.g., when performing quantitative PCR. Methods for Enriching Target Nucleic Acid Sequences a. Exemplary Methods

[0114] As disclosed herein in reference to FIG.1, methods can involve step 125 for enriching a first set of nucleic acid molecules e.g., nucleic acid molecules comprising target IPTS / 200027855.1Attorney Docket No. HRG-026WO nucleic acid sequences. Methods for enriching the first set of nucleic acid molecules is further described in reference to FIGs.4A-4D, which depict diagrams involving provision of blockers and / or probe / primers, in accordance with various embodiments.

[0115] Beginning with FIG.4A, it depicts a diagram involving blockers, in accordance with an embodiment. Step A begins with converted nucleic acids 410, including nucleic acid molecule 415A and nucleic acid molecule 415B. Step A shows the converted nucleic acids 410 after having performed step 120 shown in FIG.1. Here, nucleic acid molecule 415A may include a target sequence 405 that is derived from a sequence comprising one or more methylated CpG sites. FIG.4A shows two genomic sites (labeled as “m”) that are derived from corresponding CpG sites 402 that were previously methylated. For example, the prior CpG sites may have a sequence of “CG” where the cytosine was methylated. Following conversion, the “CG” remains and the target sequence 405 can include a “CG”, or complement thereof, at each site corresponding to a CpG site.

[0116] Additionally, nucleic acid molecule 415B includes a candidate sequence 408 that is derived from a sequence comprising one or more non-methylated CpG sites. Specifically, FIG.4A shows two genomic sites that are derived from corresponding CpG sites 404 that were previously unmethylated. For example, the prior CpG sites may have a sequence of “CG” where the cytosine was non-methylated. Following conversion, the “CG” is converted to “UG”. Thus, the candidate sequence 408 can include a “TG”, or complement thereof, at each site corresponding to a CpG site.

[0117] Following step A, one or more blockers 420 are introduced to the converted nucleic acids 410. The one or more blockers bind to a candidate sequence 408, or portion thereof, of nucleic acid molecule 415B. Although step B of FIG. 4A shows a single blocker 420 binding to candidate sequence 408, other embodiments can include multiple blockers 420 binding to different candidate sequences on a nucleic acid molecule 415B.

[0118] In various embodiments, a blocker 420 does not bind, or minimally binds, to target sequence 405. Given the mismatches between the sequence of the blocker 420 and the nucleotides of the target sequence 405 that correspond to methylated CpG sites 402, the blocker 420 may fail to hybridize, or hybridizes to a lesser extent, with the target sequence 405. In various embodiments, less than 50% of nucleic acid molecule 415A (e.g., first set of nucleic acid IPTS / 200027855.1Attorney Docket No. HRG-026WO molecules that are derived from sequences with one or more methylated CpG sites) are bound to a blocker 420. In various embodiments, less than 40%, less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, less than 9%, less than 8%, less than 7%, less than 6%, less than 5%, less than 4%, less than 3%, less than 2%, less than 1%, less than 0.9%, less than 0.8%, less than 0.7%, less than 0.6%, less than 0.5%, less than 0.4%, less than 0.3%, less than 0.2%, or less than 0.1% of nucleic acid molecule 415A are bound to a blocker 420.

[0119] Next, one or both of probes and / or primers are provided. FIGs.4B-4D show three separate embodiments in which only probes are provided (e.g., Step C.1 in FIG. 4B), only primers are provided (Step C.2 in FIG.4C), or probes and primers are provided (Step C.3 in FIG. 4D).

[0120] Reference is first made to FIG.4B, which depicts a diagram involving provision of probes 430, in accordance with a first embodiment. The probe 430 is capable of hybridizing to the target sequence 405, or a portion thereof, of the nucleic acid molecule 415A. In various embodiments, the probe 430 comprises a sequence that is at least 90% complementary, at least 95% complementary, at least 96% complementary, at least 97% complementary, at least 98% complementary, at least 99% complementary, or 100% complementary to the target sequence, or a portion thereof. In various embodiments, the probe 430 is also capable of hybridizing to the candidate sequence 408, albeit to a lesser extent than hybridizing to the target sequence 405. However, the presence of the blocker 420 bound to the candidate sequence 408 prevents or reduces the binding of the probe 430 to the candidate sequence 408. In various embodiments, less than 40%, less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, less than 9%, less than 8%, less than 7%, less than 6%, less than 5%, less than 4%, less than 3%, less than 2%, less than 1%, less than 0.9%, less than 0.8%, less than 0.7%, less than 0.6%, less than 0.5%, less than 0.4%, less than 0.3%, less than 0.2%, or less than 0.1% of nucleic acid molecule 415B are bound to a probe 430.

[0121] Given that the probe 430 is bound to nucleic acid molecule 415A and not bound to nucleic acid molecule 415B, subsequent enrichment can be performed to enrich for nucleic acid molecule 415A using the bound probe 430. For example, methods can involve performing hybrid capture e.g., using a solid support to capture the probe 430 bound to the target sequence IPTS / 200027855.1Attorney Docket No. HRG-026WO 405 of the nucleic acid molecule 415A. Thus, the nucleic acid molecule 415A can be enriched through hybrid capture while eliminating or reducing the quantity of nucleic acid molecule 415B.

[0122] Reference is next made to FIG.4C, which depicts a diagram involving provision of primers, in accordance with a second embodiment. The primers 435 may include a primer set e.g., forward and reverse primers. As shown in FIG.4C, the primers 435A and 435B may be capable of hybridizing to complementary sequences on the nucleic acid molecule 415A and the nucleic acid molecule 415B. In this scenario, the presence of the blocker 420 bound to a candidate sequence 408 of nucleic acid molecule 415B does not substantially affect the binding of the primer 435A and 435B to the nucleic acid molecule 415B.

[0123] Given the lack of a bound blocker 420 on the nucleic acid molecule 415A, selective nucleic acid amplification of nucleic acid molecule 415A can occur. For example, nucleic acid amplification can be initiated using the bound primers 435A and 435B, thereby generating amplicons of nucleic acid molecule 415A. In contrast, the presence of the bound blocker 420 on the nucleic acid molecule 415B may prevent or reduce the amplification of nucleic acid molecule 415B. Specifically, the blocker 420 may prevent extension of a strand initiated from primer 435A. Thus, the resulting amplicons derived from nucleic acid molecule 415B can be prevented or reduced.

[0124] Although FIG.4C shows the blocker 420 as binding to a candidate sequence 408 located at the center of the nucleic acid molecule 415B, the blocker 420 may bind to a differently located candidate sequence 408. For example, the candidate sequence 408 may be located directly adjacent to a sequence bound by a primer e.g., primer 435A. Therefore, the blocker 420, when bound to the candidate sequence 408, may be directly adjacent to a primer e.g., primer 435A. Positioning of the blocker 420 directly adjacent to the primer 435A may be more effective in preventing or reducing amplification of the nucleic acid molecule 415B.

[0125] Reference is next made to FIG.4D, which depicts a diagram involving provision of both probes and primers, in accordance with a third embodiment. Although the probe 430 and primers 435 are shown to be provided simultaneously to nucleic acid molecules 415A and nucleic acid molecule 415B, in various embodiments, they are provided in a successive order.

[0126] The probe 430 is capable of hybridizing to the target sequence 405, or a portion thereof, of the nucleic acid molecule 415A. The primers 435 may include a primer set e.g., IPTS / 200027855.1Attorney Docket No. HRG-026WO forward and reverse primers. The primers 435A and 435B may be capable of hybridizing to complementary sequences on the nucleic acid molecule 415A and the nucleic acid molecule 415B.

[0127] Given that the probe 430 is bound to nucleic acid molecule 415A and not bound to nucleic acid molecule 415B, subsequent enrichment can be performed to enrich for nucleic acid molecule 415A using the bound probe 430. For example, methods can involve performing hybrid capture e.g., using a solid support to capture the probe 430 bound to the target sequence 405 of the nucleic acid molecule 415A. Thus, the nucleic acid molecule 415A can be enriched through hybrid capture while eliminating or reducing the quantity of nucleic acid molecule 415B. Additionally the nucleic acid molecule 415A can be detected by fluorescence while eliminating or reducing detection of nucleic acid molecule 415B. Nucleic acid amplification can be initiated using the bound primers 435A and 435B, thereby generating amplicons of nucleic acid molecule 415A. In contrast, the presence of the bound blocker 420 on the nucleic acid molecule 415B may prevent or reduce the amplification of nucleic acid molecule 415B. Specifically, the blocker 420 may prevent extension of a strand initiated from primer 435A. Thus, the resulting amplicons derived from nucleic acid molecule 415B can be prevented or reduced. Thus, in comparison to the scenarios shown in FIGs.4B and 4C, FIG. 4D may achieve improved differential enrichment of nucleic acid molecule 415A by both 1) preventing probe 430 from binding to nucleic acid molecule 415B and 2) preventing or reducing amplification of nucleic acid molecule 415B using primers 435. b. Example Designs of Sequences

[0128] As disclosed herein, a blocker may contain a sequence that is at least 90%, at least 95%, or 100% complementary to a candidate sequence, or a portion thereof. In various embodiments, a blocker may contain a sequence that is at least 90%, at least 95%, or 100% complementary to a target sequence, or a portion thereof. In various embodiments, a blocker may be designed to be at least 90%, at least 95%, or 100% complementary to a target sequence or a candidate sequences that includes one or more CpG sites within a region disclosed in Table 1 or Table 2. In various embodiments, a blocker may be designed to be at least 90%, at least 95%, or 100% complementary to a target sequence or a candidate sequences that includes two or IPTS / 200027855.1Attorney Docket No. HRG-026WO more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, or ten or more CpG sites within a region disclosed in Table 1 or Table 2. In various embodiments, a blocker may be designed to be at least 90%, at least 95%, or 100% complementary to a target sequence or a candidate sequences that includes two, three, four, five, six, seven, eight, nine, or ten CpG sites within a region disclosed in Table 1 or Table 2. In various embodiments, a blocker may be designed to be at least 90%, at least 95%, or 100% complementary to a target sequence or a candidate sequences that includes five sequential CpG sites within a region disclosed in Table 1 or Table 2. In various embodiments, a blocker is designed to be 100% complementary to a target sequence or a candidate sequences that includes five sequential CpG sites within a region disclosed in Table 1 or Table 2.

[0129] In various embodiments, a blocker may be designed to be complementary to a candidate sequence that contains X CpG sites, where the X CpG sites are fully unmethylated. In various embodiments, a blocker may be designed to be complementary to a candidate sequence that contains X CpG sites, where the X CpG sites are fully methylated. In various embodiments, a blocker may be designed to be complementary to a candidate sequence that contains X CpG sites, where at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of the X CpG sites are unmethylated. As referred to herein, the term “K*n#” refers to a sequence having “*” CpG sites, whereof the CpG sites that are methylated. Therefore, the term “K5n5” refers to a sequence including 5 CpG sites in which 5 of the CpG sites are methylated. As another example, the term “K6n5” refers to a sequence including 6 CpG sites in which 5 of the CpG sites are methylated. In various embodiments, “*” can be any of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. In various embodiments,can be any of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. In some embodiments, a candidate sequences is less than 200 bp, less than 150 bp, less than 100 bp, less than 75 bp, less than 50 bp in length, or less than 35 bp in length. In some embodiments, a candidate sequences is less than 150 bp in length. In some embodiments, a candidate sequences is less than 100 bp in length. In some embodiments, a candidate sequences is less than 75 bp in length. In some embodiments, a candidate sequences is less than 50 bp in length. In some embodiments, a candidate sequences is less than 35 bp in length. IPTS / 200027855.1Attorney Docket No. HRG-026WO

[0130] In various embodiments, a blocker may be designed to be fully complementary to a candidate sequence derived from a “K*n#” sequence. For example, a blocker may be designed to be complementary to a candidate sequence derived from a K5n0 sequence (e.g., fully unmethylated sequence of 5 CpG sites). Thus, as each of the CpG sites of the K5n0 sequence is unmethylated, the resulting sequence corresponding to each CpG site may be “TG”, or a complement thereof. Thus, the blocker may be designed to have a sequence that is complementary to each of the five “TG”, or complement thereof.

[0131] In various embodiments, a blocker may be designed to be complementary to a candidate sequence derived from any of a K1n0 sequence, a K2n0 sequence, a K3n0 sequence, a K4n0 sequence, a K5n0 sequence, a K6n0 sequence, a K7n0 sequence, a K8n0 sequence, a K9n0 sequence, or a K10n0 sequence. In various embodiments, a blocker may be designed to be complementary to a candidate sequence derived from any of a K2n1 sequence, a K3n1 sequence, a K4n1 sequence, a K5n1 sequence, a K6n1 sequence, a K7n1 sequence, a K8n1 sequence, a K9n1 sequence, a K10n1 sequence, a K3n2 sequence, a K4n2 sequence, a K5n2 sequence, a K6n2 sequence, a K7n2 sequence, a K8n2 sequence, a K9n2 sequence, a K10n2 sequence, a K4n3 sequence, a K5n3 sequence, a K6n3 sequence, a K7n3 sequence, a K8n3 sequence, a K9n3 sequence, a K10n3 sequence, a K5n4 sequence, a K6n4 sequence, a K7n4 sequence, a K8n4 sequence, a K9n4 sequence, a K10n4 sequence, a K6n5 sequence, a K7n5 sequence, a K8n5 sequence, a K9n5 sequence, a K10n5 sequence, a K7n6 sequence, a K8n6 sequence, a K9n6 sequence, a K10n6 sequence, a K8n7 sequence, a K9n7 sequence, a K10n7 sequence, a K9n8 sequence, a K10n8 sequence, or a K10n9 sequence.

[0132] As disclosed herein, a probe may contain a sequence that is at least 90% complementary, at least 95% complementary, at least 96% complementary, at least 97% complementary, at least 98% complementary, at least 99% complementary, or 100% complementary to the target sequence, or a portion thereof. In various embodiments, a probe may be designed to be at least 90%, at least 95%, or 100% complementary to a target sequence that includes one or more CpG sites within a region disclosed in Table 1 or Table 2. In various embodiments, a probe may be designed to be at least 90%, at least 95%, or 100% complementary to a target sequence that includes two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, or ten or more CpG sites within a region IPTS / 200027855.1Attorney Docket No. HRG-026WO disclosed in Table 1 or Table 2. In various embodiments, a probe may be designed to be at least 90%, at least 95%, or 100% complementary to a target sequence that includes two, three, four, five, six, seven, eight, nine, or ten CpG sites within a region disclosed in Table 1 or Table 2. In various embodiments, a probe may be designed to be at least 90%, at least 95%, or 100% complementary to a target sequence that includes five sequential CpG sites within a region disclosed in Table 1 or Table 2. In various embodiments, a probe is designed to be 100% complementary to a target sequence that includes five sequential CpG sites within a region disclosed in Table 1 or Table 2.

[0133] In various embodiments, a probe may be designed to be complementary to a target sequence that contains X CpG sites, where the X CpG sites are fully methylated. In various embodiments, a probe may be designed to be complementary to a target sequence that contains X CpG sites, where the X CpG sites are fully methylated. In various embodiments, a probe may be designed to be complementary to a target sequence that contains X CpG sites, where at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of the X CpG sites are methylated.

[0134] In various embodiments, a probe may be designed to be fully complementary to a target sequence derived from a “K*n#” sequence. For example, a probe may be designed to be complementary to a target sequence derived from a K5n5 sequence (e.g., fully methylated sequence of 5 CpG sites). Thus, as each of the CpG sites of the K5n5 sequence is methylated, the resulting sequence corresponding to each CpG site may be “CG”, or a complement thereof. Thus, the probe may be designed to have a sequence that is complementary to each of the five “CG”, or complement thereof.

[0135] In various embodiments, a probe may be designed to be complementary to a target sequence derived from any of a K1n1 sequence, a K2n2 sequence, a K3n3 sequence, a K4n4 sequence, a K5n5 sequence, a K6n6 sequence, a K7n7 sequence, a K8n8 sequence, a K9n9 sequence, or a K10n10 sequence. In various embodiments, a probe may be designed to be complementary to a target sequence derived from any of a K2n1 sequence, a K3n1 sequence, a K4n1 sequence, a K5n1 sequence, a K6n1 sequence, a K7n1 sequence, a K8n1 sequence, a K9n1 sequence, a K10n1 sequence, a K3n2 sequence, a K4n2 sequence, a K5n2 sequence, a K6n2 sequence, a K7n2 sequence, a K8n2 sequence, a K9n2 sequence, a K10n2 sequence, a K4n3 IPTS / 200027855.1Attorney Docket No. HRG-026WO sequence, a K5n3 sequence, a K6n3 sequence, a K7n3 sequence, a K8n3 sequence, a K9n3 sequence, a K10n3 sequence, a K5n4 sequence, a K6n4 sequence, a K7n4 sequence, a K8n4 sequence, a K9n4 sequence, a K10n4 sequence, a K6n5 sequence, a K7n5 sequence, a K8n5 sequence, a K9n5 sequence, a K10n5 sequence, a K7n6 sequence, a K8n6 sequence, a K9n6 sequence, a K10n6 sequence, a K8n7 sequence, a K9n7 sequence, a K10n7 sequence, a K9n8 sequence, a K10n8 sequence, or a K10n9 sequence. c. Enrichment Steps

[0136] In certain embodiments, the target sequence or a subset of target sequences in the nucleic acid can be enriched using one or more additional enrichment steps. The one or more additional enrichments steps can be performed using any enrichment method known in the art. Non-limiting examples include hybrid capture, use of DNA-binding proteins to enrich a target sequence or a subset of target sequences, and nucleic acid amplification (e.g., polymerase chain reaction). In various embodiments, the additional enrichment step involves performing indexing PCR amplification e.g., using library adapters (e.g., P5 / P7 adapters). Thus, selective amplification nucleic acids with hybridized primer sequences can be performed using the library adapters. In contrast, nucleic acids in which primer sequences are incapable of hybridizing with do not undergo PCR amplification.

[0137] One or more additional enrichment steps can be performed before or after the blocking of the unmethylated nucleic acids, as described herein. For example, in certain embodiments, the method comprises a first step of depleting a first subset of nucleic acids (e.g., unmethylated nucleic acids or converted nucleic acids derived from unmethylated nucleic acids), thereby leaving a second subset of nucleic acids (e.g., methylated nucleic acids or converted nucleic acids derived from methylated nucleic acids). The method comprises a second step of subjecting nucleic acid sequences comprising the target sequence to one or more additional enrichment steps to enrich for at least a subset of the target sequences.

[0138] In certain embodiments, the method comprises a first step of subjecting a plurality of nucleic acid molecules that include target sequences to an enrichment step to enrich for the target sequences. The method further comprises a second step of subjecting the plurality of nucleic acid molecules to the depletion method disclosed herein, which depletes a first subset of nucleic acids (e.g., unmethylated nucleic acids or converted nucleic acids derived from IPTS / 200027855.1Attorney Docket No. HRG-026WO unmethylated nucleic acids) thereby leaving a second subset of nucleic acids (e.g., methylated nucleic acids or converted nucleic acids derived from methylated nucleic acids).

[0139] In certain embodiments, a target sequence or a subset of target sequences in the nucleic acid can be enriched by subjecting the nucleic acid comprising the target sequence or the subset of target sequences to hybrid capture. In hybrid capture, labeled (e.g., biotinylated) capture probes that can bind to one or more target sequences or subsets of target sequences are exposed to the nucleic acid comprising the one or more target sequences. The capture probes are specific to a sequence of interest, for example, a methylation pattern of interest that can be detected as a bisulfite-converted epitype. Examples of such hybrid capture probe sets include the KAPA HyperPrep KAPA HyperCap Workflow with HyperChoice Probes, Twist Bioscience Twist Fast Hybridization Custom Target Enrichment Panel, Integrated DNA technologies xGen Custom Hybridization Capture Panel, and SeqCAP Epi Enrichment System from Roche Diagnostics (Pleasanton, CA).

[0140] In various embodiments, the capture probe is specific for a sequence of interest of a probe to enrich for nucleic acid molecules that are bound by the probe. For example, as disclosed herein, a probe (such as probe 430 described in FIGs.4B and 4C) may bind to a target sequence of a nucleic acid molecule (e.g., a methylated nucleic acid molecule). Additionally, the probe may not bind to a candidate sequence of a nucleic acid molecule (e.g., a non-methylated nucleic acid molecule) due to a blocker sequence that outcompetes the probe for binding to the candidate sequence. Therefore, when performing hybrid capture, the capture probe may bind to the probe and enrich for the target sequence of a nucleic acid molecule (e.g., a methylated nucleic acid molecule). Example Nucleic Acids and Methods for Converting Nucleic Acids

[0141] As discussed herein, step 120 in FIG. 1 involves converting nucleic acid molecules from the obtained sample. In various embodiments, converting nucleic acid molecules includes treating the nucleic acid molecules to capture methylation modifications. In various embodiments, converting nucleic acid molecules involves converting one or more unmethylated nucleotides (e.g., cytosines) to another nucleotide (a “converted nucleotide”, as used herein), e.g., using chemical or enzymatic means. In certain embodiments, one or more unmethylated cytosines are converted to a nucleotide that pairs with adenine (e.g., the unmethylated cytosine IPTS / 200027855.1Attorney Docket No. HRG-026WO may be converted to uracil). In certain embodiments, one or more unmethylated adenines are converted to a base that pairs with cytosine (e.g., the unmethylated adenine may be converted to inosine (I)). In certain embodiments, one or more methylated cytosines (e.g., a 5-methylcytosine (5mC)) is converted to a thymine, which pairs with adenine. In certain embodiments, methylated cytosines are protected from conversion (e.g., deamination) during the conversion step.

