Lipid nanoparticle spherical nucleic acids for genome engineering

Abstract

Spherical nucleic acids (SNAs) are an attractive platform for therapeutic delivery due to their chemically tunable structures, biocompatibility, and ability to rapidly enter cells without transfection reagents. The present disclosure provides SNAs and strategies for delivering genome editor proteins into cells. Concurrent delivery of genome editor proteins and a single-guide RNA in an SNA platform allows for rapid entry into mammalian cells and effective genome modification.

Description

LIPID NANOPARTICLE SPHERICAL NUCLEIC ACIDS FOR GENOME ENGINEERING CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the priority benefit under 35 U.S.C. § 119(e) of U.S. Provisional Application No. 63 / 664,479, filed June 26, 2024, and U.S. Provisional Application No. 63 / 724,090, filed November 22, 2024, which are incorporated herein by reference in their entirety.STATEMENT OF GOVERNMENT INTEREST

[0002] This invention was made with government support under grant numbers FA9550- 22-1 -0300 and FA9550-17-1 -0348 awarded by the Air Force Office of Scientific Research, and grant numbers DMR2104353 and DMR2428112 awarded by the National Science Foundation. The government has certain rights in the invention.INCORPORATION BY REFERENCE OF MATERIAL SUBMITTED ELECTRONICALLY

[0003] The Sequence Listing, which is a part of the present disclosure, is submitted concurrently with the specification as a text file. The name of the text file containing the Sequence Listing is “2024-125R_SeqListing. xml”, which was created on June 26, 2025 and is 32,826 bytes in size. The subject matter of the Sequence Listing is incorporated herein in its entirety by reference.BACKGROUND

[0004] Genome editing refers to the removal or insertion of a specific DNA sequence. Among the members of genome editor proteins, the CRISPR / Cas (Clustered Regularly Interspaced Short Palindromic Repeat, and CRISPR-Associated Protein) family of proteins has been exploited as an efficient genome editing tool capable of modulating genomes and has clinical potential due to its specificity and versatility. While in vitro advancements have been made with Cas enzymes, reduction of off-target effects as well as efficient and direct transduction of Cas and single guide RNA (sgRNA) complexes are highly desirable goals that have yet to be achieved.SUMMARY

[0005] CRISPR / Cas proteins and Transcription Activator-Like Effector Nucleases (TALENs) have the potential to treat a wide range of genetic diseases, but efficient delivery into mammalian cells remains a challenge. The nanoparticles and methods of the disclosure address the challenge of efficiently and safely delivering CRISPR genome editing components to target cells and tissues. Current delivery methods, such as virus-like particles, viral vectors, and traditional lipid nanoparticles, face significant obstacles including undesirable immune responses, poor cellular uptake, and cellular toxicity. These limitationshinder the widespread application and commercialization of CRISPR-based therapies. There is a need for a delivery system that can:- Efficiently transport CRISPR components to a wide variety of cell types and tissues.- Minimize immune responses and toxicity, ensuring patient safety.- Enhance cellular uptake and expression of CRISPR components to improve therapeutic efficacy.- Enable both non-homologous end joining and homology-directed repair pathways for versatile gene editing.- Be manufactured in a straightforward and scalable manner to support commercial production and regulatory approval.

[0006] The lipid nanoparticle-based Spherical Nucleic Acids (SNAs) and the liposomal Spherical Nucleic Acids (SNAs) of the disclosure meet these needs by offering a biocompatible, versatile, and efficient delivery vehicle for CRISPR genome editors, potentially transforming the landscape of gene therapy and personalized medicine.

[0007] Applications for the lipid nanoparticle-based SNAs and the liposomal SNAs and methods of the disclosure include, but are not limited to:- Gene Therapy: Correcting genetic mutations responsible for inherited diseases.- Cancer Treatment: Targeting and modifying genes involved in cancer progression and resistance.- Neurological Disorders: Delivering CRISPR components to neurons for treating conditions like Alzheimer's, Parkinson's, and Huntington's disease.- Cardiovascular Diseases: Editing genes involved in heart diseases to prevent or treat conditions like atherosclerosis and cardiomyopathy.- Infectious Diseases: Modifying immune cells to enhance resistance against infections (e.g., HIV infection) or target viral genes directly.- Regenerative Medicine: Editing genes in stem cells to enhance their therapeutic potential for tissue regeneration and repair.- Agricultural Biotechnology: Improving crop resistance to diseases, pests, and environmental stress by editing plant genomes.- Industrial Biotechnology: Enhancing microbial strains for more efficient biofuel production, waste degradation, or biomanufacturing.- Personalized Medicine: Customizing gene editing treatments based on individual genetic profiles to maximize efficacy and minimize side effects.- Drug Development: Creating cellular models with specific genetic modifications to study disease mechanisms.

[0008] Advantages of the lipid nanoparticle-based SNAs and the liposomal SNAs and methods of the disclosure include, but are not limited to:- Modular nucleic acid components: Ability to encapsulate any genome editor, gene target, and repair sequences to achieve desired gene editing outcomes.- Ease of manufacturing: DNA functionalization may be performed after LNP preparation.- Enhanced cellular uptake: Oligonucleotide shell improves cellular uptake and protein expression.- Reduced toxicity: Oligonucleotide shell reduces cellular toxicity associated with traditional LNP components.- Access to both genome editing pathways: Supports both non-homologous end joining and homology-directed repair pathways for versatile gene editing.- Biocompatibility: Spherical Nucleic Acids (SNAs) are more biocompatible compared to virus-like particles, viral vectors, and traditional lipid nanoparticles.- Versatility: Capable of targeting a wide range of tissues and over 60 different cell types.- Precision: Allows access to precise genome editing through the homology-directed repair pathway, which is largely not available with some other CRISPR delivery methods based on SNAs or LNPs.

[0009] In some aspects, the disclosure provides a SNA comprising (a) a nanoparticle core; (b) a shell of oligonucleotides attached to the nanoparticle core; (c) a plasmid encapsulated by the nanoparticle core, wherein the plasmid comprises a first nucleotide sequence encoding a genome editor protein; (d) a second nucleotide sequence that comprises a guide RNA (gRNA) or is capable of being transcribed to produce a gRNA; and (e) a homology-directed repair (HDR) template. In various embodiments, the guide RNA is a single-guide RNA (sgRNA). In some aspects, the plasmid further comprises the second nucleotide sequence capable of being transcribed to produce a sgRNA. In various aspects, the sgRNA comprises a crRNA, and further the crRNA is at least 80% complementary to a target gene. In various embodiments, the homology-directed repair (HDR) template is singlestranded DNA or double stranded DNA. In some aspects, the homology-directed repair (HDR) template is a plasmid HDR template or a linear HDR template. In various aspects, the homology-directed repair (HDR) template comprises a donor nucleotide sequence. In some aspects, the plasmid further comprises the homology-directed repair (HDR) template.

[0010] In some embodiments, the genome editor protein comprises a CRISPR-associated protein (Cas), a Zinc-finger nuclease (ZNF), a transcription activator-like effector nuclease (TALEN), a meganuclease, an obligate mobile element guided activity (OMEGA), a catalytically impaired Cas nuclease / nickase, a TALEN fused to a deaminase enzyme, or a reverse transcriptase. In various aspects, the genome editor protein is a CRISPR-associated protein (Cas). In some aspects, the Cas is Cas9, Cas12, Cas13, Cas14, or a combination thereof. In various aspects, the Cas is Cas9. In some aspects, the genome editor protein comprises a nuclear localization signal (NLS).

[0011] In various embodiments, the first nucleotide sequence encoding the genome editor is operably linked to a first promoter. In some aspects, the first promoter is a CBh promoter, a chicken p-actin (CAG) promoter, a CMV promoter, an EF1 a promoter, a TRE promoter, a CBA promoter, or a UAS promoter. In various aspects, the first promoter is a CBh promoter. In some embodiments, the second nucleotide sequence is operably linked to a second promoter. In various aspects, the second promoter is an RNA polymerase III promoter. In some aspects, the second promoter is a U6 promoter, a 7SK promoter, or an H1 promoter. In various aspects, the second promoter is a U6 promoter.

[0012] In some embodiments, the plasmid comprises an additional genome editor. In various aspects, the plasmid comprises two different genome editors. In some aspects, the two different genome editors are operably linked to the same first promoter. In various aspects, the two different genome editors are operably linked to different first promoters.

[0013] In some embodiments, the SNA comprises an additional nucleotide sequence. In some aspects, the additional nucleotide sequence comprises an additional plasmid. In various aspects, the additional plasmid encodes a genome editor protein. In some aspects, the additional plasmid further comprises a nucleotide sequence capable of being transcribed to produce an sgRNA. In various aspects, the genome editor protein encoded by the additional plasmid is a different genome editor from the genome editor encoded by the plasmid. In some aspects, the additional plasmid comprises a nucleotide sequence capable of being transcribed to produce an sgRNA. In some embodiments, the additional nucleotide sequence is a linear nucleotide sequence. In various aspects, the linear nucleotide sequence comprises single-stranded DNA, double-stranded DNA, single-stranded RNA, or double-stranded RNA. In some aspects, the linear nucleotide sequence comprises mRNA. Invarious aspects, the linear nucleotide sequence comprises a nucleotide sequence encoding a genome editor. In some aspects, the linear nucleotide sequence further comprises a nucleotide sequence capable of being transcribed to produce an sgRNA. In various aspects, the linear nucleotide sequence comprises a nucleotide sequence capable of being transcribed to produce an sgRNA. In some aspects, the additional nucleotide sequence is an additional homology-directed repair (HDR) template.

[0014] In some embodiments, the nanoparticle core comprises a lipid nanoparticle core or a liposomal core. In some aspects, the lipid nanoparticle core comprises an ionizable lipid, a phospholipid, a sterol, and a lipid-polyethylene glycol (lipid-PEG) conjugate. In various aspects, the lipid nanoparticle comprises 45-55% ionizable lipid, 10-20% phospholipid, 30- 40% sterol, and 1 -10% lipid-PEG conjugate. In some aspects, the lipid-polyethylene glycol (lipid-PEG) conjugate comprises a functional group. In various aspects, the functional group is cycloalkyne, azide, maleimide, or thiol. In some embodiments, one or more oligonucleotides in the shell of oligonucleotides is covalently attached to the exterior of the lipid nanoparticle core through the lipid-PEG conjugate.

[0015] In some embodiments, the diameter of the SNA is about 10-50 nm greater than the diameter of a comparable nanoparticle core without a payload. In some embodiments, the diameter of the SNA is about 2-25 nm greater than the diameter of a comparable nanoparticle core carrying the same payload as the SNA.

[0016] In some embodiments, the liposomal core comprises a plurality of lipid groups. In various aspects, the plurality of lipid groups comprises a lipid selected from the group consisting of the phosphatidylcholine, phosphatidylglycerol, and phosphatidylethanolamine families of lipids. In some aspects, the lipid group is 1 ,2-dioleoyl-sn-glycero-3- phosphocholine (DOPC), 1 ,2-dimyristoyl-sn-phosphatidylcholine (DMPC), 1-palmitoyl-2- oleoyl-sn-phosphatidylcholine (POPC), 1 ,2-distearoyl-sn-glycero-3-phospho-(1 ’-rac-glycerol) (DSPG), 1 ,2-dioleoyl-sn-glycero-3-phospho-(1 ’-rac-glycerol) (DOPG), 1 ,2-distearoyl-sn- glycero-3-phosphocholine (DSPC), 1 ,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1 ,2-di-(9Z-octadecenoyl)-sn-glycero-3-phosphoethanolamine (DOPE), and 1 ,2- dihexadecanoyl-sn-glycero-3-phosphoethanolamine (DPPE).

[0017] In some embodiments, one or more oligonucleotides in the shell of oligonucleotides is attached to the exterior of the lipid nanoparticle core or liposomal core through a lipid anchor group. In various aspects, the lipid anchor group is attached to the 5’ end or the 3’ end of the one or more oligonucleotides. In some aspects, the lipid anchor group is tocopherol or cholesterol. In various aspects, the one or more oligonucleotides in the shell of oligonucleotides is modified on its 5’ end and / or 3’ end with dibenzocyclooctyl(DBCO). In some aspects, the shell of oligonucleotides comprises single-stranded DNA, double-stranded DNA, single-stranded RNA, double-stranded RNA, or a combination thereof. In various aspects, the shell of oligonucleotides comprises about 2 to about 500 oligonucleotides. In some embodiments, the shell of oligonucleotides comprises about 10 to about 200 oligonucleotides. In some aspects, the shell of oligonucleotides comprises about 10 to about 80 oligonucleotides, about 5 to about 50 oligonucleotides, or about 5 to about 20 oligonucleotides. In some embodiments, each oligonucleotide in the shell of oligonucleotides is about 5 to about 100 nucleotides in length. In various aspects, each oligonucleotide in the shell of oligonucleotides is about 25 to about 55 nucleotides in length.

[0018] In some embodiments, one or more oligonucleotides in the shell of oligonucleotides comprises a (GGX)nnucleotide sequence, wherein n is 2-20 and X is a nucleobase (A, C, T, G, or U). In some aspects, the (GGX)nnucleotide sequence is on the 5’ end of the one or more oligonucleotides. In various aspects, the (GGX)nnucleotide sequence is on the 3’ end of the one or more oligonucleotides. In some aspects, the (GGX)nnucleotide sequence is a (GGT)nnucleotide sequence. In some embodiments, the diameter of the SNA is about 50 nm to about 250 nm.

[0019] Further provided is a composition comprising the SNAs disclosed herein. In various embodiments, the composition comprises a plurality of the SNAs disclosed herein.

[0020] Further disclosed herein is a method of expressing a genome editor protein in a cell comprising contacting the cell with the SNAs or compositions disclosed herein, or a combination thereof.

[0021] Further provided is a method of treating, ameliorating, and / or preventing a disorder in a subject comprising administering to the subject an effective amount of (i) an SNA of the disclosure, (ii) a composition of the disclosure, or (iii) a combination thereof. In various embodiments, the disorder is cancer, an infectious disease, an autoimmune disease, a neurodegenerative disease, an inherited disease, an infectious disease, a cardiovascular disease, a metabolic disorder, or a combination thereof.

[0022] Further disclosed herein is a method of administering a spherical nucleic acid (SNA) to a cell comprising contacting the cell with the SNA, wherein the SNA comprises a) a lipid nanoparticle core comprising an ionizable lipid, a phospholipid, a sterol, and a lipidpolyethylene glycol (lipid-PEG) conjugate, and b) a shell of oligonucleotides attached to the lipid nanoparticle core; and wherein cellular uptake and / or cellular viability postadministration is enhanced when compared to an identical lipid nanoparticle core that does not comprise a shell of oligonucleotides. In various aspects, cellular uptake is enhanced by at least about 200% when compared to the lipid nanoparticle that does not comprise a shellof oligonucleotides. In some aspects, cellular viability is enhanced by at least about 30% when compared to the lipid nanoparticle that does not comprise a shell of oligonucleotides. In some aspects, (a) the lipid nanoparticle core comprises (A9-Cis) PC phospholipid, DLin- KC2-DMA, cholesterol, and DPPE-PEG(2000) Maleimide; (b) each of the oligonucleotides in the shell of oligonucleotides is a single-stranded oligonucleotide; (c) the SNA encapsulates a plasmid, wherein the plasmid comprises a first nucleotide sequence encoding a genome editor protein and a second nucleotide sequence, a second nucleotide sequence capable of being transcribed to produce a single-guide RNA (sgRNA); and (d) the SNA further comprises an additional nucleotide sequence that comprises a homology-directed repair (HDR) template. In various aspects, the lipid nanoparticle core comprises 12.5% (A9-Cis) PC phospholipid, 50% DLin-KC2-DMA, 35% cholesterol, and 2.5% DPPE-PEG(2000) Maleimide.BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1(A-D) provide the design of CRISPR lipid nanoparticle spherical nucleic acids (LNP-SNAs). A shows lipid components that assemble into LNPs. B provides a plasmid construct encoding a single-guide (sg)RNA and a spCas9 protein tagged with 3x FLAG epitopes and nuclear localization signals. C shows a synthetic scheme for CRISPR LNP-SNAs. D provides a scheme for CRISPR LNP-SNA cellular delivery and genome engineering.

[0024] Figure 2 (A-C) provide characterization of CRISPR LNP-SNAs synthesized via the thiol-maleimide reaction. A is an agarose (0.5%) gel electrophoresis showing the migration of Cy5-labeled 5’-thiol-DNA, CRISPR LNP-SNAs, and CRISPR LNP-SNAs ruptured using a surfactant (1% Triton X-100). B shows the hydrodynamic diameters of LNPs, CRISPR LNPs, and CRISPR LNP-SNAs measured using dynamic light scattering. C shows zeta potentials of LNPs, CRISPR LNPs, and CRISPR LNP-SNAs. The mean ± standard deviation from three biological replicates is shown.

[0025] Figure 3 (A-D) provides a schematic representation of CRISPR LNP-SNA synthesis via DBCO-azide cycloaddition, showing the lipid components used to prepare azido-terminated LNPs. Compared to maleimide, DBCO is stable in water ( / .e., no hydrolysis). B provides a schematic of the synthetic procedures for the preparation of CRISPR LNPs and CRISPR LNP-SNAs. C shows the hydrodynamic diameters of azidoterminated LNPs, CRISPR LNPs, and CRISPR LNP-SNAs synthesized via DBCO-azide cycloaddition as measured via Dynamic Light Scattering. D shows zeta potentials of azidoterminated LNPs, CRISPR LNPs, and CRISPR LNP-SNAs synthesized via DBCO-azide cycloaddition.

[0026] Figure 4 (A-F) show electron microscopy imaging of CRISPR LNPs and CRISPR LNP-SNAs. A provides representative cryo-electron microscopy imaging of maleimide- bearing CRISPR LNPs. B provides transmission electron microscopy imaging of maleimide- bearing CRISPR LNPs after negative staining. C provides representative cryo-electron microscopy images of CRISPR LNP-SNAs synthesized via thiol-maleimide Michael addition. D provides transmission electron microscopy imaging of CRISPR LNP-SNAs synthesized via thiol-maleimide Michael addition, after negative staining. E provides electron microscopy imaging of CRISPR LNPs synthesized via DBCO-azide cycloaddition. F provides electron microscopy imaging of CRISPR LNP-SNAs synthesized via DBCO-azide cycloaddition, after negative staining.

[0027] Figure 5 (A-E) demonstrate cellular uptake, biocompatibility, and functional delivery of CRISPR LNP-SNAs (prepared using thiol-maleimide chemistry). A provides flow cytometry analysis of rhodamine-labeled CRISPR LNPs and CRISPR LNP-SNAs incubated with HaCaT cells over a 4-hour period. B shows confocal imaging of rhodamine- and Cy5- labeled CRISPR LNP-SNAs in HaCaT cells. C provides cell viability assays for CRISPR LNPs and CRISPR LNP-SNAs across four different cell lines at different particle concentrations (0-40 nM) after a 24-h incubation. D provides flow cytometry analysis of EGFP fluorescence following the incubation of HaCaT cells with an EGFP plasmid (pEGFP), EGFP LNPs and EGFP LNP-SNAs (with encapsulated pEGFP). E shows quantification of protein expression levels, as determined by EGFP fluorescence intensity. The mean ± standard deviation from three biological replicates is shown throughout the figure.

[0028] Figure 6 (A-E) show genome engineering with CRISPR LNP-SNAs (prepared using thiol-maleimide chemistry). A shows a schematic illustrating the gene editing strategies available, including NHEJ-mediated indel mutations and HDR-mediated gene modifications with a repair template. B provides surveyor assays showing gene editing via the NHEJ pathway in hBMSCs and HaCaT cells. C provides the nuclease assays used to determine HDR efficiencies after GRIN2B target modification with a Hindi II cleavage site. D provides surveyor assays in HEK293T cells targeting the EGFP site. E shows confocal microscopy images of untreated and CRISPR LNP-SNA-treated cells, with arrows indicating cells whose fluorescence decreased following SNA treatment.

[0029] Figure 7 (A-E) show the results of incubating cells with CRISPR plasmids without transfection agents or delivery vehicles. Surveyor nuclease assays in hBMSC (A) and HaCaT (B) cells following GRIN2B targeting are shown, with gels run under 2% agarose, and with the size of the GRIN2B PCR product being 696 bp. C-D show the gene editing efficiencies of CRISPR LNPs targeting the GRIN2B site. Surveyor nuclease assays in hBMSC (C) and HaCaT (D) cells treated with maleimide-terminated CRISPR LNPs areshown, with gels run under 2% agarose. E provides the gene editing efficiencies of azidoterminated CRISPR LNPs and CRISPR LNP-SNAs targeting the GRIN2B site in hBMC cells (2% agarose gel).

[0030] Figure 8 (A-B) provides a flow cytometry histogram of HEK293T / EGFP cells treated with CRISPR LNPs or CRISPR LNP-SNAs (A), and shows flow cytometry of HEK293T cells without treatment and treated with CRISPR LNPs and CRISPR LNP-SNAs targeting the EGFP site for indel generation (B).

[0031] Figure 9 shows indel frequencies at the GRIN2B target in hBMSCs and HaCaT cells. Cells were treated with CRISPR LNPs or LNP-SNAs conjugated via either DBCO- azide (Azide) or thiol-maleimide (Mai) chemistry, and indel rates were assessed by T7EI or sequencing (Seq). The mean ± standard deviation across three or four biological replicates is shown.

[0032] Figure 10 shows indel frequencies at the GRIN2B target in HEK293T cells treated with CRISPR LNPs or LNP-SNAs with DBCO-azide formulation. Indel rates were assessed by T7EI assay. Data are presented as the mean ± standard deviation across three or four biological replicates.

[0033] Figure 11 shows indel frequencies at the DNAse I and Grin2b targets using CRISPR LNPs or LNP-SNAs formulated via thiol-maleimide chemistry (in hBMSC and HaCaT cells) or DBCO-azide chemistry (in HEK293T and RAW 264.7 cells). Indel rates were assessed by T7EI. The mean ± standard deviation across three or four biological replicates is shown.

[0034] Figure 12 shows HDR efficiencies at the GRIN2B and DNAse I loci using lipofectamine, CRISPR LNPs or LNP-SNAs formulated via DBCO-azide chemistry. HDR efficiencies were assessed by Hindi 11 digestion. The mean ± standard deviation across three biological replicates is shown.

[0035] Figure 13 shows cell viability assays for CRISPR LNPs (left panel) and CRISPR LNP-SNAs (right panel) across four different cell lines at different particle concentrations (0, 20, and 40 nM) after a 96-hour incubation.

[0036] Figure 14 shows an exemplary synthetic scheme for EGFP LNP-SNAs, designed to encapsulate and deliver a plasmid containing an EGFP reporter.

[0037] Figure 15 (A-B) show TIDE analysis of indel rates in untreated HaCaT cells at the GRIN2B target. A shows editing efficiency, including the frequencies of insertions and deletions. B shows sequence alignment of PCR amplicons comparing control and test samples.

