Circular mRNA yellow fever vaccine

Abstract

The present invention is directed to an artificial nucleic acid, particularly to an artificial RNA suitable for use in preventing an infection from yellow fewer virus (YFV), Hantaan Orthohantavirus (HTNV) or a disorder related to such an infection. The disclosure also provides recombinant circular RNA molecules that includes an internal ribosome entry site (IRES) sequence operably linked to a protein-coding sequence, and DNA sequences encoding the same. Embodiments also include methods of treating or preventing a disorder or a disease, first and second medical uses of the artificial RNA, compositions and vaccines

Description

Circular mRNA Yellow Fever VaccineRELATED APPLICATIONS

[0001] This is application claims priority to U.S. provisional patent application No. 63 / 664,677, filed on June 26, 2024 and U.S. provisional patent application No. 63 / 664,680, filed on June 26, 2024. The contents of these applications are incorporated herein by reference.REFERENCE TO SEQUENCE LISTING

[0002] The content of the following electronic submission of the sequence listing is hereby expressly incorporated by reference in its entirety for all purposes. The sequence listing is identified on the electronically filed .xml file as follows:File Name: EX1 -001 WO.xml; Date of Creation: June 25, 2025; Size (bytes): 61 KB.TECHNICAL FIELD

[0003] The present disclosure relates generally to vaccines, and more specifically, to circular RNA vaccines for vaccinating a subject against an infectious disease such as yellow fever and Hantaan orthohantavirus (HTNV).BACKGROUND

[0004] Yellow fever virus (YFV) is a Flavivirus, a group of enveloped positive- stranded RNA arboviruses. Among the flaviviruses there are more than 40 human pathogens responsible for considerable morbidity and mortality throughout the world causing symptoms ranging from rather unspecific pseudo-flu-like syndromes, to severe encephalitic or hemorrhagic disease. YFV is endemic in tropical and subtropical regions in Africa and South-America and causes epidemics of hemorrhagic fever with high fatality rates from 20 - 50% resulting in an estimated number of 200,000 cases with 30,000 deaths annually.

[0005] In the 1930s, a live attenuated Yellow fever vaccine virus (17D) was developed which confers long-term immunity upon a single injection. However, in some cases vaccination with the 17D YF vaccine may elicit severe side effects such as anaphylactic reactions and yellow-fever-vaccine-associated neurologic disease (YEL-AND). Anaphylaxis is most likely caused by allergic reactions to proteins fromeggs or gelatine used in vaccine production. The fatality associated with YEL-AND appears to be relatively low in general, but higher among recipients 60 years of age or older and is presumably attributed to the injection of a live attenuated virus into recipients who fail to adequately control the replication of virus. Other risks associated with the use of the live attenuated YF vaccine are transmission of the 17D virus through transfusion of blood products from recently vaccinated donors and vertical mother-to-child transmission.

[0006] A further complication associated with live attenuated vaccines is Yellow fever vaccine-associated viscerotropic disease (YEL-AVD). YEL-AVD is an illness similar to wild-type yellow fever, in which the vaccine virus proliferates in multiple organs, causing multiple organ dysfunction syndrome or multiorgan failure and death in at least 60% of cases. Viscerotropic disease has been reported in primary vaccines only, with average onset four days after vaccination.

[0007] Therefore, a safe and effective, non-infectious vaccine would be desirable in order to avoid vaccine-associated adverse events and to allow vaccination of young infants and immunocompromised recipients, for whom the live 17D vaccine is contraindicated, as well as pregnant and nursing women and elderly people. The present invention overcome these problems by providing a novel circular RNA vaccine and related methods.

[0008] Further, there is currently no vaccine for Hantaan orthohantavirus (HTNV). Therefore, a safe and effective, non-infectious vaccine would be desirable in order to avoid vaccine-associated adverse events and to allow vaccination of young infants and immunocompromised recipients, as well as pregnant and nursing women and elderly people. The present invention overcome these problems by providing a novel circular RNA vaccine and related methods.SUMMARY

[0009] The following summary is provided to facilitate an understanding of some of the innovative features unique to the disclosed embodiment and is not intended to be a full description. A full appreciation of the various aspects of the embodiments disclosed herein can be gained by taking into consideration the entire specification,claims, drawings, and abstract as a whole.

[0010] The invention includes an artificial nucleic acid (i.e. , circular mRNA) encoding at least one antigenic peptide or protein of a Yellow Fever virus that induces an efficient antigen-specific immune responses against the encoded antigenic peptide or protein.

[0011] In embodiments, the circRNA encodes viral proteins prME and NS5. Alternatively, it can encode the viral proteins prME, NS5 and NS1 .

[0012] The invention also includes an artificial nucleic acid (i.e., circular mRNA) encoding at least one antigenic peptide or protein of a Hantaan Orthohantavirus (HTNV) that induces an efficient antigen-specific immune responses against the encoded antigenic peptide or protein.

[0013] In aspects, the compositions described herein include high stability, low immunogenicity, protein / peptide-coding capacity and special closed-loop construction, circRNA vaccine and circRNA-based therapeutic platforms.

[0014] In embodiments, the circular RNA includes a least one 2-thiouridine (2Thioll) or at least one 2'-0-methylcitidine (20MeC). In embodiments, the circular RNA molecule includes about 2% to about 5% 2-thiouridine (e.g., about 2.5% 2- thiouridine). In embodiments, the circular RNA molecule includes about 2% to about 5% 2'-0-methylcitidine (e.g., about 2.5% 2'-0-methylcitidine).

[0015] In embodiments, the circRNA molecules described herein include an internal ribosome entry site (IRES) sequence operably linked to a protein-coding sequence; wherein the IRES sequence is a viral sequence; and wherein the protein-coding sequence encodes a viral protein.

[0016] In aspects, the IRES is a Type 1 IRES. In aspects, the IRES is an enterovirus IRES or a human rhinovirus (HRV) IRES.

[0017] In embodiments, the circRNA molecules described herein are administered in lipid nanoparticles (LNPs). The lipid nanoparticles can include, for example, 45 - 55 mole percent (mol %) ionizable cationic lipid, 5 - 15 mol % non-cationic lipid, 35 - 40 mol % sterol and 1 - 2 mol % PEG-modified lipid.

[0018] Also provided is a nucleic acid that encodes one or more of the circular RNA molecules described herein.

[0019] Also provided is a composition that include one or more of the circular RNA molecules and / or the nucleic acids described herein.

[0020] Also provided are host cells that include one or more of the circular RNA molecules and / or the nucleic acids described herein.

[0021] Also provided are methods for producing a protein in a cell, the method can include contacting a cell with a circular RNA molecule or a nucleic acid described herein under conditions whereby the protein-coding nucleic acid sequence of the circular RNA is translated and the protein is produced in the cell.

[0022] Also provided are methods for producing a protein in vitro, the method can include contacting a cell-free extract with a circular RNA molecule or a nucleic acid under conditions whereby the protein-coding nucleic acid sequence of the circular RNA is translated and the protein is produced.

[0023] In aspects, encapsulation and drug delivery modalities can be used such as synthetic or natural exosomes, lipid bilayers, liposomal and alginate formulation or other synthetic or natural polymer encapsulation techniques. In aspects, the mRNAs and / or small molecules described herein are administered by sublingual, acid-stable capsules, and / or transdermal methods.

[0024] Embodiments also include methods of inducing an immune response to a flavivirus in a subject. The method can include administering circRNA that encodes capsid and / or non-structural proteins.

[0025] Embodiments also include methods of inducing Yellow Fever Virus (YFV) neutralizing antibody titers in a human subject. The method can include administering a vaccine composition that includes an mRNA with a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or 100% identity to the nucleic acid sequence of SEQ ID NO: 1 - 8.

[0026] Embodiments also include methods of inducing in a human subject Hantaan Orthohantavirus (HTNV) neutralizing antibody titers. The method can include administering to a subject a vaccine composition comprising an mRNA comprising a nucleic acid sequence having at least 95% identity to the nucleic acid sequence of SEQ ID NO: 9 - 14.

[0027] In embodiments, 25 pg to 150 pg dose of mRNA is administered. Alternatively, about 150 pg dose of mRNA is administered. In embodiments, 25 pg to 75 pg dose of mRNA is administered. Alternatively, about 50 pg dose of mRNA is administered. Alternatively, about 25 pg dose of mRNA is administered.

[0028] Embodiments also include microneedle array patches (MAPs) and methods of use. The circRNA vaccine compositions described herein can be administer using the MAPs. In aspects, the MAPs include (a) a base, (b) an adhesive region and (c) a plurality of needles on a surface of the base. The needles can comprise a medicament (e.g., a therapeutic or vaccine). The MAPs can include solid microneedles, coated microneedles, hollow microneedles or dissolvable microneedles.BRIEF DESCRIPTION OF THE DRAWINGS

[0029] FIG. 1 depicts the cRNA platform, including steps of (a) circularization, (b) purification, (c) generating thermostable lipid nanoparticles (LNP) for a vaccine and (d) administering with a microneedle patch.

[0030] FIG. 2A is an image of a 2% agarose gel showing the integrity of prME- circRNA and prME-N1-ip-RNA.

[0031] FIG. 2B is a graph of YFV E protein expression and cell viability in A549 cells, analyzed by flow cytometry at 48- and 72-hours post-transfection using a transfection reagent.

[0032] FIG. 2C is a characterization of particle size and polydispersity index (PDI) following encapsulation of circular and linear RNAs in conventional lipid nanoparticles (LNPs).

[0033] FIG. 2D shows a time-course analysis of YFV E protein expression (percentage of E protein-positive cells) in A549 cells transfected with LNPs containing circular or linear RNA.

[0034] FIG. 2E shows a time-course analysis of YFV E protein expression (mean fluorescence intensity or “MFI”) in A549 cells transfected with LNPs containing circular or linear RNA.

[0035] FIG. 2F shows cell viability assessed by flow cytometry at 1 -, 3-, 5-, and 9-days post-transfection.

[0036] FIG. 3A - FIG. 3D show a time-course analysis of E protein expression in human monocyte-derived dendritic cells (hMoDCs) transfected with LNPs containing circular or linear RNA. The percentage of E protein-positive cells and CD209 expression as a differentiation marker were analyzed by flow cytometry at 5- and 7- days post-transfection.

[0037] FIG. 4 shows how hMoDCs were characterized based on surface markers, and the percentage of E protein-positive cells and CD209 expression as a differentiation marker were analyzed by flow cytometry at 5- and 7-days posttransfection.

[0038] FIG. 5A shows a dose-response and toxicity in Syrian hamsters treated with LNP-circRNA-prME. Weight gain in hamsters vaccinated with 5, 15, and 30 pgof RNA were compared. The boost was administered two weeks after the prime, and animals were euthanized 14 days post-boost.

[0039] FIG. 5B shows an analysis of neutralizing antibody levels assessed by microneutralization assay.

[0040] FIG. 5C shows an analysis of ALT levels. Liver enzyme ALT levels were measured using ELISA. Levels of cytokines IFNy, TNFa, IL-2, and IL-10 were quantified using Luminex (E-H) at 14 days post-prime.

[0041] FIG. 5D shows an analysis of ALT levels (and 14 days post-boost).

[0042] FIG. 5E shows levels of cytokines (IFNy) quantified using Luminex at 14 days post-prime and 14 days post-boost.

[0043] FIG. 5F shows Levels of cytokines (TNFa) quantified using Luminex at 14 days post-prime and 14 days post-boost.

[0044] FIG. 5G shows Levels of cytokines (IL-2) quantified using Luminex at 14 days post-prime and 14 days post-boost.

[0045] FIG. 5H shows Levels of cytokines (IL-10) quantified using Luminex at 14 days post-prime and 14 days post-boost.

[0046] FIG. 6A shows protection Induced by LNP-circRNA-prME alone or in combination with circRNA-NS1 and circRNA-NS5 in a YFV Lethal Challenge Experiment.

[0047] FIG. 6B shows the survival rate following the lethal challenge.

[0048] FIG. 6C shows the weight change (grams) after challenge.

[0049] FIG. 6D shows an analysis of neutralizing antibodies in serum two weeks post-prime.

[0050] FIG. 6E shows an analysis of neutralizing antibodies in serum two weeks post-prime, two weeks post-boost and two weeks post-challenge. Neutralizing antibody levels were measured using a microneutralization assay.

[0051] FIG. 7A shows the prime and boost vaccination schedule, lethal challenge, and timing of blood collection in another study.

[0052] FIG. 7B is a graph that indicates the levels of neutralizing antibodies at different weeks after vaccination.

[0053] FIG. 7C shows the survival rate following the lethal challenge.

[0054] FIG. 7D shows weight change in hamsters after seven days of lethal challenge.

[0055] FIG. 7E shows liver enzyme ALT levels measured using ELISA.

[0056] FIG. 8 shows the prime and boost vaccination schedule, lethal challenge, and timing of blood collection in another study.

[0057] FIG. 9A shows levels induction using circRNA and linear RNA.

[0058] FIG. 9B shows levels of HTNC GPC binding antibodies.

[0059] FIG. 9C shows levels of HTNV neutralizing antibodies and different time points.

[0060] FIG. 9D shows levels of HTNV neutralizing antibodies (fold change cs. two-wee k PP).

[0061] FIG. 9E shows TNFa levels at 24 hours and two weeks.

[0062] FIG. 9F shows IFNY levels at 24 hours and two weeks.

[0063] FIG. 10A depicts liposomes and images of loaded microneedles.

[0064] FIG. 10B is a graph of percentage of viable cells in comparison to percentage of prME positive cells.

[0065] FIG. 10C is a graph of percentage of viable cells in comparison to percentage of prME positive cells.

[0066] FIG. 11 A is an immunofluorescence (IF) that show prME expression (empty patch / nuclei).

[0067] FIG. 11 B is an are immunofluorescence (IF) that show prME expression (empty patch / prME).

[0068] FIG. 11 C is an are immunofluorescence (IF) that show prME expression (empty patch / merge).

[0069] FIG. 11 D is an are immunofluorescence (IF) that show prME expression (circ-prME / nuclei).

[0070] FIG. 11 E is an are immunofluorescence (IF) that show prME expression (circ-prME / prME).

[0071] FIG. 11 F is an are immunofluorescence (IF) that show prME expression (circ-prME / merge).Definitions

[0072] Reference in this specification to "one embodiment / aspect" or "an embodiment / aspect" means that a particular feature, structure, or characteristic described in connection with the embodiment / aspect is included in at least one embodiment / aspect of the disclosure. The use of the phrase "in one embodiment / aspect" or "in another embodiment / aspect" in various places in the specification are not necessarily all referring to the same embodiment / aspect, norare separate or alternative embodiments / aspects mutually exclusive of other embodiments / aspects. Moreover, various features are described which may be exhibited by some embodiments / aspects and not by others. Similarly, various requirements are described which may be requirements for some embodiments / aspects but not other embodiments / aspects. Embodiment and aspect can in certain instances be used interchangeably.

[0073] The terms used in this specification generally have their ordinary meanings in the art, within the context of the disclosure, and in the specific context where each term is used. Certain terms that are used to describe the disclosure are discussed below, or elsewhere in the specification, to provide additional guidance to the practitioner regarding the description of the disclosure. It will be appreciated that the same thing can be said in more than one way.

[0074] Consequently, alternative language and synonyms may be used for any one or more of the terms discussed herein. Nor is any special significance to be placed upon whether or not a term is elaborated or discussed herein. Synonyms for certain terms are provided. A recital of one or more synonyms does not exclude the use of other synonyms. The use of examples anywhere in this specification including examples of any terms discussed herein is illustrative only, and is not intended to further limit the scope and meaning of the disclosure or of any exemplified term. Likewise, the disclosure is not limited to various embodiments given in this specification.

[0075] The term “artificial nucleic acid” as used herein will be recognized and understood by the person of ordinary skill in the art, and are for example intended to refer to a nucleic acid molecule, e.g. a DNA or an RNA that does not occur naturally. In other words, an artificial nucleic acid may be understood as a non-natural nucleic acid molecule. Such nucleic acid molecule may be non-natural due to its individual sequence (which does not occur naturally, e.g. G / C content modified coding sequence, UTRs) and / or due to other modifications, e.g. structural modifications of nucleotides which do not occur naturally. An artificial nucleic acid may be a DNA molecule, an RNA molecule or a hybrid-molecule comprising DNA and RNA portions. Typically, artificial nucleic acids may be designed and / or generated bygenetic engineering methods to correspond to a desired artificial sequence of nucleotides (heterologous sequence). In this context an artificial sequence is usually a sequence that may not occur naturally, i.e. it differs from the wild type sequence by at least one nucleotide.

[0076] The term “wild type” as used herein will be recognized and understood by the person of ordinary skill in the art, and is for example intended to refer to a sequence occurring in nature. Further, the term “artificial nucleic acid” is not restricted to mean “one single molecule” but is, typically, understood to comprise an ensemble of essentially identical molecules. Accordingly, it may relate to a plurality of essentially identical molecules contained in an aliquot or a sample.

[0077] The term “circular RNA” or “circRNA” refers to a type of single-stranded RNA which, unlike linear RNA, comprises a covalently closed continuous loop. circRNAs occur naturally in mammalian cells, and play important roles in various biological processes. circRNAs innately possess greater stability and resistance to intra- and extracellular RNAses than mRNAs, making them attractive candidates for delivery of key payloads where long-lasting expression is necessary. Recently, there has been an interest in using recombinant circRNAs to express a protein of interest, in vitro or in vivo. Introduction of an internal ribosome entry sequence (IRES) into a circular RNA allows translation of a protein encoded by a circRNA. However, IRES elements that exist in nature may or may not support translation from engineered circular RNAs, as IRES elements are often evolved in the context of linear RNA genomes.

[0078] The term “internal ribosome entry sequence” or “IRES” refers to an RNA element that allows for translation initiation in a cap-independent manner, as part of the greater process of protein synthesis. Initiation of eukaryotic translation nearly always occurs at and is dependent on the 5' cap of mRNA molecules, where the translation initiation complex forms and ribosomes engage the mRNA. IRES elements, however allow ribosomes to engage the mRNA and begin translation independently of the 5' cap.

[0079] As used herein, the term "recombinant" refers to polypeptides orpolynucleotides that do not exist naturally and which may be created by combining polynucleotides or polypeptides in arrangements that would not normally occur together. The term can refer to a polypeptide produced through a biological host, selected from a mammalian expression system, an insect cell expression system, a yeast expression system, and a bacterial expression system.

[0080] An "infectious" virus or viral particle is one that comprises a polynucleotide component that it is capable of delivering into a cell for which the viral species is tropic. The term does not necessarily imply any replication capacity of the virus. As used herein, an "infectious" virus or viral particle is one that can access a target cell, can infect a target cell, and can express a heterologous nucleic acid in a target cell. Thus, "infectivity" refers to the ability of a viral particle to access a target cell, infect a target cell, and express a heterologous nucleic acid in a target cell. Infectivity can refer to in vitro infectivity or in vivo infectivity. Assays for counting infectious viral particles are described elsewhere in this disclosure and in the art. Viral infectivity can be expressed as the ratio of infectious viral particles to total viral particles. Total viral particles can be expressed as the number of viral genome copies. The ability of a viral particle to express a heterologous nucleic acid in a cell can be referred to as "transduction." The ability of a viral particle to express a heterologous nucleic acid in a cell can be assayed using a number of techniques, including assessment of a marker gene, such as a green fluorescent protein (GFP) assay (e.g., where the virus comprises a nucleotide sequence encoding GFP), where GFP is produced in a cell infected with the viral particle and is detected and / or measured; or the measurement of a produced protein, for example by an enzyme-linked immunosorbent assay (ELISA).

[0081] The term "polynucleotide" refers to a polymeric form of nucleotides of any length, including deoxyribonucleotides or ribonucleotides, or analogs thereof. A polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs, and may be interrupted by non-nucleotide components. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. The term polynucleotide, as used herein, refers interchangeably to double- and single-stranded molecules. Unless otherwise specified or required, any embodiment of the invention described herein that is apolynucleotide encompasses both the double-stranded form and each of two complementary single-stranded forms known or predicted to make up the doublestranded form.

[0082] A "gene" refers to a polynucleotide containing at least one open reading frame that is capable of encoding a particular protein after being transcribed and translated.

[0083] The term "recombinant," as applied to a polynucleotide means that the polynucleotide is the product of various combinations of cloning, restriction or ligation steps, and other procedures that result in a construct that is distinct from a polynucleotide found in nature. A recombinant virus is a viral particle comprising a recombinant polynucleotide. The terms respectively include replicates of the original polynucleotide construct and progeny of the original virus construct.

[0084] The term "control element" or "control sequence" refers to a nucleotide sequence involved in an interaction of molecules that contributes to the functional regulation of a polynucleotide, including replication, duplication, transcription, splicing, translation, or degradation of the polynucleotide. The regulation may affect the frequency, speed, or specificity of the process, and may be enhancing or inhibitory in nature. Control elements known in the art include, for example, transcriptional regulatory sequences such as promoters and enhancers. A promoter is a DNA region capable under certain conditions of binding RNA polymerase and initiating transcription of a coding region usually located downstream (in the 3' direction) from the promoter.

[0085] The term "operatively linked" or "operably linked" refers to a juxtaposition of genetic elements, wherein the elements are in a relationship permitting them to operate in the expected manner. For instance, a promoter is operatively linked to a coding region if the promoter helps initiate transcription of the coding sequence. There may be intervening residues between the promoter and coding region so long as this functional relationship is maintained.

[0086] The terms “operably linked” and “operatively linked,” as used herein, refer toan arrangement of elements that are configured so as to perform, function or be structured in such a manner as to be suitable for an intended purpose. For example, a given promoter operably linked to a coding sequence is capable of effecting the expression of the coding sequence when the proper enzymes are present.Expression is meant to include the transcription of any one or more of a recombinant nucleic acid encoding a circular RNA, or mRNA from a DNA or RNA template and can further include translation of a protein from a recombinant circular RNA comprising an IRES sequence (e.g., a non-native IRES). Thus, for example, intervening untranslated yet transcribed sequences can be present between a promoter sequence and a coding sequence and the promoter sequence can still be considered to be “operably linked” to the coding sequence.