[0142] After a nucleic acid has been treated to convert unmethylated, or, in some cases, methylated nucleotides, into another nucleotide, the nucleic acid may be amplified. During amplification, the converted nucleotide pairs with its complementary nucleotide, and in the next round of amplification, the complementary nucleotide pairs with a replacement nucleotide. For example, following the conversion of an unmethylated cytosine to a uracil, the nucleic acid may be amplified such that an adenine pairs with the uracil in the first round of replication, and in the second round of replication, the adenine pairs with a thymine. Accordingly, the thymine replaces the uracil in the original nucleic acid sequence, and is referred to herein as a “replacement nucleotide”.

[0143] In certain aspects, conversion of the nucleic acids involves selectively deaminating nucleotides. FIG. 2A depicts an example conversion of nucleic acids, in accordance with an embodiment. Selective deamination refers to a process in which unmethylated cytosine residues are selectively deaminated over methylated cytosine (5-methylcytosine) residues. In certain embodiments, deamination of cytosine forms uracil, effectively inducing a C to T point mutation to allow for detection of methylated cytosines. Methods of deaminating cytosine are known in the art, and include chemical conversion (e.g., bisulfite conversion) and enzymatic conversion. In certain embodiments, the enzymatic conversion comprises subjecting the nucleic acid to TET2, which oxidizes methylated cytosines, thereby protecting them, and subsequent exposure to APOBEC, which converts unprotected (i.e., unmethylated) cytosines to uracils.

[0144] In some embodiments, the conversion, for example, bisulfite conversion or enzymatic conversion, uses commercially available kits. Bisulfite conversion can be performed using commercially available technologies, such as EZ DNA Methylation-Gold, EZ DNAMethylation-Direct or an EZ DNAMethylation-Lighting kit (Zymo Research Corp (Irvine, California)) or EpiTect Fast available from Qiagen (Germantown, MD). In another example a IPTS / 200027855.1Attorney Docket No. HRG-026WO kit such as APOBECSeq (NEBiolabs) or OneStep qMethyl-PCR Kit (Zymo Research Corp (Irvine, California)) is used. a. Source of Nucleic Acids

[0145] Nucleic acids used in the methods described herein can be derived from any source, such as a sample taken from the environment or from a subject (e.g., a human subject). A biological sample can be treated to physically disrupt tissue or cell structure (e.g., centrifugation and / or cell lysis), thus releasing intracellular components into a solution which can further contain enzymes, buffers, salts, detergents, and the like which can be used to prepare the sample for analysis. A biological sample can take any of a variety of forms, such as a liquid biopsy (e.g., blood, urine, stool, saliva, or mucous), or a tissue biopsy, or other solid biopsy. Examples of biological samples include, but are not limited to, blood, whole blood, plasma, serum, urine, cerebrospinal fluid, fecal, saliva, sweat, tears, pleural fluid, pericardial fluid, or peritoneal fluid of the subject. A biological sample can include any tissue or material derived from a living or dead subject. A biological sample can be a cell-free sample. A sample can be a liquid sample or a solid sample (e.g., a cell or tissue sample). A biological sample can be a bodily fluid, such as blood, plasma, serum, urine, vaginal fluid, fluid from a hydrocele (e.g., of the testis), vaginal flushing fluids, pleural fluid, ascitic fluid, cerebrospinal fluid, saliva, sweat, tears, sputum, bronchoalveolar lavage fluid, discharge fluid from the nipple, aspiration fluid from different parts of the body (e.g., thyroid, breast), etc.

[0146] The nucleic acid can be of any composition form, such as deoxyribonucleic acid (DNA, e.g., complementary DNA (cDNA), genomic DNA (gDNA) and the like), and / or DNA analogs (e.g., containing base analogs, sugar analogs and / or a non-native backbone and the like), and / or ribonucleic acid (RNA) and / or RNA analogs, all of which can be in single- or double- stranded form. In certain embodiments, single-stranded nucleic acids can be made double stranded prior to cutting with an enzyme. Unless otherwise limited, a nucleic acid can comprise known analogs of natural nucleotides, some of which can function in a similar manner as naturally occurring nucleotides. A nucleic acid can be in any form useful for conducting processes herein (e.g., linear, circular, supercoiled, single-stranded, double-stranded and the like). A nucleic acid in some embodiments can be from a single chromosome or fragment thereof (e.g., a nucleic acid sample may be from one chromosome of a sample obtained from a diploid IPTS / 200027855.1Attorney Docket No. HRG-026WO organism). In certain embodiments nucleic acids comprise nucleosomes, fragments or parts of nucleosomes or nucleosome-like structures. Nucleic acids can comprise protein (e.g., histones, DNA binding proteins, and the like). Nucleic acids analyzed by processes described herein can be substantially isolated and are not substantially associated with protein or other molecules. Nucleic acids can also include derivatives, variants and analogs of DNA synthesized, replicated or amplified from single-stranded (“sense” or “antisense,” “plus” strand or “minus” strand, “forward” reading frame or “reverse” reading frame) and double-stranded polynucleotides. Deoxyribonucleotides can include deoxyadenosine, deoxycytidine, deoxyguanosine and deoxythymidine. A nucleic acid may be prepared using a nucleic acid obtained from a subject as a template.

[0147] In certain embodiments, the nucleic acid is a cell-free nucleic acid, which can be found in bodily fluids such as blood, whole blood, plasma, serum, urine, cerebrospinal fluid, fecal, saliva, sweat, sweat, tears, pleural fluid, pericardial fluid, or peritoneal fluid of a subject. In certain embodiments, a plasma sample can be used directly in the methods disclosed herein (for example, in the cutting step), without prior purification or isolation of nucleic acids in the plasma. Cell-free nucleic acids originate from one or more healthy cells and / or from one or more cancer cells, or from non-human sources such bacteria, fungi, viruses. Examples of the cell-free nucleic acids include but are not limited to cell-free DNA (“cfDNA”), including mitochondrial DNA or genomic DNA, and cell-free RNA. In certain embodiments herein, instruments for assessing the quality of the cell-free nucleic acids, such as the TapeStation System from Agilent Technologies (Santa Clara, CA) can be used. Concentrating low- abundance cfDNA can be accomplished, for example using a Qubit Fluorometer from Thermofisher Scientific (Waltham, MA).

[0148] In various embodiments, the majority of DNA in a biological sample that has been enriched for cell-free DNA (e.g., a plasma sample obtained via a centrifugation protocol) can be cell-free (e.g., greater than 50%, 60%, 70%, 80%, 90%, 95%, or 99% of the DNA can be cell-free).

[0149] A methylated nucleic acid is a nucleic acid having a modification in which a hydrogen atom on the pyrimidine ring of a cytosine base is converted to a methyl group, forming 5-methylcytosine. Methylation can occur at dinucleotides of cytosine and guanine referred to IPTS / 200027855.1Attorney Docket No. HRG-026WO herein as “CpG sites”, which can be a target for enrichment. Methylation of cytosine can occurin cytosines in other sequence contexts, for example, 5 -CHG-3 and 5 -CHH-3 , where H isadenine, cytosine or thymine. Cytosine methylation can also be in the form of 5- hydroxymethylcytosine. Methylation of DNA can include methylation of non-cytosine nucleotides, such as N6-methyladenine (6mA). Anomalous cfDNA methylation can be identified as hypermethylation or hypomethylation, both of which may be indicative of cancer status. As is well known in the art, DNA methylation anomalies (compared to healthy controls) can cause different effects, which may contribute to cancer.

[0150] In certain embodiments, the nucleic acid comprises a CpG site (i.e., cytosine and guanine separated by only one phosphate group). In certain embodiments, the nucleic acid comprises a CpG island (also referred to as a “CG islands” or “CGI”) or a portion thereof, which is the target for enrichment. Because certain CGIs and certain features of certain CGIs in tumor cells tend to be different from the same CGIs or features of the CGIs in healthy cells, detection of such CGIs can be informative of a health condition. In certain embodiments, the CGI is a “cancer informative CGIs”, which is defined and described in more detail below. In certain embodiments, the CpG is an “informative CpG”, e.g., a “cancer informative CGI”. Such CGIs may have methylation patterns in tumor cells that are different from the methylation patterns in healthy cells. Accordingly, detection of a cancer informative CGI can be informative regarding a subject’s risk of developing cancer or can be indicative that the subject has cancer. Exemplary cancer informative CGIs, which can be target sequences as described herein, are identified in, e.g., Table 1 of U.S. Patent Publication 2020 / 0109456A1 and Tables 2 and 3 of WO2022 / 133315, each of which are hereby incorporated by reference in its entirety. Further exemplary cancer informative CGIs are shown in Tables 1 and 2 included herein.

[0151] In certain aspects, the nucleic acids of the invention have been treated to convert one or more unmethylated nucleotides (e.g., cytosines) to another nucleotide (a “converted nucleotide”, as used herein, such as a uracil), for example, prior to amplification. In certain embodiments, one or more unmethylated cytosines are converted to a nucleotide that pairs with adenine (e.g., the unmethylated cytosine may be converted to uracil). In certain embodiments, one or more unmethylated adenines are converted to a base that pairs with cytosine (e.g., the unmethylated adenine may be converted to inosine (I)). In certain embodiments, one or more IPTS / 200027855.1Attorney Docket No. HRG-026WO methylated cytosines (e.g., a 5-methylcytosine (5mC)) is converted to a thymine, which pairs with adenine. In certain embodiments, methylated cytosines are protected from conversion (e.g., deamination) during the conversion step.

[0152] After a nucleic acid has been treated to convert unmethylated, or, in some cases, methylated nucleotides, into another nucleotide, the nucleic acid may be amplified. During amplification, the converted nucleotide pairs with its complementary nucleotide, and in the next round of amplification, the complementary nucleotide pairs with a replacement nucleotide. For example, following the conversion of an unmethylated cytosine to a uracil, the nucleic acid may be amplified such that an adenine pairs with the uracil in the first round of replication, and in the second round of replication, the adenine pairs with a thymine. Accordingly, the thymine replaces the uracil in the original nucleic acid sequence, and is referred to herein as a “replacement nucleotide”. b. Bisulfite conversion

[0153] Bisulfite conversion is performed on DNA by denaturation using high heat, preferential deamination (at an acidic pH) of unmethylated cytosines, which are then converted to uracil by desulfonation (at an alkaline pH). Methylated cytosines remain unchanged on the single-stranded DNA (ssDNA) product.

[0154] In some embodiments the methods include treatment of the sample with bisulfite (e.g., sodium bisulfite, potassium bisulfite, ammonium bisulfite, magnesium bisulfite, sodium metabisulfite, potassium metabisulfite, ammonium metabisulfite, magnesium metabisulfite and the like). Unmethylated cytosine is converted to uracil through a three-step process during sodium bisulfite modification. As shown in FIG. 2A, the steps are sulphonation to convert cytosine to cytosine sulphonate, deamination to convert cytosine sulphonate to uracil sulphonate and alkali desulphonation to convert uracil sulphonate to uracil. Conversion on methylated cytosine is much slower and is not observed at significant levels in a 4-16 hour reaction. (See Clark et al., Nucleic Acids Res., 22(15):2990-7 (1994).) If the cytosine is methylated it will remain a methylated cytosine. If the cytosine is unmethylated it will be converted to uracil. When the modified strand is copied, for example, through extension of a locus specific primer, a random or degenerate primer or a primer to an adaptor, a G will be incorporated in the interrogation position (opposite the C being interrogated) if the C was methylated and an A will IPTS / 200027855.1Attorney Docket No. HRG-026WO be incorporated in the interrogation position if the C was unmethylated and converted to U. When the double stranded extension product is amplified those Cs that were converted to Us and resulted in incorporation of A in the extended primer will be replaced by Ts during amplification. Those Cs that were not converted (i.e., the methylated Cs) and resulted in the incorporation of G will be replaced by unmethylated Cs during amplification. c. Enzymatic conversion

[0155] In certain embodiments, the enzymatic treatment with a cytidine deaminase enzyme is used to convert cytosine to uracil. Enzymatic conversion can include an oxidation step, in which Tet methylcytosine dioxygenase 2 (TET2) catalyzes the oxidation of 5mC to 5hmC to protect methylated cytosines from conversion by subsequent exposure to a cytidine deaminase. Other protection steps known in the art can be used in addition to or in place of oxidation by TET2. After the oxidation step, the nucleic acid is treated with the cytidine deaminase to convert one or more unmethylated cytosines to uracils. As with bisulfite conversion, when the modified strand is copied, a G will be incorporated in the interrogation position (opposite the C being interrogated) if the C was methylated and an A will be incorporated in the interrogation position if the C was unmethylated. When the double stranded extension product is amplified those Cs that were converted to Us and resulted in incorporation of A in the extended primer will be replaced by Ts during amplification. Those Cs that were not modified and resulted in the incorporation of G will remain as C.

[0156] In certain embodiments the cytidine deaminase may be APOBEC. In certain embodiments the cytidine deaminase includes activation induced cytidine deaminase (AID) and apolipoprotein B mRNA editing enzymes, catalytic polypeptide-like (APOBEC). In certain embodiments, the APOBEC enzyme is selected from the human APOBEC family consisting of: APOBEC-1 (Apo1), APOBEC-2 (Apo2), AID, APOBEC-3A, -3B, -3C, -3DE, -3F, -3G, -3H and APOBEC-4 (Apo4). In certain embodiments, the APOBEC enzyme is APOBEC-seq. d. Nitrite Conversion

[0157] In certain embodiments, nitrite treatment is used to deaminate adenine and cytosine. As shown in FIG.2B, deamination of an A results in conversion to an inosine (I), IPTS / 200027855.1Attorney Docket No. HRG-026WO which is read by a polymerase as a G, whereas deamination of a methylated A (N6- methyladenine (6mA)) results in a nitrosylated 6mA (6mA-NO), which causes the base to be read by a polymerase as an A. Deamination of a C results in conversion to a uracil, which is read by a polymerase as a T, whereas deamination of a N4-methylcytosine (4mC) to 4mC-NO or a 5- methylcytosine (5mC) to a T causes the base to be read by a polymerase as a C or a T, respectively. For 5mC bases, the C to T ratio at the 5mC position is about 40% higher than other cytosine positions, allowing 5mC to be differentiated from C. (See, Li et al. (2022) Genome Biology 23:122.) EXAMPLES

[0158] Practice of embodiments disclosed herein will be more fully understood from the foregoing examples, which are presented herein for illustrative purposes only, and should not be construed as limiting the invention in any way. Example 1 – General Methods for Enriching for Target Nucleic Acid Molecules

[0159] Generally, blocker-induced Hepitype Enrichment in Hybridization is performed by combining bisulfite-converted whole genome (WGBS) library DNA with hybridization capture reagents, targeted blockers for non-methylated sites (bisulfite converted sites) and biotinylated-probes specific for target methylated sequences. Hybridization is performed in a step-wise temperature-dependent manner in order for the targeted blockers to anneal ahead of the biotinylated-probes and then allow hybridization to continue at a set temperature for a set amount of time. Directly after hybridization incubation, combine streptavidin (SA) beads with post- hybridization material in order for the biotinylated-probe-target-library-DNA to bind to the SA beads. Wash off-target library DNA out of solution with a series of washes with increasing stringency. Amplify the captured library DNA off the SA beads using Illumina sequencing adapters. An optional step is to identify amount of library DNA enriched using qPCR as a read- out. Finally, sequence on an Illumina sequencer. Post-sequencing, align the sequenced reads to a reference to create a BAM file and subsequently use the BAM file for all pipeline processing, including on-target enrichment percentage as well as methylation metric calling. IPTS / 200027855.1Attorney Docket No. HRG-026WO

[0160] More specifically, the target specimen type (e.g. DNA, RNA, protein, exosomes, metabolites, etc.) is isolated from a patient’s biological source (e.g. tissue, blood, plasma, serum, saliva, feces, etc.). All target specimens are assayed for quality and quantity measurements.

[0161] The target specimens, specifically cfDNA nucleic acid molecules, undergo conversion to convert unmethylated cytosines to uracils. Bisulfite conversion is performed on DNA by denaturation using high heat, preferential deamination (at an acidic pH) of unmethylated cytosines, which are then converted to uracil by desulfonation (at an alkaline pH). Methylated cytosines remain unchanged on the single-stranded DNA (ssDNA) product.

[0162] Reference is made to FIG.5A, which shows an example depiction of blocker- induced enrichment. Specifically, blocker-induced enrichment in PCR is performed by combining bisulfite-converted DNA (e.g., hypermethylated DNA and unmethylated DNA, as shown in FIG.5A) with PCR reagents, targeted high Tm blockers (e.g., xenonucleic acid blockers) for non-methylated sites (bisulfite converted sites) and primers specific for target methylated sequences. Addition of a hydrolysis probe (e.g. TaqMan) specific for targeted methylated sequences adds additional specificity to target sequences. Real-time qPCR (or digital PCR) is performed for 30-50 cycles and the output is monitored for signal via fluorescence from amplified target DNA. Cycle threshold values (Ct) are recorded and exported for analysis. The delta-Ct between negative control, positive control, and sample are calculated to determine the abundance of hypermethylated DNA.

[0163] Positive results for hypermethylation target sites with the addition of blocker produce a result of the delta-Ct between sample and negative control which is greater than or equal to 3. Negative results for hypermethylation target sites with the addition of blocker produce a result of delta-Ct between sample and negative control which is less than 2. Inconclusive results for hypermethylation target sites with the addition of blocker produce a result of delta-Ct between the sample and negative control which is greater than or equal to 2 but less than 3. FIGs.5B-5D shows example qPCR graphs showing theoretical relative detected fluorescence across amplification cycles for methylated and unmethylated DNA. Specifically, FIG.5B shows that the change in cycle threshold (Ct) for methylated DNA does not change in the presence or absence of blockers. FIG.5C shows a shift in the Ct value for unmethylated DNA in the presence of blockers. Here, amplification of the unmethylated DNA is delayed. FIG. IPTS / 200027855.1Attorney Docket No. HRG-026WO 5D depicts a scenario in which unmethylated DNA is not amplified or not detected by hydrolysis probe, thereby resulting in a significant change in Ct value. Here, this scenario arises in the presence of xenonucleic acid blockers. Experimental Protocols Oligo Resuspension 1. Disinfect the PCR hood in the pre-PCR lab with DNA Away for 10 minutes, followed by 70% ethanol. Optionally, run the UV light for 30 minutes prior to disinfection. 2. Spin down the lyophilized oligonucleotides (e.g., xenonucleic acid blockers). 3. Perform vortex, centrifugation, and incubation. 4. Prepare the desired working dilution for the forward primer and reverse primer mixture, such as 10 μM. For 10 μM forward and reverse primer mixture, add 10 μL of each primer to 80 μL TLE. 5. Prepare the desired working dilution for the TaqMan probe, such as 10 μM. For 10 μM probe, add 10 μL of probe to 90 μL TLE. 6. Store oligo stocks at -20 °C. Bring the oligo working dilutions to the post-PCR lab and store at -20 °C. Prepare qPCR Plate 1. Prepare a qPCR plate layout which depicts the well location for each qPCR condition within a 384-well plate. The table 3 below shows an example of an annotated 384-well qPCR plate layout. Each well provides sufficient information to distinguish the qPCR components used in each well. In this example, five blocker types are tested across two qPCR assays at two gBlock DNA template levels. Table 3. Example of an annotated 384-well qPCR plate layout. Each well provides sufficient information to distinguish the qPCR components used in each well. In this example, five blocker types are tested across two qPCR assays at two gBlock DNA template levels. IPTS / 200027855.1Attorney Docket No. HRG-026WO1. Prepare the qPCR mixtures (N = 3 per condition). a. A standard qPCR mixture using IDT’s PrimeTime Gene Expression Master Mix and a single-plex qPCR with a single TaqMan probe, in 10 μL and 20 μL final volume, is shown in the Table 4 below. b. A standard qPCR mixture using Bio-Rad’s SYBR Green Master Mix and a single- plex qPCR, in 10 μL and 20 μL final volume, is shown in Table 5 below. c. Multiple N = 1 by the total number of wells to create a bulk mixture. The volumes will change if using different reagent concentrations or adding more reagents, such as in a multiplex reaction. Use C1V1=C2V2 when modifying the volume required for a particular reagent concentration. Table 4. Standard single-plex qPCR mixture using IDT’s Prime Time Gene Expression Master Mix.IPTS / 200027855.1Attorney Docket No. HRG-026WOTable 5. Standard single-plex qPCR mixture using Bio-Rad’s SYBR Green Supermix.2. Add 10 μL of each qPCR mixture to the qPCR plate based on the qPCR plate layout. a. Briefly vortex and centrifuge the N = 3 qPCR mixtures prior to loading on the plate. 3. Tightly seal the qPCR plate with an optical seal, especially around the perimeter of the plate and across the top of the plate. Run the qPCR Plate 1. Place the qPCR plate in the CFX 384 or CPF Opus 384 instrument in the correct orientation. 2. Run the standard qPCR protocol as follows: 95 °C for 3 minutes, 45 cycles of 95 °C for 30 seconds, 60 °C for 45 seconds with a plate reader turned ON. IPTS / 200027855.1Attorney Docket No. HRG-026WO Example 2 – Xenonucleic Acid Blockers Enable Differential Enrichment of Nucleic Acid Molecules

[0164] Generally, the experimental protocols described in Example 1 were performed to evaluate the use of xenonucleic acid blockers for differential enrichment of nucleic acid molecules. CpG-dense regions that are cancer-informative were identified. These CpG-dense regions exhibited increased levels of hypermethylation in cancer samples and hypomethylation in non-cancer samples. Quantitative bisulfite-specific (qBSP) or methylation-specific qPCR (qMSP) assays were designed with hydrolysis probes covering these target CpG sites. Xenonucleic acid blockers were designed to specifically bind to the unmethylated species, and outcompete the hydrolysis probe through a high Tm differential, thereby displacing the probe and / or preventing subsequent amplification. Next, the qBSP or qMSP assays were evaluated using a titration series of hypermethylated gDNA spiked into hypomethylated gDNA to simulate varying percentages of methylated ctDNA fragments in an unmethylated cfDNA background, as well as with real cancer and non-cancer patient samples. qPCR was run both with and without xenonucleic acid blockers and the percentage of methylated DNA was estimated by comparing the amount of methylated copies to total copies.