[0038] Figure 16 (A-B) show TIDE analysis of indel rates in LNP-SNA-treated hBMSCs at the GRIN2B target. A shows editing efficiency, including the frequencies of insertions and deletions. B shows sequence alignment of PCR amplicons comparing control and test samples.

[0039] Figure 17 (A-C) show TIDE analysis of indel rates in LNP-SNA-treated HaCaT cells at the GRIN2B target. A shows editing efficiency, including the frequencies of insertions and deletions. B shows sequence alignment of PCR amplicons comparing control and test samples. C shows composition of the +1 inserted nucleotide.

[0040] Figure 18 (A-C) show TIDER analysis of HDR in hBMSCs at the DNAse I target. A shows HDR efficiency. B shows aberrant sequence signal from alignment between control and test samples. C shows the designed sequence signal from alignment between control and reference samples.DETAILED DESCRIPTION

[0041] CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)-based genome editing technology has the potential to modify genetic targets and treat various diseases. An example of a typical CRISPR system utilizes a Cas nuclease and a guide RNA to induce double-strand breaks (DSBs) at specific genomic loci (1 , 2). These DSBs are primarily repaired through non-homologous end joining (NHEJ) or microhomology-mediated end joining (MMEJ), both of which result in error-prone insertions and deletions (indels), or through homology-directed repair (HDR), a more precise pathway that utilizes an exogenous DNA template (3, 4). Precision genome editing has also been demonstrated using base and prime editors, which utilize engineered Cas variants and guide RNAs without inducing DSBs (34, 44). One of the major challenges in the practical application of CRISPR is the inefficient delivery of CRISPR machinery to target cells and tissues. Delivery vehicles including viruslike particles, viral vectors, and lipid nanoparticles have been developed for this purpose, but still face challenges associated with immunogenicity, poor cellular uptake, and cellular toxicity. Alternatively, Spherical Nucleic Acids (SNAs) represent an efficient and biocompatible delivery vehicle ideally suited for a host of therapeutically relevant applications, including CRISPR. In short, SNAs are comprised of a nanoparticle core densely functionalized with DNA on its exterior. Since their discovery and ensuing development, many different types of SNAs have been realized that vary in terms of their nanoparticle core identity and DNA sequences. In addition, SNAs have been shown to enter many different tissues and over 60 different cell types to date. Recently, Mirkin etal. described the development of a CRISPR SNA comprised of a Cas9 protein core preloadedwith single-guide (sg)RNA to achieve insertion / deletion on the target genome via the non- homologous end joining pathway (21 ).

[0042] Disclosed herein, in various aspects, is a class of lipid nanoparticle (LNP)-based SNA and its use for delivering genome editors to target cells. The nucleic acids encoding the CRIPSR-genome editors and sgRNA are encapsulated within the LNP. Optionally, a DNA repair template can be co-encapsulated within the LNP to access the homology directed repair pathway.

[0043] Compared to the current state-of-art, the lipid nanoparticle-based SNAs of the disclosure have several advantages: (1 ) the nucleic acid components are modular: in principle, any genome editors, gene targets, and repair sequence of interests can be encapsulated to achieve desired gene editing outcomes; (2) the manufacturing of LNP SNAs is straightforward, and only DNA functionalization is needed as an additional step after LNP preparation of any kind; (3) compared to LNPs used on their own, the DNA shell in the SNA design provides enhanced cellular uptake, higher levels of protein expression (that is proteins are expressed at a higher level when delivered as an SNA form compared to INP), and allows one to access a larger scope of cellular and tissue targets; (4) DNA shell reduces cellular toxicity associated with traditional LNP components; (5) both non-homologous end joining and homology-directed repair (HDR) pathways are accessible, which enables gene knock-out or precise editing of genomic sequences, as is an insertion-deletion (indel) formation pathway, which disrupts gene function.

[0044] CRISPR-based genome editing has the potential to revolutionize disease treatment by modifying genetic targets. However, delivering CRISPR components efficiently to target cells remains a significant challenge. Existing delivery methods via virus-like particles, viral vectors, and lipid nanoparticles face issues such as undesirable immune responses, poor cellular uptake, and toxicity. Spherical Nucleic Acids (SNAs), pioneered by the Mirkin lab, offer a promising alternative. These SNAs have a nanoparticle core functionalized with DNA, allowing them to reach various tissues and cell types effectively. A new approach involves using CRISPR SNAs, where a Cas9 protein core is preloaded with single-guide RNA to facilitate genome editing via the non-homologous end joining pathway. Despite their potential, these CRISPR SNAs face challenges in protein expression and DNA functionalization, and they cannot yet access the precise homology-directed repair pathway. This invention introduces a lipid nanoparticle (LNP)-based SNA for delivering genome editors. The CRISPR components and guide RNA are encapsulated in the LNP, with an optional DNA repair template for precise editing. This method offers several advantages: modular nucleic acid components, straightforward manufacturing, enhanced cellular uptake,reduced toxicity, and access to both major genome editing pathways for versatile and precise gene modifications.

[0045] The present disclosure provides a SNA for delivering genome editors, wherein the SNA comprises a nanoparticle core and a shell of oligonucleotides attached to the nanoparticle core. In various embodiments, CRISPR components and guide RNA are encapsulated in the LNP, with an optional DNA repair template for precise editing. This SNA offers several advantages: modular nucleic acid components, straightforward manufacturing, enhanced cellular uptake, reduced toxicity, and access to both major genome editing pathways for versatile and precise gene modifications.

[0046] All language such as “from,” “to,” “up to,” “at least,” “greater than,” “less than,” and the like include the number recited and refer to ranges which can subsequently be broken down into sub-ranges.

[0047] A range includes each individual member. Thus, for example, a group having 1-3 members refers to groups having 1 , 2, or 3 members. Similarly, a group having 6 members refers to groups having 1 , 2, 3, 4, or 6 members, and so forth.

[0048] As used in this specification and the appended claims, the articles “a” and “an” refer to one or to more than one (for example, to at least one) of the grammatical object of the article.

[0049] “About” and “approximately” shall generally mean an acceptable degree of error for the quantity measured given the nature or precision of the measurements. Exemplary degrees of error are within 20-25 percent (%), or, for example, within 20 percent, 10 percent, 5 percent, 4 percent, 3 percent, 2 percent, or 1 percent of the stated value or range of values.

[0050] The terms “liposome” and “liposomal core” are interchangeable as used herein.

[0051] A “subject” is a vertebrate organism. The subject can be a non-human mammal (e.g., a mouse, a rat, or a non-human primate), or the subject can be a human subject.

[0052] The terms “administering”, “administer”, “administration”, and the like, as used herein, refer to any mode of transferring, delivering, introducing, or transporting a SNA to a subject in need of treatment with such a SNA. Such modes include, but are not limited to, oral, topical, intravenous, intraarterial, intraperitoneal, intramuscular, intratumoral, intradermal, intranasal, and subcutaneous administration.

[0053] “Treating” and “treatment” refers to any reduction in the severity and / or onset of symptoms associated with a disease or disorder. Accordingly, “treating” and “treatment” includes therapeutic and prophylactic measures. One of ordinary skill in the art willappreciate that any degree of protection from, or amelioration of, the onset and / or progression of a disease or disorder is beneficial to a subject, such as a human patient. The quality of life of a patient is improved by reducing to any degree the severity of symptoms in a subject and / or delaying the appearance of symptoms.

[0054] A “targeting oligonucleotide” is an oligonucleotide that directs a SNA to a particular tissue and / or to a particular cell type. In some embodiments, a targeting oligonucleotide is an aptamer. Thus, in some embodiments, a SNA of the disclosure comprises an aptamer attached to the exterior of the nanoparticle core, wherein the aptamer is designed to bind one or more receptors on the surface of a certain cell type.

[0055] An “immunostimulatory oligonucleotide” is an oligonucleotide that can stimulate (e.g., induce or enhance) an immune response. Typical examples of immunostimulatory oligonucleotides are CpG-motif containing oligonucleotides, single-stranded RNA oligonucleotides, double-stranded RNA oligonucleotides, and double-stranded DNA oligonucleotides. A “CpG-motif” is a cytosine-guanine dinucleotide sequence. Singlestranded RNA sequences can be recognized by toll-like receptors 8 and 9, double-stranded RNA sequences can be recognized by toll-like receptor 3, and double-stranded DNA can be recognized by toll-like receptor 3 and cyclic GMP-AMP synthase (cGAS).

[0056] The term “inhibitory oligonucleotide” refers to an oligonucleotide that reduces the production or expression of proteins, such as by interfering with translating mRNA into proteins in a ribosome or that are sufficiently complementary to either a gene or an mRNA encoding one or more of targeted proteins, that specifically bind to (hybridize with) the one or more targeted genes or mRNA thereby reducing expression or biological activity of the target protein. Inhibitory oligonucleotides include, without limitation, isolated or synthetic short hairpin RNA (shRNA or DNA), an antisense oligonucleotide e.g., antisense RNA or DNA, chimeric antisense DNA or RNA), miRNA and miRNA mimics, small interfering RNA (siRNA), DNA or RNA inhibitors of innate immune receptors, an aptamer, a DNAzyme, or an aptazyme.

[0057] As used herein, “operably linked” describes the relationship between a gene and a regulatory sequence, such that the regulatory sequence exerts control over the transcription and expression of the gene. For example, a gene can be operably linked to a promoter.

[0058] The term “indel” describes an insertion or deletion in a nucleotide sequence, which can occur during error-prone non-homologous end joining (NHEJ). “Indel efficiency”, “indel frequency” and “indel rate” are used interchangeably and refer to the rate / frequency at which an insertion or deletion of nucleotide bases occurs within a specific DNA sequence e.g., a target gene) in the genome of an organism. The indel efficiency is used to assessgenome editing efficiencies of genome editors, including, but not limited to, CRISPR / Cas systems where insertion and / or deletion mutations are intentionally introduced.

[0059] The terms “HDR efficiency” and “HDR frequency” are used interchangeably and describe the rate and / or frequency at which a specific DNA sequence ( / .e., a target gene) in the genome of an organism has been repaired through the homology-directed repair (HDR) pathway, following double-stranded breaks (DSBs) introduced by genome editors. HDR- directed DNA repair after DSB requires an exogenous DNA template (e.g., a repair template) with sequence homology, and the DNA will be repaired and modified according to the DNA sequences specified on the repair template.

[0060] “Encapsulation efficiency” is the percentage of linear oligonucleotides or plasmids encapsulated within the liposomal or lipid nanoparticle core or SNA constructs versus the total percentage of linear oligonucleotides or plasmids that are mixed with lipid mixture during the synthesis. Encapsulation efficiencies less than 100% indicate that free linear oligonucleotides or plasmids are present in the buffer / solution, as opposed to the interior cavity of the LNPs, LNP-SNAs, liposomes, or LSNAs.

[0061] As used herein, a “homology-driven repair (HDR) template” is a single-stranded or double-stranded DNA sequence that comprises a donor nucleotide sequence. The HDR template is partially ( / .e. less than 100%) or completely ( / .e. 100%) homologous to the DNA sequence of the target gene at a double-stranded break introduced by a genome editor protein. The HDR template can introduce specific mutations or new sequences that are absent in the original genomic DNA sequence e.g., the target gene) for mutations or knock- ins.

[0062] All references, patents, and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which each is cited, which in some cases may encompass the entirety of the document.Genome Editing Proteins, sgRNA

[0063] SNAs of the disclosure comprise one or more plasmids comprising a nucleotide sequence encoding a genome editor protein. In some embodiments, a SNA of the disclosure comprises: a) a nanoparticle core; b) a shell of oligonucleotides attached to the nanoparticle core e.g., a lipid nanoparticle core) and c) a plasmid encapsulated by the nanoparticle core, wherein the plasmid comprises a first nucleotide sequence encoding a genome editor protein. Genome editor proteins contemplated by the disclosure include, without limitation, a transcription activator-like effector-based nucleases (TALEN), a meganuclease, a nuclease, a zinc finger nuclease (ZFN), a CRISPR-associated protein, CRISPR / Cas9, Cas9, xCas9, Cas12a (Cpf 1 ), Cas13, Cas13a, Cas14, CasX, CasY, a Class 1 Cas protein, a Class 2 Casprotein, MAD7, an obligate mobile element guided activity (OMEGA) protein, or a combination thereof. Genome editor proteins may comprise base editors Catalytically Impaired Cas nuclease / nickase or TALEN Fused to a Deaminase enzyme, or prime editor reverse transcriptase. In any aspects or embodiments of the disclosure, genome editing is used to inhibit or reduce expression of a target gene. In certain embodiments, the reduction of gene expression and subsequent reduction of biological active protein expression can be achieved by insertion / deletion of nucleotides via non-homologous end joining (NHEJ) or the insertion of appropriate donor cassettes via homology directed repair (HDR) that lead to premature stop codons and the expression of non-functional proteins or by insertion of nucleotides.

[0064] A “target gene” refers to a nucleic acid sequence present in a cell, to which a guide RNA (gRNA) or single-guide RNA (sgRNA) is designed to have complementarity, where hybridization between a target gene and a gRNA (or sgRNA) promotes the formation of a CRISPR complex. Full complementarity is not necessarily required, provided there is sufficient complementarity to cause hybridization and promote formation of a CRISPR complex.

[0065] The genome editor protein-encoding first nucleotide sequence is optionally operably linked to a first promoter that drives expression. In some embodiments, the first promoter comprises a CBh promoter, a chicken p-actin promoter (CAG), a CMV promoter, an EF1 a promoter, a TRE promoter, a CBA promoter, or a UAS promoter.

[0066] In any of the aspects or embodiments of the disclosure, the genome editor protein encoded by the plasmid is a “fused” protein. The term “fused” refers to a genome editor protein that is linked to a moiety, such as a nuclear localization signal (NLS). In various aspects, the fused protein comprises (or consists of): (i) a detectable marker (e.g., FLAG), (ii) a genome editor protein, and (iii) a nuclear localization signal (NLS). The genome editing portion of the fused protein can be any genome editor protein known in the art and / or described herein, for example and without limitation, a CRISPR-associated protein (Cas). In various embodiments, the Cas is Cas9, Cas12, Cas13, Cas 14, or a combination thereof. In some embodiments, the Cas9 is as described in Harrington, L.B., Paez-Espino, D., Staahl, B.T. et al. A thermostable Cas9 with increased lifetime in human plasma. Nat Commun 8, 1424 (2017), incorporated by reference herein in its entirety. In any of the aspects or embodiments of the disclosure, the “fused” protein as described herein further comprises or consists of a NLS sequence. NLS sequences are known in the art (see, e.g., Cutrona, G., Carpaneto, E., Ulivi, M. et al. Effects in live cells of a c-myc anti-gene PNA linked to a nuclear localization signal. Nat Biotechnol 18, 300-303 (2000), incorporated by reference herein in its entirety). The disclosure also provides, in various aspects, compositionscomprising a fused protein as described herein and a pharmaceutically acceptable carrier. Fused proteins provided by the disclosure may be used in any of the SNAs, compositions, and / or methods described herein.

[0067] Through in vitro studies using Streptococcus pyogenes type II CRISPR / Cas system, it has been shown that the only components required for efficient CRISPR / Cas- mediated target DNA or genome modification are a Cas nuclease {e.g., a Cas9 nuclease), CRISPR RNA (crRNA) and trans-activating crRNA (tracrRNA). The wild-type mechanism of CRISPR / Cas-mediated DNA cleavage occurs via several steps. Transcription of the CRISPR array, containing small fragments (20-30 base-pairs) of the encountered (or target) DNA, into pre-crRNA, which undergoes maturation through the hybridization with tracrRNA via direct repeats of pre-crRNA. The hybridization of the pre-crRNA and tracrRNA, known as guide RNA (gRNA or sgRNA), associates with the Cas nuclease forming a ribonucleoprotein complex, which mediates conversion of pre-crRNA into mature crRNA. Mature crRNA:tracrRNA duplex directs Cas9 to the DNA target comprising or consisting of the protospacer and the requisite protospacer adjacent motif (CRISPR / cas protospacer- adjacent motif; PAM) via heteroduplex formation between the spacer region of the crRNA and the protospacer DNA on the host genome. The Cas9 nuclease mediates cleavage of the target DNA upstream of PAM to create a double-stranded break within the protospacer or a strand-specific nick using mutated Cas9 nuclease whereby one DNA strand-specific cleavage motif is mutated.

[0068] Thus, in various aspects involving gene editing, a SNA of the disclosure {e.g., LNP-SNA, LSNA) comprises a DNA or RNA genome editor substrate e.g., a single-guide RNA) in addition to a plasmid comprising a first nucleotide sequence encoding a genome editor protein, wherein the DNA or RNA genome editor substrate is, in various embodiments, attached to the surface of the SNA or encapsulated within the SNA. In some embodiments, the plasmid comprises a first nucleotide sequence encoding a genome editor protein and further comprises a second nucleotide sequence capable of being transcribed to produce a guide RNA (gRNA). In some embodiments, the gRNA is a single-guide RNA (sgRNA). In some embodiments, a SNA that comprises a plasmid encoding a genome editor protein is delivered separately from the second nucleotide sequence capable of being transcribed to produce a DNA or RNA genome editor substrate e.g., sgRNA). In some embodiments, the second nucleotide sequence capable of being transcribed to produce a sgRNA is operably linked to a second promoter. In various aspects, the second promoter is an RNA polymerase III promoter. In some aspects, the second promoter is a U6 promoter, a 7SK promoter, or an H1 promoter.

[0069] Other RNA-guided nucleases from related CRISPR systems that have also been adapted for programmable nucleic acid cleavage include Staphylococcus aureus Cas9 (SaCas9), CRISPR from Prevotella or Franciscella I (Cpfl), Geobacillus Cas9 (GeoCas9), Campylobacter jejuni Cas9 (CjCas9), metagenomically derived CRISPR-CasX and CRISPR- CasY, CRISPR-Cas3, and CRISPR-C2c2, which cleaves RNA.

[0070] In further aspects, the present disclosure provides a genome-targeting oligonucleotide a guide RNA (gRNA), that can direct the activities of an associated polypeptide, such as a genome editor protein. A gRNA is an oligonucleotide having sufficient complementarity with a target gene to hybridize with said target gene and direct sequencespecific binding of a genome editor protein. A gRNA comprises two parts: crispr RNA (crRNA), a short nucleotide sequence (e.g., 17-20 nucleotides) complementary to the target gene, and a CRISPR repeat sequence; and a tracrRNA, which serves as a binding scaffold for a genome editor protein. “gRNA” may reference crRNA alone, or crRNA combined with tracrRNA. In an embodiment where gRNA comprises crRNA and tracrRNA, the crRNA and tracrRNA may be linked together, or they may exist as separate components. A single-guide RNA (sgRNA) is a single RNA molecule comprising a crRNA fused to the scaffold tracrRNA by a linker loop. A gRNA may be used in combination with a template DNA to access the homology-directed repair (HDR) pathway for generating a gene editing event in the target gene. In some embodiments, the crRNA of a gRNA or a sgRNA has about or at least about 80% complementarity with a target gene. In some aspects, the crRNA has about or at least about 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementarity with a target gene. In various aspects, the crRNA has about or at least about 80-100%, 80- 99%, 80-95%, 80-90%, 80-85%, 90-100%, 90-99%, 90-95%, or 95-100% complementarity with a target gene. In various aspects, the crRNA has 100% complementarity with a target gene. In some embodiments, the gRNA or sgRNA sequence has less than 50% complementarity to the target gene. In various aspects, the gRNA or sgRNA has 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99% complementarity to the target gene. In some aspects, the gRNA or sgRNA has about or at least about 50-100%, 60-100%, 70-100%, 80- 100%, 90-100%, 95-100%, 50-90%, 60-90%, 70-90%, 80-90%, 85-90%, 50-80%, 60-80%, 70-80%, 75-80%, 50-70%, 60-70%, 65-70%, 50-60%, or 55-60% complementarity to the target gene.

[0071] In embodiments of the disclosure involving gene editing, the SNA of the disclosure (e.g., LNP-SNA, LSNA) further comprises a homology-directed repair (HDR) template. In various aspects, the HDR template comprises single stranded DNA or double stranded DNA. In various aspects, the HDR template comprises a plasmid or linear DNA. An HDR template comprises a donor nucleotide sequence to replace the target gene that is targeted by thegRNA or sgRNA. In some embodiments, the donor nucleotide sequence comprises the sequence of the target gene to be replaced, with one or more mutations introduced. In various embodiments, the donor nucleotide sequence comprises a truncated form of the target gene to be replaced. In various embodiments, the donor nucleotide sequence comprises a wild type version of the target gene to be replaced, wherein optionally the target gene in such an embodiment comprises a mutated form of the wild type gene. In various aspects, the mutated form of the wild type gene comprises one or more insertions, deletions, or substitutions. In some embodiments, the donor nucleotide sequence comprises a sequence unrelated to the sequence of the target gene to be replaced. The donor nucleotide sequence is flanked on either side by a homology arm. Homology arms can vary in length, but are typically greater than 40 nucleotides and are complementary to the corresponding portion of the target gene or the region surrounding the target gene. Homology arms can be oriented in either the sense or antisense direction relative to the target gene. In some aspects, the homology arms are 100% complementary to the corresponding portion of the target gene or the region surrounding the target gene. Some mismatches are tolerated in the homology arms. In various embodiments, the homology arms are about or at least about 99% complementary, about or at least about 98% complementary, or about or at least about 97% complementary to the corresponding portion of the target gene or the region surrounding the target gene. In some embodiments, the HDR template comprises the nucleotide sequence as set out in SEQ ID NO: 7. In various aspects, disclosed herein is a plasmid comprising a first nucleotide sequence encoding a genome editor protein, a second nucleotide sequence that is capable of being transcribed to produce a guide RNA (gRNA), and the homology-directed repair (HDR) template.

[0072] In some embodiments, the plasmid comprises a genome editor protein. In some embodiments, the second nucleotide sequence that comprises a guide RNA (gRNA) or is capable of being transcribed to produce a gRNA is a separate oligonucleotide from the plasmid. In some embodiments, the homology-directed repair (HDR) template is also a separate oligonucleotide from the first nucleotide sequence and the second nucleotide sequence. In some embodiments, the plasmid comprises a first nucleotide sequence encoding a genome editor protein and a second nucleotide sequence that is capable of being transcribed to produce a gRNA, and a HDR template is present as a separate oligonucleotide. In each of the aforementioned embodiments, the gRNA can comprise a sgRNA.

[0073] In various embodiments, the SNA comprises one or more homology-directed repair (HDR) templates. In some embodiments, the SNA comprises two or more homology-directed repair (HDR) templates. In various embodiments of the SNAs of the disclosure, the SNAcomprises a plasmid and a HDR template, wherein the ratio of HDR template to plasmid is between 15:1 and 1 :1 (weight to weight (w / w)). In various embodiments, the ratio of HDR template to plasmid is 15:1 , 14:1 , 13:1 , 12:1 , 11 :1 , 10:1 , 9:1 , 8:1 , 7:1 , 6:1 , 5:1 , 4:1 , 3:1 , 2:1 , or 1 :1 (w / w). In some embodiments, the ratio of HDR template to plasmid is 10:1 (w / w).