[0087] The term “exon,” as used herein, refers to a nucleic acid sequence present in a gene which is represented in the mature form of an RNA molecule after excision of introns during transcription. Exons may be translated into protein (e.g., in the case of messenger RNA (mRNA)).

[0088] The term “intron,” as used herein, refers to a nucleic acid sequence present in a given gene which is removed by RNA splicing during maturation of the final RNA product. Introns are generally found between exons. During transcription, introns are removed from precursor messenger RNA (pre-m RNA), and exons are joined via RNA splicing.

[0089] The term "expression vector" refers to a vector comprising a region which encodes a polypeptide of interest, and is used for effecting the expression of the protein in an intended target cell. An expression vector also comprises control elements operatively linked to the encoding region to facilitate expression of the protein in the target. The combination of control elements and a gene or genes to which they are operably linked for expression is sometimes referred to as an "expression cassette," a large number of which are known and available in the art or can be readily constructed from components that are available in the art.

[0090] "Heterologous" means derived from a genotypically distinct entity from that of the rest of the entity to which it is being compared. For example, a polynucleotideintroduced by genetic engineering techniques into a plasmid or vector derived from a different species is a heterologous polynucleotide. A promoter removed from its native coding sequence and operatively linked to a coding sequence with which it is not naturally found linked is a heterologous promoter. Thus, for example, an rAAV that includes a heterologous nucleic acid encoding a heterologous gene product is an rAAV that includes a nucleic acid not normally included in a naturally-occurring, wild-type AAV, and the encoded heterologous gene product is a gene product not normally encoded by a naturally-occurring, wild-type AAV.

[0091] The terms "genetic alteration" and "genetic modification" (and grammatical variants thereof), are used interchangeably herein to refer to a process wherein a genetic element (e.g., a polynucleotide) is introduced into a cell other than by mitosis or meiosis. The element may be heterologous to the cell, or it may be an additional copy or improved version of an element already present in the cell. Genetic alteration may be effected, for example, by transfecting a cell with a recombinant plasmid or other polynucleotide through any process known in the art, such as electroporation, calcium phosphate precipitation, or contacting with a polynucleotide-liposome complex. Genetic alteration may also be effected, for example, by transduction or infection with a DNA or RNA virus or viral vector. Generally, the genetic element is introduced into a chromosome or mini-chromosome in the cell; but any alteration that changes the phenotype and / or genotype of the cell and its progeny is included in this term.

[0092] A cell is said to be "stably" altered, transduced, genetically modified, or transformed with a genetic sequence if the sequence is available to perform its function during extended culture of the cell in vitro. Generally, such a cell is "heritably" altered (genetically modified) in that a genetic alteration is introduced which is also inheritable by progeny of the altered cell.

[0093] An "isolated" plasmid, nucleic acid, vector, virus, virion, host cell, or other substance refers to a preparation of the substance devoid of at least some of the other components that may also be present where the substance or a similar substance naturally occurs or is initially prepared from. Thus, for example, an isolated substance may be prepared by using a purification technique to enrich itfrom a source mixture. Enrichment can be measured on an absolute basis, such as weight per volume of solution, or it can be measured in relation to a second, potentially interfering substance present in the source mixture. Increasing enrichments of the embodiments of this invention are increasingly more isolated. An isolated plasmid, nucleic acid, vector, virus, host cell, or other substance is in some embodiments purified, e.g., from about 80% to about 90% pure, at least about 90% pure, at least about 95% pure, at least about 98% pure, or at least about 99%, or more, pure.

[0094] The term “nanoparticle” refers to a particle of matter, generally between about 1 and 100 nanometers (nm) in diameter. As used herein, a nanoparticle can refer to a liposome, virus, viral vector or other viral particle.

[0095] The term “liposome” refers to a spherical vesicle having at least one lipid bilayer (i.e. an aqueous solution core surrounded by a hydrophobic membrane). Liposomes can be prepared by disrupting biological membranes (such as by sonication). Liposomes are formed when phospholipids and their derivatives are dispersed in water. Upon dispersion in water the phospholipids form closed vesicles called “liposomes,” which are characterized by lipid bilayers encapsulating an aqueous core. Various liposomes have been used as carriers for entrapped therapeutic agents, such as drugs, enzymes and genetic sequences for use in medical science, in pharmaceutical science and in biochemistry. Specific uses include delivery of nutrients and pharmaceutical drugs, such as lipid nanoparticles in mRNA vaccines and DNA vaccines. Liposomes can be modified by the incorporation of polyethylene glycol or other hydrophilic polymers (e.g., a PEG liposome where one or more of the constituent lipids is modified by attachment of PEG). Liposomes can also be modified to target particular cell types by incorporating targeting factors (e.g., “targeting ligands”) for particular cell types. Examples include asialoglycoprotein, folate, transferrin, antibodies, etc.

[0096] The term “exosome” refers to a membrane-bound extracellular vesicles that are produced in the endosomal compartment of most eukaryotic cells. In multicellular organisms, exosomes and other EVs are found in biological fluids including saliva, blood, urine and cerebrospinal fluid. Exosomes are similar toliposomes in terms of consisting of bilayered phospholipids, but the biogenesis of exosomes ensures their biocompatibility and low toxicity. It also significantly complicates pharmaceutical development, production and safety profiling (immunogenicity, and potential biological impurities).

[0097] The term “an effective amount” refers to the amount of the defined component sufficient to achieve the desired therapeutic result. In an embodiment, that result can be effective cancer treatment.

[0098] As used herein, the terms "treatment," "treating," and the like, refer to obtaining a desired pharmacologic and / or physiologic effect. The effect may be prophylactic in terms of completely or partially preventing a disease or symptom thereof and / or may be therapeutic in terms of a partial or complete cure for a disease and / or adverse affect attributable to the disease. "Treatment," as used herein, covers any treatment of a disease in a mammal, particularly in a human, and includes: (a) preventing the disease from occurring in a subject which may be predisposed to the disease or at risk of acquiring the disease but has not yet been diagnosed as having it; (b) inhibiting the disease, i.e. , arresting its development; and (c) relieving the disease, i.e., causing regression of the disease.

[0099] The terms "individual," "host," "subject," and "patient" are used interchangeably herein, and refer to a mammal, including, but not limited to, human and non-human primates, including simians and humans; mammalian sport animals (e.g., horses); mammalian farm animals (e.g., sheep, goats, etc.); mammalian pets (dogs, cats, etc.); and rodents (e.g., mice, rats, etc.).

[0100] As used herein, "gene replacement therapy" refers to administration to the recipient of exogenous genetic material encoding a therapeutic agent and subsequent expression of the administered genetic material in situ. Thus, the phrase "condition amenable to gene replacement therapy" embraces conditions such as genetic diseases (i.e., a disease condition that is attributable to one or more gene defects), acquired pathologies (i.e., a pathological condition which is not attributable to an inborn defect), cancers and prophylactic processes (i.e., prevention of a disease or of an undesired medical condition). Accordingly, as used herein, the term"therapeutic agent" refers to any agent or material, which has a beneficial effect on the mammalian recipient. Thus, "therapeutic agent" embraces both therapeutic and prophylactic molecules having nucleic acid or protein components.

[0101] The term "substantial homology" or "substantial similarity," when referring to a nucleic acid, or fragment thereof, indicates that, when optimally aligned with appropriate nucleotide insertions or deletions with another nucleic acid (or its complementary strand), there is nucleotide sequence identity in at least about 95 to 99% of the aligned sequences. Preferably, the homology is over full-length sequence, or an open reading frame thereof, or another suitable fragment which is at least 15 nucleotides in length. Examples of suitable fragments are described herein.

[0102] The terms "sequence identity" "percent sequence identity" or "percent identical" in the context of nucleic acid sequences refers to the residues in the two sequences which are the same when aligned for maximum correspondence. The length of sequence identity comparison may be over the full-length of the genome, the full-length of a gene coding sequence, or a fragment of at least about 500 to 5000 nucleotides, is desired. However, identity among smaller fragments, e.g. of at least about nine nucleotides, usually at least about 20 to 24 nucleotides, at least about 28 to 32 nucleotides, at least about 36 or more nucleotides, may also be desired. Similarly, "percent sequence identity" may be readily determined for amino acid sequences, over the full-length of a protein, or a fragment thereof. Suitably, a fragment is at least about 8 amino acids in length, and may be up to about 700 amino acids. Examples of suitable fragments are described herein.

[0103] The term "substantial homology" or "substantial similarity," when referring to amino acids or fragments thereof, indicates that, when optimally aligned with appropriate amino acid insertions or deletions with another amino acid (or its complementary strand), there is amino acid sequence identity in at least about 95 to 99% of the aligned sequences. Preferably, the homology is over full-length sequence, or a protein thereof, e.g., a cap protein, a rep protein, or a fragment thereof which is at least 8 amino acids, or more desirably, at least 15 amino acids in length. Examples of suitable fragments are described herein.

[0104] Generally, when referring to "identity", "homology", or "similarity" between two different adeno-associated viruses, "identity", "homology" or "similarity" is determined in reference to "aligned" sequences. "Aligned" sequences or "alignments" refer to multiple nucleic acid sequences or protein (amino acids) sequences, often containing corrections for missing or additional bases or amino acids as compared to a reference sequence. In the examples, AAV alignments are performed using the published AAV2 or AAV1 sequences as a reference point. However, one of skill in the art can readily select another AAV sequence as a reference. Alignments are performed using any of a variety of publicly or commercially available Multiple Sequence Alignment Programs. Examples of such programs include, "Clustal W', "CAP Sequence Assembly", "MAP", and "MEME", which are accessible through Web Servers on the internet.

[0105] By the term "highly conserved" is meant at least 80% identity, preferably at least 90% identity, and more preferably, over 97% identity. Identity is readily determined by one of skill in the art by resort to algorithms and computer programs known by those of skill in the art.

[0106] The term “derived from” as used herein, in the context of a nucleic acid, i.e. for a nucleic acid “derived from” (another) nucleic acid, means that the nucleic acid, which is derived from (another) nucleic acid, shares at least 50%, preferably at least 55%, preferably at least 60%, preferably at least 65%, preferably at least 70%, more preferably at least 75%, more preferably at least 80%, 81%, 82%, 83%, 84%, more preferably at least 85%, 86%, 87%, 88%, 89% even more preferably at least 90%, 91 %, 92%, 93%, 94%, even more preferably at least 95%, 96%, 97%, and particularly preferably at least 98%, 99% sequence identity with the nucleic acid from which it is derived. The skilled person is aware that sequence identity is typically calculated for the same types of nucleic acids, i.e. for DNA sequences or for RNA sequences. Thus, it is understood, if a DNA is “derived from” an RNA or if an RNA is “derived from” a DNA, in a first step the RNA sequence is converted into the corresponding DNA sequence (in particular by replacing the uracils (U) by thymidines (T) throughout the sequence) or, vice versa, the DNA sequence is converted into the corresponding RNA sequence (in particular by replacing the thymidines (T) by uracils (U) throughout the sequence). Thereafter, the sequenceidentity of the DNA sequences or the sequence identity of the RNA sequences is determined. Preferably, a nucleic acid “derived from” a nucleic acid also refers to nucleic acid, which is modified in comparison to the nucleic acid from which it is derived, e.g. in order to increase RNA stability even further and / or to prolong and / or increase protein production. It goes without saying that such modifications are preferred, which do not impair RNA stability, e.g. in comparison to the nucleic acid from which it is derived.

[0107] The term “immune response” will be recognized and understood by the person of ordinary skill in the art, and is for example intended to refer to a specific reaction of the adaptive immune system to a particular antigen (so called specific or adaptive immune response) or an unspecific reaction of the innate immune system (so called unspecific or innate immune response), or a combination thereof.

[0108] The term “immune system” will be recognized and understood by the person of ordinary skill in the art, and is for example intended to refer to a system of the organism that may protect the organisms from infection. If a pathogen succeeds in passing a physical barrier of an organism and enters this organism, the innate immune system provides an immediate, but non-specific response. If pathogens evade this innate response, vertebrates possess a second layer of protection, the adaptive immune system. Here, the immune system adapts its response during an infection to improve its recognition of the pathogen. This improved response is then retained after the pathogen has been eliminated, in the form of an immunological memory, and allows the adaptive immune system to mount faster and stronger attacks each time this pathogen is encountered. According to this, the immune system comprises the innate and the adaptive immune system. Each of these two parts typically contains so called humoral and cellular components.

[0109] The term “innate immune system” (also known as non-specific or unspecific immune system) will be recognized and understood by the person of ordinary skill in the art, and is for example intended to refer to a system typically comprising the cells and mechanisms that defend the host from infection by other organisms in a nonspecific manner. This means that the cells of the innate system may recognize and respond to pathogens in a generic way, but unlike the adaptive immune system, itdoes not confer long-lasting or protective immunity to the host. The innate immune system may be, e.g. activated by ligands of Toll-like receptors (TLRs) or other auxiliary substances such as lipopolysaccharides, TNF-alpha, CD40 ligand, or cytokines, monokines, lymphokines, interleukins or chemokines, IL-1 , IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11 , IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21 , IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-28, IL-29, IL-30, IL-31 , IL-32, IL-33, IFN-alpha, IFN-beta, IFN-gamma, GM-CSF, G-CSF, M-CSF, LT-beta, TNF-alpha, growth factors, and hGH, a ligand of human Toll-like receptor TLR1 , TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, a ligand of murine Toll-like receptor TLR1 , TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, TLR11 , TLR12 or TLR13, a ligand of a NOD-like receptor, a ligand of a RIG- 1 like receptor, an immunostimulatory nucleic acid, an immunostimulatory RNA (isRNA), a CpG-DNA, an antibacterial agent, or an anti-viral agent.

[0110] The term “adaptive immune response” as used herein will be recognized and understood by the person of ordinary skill in the art, and is for example intended to refer to an antigen-specific response of the immune system. Antigen specificity allows for the generation of responses that are tailored to specific pathogens or pathogen-infected cells. The ability to mount these tailored responses is usually maintained in the body by “memory cells” (B-cells). In the context of the invention, the antigen (e.g. Bunyavirales peptide, protein, polyprotein) is provided by the artificial nucleic acid coding sequence encoding at least one antigenic peptide, protein or polyprotein of the invention.

[0111] The term “adaptive immune system” as used herein will be recognized and understood by the person of ordinary skill in the art, and is for example intended to refer to a highly adaptable system typically regulating the adaptive immune response by providing the vertebrate immune system with the ability to recognize and remember specific pathogens (to generate immunity), and to mount stronger attacks each time the pathogen is encountered. The system is highly adaptable because of somatic hyper mutation (a process of accelerated somatic mutations), and V(D)J recombination (an irreversible genetic recombination of antigen receptor gene segments). This mechanism allows a small number of genes to generate a vast number of different antigen receptors, which are then uniquely expressed on eachindividual lymphocyte. Because the gene rearrangement leads to an irreversible change in the DNA of each cell, all of the progeny (offspring) of such a cell will then inherit genes encoding the same receptor specificity, including the Memory B cells and Memory T cells that are the keys to induce long-lived specific immunity.

[0112] The term “antigen” as used herein will be recognized and understood by the person of ordinary skill in the art, and is for example intended to refer to a substance which may be recognized by the immune system, preferably by the adaptive immune system, and is capable of triggering an antigen-specific immune response, e.g. by formation of antibodies and / or antigen-specific T cells as part of an adaptive immune response. Typically, an antigen may be or may comprise a peptide or protein which may be presented by the MHC to T-cells. In the context of the present invention, an antigen, e.g. a Bunyavirales antigen, may be the product of translation of a provided inventive artificial nucleic acid of the, preferably of the mRNA as specified herein. Also fragments, variants and derivatives of peptides, proteins, or polyproteins of a virus of the order Bunyavirales comprising at least one epitope are understood as antigens in the context of the invention.

[0113] The terms “cellular immunity” or “cellular immune response” or “cellular T- cell responses” as used herein will be recognized and understood by the person of ordinary skill in the art, and are for example intended to refer to the activation of macrophages, natural killer cells (NK), antigen-specific cytotoxic T-lymphocytes, and the release of various cytokines in response to an antigen. In more general terms, cellular immunity is not based on antibodies, but on the activation of cells of the immune system. Typically, a cellular immune response may be characterized e.g. by activating antigen-specific cytotoxic T-lymphocytes that are able to induce apoptosis in cells, e.g. specific immune cells like dendritic cells or other cells, displaying epitopes of foreign antigens on their surface. In the context of the invention, the antigen (e.g. Bunyavirales peptide, protein, polyprotein) is provided by the artificial nucleic acid coding sequence encoding at least one antigenic peptide, protein or polyprotein of the invention.

[0114] The term “epitope” (also called “antigen determinant” in the art) as used herein will be recognized and understood by the person of ordinary skill in the art,and is for example intended to refer to T cell epitopes and B cell epitopes. T cell epitopes or parts of the antigenic peptides or proteins may comprise fragments preferably having a length of about 6 to about 20 or even more amino acids, e.g. fragments as processed and presented by MHC class I molecules, preferably having a length of about 8 to about 10 amino acids, e.g. 8, 9, or 10, (or even 11 , or 12 amino acids), or fragments as processed and presented by MHC class II molecules, preferably having a length of about 13 to about 20 or even more amino acids, wherein these fragments may be selected from any part of the amino acid sequence. These fragments are typically recognized by T cells in form of a complex consisting of the peptide fragment and an MHC molecule, i.e. the fragments are typically not recognized in their native form. B cell epitopes are typically fragments located on the outer surface of (native) protein or peptide antigens (e.g. Bunyavirales antigens), preferably having 5 to 15 amino acids, more preferably having 5 to 12 amino acids, even more preferably having 6 to 9 amino acids, which may be recognized by antibodies, i.e. in their native form. Such epitopes of proteins or peptides may furthermore be selected from any of the herein mentioned variants of such proteins or peptides. In this context antigenic determinants can be conformational or discontinuous epitopes which are composed of segments of the proteins or peptides as defined herein that are discontinuous in the amino acid sequence of the proteins or peptides as defined herein but are brought together in the three-dimensional structure or continuous or linear epitopes which are composed of a single polypeptide chain.

[0115] The term “strain” or “strain of a virus” is a group of viruses that are genetically distinct from other groups of the same species. Accordingly, a “strain” is a variant of a given virus (species) that is recognizable because it possesses some unique phenotypic characteristics that remain stable under natural conditions. In the context of the invention, the terms “variant” of a virus and “strain” of a virus are used interchangeably.

[0116] The terms “isolate” or “isolate of a virus” as used herein, will be recognized and understood by the person of ordinary skill in the art, and are for example intended to refer to a specific isolated virus of a certain virus species. In the context of the invention, a natural Bunyavirales isolate is an instance of a particular naturalvirus or of a particular genetic strain (or variant). Isolates can be identical or slightly different in consensus or individual sequence from each other.

[0117] The term “peptide” will be recognized and understood by the person of ordinary skill in the art, and are for example intended to refer to a polymer of amino acid monomers, linked by peptide bonds. It typically contains less than 50 amino acid monomers. Nevertheless, the term peptide is not a disclaimer for molecules having more than 50 amino acid monomers.

[0118] The terms “pharmaceutically effective amount” or “effective amount” will be recognized and understood by the person of ordinary skill in the art, and are for example intended to refer to an amount of a compound (e.g. the artificial nucleic acid of the invention) that is sufficient to induce a pharmaceutical effect, such as, in the context of the invention, an immune response (e.g. against an antigenic peptide, protein, polyprotein as defined herein).

[0119] The term “stabilized nucleic acid molecule” or “stabilized RNA” refer to is a nucleic acid molecule, preferably an RNA molecule that is modified such, that it is more stable to disintegration or degradation, e.g., by environmental factors or enzymatic digest, such as by an exo- or endonuclease degradation, than the nucleic acid molecule without the modification. Preferably, a stabilized nucleic acid molecule, e.g. stabilized RNA, in the context of the present invention is stabilized in a cell, such as a prokaryotic or eukaryotic cell, preferably in a mammalian cell, such as a human cell. The stabilization effect may also be exerted outside of cells, e.g. in a buffer solution etc., for example, in a manufacturing process for a pharmaceutical composition comprising the stabilized nucleic acid molecule.

[0120] The term “variant” as used throughout the present specification in the context of a nucleic acid sequence will be recognized and understood by the person of ordinary skill in the art, and is for example intended to refer to a variant of nucleic acid sequences which forms the basis of a nucleic acid sequence. For example, a variant nucleic acid sequence may exhibit one or more nucleotide deletions, insertions, additions and / or substitutions compared to the nucleic acid sequence from which the variant is derived. Preferably, a variant of a nucleic acid sequence isat least 40%, preferably at least 50%, more preferably at least 60%, more preferably at least 70%, even more preferably at least 80%, even more preferably at least 90%, most preferably at least 95% identical to the nucleic acid sequence the variant is derived from. Preferably, the variant is a functional variant. A “variant” of a nucleic acid sequence may have at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% nucleotide identity over a stretch of 10, 20, 30, 50, 75 or 100 nucleotide of such nucleic acid sequence.

[0121] The term “variant” as used throughout the present specification in the context of proteins or peptides will be recognized and understood by the person of ordinary skill in the art, and is for example intended to refer to a proteins or peptide variant having an amino acid sequence which differs from the original sequence in one or more mutation(s), such as one or more substituted, inserted and / or deleted amino acid(s). Preferably, these fragments and / or variants have the same biological function or specific activity compared to the full-length native protein, e.g. its specific antigenic property. “Variants” of proteins or peptides as defined in the context of the present invention may comprise conservative amino acid substitution(s) compared to their native, i.e. non-mutated physiological, sequence. Those amino acid sequences as well as their encoding nucleotide sequences in particular fall under the term variants as defined herein. Substitutions in which amino acids, which originate from the same class, are exchanged for one another are called conservative substitutions. In particular, these are amino acids having aliphatic side chains, positively or negatively charged side chains, aromatic groups in the side chains or amino acids, the side chains of which can enter into hydrogen bridges, e.g. side chains which have a hydroxyl function. This means that e.g. an amino acid having a polar side chain is replaced by another amino acid having a likewise polar side chain, or, for example, an amino acid characterized by a hydrophobic side chain is substituted by another amino acid having a likewise hydrophobic side chain (e.g. serine (threonine) by threonine (serine) or leucine (isoleuine) by isoleuine (leucine)). Insertions and substitutions are possible, in particular, at those sequence positions which cause no modification to the three-dimensional structure or do not affect the binding region. Modifications to a three-dimensional structure by insertion(s) or deletion(s) can easily be determined e.g. using CD spectra (circular dichroism spectra). A“variant” of a protein or peptide may have at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99%amino acid identity over a stretch of 10, 20, 30, 50, 75 or 100 amino acids of such protein or peptide. Preferably, a variant of a protein comprises a functional variant of the protein, which means that the variant exerts the same effect or functionality as the protein it is derived from.DETAILED DESCRIPTION

[0122] The particular configurations discussed in the following description are nonlimiting examples that can be varied and are cited merely to illustrate at least one embodiment and are not intended to limit the scope thereof. The present invention includes formulations and methods of preventing or treating an ailment such as a Yellow Fever and Hantaan orthohantavirus (HTNV). In embodiments, a subject is administered a circular mRNA vaccine.