[0165] Seven xenonucleic acid blockers were developed and tested. The blockers included modified sequences as shown in the following table 6. Table 6: Example xenonucleic acid blocker sequences. A locked nucleic acid is denoted as [LNA-X], where X refers to one of A, T, C, or G nucleobases.57 IPTS / 200027855.1Attorney Docket No. HRG-026WOFurthermore, Table 7 below shows the relative location of each blocker sequence relative to 1) CpG sites, 2) probe (e.g., Taqman probe) binding location, 3) and forward / reverse primer binding locations. Specifically, the blocker sequence in the “Relative Sequences” column of Table 7 is shown in parentheticals. For example, for Blocker 1, the blocker sequence is denoted as “[TTAGGTGTTTGTGGGGTT]”. Corresponding CpG sites are shown in bold. For example, for Blocker 1, there are a total of 5 CpG sites in the relative sequence, each bolded as “TG” (which is derived from a corresponding unmethylated CpG site as the unmethylated “C” was converted to a uracil and the resulting base after amplification of this sequence is thymine “T”). The complementary sequence to the bisulfite converted sequence will have adenosine, “A,” at the positions complementary to uracil or thymine. This is in contrast to the complementary sequence of the sequence with methylated cytosine(s), which will have guanine. The probe (e.g., Taqman probe) binding sequence is shown in italics. For Blocker 1, the full probe binding sequence is “TTTTTTTGGGGGTTGTGGATTTTAGAGTT”, where the final two thymine nucleotides overlap with the first two nucleotides of the blocker sequence. Forward and reverse primer binding sequences are shown in underline. IPTS / 200027855.1O W620- .sGnRoiHta.coolNtgenik dconibDry e TenmiGTG Gr rG G G Go pG G … … …teG G G T G G GtsrT TG G GAevG G GTeTT TrT / dTT T TTT TTTTTTTTrT TaG G GT T TT T G G G w T r G G G G G G ofG G G T T T G G dnAaTAA G TTTTA A A A A A ,[T[nG GG G G oiAGA AG G G G taG cAGAA A A TA AA ol TATTT TT AAAAAAA Ag T TTniTdATA ATGTT ATTTn G GT TTibGTG GTT T TT 95GT TTebG GTAAAAAAoTrTTT TGTATTTAT ApG G G ,sG G GTeTT TTtG G G]TTiA]A AsG G GGTG GG GpTG TTT]T A AA]T G G G CToTTtTT TT T TT TTTTTTe TvTT TTTT TTTiTG G G tTalTTT G G GeTTT T T T TrG GTTG TTTTGTTGTe T TGcT T T TneG G G GGusG G AAGAGAqeeA A G[G[ GscrnA A A eeG G GT T TT G GGkucqTTTT[TTTTTT[Toe T T T T T TlSb e TGTGTGTATATA el vi T T TA A A ptamlG G G aeA A AGTGTGTxR … … … … … … E:7rek7elc dboalnaTB1 2 3 4 5 6Attorney Docket No. HRG-026WO Xenonucleic Acid Blocker differentiates between 0% and 1% methylation

[0166] Reference is made to FIGs. 6A and 6B, which shows that a xenonucleic acid blocker (including LNAs), successfully differentiates between 0% methylated DNA and 1% methylated DNA based on qPCR Ct values. Here, bisulfite-converted hypermethylated gDNA was spiked into bisulfite-converted unmethylated gDNA to obtain 1% methylated DNA. Bisulfite-converted unmethylated gDNA was used as 0% methylated DNA. Xenonucleic acid blockers (Blocker 1 having SEQ ID NO: 8 or Blocker 7 having SEQ ID NO: 13) were added along with a TaqMan probe. qPCR was performed to generate the qPCR curves shown in FIGs. 6A (Blocker 1) and 6B (Blocker 7). Xenonucleic Acid Blockers Bind Differently to Unmethylated Candidate Sequences

[0167] Reference is made to FIGs. 7A-7B, 8, and 9, which shows different binding effects across the different xenonucleic acid blockers. Specifically, FIG.7A shows a comparison between blocker 1 (LNA at every other position) and blocker 2 (triplet LNAs at positions immediately preceding, immediately subsequent to, and corresponding to a CpG site). Each of blocker 1 and blocker 2 have two nucleobases that overlap with the binding sequence of the probe (e.g., Taqman probe). Therefore, blocker 1 and blocker 2, if bound to a candidate sequence, would outcompete the Taqman probe for binding. As shown in FIG.7A, blocker 1 showed a significant Ct difference for the unmethylated gBlock across three different concentrations (e.g., 1X, 5X, and 10X). Blocker 2 also achieved a Ct difference for the unmethylated gBlock across three different concentrations (e.g., 1X, 5X, and 10X), but to a lesser extent in comparison to blocker 1.

[0168] FIG.7B shows a comparison between blocker 4 (LNA at every other position) and blocker 5 (triplet LNAs at positions immediately preceding, immediately subsequent to, and corresponding to a CpG site and further LNA at every other position). Each of blocker 4 and blocker 5 have eighteen nucleobases that overlap with the binding sequence of the probe (e.g., Taqman probe). Therefore, blocker 4 and blocker 5, if bound to a candidate sequence, would outcompete the Taqman probe for binding. As shown in FIG.7B, both blocker 4 and 5 achieved complete dropout (indicating complete blockage and no amplification) of unmethylated gBlockAttorney Docket No. HRG-026WO at 5X and 10X concentrations. Additionally, blockers 4 and 5 also demonstrated a concentration dependent increase in Ct difference for the methylated gBlock.

[0169] FIG.8 shows a comparison between blocker 5 (8 total LNAs) and blocker 6 (11 total LNAs). Blocker 6, with the 11 total LNAs, achieved higher specificity. For example, blocker 6 demonstrated a concentration dependent increase in Ct difference for the unmethylated gBlock, but across the same concentrations, blocker 6 did not significantly impact Ct value for methylated gblock. This is likely due to the higher change in melting temperature (e.g., blocker 6 achieved Tm of 11.1-13.6 whereas blocker 5 achieved slightly lower Tm of 5.8-8.3) as well as the number of mismatches (number of CpG sites covered) (e.g., blocker 5 covers one CpG site whereas blocker 6 covers three CpG sites). This suggests that increasing number of LNAs and / or increasing number of mismatch CpG sites in the blocker sequence can increase the specificity of blocking to unmethylated sequences (and not methylated sequences).

[0170] FIG.9 shows a comparison between blocker 1 (3 CpG mismatches, with all 3 CpG mismatches located towards the center of the blocker sequence) and blocker 3 (2 CpG mismatches, with only 1 CpG mismatch located towards the center of the blocker sequence). The blocker 1 showed improved specificity for blocking unmethylated sequences (e.g., Ct difference of 6.2 for bisulfite specific PCR (BSP) and 2.3 for methylation specific PCR (MSP) for unmethylated sequences, and Ct difference of near zero for BSP and MSP for methylated sequences). These results demonstrate that these blockers can be successfully used with quantitative methylation-specific PCR.

[0171] FIGs.10A-10B show that all blockers achieve Ct differences in unmethylated sequences due to probe displacement. Gel electrophoresis experiments were separately performed. FIGs.10C and 10D show exemplary gels following use of blocker 3 and blocker 6. Although not shown, gels for blockers 1, 2, 4, and 5 were similar to the gel of blocker 3, and the gel of blocker 7 was similar to the gel of blocker 6. Specifically, FIG.10C shows that for blocker 3, amplification was occurring and amplicons could be detected regardless of blocking determined by Ct delay. Thus, the Ct difference was due to probe displacement (e.g., Taqman probe not being able to bind and emit fluorescence). For blocker 6, the blocker sequence was located directly adjacent to the forward primer binding site and limited product was observed in the gel. Here, extension was likely blocked due to blocker 6 being adjacent to the forward IPTS / 200027855.1Attorney Docket No. HRG-026WO primer. Although amplification was significantly reduced, probe displacement was likely also occurring due to binding of the blocker sequence to candidate sequences of unmethylated DNA.

[0172] FIG.11 shows that increasing blocker concentrations increases blocking, but can also reduce blocking specificity. For example, each of blockers 1-6 achieved significant Ct differences in unmethylated gblocks, with blocker 4 and 5 achieving complete dropout at 5X and 10X concentrations. However, blockers 4-6 also showed Ct differences in methylated gblocks, at increasing concentrations (blocker 6 to a lesser extent).

[0173] A slight modification to the protocol was made to include a two-step annealing process to help with blocker specificity. Specifically, FIG.12 shows the results of a 2-step annealing process in comparison to a 1-step annealing process. For the 1-step annealing process, the following methodology was applied: 95oC / 5 min initial denaturation / hot start followed by 45 cycles of: 95oC / 30 sec denaturation and 60oC / 45 sec anneal. For the 2-step annealing process, the following methodology was applied: 95oC / 5 min initial denaturation / hot start followed by 45 cycles of: 95oC / 30 sec denaturation, 60-80oC / 40 sec first anneal, and 60oC / 45 sec second anneal.

[0174] At a 5X concentration, blocker 7 achieved larger Ct difference values in unmethylated sequences when using the 2-step annealing process in comparison to the 1-step annealing process. Specifically, complete dropout was achieved using blocker 7 for unmethylated sequences across temperatures of 77oC, 79oC, and 80oC of the 2-step annealing process. In comparison, the 1-step annealing process did not achieve complete dropout and instead, achieved a Ct difference value of 20. The Ct difference for methylated sequences remained relatively consistent (e.g., about 2.5) across both the 2-step and 1-step annealing processes. Thus, this indicates that the 2-step annealing process can increase the specificity of blocking unmethylated sequences.

[0175] FIG.13 shows that combining multiple blockers can improve blocking efficiency and specificity. For example, a combination of blocker 1 and blocker 3 achieved higher Ct difference values in unmethylated sequences in comparison to similar concentrations of blocker 1 alone or blocker 3 alone. This indicates that combining different blocker sequences can increase blocking efficiency without negatively impacting blocking specificity. Additionally, a combination of blocker 5 and blocker 6 achieved complete dropout for unmethylated sequences. IPTS / 200027855.1Attorney Docket No. HRG-026WO Furthermore, the combination of blocker 5 and 6 achieved a lower Ct difference for methylated sequences in comparison to a similar concentration of blocker 5 alone.

[0176] FIG.14 shows that three blockers specifically inhibit unmethylated DNA in patient-like samples down to 15 copies of tumor DNA (e.g., 1% methylation in total input 5ng DNA). Specifically, blockers 1 and 3 achieve high specificity for blocking unmethylated DNA, Minimal Ct differences were observed between blocking and no blocking in the methylated only (100%, 10%, or 1% Met only) conditions. Blocker 7 shows less specificity, but similarly blocked unmethylated DNA (e.g., see 10% Met in Unmet, 1% Met in Unmet and 100% Unmet Only) down to 15 copies of tumor DNA. Example 3 – Design of qMSP primers to target CpG rich sites and evaluation of Xenonucleic Acid Blockers to Enrich Methylated Nucleic Acid Molecules

[0177] Forward and reverse primers were designed to amplify target sites containing CpG-dense regions that are cancer-informative; these target sites had at least two CpG sites. These CpG-dense regions exhibited increased levels of hypermethylation in cancer samples and hypomethylation in non-cancer samples. Real-time quantitative methylation-specific PCR (qMSP) was used. Generally, the experimental protocols described in Example 1 were performed to evaluate differential enrichment of nucleic acid molecules. The forward and reverse primers were designed to each bind to at least one CpG site. The probe (i.e., Taqman probe) was also designed to bind at least one CpG site. The target site sequences are summarized in Table 8 below, in which CpG sites are bolded. Table 8.63 IPTS / 200027855.1Attorney Docket No. HRG-026WO

[0178] The cycle threshold (Ct) and endpoint fluorescence (EPF) were measured for each set of primers to determine the specificity e.g., how much methylated versus unmethylated DNA was amplified. The results are summarized in Tables 9 and 10, where values in bold indicate complete specificity and values in italics indicate partial specificity. FIG. 15 summarizes the average EPF values measured for methylated and unmethylated DNA as a result of each set of primers. Table 9.Table 10.IPTS / 200027855.1Attorney Docket No. HRG-026WO

[0179] Overall, the primers sets that amplified a sequence including target sequences S_01 & S_06, S_02, S_07, and S_08 showed enrichment for amplification of methylated DNA over unmethylated DNA.

[0180] Ten xenonucleic acid blockers were then developed and tested to determine if the presence of the designed blockers would increase specificity of the qMSP reactions. The blockers included modified sequences as shown in Table 11. The blockers generally included an LNA at every other position. Generally, the experimental protocols described in Example 1 were performed to evaluate the use of the xenonucleic acid blockers for differential enrichment of nucleic acid molecules. Quantitative bisulfite-specific (qBSP) or methylation-specific qPCR (qMSP) assays were designed with hydrolysis probes covering these target CpG sites. Xenonucleic acid blockers were designed to specifically bind to the unmethylated species, or the resulting complementary sequence of the unmethylated species after the bisulfite conversion thereof, and outcompete the hydrolysis probe through a high Tm differential, thereby displacing the probe and / or preventing subsequent amplification. Next, the qBSP or qMSP assays were evaluated using a titration series of hypermethylated gDNA spiked into hypomethylated gDNA to simulate varying percentages of methylated ctDNA fragments in an unmethylated cfDNA background, as well as with real cancer and non-cancer patient samples. qPCR was run both with and without xenonucleic acid blockers and the percentage of methylated DNA was estimated by comparing the amount of methylated copies to total copies. IPTS / 200027855.1Attorney Docket No. HRG-026WO Table 11: Example xenonucleic acid blocker sequences. A locked nucleic acid is denoted as [LNA-X], where X refers to one of A, T, C, or G nucleobases.IPTS / 200027855.1Attorney Docket No. HRG-026WO

[0181] The primer sequences, probe sequences, sequences selected for amplification are summarized in Tables 12-19 and Table 20 below. In Tables 12-19, “R” refers to either an “A” or “G” nucleobase, “Y” refers to either a “C” or “T” nucleobase. In Table 20, the relative location of each blocker sequence relative to 1) CpG sites, 2) probe (e.g., Taqman probe) binding location, 3) and forward / reverse primer binding locations. Specifically, the blocker sequence is denoted between brackets, CpG sites are shown in bold, the probe (e.g., Taqman probe) binding sequence is shown in italics, and the forward and reverse primer binding sequences are underlined. Table 12.*IPTS / 200027855.1Attorney Docket No. HRG-026WO Table 15.*Table 16.*Table 17.*Table 18.*Table 19.*68 IPTS / 200027855.1Attorney Docket No. HRG-026WO*Tables 12-19: “R” refers to either an “A” or “G” nucleobase, “Y” refers to either a “C” or “T” nucleobase. IPTS / 200027855.1O W620-GRH.oNtekcoDyenrottAG G G G YTG G ATGA T TYTTGTGATA AT T TTGTTG A ATTGTG G T YT T TG TACT TTGTGTG G GTTA A TT TT TTTA ATATGTG G A A TT ATTTT TAT TTTT ATG G G YTAGT GT TT G GA TTTA TTTGGAAA TT GTTTTsG G GTG AYTGTTATTGAAT TC TT GT G ecA neATAT GTYT TTTGATA GGT T TGGTTu A A qGG G A Y G ATG ATA AT ]ATT GTG A eATTA G G GTA G TTA YATG GA TTTG]SeG G YA AT G YGTTA TTAA GT TG ATTG C viGTTTGTTTTGT T TGT TTGGYT]G G taGTT AATT GTT GTTTA GAGTTTT A G leR G A ATGTG GTG A G G G G Y CTGGTA GGAG G Y AGC TATr60.e0k S2c& eo1 2 3 4 5 7l l0 0 0 0 0 08001bBS S S S S S S SaTAttorney Docket No. HRG-026WO

[0182] Each blocker was tested in at least two conditions relative to the reaction with no blocker. FIG.16 shows the resulting qPCR products from the reactions with each blocker. Use of blocker S01 & S06, S07, S08, or S10 results in a lighter product band of the unmethylated DNA, indicative of inhibition of amplification of the unmethylated DNA compared to the amplification of the methylated DNA. FIG.17 - FIG.24 show the EPF results of each blocker individually. Table 21 below summarizes the results each reaction without the blocker and each reaction with the blocker at the tested ratios. Table 21.Attorney Docket No. HRG-026WO

[0183] Based on the data summarized in Table 21, blocker S01 & 06 did not significantly affect the average Ct of the methylated DNA. Blocker S02 did show some blocking of methylated DNA amplification. Blocker S03 did not affect the average Ct of the methylated DNA while increasing the average Ct of unmethylated DNA, indicative of specific blocking, at both 1X Blocker: Probe (B:P) and 5X B:P.

[0184] Blocker S04 showed blocking of unmethylated DNA amplification, but also some blocking of methylated DNA amplification. The qMSP protocol was optimized and landed at using half of the primer concentration (250 nM), increased Ta (62C), decreased annealing time (30 sec), and lower PCR cycles (40 cycles). With these conditions, S04 was able to specifically block unmethylated DNA amplification while not affecting the amplification of methylated DNA. The results are summarized in Table 22. Table 22. Results of S_04 qMSP with optimized qMSP protocol

[0185] Blocker S05 and S08 did not significantly affect the average Ct of the methylated DNA and did block unmethylated DNA amplification. Blocker S06 showed some blocking of methylated DNA amplification. Blocker A of S10 specifically blocked unmethylated DNA amplification, while Blocker B of S10 S06 showed blocking of methylated DNA amplification. IPTS / 200027855.1Attorney Docket No. HRG-026WO

[0186] As a way to identify possibly characteristics of the probe sequences that correlate with blocking the amplification of unmethylated DNA, Table 23 place the probes in order of number of CpG sites in the probe sequences. In general, having 4 CpG sites in the probe sequence correlated with the most inhibition of unmethylated DNA by the blocker. Generally, having 2 CpG sites close to each other also helped with specificity of blocking unmethylated DNA amplification Table 23.*An EPF of under 100 after use of the blocker is considered to be a methylation-specific blocker.

[0187] Another consideration was how many CpG sites were in the blocker sequences. Table 24 below summarizes the number of CpG sites in each blocker, blocker length, and distance of the CpG sites from the 5’ end. IPTS / 200027855.1Attorney Docket No. HRG-026WO Table 24.