[0074] The CRISPR / Cas system has been modified to perform a number of functions besides gene knockout and editing, three examples of which are described below. Catalytically inactivated Cas9 (dCas9) has been fused to transcriptional activation and repression domains, thereby enabling programmable control of gene expression [Gilbert et al., Cell 154, 442-451 (2013); Zalatan et al., Cell 160, 339-350 (2015)]. The dCas9 transcriptional activator in particular enables novel screens analogous to siRNA or CRISPR knockout libraries, but where genes are over-expressed [Gilbert et al., Cell 159, 647-61 (2014)]. dCas9 fused to fluorescent proteins enable microscopic tracking of specific sites in the genome and study of sequence-specific nuclear organization [Chen et al., Cell 155, 1479-91 (2013)]. Finally, active Cas9 can be targeted to cleave a variety of nonfunctional genomic regions in a zygote, and the frequency and sequence of the mutation in each cell of the mature organism can be used to track lineages of cell differentiation during embryonic development [Mckenna et al., Science 42, 237-241 (2016)].

[0075] The term “TALEN” means a protein comprising a Transcription Activator-like (TAL) effector binding domain and a nuclease domain. TALEN is broad and includes a monomeric TALEN that can cleave double stranded DNA without assistance from another TALEN. The term TALEN is also used to refer to one or both members of a pair of TALENs that are engineered to work together to cleave DNA at the same site. TALENs that work together may be referred to as a left-TALEN and a right-TALEN, which references the handedness of DNA or a TALEN-pair. TALEN dimerization can result in a homodimeric TALEN when both monomeric TALEN are identical, or can result in a heterodimeric TALEN when monomeric TALEN are different. TALENs have been shown to induce gene modification in immortalized human cells by means of the two major eukaryotic DNA repair pathways, non-homologous end joining (NHEJ) and homology directed repair. TALENs are often used in pairs but monomeric TALENs are known. Cells for treatment by TALENs (and other genetic tools) include a cultured cell, an immortalized cell, a primary cell, a primary somatic cell, a zygote, a germ cell, a primordial germ cell, a blastocyst, or a stem cell. In some embodiments, a TAL effector can be used to target other protein domains (e.g., non-nuclease protein domains) to specific nucleotide sequences. For example, a TAL effector can be linked to a protein domain from, without limitation, a DNA interacting enzyme e.g., a methylase, a topoisomerase, an integrase, a transposase, or a ligase), a transcription activator or repressor, or a protein that interacts with or modifies other proteins such as histones.Applications of such TAL effector fusions include, for example, creating or modifying epigenetic regulatory elements, making site-specific insertions, deletions, or repairs in DNA, controlling gene expression, and modifying chromatin structure.

[0076] In some embodiments, the plasmid comprising a first nucleotide sequence encoding a genome editor protein comprises an additional nucleotide sequence encoding an additional genome editor. In various embodiments, the plasmid comprises two nucleotide sequence encoding two different genome editors. In some aspects, the two nucleotide sequences encoding different genome editors are operably linked to the same first promoter. In various aspects, the two nucleotide sequence encoding different genome editors are operably linked to different first promoters. In various embodiments, the plasmid comprising the first nucleotide sequence is between about 6-10 kilobases (kb), 7-10 kb, 8-10 kb, 9-10 kb, 9.5-10 kb, 6-9 kb, 7-9 kb, 8-9 kb, 8.5-9 kb, 6-8 kb, 7-8 kb, or 7.5-8 kb in size. In some embodiments, the plasmid comprising the first nucleotide sequence is about or at least about 7 kb, about or at least about 7.5 kb, about or at least about 8 kb, about or at least about 8.5 kb, about or at least about 9 kb, or about or at least about 9.5 kb in size. In various aspects, the plasmid comprising the first nucleotide sequence is about or at least about 8.5 kb in size.

[0077] In some embodiments, an SNA of the present disclosure comprises an additional nucleotide sequence. In various embodiments, the additional nucleotide sequence comprises an additional plasmid. In some aspects, the additional plasmid encodes a genome editor protein. In various aspects, the additional plasmid further comprises a nucleotide sequence capable of being transcribed to produce an sgRNA. In some aspects, the genome editor protein encoded by the additional plasmid is a different genome editor from the genome editor encoded by the plasmid. In various aspects, the additional plasmid comprises a nucleotide sequence capable of being transcribed to produce an sgRNA.

[0078] In some embodiments, the additional nucleotide sequence comprises a linear nucleotide sequence. In various embodiments, the linear nucleotide sequence comprises single-stranded DNA, double-stranded DNA, single-stranded RNA, or double-stranded RNA. In some aspects, the linear nucleotide sequence is RNA. In various aspects, the linear nucleotide sequence comprises a nucleotide sequence encoding a genome editor, and optionally the linear nucleotide sequence further comprises a nucleotide sequence capable of being transcribed to produce an sgRNA. In some aspects, the linear nucleotide sequence comprises a nucleotide sequence capable of being transcribed to produce an sgRNA.

[0079] In some aspects, the disclosure provides SNAs comprising a mRNA encoding a genome editor protein and a sgRNA, or a mRNA encoding a genome editor protein and a separate mRNA encoding a sgRNA. In various aspects, the SNA comprises a mRNAencoding a genome editor protein and a sgRNA, and a second mRNA encoding a different sgRNA. The disclosure further provides SNAs comprising a plasmid comprising a nucleotide sequence encoding a genome editor protein and a nucleotide sequence capable of being transcribed to produce an sgRNA, and optionally comprising an additional plasmid encoding a different genome editor protein. In various aspects, the additional plasmid further comprises a nucleotide sequence capable of being transcribed to produce a different sgRNA. In some aspects, the additional plasmid comprises a nucleotide sequence encoding the same genome editor protein as the plasmid, while comprising a nucleotide sequence capable of being transcribed to produce a different sgRNA. In some embodiments, the SNAs comprise a plasmid comprising a nucleotide sequence encoding a genome editor protein, and an additional plasmid comprising a nucleotide sequence capable of being transcribed to produce a sgRNA. In some embodiments, the disclosure provides SNAs that further comprise one or more homology-driven repair (HDR) templates. In some aspects, the one or more HDR templates comprise single-stranded DNA. In some aspects, the one or more HDR templates comprise double-stranded DNA.

[0080] In some embodiments, the additional nucleotide sequence comprises an immunostimulatory oligonucleotide (e.g., TLR agonist, CpG), an inhibitory oligonucleotide e.g., shRNA), and / or a targeting oligonucleotide.

[0081] Accordingly, in some aspects, the disclosure provides SNAs e.g., LSNAs, LNP- SNAs) for use in the delivery of gene editing proteins. In various embodiments, the gene editing protein(s) are in a ribonucleoprotein (RNP) complex. The ribonucleoprotein (RNP) complex encapsulated in a SNA comprises, in various embodiments, CRISPR-associated protein 9 (Cas9), CRISPR RNA (crRNA), trans-activating crRNA (tracrRNA), and / or Transcription Activator-like Effector Nucleases (TALENs). In some embodiments, the Cas9 utilized in the compositions and methods of the disclosure is EnGen® Cas9 NLS, S. pyogenes (New England Biolabs Catalog Number M0646T).Spherical Nucleic Acids (SNAs)

[0082] As described herein, spherical nucleic acids (SNAs) are a unique class of nanomaterials comprising a spherical nanoparticle core functionalized with a highly oriented oligonucleotide shell. The oligonucleotide shell comprises one or more oligonucleotides attached to the external surface of the nanoparticle core. In various embodiments, the shell of oligonucleotides comprises an inhibitory oligonucleotide, an immunostimulatory oligonucleotide, a gene editor substrate DNA or RNA, a targeting oligonucleotide, or a combination thereof. The nanoparticle core can either be organic e.g., a liposome), inorganic e.g., gold, silver, or platinum), polymer-based e.g., a poly (lactic-co-glycolic acid)(PLGA) particle), or hollow e.g., silica-based). In various embodiments of the disclosure, the nanoparticle core is a liposome (liposomal SNA (LSNA)) or a lipid nanoparticle (LNP- SNA).

[0083] The spherical architecture of the oligonucleotide shell confers unique advantages over traditional nucleic acid delivery methods, including entry into nearly all cells independent of transfection agents and resistance to nuclease degradation. Furthermore, SNAs can penetrate biological barriers, including the blood-brain (see, e.g., U.S. Patent Application Publication No. 2015 / 0031745, incorporated by reference herein in its entirety) and blood-tumor barriers as well as the epidermis (see, e.g., U.S. Patent Application Publication No. 2010 / 0233270, incorporated by reference herein in its entirety).

[0084] SNAs of the disclosure comprise a payload. In various embodiments, payloads include, but are not limited to, a plasmid, a therapeutic agent, or a combination thereof. Therapeutic agents include, but are not limited to, proteins, peptides, small molecules, linear oligonucleotides, or combinations thereof. In some embodiments, the payload comprises a plasmid and a therapeutic agent. In some embodiments, the payload comprises a plasmid and a protein. In some embodiments, the payload comprises a plasmid and a linear oligonucleotide. In some embodiments, the payload comprises a plasmid, a linear oligonucleotide, and a therapeutic agent. In some embodiments, the payload comprises one or more linear oligonucleotide. In various aspects, the one or more linear oligonucleotide comprises a mRNA and an sgRNA. In some aspects, the one or more linear oligonucleotide comprises a mRNA, a crRNA, and a tracrRNA. In some embodiments, the payload comprises a protein and a linear oligonucleotide. When delivered with an SNA, a payload can be encapsulated within an SNA, attached to the exterior of the nanoparticle core, attached to one or more oligonucleotides in the shell of oligonucleotides, or a combination thereof.

[0085] In various embodiments, the SNAs disclosed herein provide the additional benefit of enhanced cellular uptake and enhanced cellular viability ( / .e., reduced toxicity) when compared to non-SNAs e.g., liposomes and lipid nanoparticles that do not comprise a shell of oligonucleotides). Such benefits can be linked to the composition and structure of the SNAs themselves. In some aspects, wherein cells are contacted with the SNAs of the disclosure to deliver a payload the cells retain a viability of about or at least about 90%, whereas a comparable nanoparticle carrying the same payload yields cell viabilities of between 50-70%. In such an aspect, payload delivery with an SNA enhances cell viability by about 30% when compared to delivery with a nanoparticle that does not comprise a shell of oligonucleotides. In some aspects, payload delivery with an SNA enhances cell viability by between about 10-60%, 20-60%, 30-60%, 40-60%, 50-60%, 55-60%, 10-50%, 20-50%, 30-50%, 40-50%, 45-50%, 10-40%, 20-40%, 30-40%, 35-40%, 10-30%, 20-30%, 25-30%, 10- 20%, or 15-20% when compared to delivery with a nanoparticle that does not comprise a shell of oligonucleotides. Cellular viability refers to the percentage of cells alive posttreatment, and can be measured, for example, via Cell Counting Kit-8 (Millipore Sigma, 96992). Remarkably, SNAs exhibit less toxicity associated with nanoparticles that do not comprise a shell of oligonucleotides.

[0086] In some aspects, the payload is successfully delivered and taken up by at least about 90% of the cells contacted with an SNA, compared to about a 25% cellular uptake with a nanoparticle that does not comprise a shell of oligonucleotides. In some embodiments, payload delivery with an SNA enhances cellular uptake by about or at least about 150% when compared to delivery with a nanoparticle that does not comprise a shell of oligonucleotides. In some embodiments, payload delivery with an SNA enhances cellular uptake by between about 120-300%. In various embodiments, payload delivery with an SNA enhances cellular uptake by between about 100-300%, 120-300%, 140-300%, 160-300%, 180-300%, 200-300%, 220-300%, 240-300%, 260-300%, 280-300%, 290-300%, 150-250%, 170-250%, 190-250%, 210-250%, or 230-250%. Cellular uptake refers to the percentage of cells that successfully internalize the payload carried by an SNA or nanoparticle, and can be measured, for example, via flow cytometry with CRISPR machinery and a plasmid encoding EGFP as the payload. Surprisingly, SNAs demonstrate enhanced cellular uptake as compared nanoparticles that do not comprise a shell of oligonucleotides.

[0087] Further provided herein, in various aspects, is a method of administering a spherical nucleic acid (SNA) to a cell, wherein the method comprises comprising contacting a cell with the SNA. In some embodiments, the SNA lipid nanoparticle core comprises an ionizable lipid, a phospholipid, a sterol, and a lipid-polyethylene glycol (lipid-PEG) conjugate, and wherein the SNA further comprises a shell of oligonucleotides attached to the lipid nanoparticle core. In various embodiments, cellular uptake and cellular viability postadministration is enhanced when compared to a lipid nanoparticle that does not comprise a shell of oligonucleotides.Lipid Nanoparticle Spherical Nucleic Acids (LNP-SNAs)

[0088] Lipid nanoparticle spherical nucleic acids (LNP-SNAs) are comprised of a lipid nanoparticle core decorated with oligonucleotides. The lipid nanoparticle core comprises a plasmid, an ionizable lipid, a phospholipid, a sterol, and a lipid-polyethylene glycol (lipid- PEG) conjugate. The oligonucleotide shell comprises one or a plurality of oligonucleotides attached to the external surface of the lipid nanoparticle core. The spherical architecture of the oligonucleotide shell confers unique advantages over traditional nucleic acid deliverymethods, including entry into nearly all cells independent of transfection agents, resistance to nuclease degradation, sequence-based function, targeting, and diagnostics.

[0089] Accordingly, in various aspects, the disclosure provides a lipid nanoparticle spherical nucleic acid (LNP-SNA) comprising (a) a lipid nanoparticle core; and (b) a shell of oligonucleotides attached to the external surface of the lipid nanoparticle core. In some aspects, the lipid nanoparticle core comprises an ionizable lipid, a phospholipid, a sterol, and a lipid-polyethylene glycol (lipid-PEG) conjugate. In some embodiments, the lipid nanoparticle core comprises 45-55% ionizable lipid, 10-20% phospholipid, 30-40% sterol, and 1 -10% lipid-PEG conjugate. In some embodiments, the lipid-polyethylene glycol (lipid- PEG) conjugate comprises a functional group. In various aspects, the functional group is cycloalkyne, azide, maleimide, or thiol. In some embodiments, the lipid nanoparticle core comprises 12.5% (A9-Cis) PC phospholipid, 50% DLin-KC2-DMA, 35% cholesterol, and 2.5% DPPE-PEG(2000) Maleimide.

[0090] In some embodiments, the ionizable lipid is dilinoleylmethyl-4- dimethylaminobutyrate (DLin-MC3-DMA), 2,2-Dilinoleyl-4-dimethylaminoethyl-[1 ,3]-dioxolane (DLin-KC2-DMA), C12-200, 1 ,2-dioleoyl-3-dimethylammonium-propane (DODAP), similar lipid / lipidoid structures, or a combination thereof. In some embodiments, the phospholipid is 1 ,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1 ,2-Dihexadecanoyl phosphatidylcholine (DPPC), 1 ,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1 ,2- dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), or a combination thereof. In further embodiments, the sterol is 3p-Hydroxycholest-5-ene (Cholesterol), 9,10-Secocholesta- 5,7,10(19)-trien-3|3-ol (Vitamin D3), 9,10-Secoergosta-5,7,10(19),22-tetraen-3p-ol (Vitamin D2), Calcipotriol, 24-Ethyl-5,22-cholestadien-3p-ol (Stigmasterol), 22,23-Dihydrostigmasterol (P-Sitosterol), 3,28-Dihydroxy-lupeol (Betulin), Lupeol, Ursolic acid, Oleanolic acid, 24a- Methylcholesterol (Campesterol), 24-Ethylcholesta-5,24(28)E-dien-3p-ol (Fucosterol), 24- Methylcholesta-5,22-dien-3p-ol (Brassicasterol), 24-Methylcholesta-5,7,22-trien-3p-ol (Ergosterol), 9,11 -Dehydroergosterol, Daucosterol, or any of the foregoing sterols modified with one or more amino acids. In some embodiments, the lipid-polyethylene glycol (lipid- PEG) conjugate comprises 2000 Dalton (Da) polyethylene glycol. In further embodiments, the lipid-polyethylene glycol (lipid-PEG) conjugate is lipid-PEG-maleimide. In still further embodiments, the lipid-PEG-maleimide is 1 ,2-dipalmitoryl-sn-glycero-3- phosphoethanolamine (DPPE) conjugated to 2000 Da polyethylene glycol maleimide, 1 ,2- dimyristoyl-sn-glycero-3-phosphoethanolamine (DMPE) conjugated to 2000 Da polyethylene glycol maleimide, or a combination thereof. In some embodiments, the lipid nanoparticle core of the LNP-SNA comprises (A9-Cis) PC phospholipid, DLin-KC2-DMA, cholesterol, and DPPE-PEG(2000) Maleimide.Docket No.30938 / 2024-125R

[0091] Oligonucleotides contemplated for use according to the disclosure include those attached to a nanoparticle core (a lipid nanoparticle core or any other nanoparticle core described herein) through any means (e.g., covalent or non-covalent attachment). In any of the aspects or embodiments of the disclosure, an oligonucleotide is attached to the exterior of a lipid nanoparticle core via a covalent attachment of the oligonucleotide to a lipid- polyethylene glycol (lipid-PEG) conjugate. In some embodiments, about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% of the oligonucleotides in the shell of oligonucleotides are covalently attached to the exterior of the lipid nanoparticle core through the lipid-PEG conjugate. In various embodiments, one or more oligonucleotides in the oligonucleotide shell is attached to the exterior of the lipid nanoparticle core through a lipid anchor group. The lipid anchor group is, in various embodiments, attached to the 5'- or 3'- end of the oligonucleotide. In various embodiments, the lipid anchor group is cholesterol or tocopherol.

[0092] In some embodiments, a LNP-SNA comprises a payload, wherein the payload is, for example and without limitation, a protein, a small molecule, or a plasmid. In various embodiments, the payload is encapsulated by the LNP-SNA. In some embodiments, the payload comprises a plasmid. In various embodiments, the plasmid can comprise an oligonucleotide. In some embodiments, the oligonucleotide encodes a protein, or is capable of being transcribed to produce an RNA.

[0093] In various embodiments, the LNP-SNAs disclosed herein provide the additional benefit of enhanced cellular uptake and enhanced cellular viability (i.e., reduced toxicity) when compared to non-SNAs (e.g., lipid nanoparticles that do not comprise a shell of oligonucleotides). Such benefits can be linked to the composition and structure of the LNP- SNAs themselves. In some aspects, wherein cells are contacted with the LNP-SNAs of the disclosure to deliver a payload the cells retain a viability of about or at least about 90%, whereas a comparable nanoparticle carrying the same payload yields cell viabilities of between 50-70%. In such an aspect, payload delivery with an LNP-SNA enhances cell viability by about or at least about 30% when compared to delivery with a nanoparticle that does not comprise a shell of oligonucleotides. In some aspects, payload delivery with an LNP-SNA enhances cell viability by between about 10-60%, 20-60%, 30-60%, 40-60%, 50- 60%, 55-60%, 10-50%, 20-50%, 30-50%, 40-50%, 45-50%, 10-40%, 20-40%, 30-40%, 35- 40%, 10-30%, 20-30%, 25-30%, 10-20%, or 15-20% when compared to delivery with a lipid nanoparticle that does not comprise a shell of oligonucleotides. Cellular viability refers to the percentage of cells alive post-treatment, and can be measured, for example, via Cell Counting Kit-8 (Millipore Sigma, 96992). Remarkably, LNP-SNAs exhibit less toxicity associated with nanoparticles that do not comprise a shell of oligonucleotides.Docket No.30938 / 2024-125R

[0094] In some aspects, the payload is successfully delivered and taken up by about or at least about 90% of the cells contacted with an LNP-SNA, compared to about a 25% cellular uptake with a lipid nanoparticle that does not comprise a shell of oligonucleotides. In some embodiments, payload delivery with an LNP-SNA enhances cellular uptake by at least about 150% when compared to delivery with a lipid nanoparticle that does not comprise a shell of oligonucleotides. In some embodiments, payload delivery with an LNP-SNA enhances cellular uptake by between about 120-300%. In various embodiments, payload delivery with an LNP-SNA enhances cellular uptake by between about 100-300%, 120-300%, 140-300%, 160-300%, 180-300%, 200-300%, 220-300%, 240-300%, 260-300%, 280-300%, 290-300%, 150-250%, 170-250%, 190-250%, 210-250%, or 230-250%. Cellular uptake refers to the percentage of cells that successfully internalize the payload carried by an LNP-SNA or lipid nanoparticle, and can be measured, for example, via flow cytometry with CRISPR machinery and a plasmid encoding EGFP as the payload. Surprisingly, LNP-SNAs demonstrate enhanced cellular uptake as compared nanoparticles that do not comprise a shell of oligonucleotides.

[0095] In any of the aspects or embodiments of the disclosure, a LNP-SNA is synthesized such that a plasmid comprising a nucleotide sequence encoding a gene editing protein is encapsulated in the lipid nanoparticle core, and a shell of oligonucleotides is attached to the exterior of the lipid nanoparticle core. In general, and by way of example, lipid nanoparticles (LNPs) may be formulated by diluting the lipids and sterols in ethanol. In various aspects, the disclosure provides a lipid nanoparticle spherical nucleic acid (LNP-SNA) comprising (a) a lipid nanoparticle core; (b) a shell of oligonucleotides attached to the lipid nanoparticle core; and (c) a plasmid encapsulated by the nanoparticle core, wherein the plasmid comprises a first nucleotide sequence encoding a genome editor protein. In further aspects, the LNP- SNA further comprises (d) a second nucleotide sequence capable of being transcribed to produce a guide RNA (gRNA); and (e) a homology-directed repair (HDR) template.