[0123] Flaviviruses are enveloped, single-stranded, positive-sense RNA viruses in the genus Flavivirus, family Flaviviridae. The viral RNA genome is approximately 11 kb in length and contains one long open reading frame (ORF) encoding four virion structural proteins, capsid (C), membrane (M), its precursor pre-membrane (prM), and envelope (E), and 7 non-structural (NS) proteins, NS1 , NS2A, NS2B, NS3, NS4A, NS4B, and NS5, flanked by 5'- and 3'-untranslated regions (5'UTR / 3'UTR), approximately 100 and 450 nucleotides (nt) long, respectively. All viral proteins derive from the post-translational processing of a polyprotein precursor by both virally-encoded and host proteinases. The C protein includes the virion core, which encapsidates the viral RNA genome. The prM, M, and E proteins are integral membrane proteins within the virion envelope. In completely matured, infectious virions the E protein exists as an N -glycosylated dimer, 180 copies per virion, along with an equal number of M protein molecules. The NS proteins, although they are not incorporated into the virion, play critical roles in the virus life cycle, including proteolytic processing, RNA replication, virion maturation, and the modulation of host cell functions and activities such as those involved in interferon and apoptosis pathways.

[0124] There are nearly 70 known flaviviruses, 30 of which have been associated with human diseases of varying incidence and severity. The flaviviruses were originally grouped and typed by their reactivity in serological assays (i.e. , virus-neutralization, hemagglutination, and complement-fixation) according to their unique (virus specific) or shared (cross-reactive) antigenic determinants. These groupings were later confirmed and extended by monoclonal antibody mapping of discrete epitopic determinants and genetic sequence analysis of the viral RNAs. Arguably, the most medically important flaviviruses in terms of disease incidence and severity are the arthropod-borne viruses or Arboviruses, particularly those in Group B, which are transmitted by mosquito or tick vectors. These include the dengue virus (DENV), yellow fever virus (YFV), Japanese encephalitis virus (JEV), and West Nile virus (WNV), Zika virus (ZIKV), St. Louis encephalitis virus (SLEV), Tick-borne encephalitis virus (TBEV) (including the Russian Spring Summer encephalitis virus (RSSEV)).Circular RNAs

[0125] CircRNAs are a class of single-stranded RNAs with covalently linked head- to-tail topology. Artificial circRNAs have been engineered as a novel class of vaccines for disease treatment and prevention. Unlike the linear mRNA vaccine which applications were limited by its instability, inefficiency, and innate immunogenicity, circRNA vaccine which incorporate internal ribosome entry sites (IRESs) and open reading frame (ORF) provides an improved approach to RNA- based vaccination with safety, stability, simplicity of manufacture, and scalability. However, circRNA vaccines are at an early stage, and their optimization, delivery and applications require further development and evaluation.

[0126] Embodiments include recombinant circular RNA molecules that include an internal ribosome entry site (IRES) sequence operably linked to a protein-coding sequence, and DNA sequences encoding the same. In embodiments, the protein coding sequence encodes a non-viral protein. For example, in some embodiments, the protein coding sequence encodes an animal protein, a plant protein, a bacterial protein, a fungal protein, or an artificial protein. In some embodiments, the protein coding sequence encodes a mammalian protein, such as a human protein.

[0127] Recombinant circRNA molecules can be generated or engineered according to several methods. For example, recombinant circRNA molecules can be generated by back- splicing of linear RNAs. For example, a recombinant circularT1RNA can be produced by back-splicing of a downstream 5’ splice site (splice donor) to an upstream 3’ splice site (splice acceptor). The splice donor and / or splice acceptor can be found, for example, in a human intron or portion thereof that is typically used for circRNA production at endogenous loci. Alternatively, a recombinant circular RNA can be produced by contacting a cell with a DNA plasmid, wherein the DNA plasmid encodes a linear RNA, and the linear RNA is back- spliced to produce a recombinant circular RNA. In embodiments, the DNA plasmid includes introns from the mammalian ZKSCAN1 gene.

[0128] In embodiments, circular RNAs are generated by a non-mammalian splicing method. For example, linear RNAs containing various types of introns, including self-splicing group I introns, self-splicing group II introns, spliceosomal introns, and tRNA introns can be circularized. In particular, group I and group II introns have the advantage that they can be readily used for production of circular RNAs in vitro as well as in vivo because of their ability to undergo self-splicing due to their autocatalytic ribozyme activity.

[0129] Alternatively, circular RNAs can be produced in vitro from a linear RNA by chemical or enzymatic ligation of the 5’ and 3’ ends of the RNA. Chemical ligation can be performed, for example, using cyanogen bromide (BrCN) or ethyl-3 -(3 - dimethylaminopropyl) carbodiimide (EDC) for activation of a nucleotide phosphomonoester group to allow phosphodiester bond formation (Sokolova, FEBS Lett, 232: 153-155 (1988); Dolinnaya et al., Nucleic Acids Res., 19: 3067-3072 (1991 ); Fedorova, Nucleosides Nucleotides Nucleic Acids, 15: 1137-1147 (1996)). Alternatively, enzymatic ligation can be used to circularize RNA. Exemplary ligases that can be used include T4 DNA ligase (T4 Dnl), T4 RNA ligase 1 (T4 Rnl 1 ), and T4 RNA ligase 2 (T4 Rnl 2).

[0130] In embodiments, splint ligation is used to generate circular RNA. Splint ligation involves the use of an oligonucleotide splint that hybridizes with the two ends of a linear RNA to bring the ends of the linear RNA together for ligation. Hybridization of the splint, which can be either a deoxyribo-oligonucleotide or a ribooligonucleotide, orients the 5 - phosphate and 3 -OH of the RNA ends for ligation. Subsequent ligation can be performed using either chemical or enzymatictechniques, as described above. Enzymatic ligation can be performed, for example, with T4 DNA ligase (DNA splint required), T4 RNA ligase 1 (RNA splint required) or T4 RNA ligase 2 (DNA or RNA splint). Chemical ligation, such as with BrCN or EDC, is more efficient in some cases than enzymatic ligation if the structure of the hybridized splint-RNA complex interferes with enzymatic activity (see, e.g., Dolinnaya et al. Nucleic Acids Res, 27(23): 5403-5407 (1993); Petkovic et al., Nucleic Acids Res, 43(4): 2454- 2465 (2015)).

[0131] While circular RNAs generally are more stable than their linear counterparts, primarily due to the absence of free ends necessary for exonuclease-mediated degradation, additional modifications can be made to the recombinant circRNA to further improve stability. Still other kinds of modifications may improve circularization efficiency, purification of circRNA, and / or protein expression from circRNA. For example, the recombinant circRNA can be engineered to include “homology arms” (i.e. , 9-19 nucleotides in length placed at the 5’ and 3’ ends of a precursor RNA with the aim of bringing the 5’ and 3’ splice sites into proximity of one another), spacer sequences, and / or a phosphorothioate (PS) cap (Wesselhoeft et al., Nat. Commun ., 9: 2629 (2018)). The recombinant circRNA also can be engineered to include 2'-O- methyl-, -fluoro- or -O-m ethoxyethyl conjugates, phosphorothioate backbones, or 2',4'-cyclic 2 '-(9-ethyl modifications to increase the stability thereof (Holdt et al., Front Physiol., 9: 1262 (2018); Kriitzfeldt et al., Nature , 435(7068): 685-9 (2005); and Crooke et al., Cell Metab., 27(4): 714-739 (2018)). The recombinant circRNA molecule can also include one or more modifications that reduce the innate immunogenicity of the circRNA molecule in a host, such as at least one N6- methyladenosine (m6A).

[0132] In embodiments, the recombinant circRNA molecule includes at least one 2- thiouridine (2Thioll) or at least one 2'-0-methylcytidine (20MeC). 2-thiouridine is a modified nucleobase found in tRNAs that has been shown to stabilize U:A base pairs and destabilize U:G wobble pairs (Rodriguez-Hemandez et al., J. Mol. Biol. 2013;425:3888-3906). Methylation of 2'-hydroxyl groups is one of the most common posttranscriptional modifications of naturally occurring stable RNA molecules (Satoh et al., RNA 2000. 6: 680-686). For example, methylation of tRNA at the 2'-OH position of the ribose sugar is generally thought to increase the stability of tRNA viamechanisms that protect against spontaneous hydrolysis or nuclease digestion (e.g., in non-helical regions) and reinforce intra-loop interactions that stabilize the tertiary structure of the molecule (Endres et al., PLoS ONE 15 (2): e0229103).

[0133] Any number of nucleotides (e.g., undine and / or cytidine) in a particular circRNA molecule generated as described herein may be modified (e.g., replaced) with a corresponding number of 2-thiouridine (2Thioll) or 2'-0-methylcytidine (20MeC). Ideally, at least one nucleotide in the circRNA molecule is replaced with a 2Thioll or a 20MeC. In some embodiments, at least 1 % (e.g., 1 %, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9% or more) of the nucleotides in the recombinant circular RNA molecule are replaced with 2Thioll or a 20MeC.

[0134] In embodiments, at least 10% (e.g., 10%, 11 %, 12%, 13%, 14%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more) of the nucleotides in the recombinant circular RNA molecule are replaced with 2Thioll or 20MeC. For example, the recombinant circRNA molecule comprises about 2% to about 5% (e.g., 2.5%, 3%, 3.5%, 4%, or 4.5%) 2-thiouridine or 2-O-methylcytidine. In some embodiments, the recombinant circRNA molecule comprises about 2.5% 2Thioll or 20MeC. In other embodiments, all (i.e., 100%) of the uridine nucleotides in the recombinant circular RNA molecule may be replaced with 2Thioll, or all (i.e., 100%) of the cytidine nucleotides in the recombinant circRNA molecule may be replaced with 20MeC. It will be appreciated that the number of 2Thioll or 20MeC modifications introduced into a recombinant circular RNA molecule will depend upon the particular use of the circRNA.

[0135] In embodiments, a DNA sequence encoding a circular RNA molecule includes sequences that encode at least two introns and at least one exon. In some embodiments, the recombinant circular RNA molecule comprises a nucleic acid sequence which includes one or more exons and one or more introns.

[0136] Accordingly, circular RNAs can be generated using either an endogenous or exogenous intron (see, e.g., WO 2017 / 222911 ). As used herein, the term “endogenous intron” generally refers to an intron sequence that is native to the host cell in which the circRNA is produced. For example, a human intron is anendogenous intron when the circRNA is expressed in a human cell. An “exogenous intron” generally refers to an intron that is heterologous to the host cell in which the circRNA is generated. For example, a bacterial intron would be an exogenous intron when the circRNA is expressed in a human cell. Numerous intron sequences from a variety of organisms and viruses are known and include sequences derived from genes encoding proteins, ribosomal RNA (rRNA), or transfer RNA (tRNA). Representative intron sequences are available in various databases, including the Group I Intron Sequence and Structure Database (ma.whu.edu.cn / gissd / ), the Database for Bacterial Group II Introns (webapps2.ucalgary.ca / ~groupii / index.html), the Database for Mobile Group II Introns (fp.ucalgary.ca / group2introns), the Yeast Intron DataBase (emblS16 heidelberg.de / Externallnfo / seraphin / yidb.html), the Ares Lab Yeast Intron Database (compbio.soe.ucsc.edu / yeast_introns.html), the U12 Intron Database (genome.crg.es / cgibin / ul2db / ul2db.cgi), and the Exon-Intron Database (bpg .utol edo . edu / ~afedorov / lab / eid.html).

[0137] In embodiments, a nucleic acid (e.g., a DNA) encoding a circular RNA molecule includes a self-splicing group I intron. Group I introns are a distinct class of RNA self-splicing introns which catalyze their own excision from mRNA, tRNA, and rRNA precursors in a wide range of organisms. All known group I introns present in eukaryote nuclei interrupt functional ribosomal RNA genes located in ribosomal DNA loci. Nuclear group I introns appear widespread among eukaryotic microorganisms, and the plasmodial slime molds (myxomycetes) contain an abundance of selfsplicing introns. The self-splicing group I intron included in the DNA encoding the circular RNA molecule may be obtained or derived from any organism, such as, for example, bacteria, bacteriophages, and eukaryotic viruses. Self-splicing group I introns also may be found in certain cellular organelles, such as mitochondria and chloroplasts, and such self-splicing introns may be incorporated into the nucleic acid encoding a circular RNA molecule.

[0138] In embodiments, a nucleic acid encoding a recombinant circular RNA molecule includes a self-splicing group I intron of the phage T4 thymidylate synthase (td) gene. The group I intron of phage T4 thymidylate synthase (td) gene is well characterized to circularize while the exons linearly splice together (Chandry and Belfort, Genes Dev., 1 : 1028-1037 (1987); Ford and Ares, Proc. Natl. Acad. Sci.USA, 9P. 3117-3121 (1994); and Perriman and Ares, RNA, 4: 1047-1054 (1998)). When the td intron order is permuted (i.e., 5 half placed at the 3 position and vice versa) flanking any exon sequence, the exon is circularized via two autocatalytic transesterification reactions (Ford and Ares, supra ; Puttaraju and Been, Nucleic Acids Symp. Ser., 33: 49-51 (1995)).

[0139] In embodiments, a nucleic acid (e.g., a DNA) encoding the recombinant circular RNA molecule comprises a ZKSCAN1 intron. The ZKSCAN1 intron is described in, for example, Yao, Z., et al., Mol. Oncol. (2017) ll(4):422-437. In some embodiments, a nucleic acid encoding the recombinant circular RNA molecule comprises a miniZKSCANI intron. The recombinant circular RNA molecule can be of any length or size. For example, the recombinant circular RNA molecule may comprise between about 200 nucleotides and about 10,000 nucleotides (e.g., about 300, about 400, about 500, about 600, about 700, about 800, about 900, about 1 ,000, about 2,000, about 3,000, about 4,000, about 5,000, about 6,000, about 7,000, about 8,000, or about 9,000 nucleotides, or a range defined by any two of the foregoing values). In some embodiments, the recombinant circular RNA molecule comprises between about 500 and about 6,000 nucleotides (about 550, about 650, about 750, about 850, about 950, about 1 ,100, about 1 ,200, about 1 ,300, about 1 ,400, about 1 ,500, about 1 ,600, about 1 ,700, about 1 ,800, about 1 ,900, about2,100, about 2,200, about 2,300, about 2,400, about 2,500, about 2,600, about2.700, about 2,800, about 2,900, about 3,100, about 3,300, about 3,500, about3.700, about 3,800, about 3,900, about 4,100, about 4,300, about 4,500, about4.700, about 4,900, about 5,100, about 5,300, about 5,500, about 5,700, or about5,900 nucleotides, or a range defined by any two of the foregoing values). In one embodiment, the recombinant circular RNA molecule comprises about 1 ,500 nucleotides.

[0140] In embodiments, a recombinant circular RNA molecule includes an internal ribosome entry site (IRES) sequence operably linked to a protein-coding sequence; wherein the IRES sequence is a viral sequence; and wherein the protein-coding sequence encodes a non-viral protein.

[0141] In embodiments, a recombinant circular RNA molecule includes a proteincoding nucleic acid sequence region and an internal ribosome entry site (IRES) sequence region operably linked to the protein-coding nucleic acid sequence region, wherein the IRES comprises: at least one sequence region having secondary structure element; and a sequence region that is complementary to an 18S ribosomal RNA (rRNA); wherein the IRES has a minimum free energy (MFE) of less than -18.9 kJ / mol and a melting temperature of at least 35.0°C. In some embodiments, the IRES sequence is linked to the protein-coding nucleic acid sequence region in a non-native configuration.Microneedle Array Patch (MAP)

[0142] In aspects, the vaccines described herein are administer using a microneedle array patch (MAP). The MAPs described herein include microneedles that penetrate the skin of a subject. In aspects, at least a portion of the MAP (e.g., the perimeter portion) is an adhesive patch material. The adhesive patch material can include an adhesive or tacky substance to adhere to skin.

[0143] The MAPs described herein can be used to administer large and small molecules. The transfer of active agents into the skin and into capillaries or lymphatic vessels is rapid and consistent. Shallow penetration of the microneedles minimizes stimulation of nerve endings. The MAPs are convenient, discreet and easy to use.

[0144] Applicant has optimized parameters that impact the delivered dose of an agent. In aspects, up to 1 mg of delivered content is delivered with high efficiency. This is significantly more than the expected dose of a vaccine that can be administered to a patient. For comparison, traditional intramuscular delivery of mRNA vaccines via needle injection, utilizes between 10 and 30pg of mRNA.Pharmaceutical Compositions

[0145] Another embodiment is a pharmaceutical composition. The pharmaceutical composition can include the above-described nucleotides and a pharmaceutically acceptable carrier. The exogenous genetic material can include a heterologous gene that encodes a therapeutic agent for treating the ailment or condition. The pharmaceutical composition can also contain an amount of nucleotides sufficient todeliver a therapeutically effective dose to stimulate an immune response in the patient.

[0146] In one embodiment, the circular RNA vaccine containing the desired transgene and cell-specific promoter for use in the target ocular cells as detailed above is optionally assessed for contamination by conventional methods and then formulated into a pharmaceutical composition intended for subretinal or intravitreal injection. Such formulation involves the use of a pharmaceutically and / or physiologically acceptable vehicle or carrier, particularly one suitable for administration to the eye, e.g., by subretinal injection, such as buffered saline or other buffers, e.g., HEPES, to maintain pH at appropriate physiological levels, and, optionally, other medicinal agents, pharmaceutical agents, stabilizing agents, buffers, carriers, adjuvants, diluents, etc. For injection, the carrier will typically be a liquid.Exemplary physiologically acceptable carriers include sterile, pyrogen-free water and sterile, pyrogen-free, phosphate buffered saline. A variety of such known carriers are provided in U.S. Pat. Publication No. 7,629,322, incorporated herein by reference. In one embodiment, the carrier is an isotonic sodium chloride solution. In another embodiment, the carrier is balanced salt solution. In one embodiment, the carrier includes tween. If the virus is to be stored long-term, it may be frozen in the presence of glycerol or Tween20. In another embodiment, the pharmaceutically acceptable carrier comprises a surfactant, such as perfluorooctane (Perfluoron liquid).

[0147] In certain embodiments of the methods described herein, the pharmaceutical composition described above is administered to the subject by injection. Other forms of administration that may be useful in the methods described herein include, but are not limited to, direct delivery to a desired organ (e.g., the eye), oral, inhalation, intranasal, intratracheal, intravenous, intramuscular, subcutaneous, intradermal, and other parental routes of administration. Routes of administration may be combined, if desired.

[0148] The composition can be delivered in a volume of from about 0.1 pL to about 1 mL, including all numbers within the range, the route of administration, and the desired effect of the method. In one embodiment, the volume is about 50 pL. Inanother embodiment, the volume is about 70 pL. In another embodiment, the volume is about 100 pL. In another embodiment, the volume is about 125 pL. In another embodiment, the volume is about 150 pL. In another embodiment, the volume is about 175 pL. In yet another embodiment, the volume is about 200 pL. In another embodiment, the volume is about 250 pL. In another embodiment, the volume is about 300 pL. In another embodiment, the volume is about 450 pL. In another embodiment, the volume is about 500 pL. In another embodiment, the volume is about 600 pL. In another embodiment, the volume is about 750 pL. In another embodiment, the volume is about 850 pL. In another embodiment, the volume is about 1000 pL. An effective concentration of a recombinant adeno-associated virus carrying a nucleic acid sequence encoding the desired transgene under the control of the cell-specific promoter sequence desirably ranges from about 107and 1013vector genomes per milliliter (vg / mL) (also called genome copies / mL (GC / mL)). The rAAV infectious units are measured as described in S. K. McLaughlin et al, 1988 J. Virol., 62:1963, which is incorporated herein by reference. Preferably, the concentration in the retina is from about 1 .5 x 109vg / mL to about 1.5 x 1012vg / mL, and more preferably from about 1 .5 x 109vg / mL to about 1.5 x 1011vg / mL. In one embodiment, the effective concentration is about 1 .4 x 108vg / mL. In one embodiment, the effective concentration is about 3.5 x 101° vg / mL. In another embodiment, the effective concentration is about 5.6 x 1011vg / mL. In another embodiment, the effective concentration is about 5.3 x 1012vg / mL. In yet another embodiment, the effective concentration is about 1.5 x 1012vg / mL. In another embodiment, the effective concentration is about 1 .5 x 1013vg / mL. In one embodiment, the effective dosage (total genome copies delivered) is from about 107to 1013vector genomes. It is desirable that the lowest effective concentration of virus be utilized in order to reduce the risk of undesirable effects, such as toxicity, retinal dysplasia and detachment. Still other dosages and administration volumes in these ranges may be selected by the attending physician, taking into account the physical state of the subject, preferably human, being treated, the age of the subject, the particular ocular disorder and the degree to which the disorder, if progressive, has developed. For extra-ocular delivery, the dosage will be increased according to the scale-up from the retina. Intravenous delivery, for example may require doses on the order of 1 .5 x 1013vg / kg.

[0149] Multiple doses can be administered to an individual in need thereof. Where multiple doses are administered over a period of time, an active agent is administered once a month to about once a year, from about once a year to once every 2 years, from about once every 2 years to once every 5 years, or from about once every 5 years to about once every 10 years, over a period of time. For example, a subject is administered over a period of from about 3 months to about 2 years, from about 2 years to about 5 years, from about 5 years to about 10 years, from about 10 years to about 20 years, or more than 20 years. The actual frequency of administration, and the actual duration of treatment, depends on various factors.