[0188] Three of the five blockers with specific blocking had 2 or more CpG sites. In general, two or more CpG sites in the blocker sequence helped with specificity. INCORPORATION BY REFERENCE

[0189] The entire disclosure of each of the patent and scientific documents referred to herein is incorporated by reference for all purposes. IPTS / 200027855.1Attorney Docket No. HRG-026WO EQUIVALENTS

[0190] The invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. The foregoing embodiments are therefore to be considered in all respects illustrative rather than limiting on the invention described herein. Scope of the invention is thus indicated by the appended claims rather than by the foregoing description, and all changes that come within the meaning and range of equivalency of the claims are intended to be embraced therein. IPTS / 200027855.1Tables Table 1. Genomic ranges of low background regions including a plurality of CpG sites mapped to human genome, hg19. The “Genomic Coordinate Start” and “Genomic Coordinate End” columns indicate the beginning and end, respectively of a range of genomic locations within a chromosome (“Chrom.”).IPTS / 200027855.1IPTS / 200027855.1ecneeuhtqeet sacidnisnmuloc”d8n38g383hghgE h“d4 1 3n3a3923148282”tr 08at60 076767S 1 1 1“eh 2T 06.3430823824208083g 6h 76076,1 171emonegnam 2r2uhr2rhchchcotdeppamsetise8 8 8 8 8 8 8 8Gpfo eshs 3Ag3hg3hg3hg3hg3hg3hg38hg38hg38 8 8 8 8 8 8 8 8 8 8 8 8 8hg3g3g3g3g3g3g3g3g3g3g3g3g3g3gCe h h h h h h h h h h h h hd gt h hnn na aree 4w33 5 588790030 21944938207511683483895043170084856288128563282960787248 0 4 6 0 2 7 9 0 3 5 4s a t 040717172 3 7 78 9 8 8 6 9 3 3 4 6 3 5noifet ob(51030303 6868717715755755657371814448422444444449514ad 1 1 3 3 3 3 373040 4 6 6 7 7 7 7 7 7 0c yl n n4 4 4 4 4 4 4 4 4 4 5oo El evcii itgcer 476 4 32 2 8 3 2 9 6 9 7 5 4 4 7 7 4 9 0 8 1 506 9 11 2 5 2 3 4 2 2 9 9 6 4 1 1 3 1 8 6 3 3meop tseg 09 9 084070717 92207282860717248838471895297393042613356367 7 7 7 7 6 3 1 1 4 8 2 4 4 4 4 9 1n er t51030 07 7 5 5 5 7 7 8 4 4 4 2 4 4 4 4 5 4e ra r3 3818 1 1 5 5 5 7 0 0 4 6 6 7 7 7 7 7 7 0g ,ld te at1 3 3 3 3 3 3 4 4 4 4 4 4 4 4 4 4 4 5a Ss nr ehtedfvi no en a eugg m 1.o558n na i nna sro 7em 2o1 1 1 1 1 1 1 1 100mnuightrh rChrchrchrchrchrchr r r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r 0chchchchchchchchchchchchchchchchchchc2 / SHebfo TPI838 8 8 8g3g3g3 3h h hghgh34518 8 18 9473 7999 180210905 6 66 616161717171761718739980377 8496 8 29991 0 10 0516166 6176 6 61717171712r2r2 2 2hr r rchchchchc838 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8g3g3g3g3g3g3g3g3g3g3g3g3g3g3g3g3g3g3g3g3g3g3g3g3g3 3 3 3 3h h h h h h h h h h h h h h h h h h h h h h h h hghghghghgh809472569006945499901194429667648 5 3 4 8 1 9 0 3 8 9 8 9 67 1 3 4 0 1 2 4 4 7 8 5 60 4 7 2 1 3 1 0 8 9 1 3 4 25 6 7 7 1 1 1 1 1 56 2 3 4 6 2 4 6 7 2 2 0 3 4 0 1 71 1 1 1 2 2 28 9 9 9 0 0 0 0 1 1 1 1 6 7 0 0 0 6 2 24 4 4 42 2 2 1 1 1 1 2 2 2 2 2 2 2 2 2 2 3 3 3 2 5 50 04 4 4 4 4 4 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 5 7 75 50505050505050505363636363636363636363636363636363656666649814575095570133842557148056630960313872 7 5 7 3 7 3 8 8 66 0 1 3 9 1 2 4 4 6 7 5 5 6 2 3 30 4 6 2 0 5 0 3 0 15 6 7 7 0 1 1 1 1 5 8 9 9 96 2 3 6 6 1 1 7 3 4 1 1 21 1 1 1 2 2 2 2 2 2 10 0 0 0 1 1 1 1 6 7 9 0 0 5 2 24 4 4 4 4 4 4 4 41 1 1 2 2 2 2 2 2 2 2 2 2 2 3 3 2 5 50 0 0 050504 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 5 7 75 5 5 50505050536363636363636363636363636363636365666661.558721r1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 100hrchrchrchrchrchrchrchrchr r r r r r r r r1r1r1r1r1r1r1r1r1r1r1r1r 0chchchchchchchchchchchchchchchchchchchchchc2 / STPI83838 8 8g g3g3g3h h h hgh0003995 8485 841747870 2 26 6614641 1681 6 6181020202651 8 4 33059 3 48 8801247 7266 4 4161116 68181062062022r2r2r2r2h hrc chchchc8383838383838 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8g g g g3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3h h h hghghghghghghghghghghghghghghghghghghghghghghghghghgh368 3 5 5 4 5 7 5 6 0 1 15 1 8 2 4 7 2 8 9 9 7 4 8 6 4 62105073540010422992 5 9 4636031025244955798294923557242799031156071818 8 9 905050526078686868686868686868696960715073751777 7 717171717272727272708090909090909090909090909 0010000000000000000000000010219311111111111111111111111111111112547363758685531153072361149 132947815770920660030 0 5 1 0 52041664767081829990505052696 0808182838587 7 9 91325022249903151071717171717172727272727 6060606 6 6868686869696071507375778090909090909090909090909 010 00000000000000000000010219311111111111111111111111111111111.558721r1 1 1 1 1 1 1 1 1 1 1 1 100hrchrchrchrchrchrchr r r r r r r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r 0chchchchchchchchchchchchchchchchchchchchchchchc2 / STPI83838 8 8g g3g3g3h h h hgh9779 70 9 80708 0759979 39 82 2 67 4702 2 252 292 28506080 0 18862797 829 36 998227 47022 25922220 0 0r2r2 2 2hchrchrchrchc83838383838383838383838383838383838383838 8 8 8 8 8 8 8 8 8g g g g g g g g g g g g g g g g g g g3 3 3 3 3 3 3 3 3 3h h h h h h h h h h h h h h h h h h hghghghghghghghghghghgh8674142770416331337599289040677 8 4 9 2 6 5 0 9 7 4 7 9 0 45 8 9 9 0 1 4 5 6 8 1 4 05 5 7 0 8 8 2 6 3 9 9 3 6 4 19 9 9 9 0 0 3 3 3 3 4 42 4 0 4 7 8 0 3 5 3 6 6 0 1 2 3 77 7 7 7 8 8 8 8 8 85 5 5 6 6 6 7 9 9 9 0 2 2 3 3 3 3 09 9 9 9 9 9 9 9 98 8 8 8 8 8 8 8 8 8 8 8 9 9 9 9 9 9 9 08 8 8 8 8 8 8 89 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 01 1 1 1 1 1 18 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 91 1 1 1 1 1 1111111111111111111111111111111111111111111111194129 4 4 5 8 0 3 4 8 9 9 7 5 4 6 7 9 2 5 3 6 7 4 4 7 3 8 557 5 8 0 6 5 6 1 7 6 5 8 9 0 0 3 2 5 7 9 4 0 5 4 1 5 9 898989999910334353831444541535064676570939493062620313232 67 7 7 7 7 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 9 9 9 9 93 09 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 99 9 08 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 89 9 9 01 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 18 8 8 8 8 91 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1111111111111111.558721r1 1 1 1 1 1 1 1 1 1 100hrchrchrchrchrchr r r r r r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r 0chchchchchchchchchchchchchchchchchchchchchchchchc2 / STPI83838 8 8g g3g3g3h h h hgh3060502 4871 839210117 7 85 5272721 1 872 2 3838368967 7 677 2 9701779 00 17 852 2 2151787 72 2 3838302020 0 0rhr2r2r2rchchchchc8383838383838383838383838383838 8 8 8 8 8 8 8 8 8 8 8 8 8 8g g g g g g g g g g g g g g3 3 3 3 3 3 3 3 3 3 3 3 3 3 3h h h h h h h h h h h h h hghghghghghghghghghghghghghghghgh380017942429846381266 8 8 4 8 1 2 5 2 3 7 8 9 2 2 9 9 1 7 58 1 6 3 8 7 7 2 46 5 8 3 3 5 2 5 6 4 2 3 9 3 6 9 6 2 7 77 8 9 0 0 6 8 50 2 1 1 6 7 8 9 9 4 8 6 5 2 4 4 9 4 5 3 40 0 7 8 8 2 32 8 0 5 5 5 5 5 5 5 3 3 3 8 4 4 4 4 5 5 0 00 0 0 0 0 29 2 8 2 4 4 4 4 4 4 4 9 9 3 5 5 5 5 5 5 5 6 69 9 7 7 78 2 3 3 4 8 8 8 8 8 8 8 8 8 3 9 3 3 3 3 3 3 6 61 1 4 40 1 5 5 6 6 6 6 6 6 6 6 6 6 6 0 1 5 5 5 5 5 5 0 01 1 1 14151515151515151515151515151515161616161616161617171748834215919729137017742261018882993733762739559837569411308 0 6 8 7 7 7 2 3 0 1 1 1 6 6 7 8 9 3 4 6 5 2 3 4 9 3 557 8 9 9 0 6 8 5 2 8 0 5 5 5 5 5 5 5 3 3 3 8 4 4 4 4 53 40 0 7 7 8 2 3 9 2 8 2 4 4 4 4 4 4 4 9 9 3 5 5 5 5 55 0 00 0 0 0 0 2 8 2 3 3 4 8 8 8 8 8 8 8 8 8 3 9 3 3 35 5 6 69 9 7 7 7 0 1 5 5 6 6 6 6 6 6 6 6 6 6 6 0 1 53 3 3 6 61 1 4 4 4 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 6 65 5 5 5 5 0 01 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 161616161616171711.558721r1 1 1 1 1 1 1 1 1 100hrchrchrchrchrchr r r r r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r 0chchchchchchchchchchchchchchchchchchchchchchchchc2 / STPIg3838383hghghghgh08804 4 259 7 4708742 6505 272396060 0 64 433336327777 6 15 9875207 7654 7 3050202096 664 4333363020 1r2 21212hrhrhr rc c chchc8383838383838383838383838383838383838 8 8 8 8 8 8 8 8 8 8 8g g g g g g g g g g g g g g g g g3 3 3 3 3 3 3 3 3 3 3 3h h h h h h h h h h h h h h h h hghghghghghghghghghghghghgh049483601361980324925624994 2 1 1 9 8 2 1 7 4 4 0 5 2 4 7 99 0 4 6 0 3 4 5 3 7 2 32 9 7 3 6 8 1 6 9 5 1 4 8 2 9 9 00 1 1 1 6 9 9 9 3 3 23 6 1 4 3 6 5 6 7 7 9 0 5 8 9 8 4 86 6 6 6 8 9 9 9 32 2 3 7 7 8 0 0 0 9 9 9 0 0 0 2 5 3 36 6 6 6 7 5 5 53 8 8 8 8 1 1 0 4 1 1 1 1 1 2 2 4 4 7 4 40 0 0 0 1 5 52 2 4 4 4 4 4 4 7 0 9 9 9 9 9 9 9 0 0 0 3 37 7 7 7 7 75 0 0 1 1 1 1 3 3 4 7 7 7 7 7 7 7 7 0 0 3 5 51 1 1 1 1 171718181818181818181819191919191919191020202020230203 0 0 5 6 5 5 7 2 7 1 6 9 6 0 8 0 0 0 4 4 1 9 0 1 4 8 791 0 3 8 2 9 0 1 8 6 7 9 3 5 3 6 7 9 6 6 3 9 7 6 1 6 7 900141610629494933731222325317473860505069799999408092454 76 6 6 6 8 9 9 9 3 3 8 8 8 8 1 1 0 4 1 1 1 1 1 1 2 4 43 36 6 6 6 7 5 5 5 2 2 4 4 4 4 4 4 7 0 9 9 9 9 9 9 9 07 4 40 0 0 0 1 5 5 5 0 0 1 1 1 1 3 3 4 7 7 7 7 7 7 70 0 3 37 7 7 7 7 7 7 7 8 8 8 8 8 8 8 8 8 9 9 9 9 9 97 0 0 3 5 51 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1919102020202021.558721r1 1 1 1 1 1 1 1 1 1 100hrchrchrchrchrchr r r r r r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r 0chchchchchchchchchchchchchchchchchchchchchchchchc2 / STPIg3838383hghghghgh077385149 413333731131 777 6793 3 302922626 821561 3 6337339 63013273763137 7792932230626 821222r2 3 3 3hrhrhr rc c chchc8383838383838383838383838383838383838 8 8 8 8 8 8 8 8 8 8 8g g g g g g g g g g g g g g g g g3 3 3 3 3 3 3 3 3 3 3 3h h h h h h h h h h h h h h h h hghghghghghghghghghghghghgh720838209762754715000934677 6 1 6 1 6 3 1 1 6 5 8 8 4 0 4 47 1 4 1 1 5 9 4 6 8 1 31 3 6 2 8 6 0 7 8 9 0 2 4 5 8 1 50 0 5 4 4 6 6 7 7 7 83 7 7 2 6 1 2 3 6 9 4 1 4 1 4 5 8 21 8 8 3 3 3 3 3 38 8 9 9 0 0 7 7 7 1 1 4 7 7 8 7 7 4 09 9 9 1 1 1 1 13 3 3 3 3 3 4 4 7 7 7 9 9 9 1 1 1 7 7 6 57 3 3 7 7 7 71 1 1 1 1 1 1 1 1 8 8 8 8 8 8 6 6 6 6 6 4 60 1 1 1 1 17 7 7 7 7 7 7 7 7 7 0 0 0 0 0 0 4 4 4 5 5 8 82 2 2 2 2 212121212121212121212122222222222222222222222222258233 1 0 3 1 6 7 2 6 8 7 2 4 0 5 9 0 9 4 8 6 3 5 3 1 6 3 065 8 6 7 3 3 2 6 2 2 5 0 2 0 6 4 3 8 4 8 6 8 1 3 7 4 0 401045041446964767771838387979205017272761810407471837578 21 8 8 3 3 3 3 3 3 3 3 3 3 3 3 4 4 7 7 7 9 9 9 1 1 1 74 09 9 9 1 1 1 1 1 1 1 1 1 1 1 1 1 1 8 8 8 8 8 8 6 6 67 6 57 3 3 7 7 7 7 7 7 7 7 7 7 7 7 7 7 0 0 0 0 0 0 46 6 4 60 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 2 2 2 2 24 4 5 5 8 82 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2222222222222221.558721r1 1 1 1 1 1 1 1 1 1 100hrchrchrchrchrchr r r r r r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r 0chchchchchchchchchchchchchchchchchchchchchchchchc2 / STPI83838 8 8g g3g3g3h h h hgh5750724 5683 220293931 2 29 9939398 8337 7 7131414141555 4 0 44400 8 98 9219173 3299 9 9898373 33131471471413r3 3hr r3r3rchchchchc838383838383838 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8g g g g g3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3h h h h hghghghghghghghghghghghghghghghghghghghghghghghghgh102 6 7 2 0 0 4 7 5 5 1 1 5 7 8 2 2 4 1 7 3 75 3 1 3 7 1 4336082171822624190025761728205891544719636307 547324549 8 60513132323232320065150505039151424387070436355 023 3 34353736849494949494969115293939334650707434747080 055252525252522 2 2 2 2 2 2 2 3 3 3 3 3 3 3 3 3 48 8612 2 2 2 2 22 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2163 4 2 5 3 4 3 4 4 4 7 4 4 7 7 9 2 9 6 4 9 0522 9 1 6 6 0 2 9 0 1 4 9 2 9 2 7 4 0 7 5 3 8138100475912206516112122262428005556565839081129277873 3 62023434343537363843943943943943940966911150290390399335464504708 0 04363552743474708080552525252525222222222222222223232323238623232323242 12222222222221.55871r1 1 1 1 1 1 1 1 1 1 1 10 0 0 0 0 0 0 0 0 0 0 0200hrchrchrchrchrchrchr r r r r r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r 0chchchchchchchchchchchchchchchchchchchchchchchc2 / STPI83838 8 8g g3g3g3h h h hgh8909620 0172 324449790 0 03 3141417 7447 7 7141414141166 6 7 51520 6 27 7303049 9031 1 1737474 44141471471413r3r3r3r3h hrc chchchc8383838383838 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8g g ghg3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3h h hghghghghghghghghghghghghghghghghghghghghghghghghghgh59211470741182180670457158939893572647215911349608599 3 9 94 5 7 2 2 3 3 7 2 3 3 5 6 8 8 0 2 4 5 4 0 2 2 98 5 1 04 4 4 5 5 5 5 5 6 6 6 6 6 6 6 7 7 7 7 2 4 58 2 4 5 8 83 3 3 4 4 4 4 4 7 7 7 7 7 7 7 7 7 7 7 75 4 7 8 1 1 1 63 3 3 3 3 3 3 3 4 4 4 4 4 4 4 4 4 47 9 9 1 1 1 4 4 4 42 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 24 1 1 1 1 2 2 2 7 7 7 72 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 22222323232326262627272727237106187617961751328211 0 3 7 7 7 2 9 2 6 7 0 2 9 6 7 2 9 04 5 7 1 2 2 3 7 21 3 8 4 9 1 4 9 0 8 9 3 6 6 7 4 4 9 94 4 4 5 5 5 52 3 5 5 7 8 9 2 4 4 4 0 1 2 8 8 2 4 5 6 73 3 3 4 45 6 6 6 6 6 6 6 6 7 7 7 2 4 5 5 4 7 8 1 1 1 63 3 34 4 4 7 7 7 7 7 7 7 7 7 7 7 7 7 9 9 1 1 1 4 4 4 423 3 3 3 3 4 4 4 4 4 4 4 4 4 4 4 1 1 1 1 2 2 2 7 7 7 7222222222222222222222222222222222222232323232626262727272721.5587010r10101010101010101010101010 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0200hrchrchrchrchrchrchr r r r r r r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r 0chchchchchchchchchchchchchchchchchchchchchchchc2 / STPI83838 8 8g g3g3g3h h h hgh3341208194 0615 4 5121324 4474 42424474747 71 1 1414171785 5 34 9849341 1 351 14 44 4242427 7447 7 71414141413r3 3 3 3hrhrhr rc c chchc8383838383838383838383838 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8g g g g g g g g g g g3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3h h h h h h h h h h hghghghghghghghghghghghghghghghghghghgh6078897119938223649 4 68 7 8 8 3 0 3 2 2 6 7 7 7 1 3 0 8 632 9 039390131410222019 1 3 14640636064915317596618556676475188119 0 1 49414161616161 4 2 6 3 35959503434353040404427272726363637356 4 5 4 5 5645494949494940707799999 060060801111111111112121212121212121101010101010101010101010101010101010472208654662688054824467 72256 4 3 0 3 6 2 2 7 1 0 9 7 0 8 4934 485934339492184564175563 6 0 2 8190121410212019910600497 3 5 7 0415416161616164425643535 59659503434343040404427272726363637345494949494940707799999 060060801111111111112121212121212121101010101010101010101010101010101011.5587010r101010101010101010 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0200hrchrchrchrchr r r r r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r 