[0096] In some embodiments, a LNP-SNA carrying a payload has an altered diameter when compared to an identical LNP carrying the same payload but not comprising a shell of oligonucleotides, and when compared to an LNP without a payload. As used herein, “diameter” can refer to the diameter of the nanoparticle core alone or the diameter of the nanoparticle core and the oligonucleotide shell. In some aspects, the diameter of the LNP- SNA carrying a payload is about or at least about 25% greater than the diameter of an LNP without a payload. In some aspects, the diameter of the LNP-SNA carrying a payload is between about 10-40%, 20-40%, 30-40%, 35-40%, 10-30%, 20-30%, 25-30%, 10-25%, 15- 25%, or 20-25% greater than the diameter of a LNP without a payload. In some embodiments, the diameter of the LNP-SNA carrying a payload is at least about 10-50 nmDocket No.30938 / 2024-125R greater than the diameter of an LNP without a payload. In various aspects, the diameter of the LNP-SNA carrying a payload is about or at least about 15-50 nm, 20-50 nm, 25-50 nm, 30-50 nm, 35-50 nm, 40-50 nm, 45-50 nm, 10-40 nm, 15-40 nm, 20-40 nm, 25-40 nm, 30-40 nm, 35-40 nm, 10-30 nm, 15-30 nm, 20-30 nm, 10-20 nm, or 15-20 nm greater than the diameter of an LNP without a payload. In various aspects, the diameter of the LNP-SNA carrying a payload is about or at least about 5% greater than the diameter of a comparable LNP carrying the same payload as the LNP-SNA. In various aspects, the diameter of the LNP-SNA carrying a payload is between about 1-20%, 3-20%, 5-20%, 10-20%, 15-20%, 1- 15%, 3-15%, 5-15%, 7-15%, 10-15%, 13-15%, 1-10%, 3-10%, 5-10%, 7-10%, or 9-10% greater than the diameter of a comparable LNP carrying the same payload as the LNP-SNA In some embodiments, the diameter of the LNP-SNA carrying a payload is about or at least about 2-25 nm greater than the diameter of a comparable LNP carrying the same payload as the LNP-SNA. In various aspects, the diameter of the LNP-SNA carrying a payload is at least about 5-25 nm, 7-25 nm, 10-25 nm, 15-25 nm, 20-25 nm, 2-20 nm, 5-20 nm, 7-20 nm, 10-20 nm, 15-20 nm, 2-15 nm, 5-15 nm, 7-15 nm, 10-15nm, 2-10 nm, 5-10 nm, 7-10 nm, 2-7 nm, or 2-5 nm greater than the diameter of a comparable LNP carrying the same payload as the LNP-SNA. In various embodiments, the diameter of the LNP-SNAs created by a method of the disclosure is about 1 nm to about 500 nm. In various embodiments, the diameter of a SNA of the disclosure (e.g., a LSNA or a LNP-SNA) is greater than or equal to about 50 nanometers (e.g., about 50 nanometers to about 500 nanometers, or about 50 nanometers to about 450 nanometers, or about 5 nanometers to about 400 nanometers, or about 50 nanometers to about 350 nanometers, or about 50 nanometers to about 300 nanometers, or about 50 nanometers to about 250 nanometers, or about 50 nanometers to about 200 nanometers, or about 50 nanometers to about 150 nanometers). In some embodiments, a plurality of SNAs (e.g., LNP-SNAs) is produced and the particles in the plurality have a mean diameter of greater than or equal to about 50 nanometers (e.g., about 50 nanometers to about 500 nanometers, or about 50 nanometers to about 450 nanometers, or about 5 nanometers to about 400 nanometers, or about 50 nanometers to about 350 nanometers, or about 50 nanometers to about 300 nanometers, or about 50 nanometers to about 250 nanometers, or about 50 nanometers to about 200 nanometers, or about 50 nanometers to about 150 nanometers). Liposomal Spherical Nucleic Acids (LSNAs)

[0097] Liposomes are spherical, self-closed structures in a varying size range comprising one or several hydrophobic lipid bilayers with a hydrophilic core. The diameter of these lipid based carriers range from 0.15-1 micrometers, which is significantly higher than an effective therapeutic range of 20-100 nanometers. Liposomes termed small unilamellar vesiclesDocket No.30938 / 2024-125R (SUVs), can be synthesized in the 20-50 nanometer size range, but encounter challenges such as instability and aggregation leading to inter-particle fusion. This inter-particle fusion limits the use of SUVs in therapeutics.

[0098] Liposomal spherical nucleic acids (LSNAs) are an attractive platform for therapeutic delivery due to their chemically tunable structures, biocompatibility, and ability to rapidly enter cells without transfection reagents. In some aspects, the instant disclosure provides methods for delivering a payload comprising contacting a cell with a LSNA.

[0099] The lipid bilayer comprises a plurality of lipid groups comprising, in various embodiments, a lipid from the phosphocholine family of lipids or the phosphoethanolamine family of lipids. Lipids contemplated by the disclosure include, without limitation, 1,2- dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dimyristoyl-sn-phosphatidylcholine (DMPC), 1-palmitoyl-2-oleoyl-sn-phosphatidylcholine (POPC), 1,2-distearoyl-sn-glycero-3- phospho-(1'-rac-glycerol) (DSPG), 1,2-dioleoyl-sn-glycero-3-phospho-(1'-rac-glycerol) (DOPG), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dipalmitoyl-sn-glycero-3- phosphocholine (DPPC), 1,2-di-(9Z-octadecenoyl)-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-dihexadecanoyl-sn-glycero-3-phosphoethanolamine (DPPE), 1,2-dioleoyl-sn- glycero-3-phospho-(1'-rac-glycerol) (DOPG), 1,2-distearoyl-sn-glycero-3- phosphoethanolamine (DSPE), cardiolipin, lipid A, or a combination thereof. In various embodiments, at least one oligonucleotide in the shell of oligonucleotides is attached to the exterior of the liposomal core through a lipid anchor group. In further embodiments, the lipid anchor group is attached to the 5’ end or the 3’ end of the at least one oligonucleotide. In still further embodiments, the lipid anchor group is tocopherol or cholesterol. Thus, in various embodiments, at least one (or all) of the oligonucleotides in the shell of oligonucleotides is an oligonucleotide-lipid conjugate containing a lipid anchor group, wherein said lipid anchor group is adsorbed into the lipid bilayer. The lipid anchor group comprises, in various embodiments, tocopherol, palmitoyl, dipalmitoyl, stearyl, distearyl, or cholesterol. In further aspects, the disclosure provides a LSNA having a substantially spherical geometry and comprising a lipid bilayer comprising a plurality of lipid groups; a ribonucleoprotein (RNP) complex encapsulated in the liposomal particle, the RNP comprising a gene editing protein (e.g., CRISPR-associated protein 9 (Cas9)) and guide RNA; and one or more oligonucleotides on the surface of the LSNA.

[0100] In some aspects, an architecture comprising a tocopherol modified oligonucleotide is disclosed. In various embodiments, tocopherol is contemplated to be on the 5' end or the 3' end of an oligonucleotide or modified form thereof. A tocopherol-modified oligonucleotide comprises a lipophilic end and a non-lipophilic end. The lipophilic end comprises tocopherol, and may be chosen from the group consisting of a tocopherol derivative, alpha-tocopherol,Docket No.30938 / 2024-125R beta-tocopherol, gamma-tocopherol and delta-tocopherol. The lipophilic end, in further embodiments, comprises palmitoyl, dipalmitoyl, stearyl, cholesterol, or distearyl.

[0101] In further aspects, the disclosure contemplates that cholesterol or phospholipids are used instead of tocopherol. Cholesterol is attached in solid phase oligonucleotide synthesis, where it is mixed with the prepared liposomes to form SNAs. In some embodiments, liposomes composed of 95% 1,2-dioleoyl-sn-glycero-3 phosphatidylcholine (DOPC) and 5% 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-(6-azidohexanoyl) (DPPE-Azide) are prepared as described below. Then DBCO-modified oligonucleotides are added, which react with the azide lipid to functionalize the surface. However, any biocompatible bioconjugation chemistries for DNA functionalization, such as maleimide-terminated lipids, are compatible with the SNAs of the disclosure.

[0102] In still further aspects, a phospholipid conjugated oligonucleotide is prepared as follows: first, a phosphatidylethanolamine lipid, such as DOPE, is reacted with succinimidyl 4-(p-maleimidophenyl)butyrate (SMPB) by mixing 25 mg / mL lipid, 1 equivalent SMPB and 1 equivalent of N,N-Diisopropylethylamine in chloroform. The mixture is reacted overnight. Next, the product is purified by flash chromatography using silica column (solvent A: dichloromethane, solvent B: methanol). The thiol-modified oligonucleotide (3' or 5' end modified) is reduced with 0.2M DTT and 0.1 M phosphate buffer (pH 8) at 40°C for 2 hours. The oligonucleotide is then purified in a size exclusion column using water. The phosphatidylethanolamine-SMPB lipid is dried over nitrogen gas and dissolved in ethanol in the same volume as the oligonucleotide. The oligonucleotide is then mixed with the lipid such that the reaction is 50:50 water and ethanol. This mixture is reacted overnight, and the excess lipid is extracted by washing the reaction mixture with chloroform three times. Next, the aqueous phase and the interface are dried and dissolved in water. All lipid-conjugated oligonucleotides as disclosed herein are contemplated to be used interchangeably in the preparation of LSNAs. The non-lipophilic end of the tocopherol-modified oligonucleotide is an oligonucleotide as described herein.

[0103] Methods of making oligonucleotides comprising a lipid anchor are disclosed herein. For example, first an oligonucleotide and phosphoramidite-modified tocopherol are provided. Then, the oligonucleotide is exposed to the phosphoramidite-modified tocopherol to create the tocopherol modified oligonucleotide. While not meant to be limiting, any chemistry known to one of skill in the art can be used to attach the tocopherol (or any lipid anchor) to the oligonucleotide, including amide linking or click chemistry.

[0104] The present disclosure provides LSNAs for use in methods including but not limited to the in vitro or in vivo delivery of payloads (e.g., to cells). In some aspects, the payloadDocket No.30938 / 2024-125R comprises an oligonucleotide encoding a genome editor proteins. Liposomal particles, for example as disclosed in International Patent Application No. PCT / US2014 / 068429 (incorporated by reference herein in its entirety, particularly with respect to the discussion of liposomal particles) are also contemplated by the disclosure. Liposomal particles of the disclosure have at least a substantially spherical geometry, an internal side and an external side, and comprise a lipid bilayer. Thus, in various aspects, the disclosure provides a spherical nucleic acid (SNA) comprising (a) a liposomal core; and (b) a shell of oligonucleotides attached to the liposomal core. In some embodiments, one or more oligonucleotides in the shell of oligonucleotides is a single stranded oligonucleotide.

[0105] In some embodiments, a LSNA comprises a payload, wherein the payload is a protein, a peptide, a linear oligonucleotide, a plasmid, and / or a small molecule. In various embodiments, the payload is encapsulated by the LSNA. In some embodiments, the payload comprises a plasmid. In various embodiments, the plasmid can comprise a nucleotide sequence. In some embodiments, the nucleotide sequence encodes a protein, or is capable of being transcribed to produce an RNA.

[0106] In various embodiments, the LSNAs disclosed herein provide the additional benefit of enhanced cellular uptake and enhanced cellular viability (i.e., reduced toxicity) when compared to non-SNAs (e.g., liposomes that do not comprise a shell of oligonucleotides). Such benefits can be linked to the composition and structure of the LSNAs themselves. In some aspects, wherein cells are contacted with the LSNAs of the disclosure to deliver a payload the cells retain a viability of about or at least about 90%, whereas a comparable liposome carrying the same payload yields cell viabilities of between 50-70%. In such aspects, payload delivery with an LSNA enhances cell viability by about or at least about 30% when compared to delivery with a liposome that does not comprise a shell of oligonucleotides. In some aspects, payload delivery with an LSNA enhances cell viability by between about 10-60%, 20-60%, 30-60%, 40-60%, 50-60%, 55-60%, 10-50%, 20-50%, 30- 50%, 40-50%, 45-50%, 10-40%, 20-40%, 30-40%, 35-40%, 10-30%, 20-30%, 25-30%, 10- 20%, or 15-20% when compared to delivery with a liposome that does not comprise a shell of oligonucleotides. Cellular viability refers to the percentage of cells alive post-treatment, and can be measured, for example, via Cell Counting Kit-8 (Millipore Sigma, 96992). Remarkably, SNAs exhibit less toxicity associated with nanoparticles that do not comprise a shell of oligonucleotides.

[0107] In some aspects, the payload is successfully delivered and taken up by about or at least about 90% of the cells contacted with an LSNA, compared to about a 25% cellular uptake with a liposome that does not comprise a shell of oligonucleotides. In some embodiments, payload delivery with an LSNA enhances cellular uptake by at least aboutDocket No.30938 / 2024-125R 150% when compared to delivery with a liposome that does not comprise a shell of oligonucleotides. In some embodiments, payload delivery with an LSNA enhances cellular uptake by between about 120-300%. In various embodiments, payload delivery with an LSNA enhances cellular uptake by between about 100-300%, 120-300%, 140-300%, 160- 300%, 180-300%, 200-300%, 220-300%, 240-300%, 260-300%, 280-300%, 290-300%, 150- 250%, 170-250%, 190-250%, 210-250%, or 230-250%. Cellular uptake refers to the percentage of cells that successfully internalize the payload carried by an LSNA or liposome, and can be measured, for example, via flow cytometry with CRISPR machinery and a plasmid encoding EGFP as the payload. Surprisingly, LSNAs demonstrate enhanced cellular uptake as compared nanoparticles that do not comprise a shell of oligonucleotides.

[0108] In various aspects, the disclosure further provides a spherical nucleic acid (SNA) comprising (a) a liposomal core; (b) a shell of oligonucleotides attached to the liposomal core; and (c) a plasmid comprising a nucleotide sequence encoding a genome editor protein. In further aspects, the LNP-SNA further comprises (d) a second nucleotide sequence capable of being transcribed to produce a guide RNA (gRNA); and (e) a homology-directed repair (HDR) template. In various embodiments, the methods comprise delivering plasmids comprising nucleotide sequences encoding gene editor proteins into cells by encapsulating them in LSNAs.

[0109] The disclosure also provides methods of making LSNAs. In some embodiments, oligonucleotides comprising lipid anchor groups are provided. Then, the phospholipid is added to the solvent to form a first mixture comprising liposomes. The size of the liposomes in the first mixture is between about 100 nanometers and about 150 nanometers. Next, the liposomes are disrupted to create a second mixture comprising liposomes and small unilamellar vesicles (SUV). The size of the liposomes and SUVs in the second mixture is between about 20 nanometers and about 150 nanometers. Next, the SUVs having a particle size between about 20 nanometers and about 50 nanometers are isolated from the second mixture. Finally, the lipid anchor group-modified oligonucleotide is added to the isolated SUVs to make a liposomal particle.

[0110] In some embodiments, an LSNA carrying a payload has an altered diameter when compared to an identical liposomal core carrying the same payload but not comprising a shell of oligonucleotides, and when compared to a liposomal core without a payload. As used herein, “diameter” can refer to the diameter of the liposomal core alone or the diameter of the liposomal core and the oligonucleotide shell. In some aspects, the diameter of the LSNA carrying a payload is about or at least about 25% greater than the diameter of a liposomal core without a payload. In some aspects, the diameter of the LSNA carrying a payload is between about 10-40%, 20-40%, 30-40%, 35-40%, 10-30%, 20-30%, 25-30%,Docket No.30938 / 2024-125R 10-25%, 15-25%, or 20-25% greater than the diameter of a liposomal core without a payload. In some embodiments, the diameter of the LSNA carrying a payload is about or at least about 10-50 nm greater than the diameter of a liposomal core without a payload. In various aspects, the diameter of the LSNA carrying a payload is about or at least about 15- 50 nm, 20-50 nm, 25-50 nm, 30-50 nm, 35-50 nm, 40-50 nm, 45-50 nm, 10-40 nm, 15-40 nm, 20-40 nm, 25-40 nm, 30-40 nm, 35-40 nm, 10-30 nm, 15-30 nm, 20-30 nm, 10-20 nm, or 15-20 nm greater than the diameter of a liposomal core without a payload. In various aspects, the diameter of the LSNA carrying a payload is about or at least about 5% greater than the diameter of a comparable liposomal core carrying the same payload as the LSNA. In various aspects, the diameter of the LSNA carrying a payload is between about 1-20%, 3- 20%, 5-20%, 10-20%, 15-20%, 1-15%, 3-15%, 5-15%, 7-15%, 10-15%, 13-15%, 1-10%, 3- 10%, 5-10%, 7-10%, or 9-10% greater than the diameter of a comparable liposomal core carrying the same payload as the LSNA. In some embodiments, the diameter of the LSNA carrying a payload is about or at least about 2-25 nm greater than the diameter of a comparable liposomal core carrying the same payload as the LSNA. In various aspects, the diameter of the LSNA carrying a payload is about or at least about 5-25 nm, 7-25 nm, 10-25 nm, 15-25 nm, 20-25 nm, 2-20 nm, 5-20 nm, 7-20 nm, 10-20 nm, 15-20 nm, 2-15 nm, 5-15 nm, 7-15 nm, 10-15nm, 2-10 nm, 5-10 nm, 7-10 nm, 2-7 nm, or 2-5 nm greater than the diameter of a comparable liposomal core carrying the same payload as the LSNA.

[0111] Further to diameters of SNAs that are contemplated herein, in still further embodiments the disclosure contemplates that the diameter of the LSNAs created by a method of the disclosure is less than or equal to about 100 nanometers. In some embodiments, a plurality of LSNAs is produced and the particles in the plurality have a mean diameter of less than or equal to about 100 nanometers (e.g., about 5 nanometers to about 100 nanometers, or about 5 nanometers to about 90 nanometers, or about 5 nanometers to about 80 nanometers, or about 5 nanometers to about 70 nanometers, or about 5 nanometers to about 60 nanometers, or about 5 nanometers to about 50 nanometers, or about 5 nanometers to about 40 nanometers, or about 5 nanometers to about 30 nanometers, or about 5 nanometers to about 20 nanometers, or about 10 nanometers to about 50 nanometers, or about 10 nanometers to about 100 nanometers, or about 90 nanometers, or about 10 nanometers to about 80 nanometers, or about 10 nanometers to about 70 nanometers, or about 10 nanometers to about 60 nanometers, or about 10 nanometers to about 50 nanometers, or about 10 nanometers to about 40 nanometers, or about 10 nanometers to about 30 nanometers, or about 10 nanometers to about 20 nanometers, or about 20 nanometers to about 100 nanometers, or about 30 nanometers to about 100 nanometers, or about 30 nanometers to about 100 nanometers, or about 40Docket No.30938 / 2024-125R nanometers to about 100 nanometers, or about 50 nanometers to about 100 nanometers, or about 60 nanometers to about 100 nanometers, or about 70 nanometers to about 100 nanometers, or about 80 nanometers to about 100 nanometers, or about 90 nanometers to about 100 nanometers). In further embodiments, the particles in the plurality of LSNAs created by a method of the disclosure have a mean diameter of less than or equal to about 20 nanometers, or less than or equal to about 25 nanometers, or less than or equal to about 30 nanometers, or less than or equal to about 35 nanometers, or less than or equal to about 40 nanometers, or less than or equal to about 45 nanometers, or less than or equal to about 50 nanometers, or less than or equal to about 55 nanometers, or less than or equal to about 60 nanometers, or less than or equal to about 65 nanometers, or less than or equal to about 70 nanometers, or less than or equal to about 75 nanometers, or less than or equal to about 80 nanometers, or less than or equal to about 85 nanometers, or less than or equal to about 90 nanometers, or less than or equal to about 95 nanometers.

[0112] In some aspects, the method comprises: (1) adding 1X PBS to dry lipids to a final concentration of 1-25 mg / mL (thus, in various embodiments, the final concentration is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 mg / ml); (2) freezing rapidly in liquid nitrogen and thawing in a bath sonicator 3 times; (3) extruding through 200, 100, 80, 50 and 30 nm filters. Double filters are used and typically passed 2-10 times through each filter. In some embodiments, the process is stopped at 50 nm, but if 30 nm structures are desired, then the 30 nm filter is additionally added. In further aspects, when 30 nm liposomes are desired, one probe sonicates after step (2). Next, the liposomes are centrifuged at 21000 x g for 10 minutes to remove metal shavings that come off in sonication and the mixture is extruded through a 30 nm filter as described in step (3).

[0113] Thus, in some aspects, the disclosure provides a method of making a LSNA, comprising adding a phospholipid to a solvent to form a first mixture, said first mixture comprising a plurality of liposomes; disrupting said plurality of liposomes to create a second mixture, said second mixture comprising a liposome and a small unilamellar vesicle (SUV); isolating said SUV from said second mixture, said SUV having a particle size between about 10 nanometers and 50 nanometers; and adding an oligonucleotide or a plurality of oligonucleotides to the isolated SUV to make the LSNA. Oligonucleotides

[0114] The disclosure provides spherical nucleic acids (e.g., LSNAs, LNP-SNAs) comprising a nanoparticle core and a shell of oligonucleotides attached to the exterior of the nanoparticle core. As described herein, the nanoparticle core further comprises an encapsulated plasmid comprising a nucleotide sequence encoding a genome editor protein.Docket No.30938 / 2024-125R Oligonucleotides of the disclosure include, in various embodiments, DNA oligonucleotides, RNA oligonucleotides, modified forms thereof, or a combination thereof. In any aspect or embodiment described herein, an oligonucleotide is single-stranded, double-stranded, or partially double-stranded. In any aspects or embodiments of the disclosure, an oligonucleotide comprises a detectable marker.