[0150] As an example, a subject at risk of exposure to YFV can be immunized by administering an initial dose of a vaccine; and administering at least a second dose (a subsequent dose). Where two or more subsequent doses are administered, the subsequent dose(s) can be separated in time from each other by at least one month, at least 3 to 6 months, at least 6 months to 1 year, at least 1 year to 5 years, at least 5 years to 10 years, at least 10 years to 20 years, or more than 20 years.

[0151] Optionally, the compositions of the invention may contain other conventional pharmaceutical ingredients, such as preservatives, or chemical stabilizers. Suitable exemplary preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, the parabens, ethyl vanillin, glycerin, phenol, and parachlorophenol. Suitable chemical stabilizers include gelatin and albumin.

[0152] According to another aspect, a method for forming the above-described pharmaceutical composition is provided. The method includes introducing an expression vector for expressing a heterologous gene product into a cell to form a genetically modified cell and placing the genetically modified cell in a pharmaceutically acceptable carrier.

[0153] While the invention is primarily described for treating an eye ailment such as retinal degeneration, retinal dystrophy, macular degeneration or macular dystrophy, it is understood that the invention is not so limited and can be used to assist with other ailments.

[0154] In another aspect, a pharmaceutical composition disclosed hereinreduces the severity of a symptom of a disorder associated with YFV. In aspects of this embodiment, a pharmaceutical composition disclosed herein reduces the severity of a symptom of a disorder associated with a YFV by, e.g., at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90% or at least 95%. In other aspects of this embodiment, a pharmaceutical composition disclosed herein reduces the severity of a symptom of a disorder associated with a YFV by, e.g., about 10% to about 100%, about 20% to about 100%, about 30% to about 100%, about 40% to about 100%, about 50% to about 100%, about 60% to about 100%, about 70% to about 100%, about 80% to about 100%, about 10% to about 90%, about 20% to about 90%, about 30% to about 90%, about 40% to about 90%, about 50% to about 90%, about 60% to about 90%, about 70% to about 90%, about 10% to about 80%, about 20% to about 80%, about 30% to about 80%, about 40% to about 80%, about 50% to about 80%, or about 60% to about 80%, about 10% to about 70%, about 20% to about 70%, about 30% to about 70%, about 40% to about 70%, or about 50% to about 70%.

[0155] In aspects of this embodiment, a therapeutically effective amount of a pharmaceutical composition disclosed herein reduces a symptom associated with YFV by, e.g., at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 100%. In other aspects of this embodiment, a therapeutically effective amount of a pharmaceutical composition disclosed herein reduces a symptom associated with YFV by, e.g., at most 10%, at most 15%, at most 20%, at most 25%, at most 30%, at most 35%, at most 40%, at most 45%, at most 50%, at most 55%, at most 60%, at most 65%, at most 70%, at most 75%, at most 80%, at most 85%, at most 90%, at most 95% or at most 100%. In yet other aspects of this embodiment, a therapeutically effective amount of a pharmaceutical composition disclosed herein reduces a symptom associated with YFV by, e.g., about 10% to about 100%, about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 10% to about 60%, about 10% to about 50%, about 10% to about 40%,about 20% to about 100%, about 20% to about 90%, about 20% to about 80%, about 20% to about 20%, about 20% to about 60%, about 20% to about 50%, about 20% to about 40%, about 30% to about 100%, about 30% to about 90%, about 30% to about 80%, about 30% to about 70%, about 30% to about 60%, or about 30% to about 50%.

[0156] In yet other aspects of this embodiment, a therapeutically effective amount of a pharmaceutical composition disclosed herein generally is in the range of about 0.001 mg / kg to about 100 mg / kg and administered, for example, every 3, 5, 7, 10 or 14 days. In aspects of this embodiment, an effective amount of a pharmaceutical composition disclosed herein may be, e.g., at least 0.001 mg / kg, at least 0.01 mg / kg, at least 0.1 mg / kg, at least 1.0 mg / kg, at least 5.0 mg / kg, at least 10 mg / kg, at least 15 mg / kg, at least 20 mg / kg, at least 25 mg / kg, at least 30 mg / kg, at least 35 mg / kg, at least 40 mg / kg, at least 45 mg / kg, or at least 50 mg / kg and administered, for example, every 3, 5, 7, 10 or 14 days. In other aspects of this embodiment, an effective amount of a pharmaceutical composition disclosed herein may be in the range of, e.g., about 0.001 mg / kg to about 10 mg / kg, about 0.001 mg / kg / day to about 15 mg / kg, about 0.001 mg / kg to about 20 mg / kg, about 0.001 mg / kg to about 25 mg / kg, about 0.001 mg / kg to about 30 mg / kg, about 0.001 mg / kg to about 35 mg / kg, about 0.001 mg / kg to about 40 mg / kg, about 0.001 mg / kg to about 45 mg / kg, about 0.001 mg / kg to about 50 mg / kg, about 0.001 mg / kg to about 75 mg / kg, or about 0.001 mg / kg to about 100 mg / kg and administered, for example, every 3, 5, 7, 10 or 14 days. In yet other aspects of this embodiment, an effective amount of a pharmaceutical composition disclosed herein may be in the range of, e.g., about 0.01 mg / kg to about 10 mg / kg, about 0.01 mg / kg to about 15 mg / kg, about 0.01 mg / kg to about 20 mg / kg, about 0.01 mg / kg to about 25 mg / kg, about 0.01 mg / kg to about 30 mg / kg, about 0.01 mg / kg to about 35 mg / kg, about 0.01 mg / kg to about 40 mg / kg, about 0.01 mg / kg to about 45 mg / kg, about 0.01 mg / kg to about 50 mg / kg, about 0.01 mg / kg to about 75 mg / kg, or about 0.01 mg / kg to about 100 mg / kg and administered, for example, every 3, 5, 7, 10 or 14 days. In still other aspects of this embodiment, an effective amount of a pharmaceutical composition disclosed herein may be in the range of, e.g., about 0.1 mg / kg to about 10 mg / kg, about 0.1 mg / kg to about 15 mg / kg, about 0.1 mg / kg to about 20 mg / kg, about 0.1 mg / kg to about 25 mg / kg, about 0.1 mg / kg to about 30 mg / kg, about 0.1 mg / kg toabout 35 mg / kg, about 0.1 mg / kg to about 40 mg / kg, about 0.1 mg / kg to about 45 mg / kg, about 0.1 mg / kg to about 50 mg / kg, about 0.1 mg / kg to about 75 mg / kg, or about 0.1 mg / kg to about 100 mg / kg and administered, for example, every 3, 5, 7, 10 or 14 days.

[0157] Dosing can be single dosage or cumulative (serial dosing), and can be readily determined by one skilled in the art. For instance, treatment of a YFV may comprise a one-time administration of an effective dose of a pharmaceutical composition disclosed herein. Alternatively, treatment of a YFV may comprise multiple administrations of an effective dose of a pharmaceutical composition carried out over a range of time periods, such as, e.g., once daily, twice daily, trice daily, once every few days, or once weekly. The timing of administration can vary from individual to individual, depending upon such factors as the severity of an individual's symptoms. For example, an effective dose of a pharmaceutical composition disclosed herein can be administered to an individual once daily for an indefinite period of time, or until the individual no longer requires therapy. A person of ordinary skill in the art will recognize that the condition of the individual can be monitored throughout the course of treatment and that the effective amount of a pharmaceutical composition disclosed herein that is administered can be adjusted accordingly.

[0158] A pharmaceutical composition or YFV therapeutic is administered to an individual. An individual is typically a human being, but can be an animal, including, but not limited to, dogs, cats, birds, cattle, horses, sheep, goats, reptiles and other animals, whether domesticated or not. Typically, any individual who is a candidate for treatment is a candidate with some form of YFV.

[0159] In one aspect, a pharmaceutical composition disclosed herein reduces a symptom of a disorder associated with a YFV. In aspects of this embodiment, a pharmaceutical composition disclosed herein reduces a symptom of a disorder associated with a YFV by, e.g., at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90% or at least 95%. In other aspects of this embodiment, apharmaceutical composition disclosed herein reduces a symptom of a disorder associated with a YFV by, e.g., about 10% to about 100%, about 20% to about 100%, about 30% to about 100%, about 40% to about 100%, about 50% to about 100%, about 60% to about 100%, about 70% to about 100%, about 80% to about 100%, about 10% to about 90%, about 20% to about 90%, about 30% to about 90%, about 40% to about 90%, about 50% to about 90%, about 60% to about 90%, about 70% to about 90%, about 10% to about 80%, about 20% to about 80%, about 30% to about 80%, about 40% to about 80%, about 50% to about 80%, or about 60% to about 80%, about 10% to about 70%, about 20% to about 70%, about 30% to about 70%, about 40% to about 70%, or about 50% to about 70%.EXAMPLES

[0160] The following non-limiting examples are provided for illustrative purposes only in order to facilitate a more complete understanding of representative embodiments now contemplated. These examples are intended to be a mere subset of all possible contexts in which the components of the formulation may be combined. Thus, these examples should not be construed to limit any of the embodiments described in the present specification, including those pertaining to the type and amounts of components of the formulation and / or methods and uses thereofExample 1Vaccination with circRNA Yellow Fever Vaccine

[0161] Yellow fever (YF) causes up to 50,000 deaths annually. The YF-17D vaccine, offers lifelong immunity but faces safety concerns for vulnerable populations. With no antiviral therapies available and 1.38 billion doses required in the decade of 2020-2030 scalable RNA vaccines offer a faster and more efficient solution to address the growing need. Linear mRNA, used in first-generation COVID- 19 vaccines, degrades quickly in cells, offers short-lasting protection, and requires costly cold storage. Circular RNA, in contrast, offers greater stability, durability, and prolonged antigen expression, resulting in stronger, longer-lasting immunity.

[0162] The YFV genome is an 11 kb single-stranded positive-sense RNAgenome coding for a polyprotein, which is post- and co-translationally processed into three structural proteins and seven non-structural proteins. The largest of the structural proteins, the envelope (E) protein (445aa), is the major component of the virion surface. It is the primary immunogen and plays a central role in receptor binding and membrane fusion. It is the primary immunogen and plays a central role in receptor binding and membrane fusion.

[0163] Circular RNA expressing the YFV prME protein (emxRNA-prME) was generated using a group I intron-exon ribozyme. Its purity was confirmed through agarose gel migration and testing for immune-reactogenic RNA species (Doublestranded RNAs). The RNA was encapsulated in Moderna-like lipid nanoparticles (LNPs) to form LNP-emxRNA-prME. In vitro studies and in vivo studies were performed to test antigen expression, safety, and efficacy of emxRNA vaccine against YFV.

[0164] FIG. 1 depicts the cRNA platform. In aspects, it includes a step of circularization RNA and removing contaminants (e.g., non-circular RNA). Next, the circRNA can be purified to remove contaminants. The purified circRNA can be encapsulated in thermostable lipid nanoparticles (LNPs) and administered to a patient by intramuscular injection, microneedle patch or intravenously. circRNA vaccine in vitro validation

[0165] In vitro studies were conducted before animal experiments. FIG. 2 - FIG. 4 show in vitro validation of circRNA Encoding YFV prME Protein (circRNA-prME). FIG. 2A is an image of a 2% agarose gel showing the integrity of prME-circRNA and prME-N1-ip-RNA. FIG. 2B is a graph of YFV E protein expression and cell viability in A549 cells, analyzed by flow cytometry at 48- and 72-hours post-transfection using a transfection reagent. Control is compared with circRNA-prME (emxRNA-prME) and N1-y-linear-prME at 48 and 72 hours.

[0166] FIG. 2C is a characterization of particle size and polydispersity index (PDI) following encapsulation of circular and linear RNAs in conventional lipid nanoparticles (LNPs). FIG. 2D and FIG. 2E show a time-course analysis of YFV E protein expression in A549 cells transfected with LNPs containing circular or linearRNA. The percentage of E protein-positive cells (FIG. 2D), mean fluorescence intensity (MFI) (FIG. 2E). FIG. 2F shows cell viability assessed by flow cytometry at 1-, 3-, 5-, and 9-days post-transfection.

[0167] FIG. 3A - FIG. 3D show the results of a time-course analysis of E protein expression in human monocyte-derived dendritic cells (hMoDCs) transfected with LNPs containing circular or linear RNA. hMoDCs were characterized based on surface markers, and the percentage of E protein-positive cells (FIG. 4) and CD209 expression as a differentiation marker were analyzed by flow cytometry at 5- and 7- days post-transfection.Safety Profile of Yellow Fever circRNA Vaccine in Syrian Hamsters

[0168] In the next experiments, the safety profile was studied in hamsters. FIG. 5A - FIG. 5H show a dose-response and toxicity in Syrian hamsters treated with LNP-emxRNA-prME. (FIG. 5A) Weight gain in hamsters vaccinated with 5, 15, and 30 pg of RNA. The boost was administered two weeks after the prime, and animals were euthanized 14 days post-boost. (FIG. 5B - FIG. 5H) Analysis of serum and biochemical markers. Neutralizing antibody levels were assessed by microneutralization assay (FIG. 5B). Liver enzyme ALT levels were measured using ELISA (FIG. 5C and FIG. 5D). Levels of cytokines IFNy, TNFa, IL-2, and IL-10 were quantified using Luminex (E-H) at 14 days post-prime and 14 days post-boost. circRNA protects Syrian hamsters from a YFV lethal challenge

[0169] Next, the hamsters were studied for protection induced by the circRNA vaccine. The figures show protection induced by LNP-circRNA-prME alone or in combination with circRNA-NS1 and circRNA-NS5 in a YFV Lethal Challenge Experiment. FIG. 6A shows the prime and boost vaccination schedule, lethal challenge, and timing of blood collection. FIG. 6B shows the survival rate following the lethal challenge. FIG. 6C shows weight change in grams after challenge. Analysis of neutralizing antibodies in serum: two weeks post-prime (FIG. 6D) and two weeks post-boost (FIG. 6E). Neutralizing antibody levels were measured using a microneutralization assay. Viremia levels were analyzed in serum six days postchallenge (not shown).

[0170] FIG. 7A shows the prime and boost vaccination schedule, lethal challenge, and timing of blood collection in another study. FIG. 7B is a graph that indicates the levels of neutralizing antibodies at different weeks after vaccination. Survival rate following the lethal challenge. FIG. 7C shows ALT levels in serum 6 days after challenge. FIG. 7D shows weight change in hamsters after 7 days of lethal challenge. Liver enzyme ALT levels were measured using ELISA (FIG. 7E). The results demonstrate protection induced by LNP-circRNA-prME after four months of vaccination. circRNA HTNV vaccine induces higher antibodies titer than linear mRNA vaccine in mice

[0171] The circRNA platform described herein can be readily adapted to new pathogens. Here, a vaccine based on the HTNV GPC protein was generated using the platform and formulated in SM-102 LNPs. For YFV experiments, 30 pg of RNA was used, and a booster vaccination was administered two weeks after the prime dose. To increase the chances of observing differences between circRNA and mRNA, mice were vaccinated with a lower dose (5 pg), and the booster was administered four weeks post-prime. Antibody titers were analyzed at multiple time points: two weeks post-prime, 24 hours post-boost, two weeks post-boost, and four weeks post-boost. Additionally, reactogenicity (TNFa and IFNy) was assessed using a Luminex assay at 24 hours and two weeks post-boost. The data clearly demonstrate that circRNA induces higher binding and antibody titers than linear mRNA vaccine.Example 2Effectiveness of Delivering circRNA Vaccine using MAPs

[0172] A microneedle patch (MAP) can be used to administer large and small molecules. The transfer of active agents into the skin and into capillaries or lymphatic vessels is rapid and consistent. Shallow penetration of the microneedles minimizes stimulation of nerve endings. The MAPs are convenient, discreet and easy to use. The circRNA vaccines described herein are compatible with Kindeva™ microneedle patches.

[0173] These studies included coating, release and crcRNA vaccine delivery using a microneedle patch. Five micrograms (5 pg) of the emxRNA YFV vaccine, encapsulated in SM102-LNPs, was used to coat Kindeva’s microneedle patches with five different coating formulations. The biological activity of the patches was tested in vitro on A549 cells. Patches coated with the emxRNA YFV prME vaccine using formulation 7 induced 30% prME-positive cells. A standard curve was performed to calculate the coating / release efficiency, indicating that each patch releases 0.5 pg of the emxRNA vaccine. Furthermore, formulation 7 patches were applied to the right leg of swine, while empty patches were applied to the left leg of the same animal. Skin biopsies from the application sites were collected three days post-vaccination, and immunofluorescence (IF) was performed to detect prME expression.

[0174] FIG. 10A depicts liposomes and images of loaded microneedles. FIG. 10B is a graph of percentage of viable cells in comparison to percentage of prME positive cells. FIG. 10C is a graph of percentage of viable cells in comparison to percentage of prME positive cells. FIG. 11 A - 11 F are immunofluorescence (IF) that show prME expression.Example 3Administration of Yellow Fever circRNA Vaccine using MAPs

[0175] In this example, a patient is vaccinated against yellow fever. As described herein, the microneedle array patch includes a polymeric array containing hundreds of microneedles (the number of microneedles is dependent on the size of the array), each of which is coated with a droplet of vaccine.

[0176] The microneedle array was evaluated in the biocompatibility tests (i.e. , cytotoxicity, sensitization, primary skin irritation, acute systemic toxicity, and ASTM Hemolysis). The results demonstrate the array was safe for administering an API or vaccine. Further, the constituents of the adhesive patch were evaluated for biocompatibility (cytotoxicity, irritation via intracutaneous reactivity test, primary skin irritation, and sensitization) with results meeting all test requirements. The skin contacting portions of the array patch applicator were also evaluated for biocompatibility (cytotoxicity, irritation, and sensitization) with the test articlesmeeting the test requirements.

[0177] Formulations for coating the microneedle arrays were manufactured by adding polymer excipients and sugars, either as dry powders or as highly concentrated solutions, to aliquots of a solution containing the cRNA vaccine. Water-soluble pharmaceutical grade polymers of varying molecular weights were chosen as polymer excipients based on previous development experience demonstrating these polymers produce robust coatings on the microneedle tips, while maintaining the stability of the vaccine that has been applied. Microneedle arrays are coated with the cRNA vaccine formulations using a dip coating and drying process, followed by a packaging step to ensure product stability.

[0178] The coated microneedle array is applied to the skin using an applicator, which ensures consistent delivery and ease of use by a medical professional or the patient. The coated microneedle array is held on the skin by an integrated adhesive patch. The droplets on the microneedles are delivered approximately 150pm to 350pm deep into the skin to an area with limited nerve endings, resulting in very low skin sensitivity. Once inserted into the skin, the API or vaccine formulation dissolves off the microneedles into the interstitial fluid. A typical delivery duration is between 30 seconds and five minutes, after which, the microneedle array patch is removed and disposed of. In this example, the patient wears the MAP for five minutes.

[0179] After 60 days, the patient was evaluated by her treating physician. A blood sample was analyzed to confirm that she was effectively immunized. In conclusion, the study demonstrated:• a robust Immune response to yellow fever• the administration was well toleratedThe results demonstrate that MAPs obtained the same drug efficacy as the administration method through injection. Further, the patient expressed a preference for vaccination using MAPs rather than conventional intramuscular (IM) injection.Example 4Vaccination with circRNA Hantaan orthohantavirus Vaccine

[0180] Hantaan orthohantavirus (HTNV) is an enveloped, single-stranded, negative-sense RNA virus species of Old World Orthohantavirus. It is the causative agent of Korean hemorrhagic fever in humans. It is named for the Hantan River in South Korea, and in turn lends the name to its genus Orthohantavirus and family Hantaviridae.

[0181] The genome of HTNV is about 11 .9 kilobases (kb) in length and segmented into three negative-sense, single-stranded RNA (-ssRNA) strands. The small strand encodes the viral nucleoprotein, the medium strand encodes the viral spike protein, which attaches to cell receptors for entry into cells, and the long strand encodes the viral RNA-dependent RNA polymerase (RdRp), which replicates and transcribes the genome. Genome segments are encased in nucleoproteins to form ribonucleoprotein (RNP) complexes that are surrounded by a viral envelope that contains spikes emanating from its surface.

[0182] Hantaan virus replicates first by binding to the surface of cells with its envelope spikes. Virus particles, called virions, are then taken into the cell by endosomes, where a drop in pH causes the viral envelope to fuse with the endosome, which releases viral RNA into the host cell. RdRp then transcribes the genome for translation by host cell ribosomes and produces copies of the genome for progeny viruses. New virions are assembled at the endoplasmic reticulum and bud from its surface to obtain their viral envelope. Progeny viruses are then transported by a cellular vesicle to the cell membrane, where they leave the cell by exocytosis.

[0183] In hantavirus induced hemorrhagic fever, incubation time is between two and four weeks in humans before symptoms of infection present. Severity of symptoms depends on the viral load. Like Dobrava-Belgrade virus, Hantaan virus has a mortality rate of 10 to 12%

[0184] There is currently no vaccine for HTNV. Therefore, a safe and effective, non-infectious vaccine would be desirable in order to avoid vaccine-associated adverse events and to allow vaccination of young infants and immunocompromised recipients, as well as pregnant and nursing women and elderly people. The presentinvention overcome these problems by providing a novel circular RNA vaccine and related methods.

[0185] FIG. 8 shows the prime and boost vaccination schedule, lethal challenge, and timing of blood collection in a study using a circRNA HTNV vaccine. FIG. 9A shows levels induction using circRNA and linear RNA. FIG. 9B shows levels of HTNC GPC binding antibodies. FIG. 9C shows levels of HTNV neutralizing antibodies and different time points. Similarly, FIG. 9D shows levels of HTNV neutralizing antibodies (fold change cs. Two week PP). FIG. 9E shows TNFa levels at 24 hours and two weeks. FIG. 9F shows IFNY levels at 24 hours and two weeks.* * *

[0186] Certain embodiments of the present invention are described herein, including the best mode known to the inventors for carrying out the invention. Of course, variations on these described embodiments will become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventor expects skilled artisans to employ such variations as appropriate, and the inventors intend for the present invention to be practiced otherwise than specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described embodiments in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.