0chchchchchchchchchchchchchchchchchchchchchchchchchc2 / STPI83838 8 8g g3g3g3h h h hgh3508134427 8926 8 8020747471 1484 4 4585272721 1 1 1715825307956 8526 7 8020747471 1484 4 4585272721 1 1 1713r3r3r3r3h hrc chchchc83838383838383838383838383838383838 8 8 8 8 8 8 8 8 8 8 8 8g g g g g g g g g g g g g g g g g3 3 3 3 3 3 3 3 3 3 3 3 3h h h h h h h h h h h h h h h h hghghghghghghghghghghghghgh93373016731822760337259894653034978 9 0 9 8 3 3 1 0 2 1 8 53 4 6 0 2 6 3 5 5 8 9 8 9 7 7 1 16 0 2 4 8 7 9 0 9 3 0 6 57 7 7 8 8 8 4 4 3 0 0 6 0 1 2 0 07 4 8 1 4 6 7 9 9 2 1 2 03 3 3 3 3 3 8 8 7 4 4 5 6 3 3 4 40 1 1 5 4 4 4 4 4 6 9 9 42 2 2 2 2 2 2 2 7 2 2 4 8 1 1 1 14 5 5 3 9 9 9 9 9 9 4 4 61 1 1 1 1 1 1 1 1 2 2 9 6 7 7 7 71 5 5 7 5 5 5 5 5 5 9 9 10 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 17 7 7 7 8 8 8 8 8 8 0 0 21 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 111111111111111111111212121615408325173043310981296842827403 9 1 1 9 6 2 9 9 5 2 9 4 53 3 4 0 1 5 2 3 5 6 9 8 9 6 6 16 3 9 0 0 4 6 3 6 8 2 0 2 17 7 7 8 8 8 4 4 3 0 0 6 0 1 2 01 7 3 8 1 4 6 7 8 9 2 0 1 23 3 3 3 3 3 8 8 7 4 4 5 6 3 3 40 0 1 1 5 4 4 4 4 4 6 9 9 32 2 2 2 2 2 2 2 7 2 2 4 8 1 1 14 4 5 5 3 9 9 9 9 9 9 4 4 61 1 1 1 1 1 1 1 1 2 2 9 6 7 7 71 1 5 5 7 5 5 5 5 5 5 9 9 10 0 0 0 0 0 0 0 0 0 0 0 1 1 1 17 7 7 7 7 8 8 8 8 8 8 0 0 21 1 1 1 1 1 1 1 1 1 1 1 1 1 1 111111111111111111111112121211.5587010r101010101010 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0200hrchrchrchr r r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r 0chchchchchchchchchchchchchchchchchchchchchchchchchchc2 / STPI838 8 8 8g3g3g3 3h h hghgh54526 6 67338 9726823 5 6 6727040 0181 14141181317756945833738 2 82 250606717 4 4048181 1 11 13r3 4 4 4hrhrhr rc c chchc83838383838383838383838383838383838 8 8 8 8 8 8 8 8 8 8 8 8g g g g g g g g g g g g g ghg3 3 3 3 3 3 3 3 3 3 3 3 3h h h h h h h h h h h h h hghghghghghghghghghghghghghghgh173 7 6 0 8 1 9 51594637563293085999 6 1 5 625 8 9 4897094767832629495834853999611631627 4 2 3059001119 1 0 3 0 9 3 7 7 0 1 1 214056348484848482 3 2 35 0 9 6 1 8 8 4 4 5 5 5 521313777272727272 6 448 55 1 1 1 7 2 5 9 4 8 9 0 0 0 0 0 010464 9166666647771050329371818181818 82 2 2 2 3 3 3 3 31 1 1 1 1 1 2 2 2 2 3 3 3 3 31311 1 1 1 1 1 1 1 1 3727 1 6 0 4 3 2 710 4 51 2 2 9 455607246143874969 15 649243 806 2 4 6139327454842696884002589462405634848484848 7342 35900111951009360198381474051515151 2213137772727 7 7648056 591616167427519543899708080808080822 2 2 1 4 4112121213131313131 1616161717102022232131313131313131.5587010r1010101010101011111111111111 1 1 1 1 1 1 1 1 1 1 1 1 1 1200hrchrchrchrchrchrchrchr r r r r r r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r 0chchchchchchchchchchchchchchchchchchchchchchc2 / STPI838 8 8 8g3g3g3 3h h hghgh57807 9 94 5814273 3020 0 5525080 43131482472148118125124 4731 2 0232000 5535 808471314242144r4r4 4 4hr r rchchchchc83838383838383838383838383838 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8g g g g g g g g g g ghg3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3h h h h h h h h h h hghghghghghghghghghghghghghghghghghgh78877019443 4 2 0 9 0 8 7 7 4 5 6 0 0 5 9 5 5 9 5 7 3 1 6 12 5 94 7 2 1 6 4 9 2 2 4 9 4 1 3 1 0 1 1 5 8 7 0 1 1 750 4 0 1 2 4 5 6 8 3 6 8 4 0 9 3 2 4 7 9 9 9 5 9 5 1 70505060600202020202020252523372923383383040404066158 6 7 78 8 8 8 8 8 8 8 8 8 8 8 8 8 3 4 4 4 4 5 3 3 3 33 2 2 41 1 1 1 1 1 1 1 1 1 1 1 1 1 2 2 2 2 2 3 4 43 9 1 9 9 03 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 4 4 444446406262626566463710775280011298351894129455 8 9 9 3 2 0 5 5 5 0 2 1 2 32 5 8 9 3 9 1 2 3 4 6 7 30 1 7 8 0 7 1 9 3 5 4 0 0 8 65 5 5 5 6 9 0 0 0 05 2 9 0 8 2 2 3 7 8 9 3 5 9 9 0 70 0 0 0 0 1 2 20 0 5 5 3 6 9 3 8 3 3 4 4 4 6 1 8 5 7 78 8 8 8 8 82 2 2 2 2 2 3 2 2 3 3 8 0 0 0 0 6 5 3 2 2 41 1 1 18 8 8 8 8 8 8 8 3 4 4 4 4 5 3 3 3 3 3 9 1 9 9 03 3 3 313131313131313131313232323232334444444446406262626561.5587111r111111111111111111111111111111 1 1 1 1 1 1 1 1 1 1 1 1 1200hrchrchrchrchrchrchrchr r r r r r r r1r1r1r1r1r1r1r1r1r1r1r1r1r1r 0chchchchchchchchchchchchchchchchchchchchchchc2 / STPI838 8 8 8g3g3g3 3h h hghgh54758 5 11 1462 7080 171028888 8 81 1444444 4 8 84879643 9 70 1366610 0881 1 1888848 81414448448484r4r4r4r4hchchchrchc8383838383838383838383838 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8g g g g g g g ghg3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3h h h h h h h hghghghghghghghghghghghghghghghghghghghghgh608 0 58 7 5 352 0 6 5 0 1 8 55 6 4 9 9 2 0 0 3 9 1 6 81141242 52002932 67 5771587898700112 0770324277380330526 1 3 368561414 24566769 48 4665272727373737 361414141 1 1 0 62726023899302222 06470984 81456878787878787 5 9 9 94949195038999243526 7 7 70 1 1 2 3112121212126 5 8 8 9 9 211 1 1 2 4 4 4 4 4 5999097823 756 4 244 9 0 4 0 0 9 8632002932 63 47522868885080009520045681999925594940528511212 796934242 45066769 48 427655272727373737 306124124174184124191924613719609234856072727 64 0 881 5 8 8 8 8 8 85 9 9 9 9 9 9 0 8 9 2 3 207 9 4 4 6 7 7 7 7 7 73 1 1 1 1 1 6 5 8 8 9 91111121 1 2 2 2 2 2 2 4 4 4 4 4251.5587111r11111111111112121212121212121212 2 2 2 2 2 2 2 2 2 2 2 2200hrchrchrchrchrchrchrchrchr r r r r r r r1r1r1r1r1r1r1r1r1r1r1r1r1r 0chchchchchchchchchchchchchchchchchchchchchc2 / STPI83838 8 8g g3g3g3h h h hgh3692770 1168 377434911 2 03 6474701 0504 4 3111515171936 5 7 59975 1 95 9317124 1034 4 0160747 50111541531714r4r4r4r4h hrc chchchc8383838383838 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8g g ghg3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3h h hghghghghghghghghghghghghghghghghghghghghghghghghghgh68479923333414924381874239238567360995251855289463851 0 7 23 7 3 5 6 7 0 2 3 5 7 8 6 8 8 6 7 8 2 3 8 2 2 86 6 7 18 8 8 8 7 7 5 5 5 5 0 0 6 6 6 9 9 0 1 7 7 32 0 9 0 1 25 5 3 3 2 2 4 4 4 4 6 6 6 6 6 2 2 3 3 47 4 5 6 7 8 8 82 2 7 7 9 9 9 9 9 9 9 9 9 9 9 0 0 04 5 0 2 2 5 2 2 2 22 2 3 3 3 3 3 3 3 3 3 3 3 3 3 4 40 0 0 0 1 2 2 2 6 6 6 65 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 54545454545457575757575757537308622054389354967757 9 0 0 5 6 2 0 6 9 0 7 0 6 7 1 8 0 33 4 3 5 5 7 8 1 21 3 2 4 6 5 5 8 4 5 6 4 1 1 5 1 4 7 98 8 8 8 7 7 43 7 8 6 8 8 6 7 8 1 3 8 1 2 8 9 0 5 0 1 15 5 3 3 25 5 5 0 0 6 6 6 9 9 0 1 7 7 3 7 4 4 6 7 8 8 82 2 72 4 4 4 4 6 6 6 6 6 2 2 3 3 4 4 5 0 2 2 5 2 2 2 227 9 9 9 9 9 9 9 9 9 9 9 0 0 0 0 0 0 0 1 2 2 2 6 6 6 6525353535353535353535353535354545454545454545757575757575751.5587212r12121212121212121212121212 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2200hrchrchrchrchrchrchr r r r r r r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r 0chchchchchchchchchchchchchchchchchchchchchchchc2 / STPI838 8 8 8g3g3g3 3h h hghgh11928 9 78269 5554618 8 8 8515787 7373 181811719993789327 8264 5 6181878 8535 878787371 1 11 14r4 5 5 5hrhr r rc chchchc8383838383838383838383838383838 8 8 8 8 8 8 8 8 8 8 8 8 8 8g g g g g g g g g g g ghg3 3 3 3 3 3 3 3 3 3 3 3 3 3 3h h h h h h h h h h h hghghghghghghghghghghghghghghghghgh6029579779224 6 8 1 2 0 3 7 6 4 2 5 9 4 5 2 5 5 7 5 8 6 1 39 6 9 04 9 3 9 4 1 8 4 0 2 7 0 5 1 3 1 9 3 6 1 4 2 0 61 11 3 3 3 4 4 6 0 0 4 5 6 6 7 7 8 8 3 6 7 7 9 5 6 8 13 9940505050505050505524770707070707070709080808080878 8 96 1 1 1 1 1 1 1 1 1 1 8 5 2 2 2 2 2 2 2 2 2 7 7 77 7 77 2 3 3 3 3 3 3 3 3 3 4 9 5 5 5 5 5 5 5 5 5 07 2 2 2 25 6 6 6 6 6 6 6 6 6 6 6 6 7 7 7 7 7 7 7 7 7 8080808585858583848260289883218321679282804984 0 5 8 8 6 8 5 3 7 2 4 9 0 48 6 8 0 0 2 3 3 4 4 5 9 05 6 8 3 9 1 8 6 2 3 7 1 4 6 91 1 9 0 0 0 0 0 0 04 4 5 6 6 7 7 8 2 3 7 7 7 5 5 7 03 9 4 5 5 5 5 50 4 4 7 7 7 7 7 7 7 7 9 8 8 8 8 8 8 8 96 1 1 1 1 15 5 5 2 7 0 0 0 0 0 0 0 0 0 0 0 0 0 7 7 7 77 2 3 31 1 1 1 1 8 5 2 2 2 2 2 2 2 2 2 7 7 7 7 2 2 2 25 6 6 636363636363636469657575757575757575708080808585858581.5587212r121212121212121212121212121212 2 2 2 2 2 2 2 2 2 2 2 2 2200hrchrchrchrchrchrchrchr r r r r r r r1r1r1r1r1r1r1r1r1r1r1r1r1r1r 0chchchchchchchchchchchchchchchchchchchchchchc2 / STPI83838 8 8g g3g3g3h h h hgh4213376 3023 910628588 9 98 8474741 1 2 2726091250080 2329 0 2858849 98181742742725r5r5r5r5h hrc chchchc83838383838383838383838383838383838383838383838383838383838g g g g g g g g g g g g g g g g g g g g g g g g g g g3h h h h h h h h h h h h h h h h h h h h h h h h h h hghghgh67 35 8363933262763139165622 1 1 5 9 4 514821484928402802047799 27 6257565880074180 7 88142624565067661812606263920143464642 15 7777775748 0 09090908479798036361703034947476450292929298 0070702134134144144144144144146146145161010520 0 0 4 4 5 7 7 7 7 711 1 1 1 1 1 1 1 1 1 1 1 111313131 2 2 2 2 2 2 2 2 2 2 274 0 8 0 7 1 2 0 3 9 6 2 6 8 2 0 4 7 14 6 0 8 15 623287954850270189210861915235557539 06872 2 022912959948797 62 155 7757578708408080909084797980363696 1 12606263920042464648 0707775 024343444444444444646456101052 300349474764502929292910101111111111111111111111111313131 2020242425272727272721.5587212r1212121212121212121212 2 2 2 2 2 2 3 3 3 3 3 3 3 3 3 3 3200hrchrchrchrchrchr r r r r r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r 0chchchchchchchchchchchchchchchchchchchchchchchchc2 / STPI838 8 8 8g3g3g3 3h h hghgh46459 8 06 7480 3092 999995959 9 93 3535353234 0 1 96472 8 10 2898999 9959 9 93535353535r5 5 5 5hrhr r rc chchchc838383838383838383838383838383838383838383838 8 8 8 8 8 8 8g g g g g g g g g g g g g g g g g ghg3 3 3 3 3 3 3 3h h h h h h h h h h h h h h h h h hghghghghghghghghghghgh5815284398093077451928267 9 8 6 1 5 2 0 0 9 1 6 0 5 8 0 2 74 5 6 0 1 2 5 6 52 6 0 7 5 3 1 7 8 2 4 5 0 5 2 8 1 60 0 0 1 1 3 38 8 1 0 0 1 2 3 4 6 6 0 1 3 8 0 3 7 7 8 87 7 7 73 7 7 9 0 3 3 3 3 3 3 3 3 6 6 6 6 2 2 2 2 2 39 92 4 4 4 4 4 2 3 3 3 3 3 3 3 3 3 9 9 9 9 0 0 0 0 0 07 7974529808080828267676767676767676767585858587474747 7 72 2 2 3 4 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 7 7 7 7 9 9 94949496710374196773595430724291154298150659 3 7 1 0 4 9 7 9 2 5 24 5 6 0 1 2 4 6 5 8 2 8 0 0 0 25 5 3 0 3 2 6 2 0 5 9 40 0 0 1 1 3 3 3 7 7 9 9 33 3 5 6 0 1 3 8 9 3 7 7 7 87 7 7 7 2 4 4 4 4 4 23 3 3 3 3 3 3 6 6 6 6 1 2 2 2 2 39 9 9 4 2 8 8 82 3 3 3 3 3 3 3 3 9 9 9 9 0 0 0 0 0 07 7 7 5 9 08 8 6 6 6 6 6 6 6 6 6 6 5 5 5 5 7 7 7 7 7 72 2 2 3 4 50505252575757575757575757575878787874949494949491.5587313r13131313131313131313131313131313 3 3 3 3 3 3 3 3 3 3 3 3200hrchrchrchrchrchrchrchrchr r r r r r r r1r1r1r1r1r1r1r1r1r1r1r1r1r 0chchchchchchchchchchchchchchchchchchchchchc2 / STPI83838 8 8g g3g3g3h h h hgh08230366376524 5 5959 3 3 33 2737 225222555555638 0 1022 8 2 45 39535353392 2 2737 252 2555555r5r5r5r5h h hrc c chchc838383838383838383838383838383838383838383838 8 8 8 8 8 8 8g g g g g g g g g g g g g g g g g g g g3 3 3 3 3 3 3 3h h h h h h h h h h h h h h h h h h h hghghghghghghghghghgh354721936483 0 9 8 3 0 0 6 4 5 0 6 01232425225427921671 6 39 683764058620041232198945 8 6 6358878729519506265415849 0 7 9 5 80 677989898999 9657575857686969696304074 5 5 5 6 7575753 3 0 0 0 6 6 6 64 499999999999 8002020202020202020212123 3 334342626267878787811111111111111111111111 2 2 2 2 2 2 2 2 2 2 2 2647 2 8 6 40 5 8 7 0 6 6 7 5 8 8 65 79659718321621744844882839112887925 9 8819924108530257644043 8 7 7 9518595264454849405759 5 80 7 596575757566869696963040 5 6 7749898989994 799999999999 800202020202020202021212 57357533330202026767676711111111111111111111111 232324242626262828282821.5587313r131313131313131313131313 3 3 3 3 4 4 4 4 4 4 4 4 4 4 4 4200hrchrchrchrchrchrchr r r r r r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r 0chchchchchchchchchchchchchchchchchchchchchchchc2 / STPI838 8 8 8g3g3g3 3h h hghgh95355 3 79 5159590 2538 8 2232262 33737767767779978307318 4805 5 5323828 2232 626367377777775r5r5 5 5hr r rchchchchc83838383838383838383838383838 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8g g g g g g g g g g ghg3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3h h h h h h h h h h hghghghghghghghghghghghghghghghghghgh40629198576 5 2 5 2 8 1 0 0 5 4 9 5 6 6 3 0 4 3 2 6 6 5 9 49 0 17 3 9 3 3 0 8 4 4 0 7 4 5 8 3 6 7 0 6 4 9 9 4 7 471 2 3 4 5 4 2 7 9 6 1 5 5 8 0 1 8 8 6 7 7 0 5 6 7 0 96868686868686584050611222324245455555657585858516666 6 7 97 7 7 7 7 7 7 7 5 5 5 5 5 5 5 6 6 6 6 6 6 6 6 66 6 6 08 8 8 8 8 8 8 8 6 6 6 6 6 6 6 6 6 6 6 6 6 66 6 6 6 6 22 2 2 2 2 2 2 2 3 3 3 3 3 3 3 3 3 3 3 3 3 363636363636363830871088436356836922739854702191 3 4 9 7 3 1 3 9 4 9 4 4 3 58 0 0 1 2 3 3 5 4 1 6 9 50 1 1 3 0 8 1 9 4 4 4 5 1 5 07 8 8 8 8 8 8 5 4 51 4 4 8 0 1 7 3 5 6 7 9 5 6 7 0 96 6 6 6 6 6 6 86 1 2 3 4 4 4 5 5 6 7 8 8 8 0 6 6 6 7 97 7 7 7 7 70 0 1 2 2 2 2 5 5 5 5 5 5 5 5 5 6 6 6 6 6 08 8 8 87 7 5 5 5 5 5 5 5 6 6 6 6 6 6 6 6 6 6 6 6 6 6 22 2 2 282828282636363636363636363636363636363636363636363831.5587414r141414141414141414141414141414 4 4 4 4 4 4 4 4 4 4 4 4 4200hrchrchrchrchrchrchrchr r r r r r r r1r1r1r1r1r1r1r1r1r1r1r1r1r1r 0chchchchchchchchchchchchchchchchchchchchchchc2 / STPI838 8 8 8g3g3g3 3h h hghgh8582 4 1 69 34378 605225676 98 809 98888 302303121212386 4 19104378 68517848676 9 9 98 0888 302303121215r5 5 5 5hrhr r rc chchchc8383838383838383838 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8g g g g g ghg3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3h h h h h hghghghghghghghghghghghghghghghghghghghghghghgh244 4 2 8 0 9 9 0 6 6 1 4 5 4 9 5 4 3 0 2 3 4 9 5 8 7 9 5 3081451904847083647416312657773335094908597911712598195 0 50 0 0 0 1 1 5 6 4 4 4 5 5 8 8 9 4 7 7 8 8 8 9 9 99 1 31 1 1 1 1 1 5 5 9 9 9 9 9 9 9 9 0 0 0 0 0 0 09 9 9 0 02 2 2 2 2 2 2 2 7 7 7 7 7 7 7 7 8 8 8 8 80 0 0 0 0 1 18 8 8 8 8 8 8 8 6 6 6 6 6 6 6 6 6 6 68 8 8 8 8 8 8 8 83 3 3 3 3 3 3 3 5 5 5 5 5 5 5 5 5 5 565656565656565656565658737412488850594535659108 3 4 1 9 8 0 5 5 9 5 8 6 7 0 9 8 29 1 5 8 3 4 0 3 4 41 4 6 1 4 9 1 6 1 5 0 5 1 8 0 1 3 39 0 0 0 1 1 5 55 1 6 7 7 3 4 8 9 7 9 9 1 1 5 8 9 9 0 30 1 1 1 1 14 4 4 5 5 8 8 9 4 7 7 8 8 8 9 9 9 9 9 9 0 02 2 2 25 5 9 9 9 9 9 9 9 9 0 0 0 0 0 0 0 0 0 0 0 0 1 18 82 2 2 2 7 7 7 7 7 7 7 7 8 8 8 8 8 8 8 8 8 8 8 8 8 83 3838383838383656565656565656565656565656565656565656565651.5587414r1414141414141414141414141414 4 4 4 4 4 4 4 4 4 4 4 4 4 4200hrchrchrchrchrchrchrchr r r r r r r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r 0chchchchchchchchchchchchchchchchchchchchchchc2 / STPI83838 8 8g g3g3g3h h h hgh8196469 0888 243543048 8 80 0878785 5730 0 0131414141496 3 5 67489 3 98 0183833 4808 8 