[0115] In some aspects, the shell of oligonucleotides is attached to the exterior of the nanoparticle core at a surface density that is at least about 1 pmol / cm2, 1.5 pmol / cm2, or 2 pmoles / cm2. In some aspects, the surface density of a SNA of the disclosure (e.g., a LSNA or a LNP-SNA) is at least 15 pmoles / cm2. SNAs are also provided wherein the oligonucleotide is attached to the nanoparticle core of the SNA at a surface density of about 0.5 pmol / cm2to about 1000 pmol / cm2, or about 2 pmol / cm2to about 200 pmol / cm2, or about 10 pmol / cm2to about 100 pmol / cm2. In some embodiments, the surface density is about 1.7 pmol / cm2. In some embodiments, the surface density is about 2 pmol / cm2. In further embodiments, the surface density is at least about 0.5 pmol / cm2, at least about 0.6 pmol / cm2, at least about 0.7 pmol / cm2, at least about 0.8 pmol / cm2, at least about 0.9 pmol / cm2, at least about 1 pmol / mc2, at least about 1.5 pmol / cm2, at least about 2 pmol / cm2, at least 3 pmol / cm2, at least 4 pmol / cm2, at least 5 pmol / cm2, at least 6 pmol / cm2, at least 7 pmol / cm2, at least 8 pmol / cm2, at least 9 pmol / cm2, at least 10 pmol / cm2, at least about 15 pmol / cm2, at least about 19 pmol / cm2, at least about 20 pmol / cm2, at least about 25 pmol / cm2, at least about 30 pmol / cm2, at least about 35 pmol / cm2, at least about 40 pmol / cm2, at least about 45 pmol / cm2, at least about 50 pmol / cm2, at least about 55 pmol / cm2, at least about 60 pmol / cm2, at least about 65 pmol / cm2, at least about 70 pmol / cm2, at least about 75 pmol / cm2, at least about 80 pmol / cm2, at least about 85 pmol / cm2, at least about 90 pmol / cm2, at least about 95 pmol / cm2, at least about 100 pmol / cm2, at least about 125 pmol / cm2, at least about 150 pmol / cm2, at least about 175 pmol / cm2, at least about 200 pmol / cm2, at least about 250 pmol / cm2, at least about 300 pmol / cm2, at least about 350 pmol / cm2, at least about 400 pmol / cm2, at least about 450 pmol / cm2, at least about 500 pmol / cm2, at least about 550 pmol / cm2, at least about 600 pmol / cm2, at least about 650 pmol / cm2, at least about 700 pmol / cm2, at least about 750 pmol / cm2, at least about 800 pmol / cm2, at least about 850 pmol / cm2, at least about 900 pmol / cm2, at least about 950 pmol / cm2, at least about 1000 pmol / cm2or more. In further embodiments, the surface density is less than about 2 pmol / cm2, less than about 3 pmol / cm2, less than about 4 pmol / cm2, less than about 5 pmol / cm2, less than about 6 pmol / cm2, less than about 7 pmol / cm2, less than about 8 pmol / cm2, less than about 9 pmol / cm2, less than about 10 pmol / cm2, less than about 15 pmol / cm2, less than about 19 pmol / cm2, less than about 20 pmol / cm2, less than about 25 pmol / cm2, less than about 30Docket No.30938 / 2024-125R pmol / cm2, less than about 35 pmol / cm2, less than about 40 pmol / cm2, less than about 45 pmol / cm2, less than about 50 pmol / cm2, less than about 55 pmol / cm2, less than about 60 pmol / cm2, less than about 65 pmol / cm2, less than about 70 pmol / cm2, less than about 75 pmol / cm2, less than about t 80 pmol / cm2, less than about 85 pmol / cm2, less than about 90 pmol / cm2, less than about 95 pmol / cm2, less than about 100 pmol / cm2, less than about 125 pmol / cm2, less than about 150 pmol / cm2, less than about 175 pmol / cm2, less than about 200 pmol / cm2, less than about 250 pmol / cm2, less than about 300 pmol / cm2, less than about 350 pmol / cm2, less than about 400 pmol / cm2, less than about 450 pmol / cm2, less than about 500 pmol / cm2, less than about 550 pmol / cm2, less than about 600 pmol / cm2, less than about 650 pmol / cm2, less than about 700 pmol / cm2, less than about 750 pmol / cm2, less than about 800 pmol / cm2, less than about 850 pmol / cm2, less than about 900 pmol / cm2, less than about 950 pmol / cm2, or less than about 1000 pmol / cm2.

[0116] Alternatively, the density of oligonucleotide attached to the exterior of a nanoparticle core is measured by the number of oligonucleotides attached to the exterior of the nanoparticle core. With respect to the surface density of oligonucleotides on the surface of nanoparticle core of the disclosure, it is contemplated that a nanoparticle core (e.g., a LSNA or a LNP-SNA) as described herein comprises from about 2 to about 10,000 oligonucleotides on its surface. In some embodiments, a nanoparticle core comprises from about 10 to about 10,000 oligonucleotides on its surface. In various embodiments, a nanoparticle core comprises from about 10 to about 9,000, or from about 10 to about 8,000, or from about 10 to about 7,000, or from about 10 to about 6,000, or from about 10 to about 5,000, or from about 10 to about 4,000, or from about 10 to about 3,000, or from about 10 to about 2,000, or from about 10 to about 1,000, or from about 10 to about 500, or from about 10 to about 400, or from about 10 to about 300, or from about 10 to about 200, or from about 10 to about 100, or from about 10 to about 50 oligonucleotides on its surface. In some embodiments, a SNA comprises about 80 to about 150 oligonucleotides in the shell of oligonucleotides attached to the nanoparticle core. In further embodiments, a SNA comprises at least about 5, 10, 20, 30, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 500, 1,000, 2,000, 3,000, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000, or 10,000 oligonucleotides in the shell of oligonucleotides attached to the nanoparticle core. In further embodiments, a SNA comprises less than about 5, 10, 20, 30, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 500, 1,000, 2,000, 3,000, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000, or 10,000 oligonucleotides in the shell of oligonucleotides attached to the nanoparticle core. In further embodiments, the shell of oligonucleotides attached to the nanoparticle coreDocket No.30938 / 2024-125R of the SNA consists of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 500, 1,000, 2,000, 3,000, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000, or 10,000 oligonucleotides in the shell of oligonucleotides attached to the nanoparticle core. In still further embodiments, the shell of oligonucleotides attached to the nanoparticle core of the SNA comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 50, 60, 70, 75, 80, 90, 100, 150, 160, 170, 175, 180, 190, 200, 500, 1,000, 2,000, 3,000, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000, 10,000, or more oligonucleotides. In some embodiments, the shell of oligonucleotides comprises about 10 to about 80 oligonucleotides. In some embodiments, the shell of oligonucleotides comprises about 10 to about 200 oligonucleotides. In some embodiments, the shell of oligonucleotides comprises or consists of about 75 oligonucleotides. In some embodiments, the shell of oligonucleotides attached to the nanoparticle core of the SNA comprises or consists of 100 oligonucleotides. In some embodiments, the shell of oligonucleotides attached to the nanoparticle core of the SNA comprises or consists of 200 oligonucleotides. In some embodiments, the shell of oligonucleotides attached to the nanoparticle core of the SNA comprises or consists of 400 oligonucleotides. In some embodiments, a nanoparticle core comprises from about 2 to about 500 oligonucleotides on its surface. In various embodiments, a nanoparticle core comprises from about 10 to about 100, or from 10 to about 90, or from about 10 to about 80, or from about 10 to about 70, or from about 10 to about 60, or from about 10 to about 50, or from about 10 to about 40, or from about 10 to about 30, or from about 10 to about 20, or from about 50 to about 100, or from about 60 to about 100, or from about 70 to about 100, or from about 80 to about 100, or from about 90 to about 100 oligonucleotides on its surface. In further embodiments, a nanoparticle core comprises or consists of at least about 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, or 400 oligonucleotides on its surface. In some embodiments, an SNA comprises or consists of 70 oligonucleotides on its surface. Additional surface densities for SNAs are described herein below.

[0117] As described herein, modified forms of oligonucleotides are also contemplated by the disclosure which include those having at least one modified internucleotide linkage. In some embodiments, the oligonucleotide is all or in part a peptide nucleic acid. Other modified internucleoside linkages include at least one phosphorothioate linkage. Still other modified oligonucleotides include those comprising one or more universal bases. "Universal base" refers to molecules capable of substituting for binding to any one of A, C, G, T and U in nucleic acids by forming hydrogen bonds without significant structure destabilization. The oligonucleotide incorporated with the universal base analogues is able to function, e.g., as aDocket No.30938 / 2024-125R probe in hybridization. Examples of universal bases include but are not limited to 5’- nitroindole-2’-deoxyriboside, 3-nitropyrrole, inosine and hypoxanthine.

[0118] The term "nucleotide" or its plural as used herein is interchangeable with modified forms as discussed herein and otherwise known in the art. The term "nucleobase" or its plural as used herein is interchangeable with modified forms as discussed herein and otherwise known in the art. Nucleotides or nucleobases comprise the naturally occurring nucleobases A, G, C, T, and U. Non-naturally occurring nucleobases include, for example and without limitations, xanthine, diaminopurine, 8-oxo-N6-methyladenine, 7-deazaxanthine, 7-deazaguanine, N4,N4-ethanocytosin, N’,N’-ethano-2,6-diaminopurine, 5-methylcytosine (mC), 5-(C3—C6)-alkynyl-cytosine, 5-fluorouracil, 5-bromouracil, pseudoisocytosine, 2- hydroxy-5-methyl-4-tr- iazolopyridin, isocytosine, isoguanine, inosine and the "non-naturally occurring" nucleobases described in Benner et al., U.S. Patent No.5,432,272 and Susan M. Freier and Karl-Heinz Altmann, 1997, Nucleic Acids Research, vol.25: pp 4429-4443. The term "nucleobase" also includes not only the known purine and pyrimidine heterocycles, but also heterocyclic analogues and tautomers thereof. Further naturally and non-naturally occurring nucleobases include those disclosed in U.S. Patent No.3,687,808 (Merigan, et al.), in Chapter 15 by Sanghvi, in Antisense Research and Application, Ed. S. T. Crooke and B. Lebleu, CRC Press, 1993, in Englisch et al., 1991, Angewandte Chemie, International Edition, 30: 613-722 (see especially pages 622 and 623, and in the Concise Encyclopedia of Polymer Science and Engineering, J. I. Kroschwitz Ed., John Wiley & Sons, 1990, pages 858-859, Cook, Anti-Cancer Drug Design 1991, 6, 585-607, each of which are hereby incorporated by reference in their entirety). In various aspects, oligonucleotides also include one or more "nucleosidic bases" or "base units" which are a category of non-naturally- occurring nucleotides that include compounds such as heterocyclic compounds that can serve like nucleobases, including certain "universal bases" that are not nucleosidic bases in the most classical sense but serve as nucleosidic bases. Universal bases include 3- nitropyrrole, optionally substituted indoles (e.g., 5-nitroindole), and optionally substituted hypoxanthine. Other desirable universal bases include, pyrrole, diazole or triazole derivatives, including those universal bases known in the art.

[0119] Examples of oligonucleotides include those containing modified backbones or non- natural internucleoside linkages. Oligonucleotides having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone. Modified oligonucleotides that do not have a phosphorus atom in their internucleoside backbone are considered to be within the meaning of "oligonucleotide".

[0120] Modified oligonucleotide backbones containing a phosphorus atom include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates,Docket No.30938 / 2024-125R phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3’-alkylene phosphonates, 5’-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3’-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, selenophosphates and boranophosphates having normal 3’-5’ linkages, 2’-5’ linked analogs of these, and those having inverted polarity wherein one or more internucleotide linkages is a 3’ to 3’, 5’ to 5’ or 2’ to 2’ linkage. Also contemplated are oligonucleotides having inverted polarity comprising a single 3’ to 3’ linkage at the 3’-most internucleotide linkage, i.e. a single inverted nucleoside residue which may be abasic (the nucleotide is missing or has a hydroxyl group in place thereof). Salts, mixed salts and free acid forms are also contemplated. Representative United States patents that teach the preparation of the above phosphorus-containing linkages include, U.S. Pat. Nos.3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,194,599; 5,565,555; 5,527,899; 5,721,218; 5,672,697; and 5,625,050, the disclosures of which are incorporated by reference herein.

[0121] Modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages; siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; riboacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts. See, for example, U.S. Patent Nos.5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; 5,792,608; 5,646,269; and 5,677,439, the disclosures of which are incorporated herein by reference in their entireties.

[0122] In still further embodiments, oligonucleotide mimetics wherein both one or more sugar and / or one or more internucleotide linkage of the nucleotide units are replaced with "non-naturally occurring" groups are contemplated. The bases of the oligonucleotide are maintained for hybridization. In some aspects, this embodiment contemplates a peptide nucleic acid (PNA). In PNA compounds, the sugar-backbone of an oligonucleotide isDocket No.30938 / 2024-125R replaced with an amide containing backbone. See, for example US Patent Nos.5,539,082; 5,714,331; and 5,719,262, and Nielsen et al., Science, 1991, 254, 1497-1500, the disclosures of which are herein incorporated by reference.

[0123] In still further embodiments, oligonucleotides are provided with phosphorothioate backbones and oligonucleosides with heteroatom backbones, and including —CH2—NH— O—CH2—, —CH2—N(CH3)—O—CH2—, —CH2—O—N(CH3)—CH2—, —CH2—N(CH3)— N(CH3)—CH2— and —O—N(CH3)—CH2—CH2— described in US Patent Nos.5,489,677, and 5,602,240. Also contemplated are oligonucleotides with morpholino backbone structures described in U.S. Patent No.5,034,506.

[0124] In various forms, the linkage between two successive monomers in the oligonucleotide consists of 2 to 4, desirably 3, groups / atoms selected from —CH2—, —O—, —S—, —NRH—, >C=O, >C=NRH, >C=S, —Si(R")2—, —SO—, —S(O)2—, —P(O)2—, — PO(BH3) —, —P(O,S) —, —P(S)2—, —PO(R")—, —PO(OCH3) —, and —PO(NHRH)—, where RHis selected from hydrogen and C1-4-alkyl, and R" is selected from C1-6-alkyl and phenyl. Illustrative examples of such linkages are —CH2—CH2—CH2—, —CH2—CO— CH2—, —CH2—CHOH—CH2—, —O—CH2—O—, —O—CH2—CH2—, —O—CH2— CH=(including R5when used as a linkage to a succeeding monomer), —CH2—CH2—O—, — NRH—CH2—CH2—, —CH2—CH2—NRH—, —CH2—NRH—CH2— -, —O—CH2—CH2— NRH—, —NRH—CO—O—, —NRH—CO—NRH—, —NRH—CS—NRH—, —NRH—C(=NRH)— NRH—, —NRH—CO—CH2—NRH—O—CO—O—, —O—CO—CH2—O—, —O—CH2—CO— O—, —CH2—CO—NRH—, —O—CO—NRH—, —NRH—CO—CH2 —, —O—CH2—CO— NRH—, —O—CH2—CH2—NRH—, —CH=N—O—, —CH2—NRH—O—, —CH2—O— N=(including R5when used as a linkage to a succeeding monomer), —CH2—O—NRH—, —S— CH2—CH=(including R5when used as a linkage to a succeeding monomer), —S— CH2— CH2—, —S— CH2— CH2—- O—, —S— CH2— CH2—S—, — CH2—S— CH2—, — CH2—SO— CH2—, — CH2—SO2— CH2—, —O—SO—O—, —O—S(O)2—O—, —O— S(O)2— CH2—, —O—S(O)2—NRH—, —NRH—S(O)2— CH2—; —O—S(O)2— CH2—, —O— P(O)2—O—, —O—P(O,S)—O—, —O—P(S)2—O—, —S—P(O)2—O—, —S—P(O,S)—O—, —S—P(S)2—O—, —O—P(O)2—S—, —O—P(O,S)—S—, —O—P(S)2—S—, —S—P(O)2— S—, —S—P(O,S)—S—, —S—P(S)2—S—, —O—PO(R")—O—, —O—PO(OCH3)—O—, — O—PO(O CH2CH3)—O—, —O—PO(O CH2CH2S—R)—O—, —O—PO(BH3)—O—, —O— PO(NHRN)—O—, —O—P(O)2—NRHH—, —NRH—P(O)2—O—, —O—P(O,NRH)—O—, — CH2—P(O)2—O—, —O—P(O)2— CH2—, and —O—Si(R")2—O—; among which — CH2— CO—NRH—, — CH2—NRH—O—, —S— CH2—O—, —O—P(O)2—O—O—P(- O,S)—O—,Docket No.30938 / 2024-125R —O—P(S)2—O—, —NRHP(O)2—O—, —O—P(O,NRH)—O—, —O—PO(R")—O—, —O— PO(CH3)—O—, and —O—PO(NHRN)—O—, where RHis selected form hydrogen and C1-4- alkyl, and R" is selected from C1-6-alkyl and phenyl, are contemplated. Further illustrative examples are given in Mesmaeker et. al., Current Opinion in Structural Biology 1995, 5, 343- 355 and Susan M. Freier and Karl-Heinz Altmann, Nucleic Acids Research, 1997, vol 25, pp 4429-4443.

[0125] Still other modified forms of oligonucleotides are described in detail in U.S. Patent Application Publication No.20040219565, the disclosure of which is incorporated by reference herein in its entirety.

[0126] Modified oligonucleotides may also contain one or more substituted sugar moieties. In certain aspects, oligonucleotides comprise one of the following at the 2’ position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C1 to C10 alkyl or C2 to C10 alkenyl and alkynyl. Other embodiments include O[(CH2)nO]mCH3, O(CH2)nOCH3, O(CH2)nNH2, O(CH2)nCH3, O(CH2)nONH2, and O(CH2)nON[(CH2)nCH3]2, where n and m are from 1 to about 10. Other oligonucleotides comprise one of the following at the 2’ position: C1 to C10 lower alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O- aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, or an RNA cleaving group. In one aspect, a modification includes 2’-methoxyethoxy (2’-O- CH2CH2OCH3, also known as 2’-O-(2-methoxyethyl) or 2’-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78, 486-504) i.e., an alkoxyalkoxy group. Other modifications include 2’- dimethylaminooxyethoxy, i.e., a O(CH2)2ON(CH3)2 group, also known as 2’-DMAOE, and 2’- dimethylaminoethoxyethoxy (also known in the art as 2’-O-dimethyl-amino-ethoxy-ethyl or 2’- DMAEOE), i.e., 2’-O—CH2—O—CH2—N(CH3)2.

[0127] Still other modifications include 2’-methoxy (2’-O—CH3), 2’-aminopropoxy (2’- OCH2CH2CH2NH2), 2’-allyl (2’-CH2—CH=CH2), 2’-O-allyl (2’-O—CH2—CH=CH2) and 2’- fluoro (2’-F). The 2’-modification may be in the arabino (up) position or ribo (down) position. In one aspect, a 2’-arabino modification is 2’-F. Similar modifications may also be made at other positions on the oligonucleotide, for example, at the 3’ position of the sugar on the 3’ terminal nucleotide or in 2’-5’ linked oligonucleotides and the 5’ position of 5’ terminal nucleotide. Oligonucleotides may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. See, for example, U.S. Pat. Nos.4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873;Docket No.30938 / 2024-125R 5,670,633; 5,792,747; and 5,700,920, the disclosures of which are incorporated by reference in their entireties herein.

[0128] In some aspects, a modification of the sugar includes Locked Nucleic Acids (LNAs) in which the 2’-hydroxyl group is linked to the 3’ or 4’ carbon atom of the sugar ring, thereby forming a bicyclic sugar moiety. The linkage is in certain aspects is a methylene (—CH2—)n group bridging the 2’ oxygen atom and the 4’ carbon atom wherein n is 1 or 2. LNAs and preparation thereof are described in WO 98 / 39352 and WO 99 / 14226.

[0129] Modified nucleotides are further described in EP 1072679 and WO 97 / 12896, the disclosures of which are incorporated herein by reference. Modified nucleobases include without limitation, 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8- azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine. Further modified bases include tricyclic pyrimidines such as phenoxazine cytidine(1H-pyrimido[5 ,4-b][1,4]benzoxazin-2(3H)-one), phenothiazine cytidine (1H-pyrimido[5 ,4-b][1,4]benzothiazin-2(3H)-one), G-clamps such as a substituted phenoxazine cytidine (e.g.9-(2-aminoethoxy)-H-pyrimido[5,4-b][1,4]benzox- azin-2(3H)- one), carbazole cytidine (2H-pyrimido[4,5-b]indol-2-one), pyridoindole cytidine (H- pyrido[3’,2’:4,5]pyrrolo[2,3-d]pyrimidin-2-one). Modified bases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7- deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Additional nucleobases include those disclosed in U.S. Pat. No.3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. I., ed. John Wiley & Sons, 1990, those disclosed by Englisch et al., 1991, Angewandte Chemie, International Edition, 30: 613, and those disclosed by Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., ed., CRC Press, 1993. Certain of these bases are useful for increasing binding affinity and include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine.5- methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2° C and are, in certain aspects combined with 2’-O-methoxyethyl sugar modifications.Docket No.30938 / 2024-125R See, U.S. Patent Nos.3,687,808, U.S. Pat. Nos.4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; 5,645,985; 5,830,653; 5,763,588; 6,005,096; 5,750,692 and 5,681,941, the disclosures of which are incorporated herein by reference.

[0130] Methods of making oligonucleotides of a predetermined sequence are well-known. See, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual (2nd ed.1989) and F. Eckstein (ed.) Oligonucleotides and Analogues, 1st Ed. (Oxford University Press, New York, 1991). Solid-phase synthesis methods are preferred for both polyribonucleotides and polydeoxyribonucleotides (the well-known methods of synthesizing DNA are also useful for synthesizing RNA). Polyribonucleotides can also be prepared enzymatically. Non-naturally occurring nucleobases can be incorporated into the oligonucleotide, as well. See, e.g., U.S. Patent No.7,223,833; Katz, J. Am. Chem. Soc., 74:2238 (1951); Yamane, et al., J. Am. Chem. Soc., 83:2599 (1961); Kosturko, et al., Biochemistry, 13:3949 (1974); Thomas, J. Am. Chem. Soc., 76:6032 (1954); Zhang, et al., J. Am. Chem. Soc., 127:74-75 (2005); and Zimmermann, et al., J. Am. Chem. Soc., 124:13684-13685 (2002).

[0131] In various aspects, an oligonucleotide of the disclosure, or a modified form thereof, is generally about 5 nucleotides to about 100 nucleotides in length. More specifically, an oligonucleotide of the disclosure is about 5 to about 90 nucleotides in length, about 5 to about 80 nucleotides in length, about 5 to about 70 nucleotides in length, about 5 to about 60 nucleotides in length, about 5 to about 50 nucleotides in length about 5 to about 45 nucleotides in length, about 5 to about 40 nucleotides in length, about 5 to about 35 nucleotides in length, about 5 to about 30 nucleotides in length, about 5 to about 25 nucleotides in length, about 5 to about 20 nucleotides in length, about 5 to about 15 nucleotides in length, about 5 to about 10 nucleotides in length, about 10 to about 100 nucleotides in length, about 10 to about 90 nucleotides in length, about 10 to about 80 nucleotides in length, about 10 to about 70 nucleotides in length, about 10 to about 60 nucleotides in length, about 10 to about 50 nucleotides in length about 10 to about 45 nucleotides in length, about 10 to about 40 nucleotides in length, about 10 to about 35 nucleotides in length, about 10 to about 30 nucleotides in length, about 10 to about 25 nucleotides in length, about 10 to about 20 nucleotides in length, about 10 to about 15 nucleotides in length, about 18 to about 28 nucleotides in length, about 15 to about 26 nucleotides in length, and all oligonucleotides intermediate in length of the sizes specifically disclosed to the extent that the oligonucleotide is able to achieve the desired result. In further embodiments, an oligonucleotide of the disclosure is about 5 to about 100 nucleotides in length, about 5 to about 90 nucleotides in length, about 5 to about 80Docket No.30938 / 2024-125R nucleotides in length, about 5 to about 70 nucleotides in length, about 5 to about 60 nucleotides in length, about 5 to about 50 nucleotides in length, about 5 to about 40 nucleotides in length, about 5 to about 30 nucleotides in length, about 5 to about 20 nucleotides in length, about 5 to about 10 nucleotides in length, and all oligonucleotides intermediate in length of the sizes specifically disclosed to the extent that the oligonucleotide is able to achieve the desired result. In further embodiments, an oligonucleotide of the disclosure is about 25 to about 55 nucleotides in length. Accordingly, in various embodiments, an oligonucleotide of the disclosure is or is at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, or more nucleotides in length. In further embodiments, an oligonucleotide of the disclosure is less than 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, or more nucleotides in length. In various embodiments, the shell of oligonucleotides attached to the exterior of the nanoparticle core of the SNA comprises a plurality of oligonucleotides that all have the same length / sequence, while in some embodiments, the plurality of oligonucleotides comprises one or more oligonucleotide that have a different length and / or sequence relative to at least one other oligonucleotide in the plurality. In various embodiments, the nanoparticle core comprises one or more oligonucleotides encapsulated therein.