[0187] Groupings of alternative embodiments, elements, or steps of the present invention are not to be construed as limitations. Each group member may be referred to and claimed individually or in any combination with other group members disclosed herein. It is anticipated that one or more members of a group may be included in, or deleted from, a group for reasons of convenience and / or patentability. When any such inclusion or deletion occurs, the specification is deemed to contain the group as modified thus fulfilling the written description of all Markush groups used in the appended claims.

[0188] Unless otherwise indicated, all numbers expressing a characteristic, item,quantity, parameter, property, term, and so forth used in the present specification and claims are to be understood as being modified in all instances by the term "about." As used herein, the term "about" means that the characteristic, item, quantity, parameter, property, or term so qualified encompasses a range of plus or minus ten percent above and below the value of the stated characteristic, item, quantity, parameter, property, or term. Accordingly, unless indicated to the contrary, the numerical parameters set forth in the specification and attached claims are approximations that may vary. At the very least, and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims, each numerical indication should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques. Notwithstanding that the numerical ranges and values setting forth the broad scope of the invention are approximations, the numerical ranges and values set forth in the specific examples are reported as precisely as possible. Any numerical range or value, however, inherently contains certain errors necessarily resulting from the standard deviation found in their respective testing measurements. Recitation of numerical ranges of values herein is merely intended to serve as a shorthand method of referring individually to each separate numerical value falling within the range. Unless otherwise indicated herein, each individual value of a numerical range is incorporated into the present specification as if it were individually recited herein.

[0189] The terms "a," "an," "the" and similar referents used in the context of describing the present invention (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., "such as") provided herein is intended merely to better illuminate the present invention and does not pose a limitation on the scope of the invention otherwise claimed. No language in the present specification should be construed as indicating any non-claimed element essential to the practice of the invention.

[0190] All patents, patent publications, and other publications referenced and identified in the present specification are individually and expressly incorporatedherein by reference in their entirety for the purpose of describing and disclosing, for example, the compositions and methodologies described in such publications that might be used in connection with the present invention. These publications are provided solely for their disclosure prior to the filing date of the present application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention or for any other reason. All statements as to the date or representation as to the contents of these documents is based on the information available to the applicants and does not constitute any admission as to the correctness of the dates or contents of these documents.

[0191] In closing, it is to be understood that although aspects of the present specification are highlighted by referring to specific embodiments, one skilled in the art will readily appreciate that these disclosed embodiments are only illustrative of the principles of the subject matter disclosed herein. Therefore, it should be understood that the disclosed subject matter is in no way limited to a particular methodology, protocol, and / or reagent, etc., described herein. As such, various modifications or changes to or alternative configurations of the disclosed subject matter can be made in accordance with the teachings herein without departing from the spirit of the present specification. Lastly, the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention, which is defined solely by the claims. Accordingly, the present invention is not limited to that precisely as shown and described.