8505707 73131401401415r5r5r5r5h hrc chchchc8383838383838 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8g g ghg3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3h h hghghghghghghghghghghghghghghghghghghghghghghghghghgh95011747040683041695045192040876615308788056463093701 1 4 13 2 3 0 1 4 8 1 1 1 3 8 8 5 6 8 4 5 5 6 7 7 9 63 7 4 11 2 2 7 7 7 7 6 6 7 7 8 9 0 0 0 1 1 5 5 5 57 9 1 0 1 31 1 1 1 1 1 1 8 8 0 0 0 0 1 1 1 1 1 1 15 7 7 7 8 2 2 28 8 8 8 8 8 8 4 4 5 5 5 5 5 5 5 5 51 1 1 3 3 3 3 4 4 46 6 6 6 6 6 6 0 0 0 0 0 0 0 0 0 05 5 5 5 5 6 6 6 6 6 6 65 5 5 5 5 5 5 6 6 6 6 6 6 6 6 6 60606060606060606060606060623639033534101902550129 0 6 5 0 9 2 9 9 1 5 0 8 4 9 8 5 0 72 1 3 0 1 4 8 1 12 1 7 4 5 0 3 5 4 9 4 9 6 3 8 3 5 2 31 2 2 7 7 7 71 3 7 8 4 6 8 4 4 5 6 6 7 8 5 7 8 9 0 1 21 1 1 1 16 6 7 7 8 9 0 0 0 1 1 5 5 5 5 5 7 7 7 7 2 2 28 8 81 1 8 8 0 0 0 0 1 1 1 1 1 1 1 1 1 1 3 3 3 3 4 4 468 8 8 8 4 4 5 5 5 5 5 5 5 5 5 5 5 5 5 5 6 6 6 6 6 6 6565656565656506060606060606060606060606060606060606060606061.5587414r14141414141414141414141414 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4200hrchrchrchrchrchrchr r r r r r r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r 0chchchchchchchchchchchchchchchchchchchchchchchc2 / STPI83838 8 8g g3g3g3h h h hgh1292576 5297 283648499 9 91 1141411 1 144 41 11 1414141697 5 8 5186125 3984 939491911 1 11 1414144 411 14141415r5r5 5 5hr r rchchchchc8383838383838383838 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8g g g g g g g3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3h h h h h h hghghghghghghghghghghghghghghghghghghghghghghgh9106838 5 8 6 6 6 2 9 9 8 5 0 5 8 3 14 6 6 8 0 4 6 72 1 8424 527186022735446660708482407033332 6139174980042415 3840694242424243434345555957878781717373747 7265758847474747 7 8 960606060606060606060477373737474747 77041411 6323232323 969786 6 6 6 6 6 6 6 6 6 7 9 9 9 9 9 949490 0 0 0 6 6 611 1 101010101 2 2 38952980283109452882786099 4 8 7 1 1 84 6 3 3 5 8 6 53 1 43 4 49 3 8 4 6 1 18619963960730474 1 1 1242 2727203133335556967778731612333246 8 0 964064646464646465656548787877777777777 2675758847474747 7686976060606060606060606773939394949494949 0401411323232323 969686101010101010101 2 2 31.5587414r1414141414141414141414 4 4 4 4 4 4 4 4 4 4 4 4 4 4 5 5 5200hrchrchrchrchrchr r r r r r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r 0chchchchchchchchchchchchchchchchchchchchchchchchc2 / STPI83838 8 8g g3g3g3h h h hgh8330866 2803 111793133 6 74 4434321 1546 6 0141414151278 8 6 17321 1 70 1138593 3744 4 2141363 54141461401515r5r5r5r5h hrc chchchc8383838383838 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8g g ghg3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3h h hghghghghghghghghghghghghghghghghghghghghghghghghghgh99462250743031307074108073370924193537346927817435076 8 7 91 6 3 4 5 7 3 8 0 2 4 8 9 8 8 9 0 9 1 2 4 1 6 94 7 4 96 6 5 5 5 5 3 5 5 6 6 6 6 9 9 9 0 1 9 4 8 81 5 7 9 1 21 1 3 3 3 3 8 0 6 2 2 2 2 2 2 2 3 3 4 38 9 0 0 0 2 7 31 1 1 1 1 1 7 8 0 8 8 8 8 8 8 8 8 35 3 3 3 4 4 4 4 9 35 5 5 5 5 5 2 2 8 7 7 7 7 7 7 7 72 1 3 3 3 3 3 3 3 3 4 44 4 4 4 4 4 5 5 5 6 6 6 6 6 6 6 68637475767676767676767879719277005935318187632567 6 8 3 8 1 2 2 6 5 0 8 1 3 1 4 8 6 01 5 3 3 5 6 2 7 98 2 5 8 0 8 5 7 9 9 0 5 6 7 6 1 6 4 56 6 5 5 5 5 32 3 7 9 8 8 9 0 9 1 1 4 1 2 8 0 4 6 7 1 21 1 3 3 35 4 6 6 6 6 9 9 9 0 1 9 4 8 8 8 9 0 0 0 2 7 31 1 13 8 0 6 2 2 2 2 2 2 2 3 3 4 3 5 3 3 3 4 4 4 4 9 351 1 1 7 8 0 8 8 8 8 8 8 8 8 3 2 1 3 3 3 3 3 3 3 3 4 4454545454542525857676767676767676863747576767676767676787971.5587515r15151515151515151515151515 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5200hrchrchrchrchrchrchr r r r r r r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r 0chchchchchchchchchchchchchchchchchchchchchchchc2 / STPI838 8 8 8g3g3g3 3h h hghgh79532 1 5818928168828632227 7 83 3313137 711 15822480 5889 948952827 8 32732 3738373 1 1 11715r5r6 6 6hr r rchchchchc838383838383838383838383838 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8g g g g g g g g ghg3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3h h h h h h h h hghghghghghghghghghghghghghghghghghghghgh54225 5 0 0 3 2 9 8 5 4 4 2 7 0 3 1 2 0 6 3 1 49 0 0 5 920 775533255934031527295575002927354476951339 78082402372 04 6 0 9 6 6 8 9 9 9 9 9 9 0 4 4 4 4 0 5 6 6670572 0 7 7 0 0 0 0 0 0 0 0 0 1 1 1 1717274850 99 6 3 3 4 4 4 4 4 4 4 4 4 4 8 818186 6 6 6 6 6 64 8 9 9 9 9 9 9 9 9 93 3 3 3 3 51313131384 58 8 8 8 8 8 8 8 8 8 89898989898989869696969691344310157790386408204869538173 8 3 2 7 4 3 2 8 71 5 0 4 880 7 5 9 1 4 28 6 5 4 0 3 9 2 7 48971691372 34 6 0 8 6 6 898192 2 4 6 9 1 2 3 4 7 9 0 3 6 0 229 9 9 9 9 4 4 4 4 0 5 6 6 7 50717174850 99046737304040404040404040404181818186363636363651 6888989898989898989898989898989898986969696969 313131384 5131.5587515r1515151515151515151515151515151515 5 5 5 5 6 6 6 6 6 6 6200hrchrchrchrchrchrchrchrchr r r r r r r r r1r1r1r1r1r1r1r1r1r1r1r1r 0chchchchchchchchchchchchchchchchchchchchchc2 / STPI838 8 8 8g3g3g3 3h h hghgh4955345 16289714042 180002606 4808810217149550 653640341040 27218800 0 86 6 408 2101716r6r6 6 6h hrhrhrc c c chc83838383838383838383838383838383838 8 8 8 8 8 8 8 8 8 8 8 8g g g g g g g g g g g g g ghg3 3 3 3 3 3 3 3 3 3 3 3 3h h h h h h h h h h h h h hghghghghghghghghghghghghghghgh99828147112068983 7 7 6 6 9 6 6 3 9 9 2 9 9 5 8 6 7 4 9 9 58 6 5 1 23 0 1 7 8 5 3 4 5 6 6 6 7 4 1 6 0 8 3 9 7 47 8 95 0 3 4 5 7 2 4 5 6 5 7 6 6 0 9 1 9 0 7 8 3 3 9 47 7 4354588989898989809090909191963739203131323798797973 52 2 1 1 1 2 2 2 2 2 2 2 2 2 2 2 2 9 9 3 3 3 3 3 1 56 69 9 1 1 1 4 4 4 4 4 4 4 4 4 4 4 4 4 4 5 5 5 5 55 5 1 14 4 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5856666667676386090654078622632349758526200329 9 9 9 1 6 3 8 1 7 6 3 9 98 6 5 1 2 3 0 2 4 4 6 1 4 50 3 3 4 3 9 0 3 6 4 5 6 7 87 8 9 3 4 8 9 9 9 9 96 5 7 3 0 0 9 0 9 0 3 8 9 3 1 37 7 4 5 5 8 8 8 80 0 0 0 1 1 6 7 9 0 1 1 2 7 8 8 9 3 52 2 1 1 1 2 28 8 9 9 9 9 9 9 3 3 2 3 3 3 3 9 7 7 7 6 69 9 1 1 12 2 2 2 2 2 2 2 2 2 9 9 3 3 3 3 3 1 5 5 5 1 14 4 5 5 5454545454545454545454545454555555555558566666676761.5587616r161616161616161616161616161616 6 6 6 6 6 6 6 6 6 6 6 6 6200hrchrchrchrchrchrchrchr r r r r r r r1r1r1r1r1r1r1r1r1r1r1r1r1r1r 0chchchchchchchchchchchchchchchchchchchchchchc2 / STPI838 8 8 8g3g3g3 3h h hghgh33336 8 06 2366610 8888 8 4602858 17282157137372560829 9502 656978808 8 46 2858517 832 21717376r6hr6r6r6rchchchchc838383838383838383838383838 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8g g g g g g g g g ghg3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3h h h h h h h h h hghghghghghghghghghghghghghghghghghghgh392608356 0 2 9 1 7 4 24 81 1 8 3 3 8 6 7 9 9 4 2 4 8 5 04 8 9 43081076263937942 4657 58383297347556867831628203472935 5 5 1 3 3 4 1 1 1 3 9 4 1 7 9 1 9 0 0 0 2 2 2 2 206 6 6 8 6 6 0 1 1 1 1 7 79796 1 5 4 4 3 4 4 4 42 31 1 1 4 0 0 5 5 5 5 5 5 2 7 1 4 6 9 9 9 9 94 4 4 4 4 47 7 7 0 3 3 6 6 6 6 6 6 05057 8 4 5 6 69 9 9 9 9 96 6 6 7 7 7 8 8 8 8 8 8 1 2 3 3 3 363636363636363636363267273253485163554099622 4 205198 6 2 6 1 8 3 6 8 6 0 0 7 64 7 9 4 9 1 6 2 3 3 3857 0 6 0 1 5 6 5 8 1 6 9 3 1 15 5 5 1 2 3 4 1 19 8 8 7 9 7 4 5 5 6 8 0 2 2 2 7 9 06 6 6 8 61 3 86979 4 1 6 9 1 9 0 0 0 2 2 2 2 2 2 31 1 1 4 06 0 1 1 1 1 7 6 1 5 4 4 3 4 4 4 4 4 4 4 4 4 470 5 5 5 5 5 50505 2 7 1 4 6 9 9 9 9 9 9 9 9 9 9 967676073737686868686868718243536363636363636363636363631.5587616r161616161616161616161717171717 7 7 7 7 7 7 7 7 7 7 7 7 7200hrchrchrchrchrchrchrchr r r r r r r r1r1r1r1r1r1r1r1r1r1r1r1r1r1r 0chchchchchchchchchchchchchchchchchchchchchchc2 / STPI838 8 8 8g3g3g3 3h h hghgh9550 2 5 53 99927 887990848 67 946 68989 040040101016408 6 53939827 87795709848 6 6 68 4989 040040101016r6 6 6 6hrhr r rc chchchc8383838383838383838 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8g g g g g ghg3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3h h h h h hghghghghghghghghghghghghghghghghghghghghghghgh183 3 9 8 1 5 2 1 8 5 0 3 1 8 1 1 3 7 7 4 5 5 6 6 0 0 2 4 9086275536070030313353997386380090034851932600166456105 6 53 3 1 5 9 1 2 8 2 2 2 3 8 8 8 9 9 9 9 0 2 2 7 4 77 1 24 4 6 6 1 3 4 4 9 9 9 3 1 1 1 1 1 1 1 2 2 2 27 8 9 0 09 9 5 1 8 8 5 5 5 5 5 6 7 7 7 7 7 7 7 7 73 4 4 4 4 5 56 6 8 9 6 7 8 8 8 8 8 8 8 8 8 8 8 8 87 7 7 7 7 7 7 7 73 3 3 3 4 4 4 4 4 4 4 4 4 4 4 4 4 4 484848484848484848484842557099781815650326184013 9 2 3 0 3 8 7 0 6 6 4 5 0 9 4 1 80 5 6 4 6 4 5 0 1 36 1 4 7 8 9 0 0 6 9 8 8 4 6 0 6 4 03 3 1 4 9 1 1 83 7 3 6 7 8 0 2 8 1 3 4 9 5 4 5 9 6 1 24 4 6 6 1 32 2 2 3 8 8 8 8 9 9 9 0 2 2 6 4 7 7 7 9 0 09 9 5 14 4 9 9 9 3 1 1 1 1 1 1 1 2 2 2 2 3 4 4 4 4 5 56 68 8 5 5 5 5 5 6 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 73 3839364748484848484848484848484848484848484848484848484841.5587717r1717171717171717171717171717 7 7 7 7 7 7 7 7 7 7 7 7 7 7200hrchrchrchrchrchrchrchr r r r r r r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r 0chchchchchchchchchchchchchchchchchchchchchchc2 / STPI83838 8 8g g3g3g3h h h hgh9904283 0174 566296760 9 91 1428888 8803 3 3101313131360 1 3 11931 4 17 7506996 6914 8 8818238 80101331331316r6r6r6r6h hrc chchchc8383838383838 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8g g ghg3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3h h hghghghghghghghghghghghghghghghghghghghghghghghghghgh45976510685592095154513900772648248721896100004209687 8 4 30 7 9 2 2 9 1 7 8 0 4 5 8 7 8 3 7 9 2 4 5 8 9 43 8 4 90 4 4 5 5 2 3 5 5 6 8 1 1 5 5 8 1 1 2 2 2 24 6 7 7 8 87 6 6 6 6 7 7 9 9 9 9 0 0 0 0 0 5 5 5 52 4 4 4 4 4 4 44 9 9 9 9 9 9 3 3 3 3 4 4 4 4 4 4 45 5 5 5 5 5 5 5 5 59 9 9 9 9 9 9 1 1 1 1 1 1 1 1 1 14 4 4 4 4 4 4 4 4 4 4 44 4 4 4 4 4 4 6 6 6 6 6 6 6 6 6 61616161616161616161616161653361968800170773920309 8 5 3 0 4 5 7 1 1 3 2 4 7 9 7 4 6 60 7 8 1 2 9 1 7 77 7 5 5 6 2 0 0 8 0 7 2 7 7 6 9 7 3 50 4 4 5 5 2 30 4 5 7 7 8 3 6 9 2 4 5 7 8 3 4 6 6 7 8 87 6 6 6 65 5 6 8 1 1 5 5 8 1 1 2 2 2 2 2 4 4 4 4 4 4 44 9 97 7 9 9 9 9 0 0 0 0 0 5 5 5 5 5 5 5 5 5 5 5 5 5 599 9 9 9 3 3 3 3 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4494949494949416161616161616161616161616161616161616161616161.5587717r17171717171717171717171717 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7200hrchrchrchrchrchrchr r r r r r r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r 0chchchchchchchchchchchchchchchchchchchchchchchc2 / STPI838 8 8 8g3g3g3 3h h hghgh71856 6 80836 3242693 2 2 2494444 4737 848481310913540928 6023 3 6939242 2474 444443738 8 81 16r6 7 7 7hrhr r rc chchchc8383838383838383838383838383838 8 8 8 8 8 8 8 8 8 8 8 8 8 8g g g g g g g g g g g ghg3 3 3 3 3 3 3 3 3 3 3 3 3 3 3h h h h h h h h h h h hghghghghghghghghghghghghghghghghgh4843665143669 5 2 5 1 7 3 5 6 9 2 6 7 3 5 8 7 7 4 0 5 5 3 79 0 4 41 6 1 1 2 9 4 4 1 6 1 5 9 0 5 1 3 3 9 1 2 3 9 44 55 5 6 6 7 8 1 1 2 4 8 5 9 1 1 0 5 7 7 1 1 6 0 0 0 15 5556565656565656575757575756673101361616161711735456 8 84 4 4 4 4 4 4 4 4 4 4 4 4 4 4 9 2 7 8 1 1 1 1 1 61 4 41 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 3 3 3 2 2 2 27 7 8 6 66 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 7 7 7 7274757579718180052771941040894969415271260298 1 8 6 6 2 4 6 0 0 3 9 3 6 79 0 3 3 5 5 5 6 6 7 0 1 26 1 2 9 8 9 8 2 0 6 9 8 9 7 14 5 5 6 6 6 6 6 6 64 7 5 9 1 1 9 4 6 7 1 1 5 9 9 0 15 5 5 5 5 5 5 57 7 7 7 7 6 7 1 1 5 6 6 6 7 1 3 3 5 8 84 4 4 4 4 45 5 5 5 5 5 5 6 3 0 3 1 1 1 1 1 7 5 5 1 4 41 1 1 14 4 4 4 4 4 4 4 4 9 2 7 8 1 1 1 1 1 6 7 7 8 6 66 6 6 616161616161616161616161636363627272727274757579718181.5587717r171717171717171717171717171717 7 7 7 7 7 7 7 7 7 7 7 7 7200hrchrchrchrchrchrchrchr r r r r r r r1r1r1r1r1r1r1r1r1r1r1r1r1r1r 0chchchchchchchchchchchchchchchchchchchchchchc2 / STPI838 8 8 8g3g3g3 3h h hghgh09985 5 47 3788634 4282 3 0782424 50242722722726693868 6749 895818382 3 07 2424250 422 27272727r7hr7r7r7rchchchchc838383838383838383838383838 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8g g g g g g g g ghg3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3h h h h h h h h hghghghghghghghghghghghghghghghghghghghgh9401 8 5 3036 6 0 9 2 0 8 7 3 2 8 6 5 1 9 7 4 6 4 0 8 9 9 73 5 9469885569306270316306258047517571848983920516579210 58 8 2 2 8 8 8 8 5 9 9 7 8 8 8 8 8 8 8 8 9 9 0 0 15 24 4 6980943 3 4 4 4 9 6 5 4 4 4 4 4 4 4 4 4 42 86 6 0 0 1 1 1 1 1 1 3 2 2 2 2 2 2 2 2 2424 5 5 6 6 61 1 1568790 0 1 1 1 5 2 5 5 7 7 7 7 72 2 2 2 2 98 8 1 1 1 1 1 1 2 2 2 4 4 4 4 474747474747474747474053258 9 2 21380241912388773069338251 5 7 3 8 4 2 5 0 3 9 9 63 4 4449884 6 3 5 7 2 58 4 8 4 6 1 1 9 4 6 9 8 08 8 2 2 8 8 8 8 50 2 8 3 5 6 7 7 8 8 9 0 0 5 9 0 4 94 4 6980943 39 9 7 8 8 8 8 8 8 8 8 9 9 0 0 1 2 76161818 56879 000414141916151434242424242424242424242525262626910111111151225252747474747474747474747474747474051.5587717r181818181818181818181818181818 8 8 8 8 8 8 8 8 8 8 8 8 8200hrchrchrchrchrchrchrchr r r r r r r r1r1r1r1r1r1r1r1r1r1r1r1r1r1r 0chchchchchchchchchchchchchchchchchchchchchchc2 / STPI838 8 8 8g3g3g3 3h h hghgh17285 2 50 1443 0363 253377670 0 02 2070703 3 9 97974288 2 40 0240583 3262 3 7767000 02323709709797r7r7r7r7hchchchrchc8383838383838383838383838 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8g g g g g g g ghg3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3h h h h h h h hghghghghghghghghghghghghghghghghghghghghgh21610 5 2 35 4 5 4 02 1 6 0 5 8 4 1 9 1 4 5 6 8 5 8 5 4 83 807758305 5627419124 908243851677201606778215244340938 2 74 8 8 4 9 7 4 4 4 4 4 4 5 5 9 2 3 3 8 0 3 0899995 2 4 7 6 8 19198989891 1 1 1 1 9 9 5 9 2 393 4 6 2 8 0 5 5 5 5 5 1 1 5 0 1 232247 1 4 2 2 27 7 7 9 2 7 22224949490 0 0 0 0 28 9 5 5 5 55 5 5 5 7 7 1 1 1 1 1 121213151515151818191929292693089825669 6 4 9 3 8176514363895115 9 0 5 6 4 6 4 3 5 6 02 8 4 5 3 4 4617215104 8 3 7 3 4 5 3 4 9 2 9 64 8 8 4 9 704243 5 5 7 0 5 2 7 2 4 1 3 0 3 8 8 95 1919898989 4 4 4 4 5 5 9 2 3 3 8 0 3 0 9 9 93274467268802 1 1 1 1 1 9 9 5 9 2 3 3 2 7 1 4 2 2 257575952777 222494949 505 5 5 5 1 1 5 0 1 2 2 4 8 9 5 5 5 510101010121212131515151518181919292921.5587818r18181818191919191919191919191919 9 9 9 9 9 9 9 9 9 9 9 9200hrchrchrchrchrchrchrchrchr r r r r r r r1r1r1r1r1r1r1r1r1r1r1r1r1r 0chchchchchchchchchchchchchchchchchchchchchc2 / STPI838 8 8 8g3g3g3 3h h hghgh9418 1 7 84 71421 027449020 07 130 17979 232232121218394 9 34641421 06732791020 0 0 17 3979 232232121217r7 7 7 7hrhr r