[0132] In some embodiments, one or more oligonucleotides in the shell of oligonucleotides comprises or consists of a (GGX)n nucleotide sequence, wherein n is 2-20 and X is a nucleobase (A, C, T, G, or U). In some embodiments, the (GGX)n nucleotide sequence is on the 5’ end of the one or more oligonucleotides. In some embodiments, the (GGX)n nucleotide sequence is on the 3’ end of the one or more oligonucleotides. In some embodiments, one or more oligonucleotides in the shell of oligonucleotides comprises or consists of a (GGT)nnucleotide sequence, wherein n is 2-20. In some embodiments, the (GGT)nnucleotide sequence is on the 5’ end of the one or more oligonucleotides. In some embodiments, the (GGT)nnucleotide sequence is on the 3’ end of the one or more oligonucleotides.

[0133] In some embodiments, an oligonucleotide in the shell of oligonucleotides is an aptamer. Accordingly, all features and aspects of oligonucleotides described herein (e.g., length, type (DNA, RNA, modified forms thereof), optional presence of spacer) also apply toDocket No.30938 / 2024-125R aptamers. Aptamers are oligonucleotide sequences that can be evolved to bind to various target analytes of interest. Aptamers may be single stranded, double stranded, or partially double stranded.

[0134] Methods of attaching detectable markers (e.g., fluorophores, radiolabels) and therapeutic agents (e.g., an antibody) as described herein to an oligonucleotide are known in the art. Compositions

[0135] The disclosure also provides compositions that comprise a SNA of the disclosure, or a plurality thereof. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier. The term "carrier" refers to a vehicle within which the SNA as described herein is administered to a subject. Any conventional media or agent that is compatible with the SNAs according to the disclosure can be used. The term “carrier” encompasses diluents, excipients, adjuvants and a combination thereof. Pharmaceutically acceptable carriers are well known in the art (see, e.g., Remington's Pharmaceutical Sciences by Martin, 1975, the entire disclosure of which is herein incorporated by reference).

[0136] Exemplary "diluents" include water for injection, saline solution, buffers such as Tris, acetates, citrates or phosphates, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents. Exemplary "excipients" include but are not limited to stabilizers such as amino acids and amino acid derivatives, polyethylene glycols and polyethylene glycol derivatives, polyols, acids, amines, polysaccharides or polysaccharide derivatives, salts, and surfactants; and pH-adjusting agents. In some embodiments, the SNAs provided herein comprise immunostimulatory oligonucleotides (for example and without limitation, a CpG oligonucleotide) as adjuvants. Other adjuvants known in the art may also be used in the compositions of the disclosure. For example, the adjuvant may be aluminum or a salt thereof, mineral oils, Freund adjuvant, vegetable oils, water-in-oil emulsion, mineral salts, small molecules (e.g., imiquimod, resiquimod), bacterial components (e.g., flagellin, monophosphoryl lipid A), or a combination thereof. Uses of SNAs in Gene Editing

[0137] In some aspects of the disclosure, it is contemplated that a SNA delivers a plasmid comprising a first nucleotide sequence encoding a genome editor protein, inducing expression of the genome editor protein and mediating editing of a target gene. In such aspects, the SNA of the disclosure optionally further comprises a second nucleotide sequence capable of being transcribed to produce a single-guide RNA (sgRNA), wherein the sgRNA is a specific RNA sequence capable of recognizing the target gene and directs the genome editor protein to the target gene site for editing. Optionally, the sgRNA comprises aDocket No.30938 / 2024-125R sequence which is 100% complementary to at least a portion a target gene (i.e., a perfect match), while in other aspects, the sgRNA is at least (meaning greater than or equal to) about 95%, at least about 90%, at least about 85%, at least about 80%, at least about 75%, at least about 70%, at least about 65%, at least about 60%, at least about 55%, at least about 50%, at least about 45%, at least about 40%, at least about 35%, at least about 30%, at least about 25%, at least about 20% complementary to at least a portion of the target gene. As described herein, in some embodiments the SNA comprises an additional nucleotide sequence. In some aspects, the additional nucleotide sequence is a linear nucleotide sequence. In various embodiments, the linear nucleotide sequence comprises single-stranded DNA, double-stranded DNA, single-stranded RNA, or double-stranded RNA. In some embodiments, the linear nucleotide sequence comprises mRNA. In further embodiments, the linear nucleotide sequence comprises a nucleotide sequence encoding a genome editor. In some aspects, the linear nucleotide sequence comprises a nucleotide sequence capable of being transcribed to produce an sgRNA. In some embodiments, the additional nucleotide sequence is an additional homology-directed repair (HDR) template.

[0138] In further embodiments, the genome editor protein-mediated genetic changes include, but are not limited to, gene replacement, gene introduction, gene reintroduction, gene correction and gene re-framing. In various aspects, the genome editor protein- mediated genetic changes serve to introduce a protein function or restore defective protein function. In some aspects, the SNA comprises a nucleic acid sequence encoding a genome editor protein that effectively inhibits gene expression. Optionally, administration of the SNA treats a disease or disorder (See, e.g., Maeder ML, Gersbach CA, MOL THER, 2016 24(3);430-46, incorporated herein by reference in its entirety).

[0139] In various embodiments, SNAs of the disclosure (e.g., LSNAs or LNP–SNAs) achieve an indel frequency of about or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%. In further embodiments, SNAs of the disclosure (e.g., LSNAs or LNP–SNAs) achieve an indel frequency that is about or at least about 1.1, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, or 10.0-fold improvement relative to a control (e.g., LNPs). In some embodiments, SNAs of the disclosure (e.g., LSNAs or LNP–SNAs) achieve an HDR efficiency of about or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%. In further embodiments, SNAs of the disclosure (e.g., LSNAs or LNP–SNAs) achieve an HDR efficiency that is about or at least about 1.1, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, or 10.0-fold improvement relative to a control (e.g., LNPs).Docket No.30938 / 2024-125R

[0140] In various aspects, the SNA comprises a therapeutic agent, such as an inhibitory oligonucleotide (i.e., an oligonucleotide that reduces or inhibits gene expression). Optionally, the SNA is functionalized with one or more oligonucleotides designed to effect inhibition of target gene expression. In various aspects, the SNA comprises an oligonucleotide which is 100% complementary to an oligonucleotide targeted for inhibition (i.e., a perfect match), while in other aspects, the oligonucleotide is at least (meaning greater than or equal to) about 95% complementary to the oligonucleotide over the length of the oligonucleotide, at least about 90%, at least about 85%, at least about 80%, at least about 75%, at least about 70%, at least about 65%, at least about 60%, at least about 55%, at least about 50%, at least about 45%, at least about 40%, at least about 35%, at least about 30%, at least about 25%, at least about 20% complementary to the oligonucleotide over the length of the oligonucleotide to the extent that the oligonucleotide is able to achieve the desired degree of inhibition of a target gene product.

[0141] In various aspects, the therapeutic agent is an antisense oligonucleotide. It is understood in the art that the sequence of an antisense compound need not be 100% complementary to that of its target gene to be specifically hybridizable. Moreover, an oligonucleotide may hybridize over one or more segments such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure or hairpin structure).

[0142] Percent complementarity is determined over the length of an oligonucleotide. Merely to illustrate, given an antisense compound in which 18 of 20 nucleotides of the antisense compound are complementary to a 20 nucleotide region in a target oligonucleotide of 100 nucleotides total length, the oligonucleotide would be 90 percent complementary. In this example, the remaining noncomplementary nucleotides may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleotides. Percent complementarity of an antisense compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656).

[0143] When the therapeutic agent is an oligonucleotide, the oligonucleotide may be RNA or DNA. The RNA can be an inhibitory oligonucleotide, such as an inhibitory RNA (RNAi) that performs a regulatory function, and in various embodiments is selected from the group consisting of a small inhibitory RNA (siRNA), a single-stranded RNA (ssRNA), and a ribozyme. Alternatively, the RNA is microRNA that performs a regulatory function. The DNA is, in some embodiments, an antisense-DNA. In some embodiments, the RNA is a piwi- interacting RNA (piRNA).Docket No.30938 / 2024-125R

[0144] In some aspects of the disclosure, an oligonucleotide associated with a SNA (e.g., LNP-SNA, LSNA) inhibits the expression of a gene. Any degree of expression inhibition is contemplated. In various aspects, expression of a target gene product is inhibited by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% compared to gene product expression in the absence of a SNA described herein.

[0145] Optionally, the degree of inhibition is determined in vivo from a body fluid sample or from a biopsy sample or by imaging techniques well known in the art. Alternatively, the degree of inhibition may be determined in a cell culture assay, generally as a predictable measure of a degree of inhibition that can be expected in vivo resulting from use of a specific type of SNA and a specific oligonucleotide. Uses of SNAs to Treat a Disorder

[0146] In some embodiments, a SNA of the disclosure (e.g., LSNA, LNP-SNA) is used to treat a disorder. Thus, in some aspects, the disclosure provides methods of treating a disorder comprising administering an effective amount of a SNA of the disclosure to a subject (e.g., a human subject) in need thereof, wherein the administering treats the disorder. In various embodiments, the disorder is cancer, an infectious disease, a pulmonary disease, a gastrointestinal disease, a hematologic disease, a viral disease, an inflammatory disease, an autoimmune disease, a neurodegenerative disease, an inherited disease, an infectious disease, a cardiovascular disease, a metabolic disorder, or a combination thereof. An "effective amount" of the SNA is an amount sufficient to, for example, effect gene editing and treat the disorder. An effective amount of the SNA is also the amount to, for example, edit a target gene, inhibit gene expression, activate an innate immune response, or a combination thereof and treat the disorder. Thus, methods of activating an innate immune response are also contemplated herein, such methods comprising administering a SNA of the disclosure to a subject in need thereof in an amount effective to activate an innate immune response in the subject.

[0147] A SNA of the disclosure can be administered via any suitable route, such as parenteral administration, intramuscular injection, subcutaneous injection, intradermal administration, and / or mucosal administration such as oral or intranasal. Additional routes of administration include but are not limited to intravenous, intraperitoneal, intranasal, intra-Docket No.30938 / 2024-125R vaginal, intra-rectal, and oral administration. A combination of different routes of administration, separately or at the same time, is also contemplated by the disclosure. Methods of Making

[0148] Disclosed herein are methods of making any of the LNP-SNAs of the disclosure. Accordingly, in some aspects the disclosure provides a method of making a lipid nanoparticle SNA, the SNA comprising (a) a lipid nanoparticle core, and (b) a shell of oligonucleotides; the method comprising: mixing one or more lipid groups in ethanol to yield lipids in an ethanol phase, and dialyzing the lipids in the ethanol phase against 1x phosphate-buffered saline (PBS) or a similar aqueous buffer to create the LNP. In various aspects, one of the one or more lipid groups is a lipid-polyethylene glycol (lipid-PEG) conjugate. In some embodiments, the lipid-PEG conjugate is a DPPE-PEG(2000) Maleimide, or a DPPE-PEG(2000) azide.

[0149] In some embodiments, the LNP-SNA made by the methods disclosed herein further comprises a payload. Accordingly, for the methods of making a LNP-SNA wherein the payload comprises one or more oligonucleotides, the method further comprises dissolving the oligonucleotides in an aqueous buffer and mixing the oligonucleotide solution with the aforementioned lipids in the ethanol phase, followed by dialyzing the resultant mixture against PBS or similar aqueous buffer.

[0150] The methods disclosed herein further comprise functionalizing a lipid nanoparticle core with oligonucleotides. To create a shell of oligonucleotides, the oligonucleotides are synthesized on a solid-phase. In some embodiments, the oligonucleotide is 5’ thiol oligonucleotide and / or 5’ DBCO oligonucleotide. Wherein the oligonucleotide is a 5’ thiol oligonucleotide, the oligonucleotide is deprotected under a 1:1 (v / v) mixture of 30% ammonia solution and 40% methylamine. Wherein the oligonucleotide is a 5’ DBCO oligonucleotide, the oligonucleotide is deprotected under 30% ammonia solution or a 1:1 (v / v) mixture of 30% ammonia solution and 40% methylamine. The oligonucleotide solution is subsequently evaporated to dryness, resuspended in water, purified by liquid chromatography, and finally evaporated to dryness. The 5’ thiol-modified oligonucleotides are further reduced by reducing agents such as dithiothreitol (DTT) or tris(2-carboxyethyl)phosphine (TCEP), and then reducing agents are removed and oligonucleotides are evaporated to dryness. To functionalize the LNP with oligonucleotides, the oligonucleotides are resolubilized via mixing the oligonucleotide with the LNPs in PBS immediately after dialysis, and incubated at room temperature. EXAMPLES Example 1: LNP-SNA Synthesis ProcedureDocket No.30938 / 2024-125R

[0151] Materials 30 mM DOPC phospholipid (Avanti Polar Lipids, powder, 734.053 g / mol; 22.02 g / mL) 10 mM DPPE-PEG (2000) Maleimide (Nanocs, 2000 g / mol; 20 mg / mL) 40 mM DLin-KC2-DMA ionizable lipid (MedChemExpress, liquid, 642.1 g / mol; 25.68 mg / mL) 60 mM Cholesterol (Sigma, 386.65 g / mol; 23.2 mg / mL) 800 µM 18:1 Liss Rhod PE (Avanti Polar Lipids, powder, 1301.715 g / mol; 1.04 µg / µL)

[0152] Procedure 1. Dissolve lipids in 18 µL ethanol a. 6 µL Ethanol, OR 6 µL, 800 µM 18:1 Liss Rhod PE (dry) for dye labelling b. 1.2 µL, 10 mM Lipid PEG, DPPE-PEG (2000) Maleimide (heating, sonicate 80 ºC, 1 min) c. 2 µL, 30 mM DOPC phospholipid d. 2.8 µL, 60 mM Cholesterol (heat to dissolve) e. 6 µL, 40 mM DLin-KC2-DMA ionizable lipid Total 480 nmol lipid Final 12.5% DOPC, 50% ionizable lipid, 2.5% lipid-PEG, 35% cholesterol 2. Dissolve 10 µg CRISPR plasmid (powder) and 1 µg GRIN2B-HDR (optional) in 54 µL 10 mM citrate buffer (pH 4.0) 3. To 18 µL lipid in ethanol, add 54 µL plasmid, pipet mixing (total volume = 72 µL, [lipid] = 6.67 mM) 4. Dialysis (micro-dialysis plate) 2 h in 1x PBS 5. Nanosight concentration.2 µL LNP [lipid] ~ 250 nM, dilute 500-fold to 1 mL, [lipid] ~ 500 pM 6. Add SH-GGT DNA in 3-5-fold excess of lipid-PEG (12 nmol), i.e.30-60 nmol DNA, 300 rpm, overnight Cellular Uptake and Gene Editing 1. Wash the HaCaT (or other) cell with DPBS, treat the cell with trypsin-EDTA, add 6 mL 10% FBS, centrifuge 200 xg, 5 min 2. Mix 15 µL cell with 15 µL Trypan blue, count the cell from 10 µL mixtureDocket No.30938 / 2024-125R 3. Plate the cell in a 48-well plate by adding 250 µL HaCaT cells in 48 well plate (30,000 cells); culture cells overnight in respective media 4. Add 10 µL LNP SNA (diluted 70-fold from synthesis) in DMEM and Opti-MEM; culture in DMEM for 16 h, then Opti-MEM for 3 h 5. Continue culturing the cells for three days in DMEM containing 5% FBS, change the media every day 6. Add 200 µL trpsin, incubate 3 min, add 200 µL PBS and transfer to 1.5 mL centrifuge tubes, centrifuge 300 g, 5 min. Wash the cells twice with PBS to remove the media. 7. Extract the genome using the kit, 500 µL extraction media: 65 ºC for 6 min, vortex, then 98 ºC for 2 min. 8. Take out 5 µL for PCR reaction and analyze the indel efficiency using T7 endonuclease. Example 2: General genome editing strategy using CRISPR lipid nanoparticle spherical nucleic acids (LNP-SNA)

[0153] Disclosed herein are two approaches to nucleic acid delivery that can be combined to create a new class of CRISPR lipid nanoparticle spherical nucleic acids (LNP-SNAs), to access the HDR pathway and make genome modifications, including HDR-mediated knock- ins. CRISPR LNP-SNAs exhibit enhanced cellular uptake, reduced cytotoxicity, and improved gene transfection efficiency compared to CRISPR LNPs (structures without a shell of surface-bound DNA). Gene editing data showed that in multiple cell lines and targets, CRISPR LNP-SNAs were capable of gene insertion and deletion at approximately twice the frequency of CRISPR LNPs, and yielded 1.6 times higher HDR efficiencies compared to when the DNA components were delivered using lipofectamine. Across multiple cell lines and genomic loci, CRISPR LNP–SNAs induced insertion–deletion mutations at an average frequency of 43 ± 20%, two- to three-fold higher than those observed with LNPs (18 ±10%). When co-delivered with donor templates, CRISPR LNP–SNAs enabled homology-directed repair at an average efficiency of 21 ± 7%, a 2.5-fold improvement over LNPs (8 ± 4%). The ease of synthesis, biocompatibility, and modularity of CRISPR LNP-SNAs highlight their potential as an advanced delivery vehicle for CRISPR-Cas and a wide range of other gene- editing therapies. LNP–SNAs of the disclosure enable both insertion–deletion (indel) formation, which disrupts gene function, and homology-directed repair (HDR) for precise, user-defined genome modifications. Across multiple cell lines and genomic targets, LNP–Docket No.30938 / 2024-125R SNAs achieved indel rates of 15–68% and HDR efficiencies of 13–30%, representing a 1.5– 3-fold improvement over LNPs.

[0154] The LNP core used herein comprised four components (see Fig.1A): ionizable cationic lipids (Dlin-KC2-DMA) that bind to anionic nucleic acids and facilitate endosomal escape, phospholipids (DOPC) that assist in encapsulation, cholesterol that provides structural integrity, and lipid-anchored polyethylene glycol (PEG) that controls size and colloidal stability (22, 23). The genome editor, spCas9 protein, and its single-guide (sg)RNA were encoded by a plasmid, with U6 and CBh promoters regulating the expression of the sgRNA and protein, respectively (Fig.1B, Table 1)(4).

[0155] Table 1: DNA sequences used for cloning and homology-directed repair (HDR)

[0156] To synthesize CRISPR-LNPs, the lipid components were first dissolved in ethanol and then mixed with the plasmid in an acidic buffer, followed by dialysis (Fig.1C). A repair template was included in the lipid and plasmid mixture to create HDR-accessible constructs. After optimization, the formulation that resulted in a LNP size of 110 ± 19.4 nm and aDocket No.30938 / 2024-125R plasmid encapsulation efficiency of 84% (12.5% DOPC, 50% DLin-KC2-DMA, 2.5% DPPE- PEG-maleimide, and 35% cholesterol) was selected (Table 2). CRISPR LNP-SNAs were subsequently synthesized by reacting 5’ thiol-modified oligonucleotides with maleimides on lipid-PEG, where a guanine-rich sequence, 5’—T4(TGG)10—3’ (SEQ ID NO: 19), was used to enhance cellular uptake via G-quadruplex formation (24). To expand the range of conjugation chemistries accessible, an alternative lipid-PEG with an azide moiety (DPPE- PEG-azide) was used to facilitate conjugation of 5’ DBCO-modified, guanine-rich DNA (Fig. 3A).

[0157] Table 2: Optimization of lipid components

[0158] The DNA shell of the SNA facilitated the delivery of the genome editors through scavenger receptor A and caveolin-mediated endocytosis, and endosomal escape was aided by the ionizable lipids (Fig.1D) (23, 25). Once in the cytosol, the plasmid was transported into the nucleus to initiate transcription (26). Following cytosolic expression, genome editors tagged with nuclear localization signals (NLSs) entered the nucleus and associated with sgRNA to perform gene editing steps.

[0159] The CRISPR LNP-SNAs (prepared using thiol-maleimide chemistry) were characterized using gel electrophoresis (Fig.2A). The CRISPR LNP-SNA sample was less mobile in the gel than the free DNA and LNP-SNA samples, which indicated the formation of larger structures based on the chemical conjugation of the CRISPR LNPs with DNA. Surfactant treatment disrupted the lipid core of CRISPR LNP-SNAs, which resulted in theirDocket No.30938 / 2024-125R dissociation into lipid-DNA conjugates with lower molecular weights. Dynamic light scattering (DLS) measurements confirmed a progressive increase in hydrodynamic diameter: LNPs < CRISPR LNPs < CRISPR LNP-SNAs (Fig.2B). These size increases correlated to what would be expected given the sequential addition of plasmids and DNA shells. In addition, the zeta potential went as: LNPs > CRISPR LNPs > CRISPR LNP-SNAs, with CRISPR LNP- SNAs being the most negatively charged (Fig.2C). These findings were consistent with the idea that higher the nucleic acid content results in more negatively charged constructs (27). Similar trends in particle size and zeta potential were observed for the analogous system prepared using DPPE-PEG-azide and DBCO-modified DNA, indicating that this conjugation chemistry could also be used to synthesize CRISPR LNP-SNAs (Fig.3B-3C).

[0160] Particle morphology was characterized using transmission electron microscopy (TEM). Cryo-TEM images of maleimide-modified CRISPR LNPs revealed monolayer and bilayer structures; upon negative staining, lamellar rings were observed (Fig.4A-4B). CRISPR LNP-SNA structures were predominantly observed as bilayers, with cores that appeared more electron-dense than those of the CRISPR LNPs, likely due to the presence of the DNA shell (Fig.4C-4D). Similarly, lamellar structures were seen in samples of azide- modified CRISPR LNPs and CRISPR LNP-SNAs synthesized via cycloaddition (Fig.4E-4F).

[0161] Cellular uptake of rhodamine-labeled maleimide-modified CRISPR LNPs and CRISPR LNP-SNAs SNAs (prepared using thiol-maleimide chemistry) was assessed using flow cytometry. Over a 4-hour incubation period, epidermal keratinocytes (HaCaT) treated with CRISPR LNP-SNAs exhibited fluorescence intensities 2-to-3 times greater than those observed when cells were treated with CRISPR LNPs (Fig.5A). Confocal microscopy images further confirmed the internalization of CRISPR LNP-SNAs with rhodamine-labeled lipids and Cy5-labeled thiol-modified DNA (Fig.5B). These data indicated that when the CRISPR LNP system was formulated as an SNA architecture via surface DNA modification, rapid cellular entry (compared to the CRISPR LNP system) occurred.