[0192] Sequences include:SEQ ID NO: 1 - YFV Ab JprMEA sequence for producing a circular RNA vaccine for the YFV membrane and envelope proteins using the Anabaena tRNA group I intron SEQ ID NO: 2 - YFV Ab NS1A sequence for producing a circular RNA vaccine for the YFV nonstructural protein 1 (NS1) using the Anabaena tRNA group I intron SEQ ID NO: 3 - YFV Ab NS5A sequence for producing a circular RNA vaccine for the YFV nonstructural protein 5 (NS5) using the Anabaena tRNA group I intronSEQ ID NO: 4 - YFV Linear JprMEA sequence for producing an mRNA vaccine for the YFV membrane and envelope proteins using established mRNA elementsSEQ ID NO: 5 - YFV Linear NS1A sequence for producing a mRNA vaccine for the YFV nonstructural protein 1 (NS1) using established mRNA elementsSEQ ID NO: 6 - YFV T4 JprMEA sequence for producing a circular RNA vaccine for the YFV membrane and envelope proteins using the T4 td group I intronSEQ ID NO: 7 - YFV T4 NS1A sequence for producing a circular RNA vaccine for the YFV nonstructural protein 1 (NS1) using the T4 td group I intronSEQ ID NO: 8 - YFV T4 NS5A sequence for producing a circular RNA vaccine for the YFV nonstructural protein 5 using the T4 td group I intronSEQ ID NO: 9 - HTNV Ab GnGcA sequence for producing a circular RNA vaccine for the HNTV glycoprotein using theAnabaena tRNA group I intronSEQ ID NO: 10 - HTNV Ab NpA sequence for producing a circular RNA vaccine for the HNTV nucleoprotein using theAnabaena tRNA group I intronSEQ ID NO: 11 - HTNV Linear GnGcA sequence for producing an mRNA vaccine for the HNTV glycoprotein using established mRNA elementsSEQ ID NO: 12 - HTNV Linear NPA sequence for producing an mRNA vaccine for the HNTV nucleoprotein using established mRNA elementsSEQ ID NO: 13 - HTNV T4 GnGcA sequence for producing a circular RNA vaccine for the HNTV glycoprotein using the T4 td group I intronSEQ ID NO: 14 - HTNV T4 NpA sequence for producing a circular RNA vaccine for the HNTV nucleoprotein using the T4 td group I intronLIST OF SEQUENCES (YFV)| SEQ ID NO: 1 | YFV Ab JprME |GATAATACGACTCACTATAGGGAGACCCTCGACCGTCGATTGTCCACTGGTCAACAATAGATGACTTACAACT AATCGGAAGGTGCAGAGACTCGACGGGAGCTACCCTAACGTCAAGACGAGGGTAAAGAGAGAGTCCAATTC TCAAAGCCAATAGGCAGTAGCGAAAGCTGCAAGAGAATGAAAATCCGTTGACCTTAAACGGTCGTGTGGGTT CAAGTCCCTCCACCCCCACGCCGGAAACGCAATAGCCGTTTTTGTTTTTTG I I I I I I I TG I I I I I I I I I TGGTTTTT TTGTTTTGTGTTTAAAACAGCCTGTGGGTTGATCCCACCCACAGGCCCATTGGGCGCTAGCACTCTGGTATCAC GGTACCTTTGTGCGCCTGTTTTATACCCCCTCCCCCAACTGTAACTTAGAAGTAACACACACCGATCAACAGTC AGCGTGGCACACCAGCCACGTTTTGATCAAGCACTTCTGTTACCCCGGACTGAGTATCAATAGACTGCTCACG CGGTTGAAGGAGAAAGCGTTCGTTATCCGGCCAACTACTTCGAAAAACCTAGTAACACCGTGGAAGTTGCAG AGTGTTTCGCTCAGCACTACCCCAGTGTAGATCAGGTCGATGAGTCACCGCATTCCCCACGGGCGACCGTGGC GGTGGCTGCGTTGGCGGCCTGCCCATGGGGAAACCCATGGGACGCTCTAATACAGACATGGTGCGAAGAGTC TATTGAGCTAGTTGGTAGTCCTCCGGCCCCTGAATGCGGCTAATCCTAACTGCGGAGCACACACCCTCAAGCC AGAGGGCAGTGTGTCGTAACGGGCAACTCTGCAGCGGAACCGACTACTTTGGGTGTCCGTGTTTCATTTTATT CCTATACTGGCTGCTTATGGTGACAATTGAGAGATCGTTACCATATAGCTATTGGATTGGCCATCCGGTGACTA ATAGAGCTATTATATATCCCTTTGTTGGGTTTATACCACTTAGCTTGAAAGAGGTTAAAACATTACAATTCATTG TTAAGTTGAATACAGCAAAATGGGCAAGAGGTCCGCCGGCAGCATCATGTGGCTGGCCAGCCTGGCCGTGGT GATCGCCTGCGCCGGCGCCGTGACCCTGGTGAGAAAGAACAGATGGCTGCTGCTGAACGTGACCTCTGAGGA CCTGGGCAAGACCTTTAGCGTGGGCACCGGCAACTGCACCACCAACATCCTGGAGGCCAAGTACTGGTGCCC CGACAGCATGGAGTACAACTGCCCAAACCTGAGCCCTAGAGAGGAGCCAGACGACATCGACTGTTGGTGTTA CGGCGTGGAGAACGTGAGAGTGGCCTACGGCAAGTGCGACTCCGCCGGCAGGAGCAGGAGATCCAGGAGA GCCATCGACCTGCCCACCCACGAGAACCACGGCCTGAAGACCCGGCAGGAGAAGTGGATGACCGGCAGGAT GGGCGAGAGACAGCTGCAGAAGATCGAGAGATGGTTCGTGAGGAACCCTTTCTTCGCCGTGACCGCCCTGAC TATCGCCTACCTGGTGGGCTCCAACATGACCCAGAGAGTGGTGATCGCCCTGCTGGTGCTGGCCGTGGGCCC CGCCTACAGCGCCCACTGCATCGGCATTACCGACAGAGACTTCATCGAAGGCGTGCACGGCGGCACCTGGGT GAGTGCCACACTGGAGCAGGACAAGTGTGTCACCGTGATGGCCCCTGACAAGCCCTCCCTGGACATCAGCCT GGAGACAGTGGCCATCGACAGACCTGCCGAGGTGAGAAAGGTGTGCTACAACGCCGTGCTGACCCACGTGA AGATCAACGACAAGTGCCCCTCTACAGGCGAGGCCCACCTGGCCGAGGAGAACGAGGGCGATAACGCCTGC AAGAGAACATACAGCGATCGGGGCTGGGGCAACGGCTGCGGCCTGTTCGGCAAGGGCTCTATCGTGGCCTG CGCCAAGTTCACCTGTGCCAAGAGCATGAGCCTCTTCGAGGTGGACCAGACCAAGATCCAGTACGTGATCAG GGCCCAGCTGCACGTGGGCGCCAAGCAGGAGAACTGGAACACCGACATCAAGACCCTGAAGTTCGATGCCCT GAGCGGCAGCCAGGAGGTGGAGTTTATCGGCTACGGCAAGGCTACCCTGGAGTGCCAGGTGCAGACAGCCG TGGACTTTGGCAACTCTTATATCGCCGAGATGGAGACCGAGAGCTGGATCGTGGACAGGCAGTGGGCCCAGG ACCTGACCCTGCCCTGGCAGTCCGGCTCTGGCGGCGTGTGGCGGGAGATGCACCACCTGGTGGAGTTCGAGC CTCCTCACGCCGCCACCATCAGAGTGCTGGCCCTGGGCAACCAGGAGGGCTCCCTGAAGACCGCCCTGACCG GCGCCATGAGGGTGACCAAGGACACCAACGACAATAATCTGTACAAGCTGCACGGCGGCCACGTGAGCTGCA GAGTGAAGCTGAGCGCCCTGACCCTGAAGGGCACCAGCTACAAGATCTGCACCGACAAGATGTTCTTCGTGA AGAACCCAACCGACACCGGCCACGGCACAGTGGTGATGCAGGTGAAGGTGTCCAAAGGGGCCCCCTGCAGG ATCCCCGTGATCGTGGCCGACGACCTGACCGCCGCCATCAACAAGGGCATCCTGGTGACCGTGAACCCCATCG CCAGCACCAATGACGACGAGGTGCTGATCGAGGTGAATCCCCCTTTCGGAGATTCCTACATCATCGTGGGCAG AGGCGACAGCAGACTGACTTACCAGTGGCACAAGGAGGGCAGCAGCATCGGCAAGCTGTTCACCCAGACCAT GAAGGGCGTGGAGAGACTGGCCGTGATGGGCGACACAGCCTGGGACTTCAGCAGCGCCGGCGGCTTCTTCA CAAGCGTGGGCAAGGGCATCCACACTGTGTTCGGCTCCGCCTTCCAGGGCCTGTTTGGCGGCCTGAACTGGA TCACCAAGGTGATCATGGGCGCCGTGCTGATCTGGGTGGGCATCAATACCAGAAACATGACCATGAGCATGA GCATGATTCTGGTGGGCGTGATCATGATGTTCCTGTCCCTGGGCGTGGGCGCCTAATAATTTTTTTGTTTTTTGTTTTGGGCTATTATGCGTTACCGGCGAGACGCTACGGACTTAAATAATTGAGCCTTAAAGAAGAAATTCTTTAA GTGGATGCTCTCAAACTCAGGGAAACCTAAATCTAGTTATAGACAAGGCAATCCTGAGCCAAGCCGAAGTAG TAATTAGTAAGACCAGTGGACAATCGACGGATAACAGCATATCTAGGATATCAAAAGCGGCCGCGATAATACGACTCACTATAGGGAGACCCTCGACCGTCGATTGTCCACTGGTCAACAATAGATGACTTACAACT AATCGGAAGGTGCAGAGACTCGACGGGAGCTACCCTAACGTCAAGACGAGGGTAAAGAGAGAGTCCAATTC TCAAAGCCAATAGGCAGTAGCGAAAGCTGCAAGAGAATGAAAATCCGTTGACCTTAAACGGTCGTGTGGGTT CAAGTCCCTCCACCCCCACGCCGGAAACGCAATAGCCGTTTTTGTTTTTTG I I I I I I I TG I I I I I I I I I TGGTTTTT TTGTTTTGTGTTTAAAACAGCCTGTGGGTTGATCCCACCCACAGGCCCATTGGGCGCTAGCACTCTGGTATCAC GGTACCTTTGTGCGCCTGTTTTATACCCCCTCCCCCAACTGTAACTTAGAAGTAACACACACCGATCAACAGTC AGCGTGGCACACCAGCCACGTTTTGATCAAGCACTTCTGTTACCCCGGACTGAGTATCAATAGACTGCTCACG CGGTTGAAGGAGAAAGCGTTCGTTATCCGGCCAACTACTTCGAAAAACCTAGTAACACCGTGGAAGTTGCAG AGTGTTTCGCTCAGCACTACCCCAGTGTAGATCAGGTCGATGAGTCACCGCATTCCCCACGGGCGACCGTGGC GGTGGCTGCGTTGGCGGCCTGCCCATGGGGAAACCCATGGGACGCTCTAATACAGACATGGTGCGAAGAGTC TATTGAGCTAGTTGGTAGTCCTCCGGCCCCTGAATGCGGCTAATCCTAACTGCGGAGCACACACCCTCAAGCC AGAGGGCAGTGTGTCGTAACGGGCAACTCTGCAGCGGAACCGACTACTTTGGGTGTCCGTGTTTCATTTTATT CCTATACTGGCTGCTTATGGTGACAATTGAGAGATCGTTACCATATAGCTATTGGATTGGCCATCCGGTGACTA ATAGAGCTATTATATATCCCTTTGTTGGGTTTATACCACTTAGCTTGAAAGAGGTTAAAACATTACAATTCATTG TTAAGTTGAATACAGCAAAATGGGCAGAAACATGACCATGAGCATGAGCATGATCCTGGTGGGCGTGATCAT GATGTTCCTGAGCCTGGGCGTGGGCGCCGACCAGGGCTGCGCCATCAACTTCGGCAAGAGAGAGCTGAAGT GCGGCGACGGCATCTTCATCTTCAGAGACAGCGACGACTGGCTGAACAAGTACAGCTACTACCCCGAGGACC CCGTGAAGCTGGCCAGCATCGTGAAGGCCAGCTTCGAGGAGGGCAAGTGCGGCCTGAACAGCGTGGACTCC CTGGAGCACGAGATGTGGAGAAGCAGAGCCGACGAGATCAACGCCATCTTCGAGGAGAACGAGGTGGACAT CAGCGTGGTGGTGCAGGACCCCAAGAACGTGTACCAGAGAGGCACCCACCCCTTCAGCAGAATCAGGGACG GCCTGCAGTACGGCTGGAAGACATGGGGCAAGAACCTGGTGTTCAGCCCCGGCAGAAAGAACGGCAGCTTC ATCATCGACGGCAAGAGCAGAAAGGAGTGCCCCTTCAGCAACAGAGTGTGGAACAGCTTCCAGATCGAGGA GTTCGGCACCGGCGTGTTCACCACCAGAGTGTACATGGACGCCGTGTTCGAGTACACAATCGACTGCGACGG CAGCATCCTGGGCGCCGCCGTGAACGGCAAGAAGTCCGCCCACGGCAGCCCCACCTTCTGGATGGGCAGCCA CGAGGTGAACGGCACCTGGATGATCCACACCCTGGAGGCCCTGGACTACAAGGAGTGCGAGTGGCCCCTGAC CCACACCATCGGCACCAGCGTGGAGGAGAGCGAGATGTTCATGCCCAGAAGCATCGGCGGCCCCGTGAGCA GCCACAACCACATCCCCGGCTACAAGGTGCAGACCAACGGCCCCTGGATGCAGGTGCCCCTGGAGGTGAAGA GAGAGGCCTGCCCCGGCACAAGCGTGATCATCGACGGCAACTGCGACGGCAGAGGCAAGAGCACCAGAAGC ACCACCGACAGCGGCAAGGTGATCCCCGAGTGGTGCTGCAGAAGCTGCACCATGCCCCCCGTGAGCTTCCAC GGCAGCGACGGCTGCTGGTACCCCATGGAGATCAGACCCAGGAAGACCCACGAGAGCCACCTGGTGAGAAG CTGGGTGACCGCCTAATAATTTTTTTGTTTTTTGTTTTGGGCTATTATGCGTTACCGGCGAGACGCTACGGACTT AAATAATTGAGCCTTAAAGAAGAAATTCTTTAAGTGGATGCTCTCAAACTCAGGGAAACCTAAATCTAGTTAT AGACAAGGCAATCCTGAGCCAAGCCGAAGTAGTAATTAGTAAGACCAGTGGACAATCGACGGATAACAGCAT ATCTAGGATATCAAAAGCGGCCGC| SEQ ID NO: 3 | YFV Ab NS5 |GATAATACGACTCACTATAGGGAGACCCTCGACCGTCGATTGTCCACTGGTCAACAATAGATGACTTACAACT AATCGGAAGGTGCAGAGACTCGACGGGAGCTACCCTAACGTCAAGACGAGGGTAAAGAGAGAGTCCAATTC TCAAAGCCAATAGGCAGTAGCGAAAGCTGCAAGAGAATGAAAATCCGTTGACCTTAAACGGTCGTGTGGGTT CAAGTCCCTCCACCCCCACGCCGGAAACGCAATAGCCGTTTTTGTTTTTTG I I I I I I I TG I I I I I I I I I TGGTTTTT TTGTTTTGTGTTTAAAACAGCCTGTGGGTTGATCCCACCCACAGGCCCATTGGGCGCTAGCACTCTGGTATCAC GGTACCTTTGTGCGCCTGTTTTATACCCCCTCCCCCAACTGTAACTTAGAAGTAACACACACCGATCAACAGTC AGCGTGGCACACCAGCCACGTTTTGATCAAGCACTTCTGTTACCCCGGACTGAGTATCAATAGACTGCTCACG CGGTTGAAGGAGAAAGCGTTCGTTATCCGGCCAACTACTTCGAAAAACCTAGTAACACCGTGGAAGTTGCAG AGTGTTTCGCTCAGCACTACCCCAGTGTAGATCAGGTCGATGAGTCACCGCATTCCCCACGGGCGACCGTGGC GGTGGCTGCGTTGGCGGCCTGCCCATGGGGAAACCCATGGGACGCTCTAATACAGACATGGTGCGAAGAGTC TATTGAGCTAGTTGGTAGTCCTCCGGCCCCTGAATGCGGCTAATCCTAACTGCGGAGCACACACCCTCAAGCC AGAGGGCAGTGTGTCGTAACGGGCAACTCTGCAGCGGAACCGACTACTTTGGGTGTCCGTGTTTCATTTTATT CCTATACTGGCTGCTTATGGTGACAATTGAGAGATCGTTACCATATAGCTATTGGATTGGCCATCCGGTGACTA ATAGAGCTATTATATATCCCTTTGTTGGGTTTATACCACTTAGCTTGAAAGAGGTTAAAACATTACAATTCATTG TTAAGTTGAATACAGCAAAATGGGCTCCGCTAACGGTAAGACGCTGGGCGAGGTGTGGAAACGTGAGTTAAA TCTCCTCGATAAAAGGCAATTCGAACTGTACAAGAGAACAGATATAGTAGAAGTTGACCGCGACACAGCCAGGCGGCACCTTGCAGAGGGCAAAGTCGATACAGGCGTCGCTGTAAGTAGAGGCACAGCCAAACTTCGGTGGTT TCACGAACGCGGATACGTTAAACTTGAGGGCCGGGTCATAGATTTGGGCTGCGGGCGTGGCGGGTGGTGCT ATTATGCCGCAGCCCAGAAAGAGGTCTCCGGCGTGAAGGGTTTCACACTGGGCCGGGATGGGCACGAAAAG CCTATGAACGTACAGTCCCTCGGGTGGAATATTATAACTTTTAAAGATAAGACAGACATTCATCGACTCGAGC CCGTTAAGTGCGATACTTTACTGTGCGATATAGGCGAATCCTCTTCCAGCAGTGTTACGGAAGGTGAGCGAAC AGTAAGGGTGTTAGACACAGTGGAGAAGTGGTTGGCGTGCGGTGTGGATAATTTCTGCGTTAAAGTTCTCGC CCCGTATATGCCTGACGTACTGGAAAAGCTTGAGCTGCTTCAGCGACGCTTCGGTGGCACCGTCATTCGAAAT CCCCTGTCTCGTAACTCAACCCACGAGATGTATTATGTATCCGGGGCGCGATCTAACGTGACCTTCACCGTAAATCAGACTAGCCGTCTGTTGATGCGCAGGATGAGACGGCCTACCGGGAAGGTTACTTTAGAAGCCGATGTGAT TCTTCCTATCGGCACCCGGTCAGTGGAAACTGATAAAGGCCCATTGGATAAGGAAGCGATCGAGGAGAGAGT GGAACGTATCAAGTCAGAATATATGACAAGCTGGTTCTACGATAACGATAATCCGTATAGAACTTGGCATTAT TGCGGGTCTTACGTGACCAAGACAAGTGGCTCCGCCGCTTCCATGGTTAACGGAGTGATCAAGATATTGACTT ACCCTTGGGATCGGATTGAAGAAGTGACCCGTATGGCCATGACCGATACTACTCCCTTCGGGCAACAGCGCGT CTTCAAGGAGAAGGTGGATACTAGGGCTAAAGACCCACCCGCTGGGACAAGAAAGATTATGAAGGTGGTGA ATAGATGGCTTTTCAGACATCTCGCAAGGGAGAAGAATCCACGGTTATGTACCAAAGAGGAGTTCATCGCTAA GGTGAGGAGCCACGCTGCTATCGGGGCCTATTTAGAGGAGCAGGAGCAATGGAAAACAGCTAACGAAGCCGTGCAGGATCCTAAATTTTGGGAGCTCGTTGACGAGGAGCGCAAATTGCATCAGCAGGGTCGATGCAGAACCT GCGTCTATAATATGATGGGAAAGAGGGAAAAGAAACTCTCCGAATTCGGCAAGGCTAAAGGCTCTAGAGCTA TCTGGTACATGTGGCTTGGTGCAAGGTACCTCGAATTCGAAGCGTTAGGGTTTCTCAACGAAGATCACTGGGC ATCTCGTGAGAATTCCGGGGGGGGCGTCGAGGGTATCGGGTTGCAGTATCTCGGCTACGTAATTCGGGATTT GGCGGCGATGGACGGCGGCGGTTTCTATGCTGACGATACAGCCGGGTGGGATACAAGGATTACTGAAGCTG ATCTCGACGACGAGCAAGAAATACTGAATTATATGTCACCCCACCATAAGAAGTTAGCTCAGGCTGTCATGGA GATGACGTATAAGAATAAGGTAGTCAAGGTTCTGCGCCCCGCGCCGGGCGGAAAGGCGTATATGGACGTGA TCAGCAGAAGGGATCAACGAGGTAGTGGTCAAGTCGTCACCTACGCACTCAATACAATTACGAATCTGAAGGTGCAGCTGATAAGGATGGCTGAGGCCGAAATGGTTATCCACCATCAGCACGTCCAGGACTGCGACGAGTCTG TATTGACAAGACTCGAAGCTTGGTTGACAGAACATGGCTGCGATCGGCTTAAAAGAATGGCCGTCAGCGGCG ATGATTGCGTCGTGCGACCTATTGACGATCGATTTGGATTAGCTCTTTCACACCTGAATGCTATGAGTAAAGTG CGCAAAGATATAAGCGAGTGGCAACCTAGCAAGGGATGGAACGACTGGGAAAACGTCCCTTTCTGCAGTCAT CATTTTCACGAGCTGCAACTCAAAGACGGACGCAGAATAGTTGTACCCTGTCGCGAGCAAGATGAACTGATCG GCCGCGGGCGAGTTAGTCCCGGCAATGGTTGGATGATAAAAGAGACCGCCTGTTTATCAAAGGCGTACGCGA ATATGTGGAGCTTGATGTACTTCCATAAGCGGGATATGCGCTTACTCAGTCTCGCCGTCAGTAGCGCCGTGCCGACTTCTTGGGTCCCTCAGGGGCGGACTACCTGGTCCATCCACGGCAAGGGAGAATGGATGACAACCGAGGA TATGCTCGAAGTTTGGAATCGCGTCTGGATTACTAATAATCCTCATATGCAAGATAAAACTATGGTTAAGAAGT GGCGGGACGTGCCCTACCTCACGAAAAGGCAGGATAAACTCTGTGGCTCCTTGATAGGGATGACTAACCGGG CTACATGGGCAAGTCATATTCACCTGGTTATTCACAGAATTCGGACTCTTATAGGTCAAGAAAAGTATACCGAT TATCTCACGGTGATGGATAGATACTCCGTCGACGCAGATTTACAGTTAGGCGAACTCATCTAATAATTTTTTTG TTTTTTGTTTTGGGCTATTATGCGTTACCGGCGAGACGCTACGGACTTAAATAATTGAGCCTTAAAGAAGAAAT TCTTTAAGTGGATGCTCTCAAACTCAGGGAAACCTAAATCTAGTTATAGACAAGGCAATCCTGAGCCAAGCCG AAGTAGTAATTAGTAAGACCAGTGGACAATCGACGGATAACAGCATATCTAGGATATCAAAAGCGGCCGCAA| SEQ ID NO: 4 | YFV Linear JprME | CGGCCGCTAATACGACTCACTATAAGGACTCTTCTGGTCCCCACAGACTCAGAGAGAACGCCACCATGGGCAA GAGGTCCGCCGGCAGCATCATGTGGCTGGCCAGCCTGGCCGTGGTGATCGCCTGCGCCGGCGCCGTGACCCT GGTGAGAAAGAACAGATGGCTGCTGCTGAACGTGACCTCTGAGGACCTGGGCAAGACCTTTAGCGTGGGCA CCGGCAACTGCACCACCAACATCCTGGAGGCCAAGTACTGGTGCCCCGACAGCATGGAGTACAACTGCCCAA ACCTGAGCCCTAGAGAGGAGCCAGACGACATCGACTGTTGGTGTTACGGCGTGGAGAACGTGAGAGTGGCC TACGGCAAGTGCGACTCCGCCGGCAGGAGCAGGAGATCCAGGAGAGCCATCGACCTGCCCACCCACGAGAA CCACGGCCTGAAGACCCGGCAGGAGAAGTGGATGACCGGCAGGATGGGCGAGAGACAGCTGCAGAAGATCGAGAGATGGTTCGTGAGGAACCCTTTCTTCGCCGTGACCGCCCTGACTATCGCCTACCTGGTGGGCTCCAACA TGACCCAGAGAGTGGTGATCGCCCTGCTGGTGCTGGCCGTGGGCCCCGCCTACAGCGCCCACTGCATCGGCA TTACCGACAGAGACTTCATCGAAGGCGTGCACGGCGGCACCTGGGTGAGTGCCACACTGGAGCAGGACAAG TGTGTCACCGTGATGGCCCCTGACAAGCCCTCCCTGGACATCAGCCTGGAGACAGTGGCCATCGACAGACCTGCCGAGGTGAGAAAGGTGTGCTACAACGCCGTGCTGACCCACGTGAAGATCAACGACAAGTGCCCCTCTACAG GCGAGGCCCACCTGGCCGAGGAGAACGAGGGCGATAACGCCTGCAAGAGAACATACAGCGATCGGGGCTG GGGCAACGGCTGCGGCCTGTTCGGCAAGGGCTCTATCGTGGCCTGCGCCAAGTTCACCTGTGCCAAGAGCAT GAGCCTCTTCGAGGTGGACCAGACCAAGATCCAGTACGTGATCAGGGCCCAGCTGCACGTGGGCGCCAAGCA GGAGAACTGGAACACCGACATCAAGACCCTGAAGTTCGATGCCCTGAGCGGCAGCCAGGAGGTGGAGTTTAT CGGCTACGGCAAGGCTACCCTGGAGTGCCAGGTGCAGACAGCCGTGGACTTTGGCAACTCTTATATCGCCGA GATGGAGACCGAGAGCTGGATCGTGGACAGGCAGTGGGCCCAGGACCTGACCCTGCCCTGGCAGTCCGGCT CTGGCGGCGTGTGGCGGGAGATGCACCACCTGGTGGAGTTCGAGCCTCCTCACGCCGCCACCATCAGAGTGC TGGCCCTGGGCAACCAGGAGGGCTCCCTGAAGACCGCCCTGACCGGCGCCATGAGGGTGACCAAGGACACC AACGACAATAATCTGTACAAGCTGCACGGCGGCCACGTGAGCTGCAGAGTGAAGCTGAGCGCCCTGACCCTG AAGGGCACCAGCTACAAGATCTGCACCGACAAGATGTTCTTCGTGAAGAACCCAACCGACACCGGCCACGGC ACAGTGGTGATGCAGGTGAAGGTGTCCAAAGGGGCCCCCTGCAGGATCCCCGTGATCGTGGCCGACGACCTG ACCGCCGCCATCAACAAGGGCATCCTGGTGACCGTGAACCCCATCGCCAGCACCAATGACGACGAGGTGCTG ATCGAGGTGAATCCCCCTTTCGGAGATTCCTACATCATCGTGGGCAGAGGCGACAGCAGACTGACTTACCAGTGGCACAAGGAGGGCAGCAGCATCGGCAAGCTGTTCACCCAGACCATGAAGGGCGTGGAGAGACTGGCCGTG ATGGGCGACACAGCCTGGGACTTCAGCAGCGCCGGCGGCTTCTTCACAAGCGTGGGCAAGGGCATCCACACT