rc chchchc8383838383838383838 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8g g g g g ghg3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3h h h h h hghghghghghghghghghghghghghghghghghghghghghghgh935 7 3 6 3 3 8 6 2 1 3 5 9 2 5 8 1 2 2 3 5 2 9 2 1 8 9 5 1080017239228215562794841202438304946678800355563700235 1 10 0 0 0 1 8 5 5 1 6 5 4 4 2 2 2 2 2 5 5 6 6 6 6 63 4 93 3 3 3 5 8 0 0 2 5 9 6 1 5 5 5 5 5 8 9 9 9 97 5 5 5 55 5 5 5 3 0 9 9 4 2 3 2 6 1 1 1 1 1 3 3 39 9 9 1 1 1 19 9 9 9 1 3 4 4 6 8 8 9 0 5 5 5 5 5 53 3 3 3 3 8 8 8 82 2 2 2 3 3 3 3 3 3 3 3 4 4 4 4 4 4 454545454545454545454548257984352223670346007155 4 6 3 0 5 2 8 9 5 3 5 1 3 8 0 8 20 0 0 2 9 2 2 5 6 70 6 1 7 9 8 2 5 5 4 2 4 0 8 0 4 7 30 0 0 0 1 8 5 54 4 3 1 3 3 3 4 6 8 0 2 5 6 7 9 3 3 3 83 3 3 3 5 81 6 5 4 3 2 2 2 2 2 5 5 6 6 6 6 6 6 5 5 5 55 5 5 50 0 2 5 9 6 1 5 5 5 5 5 8 9 9 9 9 9 9 9 1 1 1 19 93 0 9 9 4 2 3 2 6 1 1 1 1 1 3 3 3 3 3 3 3 3 8 8 8 82 2929213334343638383930454545454545454545454545454545454541.5587919r1919191919191919191919191919 9 9 9 9 9 9 9 9 9 9 9 9 9 9200hrchrchrchrchrchrchrchr r r r r r r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r 0chchchchchchchchchchchchchchchchchchchchchchc2 / STPI83838 8 8g g3g3g3h h h hgh6357662 1855 869231874 6 79 7298888 9822 3 3121515151700 5 9 18753 4 15 8849631 7792 8 8879928 82121531531517r7r7r7r7h hrc chchchc8383838383838 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8g g ghg3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3h h hghghghghghghghghghghghghghghghghghghghghghghghghghgh41091538447529224972947800348605737206133940672821895 4 4 57 9 2 2 4 5 6 7 7 8 9 9 0 1 1 5 5 6 6 7 8 1 2 54 4 9 93 3 4 4 4 4 4 4 4 8 8 8 9 9 9 9 9 9 9 9 9 98 9 0 2 5 81 9 9 9 9 9 9 9 9 4 4 4 4 4 4 4 1 1 1 19 3 3 5 6 6 6 44 4 4 4 4 4 4 4 4 6 6 6 6 6 6 6 7 71 4 4 5 5 3 3 3 3 56 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 17 7 7 9 9 4 4 5 5 5 5 24 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 51515151515152525252525253545083085628377218779614 4 2 8 3 0 4 1 2 6 7 4 8 8 5 9 1 0 63 1 2 2 4 5 6 7 77 9 3 5 4 2 1 5 6 5 6 9 6 9 6 3 8 5 83 3 4 4 4 4 47 9 9 9 1 1 5 5 6 6 6 8 0 1 5 7 9 0 1 5 81 9 9 9 94 4 8 8 8 8 9 9 9 9 9 9 9 9 9 9 3 3 5 6 6 6 44 4 49 9 9 9 4 4 4 4 4 4 4 1 1 1 1 1 4 4 5 5 3 3 3 3 564 4 4 4 4 4 6 6 6 6 6 6 6 7 7 7 7 7 9 9 4 4 5 5 5 5 2464646464646464646464646464646415151515151515252525252525351.5587919r19191919191919191919191919 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9200hrchrchrchrchrchrchr r r r r r r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r1r 0chchchchchchchchchchchchchchchchchchchchchchchc2 / STPI838 8 8 8g3g3g3 3h h hghgh7541158 68124571203050608607 68168165151 1 1116709 4 7028 2 0 87 11203040608607 68 816 65151 111117r7 8 8 8hr r r rchchchchc83838383838383838 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8g g g ghg3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3h h h hghghghghghghghghghghghghghghghghghghghghghghghghgh612800950266334498878312195258446688634706437090 1428 1 9 32 5 8 0 1 1 2 5 2 1 8 3 3 5 8 0 7 7 0 8 4 6 17 8 3 2 98 8 1 2 2 2 2 2 7 1 1 6 6 6 6 7 3 3 9 38 6 1 5 6 0 17 7 8 8 8 8 8 8 8 6 7 0 0 0 0 0 80 0 0 839 3 1 1 2 29 9 0 0 0 0 0 0 0 1 6 1 1 1 18 0 3 4 4 4 6 9 5 5 5 53 3 5 5 5 5 5 5 5 5 6 71 5 5 7 0 4 4 4 465 7 3 3 3 35 5 5 5 5 5 5 5 5 5 5 57575757575757585858585019191919170657860401401229 3 0 9 6 3 4 6 4 2 6 7 1 2 3 923 7 1 5 52 5 7 0 16 6 3 0 8 1 7 3 5 8 9 5 6 2 4 796 2 4 9 7 7878 1 2 2122252961181363656860773739883306070083 1 5 5 9 197980808080808080617601010101018585073044444464 9 391 1 1 27535 5 53 3 5 5 5 5 5 5 5 5 6 7 7 7 7 7 7 7 7 8 8 8 655 3 3 35 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 58 01919191911.5587919r191919191919191919191921919191919 9 9 9 9 9 00hrchrchrchrchrchrchrchrchr r r r r r r r1r1r1r1r1r1r2r2r2r2r2r2r2r 0chchchchchchchchchchchchchchchchchchchchchc2 / STPI838 8 8 8g3g3g3 3h h hghgh877 2 0 63173 9 27 7635576 6551 4 4151164 44 4 56565003 5 1 8366267 0767 3557556 1 4 4151164 44 4 565658r8r8 8 8h hrhr rc c chchc83838383838383838 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8g g ghghg3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3h h hghghghghghghghghghghghghghghghghghghghghghghghghgh602036624535002369145004861983249774763901206 0 4 9 6 9 2 60 6 7 8 9 1 3 5 6 7 8 8 8 8 2 1 0 1 15 4 9 0 6 1 8 36 6 6 6 6 7 1 0 4 4 4 4 4 4 4 79 1 8 1 4 4 3 7 9 8 65 5 5 5 5 5 6 5 7 7 7 7 78 8 8 8 9 9 0 0 0 2 2 2 9 23 3 3 3 3 3 3 0 0 07 7 2 2 2 2 2 2 2 3 3 3 3 3 3 3 49 9 9 9 9 9 90 0 0 0 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 91 1 1 1 1 1 172838383838383344444444444444444444444444444442428140063512887874288421427731026025576682144040 5 5 6 5 09 5 7 8 9 1 2 9 6 7 7 8 8 8 2 1 0 1 1 98 9 5 0 3 45 6 6 6 6 7 1 9 4 4 4 4 4 4 4 7 80 7 1 2 4 2 7 9 8 55 5 5 5 5 5 6 4 7 7 7 7 7 78 8 8 9 9 0 0 0 2 2 2 9 23 3 3 3 3 3 3 0 0 0 07 2 2 2 2 2 2 2 3 3 3 3 3 3 3 49 9 9 9 919190 0 0 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 91 1 1 1 172838383838383344444444444444444444444444444441.558722r2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 200hrchrchrchrchrchrchrchrchrchr r r r r r r r r2r2r2r2r2r2r2r2r2r2r2r 0chchchchchchchchchchchchchchchchchchchchc2 / STPI838 8 8 8g3g3g3 3h h hghgh984 1 9 61224 8 78 8516177 7137 7 7434000 06 6 70707172 9 2 3191155 5878 1617137 7 7 7434000 06 6 707078r8r8 8 8h hrhr rc c chchc83838383838383838 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8g g ghghg3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3h h hghghghghghghghghghghghghghghghghghghghghghghghghgh253249169603909441497294819714680500598488923 6 1 6 3 3 8 76 7 8 0 4 3 5 5 6 6 1 5 5 5 7 7 8 9 76 8 1 1 0 7 9 92 2 2 3 3 4 4 4 4 4 5 4 0 0 0 00 0 1 1 5 8 1 3 3 0 24 4 4 4 4 4 4 4 4 4 4 5 00 0 1 4 4 4 4 4 4 5 5 5 6 69 9 9 9 9 9 9 9 9 90 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 04 4 4 4 4 4 49 9 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 04 4 4 4 4 4 444444444445454545454545454545454545454545454545479671511586224598411910156583512972627374104562 3 8 4 8 26 6 8 0 4 2 4 5 5 6 0 5 5 5 6 7 8 8 9 95 8 7 5 4 62 2 2 3 3 4 4 4 4 4 5 4 0 0 0 0 00 1 1 5 7 0 2 3 0 24 4 4 4 4 4 4 4 4 4 4 5 0 00 0 3 4 4 4 4 4 5 5 5 6 69 9 9 9 9 9 9 9 9 9 90 0 0 0 0 0 0 0 0 0 0 0 0 0 0 04 4 4 4 444449 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 04 4 4 4 444444444445454545454545454545454545454545454541.558722r2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 200hrchrchrchrchrchrchrchrchrchr r r r r r r r r2r2r2r2r2r2r2r2r2r2r2r 0chchchchchchchchchchchchchchchchchchchchc2 / STPI838 8 8 8g3g3g3 3h h hghgh273 6 9 23931 8 66 6940815 5858 3 3151144 47 7 85858362 4 9 4383884 3656 4081855 8 3 3151144 47 7 858588r8r8 8 8h hrhr rc c chchc83838383838383838 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8g g ghghg3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3h h hghghghghghghghghghghghghghghghghghghghghghghghghgh956758116209225009863867012516865740879534940 4 8 9 0 0 8 03 4 5 9 3 9 0 9 6 4 6 8 0 1 3 8 0 3 39 3 4 0 9 2 3 36 6 8 2 3 0 1 9 7 8 8 8 2 2 2 21 4 5 6 7 8 4 6 5 7 80 0 0 1 1 7 7 9 4 4 4 4 53 3 3 4 4 5 5 5 5 6 7 8 8 80 0 0 0 0 1 1 8 0 05 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 55 5 5 5 5 5 50 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 04 4 4 4 4 4 435363636363636363636363636363636363636363636363233868643568940277295941833684449953298031270001 3 9 3 0 53 4 5 8 2 9 9 9 6 4 6 8 9 1 2 8 8 2 3 85 4 4 2 0 16 6 8 2 3 0 0 9 7 8 8 8 1 2 2 2 24 5 6 7 7 3 6 2 7 80 0 0 1 1 7 7 9 4 4 4 4 5 53 3 3 4 5 5 5 5 6 7 8 8 80 0 0 0 0 1 1 8 0 0 05 5 5 5 5 5 5 5 5 5 5 5 5 5 5 55 5 5 5 545450 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 04 4 4 4 435363636363636363636363636363636363636363636361.558722r2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 200hrchrchrchrchrchrchrchrchrchr r r r r r r r r2r2r2r2r2r2r2r2r2r2r2r 0chchchchchchchchchchchchchchchchchchchchc2 / STPI838 8 8 8g3g3g3 3h h hghgh593 5 4 16579 3 84 4194954 4914 4 4616989 99 9 98989076 0 5 6617719 3444 9395914 4 4 4616989 99 9 989898r8r8 8 8h hrhr rc c chchc83838383838383838 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8g g ghghg3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3h h hghghghghghghghghghghghghghghghghghghghghghghghghgh655146494276310661295647967044972526272852597 2 8 7 6 7 4 28 9 0 0 2 3 5 5 4 6 8 2 5 6 6 8 9 0 82 6 7 5 5 6 8 98 8 9 9 9 9 9 9 2 1 8 9 9 9 7 42 3 3 5 6 6 1 9 3 5 55 5 5 5 5 5 5 5 8 6 8 8 84 5 5 7 7 7 7 7 3 0 0 9 9 60 0 0 0 0 0 0 0 5 18 9 0 0 0 0 0 0 0 0 0 4 2 2 9 9 13 3 3 3 3 3 38 8 8 8 8 9 9 9 9 9 9 9 9 9 9 9 9 4 4 56 6 6 6 6 6 636668607070707070707070707070707070727274747479317590710446194201984550397804672621259691687697 9 6 5 2 68 8 9 0 2 3 4 5 3 6 8 2 5 5 6 8 9 0 8 17 4 7 5 2 78 8 8 9 9 9 9 9 1 1 8 9 9 9 7 4 42 3 4 5 6 1 2 3 5 55 5 5 5 5 5 5 5 8 6 8 8 8 85 5 7 7 7 7 7 3 0 0 9 9 60 0 0 0 0 0 0 0 5 1 89 0 0 0 0 0 0 0 0 0 4 2 2 9 9 13 3 3 3 363638 8 8 8 9 9 9 9 9 9 9 9 9 9 9 9 4 4 56 6 6 6 636668607070707070707070707070707070727274747471.558722r2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 200hrchrchrchrchrchrchrchrchrchr r r r r r r r r2r2r2r2r2r2r2r2r2r2r2r 0chchchchchchchchchchchchchchchchchchchchc2 / STPI83838 8 8g g3g3g3h h h hgh5375 090 254674 472812979 41037198989 13348131317032 1 9 23 84674 462868979 41 603 98989 113348131318r8 8 8 8hrhrhr rc c chchc838383838383838383838 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8g g g g g g ghg3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3h h h h h h hghghghghghghghghghghghghghghghghghghghghghgh69092 2 6 4 8 5 0 4 7 4 09 5 9 2 3 4 9 0 5 9 4 7 1 6 5 5 90555756460478618860551 89024580314353777105100716268380949525020302253535 7 7 77727343434656565656585264646465681818143703803803 1 720494343433988085849596989898989 480484848484848484848484840611111110101010101010101010101010111111193560321043845359785158935 979015197040518518741764336 5 1 594527223623585158707576727 5213832646567676971 9 1 21437782955030303233137204943434339 48484858585 5 5 5263646465681818147080808085849596989898989 404 4 4 48484848484848484061111111010101010101010101010101011111111.558722r2 2 2 2 2 2 2 2 2 2 2 2 200hrchrchrchrchrchrchr r r r r r r2r2r2r2r2r2r2r2r2r2r2r2r2r2r2r2r 0chchchchchchchchchchchchchchchchchchchchchchchc2 / STPI83838 8 8g g3g3g3h h h hgh6429488 8919 506005152 2 90 0404044 4 104 41 11 1048 3 4 59697 9 61 152529505 4840404 410 041 11418r8r9r9 9h hr rc chchchc8383838383838383838383838383838383838383838 8 8 8 8 8 8 8 8g g g g g g g g g g g g g g g g g g g g3 3 3 3 3 3 3 3 3h h h h h h h h h h h h h h h h h h h hghghghghghghghghghgh959718873512365309303750764143728 1 3 2 0 7 6 5 5 9 0 5 4 01 1 3 8 9 0 7 5 5 6 7 8 8 37 7 2 7 2 2 2 5 5 4 8 9 8 39 9 9 5 5 6 6 7 7 7 7 7 73 4 9 3 5 6 8 4 9 8 1 8 3 6 9 81 1 1 7 7 7 7 7 7 7 78 8 9 9 4 4 4 4 2 2 9 0 2 3 7 7 81 1 1 2 2 2 2 2 2 27 7 7 7 9 9 2 2 2 2 4 4 4 5 5 5 5 5 51 1 1 3 3 3 3 3 32 2 2 2 2 4 4 2 2 2 2 8 8 8 8 8 8 8 8 81 1 1 1 1 1 1 13 3 3 3 3 3 3 3 8 8 8 8 8 8 8 8 8 8 8 8 81 1 1 1 1 1 1 1111111111111111111111111111111111111111111117486072 8 4 7 5 8 5 0 1 3 4 8 7 8 4 8 9 6 6 1 6 9 2 5 4 7 51 12 4 0 1 0 6 9 4 9 4 5 2 3 5 4 7 3 0 6 0 1 9 4 6 4 3 59 939859506765757577777872838394934345484329289008233579771 1 1 7 7 7 7 7 7 7 7 7 7 7 7 9 9 2 2 2 2 4 4 4 5 5 5 581 1 1 2 2 2 2 2 2 2 2 2 2 2 2 4 4 2 2 2 2 8 8 8 8 8 85 51 1 1 3 3 3 3 3 3 3 3 3 3 3 3 3 3 8 8 8 8 8 8 8 88 8 81 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 18 8 8 8 81 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 11111111111111.558722r2 2 2 2 2 2 2 2 2 2 200hrchrchrchrchrchr r r r r r2r2r2r2r2r2r2r2r2r2r2r2r2r2r2r2r2r2r 0chchchchchchchchchchchchchchchchchchchchchchchchc2 / STPI83838 8 8g g3g3g3h h h hgh2987817 2999 530811128 9 90 0484847 7 787 7 9797907705 0 691 5 4991388 1102 484947078 8 87 77979799r9 9 9 9hrhrhrhrc c c chc838383838383838383838383838383838383838 8 8 8 8 8 8 8 8 8 8g g g g g g g g g g g g g g g g g g3 3 3 3 3 3 3 3 3 3 3h h h h h h h h h h h h h h h h h hghghghghghghghghghghghgh39585019277341651080368193810 3 5 4 1 2 1 6 7 1 9 8 0 9 8 89 3 4 4 9 0 1 2 3 5 5 9 91 4 1 7 6 5 1 4 0 3 2 6 3 6 8 08 4 9 9 9 0 0 0 0 0 0 22 6 8 4 6 4 6 2 3 4 5 9 0 2 6 3 75 6 9 9 1 2 2 2 2 22 9 9 9 3 4 6 6 7 7 7 7 7 8 2 2 3 38 6 6 6 3 3 3 3 32 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 28 7 4 4 6 6 6 63 3 3 3 3 3 3 4 4 4 4 4 4 4 4 4 4 8 8 8 81 2 5 5 5 5 56 6 6 6 6 6 6 6 1 1 1 1 1 1 1 1 1 1 0 0 0 01 1 1 1 1 1 1515151515151515151616161616161616161617171717148552 0 2 8 2 8 8 9 5 0 1 6 5 3 4 6 1 2 2 0 2 3 3 9 8 7 8 897 5 4 9 6 4 7 5 5 3 3 5 0 0 9 0 1 3 5 0 8 8 4 0 8 5 8 181439499999002020405082921959893364466617373747870812628 45 6 9 9 1 1 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 22 38 6 6 6 3 3 3 3 3 3 3 3 3 3 3 3 4 4 4 4 4 4 4 4 4 42 2 28 7 4 4 6 6 6 6 6 6 6 6 6 6 6 6 1 1 1 1 1 1 1 18 8 8 81 2 5 5 5 5 5 5 5 5 5 5 5 5 5 5 6 6 6 6 6 6 61 1 0 0 0 01 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1616161717171711.558722r2 2 2 2 2 2 2 2 2 2 200hrchrchrchrchrchr r r r r r2r2r2r2r2r2r2r2r2r2r2r2r2r2r2r2r2r2r 0chchchchchchchchchchchchchchchchchchchchchchchchc2 / STPI838 8 8 8g3g3 3 3h hghghgh517 1 8392 2 708 9 0 152215804800 400 1924 9 7212141 1417 0 72954297102281505800 40044 0 1921291472119r9hr9hr9hr9hr9hr9hr9hr9hr9hr9hr9hr9hr9hr9hr9hr9hrX0hrXhrXhrY Y Y 2hrhrhr 1c c c c c c c c c c c c c c c c c c c c c chc838383838 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8g g g g3g3g3g3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3h h h h h h hghghghghghghghghghghghghghghghgh49146233996359601160726054570 3 5 1 0 3 1 1 62 3 4 5 5 6 9 4 4 8 0 9 7 97233694 7 8 3 9 20 0 0 0 0 0 0 1 7 8 9 0 3 3 4 4 627278 9 0 68 8 8 8 8 8 8 8 8 2 2 4 4 4 4 4 6 6 676768680 0 0 0 0 0 0 0 0 3 3623 3 3 3 3 0 0 0 0 0 0 072727272 2 2 2 2 4 4 4 4 4 4 4 6 6 6 6 6 6 61 1 1 17171717171717171717171717171717171717196036170640086371033246 1 5 3 6 8 8 3 5 4 3 12 3 4 5 5 6 9 2 4 7 93837493 2 4 2 5 6 9 5 00 0 0 0 0 0 0 1 7 8 8 0 3 324348 2 2 8 8 0 68 8 8 8 8 8 8 8 8 2 2 4 4 4 4 46676767 7 8 80 0 0 0 0 0 0 0 0 3 3 3 3 3 3 3 0 0 060606 62 2 2 2 2 2 2 2 2 4 40 074 4 4 4 4 6 6 6 6 6 6 61717171717171717171717171717171717171717171711.558722r2hr2r2r2r2r2r2r2r2r2r2r2r2r2r2r2r2r2r2r2r20r2r00chchchchchchchchchchchchchchchchchchchchchchc2 / STPI