[0162] Next, the cytotoxicity of maleimide-modified CRISPR LNPs and CRISPR LNP- SNAs (prepared using thiol-maleimide chemistry) was evaluated in multiple therapeutically relevant cell lines, including HaCaTs, human bone marrow stem cells (hBMSCs), macrophages (RAW 264.7), and human embryonic kidney cells (HEK293T) (Fig.5C). Following a 24-h incubation, cells treated with as little as 10 nM CRISPR LNPs exhibited a decrease in viability (between approximately 20% and 40%). In contrast, cells treated with 40 nM CRISPR LNP-SNAs maintained viabilities over 80%, suggesting that formulating the CRISPR LNP as an SNA mitigated the cytotoxic effects associated with the LNPs (28, 29). Prolonged incubation (96 h) with CRISPR LNPs further decreased viability by approximately 45–80%, whereas CRISPR LNP–SNAs maintained viability above 55% across all particleDocket No.30938 / 2024-125R concentrations tested (Fig.13). Rather than designing and preparing alternative LNP formulations (30), a simple and effective strategy for enhancing biocompatibility in this system may be to modify existing LNP constructs with DNA to create an SNA architecture.

[0163] Gene expression was quantified by measuring protein fluorescence following the delivery of LNPs and LNP-SNAs (prepared using thiol-maleimide chemistry), with each construct encapsulating an enhanced green fluorescent protein (EGFP) plasmid (Fig.14, referred to as EGFP LNP and EGFP LNP–SNA, respectively). Flow cytometry analysis revealed that treating HaCaT cells with the plasmid alone (without a delivery vehicle) did not result in a detectable increase in protein expression, as expected (Fig.5D). Notably, with EGFP LNP-SNAs, protein expression was found to be approximately three-fold higher compared to when EGFP LNPs were used, mirroring the observed trend in cellular uptake (Fig.5E). These findings indicated that plasmids delivered using LNP-SNAs could efficiently undergo transcription and translation intracellularly.

[0164] NHEJ / MMEJ and HDR are the principal mechanisms for repairing DSBs that result in indel formation or templated repair, respectively (Fig.6A). To assess the gene editing efficiencies (indel frequencies) of CRISPR LNP-SNAs, two target loci were selected: GRIN2B (relevant in neurodevelopmental disorders) and DNAse I hypersensitive sites (for their association with transcriptional activity) (31, 32). To explore NHEJ-mediated indel processing, hBMSCs and HaCaT cells were treated with 10 nM CRISPR LNP-SNAs (prepared using thiol-maleimide chemistry) without repair templates for 3 h. After 3 days of culture, the cells were harvested, and the genomic targets were extracted and amplified (Table 3). Surveyor assays with T7 endonuclease I (21) revealed high indel efficiencies ranging from 52 to 70% for the two targets investigated (Fig.6B). As expected, control treatments with CRISPR plasmids alone did not yield observable indel gene editing (Fig.7A- 7B).

[0165] Table 3: Primers used for PCR amplification of the target genomic regionsDocket No.30938 / 2024-125R

[0166] To compare the indel efficiencies of CRISPR LNPs and CRISPR LNP-SNAs, cells were treated with 10 nM maleimide-bearing CRISPR LNPs or CRISPR LNP-SNAs targeting the GRIN2B site. Surveyor assays revealed indel efficiencies of 20% and 23% in hBMSCs and HaCaT cells, respectively, for the CRISPR LNPs, approximately 2- to 3-fold lower than the frequencies achieved with CRISPR LNP-SNAs (i.e., 52% in hBMSCs and 58% in HaCaT) (Fig.7C-7D). This result correlates well with the difference in cellular internalization between CRISPR LNPs and CRISPR LNP-SNAs. The indel efficiencies of the analogous azide-bearing constructs were also evaluated in hBMSCs. For the GRIN2B target, azide- bearing CRISPR LNPs and CRISPR LNP-SNAs (prepared using cycloaddition) generated indel efficiencies of 37% and 69%, respectively (Fig.7E). The roughly two-fold increase in efficiency seen when CRISPR LNP-SNAs were used demonstrated that such constructs, prepared using different conjugation chemistry, were also effective in the NHEJ pathway to carry out indel-based gene editing.

[0167] The HDR pathway was assessed by the inclusion of a DNA template containing a 12-bp insert with a HindIII cleavage site (Table 1). HaCaT cells were treated with GRIN2B- targeting CRISPR LNP-SNAs or the DNA components were delivered using lipofectamine. HindIII digestion revealed an HDR efficiency of 31% and 19% when CRISPR LNP-SNAs and the DNA components with lipofectamine were used, respectively – the CRISPR LNP-SNAs resulted in a 1.6-fold higher HDR efficiency (Fig.6C). Taken together with follow-up experiments that were performed, in three human cell lines, CRISPR LNP–SNAs yielded approximately 2–3-fold higher HDR efficiencies compared to LNPs or lipofectamine (Fig.12, Table 4, and Fig.6C). HDR was not observed at the Grin2b locus in RAW 264.7 cells, likely due to their reduced transfection efficiency. The enhanced co-delivery of the repair templates and genome editors by the SNAs likely contributed to higher efficiency observed; gene knock-ins were likely facilitated by the higher frequency of DSBs and higher concentration of templates near cleavage sites.

[0168] Table 4. Summary of HDR efficiencies in hBMSC, HaCaT, HEK293T cell lines. Mean and standard deviation are determined from three biological replicates.Docket No.30938 / 2024-125R

[0169] Finally, the gene silencing capabilities of CRISPR LNP-SNAs targeting the EGFP gene were evaluated in HEK293T cells (Fig.6D). The indel efficiency was measured to be 36%, as confirmed by the loss of fluorescence in confocal microscopy images (Fig.6E). Flow cytometry experiments revealed that treatment with CRISPR LNPs resulted in a fluorescence reduction of approximately 13% of the cell population, whereas CRISPR LNP- SNAs induced reduction in 32% of cells, indicating an enhanced gene knockout efficiency by the SNA constructs (Fig.8A-8B).

[0170] The instant disclosure established multiple facets of the LNP-SNA platform developed herein. First, the data showed that by transforming an LNP delivery system into an LNP-SNA, one can increase cellular uptake and editing efficiency. Second, the data showed how multiple nucleic acid cargos can be co-delivered to the same cells via this approach. Third, transforming LNPs into SNAs capable of dual nucleic acid delivery allowed access to the HDR pathway, which has previously been a significant challenge for those interested in increasing the precision of gene editing. The versatility and ease of synthesis of SNA-LNPs makes the platform broadly applicable throughout the gene editing field. Finally, the data highlighted delivery efficacy as a key factor in enhancing gene editing frequencies, and the critical role of the chemical structure (not just the components) of the delivery vehicle in accessing two distinct gene editing pathways. Further development of CRISPR LNP-SNAs could involve the delivery of high-fidelity Cas9 variants (33) or base and prime editors (34) to broaden the scope of accessible tissue and disease targets. In addition, mRNA or ribonucleoprotein complex delivery could mitigate prolonged protein expression, thereby enhancing precision. Given that, in principle, any genome editor can be encapsulated byDocket No.30938 / 2024-125R LNP-SNAs, these structures point towards a versatile and promising platform for the next generation of genome-editing therapies. Example 3: Materials and Methods

[0171] CRISPR Plasmid Construct.10 units of BbsI endonuclease (New England Biolabs), 1 µg of pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene #42230) (35), and 1× NEBuffer r2.1 (New England Biolabs) were added to a 50-µL reaction and incubated overnight at 37 ºC for plasmid digestion. The reactions were purified under 1% agarose gel electrophoresis, and the digested plasmids were extracted using an Omega Bio-Tek E.Z.N.A Gel Extraction Kit.

[0172] Complementary gene fragments encoding sgRNAs for respective genomic loci (Table 1) were purchased from Integrated DNA Technologies and annealed in 1× NEBuffer 2 (New England Biolabs). The annealed fragments were then cloned into the hSpCas9 vector using T7 ligase (New England Biolabs). The ligation products were transformed into E. coli DH5α competent cells (Thermo Fisher) under 100 μg / mL ampicillin and cultured overnight from single colonies. Finally, plasmids were extracted using a QIAprep Spin Miniprep Kit (Qiagen), and the sequences were confirmed by Sanger sequencing (forward: 5’—GAGGGCCTATTTCCCATGATTCC—3’ (SEQ ID NO: 17) and reverse: 5’— AAAAGCACCGACTCGGTGCCAC—3’ (SEQ ID NO: 18)).

[0173] Synthesis of CRISPR Lipid Nanoparticles (LNPs). Lipid concentrations were screened to determine the best formulation with the optimal overall encapsulation efficiency and size distribution (Table 2). The optimized components include 12.5% 18:1 (Δ9-Cis) PC phospholipid (DOPC, Avanti Polar Lipids), 50% DLin-KC2-DMA (MedChemExpress), 2.5% DPPE-PEG(2000) Maleimide (Nanocs), and 35% cholesterol (Sigma), which were dissolved in 18 µL of ethanol. For cellular uptake experiments, an additional 1% 18:1 Liss Rhod PE (Avanti Polar Lipids) was added and mixed in ethanol for labeling and tracking.

[0174] CRISPR plasmids (10 µg) were dissolved in 54 µL of 10 mM citrate buffer (pH 4.0) and mixed with lipids in the ethanol phase. The mixtures were dialyzed against 1× PBS for 2 h, in 4 ºC using Pierce 96-well Microdialysis Plates (Thermo Scientific).

[0175] The concentration and size of the CRISPR LNPs were determined using a NanoSight (Malvern Panalytical).2 µL of CRISPR LNPs were diluted 500-fold in water and run through the microfluidics at 50 µL / min. Size was determined using the NTA software with a manually set detection threshold to avoid background.

[0176] To encapsulate both the CRISPR plasmid and HDR template, an additional 1 µg of the double-stranded, GRIN2B-HDR template (Table 1; Fig.6C) or 1 μg of the single-Docket No.30938 / 2024-125R stranded, Alt-R™ HDR donor templates (Integrated DNA Technologies (IDT); see Example 5, Table 7) was mixed with 10 µg of the CRISPR plasmid targeting GRIN2B in 54 µL of 10 mM citrate buffer (pH 4.0). The synthesis was then completed using the procedures outlined above.

[0177] For EGFP cellular uptake and expression experiments, 10 µg pCMV-GFP (Addgene #11153) (36) was used and encapsulated in lieu of the CRISPR plasmid. The synthesis was then completed using the procedures outlined above. See also Fig.14 for synthetic scheme.

[0178] To synthesize azido-terminated LNPs, DPPE-PEG(2000) Azide (Avanti Polar Lipids) was used in lieu of DPPE-PEG(2000) Maleimide. The final lipid ratio and concentrations remained constant, and the synthesis was then completed using the procedures outlined above.

[0179] Determination of Plasmid Encapsulation Efficiency. Quant-iT PicoGreen dsDNA Reagent (Invitrogen) was diluted in 1× TE buffer or 1× TE buffer supplemented with 0.1% Triton X-100 and mixed with known concentrations of CRISPR plasmids to generate two standard curves. LNPs were mixed with the same amount of PicoGreen reagent and then diluted 500-fold in either 1× TE buffer or 1× TE buffer with 0.1% Triton X-100. The florescence of the samples and standards were measured using a plate reader, and the concentrations of nucleic acids were determined in the linear region of the standard curve. The concentration of free plasmids, [Free], was determined from the 1× TE standard curve, and the concentration of total plasmids, [Total], was determined by the particles lysed in 0.1% Triton X-100. From this, the encapsulation efficiency was calculated from the following formula: Encapsulation efficiency (%) = ([Total] – [Free]) / [Total]

[0180] Synthesis of CRISPR LNP-Spherical Nucleic Acids (LNP-SNAs).5’ Thiol DNA (sequence: 5’—SH-TTTT(TGG)10—3’, incorporated with 5’-Thiol-Modifier C6, Glen Research; SEQ ID NO: 14) and 5’ DBCO DNA (sequence: 5’—DBCO-TTTT(TGG)10—3’, incorporated with 5’-DBCO-TEG Modifier, Glen Research; SEQ ID NO: 15) were synthesized on the solid-phase.5’ Thiol DNA was deprotected under 1:1 mixture of 30% ammonia solution and 40% methylamine (aq) for 25 min at 55°C.5’ DBCO DNA was deprotected under 30% ammonia solution for 3 h at 55°C. Subsequently, the solution was evaporated to dryness, and deprotected DNA were resuspended in water and purified using reversed-phase high-performance liquid chromatography (HPLC). For cellular uptake experiments, Cyanine 5 phosphoramidite (Glen Research) was incorporated near the 5’ end of the thiol DNA (sequence: 5’—SH-Cy5-TTTT(TGG)10—3’; SEQ ID NO: 16). The purifiedDocket No.30938 / 2024-125R DNA was lyophilized, re-dissolved in nuclease-free water, and reduced under dithiothreitol for 1 h. Dithiothreitol was then removed via NAP-10 columns (Cytiva), and the eluent was vacuum-concentrated to dryness in a centrivap (Labconco).

[0181] For DNA functionalization of CRISPR LNPs, 30 nmol DNA was resolubilized by mixing with 500 pM respective LNPs (i.e., 5’ Thiol DNA with maleimido-terminated LNPs and 5’ DBCO DNA with azido-terminated LNPs) in 1× PBS buffer immediately after dialysis. The reaction was incubated overnight at room temperature with shaking at 300 rpm. The size of CRISPR LNP-SNAs were determined using dynamic light scattering (Malvern Panalytical).

[0182] Gel Electrophoresis. Samples of 5’-SH-DNA, CRISPR LNP-SNA (synthesized via the thiol-Michael addition), and CRISPR LNP-SNA lysed with 1% Triton X-100 (ruptured SNA, synthesized via the thiol-Michael addition) were loaded onto 0.5% agarose gel on ice. Gel electrophoresis was run under 1×TAE buffer, 70 V, and 2 h.

[0183] Electron Microscopy. CRISPR LNP and LNP-SNA samples were drop-casted onto a formvar-coated carbon grid (Ted Pella) after glow discharge and incubated for 2 min. Excess samples were blotted away and stained with 1% uranyl acetate. For cryo- transmission electron microscopy, samples were drop-cast onto a lacey carbon grid (Ted Pella) and plunge-frozen into liquid ethane using a FEI Mark IV Vitrobot. All samples were imaged using a JEOL 1400 TEM operating at 120 kV.

[0184] Cellular Viability Assay. Cells (i.e., HaCaT, hBMSC, RAW 264.7, HEK293T) were seeded in 96-well cell culture plates at a density of 1×104per well in DMEM media with 10% fetal bovine serum (or mesenchymal stem cell growth medium 2 (for hBMSC)) overnight. Then, the cell culture was replaced with fresh media containing different concentrations of CRISPR LNPs and CRISPR LNP-SNAs (synthesized via the thiol-Michael addition) and incubated for another 24 h or 96 h. The cells were washed with 1×PBS buffer, replaced with 10% CCK8 solution (Cell Counting Kit-8), and incubated for 30 min. The absorbance value at 460 nm was measured using a BioTek Synergy plate reader.

[0185] Cellular Uptake and Flow Cytometry. HaCaT cells were seeded in 48-well plates at a density of 3×104per well and cultured overnight in DMEM containing 10% fetal bovine serum and 1% penicillin and streptomycin. The cell culture media were replaced with Opti- MEM and then incubated with 10 nM rhodamine-labeled CRISPR LNP or CRISPR LNP-SNA for various lengths of time (i.e., 0.5 h, 1 h, 2 h, and 4 h). At the end of each treatment, the cells were washed with PBS, trypsinized (Gibco), centrifuged at 300 g for 5 min, and fixed with fixation buffer (BioLegend). Flow cytometry was conducted using a BD FACSymphony A3 Cell Analyzer. The fluorescence of rhodamine was measured at least 1×104single cell events per sample. The measurements were conducted in biological triplicate.Docket No.30938 / 2024-125R

[0186] Confocal Microscopy. Confocal laser scanning microscope (Zeiss LSM 810) was used to determine the intracellular delivery of CRISPR LNP-SNA (synthesized via the thiol- Michael addition). HaCaT cells were seeded at a density of 1×104per well in borosilicate eight-chambered cover glass slides (Nalge Nunc International). After 8 h, the cells were incubated with 10 nM CRISPR LNP-SNA for 4 h. The cells were then washed with 1×PBS buffer to remove excess CRISPR LNP-SNAs, stained with 1 µg / mL Hoechst 33342 for 1 min, and fixed with 4% paraformaldehyde (Thermo Fisher) for 15 min. The cell nuclei, lipid, and 5’ thiol DNA were imaged via the Hoechst, rhodamine, and Cy5 channels, respectively.

[0187] Surveyor Nuclease Assay. HaCaT, hBMSC, HEK293T, HEK293T / EGFP, and RAW 264.7 cells were seeded in 48-well plates at a density of 3×104per well and cultured overnight. The cells were then incubated with 10 nM CRISPR LNP or LNP-SNA in Opti-MEM for 3 h. Excess CRISPR LNPs or LNP-SNAs were washed away, and the cells were incubated in fresh media for an additional 3 days.

[0188] Transfected cells were dissociated and centrifuged at 300 g for 10 min. The media was removed, and the cells were resuspended in 500 µL of QuickExtract DNA Extraction Solution (Biosearch Technologies). DNA was extracted by incubation at 65 ºC for 6 min, and then 98 ºC for 2 min. Then, 5 µL of the extraction solution was amplified with target region primers (Table 3). To detect indel mutations, PCR amplified products were annealed in 1× NEBuffer 2 (New England Biolabs) to allow for heteroduplex formation (95 ºC for 10 min, 95 to 85 ºC ramping at –2 ºC / s, and 85 to 20 ºC ramping at –0.2 ºC / s). The annealed products were incubated with T7 endonuclease I (New England Biolabs) for 15 min at 37 ºC and analyzed on 4–15% polyacrylamide or 2% agarose gels. Bands (cleavage and uncleaved) were visualized on a ChemiDoc MP Imaging System (Biorad) and quantified using ImageJ densitometry analysis (37). Alternatively, PCR amplicons were sequenced by Sanger sequencing, and indel rates were assessed by TIDE (39).

[0189] The indel efficiency was determined using the following equations: (35, 38) ^^^^ = (^ + ^) / (^ + ^ + ^)indel (%) = 100wherein a is the integrated intensity of the uncleaved PCR product, and b and c are the integrated intensities of two cleavage products.

[0190] HDR-Mediated Target Modification. HaCaT, hBMSC, and HEK293T cells were seeded in 48-well plates at a density of 3×104per well and cultured overnight. The cells were then incubated with 10 nM CRISPR LNP or LNP-SNA in Opti-MEM for 3 h. Excess CRISPRDocket No.30938 / 2024-125R LNP-SNAs were washed away, and the cells were incubated in fresh DMEM containing 3% fetal bovine serum for an additional 3 days.

[0191] Transfected cells were dissociated and centrifuged at 300g for 10 min. The media was removed, and the cells were resuspended in 500 µL of QuickExtract DNA Extraction Solution (Biosearch Technologies). DNA was extracted by incubation at 65 ºC for 6 min, and then 98 ºC for 2 min. Then, 5 µL of the extraction solution was amplified using target region primers (Table 3).

[0192] To detect indel mutations, PCR amplified products were annealed in 1× rCutSmart™ buffer (New England Biolabs) to allow for heteroduplex formation (95 ºC for 10 min, 95 to 85 ºC ramping at –2 ºC / s, and 85 to 20 ºC ramping at –0.2 ºC / s). The annealed products were digested with HindIII-HF endonuclease (New England Biolabs) for 60 min at 37 ºC and analyzed on 4–15% polyacrylamide gels or 2% agarose gels (4). Bands (cleavage and uncleaved) were visualized on the ChemiDoc MP Imaging System (Biorad) and quantified using ImageJ (37) densitometry analysis.

[0193] The HDR efficiency was determined using the following equation: (35, 38) HDR (%) = (b+c) / (a+b+c) wherein a is the integrated intensity of undigested HDR PCR product, and b and c are the integrated intensities of HindIII-digested fragments. Example 4

[0194] Further gene editing experiments similar to those described in Example 2 were performed to evaluate indel frequencies of CRISPR LNP-SNAs at three genomic targets (human GRIN2B, mouse Grin2b, and DNAse I) across four cell types (hBMSC, HaCaT, HEK293T and RAW 264.7). Because RAW 264.7 is a murine macrophage cell line, editing was evaluated only at the Grin2b target using constructs with a mouse-specific sgRNA sequence (Table 5). The editing efficiencies of CRISPR LNP-SNAs were compared with those of CRISPR LNPs and, in some experiments, evaluated particles synthesized using different lipid formulations or chemistries. All experiments were performed with at least three biological replicates, and statistical significance was determined using one-way ANOVA.

[0195] Like Example 2, hBMSCs, HaCaT, HEK293T, and RAW 264.7 cells were treated with 10 nM CRISPR LNP–SNAs (without repair templates) for 3 h. Three days posttreatment, the genomic DNA was extracted and the target regions were PCR-amplified (Table 3). Subsequently, indel efficiencies were quantified by T7 endonuclease I (T7EI) assays (21) or sequencing (39). As described in Example 2, at the GRIN2B locus, sequencing identified indels near the Cas9 cleavage site in hBMSC and HaCaT cells,Docket No.30938 / 2024-125R indicating error-prone repair (Fig.7C-7D); T7EI assay confirmed similar results (Fig.9). No significant difference in indel rates was observed between particles prepared via azide- DBCO or thiol-maleimide chemistry, indicating that terminal lipid functional groups have minimal impact on editing outcomes. GRIN2B-targeting LNP–SNAs generated approximately 1.5- to 2-fold higher average indel rates than LNPs (55 ± 8% vs.24 ± 10% in hBMSCs; 41 ± 11% vs.26 ± 5% in HaCaT; 28 ± 3% vs.9 ± 6% in HEK293T; all measured by T7EI; Figs.9 and 10). Similar trends were observed at DNAse I and grin2b loci (Fig.11, Table 6), consistent with the enhanced uptake of LNP–SNAs. As expected, plasmid-only controls showed no detectable editing (Fig.7A and Fig.7B).

[0196] Table 5. DNA sequences used for cloning and primers used for PCR amplification of the target genomic regions.

[0197] The results presented in Figs.9-11 indicate the following: (1) Indel frequencies were not significantly affected by the use of either azide or maleimide-terminated lipids in either LNPs or LNP-SNAs formulations; (2) the use of LNP-SNAs as the delivery vehicle improved the indel rates by 1.5-2 fold compared to LNP across all cell lines tested; (3) these results were consistent with outcomes obtained via TIDE analysis.

[0198] A summary of the data plotted in Figs.9-11 is shown in Table 6.

[0199] Table 6. Summary of indel rates in hBMSC, HaCaT, HEK293T, and RAW264.7 cell lines at the GRIN2B, DNAse I, and Grin2b targets. The mean and standard deviation were calculated for at least three biological replicates.Docket No.30938 / 2024-125RExample 5

[0200] LNPs and LNP–SNAs were synthesized using ssDNA HDR donor templates targeting GRIN2B, DNAse I, and Grin2b sites (as shown in Table 7), and evaluated the HDR efficiencies in HaCaT, hBMSC, HEK293T, and RAW 264.7 cells (Figs.6 and 12). Editing using LNP-SNAs showed significant improvement in HDR efficiencies at most targets compared to LNPs. Given that macrophage cell lines (RAW 264.7) are inherently difficult to transfect, noticeable HDR was not observed after HindIII digestion.