GTGTTCGGCTCCGCCTTCCAGGGCCTGTTTGGCGGCCTGAACTGGATCACCAAGGTGATCATGGGCGCCGTGC TGATCTGGGTGGGCATCAATACCAGAAACATGACCATGAGCATGAGCATGATTCTGGTGGGCGTGATCATGA TGTTCCTGTCCCTGGGCGTGGGCGCCTAATAACAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCCA CACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACACCCTGGTACTGCATGCACGCAATGCTAGCTGCCCCTTTCCCGTCCTGG GTACCCCGAGTCTCCCCCGACCTCGGGTCCCAGGTATGCTCCCACCTCCACCTGCCCCACTCACCACCTCTGCTA GTTCCAGACACCTCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGATATCA AAACCCGGG| SEQ ID NO: 5 | YFV Linear NS1 | GCGGCCGCTAATACGACTCACTATAAGGACTCTTCTGGTCCCCACAGACTCAGAGAGAACGCCACCATGGGCA GAAACATGACCATGAGCATGAGCATGATCCTGGTGGGCGTGATCATGATGTTCCTGAGCCTGGGCGTGGGCG CCGACCAGGGCTGCGCCATCAACTTCGGCAAGAGAGAGCTGAAGTGCGGCGACGGCATCTTCATCTTCAGAG ACAGCGACGACTGGCTGAACAAGTACAGCTACTACCCCGAGGACCCCGTGAAGCTGGCCAGCATCGTGAAGG CCAGCTTCGAGGAGGGCAAGTGCGGCCTGAACAGCGTGGACTCCCTGGAGCACGAGATGTGGAGAAGCAGA GCCGACGAGATCAACGCCATCTTCGAGGAGAACGAGGTGGACATCAGCGTGGTGGTGCAGGACCCCAAGAA CGTGTACCAGAGAGGCACCCACCCCTTCAGCAGAATCAGGGACGGCCTGCAGTACGGCTGGAAGACATGGG GCAAGAACCTGGTGTTCAGCCCCGGCAGAAAGAACGGCAGCTTCATCATCGACGGCAAGAGCAGAAAGGAG TGCCCCTTCAGCAACAGAGTGTGGAACAGCTTCCAGATCGAGGAGTTCGGCACCGGCGTGTTCACCACCAGA GTGTACATGGACGCCGTGTTCGAGTACACAATCGACTGCGACGGCAGCATCCTGGGCGCCGCCGTGAACGGC AAGAAGTCCGCCCACGGCAGCCCCACCTTCTGGATGGGCAGCCACGAGGTGAACGGCACCTGGATGATCCAC ACCCTGGAGGCCCTGGACTACAAGGAGTGCGAGTGGCCCCTGACCCACACCATCGGCACCAGCGTGGAGGA GAGCGAGATGTTCATGCCCAGAAGCATCGGCGGCCCCGTGAGCAGCCACAACCACATCCCCGGCTACAAGGT GCAGACCAACGGCCCCTGGATGCAGGTGCCCCTGGAGGTGAAGAGAGAGGCCTGCCCCGGCACAAGCGTGA TCATCGACGGCAACTGCGACGGCAGAGGCAAGAGCACCAGAAGCACCACCGACAGCGGCAAGGTGATCCCC GAGTGGTGCTGCAGAAGCTGCACCATGCCCCCCGTGAGCTTCCACGGCAGCGACGGCTGCTGGTACCCCATG GAGATCAGACCCAGGAAGACCCACGAGAGCCACCTGGTGAGAAGCTGGGTGACCGCCTAATAACAAGCACG CAGCAATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATA AACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACACCCTGGTACTGCATGCACGCAATGCTAGCTGCCCCTTTCCCGTCCTGGGTACCCCGAGTCTCCCCCGACCTCGGGTCCCAGGTATGCT CCCACCTCCACCTGCCCCACTCACCACCTCTGCTAGTTCCAGACACCTCCAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAGATATCAAAACCCGGG| SEQ ID NO: 6 | YFV T4 JprME |CATAATACGACTCACTATAGGGAATTCTAGAGAAAATTTCGTCTGGATTAGTTACTTATCGTGTAAAATCTGATAAATGGAATTGGTTCTACATAAATGCCTAACGACTATCCCTTTGGGGAGTAGGGTCAAGTGACTCGAAACGATAGACAACTTGCTTTAACAAGTTGGAGATATAGTCTGCTCTGCATGGTGACATGCAGCTGGATATAATTCCGGGGTAAGATTAACGACCTTATCTGAACATAACGCTACCGTTTAATATTGCGTCATATAAAAAAAAAAAACCAAAAAAAAAAAACAAAAAAAAAAAATAATTGACTAATTAAAACAGCGGATGGGTACCCCACCATCCGACCCACTGGGTGTAGTACTCTGGTACTTCGTACCTTTGTACGCCTGTTCTTCCCATTGTACCCTTCCTGAACTTCCAACCCAAGTAACGTTAGAAGCTCAACATTTAGTACAACAGGAAGCACCACATCCAGTGGTGTTTAGTACAAGCACTTCTGTTTCCCCGGAGCGAGGTATAGGCTGTACCCACTGCCAAAAACCTTTAACCGTTATCCGCCAACCAACTACGTAAAAGCTAGTAGTATTATGTTTTTAACTAGGCGTTCGATCAGGTGGATTTCCCCTCCACTAGTTTGGTCGATGAGGCTAGGAATTCCCCACGGGTGACCGTGTCCTAGCCTGCGTGGCGGCCAACCCGGACTCACTATTTGTTTTCGCGCCCAGTTGCAAAAAGTGTCGCCGGGACGCCTTTTTATAGACATGGTGTGAAGACTCGCATGTGCTTGGTTGTGATTCCTCCGGCCCCTGAATGCGGCTAACCTTAACCCTGGAGCCTTGTGTCACAAACCAGTGATGATAAGGTCGTAATGAGCAATTCCGGGACGGGACCGACTACTTTGGGTGTCCGTGTTTCTTATTTTTCTTATTATTGTCTTATGGTCACAGCATATATATAACATATACTGTGATCATGGGCAAGAGGTCCGCCGGCAGCATCATGTGGCTGGCCAGCCTGGCCGTGGTGATCGCCTGCGCCGGCGCCGTGACCCTGGTGAGAAAGAACAGATGGCTGCTGCTGAACGTGACCTCTGAGGACCTGGGCAAGACCTTTAGCGTGGGCACCGGCAACTGCACCACCAACATCCTGGAGGCCAAGTACTGGTGCCCCGACAGCATGGAGTACAACTGCCCAAACCTGAGCCCTAGAGAGGAGCCAGACGACATCGACTGTTGGTGTTACGGCGTGGAGAACGTGAGAGTGGCCTACGGCAAGTGCGACTCCGCCGGCAGGAGCAGGAGATCCAGGAGAGCCATCGACCTGCCCACCCACGAGAACCACGGCCTGAAGACCCGGCAGGAGAAGTGGATGACCGGCAGGATGGGCGAGAGACAGCTGCAGAAGATCGAGAGATGGTTCGTGAGGAACCCTTTCTTCGCCGTGACCGCCCTGACTATCGCCTACCTGGTGGGCTCCAACATGACCCAGAGAGTGGTGATCGCCCTGCTGGTGCTGGCCGTGGGCCCCGCCTACAGCGCCCACTGCATCGGCATTACCGACAGAGACTTCATCGAAGGCGTGCACGGCGGCACCTGGGTGAGTGCCACACTGGAGCAGGACAAGTGTGTCACCGTGATGGCCCCTGACAAGCCCTCCCTGGACATCAGCCTGGAGACAGTGGCCATCGACAGACCTGCCGAGGTGAGAAAGGTGTGCTACAACGCCGTGCTGACCCACGTGAAGATCAACGACAAGTGCCCCTCTACAGGCGAGGCCCACCTGGCCGAGGAGAACGAGGGCGATAACGCCTGCAAGAGAACATACAGCGATCGGGGCTGGGGCAACGGCTGCGGCCTGTTCGGCAAGGGCTCTATCGTGGCCTGCGCCAAGTTCACCTGTGCCAAGAGCATGAGCCTCTTCGAGGTGGACCAGACCAAGATCCAGTACGTGATCAGGGCCCAGCTGCACGTGGGCGCCAAGCAGGAGAACTGGAACACCGACATCAAGACCCTGAAGTTCGATGCCCTGAGCGGCAGCCAGGAGGTGGAGTTTATCGGCTACGGCAAGGCTACCCTGGAGTGCCAGGTGCAGACAGCCGTGGACTTTGGCAACTCTTATATCGCCGAGATGGAGACCGAGAGCTGGATCGTGGACAGGCAGTGGGCCCAGGACCTGACCCTGCCCTGGCAGTCCGGCTCTGGCGGCGTGTGGCGGGAGATGCACCACCTGGTGGAGTTCGAGCCTCCTCACGCCGCCACCATCAGAGTGCTGGCCCTGGGCAACCAGGAGGGCTCCCTGAAGACCGCCCTGACCGGCGCCATGAGGGTGACCAAGGACACCAACGACAATAATCTGTACAAGCTGCACGGCGGCCACGTGAGCTGCAGAGTGAAGCTGAGCGCCCTGACCCTGAAGGGCACCAGCTACAAGATCTGCACCGACAAGATGTTCTTCGTGAAGAACCCAACCGACACCGGCCACGGCACAGTGGTGATGCAGGTGAAGGTGTCCAAAGGGGCCCCCTGCAGGATCCCCGTGATCGTGGCCGACGACCTGACCGCCGCCATCAACAAGGGCATCCTGGTGACCGTGAACCCCATCGCCAGCACCAATGACGACGAGGTGCTGATCGAGGTGAATCCCCCTTTCGGAGATTCCTACATCATCGTGGGCAGAGGCGACAGCAGACTGACTTACCAGTGGCACAAGGAGGGCAGCAGCATCGGCAAGCTGTTCACCCAGACCATGAAGGGCGTGGAGAGACTGGCCGTGATGGGCGACACAGCCTGGGACTTCAGCAGCGCCGGCGGCTTCTTCACAAGCGTGGGCAAGGGCATCCACACTGTGTTCGGCTCCGCCTTCCAGGGCCTGTTTGGCGGCCTGAACTGGATCACCAAGGTGATCATGGGCGCCGTGCTGATCTGGGTGGGCATCAATACCAGAAACATGACCATGAGCATGAGCATGATTCTGGTGGGCGTGATCATGATGTTCCTGTCCCTGGGCGTGGGCGCCTAATAAGCTGGAGCCTCGGTGGCCATGCTTCTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAAAGTCTGACTCAGTAGATGTTTTCTTGGGTTAATTGAGGCCTGAGTATAAGGTGACTTATACTTGTAATCTATCTAAACGGGGAACCTCTCTAGTAGACAATCCCGTGCTAAATTGTAGGACTGCCCTTTAATAAATACTTCTATATTTAAAGAGGTATTTATGAAAAGCGGAATTTATCAGATTAAAAATACTTTCTCTAGAGTCGACCTGCAGATAACAGCATATCTAGGATATCAAAAGCGGCCGC| SEQ ID NO: 7 | YFV T4 NS1 |CATAATACGACTCACTATAGGGAATTCTAGAGAAAATTTCGTCTGGATTAGTTACTTATCGTGTAAAATCTGATAAATGGAATTGGTTCTACATAAATGCCTAACGACTATCCCTTTGGGGAGTAGGGTCAAGTGACTCGAAACGATAGACAACTTGCTTTAACAAGTTGGAGATATAGTCTGCTCTGCATGGTGACATGCAGCTGGATATAATTCCGGGGTAAGATTAACGACCTTATCTGAACATAACGCTACCGTTTAATATTGCGTCATATAAAAAAAAAAAACCAAAAAAAAAAAACAAAAAAAAAAAATAATTGACTAATTAAAACAGCGGATGGGTACCCCACCATCCGACCCACTGGGTGTAGTACTCTGGTACTTCGTACCTTTGTACGCCTGTTCTTCCCATTGTACCCTTCCTGAACTTCCAACCCAAGTAACGTTAGAAGCTCAACATTTAGTACAACAGGAAGCACCACATCCAGTGGTGTTTAGTACAAGCACTTCTGTTTCCCCGGAGCGAGGTATAGGCTGTACCCACTGCCAAAAACCTTTAACCGTTATCCGCCAACCAACTACGTAAAAGCTAGTAGTATTATGTTTTTAACTAGGCGTTCGATCAGGTGGATTTCCCCTCCACTAGTTTGGTCGATGAGGCTAGGAATTCCCCACGGGTGACCGTGTCCTAGCCTGCGTGGCGGCCAACCCGGACTCACTATTTGTTTTCGCGCCCAGTTGCAAAAAGTGTCGCCGGGACGCCTTTTTATAGACATGGTGTGAAGACTCGCATGTGCTTGGTTGTGATTCCTCCGGCCCCTGAATGCGGCTAACCTTAACCCTGGAGCCTTGTGTCACAAACCAGTGATGATAAGGTCGTAATGAGCAATTCCGGGACGGGACCGACTACTTTGGGTGTCCGTGTTTCTTATTTTTCTTATTATTGTCTTATGGTCACAGCATATATATAACATATACTGTGATCATGGGCAGAAACATGACCATGAGCATGAGCATGATCCTGGTGGGCGTGATCATGATGTTCCTGAGCCTGGGCGTGGGCGCCGACCAGGGCTGCGCCATCAACTTCGGCAAGAGAGAGCTGAAGTGCGGCGACGGCATCTTCATCTTCAGAGACAGCGACGACTGGCTGAACAAGTACAGCTACTACCCCGAGGACCCCGTGAAGCTGGCCAGCATCGTGAAGGCCAGCTTCGAGGAGGGCAAGTGCGGCCTGAACAGCGTGGACTCCCTGGAGCACGAGATGTGGAGAAGCAGAGCCGACGAGATCAACGCCATCTTCGAGGAGAACGAGGTGGACATCAGCGTGGTGGTGCAGGACCCCAAGAACGTGTACCAGAGAGGCACCCACCCCTTCAGCAGAATCAGGGACGGCCTGCAGTACGGCTGGAAGACATGGGGCAAGAACCTGGTGTTCAGCCCCGGCAGAAAGAACGGCAGCTTCATCATCGACGGCAAGAGCAGAAAGGAGTGCCCCTTCAGCAACAGAGTGTGGAACAGCTTCCAGATCGAGGAGTTCGGCACCGGCGTGTTCACCACCAGAGTGTACATGGACGCCGTGTTCGAGTACACAATCGACTGCGACGGCAGCATCCTGGGCGCCGCCGTGAACGGCAAGAAGTCCGCCCACGGCAGCCCCACCTTCTGGATGGGCAGCCACGAGGTGAACGGCACCTGGATGATCCACACCCTGGAGGCCCTGGACTACAAGGAGTGCGAGTGGCCCCTGACCCACACCATCGGCACCAGCGTGGAGGAGAGCGAGATGTTCATGCCCAGAAGCATCGGCGGCCCCGTGAGCAGCCACAACCACATCCCCGGCTACAAGGTGCAGACCAACGGCCCCTGGATGCAGGTGCCCCTGGAGGTGAAGAGAGAGGCCTGCCCCGGCACAAGCGTGATCATCGACGGCAACTGCGACGGCAGAGGCAAGAGCACCAGAAGCACCACCGACAGCGGCAAGGTGATCCCCGAGTGGTGCTGCAGAAGCTGCACCATGCCCCCCGTGAGCTTCCACGGCAGCGACGGCTGCTGGTACCCCATGGAGATCAGACCCAGGAAGACCCACGAGAGCCACCTGGTGAGAAGCTGGGTGACCGCCTAATAAGCTGGAGCCTCGGTGGCCATGCTTCTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAAAGTCTGACTCAGTAGATGTTTTCTTGGGTTAATTGAGGCCTGAGTATAAGGTGACTTATACTTGTAATCTATCTAAACGGGGAACCTCTCTAGTAGACAATCCCGTGCTAAATTGTAGGACTGCCCTTTAATAAATACTTCTATATTTAAAGAGGTATTTATGAAAAGCGGAATTTATCAGATTAAAAATACTTTCTCTAGAGTCGACCTGCAGATAACAGCATATCTAGGATATCAAAAGCGGCC| SEQ ID NO: 8 | YFV T4 NS5 |CATAATACGACTCACTATAGGGAATTCTAGAGAAAATTTCGTCTGGATTAGTTACTTATCGTGTAAAATCTGATAAATGGAATTGGTTCTACATAAATGCCTAACGACTATCCCTTTGGGGAGTAGGGTCAAGTGACTCGAAACGATAGACAACTTGCTTTAACAAGTTGGAGATATAGTCTGCTCTGCATGGTGACATGCAGCTGGATATAATTCCGGGGTAAGATTAACGACCTTATCTGAACATAACGCTACCGTTTAATATTGCGTCATATAAAAAAAAAAAACCAAAAAAAAAAAACAAAAAAAAAAAATAATTGACTAATTAAAACAGCGGATGGGTACCCCACCATCCGACCCACTGGGTGTAGTACTCTGGTACTTCGTACCTTTGTACGCCTGTTCTTCCCATTGTACCCTTCCTGAACTTCCAACCCAAGTAACGTTAGAAGCTCAACATTTAGTACAACAGGAAGCACCACATCCAGTGGTGTTTAGTACAAGCACTTCTGTTTCCCCGGAGCGAGGTATAGGCTGTACCCACTGCCAAAAACCTTTAACCGTTATCCGCCAACCAACTACGTAAAAGCTAGTAGTATTATGTTTTTAACTAGGCGTTCGATCAGGTGGATTTCCCCTCCACTAGTTTGGTCGATGAGGCTAGGAATTCCCCACGGGTGACCGTGTCCTAGCCTGCGTGGCGGCCAACCCGGACTCACTATTTGTTTTCGCGCCCAGTTGCAAAAAGTGTCGCCGGGACGCCTTTTTATAGACATGGTGTGAAGACTCGCATGTGCTTGGTTGTGATTCCTCCGGCCCCTGAATGCGGCTAACCTTAACCCTGGAGCCTTGTGTCACAAACCAGTGATGATAAGGTCGTAATGAGCAATTCCGGGACGGGACCGACTACTTTGGGTGTCCGTGTTTCTTATTTTTCTTATTATTGTCTTATGGTCACAGCATATATATAACATATACTGTGATCATGGGCTCCGCCAACGGTAAGACCCTGGGCGAGGTTTGGAAACGC GAGCTCAACTTACTGGATAAAAGGCAATTCGAACTGTACAAGAGAACGGATATAGTTGAAGTTGACAGAGAC ACTGCCCGGCGCCACCTGGCTGAGGGCAAAGTTGATACGGGAGTTGCCGTGAGTAGAGGCACAGCCAAACT GAGATGGTTTCACGAAAGAGGATACGTGAAATTAGAGGGCAGAGTCATCGATCTTGGTTGCGGAAGGGGTG GGTGGTGCTATTATGCCGCCGCCCAGAAAGAGGTTAGCGGCGTGAAGGGGTTCACATTAGGAAGGGATGGA CACGAAAAGCCGATGAACGTCCAGTCTTTGGGCTGGAATATAATTACTTTTAAAGATAAGACCGACATACATA GACTGGAGCCTGTAAAGTGCGATACATTATTATGCGATATTGGTGAATCCAGCTCCTCTTCTGTGACCGAAGG AGAGAGAACTGTCCGGGTGCTCGACACGGTGGAGAAGTGGCTCGCCTGCGGTGTCGATAACTTTTGCGTAAA AGTTCTTGCACCTTATATGCCTGACGTGCTGGAAAAGTTGGAGCTGCTGCAGAGACGATTCGGCGGCACTGTA ATTCGCAATCCACTGTCACGAAACAGTACACACGAGATGTATTATGTTTCAGGCGCAAGAAGTAACGTGACCT TCACCGTTAATCAGACCTCACGACTGCTTATGCGGCGAATGCGTCGCCCCACCGGCAAGGTAACTCTCGAAGC CGATGTGATTCTGCCCATAGGCACTCGGTCCGTCGAAACCGATAAAGGGCCACTCGATAAGGAAGCAATCGA GGAGCGCGTGGAACGTATCAAGTCAGAATATATGACTAGCTGGTTCTACGATAACGATAATCCTTATAGAACT TGGCATTATTGCGGATCATACGTGACTAAGACTTCCGGGTCCGCCGCATCCATGGTGAACGGCGTGATCAAGA TCTTGACCTACCCTTGGGATCGCATTGAAGAAGTGACTAGGATGGCGATGACCGATACTACGCCATTCGGCCA ACAGCGCGTCTTCAAGGAGAAGGTAGATACACGGGCTAAAGACCCACCCGCTGGGACGCGGAAAATAATGA AGGTCGTGAATCGTTGGTTGTTTAGACATCTCGCGCGCGAGAAGAATCCACGGCTTTGTACTAAAGAGGAGTT CATAGCGAAGGTGCGGTCCCACGCGGCTATCGGCGCCTATTTGGAAGAGCAGGAGCAATGGAAAACCGCTA ACGAAGCAGTACAGGATCCCAAATTTTGGGAGTTAGTAGACGAGGAGCGCAAACTTCATCAGCAGGGGCGTT GCAGGACCTGCGTTTATAATATGATGGGCAAGCGGGAAAAGAAACTCAGTGAATTCGGCAAGGCTAAAGGTT CTCGCGCAATCTGGTACATGTGGTTGGGCGCCAGATACTTGGAATTCGAAGCACTCGGGTTTCTGAACGAAGA TCACTGGGCAAGTCGCGAGAATTCCGGCGGTGGCGTCGAGGGAATCGGTTTGCAGTATCTGGGGTACGTTAT TCGGGATCTCGCAGCTATGGACGGCGGCGGTTTCTATGCTGACGATACAGCCGGGTGGGATACTAGAATTAC CGAAGCCGATTTGGACGACGAGCAAGAAATACTCAATTATATGAGTCCGCACCATAAGAAGCTCGCCCAGGC CGTAATGGAGATGACTTATAAGAATAAGGTTGTCAAGGTTCTGAGGCCCGCTCCCGGCGGTAAGGCTTATAT GGACGTTATCAGCCGCAGGGATCAACGCGGGAGTGGACAAGTGGTCACCTACGCACTCAATACAATTACAAA TCTGAAGGTTCAGTTAATTCGAATGGCCGAGGCGGAAATGGTCATCCACCATCAGCACGTGCAGGACTGCGACGAGTCCGTCCTTACGAGATTAGAAGCCTGGCTGACAGAACATGGCTGCGATCGATTAAAACGTATGGCCGTC TCCGGGGATGATTGCGTCGTGCGCCCAATTGACGATCGTTTTGGATTAGCTCTCAGCCACCTTAATGCTATGTC TAAAGTGCGTAAAGACATCAGCGAGTGGCAACCTTCCAAGGGCTGGAACGACTGGGAAAACGTCCCCTTTTG CAGTCATCATTTTCACGAGTTACAACTCAAAGACGGTCGCCGGATAGTAGTCCCATGTAGAGAGCAAGATGAA TTAATCGGACGGGGCCGGGTCTCCCCCGGCAATGGTTGGATGATTAAAGAGACGGCGTGTTTGTCTAAGGCG TACGCTAATATGTGGAGTCTCATGTACTTCCATAAGAGAGATATGCGACTCTTGTCTCTTGCCGTGAGCTCCGC AGTGCCTACAAGCTGGGTGCCGCAGGGTAGGACGACGTGGAGCATCCACGGAAAGGGCGAATGGATGACAA CTGAGGATATGCTGGAAGTTTGGAATCGCGTGTGGATCACAAATAATCCCCATATGCAAGATAAAACTATGGT CAAGAAGTGGCGGGACGTGCCCTACCTGACAAAACGACAGGATAAACTTTGTGGCTCCCTCATCGGGATGAC AAACCGCGCAACGTGGGCATCTCATATACACCTGGTTATTCACAGGATTAGAACCTTAATCGGTCAAGAAAAG TATACGGATTATCTGACCGTTATGGATCGCTACTCCGTTGACGCCGATTTACAGTTAGGCGAACTGATATAATA AGCTGGAGCCTCGGTGGCCATGCTTCTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGT ACCCCCGTGGTCTTTGAATAAAGTCTGACTCAGTAGATGTTTTCTTGGGTTAATTGAGGCCTGAGTATAAGGT GACTTATACTTGTAATCTATCTAAACGGGGAACCTCTCTAGTAGACAATCCCGTGCTAAATTGTAGGACTGCCC TTTAATAAATACTTCTATATTTAAAGAGGTATTTATGAAAAGCGGAATTTATCAGATTAAAAATACTTTCTCTAG AGTCGACCTGCAGATAACAGCATATCTAGGATATCAAAAGCGGCCGCAALIST OF SEQUENCES (HTNV)| SEQ ID NO: 9 | HTNV Ab GnGc |GATAATACGACTCACTATAGGGAGACCCTCGACCGTCGATTGTCCACTGGTCAACAATAGATGACTTACAACTAATCGGAAGGTGCAGAGACTCGACGGGAGCTACCCTAACGTCAAGACGAGGGTAAAGAGAGAGTCCAATTC TCAAAGCCAATAGGCAGTAGCGAAAGCTGCAAGAGAATGAAAATCCGTTGACCTTAAACGGTCGTGTGGGTTCAAGTCCCTCCACCCCCACGCCGGAAACGCAATAGCCGTTTTTGTTTTTTGT I I I I I I TG I I I I I I I I I I