Claims

1. CLAIMS WHAT IS CLAIMED IS:

1. A method for performing differential enrichment of nucleic acid molecules, the method comprising: a) providing a mixture of nucleic acid molecules comprising: a first set of nucleic acid molecules comprising a target sequence derived from a sequence comprising one or more methylated CpG sites; and a second set of nucleic acid molecules comprising a candidate sequence derived from a sequence comprising one or more non-methylated CpG sites, b) providing a blocker that binds to the candidate sequence, or a portion thereof, or the complementary sequence thereof, of the second set of nucleic acid molecules, the blocker comprising one or more xenonucleic acids; c) selectively enrich for the first set of nucleic acid molecules comprising the target sequence in comparison to the second set of nucleic acid molecules comprising the candidate sequence, wherein the blocker comprising one or more xenonucleic acids prevents or reduces enrichment of the second set of nucleic acid molecules comprising the candidate sequence; and d) detecting the selectively enriched first set of nucleic acid molecules.

2. The method of claim 1, wherein the one or more xenonucleic acids comprise one or more of a locked nucleic acid (LNA), hexitol nucleic acid (HNA), threose nucleic acid (TNA), glycol nucleic acid (GNA), cyclohexenyl nucleic acid (CeNA), or peptide nucleic acid (PNA).

3. The method of claim 1 or 2, wherein the blocker comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 xenonucleic acids.

4. The method of claim 1 or 2, wherein the blocker comprises between 6 and 12 xenonucleic acids.

5. The method of claim 1 or 2, wherein the blocker comprises 8 xenonucleic acids.

6. The method of claim 1 or 2, wherein the blocker comprises a xenonucleic acid at every other nucleoside. IPTS / 200027855.

17. The method of claim 1 or 2, wherein the blocker comprises three consecutive xenonucleic acids at three consecutive positions.

8. The method of claim 1 or 2, wherein the blocker comprises a xenonucleic acid at a position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site.

9. The method of claim 1 or 2, wherein the blocker comprises a xenonucleic acid at a position immediately preceding or immediately subsequent to a position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site.

10. The method of claim 1 or 2, wherein the blocker comprises one or more triplets of xenonucleic acids, wherein a triplet of xenonucleic acids comprises: a first xenonucleic acid at a position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site; a second xenonucleic acid at a position immediately preceding the position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site; and a third xenonucleic acid at a position immediately subsequent to the position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site.

11. The method of claim 1 or 2, wherein the blocker comprises: one or more triplets of xenonucleic acids, wherein a triplet of xenonucleic acids comprises: a first xenonucleic acid at a position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site; a second xenonucleic acid at a position immediately preceding the position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site; a third xenonucleic acid at a position immediately subsequent to the position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site; and a sequence in which every other nucleoside is a xenonucleic acid. IPTS / 200027855.

12. The method of claim 11, wherein the blocker comprises two triplets of xenonucleic acids, three triplets of xenonucleic acids, four triplets of xenonucleic acids, five triplets of xenonucleic acids, six triplets of xenonucleic acids, seven triplets of xenonucleic acids, eight triplets of xenonucleic acids, nine triplets of xenonucleic acids, or ten triplets of xenonucleic acids.

13. The method of claim 1 or 2, wherein the blocker comprises a sequence that shares at least 85% identity with any one of SEQ ID NOs: 1-6 or 14-21.

14. The method of claim 1 or 2, wherein the blocker comprises a sequence of any one of SEQ ID NOs: 1-6 or 14-21.

15. The method of claim 1 or 2, wherein the blocker comprises a sequence of any one of SEQ ID NOs: 7-13 or 22-29.

16. The method of any one of claims 1-15, wherein the blocker, when bound to the candidate sequence, increases the melting temperature to at least 65oC, optionally at least 75oC.

17. The method of any one of claims 1-15, wherein the blocker, when bound to the candidate sequence, achieves a melting temperature that is at least 5oC higher than a melting temperature of the candidate sequence bound to a probe.

18. The method of any one of claims 1-17, wherein the blocker comprises between 15 and 30 nucleosides, optionally between 16-24 nucleosides.

19. The method of any one of claims 1-18, further comprising: between step (b) and step (c), exposing the blocker and the candidate sequence to one or more temperatures, thereby enabling the blocker to bind to the candidate sequence or complementary sequence thereof.

20. The method of claim 19, wherein the one or more temperatures comprises a temperature between 50oC and 65oC, optionally about 60oC.

21. The method of claim 19, wherein the one or more temperatures comprises two different temperatures, wherein a first temperature is higher than a second temperature.

22. The method of claim 21, wherein the first temperature is between 70oC and 90oC, optionally about 80oC, and the second temperature is between 50oC and 65oC, optionally about 60oC.

23. The method of any one of claims 1-18, wherein the first set of nucleic acid molecules and / or the second set of nucleic acid molecules are DNA. IPTS / 200027855.

124. The method of claim 23, wherein the DNA is cell-free DNA.

25. The method of any one of claims 1-18, wherein the first set of nucleic acid molecules and / or the second set of nucleic acid molecules are RNA.

26. The method of any one of claims 1-24, wherein the first set of nucleic acid molecules and / or the second set of nucleic acid molecules have been treated using bisulfite conversion to convert unmethylated cytosines to uracil.

27. The method of any one of claims 1-24, wherein the first set of nucleic acid molecules and / or the second set of nucleic acid molecules have been treated using enzymatic conversion to convert unmethylated cytosines to uracil.

28. The method of claim 27, wherein the enzymatic conversion is selected from TET2 oxidation of cytosines and APOBEC conversion of cytosines.

29. The method of any one of claims 1-28, wherein the first set of nucleic acid molecules and / or the second set of nucleic acid molecules were obtained from a sample.

30. The method of claim 29, wherein the sample comprises a tissue sample, a blood sample, a stool sample, a urine sample, a mucous sample, or a saliva sample.

31. The method of any one of claims 1-30, wherein the target sequence comprises at least a CpG island, or a portion thereof.

32. The method of any one of claims 1-31, wherein selectively enriching the first set of nucleic acid molecules comprises performing one or more of PCR, RT-PCR, digital PCR, nicking endonuclease amplification (NEAR), transcription-mediated amplification (TMA), loop-mediated isothermal amplification (LAMP), helicase-dependent amplification (HAD), strand displacement amplification (SDA), sequencing library PCR, hybrid capture, or hybrid capture PCR.

33. The method of any one of claims 1-32, wherein selectively enriching for the first set of nucleic acid molecules comprises providing primers for performing nucleic acid amplification.

34. The method of claim 33, wherein when a primer is bound to a sequence of the second set of nucleic acid molecules, a nucleobase of the primer is immediately adjacent to a xenonucleic acid of the blocker that is bound to the candidate sequence of the second set of nucleic acid molecules. IPTS / 200027855.

135. The method of claim 33, wherein when a primer is bound to a sequence of the second set of nucleic acid molecules, a nucleoside of the 3’ end of the primer is complementary to a nucleoside of the nucleic acid molecule of the second set that is adjacent to one or more consecutive nucleosides derived from one or more consecutive CpG sites.

36. The method of any one of claims 1-35, further comprises: either simultaneous with step (b) or after step (b), providing a second blocker that binds to a different candidate sequence, or a portion thereof, of the second set of nucleic acid molecules, the second blocker comprising one or more xenonucleic acids.

37. The method of any one of claims 1-36, further comprises: either simultaneous with step (b) or after step (b), providing a probe capable of hybridizing to one or both of the target sequence, or portion thereof, of the first set of nucleic acid molecules and the candidate sequence, or portion thereof, of the second set of nucleic acid molecules.

38. The method of claim 37, further comprising hybridizing the probe to the target sequence, or portion thereof of the first set of nucleic acid molecules, wherein selectively enriching for the first set of nucleic acid molecules comprises enriching for the first set of nucleic acid molecules using the probe hybridized to the target sequence, or portion thereof, of the first set of nucleic acid molecules.

39. The method of claim 38, wherein enriching for the first set of nucleic acid molecules using the probe comprises performing hybrid capture.

40. A method for performing differential enrichment of nucleic acid molecules, the method comprising: a) providing nucleic acid molecules comprising a target sequence derived from a sequence comprising one or more methylated CpG sites; b) providing a blocker capable of binding to a candidate sequence, or a portion thereof, or the complementary sequence thereof, the candidate sequence only differing from the target sequence at nucleotides corresponding to the one or more methylated CpG sites, wherein the blocker comprises one or more xenonucleic acids; c) enriching for the nucleic acid molecules comprising the target sequence, wherein the blocker comprising one or more xenonucleic acids does not prevent enrichment of the nucleic acid molecules comprising the target sequence; and 125 IPTS / 200027855.1d) detecting the enriched nucleic acid molecules.

41. The method of claim 40, wherein the one or more xenonucleic acids comprise one or more of a locked nucleic acid (LNA), hexitol nucleic acid (HNA), threose nucleic acid (TNA), glycol nucleic acid (GNA), cyclohexenyl nucleic acid (CeNA), or peptide nucleic acid (PNA).

42. The method of claim 40 or 41, wherein the blocker comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 xenonucleic acids.

43. The method of claim 40 or 41, wherein the blocker comprises between 6 and 12 xenonucleic acids.

44. The method of claim 40 or 41, wherein the blocker comprises 8 xenonucleic acids.

45. The method of claim 40 or 41, wherein the blocker comprises a xenonucleic acid at every other nucleoside.

46. The method of claim 40 or 41, wherein the blocker comprises three consecutive xenonucleic acids at three consecutive positions.

47. The method of claim 40 or 41, wherein the blocker comprises a xenonucleic acid at a position complementary to a nucleotide derived from a cytosine of a CpG site.

48. The method of claim 40 or 41, wherein the blocker comprises a xenonucleic acid at a position immediately preceding or immediately subsequent to a position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site.

49. The method of claim 40 or 41, wherein the blocker comprises one or more triplets of xenonucleic acids, wherein a triplet of xenonucleic acids comprises: a first xenonucleic acid at a position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site; a second xenonucleic acid at a position immediately preceding the position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site; and a third xenonucleic acid at a position immediately subsequent to the position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site.

50. The method of claim 40 or 41, wherein the blocker comprises: IPTS / 200027855.1one or more triplets of xenonucleic acids, wherein a triplet of xenonucleic acids comprises: a first xenonucleic acid at a position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site; a second xenonucleic acid at a position immediately preceding the position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site; a third xenonucleic acid at a position immediately subsequent to the position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site; and a sequence in which every other nucleoside is a xenonucleic acid.

51. The method of claim 49 or 50, wherein the blocker comprises two triplets of xenonucleic acids, three triplets of xenonucleic acids, four triplets of xenonucleic acids, five triplets of xenonucleic acids, six triplets of xenonucleic acids, seven triplets of xenonucleic acids, eight triplets of xenonucleic acids, nine triplets of xenonucleic acids, or ten triplets of xenonucleic acids.

52. The method of claim 40 or 41, wherein the blocker comprises a sequence that shares at least 85% identity with any one of SEQ ID NOs: 1-6 or 14-21.

53. The method of claim 40 or 41, wherein the blocker comprises a sequence of any one of SEQ ID NOs: 1-6 or 14-21.

54. The method of claim 40 or 41, wherein the blocker comprises a sequence of any one of SEQ ID NOs: 7-13 or 22-29.

55. The method of any one of claims 40-54, wherein the blocker comprises between 15 and 30 nucleosides, optionally between 16-24 nucleosides.

56. The method of any one of claims 40-55, further comprising: between step (b) and step (c), exposing the blocker to one or more temperatures.

57. The method of claim 56, wherein the one or more temperatures comprises a temperature between 50oC and 65oC, optionally about 60oC.

58. The method of claim 56, wherein the one or more temperatures comprises two different temperatures, wherein a first temperature is higher than a second temperature. IPTS / 200027855.

159. The method of claim 58, wherein the first temperature is between 70oC and 90oC, optionally about 80oC, and the second temperature is between 50oC and 65oC, optionally about 60oC.

60. The method of any one of claims 40-59, wherein the nucleic acid molecules are DNA.

61. The method of claim 60, wherein the DNA is cell-free DNA.

62. The method of any one of claims 40-61, wherein the nucleic acid molecules are RNA.

63. The method of any one of claims 40-62, wherein the nucleic acid molecules have been treated using bisulfite conversion to convert unmethylated cytosines to uracil.

64. The method of any one of claims 40-62, wherein the nucleic acid molecules have been treated using enzymatic conversion to convert unmethylated cytosines to uracil.

65. The method of claim 64, wherein the enzymatic conversion is selected from TET2 oxidation of cytosines and APOBEC conversion of cytosines.

66. The method of any one of claims 40-65, wherein the nucleic acid molecules were obtained from a sample.

67. The method of claim 66, wherein the sample comprises a tissue sample, a blood sample, a stool sample, a urine sample, a mucous sample, or a saliva sample.

68. The method of any one of claims 40-65, wherein the target sequence comprises at least a CpG island, or a portion thereof.

69. The method of any one of claims 40-68, wherein enriching for the nucleic acid molecules comprises performing one or more of one or more of PCR, RT-PCR, digital PCR, nicking endonuclease amplification (NEAR), transcription-mediated amplification (TMA), loop- mediated isothermal amplification (LAMP), helicase-dependent amplification (HAD), strand displacement amplification (SDA), sequencing library PCR, hybrid capture, or hybrid capture PCR.

70. The method of any one of claims 40-69, wherein enriching for the nucleic acid molecules comprises providing primers for performing nucleic acid amplification.

71. The method of any one of claims 40-70, further comprises: either simultaneous with step (b) or after step (b), providing a probe capable of hybridizing to the target sequence, or portion thereof, of the nucleic acid molecules.

72. The method of claim 71, further comprising hybridizing the probe to the target sequence, or portion thereof, or the complementary sequence thereof, of the nucleic acid molecules, 128 IPTS / 200027855.1wherein selectively enriching for the first set of nucleic acid molecules comprises enriching for the nucleic acid molecules using the probe hybridized to the target sequence, or portion thereof, of the nucleic acid molecules.

73. The method of claim 72, wherein enriching for the nucleic acid molecules using the probe comprises performing hybrid capture.

74. A method for performing differential enrichment of nucleic acid molecules, the method comprising: a) providing nucleic acid molecules comprising a candidate sequence derived from a sequence comprising one or more non-methylated CpG sites; b) providing a blocker capable of binding to the candidate sequence, or a portion thereof, or the complementary sequence thereof, wherein the blocker comprises one or more xenonucleic acids; and c) exposing the nucleic acid molecules comprising the candidate sequence to conditions suitable for nucleic acid enrichment, wherein the blocker comprising one or more xenonucleic acids binds to the candidate sequence, or a portion thereof, or the complementary sequence thereof, and prevents or reduces enrichment of nucleic acid molecules comprising the candidate sequence.

75. The method of claim 74, wherein the one or more xenonucleic acids comprise one or more of a locked nucleic acid (LNA), hexitol nucleic acid (HNA), threose nucleic acid (TNA), glycol nucleic acid (GNA), cyclohexenyl nucleic acid (CeNA), or peptide nucleic acid (PNA).

76. The method of claim 74 or 75, wherein the blocker comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 xenonucleic acids.

77. The method of claim 74 or 75, wherein the blocker comprises between 6 and 12 xenonucleic acids.

78. The method of claim 74 or 75, wherein the blocker comprises 8 xenonucleic acids.

79. The method of claim 74 or 75, wherein the blocker comprises a xenonucleic acid at every other nucleoside.

80. The method of claim 74 or 75, wherein the blocker comprises three consecutive xenonucleic acids at three consecutive positions. IPTS / 200027855.

181. The method of claim 74 or 75, wherein the blocker comprises a xenonucleic acid at a position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site 82. The method of claim 74 or 75, wherein the blocker comprises a xenonucleic acid at a position immediately preceding or immediately subsequent to a position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site.

83. The method of claim 74 or 75, wherein the blocker comprises one or more triplets of xenonucleic acids, wherein a triplet of xenonucleic acids comprises: a first xenonucleic acid at a position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site; a second xenonucleic acid at a position immediately preceding the position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site; and a third xenonucleic acid at a position immediately subsequent to the position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site.

84. The method of claim 74 or 75, wherein the blocker comprises: one or more triplets of xenonucleic acids, wherein a triplet of xenonucleic acids comprises: a first xenonucleic acid at a position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site; a second xenonucleic acid at a position immediately preceding the position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site; a third xenonucleic acid at a position immediately subsequent to the position complementary to a nucleotide derived from a cytosine of a CpG site or a position of a nucleotide derived from a cytosine of a CpG site; and a sequence in which every other nucleoside is a xenonucleic acid. IPTS / 200027855.

185. The method of claim 83 or 84, wherein the blocker comprises two triplets of xenonucleic acids, three triplets of xenonucleic acids, four triplets of xenonucleic acids, five triplets of xenonucleic acids, six triplets of xenonucleic acids, seven triplets of xenonucleic acids, eight triplets of xenonucleic acids, nine triplets of xenonucleic acids, or ten triplets of xenonucleic acids.

86. The method of claim 74 or 75, wherein the blocker comprises a sequence that shares at least 85% identity with any one of SEQ ID NOs: 1-6 or 14-21.

87. The method of claim 74 or 75, wherein the blocker comprises a sequence of any one of SEQ ID NOs: 1-6 or 14-21.

88. The method of claim 74 or 75, wherein the blocker comprises a sequence of any one of SEQ ID NOs: 7-13 or 22-29.

89. The method of any one of claims 74-88, wherein the blocker comprises between 15 and 30 nucleosides, optionally between 16-24 nucleosides.

90. The method of any one of claims 74-89, further comprising: between step (b) and step (c), exposing the blocker to one or more temperatures, thereby enabling the blocker to bind to the candidate sequence or the complementary sequence thereof.

91. The method of claim 90, wherein the one or more temperatures comprises a temperature between 50oC and 65oC, optionally about 60oC.

92. The method of claim 90, wherein the one or more temperatures comprises two different temperatures, wherein a first temperature is higher than a second temperature.

93. The method of claim 92, wherein the first temperature is between 70oC and 90oC, optionally about 80oC, and the second temperature is between 50oC and 65oC, optionally about 60oC.

94. The method of any one of claims 74-93, wherein the nucleic acid molecules are DNA.

95. The method of claim 94, wherein the DNA is cell-free DNA.

96. The method of any one of claims 74-93, wherein the nucleic acid molecules are RNA.

97. The method of any one of claims 74-96, wherein the nucleic acid molecules have been treated using bisulfite conversion to convert unmethylated cytosines to uracil.

98. The method of any one of claims 74-96, wherein the nucleic acid molecules have been treated using enzymatic conversion to convert unmethylated cytosines to uracil. IPTS / 200027855.

199. The method of claim 98, wherein the enzymatic conversion is selected from TET2 oxidation of cytosines and APOBEC conversion of cytosines.

100. The method of any one of claims 74-99, wherein the nucleic acid molecules were obtained from a sample.

101. The method of claim 100, wherein the sample comprises a tissue sample, a blood sample, a stool sample, a urine sample, a mucous sample, or a saliva sample.

102. The method of any one of claims 74-101, wherein the target sequence comprises at least a CpG island, or a portion thereof.

103. The method of any one of claims 74-102, wherein enriching for the nucleic acid molecules comprises performing one or more of one or more of PCR, RT-PCR, digital PCR, nicking endonuclease amplification (NEAR), transcription-mediated amplification (TMA), loop-mediated isothermal amplification (LAMP), helicase-dependent amplification (HAD), strand displacement amplification (SDA), sequencing library PCR, hybrid capture, or hybrid capture PCR. IPTS / 200027855.1