[0201] Table 7. DNA sequences used for homology-directed repair (HDR). In HDR, DNA modification that includes a HindIII recognition site is underlined. / Alt-R-HDR / refers to IDT Alt-R modification, and * refers to phosphorothioate modification.Docket No.30938 / 2024-125R

[0202] Table 8. Summary of HDR efficiencies in hBMSC, HaCaT, HEK293T cell lines. Mean and standard deviation are determined from three biological replicates.Example 6

[0203] The time course for the cell viability experiments in HaCaT, hBMSC, RAW 264.7 and HEK293T cells lines was extended to a 96-hour treatment with CRISPR LNPs or LNP– SNAs. The results indicated that even at the highest particle concentration (40 nM), all four cell lines retain moderate to high viability (55–91%) following incubation with LNP–SNAs, whereas a more significant reduction in cell viability was observed after incubation with LNPs (22–56%). These results highlighted that LNP–SNAs are more biocompatible compared to unmodified LNPs. See Fig.13.Docket No.30938 / 2024-125R Example 7

[0204] The indel rates at the GRIN2B target were assessed via sequencing and TIDE analysis in biological triplicates. As shown in Fig.9, TIDE and T7EI-derived indel frequencies showed no significant difference. Representative TIDE analyses from three independent experiments are shown in Figs.15-17.

[0205] TIDER analysis of HDR was performed and is shown in Fig.18. References: 1. M. Jinek, et al., A Programmable Dual-RNA–Guided DNA Endonuclease in Adaptive Bacterial Immunity. Science 337, 816–821 (2012). 2. L. Cong, et al., Multiplex Genome Engineering Using CRISPR / Cas Systems. Science 339, 819–823 (2013). 3. C. D. Yeh, C. D. Richardson, J. E. Corn, Advances in genome editing through control of DNA repair pathways. Nat Cell Biol 21, 1468–1478 (2019). 4. F. A. Ran, et al., Genome engineering using the CRISPR-Cas9 system. Nat Protoc 8, 2281–2308 (2013). 5. K. Lee, et al., Nanoparticle delivery of Cas9 ribonucleoprotein and donor DNA in vivo induces homology-directed DNA repair. Nat Biomed Eng 1, 889–901 (2017). 6. R. Shahbazi, et al., Targeted homology-directed repair in blood stem and progenitor cells with CRISPR nanoformulations. Nat Mater 18, 1124–1132 (2019). 7. J. Song, et al., RS-1 enhances CRISPR / Cas9- and TALEN-mediated knock-in efficiency. Nat Commun 7, 10548 (2016). 8. S. Lin, B. T. Staahl, R. K. Alla, J. A. Doudna, Enhanced homology-directed human genome engineering by controlled timing of CRISPR / Cas9 delivery. Elife 3, e04766 (2014). 9. S. Riesenberg, et al., Efficient high-precision homology-directed repair-dependent genome editing by HDRobust. Nat Methods 20, 1388–1399 (2023). 10. J. A. Zuris, et al., Cationic lipid-mediated delivery of proteins enables efficient protein- based genome editing in vitro and in vivo. Nat Biotechnol 33, 73–80 (2015). 11. V. Madigan, F. Zhang, J. E. Dahlman, Drug delivery systems for CRISPR-based genome editors. Nat Rev Drug Discov 22, 875–894 (2023). 12. J. D. Gillmore, et al., CRISPR-Cas9 In Vivo Gene Editing for Transthyretin Amyloidosis. New England Journal of Medicine 385, 493–502 (2021). 13. H. J. Longhurst, et al., CRISPR-Cas9 In Vivo Gene Editing of KLKB1 for Hereditary Angioedema. New England Journal of Medicine 390, 432–441 (2024). 14. P. Kazemian, et al., Lipid-Nanoparticle-Based Delivery of CRISPR / Cas9 Genome- Editing Components. Mol Pharm 19, 1669–1686 (2022). 15. J. I. Cutler, E. Auyeung, C. A. Mirkin, Spherical Nucleic Acids. J Am Chem Soc 134, 1376–1391 (2012). 16. C. A. Mirkin, R. L. Letsinger, R. C. Mucic, J. J. Storhoff, A DNA-based method for rationally assembling nanoparticles into macroscopic materials. Nature 382, 607–609 (1996).Docket No.30938 / 2024-125R 17. C. A. Mirkin, S. H. Petrosko, Inspired Beyond Nature: Three Decades of Spherical Nucleic Acids and Colloidal Crystal Engineering with DNA. ACS Nano 17, 16291–16307 (2023). 18. N. L. Rosi, et al., Oligonucleotide-Modified Gold Nanoparticles for Intracellular Gene Regulation. Science 312, 1027–1030 (2006). 19. P. Kumthekar, et al., A first-in-human phase 0 clinical study of RNA interference– based spherical nucleic acids in patients with recurrent glioblastoma. Sci Transl Med 13, 3945 (2021). 20. W. L. Daniel, U. Lorch, S. Mix, A. S. Bexon, A first-in-human phase 1 study of cavrotolimod, a TLR9 agonist spherical nucleic acid, in healthy participants: Evidence of immune activation. Front Immunol 13 (2022). 21. C. Huang, Z. Han, M. Evangelopoulos, C. A. Mirkin, CRISPR Spherical Nucleic Acids. J Am Chem Soc 144, 18756–18760 (2022). 22. A. J. Sinegra, M. Evangelopoulos, J. Park, Z. Huang, C. A. Mirkin, Lipid Nanoparticle Spherical Nucleic Acids for Intracellular DNA and RNA Delivery. Nano Lett 21, 6584–6591 (2021). 23. C. Hald Albertsen, et al., The role of lipid components in lipid nanoparticles for vaccines and gene therapy. Adv Drug Deliv Rev 188, 114416 (2022). 24. S. P. Narayan, et al., The Sequence-Specific Cellular Uptake of Spherical Nucleic Acid Nanoparticle Conjugates. Small 11, 4173–4182 (2015). 25. C. H. J. Choi, L. Hao, S. P. Narayan, E. Auyeung, C. A. Mirkin, Mechanism for the endocytosis of spherical nucleic acid nanoparticle conjugates. Proceedings of the National Academy of Sciences 110, 7625–7630 (2013). 26. H. Bai, G. M. S. Lester, L. C. Petishnok, D. A. Dean, Cytoplasmic transport and nuclear import of plasmid DNA. Biosci Rep 37 (2017). 27. A. Algarni, et al., In vivo delivery of plasmid DNA by lipid nanoparticles: the influence of ionizable cationic lipids on organ-selective gene expression. Biomater Sci 10, 2940–2952 (2022). 28. S. Ndeupen, et al., The mRNA-LNP platform’s lipid nanoparticle component used in preclinical vaccine studies is highly inflammatory. iScience 24, 103479 (2021). 29. S. Tahtinen, et al., IL-1 and IL-1ra are key regulators of the inflammatory response to RNA vaccines. Nat Immunol 23, 532–542 (2022). 30. C. Wang, C. Zhao, W. Wang, X. Liu, H. Deng, Biomimetic noncationic lipid nanoparticles for mRNA delivery. Proceedings of the National Academy of Sciences 120 (2023). 31. W. Meuleman, et al., Index and biological spectrum of human DNase I hypersensitive sites. Nature 584, 244–251 (2020). 32. C. Hu, W. Chen, S. J. Myers, H. Yuan, S. F. Traynelis, Human GRIN2B variants in neurodevelopmental disorders. J Pharmacol Sci 132, 115–121 (2016). 33. J. S. Chen, et al., Enhanced proofreading governs CRISPR–Cas9 targeting accuracy. Nature 550, 407–410 (2017). 34. A. C. Komor, Y. B. Kim, M. S. Packer, J. A. Zuris, D. R. Liu, Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage. Nature 533, 420–424 (2016). 35. L. Cong, et al., Multiplex Genome Engineering Using CRISPR / CAS Systems. Science 339, 819-823 (2013).Docket No.30938 / 2024-125R 36. T. Matsuda, C. L. Cepko, Electroporation and RNA interference in the rodent retina in vivo and in vitro. Proceedings of the National Academy of Sciences 101, 16–22 (2004). 37. C. A. Schneider, W. S. Rasband, K. W. Eliceiri, NIH Image to ImageJ: 25 years of image analysis. Nat Methods 9, 671–675 (2012). 38. F. A. Ran, et al., Genome engineering using the CRISPR-Cas9 system. Nat Protoc 8, 2281–2308 (2013). 39. E. K. Brinkman, T. Chen, M. Amendola, B. van Steensel, Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Res 42, e168–e168 (2014). 40. J. Gilleron, et al., Image-based analysis of lipid nanoparticle–mediated siRNA delivery, intracellular trafficking and endosomal escape. Nat Biotechnol 31, 638–646 (2013). 41. K. Chen, et al., Lung and liver editing by lipid nanoparticle delivery of a stable CRISPR–Cas9 ribonucleoprotein. Nat Biotechnol (2024). https: / / doi.org / 10.1038 / s41587- 024-02437-3. 42. J. S. Chen, et al., Enhanced proofreading governs CRISPR–Cas9 targeting accuracy. Nature 550, 407–410 (2017). 43. T. Matsuda, C. L. Cepko, Electroporation and RNA interference in the rodent retina in vivo and in vitro. Proceedings of the National Academy of Sciences 101, 16–22 (2004). 44. A. V. Anzalone, et al., Search-and-replace genome editing without double-strand breaks or donor DNA. Nature 576, 149–157 (2019). 45. M. Segel, et al., Mammalian retrovirus-like protein PEG10 packages its own mRNA and can be pseudotyped for mRNA delivery. Science 373, 882–889 (2021). 46. S. Nooraei, et al., Virus-like particles: preparation, immunogenicity and their roles as nanovaccines and drug nanocarriers. J Nanobiotechnology 19, 59 (2021). 47. S. Banskota, et al., Engineered virus-like particles for efficient in vivo delivery of therapeutic proteins. Cell 185, 250-265.e16 (2022). 48. J. G. Choi, et al., Lentivirus pre-packed with Cas9 protein for safer gene editing. Gene Ther 23, 627–633 (2016). 49. P. Gee, et al., Extracellular nanovesicles for packaging of CRISPR-Cas9 protein and sgRNA to induce therapeutic exon skipping. Nat Commun 11 (2020). 50. M. An, et al., Engineered virus-like particles for transient delivery of prime editor ribonucleoprotein complexes in vivo. Nat Biotechnol 42, 1526–1537 (2024). 51. J. Wang, et al., Recent Advances in Lipid Nanoparticles and Their Safety Concerns for mRNA Delivery. Vaccines (Basel) 12, 1148 (2024).

Claims

Docket No.30938 / 2024-125R WHAT IS CLAIMED IS:

1. A spherical nucleic acid (SNA) comprising: a) a nanoparticle core; b) a shell of oligonucleotides attached to the nanoparticle core; c) a plasmid encapsulated by the nanoparticle core, wherein the plasmid comprises a first nucleotide sequence encoding a genome editor protein; d) a second nucleotide sequence that comprises a guide RNA (gRNA) or is capable of being transcribed to produce a gRNA; and e) a homology-directed repair (HDR) template.

2. The SNA of claim 1, wherein the guide RNA is a single-guide RNA (sgRNA).

3. The SNA of claim 1 or claim 2, wherein the plasmid further comprises the second nucleotide sequence capable of being transcribed to produce a sgRNA.

4. The SNA of claim 2 or claim 3, wherein the sgRNA comprises a crRNA, and wherein the crRNA is at least 80% complementary to a target gene.

5. The SNA of any one of claims 1-4, wherein the homology-directed repair (HDR) template is single stranded DNA or double stranded DNA.

6. The SNA of claim 5, wherein the homology-directed repair (HDR) template is a plasmid HDR template or a linear HDR template.

7. The SNA of claim 5 or claim 6, wherein the homology-directed repair (HDR) template comprises a donor nucleotide sequence.

8. The SNA of claim 3, wherein the plasmid further comprises the homology-directed repair (HDR) template.

9. The SNA of any one of claims 1-8, wherein the genome editor protein comprises a CRISPR-associated protein (Cas), a Zinc-finger nuclease (ZNF), a transcription activator-like effector nuclease (TALEN), a meganuclease, an obligate mobile element guided activity (OMEGA), a catalytically impaired Cas nuclease / nickase, a TALEN fused to a deaminase enzyme, or a reverse transcriptase.

10. The SNA of any one of claims 1-9, wherein the genome editor protein is a CRISPR- associated protein (Cas).

11. The SNA of claim 10, wherein the Cas is Cas9, Cas12, Cas13, Cas14, or a combination thereof.Docket No.30938 / 2024-125R 12. The SNA of claim 11, wherein the genome editor protein comprises Cas9.

13. The SNA of any one of claims 1-12, wherein the genome editor protein comprises a nuclear localization signal (NLS).

14. The SNA of any one of claims 1-13, wherein the first nucleotide sequence encoding the genome editor protein is operably linked to a first promoter.

15. The SNA of claim 14, wherein the first promoter is a CBh promoter, a chicken β-actin (CAG) promoter, a CMV promoter, an EF1a promoter, a TRE promoter, a CBA promoter, or a UAS promoter.

16. The SNA of claim 15, wherein the first promoter is a CBh promoter.

17. The SNA of any one of claims 1-16, wherein the second nucleotide sequence is operably linked to a second promoter.

18. The SNA of claim 17, wherein the second promoter is an RNA polymerase III promoter.

19. The SNA of claim 18, wherein the second promoter is a U6 promoter, a 7SK promoter, or an H1 promoter.

20. The SNA of claim 19, wherein the second promoter is a U6 promoter.

21. The SNA of any one of claims 11-17, wherein the plasmid comprises an additional genome editor.

22. The SNA of claim 21, wherein the plasmid comprises two different genome editors.

23. The SNA of claim 22, wherein the two different genome editors are operably linked to the same first promoter.

24. The SNA of claim 22, wherein the two different genome editors are operably linked to different first promoters.

25. The SNA of any one of claims 1-24, wherein the SNA comprises an additional nucleotide sequence.

26. The SNA of claim 25, wherein the additional nucleotide sequence comprises an additional plasmid.

27. The SNA of claim 26, wherein the additional plasmid encodes a genome editor protein.

28. The SNA of claim 27, wherein the additional plasmid further comprises a nucleotide sequence capable of being transcribed to produce an sgRNA.Docket No.30938 / 2024-125R 29. The SNA of claim 27 or claim 28, wherein the genome editor protein encoded by the additional plasmid is a different genome editor from the genome editor encoded by the plasmid.

30. The SNA of claim 26, wherein the additional plasmid comprises a nucleotide sequence capable of being transcribed to produce an sgRNA.

31. The SNA of claim 25, wherein the additional nucleotide sequence is a linear nucleotide sequence.

32. The SNA of claim 31, wherein the linear nucleotide sequence comprises single- stranded DNA, double-stranded DNA, single-stranded RNA, or double-stranded RNA.

33. The SNA of claim 31 or claim 32, wherein the linear nucleotide sequence comprises mRNA.

34. The SNA of any one of claims 31-33, wherein the linear nucleotide sequence comprises a nucleotide sequence encoding a genome editor.

35. The SNA of claim 34, wherein the linear nucleotide sequence further comprises a nucleotide sequence capable of being transcribed to produce an sgRNA.

36. The SNA of any one of claims 31-33, wherein the linear nucleotide sequence comprises a nucleotide sequence capable of being transcribed to produce an sgRNA.

37. The SNA of any one of claims 31-36, wherein the additional nucleotide sequence is an additional homology-directed repair (HDR) template.

38. The SNA of any one of claims 1-37, wherein the nanoparticle core comprises a lipid nanoparticle core or a liposomal core.

39. The SNA of claim 38, wherein the lipid nanoparticle core comprises an ionizable lipid, a phospholipid, a sterol, and a lipid-polyethylene glycol (lipid-PEG) conjugate.

40. The SNA of claim 39, wherein the lipid nanoparticle comprises 45-55% ionizable lipid, 10-20% phospholipid, 30-40% sterol, and 1-10% lipid-PEG conjugate.

41. The SNA of claim 39 or claim 40, wherein the lipid-polyethylene glycol (lipid-PEG) conjugate comprises a functional group.

42. The SNA of claim 41, wherein the functional group is cycloalkyne, azide, maleimide, or thiol.

43. The SNA of any one of claims 39-42, wherein one or more oligonucleotides in the shell of oligonucleotides is covalently attached to the exterior of the lipid nanoparticle core through the lipid-PEG conjugate.Docket No.30938 / 2024-125R 44. The SNA of any one of claims 38-43, wherein the diameter of the SNA is about 10-50 nm greater than the diameter of a comparable nanoparticle core without a payload.

45. The SNA of any one of claims 38-44, wherein the diameter of the SNA is about 2-25 nm greater than the diameter of a comparable nanoparticle core carrying the same payload as the SNA.

46. The SNA of claim 37 wherein the liposomal core comprises a plurality of lipid groups.

47. The SNA of any one of claims 46, wherein the plurality of lipid groups comprises a lipid selected from the group consisting of the phosphatidylcholine, phosphatidylglycerol, and phosphatidylethanolamine families of lipids.

48. The SNA of claim 47, wherein the lipid group is 1,2-dioleoyl-sn-glycero-3- phosphocholine (DOPC), 1,2-dimyristoyl-sn-phosphatidylcholine (DMPC), 1-palmitoyl-2- oleoyl-sn-phosphatidylcholine (POPC), 1,2-distearoyl-sn-glycero-3-phospho-(1’-rac-glycerol) (DSPG), 1,2-dioleoyl-sn-glycero-3-phospho-(1’-rac-glycerol) (DOPG), 1,2-distearoyl-sn- glycero-3-phosphocholine (DSPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-di-(9Z-octadecenoyl)-sn-glycero-3-phosphoethanolamine (DOPE), and 1,2- dihexadecanoyl-sn-glycero-3-phosphoethanolamine (DPPE).

49. The SNA of any one of claims 1-48, wherein one or more oligonucleotides in the shell of oligonucleotides is attached to the exterior of the lipid nanoparticle core or liposomal core through a lipid anchor group.

50. The SNA of claim 49, wherein the lipid anchor group is attached to the 5’ end or the 3’ end of the one or more oligonucleotides.

51. The SNA of claim 49 or claim 50, wherein the lipid anchor group is tocopherol or cholesterol.

52. The SNA of any one of claims 1-51, wherein the one or more oligonucleotides in the shell of oligonucleotides is modified on its 5’ end and / or 3’ end with dibenzocyclooctyl (DBCO).

53. The SNA of any one of claims 1-52, wherein the shell of oligonucleotides comprises single-stranded DNA, double-stranded DNA, single-stranded RNA, double-stranded RNA, or a combination thereof.

54. The SNA of any one of claims 1-53, wherein the shell of oligonucleotides comprises about 2 to about 500 oligonucleotides.

55. The SNA of claim 54, wherein the shell of oligonucleotides comprises about 10 to about 200 oligonucleotides.Docket No.30938 / 2024-125R 56. The SNA of claim 54, wherein the shell of oligonucleotides comprises about 5 to about 50 oligonucleotides.

57. The SNA of claim 54, wherein the shell of oligonucleotides comprises about 5 to about 20 oligonucleotides.

58. The SNA of any one of claims 1-57, wherein each oligonucleotide in the shell of oligonucleotides is about 5 to about 100 nucleotides in length.

59. The SNA of claim 58, wherein each oligonucleotide in the shell of oligonucleotides is about 25 to about 55 nucleotides in length.

60. The SNA of any one of claims 1-59, wherein one or more oligonucleotides in the shell of oligonucleotides comprises a (GGX)n nucleotide sequence, wherein n is 2-20 and X is a nucleobase (A, C, T, G, or U).

61. The SNA of claim 60, wherein the (GGX)n nucleotide sequence is on the 5’ end of the one or more oligonucleotides.

62. The SNA of claim 60, wherein the (GGX)n nucleotide sequence is on the 3’ end of the one or more oligonucleotides.

63. The SNA of any one of claims 60-62, wherein the (GGX)n nucleotide sequence is a (GGT)n nucleotide sequence.

64. The SNA of any one of claims 1-63, wherein the diameter of the SNA is about 1 nm to about 500 nm.

65. The SNA of claim 64, wherein the diameter of the SNA is about 50 nm to about 250 nm.

66. A composition comprising the SNA of any one of claims 1-65.

67. A composition comprising a plurality of the SNAs of any one of claims 1-65.

68. A method of expressing a genome editor protein in a cell comprising contacting the cell with the SNA of any one of claims 1-52 or the composition of claims 66-67.

69. A method of treating, ameliorating, and / or preventing a disorder in a subject comprising administering to the subject an effective amount of (i) the SNA of any one of claims 1-65, (ii) the composition of claims 66-67, or (iii) a combination thereof.

70. The method of claim 69, wherein the disorder is cancer, an infectious disease, an autoimmune disease, a neurodegenerative disease, an inherited disease, an infectious disease, a cardiovascular disease, a metabolic disorder, or a combination thereof.Docket No.30938 / 2024-125R 71. A method of administering a spherical nucleic acid (SNA) to a cell comprising contacting the cell with the SNA, wherein the SNA comprises a) a lipid nanoparticle core comprising an ionizable lipid, a phospholipid, a sterol, and a lipid-polyethylene glycol (lipid- PEG) conjugate, and b) a shell of oligonucleotides attached to the lipid nanoparticle core; and wherein cellular uptake and / or cellular viability post-administration is enhanced when compared to an identical lipid nanoparticle core that does not comprise a shell of oligonucleotides.

72. The method of claim 71, wherein cellular uptake is enhanced by at least about 200% when compared to the lipid nanoparticle that does not comprise a shell of oligonucleotides.

73. The method of claim 71, wherein cellular viability is enhanced by at least about 30% when compared to the lipid nanoparticle that does not comprise a shell of oligonucleotides.

74. The method of any one of claims 71-73, wherein: a) the lipid nanoparticle core comprises (Δ9-Cis) PC phospholipid, DLin-KC2-DMA, cholesterol, and DPPE-PEG(2000) Maleimide; b) each of the oligonucleotides in the shell of oligonucleotides is a single stranded oligonucleotide; c) the SNA encapsulates a plasmid, wherein the plasmid comprises a first nucleotide sequence encoding a genome editor protein and a second nucleotide sequence, a second nucleotide sequence capable of being transcribed to produce a single-guide RNA (sgRNA); and d) the SNA further comprises an additional nucleotide sequence that comprises a homology-directed repair (HDR) template.

75. The method of claim 74, wherein the lipid nanoparticle core comprises 12.5% (Δ9- Cis) PC phospholipid, 50% DLin-KC2-DMA, 35% cholesterol, and 2.5% DPPE-PEG(2000) Maleimide.

Images