GGTTTTTTTGTTTTGTGTTTAAAACAGCCTGTGGGTTGATCCCACCCACAGGCCCATTGGGCGCTAGCACTCTGGTATCACGGTACCTTTGTGCGCCTGTTTTATACCCCCTCCCCCAACTGTAACTTAGAAGTAACACACACCGATCAACAGTCAGCGTGGCACACCAGCCACGTTTTGATCAAGCACTTCTGTTACCCCGGACTGAGTATCAATAGACTGCTCACGCGGTTGAAGGAGAAAGCGTTCGTTATCCGGCCAACTACTTCGAAAAACCTAGTAACACCGTGGAAGTTGCAGAGTGTTTCGCTCAGCACTACCCCAGTGTAGATCAGGTCGATGAGTCACCGCATTCCCCACGGGCGACCGTGGCGGTGGCTGCGTTGGCGGCCTGCCCATGGGGAAACCCATGGGACGCTCTAATACAGACATGGTGCGAAGAGTCTATTGAGCTAGTTGGTAGTCCTCCGGCCCCTGAATGCGGCTAATCCTAACTGCGGAGCACACACCCTCAAGCCAGAGGGCAGTGTGTCGTAACGGGCAACTCTGCAGCGGAACCGACTACTTTGGGTGTCCGTGTTTCATTTTATTCCTATACTGGCTGCTTATGGTGACAATTGAGAGATCGTTACCATATAGCTATTGGATTGGCCATCCGGTGACTAATAGAGCTATTATATATCCCTTTGTTGGGTTTATACCACTTAGCTTGAAAGAGGTTAAAACATTACAATTCATTGTTAAGTTGAATACAGCAAAATGGGCATCTGGAAGTGGCTCGTGATGGCCTCCCTGGTGTGGCCCGTGCTGACCCTGCGGAACGTGTACGATATGAAGATCGAGTGCCCTCACACCGTGAGCTTCGGCGAGAATAGCGTGATCGGCTACGTGGAGCTGCCTCCCGTGCCCCTGGCCGACACCGCCCAGATGGTGCCCGAGAGCAGCTGCAACATGGACAACCACCAGAGCCTGAACACCATCACCAAGTATACCCAGGTGAGCTGGCGGGGCAAGGCCGACCAGTCTCAGAGCTCCCAGAACAGCTTCGAAACCGTGTCCACCGAGGTGGATCTGAAGGGGACCTGCGTGCTGAAGCACAAGATGGTGGAGGAGAGCTACAGGTCCCGCAAGAGCGTGACCTGCTATGACCTGTCCTGCAACAGCACCTACTGCAAGCCCACCCTGTACATGATCGTGCCCATCCACGCCTGCAACATGATGAAGTCCTGCCTGATCGCTCTGGGCCCCTACCGGGTGCAGGTGGTGTACGAGCGGTCCTACTGCATGACCGGGGTGCTGATCGAGGGCAAGTGTTTCGTGCCTGACCAGAGCGTGGTGTCCATCATCAAGCACGGAATCTTCGACATCGCCTCCGTGCACATTGTGTGCTTCTTCGTGGCCGTGAAGGGCAACACCTACAAGATCTTCGAGCAGGTGAAGAAGTCCTTTGAGTCCACCTGCAACGACACAGAGAACAAGGTGCAGGGCTACTACATCTGCATCGTGGGCGGGAACTCTGCCCCCATCTACGTGCCCACCCTGGACGACTTCCGGAGCATGGAGGCCTTCACTGGCATTTTTCGCTCCCCCCACGGCGAGGACCACGACCTGGCCGGGGAGGAGATCGCCAGCTACAGCATCGTGGGCCCCGCCAACGCCAAGGTGCCCCACTCCGCCAGCAGCGACACCCTGAGCCTGATCGCCTACAGCGGGATCCCCTCCTACAGCTCCCTGTCCATCCTGACATCCTCCACCGAGGCCAAACACGTCTTCTCCCCCGGCCTGTTCCCAAAGCTGAACCACACCAACTGCGACAAGTCCGCCATCCCCCTGATCTGGACCGGCATGATTGACCTGCCCGGCTATTACGAGGCCGTGCACCCCTGTACTGTCTTCTGCGTGCTGTCCGGCCCCGGCGCCAGCTGCGAGGCCTTCAGCGAGGGCGGCATCTTCAACATCACCAGTCCCATGTGCCTGGTGAGCAAGCAGAACCGGTTCCGGCTGACCGAGCAGCAGGTGAACTTCGTGTGCCAGAGGGTGGACATGGACATCGTGGTGTACTGCAACGGCCAGCGCAAGGTGATCCTGACCAAGACCCTGGTGATCGGGCAGTGCATCTACACCATCACCAGCCTGTTCAGCCTGCTGCCCGGCGTCGCCCACAGCATCGCCGTGGAGCTGTGCGTGCCCGGCTTCCACGGCTGGGCCACCGCCGCCCTGCTGGTGACTTTCTGCTTCGGCTGGGTGCTCATCCCCGCCATCACCTTCATCATCCTGACCGTGCTGAAGTTCATCGCCAACATCTTCCACACCAGCAACCAGGAGAACCGGCTGAAGTCCGTGCTGCGGAAGATCAAGGAGGAGTTCGAGAAGACCAAGGGCTCTATGGTGTGCGACGTGTGCAAGTACGAGTGCGAGACCTACAAGGAGCTGAAAGCCCACGGCGTGTCCTGCCCTCAGTCTCAGTGCCCTTACTGCTTCACCCACTGCGAGCCCACCGAGGCCGCCTTCCAGGCCCACTACAAAGTGTGCCAGGTGACCCACCGGTTCCGGGACGACCTGAAGAAGACCGTGACCCCCCAGAATTTCACCCCTGGCTGCTACCGCACCCTGAATCTGTTCCGCTACAAGTCCCGGTGCTATATCTTCACCATGTGGATCTTCCTGCTGGTGCTGGAGAGCATCCTGTGGGCCGCCAGCGCCTCCGAGACCCCCCTGACCCCTGTGTGGAACGACAACGCCCACGGCGTGGGCAGCGTGCCCATGCACACCGACCTGGAGCTGGACTTCTCCCTGACCTCCTCCTCTAAGTACACCTACCGCCGCAAGCTGACCAACCCCCTGGAGGAGGCCCAGAGCATCGACCTGCACATCGAGATCGAGGAGCAGACCATCGGGGTGGACGTGCACGCTTTGGGCCACTGGTTCGATGGCCGGCTGAACCTGAAGACCAGCTTCCACTGCTACGGCGCCTGCACCAAGTACGAGTACCCCTGGCACACCGCCAAGTGCCACTACGAGCGCGACTACCAGTACGAGACCAGCTGGGGGTGCAACCCCTCCGACTGCCCCGGCGTGGGCACCGGATGCACCGCCTGCGGCCTGTATCTGGACCAGCTGAAGCCCGTGGGCAGCGCCTACAAGATCATCACCATCCGGTACTCCCGGCGGGTGTGTGTGCAGTTTGGGGAGGAAAATCTGTGCAAGATTATCGACATGAACGACTGCTTCGTGTCCCGGCACGTGAAGGTGTGCATCATCGGCACCGTGAGCAAGTTCA GCCAGGGCGACACCCTGCTGTTCTTCGGCCCCCTGGAGGGGGGCGGGCTGATCTTCAAGCACTGGTGCACCA GCACCTGCCAGTTCGGCGACCCCGGCGACATCATGTCCCCCCGCGACAAGGGCTTCCTGTGCCCCGAGTTCCC CGGTAGTTTCCGGAAGAAGTGCAACTTCGCCACCACCCCCATCTGCGAGTACGACGGGAACATGGTGTCCGG CTACAAGAAGGTGATGGCCACCATCGACTCCTTCCAGAGCTTCAACACCTCCACCATGCATTTCACCGACGAGC GAATCGAGTGGAAGGACCCCGACGGCATGCTGCGGGATCACATCAACATCCTGGTGACAAAGGACATAGACT TCGACAACCTCGGGGAGAACCCTTGCAAGATCGGGCTGCAGACCAGCTCCATCGAGGGCGCCTGGGGCAGC GGCGTGGGCTTCACCCTGACCTGTCTGGTGAGCCTGACAGAGTGCCCCACCTTCCTCACCAGCATCAAGGCCT GCGACAAGGCCATCTGCTACGGCGCCGAGTCCGTGACCCTGACCCGCGGACAGAACACCGTGAAGGTAAGC GGGAAGGGGGGCCACAGCGGCAGCACCTTCCGGTGCTGCCACGGGGAGGACTGCAGCCAGATCGGGCTGC ACGCCGCCGCCCCCCACCTGGACAAGGTGAACGGCATCTCCGAGATCGAAAACTCTAAGGTGTACGACGACG GCGCCCCCCAGTGCGGCATCAAGTGCTGGTTCGTGAAGTCCGGGGAGTGGATCTCTGGCATCTTCAGCGGGA ACTGGATCGTGCTGATCGTGCTGTGCGTGTTCCTGCTGTTCTCCCTGGTGCTGCTGAGCATCCTGTGCCCGGTG CGCAAGCACAAGAAGTCCTAATAATTTTTTTGTTTTTTGTTTTGGGCTATTATGCGTTACCGGCGAGACGCTAC GGACTTAAATAATTGAGCCTTAAAGAAGAAATTCTTTAAGTGGATGCTCTCAAACTCAGGGAAACCTAAATCT AGTTATAGACAAGGCAATCCTGAGCCAAGCCGAAGTAGTAATTAGTAAGACCAGTGGACAATCGACGGATAA CAGCATATCTAGGATATCAAAAGCGGCCGC| SEQ ID NO: 10 | HTNV Ab Np |GATAATACGACTCACTATAGGGAGACCCTCGACCGTCGATTGTCCACTGGTCAACAATAGATGACTTACAACTAATCGGAAGGTGCAGAGACTCGACGGGAGCTACCCTAACGTCAAGACGAGGGTAAAGAGAGAGTCCAATTC TCAAAGCCAATAGGCAGTAGCGAAAGCTGCAAGAGAATGAAAATCCGTTGACCTTAAACGGTCGTGTGGGTT CAAGTCCCTCCACCCCCACGCCGGAAACGCAATAGCCGTTTTTGTTTTTTG I I I I I I I TG I I I I I I I I I TGGTTTTT TTGTTTTGTGTTTAAAACAGCCTGTGGGTTGATCCCACCCACAGGCCCATTGGGCGCTAGCACTCTGGTATCAC GGTACCTTTGTGCGCCTGTTTTATACCCCCTCCCCCAACTGTAACTTAGAAGTAACACACACCGATCAACAGTC AGCGTGGCACACCAGCCACGTTTTGATCAAGCACTTCTGTTACCCCGGACTGAGTATCAATAGACTGCTCACG CGGTTGAAGGAGAAAGCGTTCGTTATCCGGCCAACTACTTCGAAAAACCTAGTAACACCGTGGAAGTTGCAG AGTGTTTCGCTCAGCACTACCCCAGTGTAGATCAGGTCGATGAGTCACCGCATTCCCCACGGGCGACCGTGGC GGTGGCTGCGTTGGCGGCCTGCCCATGGGGAAACCCATGGGACGCTCTAATACAGACATGGTGCGAAGAGTC TATTGAGCTAGTTGGTAGTCCTCCGGCCCCTGAATGCGGCTAATCCTAACTGCGGAGCACACACCCTCAAGCC AGAGGGCAGTGTGTCGTAACGGGCAACTCTGCAGCGGAACCGACTACTTTGGGTGTCCGTGTTTCATTTTATT CCTATACTGGCTGCTTATGGTGACAATTGAGAGATCGTTACCATATAGCTATTGGATTGGCCATCCGGTGACTA ATAGAGCTATTATATATCCCTTTGTTGGGTTTATACCACTTAGCTTGAAAGAGGTTAAAACATTACAATTCATTG TTAAGTTGAATACAGCAAAATGGCCACCATGGAGGAGCTGCAGAGAGAGATCAACGCCCACGAGGGCCAGC TGGTGATCGCCAGACAGAAGGTGAGAGACGCCGAGAAGCAGTACGAGAAGGACCCCGACGAGCTGAACAA GAGAACCCTGACCGACAGAGAGGGCGTGGCCGTGAGCATCCAGGCCAAGATCGACGAGCTGAAGAGACAGC TGGCCGACAGAATCGCCACCGGCAAGAACCTGGGCAAGGAGCAGGACCCTACCGGCGTGGAGCCCGGCGAC CACCTGAAGGAGAGAAGCATGCTGTCCTACGGCAACGTGCTGGACCTGAACCACCTGGACATCGACGAGCCC ACCGGCCAGACCGCCGACTGGCTGAGCATCATCGTGTACCTGACCAGCTTCGTGGTGCCCATCCTGCTGAAGG CCCTGTACATGCTGACCACCAGAGGCAGACAGACCACCAAGGACAACAAGGGCACCAGAATCAGATTTAAGG ACGACAGCAGCTTCGAGGACGTGAACGGCATCAGAAAGCCTAAGCACCTGTACGTGAGCCTGCCCAACGCCC AGAGCAGCATGAAGGCCGAGGAGATCACCCCCGGCAGATACAGGACCGCCGTGTGCGGCCTGTACCCCGCCCAGATCAAGGCCAGACAGATGATCAGCCCCGTGATGAGCGTGATCGGCTTCCTGGCCCTGGCCAAGGACTGG AGCGACAGAATCGAGCAGTGGCTGATCGAGCCCTGCAAGCTGCTGCCCGATACCGCCGCCGTGAGCCTGCTGGGCGGCCCCGCCACCAACAGGGACTATCTGAGACAGAGGCAGGTGGCCCTGGGCAACATGGAGACCAAGGAGAGCAAGGCCATCAGACAGCACGCCGAGGCCGCCGGCTGCAGCATGATCGAGGACATCGAGAGCCCCAGCAGCATCTGGGTGTTCGCCGGCGCCCCTGACAGATGCCCCCCTACCTGCCTGTTCATCGCCGGCATCGCCGAGCTGGGCGCCTTCTTCAGCATCCTGCAGGACATGAGAAACACCATCATGGCCAGCAAGACCGTGGGCACCAGCGAGGAGAAGCTGAGAAAGAAGTCCAGCTTCTACCAGAGCTACCTGAGGAGAACCCAGAGCATGGGCATCCAGCTGGGCCAGAGAATCATCGTGCTGTTTATGGTGGCCTGGGGCAAGGAGGCCGTGGACAACTTTCACCTGGGCGACGACATGGACCCCGAGCTGAGAACCCTGGCCCAGTCCCTGATCGACGTGAAGGTGAAGGAGATCAGCAACCAGGAGCCCCTGAAGCTGTAATAATTTTTTTGTTTTTTGTTTTGGGCTATTATGCGTTACCGGCGAGACGCTACGGACTTAAATAATTGAGCCTTAAAGAAGAAATTCTTTAAGTGGATGCTCTCAAACTCAGGGAAACCTAAATCTAGTTATAGACAAGGCAATCCTGAGCCAAGCCGAAGTAGTAATTAGTAAGACCAGTGGACAATCGACGGATAACAG CATATCTAGGATATCAAAAGCGGCCGC| SEQ ID NO: 1 1 | HTNV Linear GnGc |GCGGCCGCTAATACGACTCACTATAAGGACTCTTCTGGTCCCCACAGACTCAGAGAGAACGCCACCATGGGCATCTGGAAGTGGCTCGTGATGGCCTCCCTGGTGTGGCCCGTGCTGACCCTGCGGAACGTGTACGATATGAAGATCGAGTGCCCTCACACCGTGAGCTTCGGCGAGAATAGCGTGATCGGCTACGTGGAGCTGCCTCCCGTGCCCCTGGCCGACACCGCCCAGATGGTGCCCGAGAGCAGCTGCAACATGGACAACCACCAGAGCCTGAACACCATCACCAAGTATACCCAGGTGAGCTGGCGGGGCAAGGCCGACCAGTCTCAGAGCTCCCAGAACAGCTTCGAAACCGTGTCCACCGAGGTGGATCTGAAGGGGACCTGCGTGCTGAAGCACAAGATGGTGGAGGAGAGCTACAGGTCCCGCAAGAGCGTGACCTGCTATGACCTGTCCTGCAACAGCACCTACTGCAAGCCCACCCTGTACATGATCGTGCCCATCCACGCCTGCAACATGATGAAGTCCTGCCTGATCGCTCTGGGCCCCTACCGGGTGCAGGTGGTGTACGAGCGGTCCTACTGCATGACCGGGGTGCTGATCGAGGGCAAGTGTTTCGTGCCTGACCAGAGCGTGGTGTCCATCATCAAGCACGGAATCTTCGACATCGCCTCCGTGCACATTGTGTGCTTCTTCGTGGCCGTGAAGGGCAACACCTACAAGATCTTCGAGCAGGTGAAGAAGTCCTTTGAGTCCACCTGCAACGACACAGAGAACAAGGTGCAGGGCTACTACATCTGCATCGTGGGCGGGAACTCTGCCCCCATCTACGTGCCCACCCTGGACGACTTCCGGAGCATGGAGGCCTTCACTGGCATTTTTCGCTCCCCCCACGGCGAGGACCACGACCTGGCCGGGGAGGAGATCGCCAGCTACAGCATCGTGGGCCCCGCCAACGCCAAGGTGCCCCACTCCGCCAGCAGCGACACCCTGAGCCTGATCGCCTACAGCGGGATCCCCTCCTACAGCTCCCTGTCCATCCTGACATCCTCCACCGAGGCCAAACACGTCTTCTCCCCCGGCCTGTTCCCAAAGCTGAACCACACCAACTGCGACAAGTCCGCCATCCCCCTGATCTGGACCGGCATGATTGACCTGCCCGGCTATTACGAGGCCGTGCACCCCTGTACTGTCTTCTGCGTGCTGTCCGGCCCCGGCGCCAGCTGCGAGGCCTTCAGCGAGGGCGGCATCTTCAACATCACCAGTCCCATGTGCCTGGTGAGCAAGCAGAACCGGTTCCGGCTGACCGAGCAGCAGGTGAACTTCGTGTGCCAGAGGGTGGACATGGACATCGTGGTGTACTGCAACGGCCAGCGCAAGGTGATCCTGACCAAGACCCTGGTGATCGGGCAGTGCATCTACACCATCACCAGCCTGTTCAGCCTGCTGCCCGGCGTCGCCCACAGCATCGCCGTGGAGCTGTGCGTGCCCGGCTTCCACGGCTGGGCCACCGCCGCCCTGCTGGTGACTTTCTGCTTCGGCTGGGTGCTCATCCCCGCCATCACCTTCATCATCCTGACCGTGCTGAAGTTCATCGCCAACATCTTCCACACCAGCAACCAGGAGAACCGGCTGAAGTCCGTGCTGCGGAAGATCAAGGAGGAGTTCGAGAAGACCAAGGGCTCTATGGTGTGCGACGTGTGCAAGTACGAGTGCGAGACCTACAAGGAGCTGAAAGCCCACGGCGTGTCCTGCCCTCAGTCTCAGTGCCCTTACTGCTTCACCCACTGCGAGCCCACCGAGGCCGCCTTCCAGGCCCACTACAAAGTGTGCCAGGTGACCCACCGGTTCCGGGACGACCTGAAGAAGACCGTGACCCCCCAGAATTTCACCCCTGGCTGCTACCGCACCCTGAATCTGTTCCGCTACAAGTCCCGGTGCTATATCTTCACCATGTGGATCTTCCTGCTGGTGCTGGAGAGCATCCTGTGGGCCGCCAGCGCCTCCGAGACCCCCCTGACCCCTGTGTGGAACGACAACGCCCACGGCGTGGGCAGCGTGCCCATGCACACCGACCTGGAGCTGGACTTCTCCCTGACCTCCTCCTCTAAGTACACCTACCGCCGCAAGCTGACCAACCCCCTGGAGGAGGCCCAGAGCATCGACCTGCACATCGAGATCGAGGAGCAGACCATCGGGGTGGACGTGCACGCTTTGGGCCACTGGTTCGATGGCCGGCTGAACCTGAAGACCAGCTTCCACTGCTACGGCGCCTGCACCAAGTACGAGTACCCCTGGCACACCGCCAAGTGCCACTACGAGCGCGACTACCAGTACGAGACCAGCTGGGGGTGCAACCCCTCCGACTGCCCCGGCGTGGGCACCGGATGCACCGCCTGCGGCCTGTATCTGGACCAGCTGAAGCCCGTGGGCAGCGCCTACAAGATCATCACCATCCGGTACTCCCGGCGGGTGTGTGTGCAGTTTGGGGAGGAAAATCTGTGCAAGATTATCGACATGAACGACTGCTTCGTGTCCCGGCACGTGAAGGTGTGCATCATCGGCACCGTGAGCAAGTTCAGCCAGGGCGACACCCTGCTGTTCTTCGGCCCCCTGGAGGGGGGCGGGCTGATCTTCAAGCACTGGTGCACCAGCACCTGCCAGTTCGGCGACCCCGGCGACATCATGTCCCCCCGCGACAAGGGCTTCCTGTGCCCCGAGTTCCCCGGTAGTTTCCGGAAGAAGTGCAACTTCGCCACCACCCCCATCTGCGAGTACGACGGGAACATGGTGTCCGGCTACAAGAAGGTGATGGCCACCATCGACTCCTTCCAGAGCTTCAACACCTCCACCATGCATTTCACCGACGAGCGAATCGAGTGGAAGGACCCCGACGGCATGCTGCGGGATCACATCAACATCCTGGTGACAAAGGACATAGACTTCGACAACCTCGGGGAGAACCCTTGCAAGATCGGGCTGCAGACCAGCTCCATCGAGGGCGCCTGGGGCAGCGGCGTGGGCTTCACCCTGACCTGTCTGGTGAGCCTGACAGAGTGCCCCACCTTCCTCACCAGCATCAAGGCCTGCGACAAGGCCATCTGCTACGGCGCCGAGTCCGTGACCCTGACCCGCGGACAGAACACCGTGAAGGTAAGCGGGAAGGGGGGCCACAGCGGCAGCACCTTCCGGTGCTGCCACGGGGAGGACTGCAGCCAGATCGGGCTGCACGCCGCCGCCCCCCACCTGGACAAGGTGAACGGCATCTCCGAGATCGAAAACTCTAAGGTGTACGACGACGGCGCCCCCCAGTGCGGCATCAAGTGCTGGTTCGTGAAGTCCGGGGAGTGGATCTCTGGCATCTTCAGCGGGAACTGGATCGTGCTGATCGTGCTGTGCGTGTTCCTGCTGTTCTCCCTGGTGCTGCTGAGCATCCTGTGCCCGGTGCGCAAGCACAAGAAGTCCTAATAACAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACACCCTGGTACTGCATGCACGCAATGCTAGCTGCCCCTTTCCCGTCCTGGGTACCCCGAGTCTCCCCCGACCTCGGGTCCCAGGTATGCTCCCACCTCCACCTGCCCCACTCACCACCTCTGCTAGTTCCAGACACCTCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGATATCAAAACCCGGG| SEQ ID NO: 12 | HTNV Linear NP |GCGGCCGCTAATACGACTCACTATAAGGACTCTTCTGGTCCCCACAGACTCAGAGAGAACGCCACCATGGCCACCATGGAGGAGCTGCAGAGAGAGATCAACGCCCACGAGGGCCAGCTGGTGATCGCCAGACAGAAGGTGAGAGACGCCGAGAAGCAGTACGAGAAGGACCCCGACGAGCTGAACAAGAGAACCCTGACCGACAGAGAGGGCGTGGCCGTGAGCATCCAGGCCAAGATCGACGAGCTGAAGAGACAGCTGGCCGACAGAATCGCCACCGGCAAGAACCTGGGCAAGGAGCAGGACCCTACCGGCGTGGAGCCCGGCGACCACCTGAAGGAGAGAAGCATGCTGTCCTACGGCAACGTGCTGGACCTGAACCACCTGGACATCGACGAGCCCACCGGCCAGACCGCCGACTGGCTGAGCATCATCGTGTACCTGACCAGCTTCGTGGTGCCCATCCTGCTGAAGGCCCTGTACATGCTGACCACCAGAGGCAGACAGACCACCAAGGACAACAAGGGCACCAGAATCAGATTTAAGGACGACAGCAGCTTCGAGGACGTGAACGGCATCAGAAAGCCTAAGCACCTGTACGTGAGCCTGCCCAACGCCCAGAGCAGCATGAAGGCCGAGGAGATCACCCCCGGCAGATACAGGACCGCCGTGTGCGGCCTGTACCCCGCCCAGATCAAGGCCAGACAGATGATCAGCCCCGTGATGAGCGTGATCGGCTTCCTGGCCCTGGCCAAGGACTGGAGCGACAGAATCGAGCAGTGGCTGATCGAGCCCTGCAAGCTGCTGCCCGATACCGCCGCCGTGAGCCTGCTGGGCGGCCCCGCCACCAACAGGGACTATCTGAGACAGAGGCAGGTGGCCCTGGGCAACATGGAGACCAAGGAGAGCAAGGCCATCAGACAGCACGCCGAGGCCGCCGGCTGCAGCATGATCGAGGACATCGAGAGCCCCAGCAGCATCTGGGTGTTCGCCGGCGCCCCTGACAGATGCCCCCCTACCTGCCTGTTCATCGCCGGCATCGCCGAGCTGGGCGCCTTCTTCAGCATCCTGCAGGACATGAGAAACACCATCATGGCCAGCAAGACCGTGGGCACCAGCGAGGAGAAGCTGAGAAAGAAGTCCAGCTTCTACCAGAGCTACCTGAGGAGAACCCAGAGCATGGGCATCCAGCTGGGCCAGAGAATCATCGTGCTGTTTATGGTGGCCTGGGGCAAGGAGGCCGTGGACAACTTTCACCTGGGCGACGACATGGACCCCGAGCTGAGAACCCTGGCCCAGTCCCTGATCGACGTGAAGGTGAAGGAGATCAGCAACCAGGAGCCCCTGAAGCTGTAATAACAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACACCCTGGTACTGCATGCACGCAATGCTAGCTGCCCCTTTCCCGTCCTGGGTACCCCGAGTCTCCCCCGACCTCGGGTCCCAGGTATGCTCCCACCTCCACCTGCCCCACTCACCACCTCTGCTAGTTCCAGACACCTCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGATATCAAAACCCGGG| SEQ ID NO: 13 | HTNV T4 GnGc |CATAATACGACTCACTATAGGGAATTCTAGAGAAAATTTCGTCTGGATTAGTTACTTATCGTGTAAAATCTGATAAATGGAATTGGTTCTACATAAATGCCTAACGACTATCCCTTTGGGGAGTAGGGTCAAGTGACTCGAAACGATAGACAACTTGCTTTAACAAGTTGGAGATATAGTCTGCTCTGCATGGTGACATGCAGCTGGATATAATTCCGGGGTAAGATTAACGACCTTATCTGAACATAACGCTACCGTTTAATATTGCGTCATATAAAAAAAAAAAACCAAAAAAAAAAAACAAAAAAAAAAAATAATTGACTAATTAAAACAGCGGATGGGTACCCCACCATCCGACCCACTGGGTGTAGTACTCTGGTACTTCGTACCTTTGTACGCCTGTTCTTCCCATTGTACCCTTCCTGAACTTCCAACCCAAGTAACGTTAGAAGCTCAACATTTAGTACAACAGGAAGCACCACATCCAGTGGTGTTTAGTACAAGCACTTCTGTTTCCCCGGAGCGAGGTATAGGCTGTACCCACTGCCAAAAACCTTTAACCGTTATCCGCCAACCAACTACGTAAAAGCTAGTAGTATTATGTTTTTAACTAGGCGTTCGATCAGGTGGATTTCCCCTCCACTAGTTTGGTCGATGAGGCTAGGAATTCCCCACGGGTGACCGTGTCCTAGCCTGCGTGGCGGCCAACCCGGACTCACTATTTGTTTTCGCGCCCAGTTGCAAAAAGTGTCGCCGGGACGCCTTTTTATAGACATGGTGTGAAGACTCGCATGTGCTTGGTTGTGATTCCTCCGGCCCCTGAATGCGGCTAACCTTAACCCTGGAGCCTTGTGTCACAAACCAGTGATGATAAGGTCGTAATGAGCAATTCCGGGACGGGACCGACTACTTTGGGTGTCCGTGTTTCTTATTTTTCTTATTATTGTCTTATGGTCACAGCATATATATAACATATACTGTGATCATGGGCATCTGGAAGTGGCTCGTGATGGCCTCCCTGGTGTGGCCCGTGCTGACCCTGCGGAACGTGTACGATATGAAGATCGAGTGCCCTCACACCGTGAGCTTCGGCGAGAATAGCGTGATCGGCTACGTGGAGCTGCCTCCCGTGCCCCTGGCCGACACCGCCCAGATGGTGCCCGAGAGCAGCTGCAACATGGACAACCACCAGAGCCTGAACACCATCACCAAGTATACCCAGGTGAGCTGGCGGGGCAAGGCCGACCAGTCTCAGAGCTCCCAGAACAGCTTCGAAACCGTGTCCACCGAGGTGGATCTGAAGGGGACCTGCGTGCTGAAGCACAAGATGGTGGAGGAGAGCTACAGGTCCCGCAAGAGCGTGACCTGCTATGACCTGTCCTGCAACAGCACCTACTGCAAGCCCACCCTGTACATGATCGTGCCCATCCACGCCTGCAACATGATGAAGTCCTGCCTGATCGCTCTGGGCCCCTACCGGGTGCAGGTGGTGTACGAGCGGTCCTACTGCATGACCGGGGTGCTGATCGAGGGCAAGTGTTTCGTGCCTGACCAGAGCGTGGTGTCCATCATCAAGCACGGAATCTTCGACATCGCCTCCGTGCACATTGTGTGCTTCTTCGTGGCCGTGAAGGGCAACACCTACAAGATCTTCGAGCAGGTGAAGAAGTCCTTTGAGTCCACCTGCAACGACACAGAGAACAAGGTGCAGGGCTACTACATCTGCATCGTGGGCGGGAACTCTGCCCCCATCTACGTGCCCACCCTGGACGACTTCCGGAGCATGGAGGCCTTCACTGGCATTTTTCGCTCCCCCCACGGCGAGGACCACGACCTGGCCGGGGAGGAGATCGCCAGCTACAGCATCGTGGGCCCCGCCAACGCCAAGGTGCCCCACTCCGCCAGCAGCGACACCCTGAGCCTGATCGCCTACAGCGGGATCCCCTCCTACAGCTCCCTGTCCATCCTGACATCCTCCACCGAGGCCAAACACGTCTTCTCCCCCGGCCTGTTCCCAAAGCTGAACCACACCAACTGCGACAAGTCCGCCATCCCCCTGATCTGGACCGGCATGATTGACCTGCCCGGCTATTACGAGGCCGTGCACCCCTGTACTGTCTTCTGCGTGCTGTCCGGCCCCGGCGCCAGCTGCGAGGCCTTCAGCGAGGGCGGCATCTTCAACATCACCAGTCCCATGTGCCTGGTGAGCAAGCAGAACCGGTTCCGGCTGACCGAGCAGCAGGTGAACTTCGTGTGCCAGAGGGTGGACATGGACATCGTGGTGTACTGCAACGGCCAGCGCAAGGTGATCCTGACCAAGACCCTGGTGATCGGGCAGTGCATCTACACCATCACCAGCCTGTTCAGCCTGCTGCCCGGCGTCGCCCACAGCATCGCCGTGGAGCTGTGCGTGCCCGGCTTCCACGGCTGGGCCACCGCCGCCCTGCTGGTGACTTTCTGCTTCGGCTGGGTGCTCATCCCCGCCATCACCTTCATCATCCTGACCGTGCTGAAGTTCATCGCCAACATCTTCCACACCAGCAACCAGGAGAACCGGCTGAAGTCCGTGCTGCGGAAGATCAAGGAGGAGTTCGAGAAGACCAAGGGCTCTATGGTGTGCGACGTGTGCAAGTACGAGTGCGAGACCTACAAGGAGCTGAAAGCCCACGGCGTGTCCTGCCCTCAGTCTCAGTGCCCTTACTGCTTCACCCACTGCGAGCCCACCGAGGCCGCCTTCCAGGCCCACTACAAAGTGTGCCAGGTGACCCACCGGTTCCGGGACGACCTGAAGAAGACCGTGACCCCCCAGAATTTCACCCCTGGCTGCTACCGCACCCTGAATCTGTTCCGCTACAAGTCCCGGTGCTATATCTTCACCATGTGGATCTTCCTGCTGGTGCTGGAGAGCATCCTGTGGGCCGCCAGCGCCTCCGAGACCCCCCTGACCCCTGTGTGGAACGACAACGCCCACGGCGTGGGCAGCGTGCCCATGCACACCGACCTGGAGCTGGACTTCTCCCTGACCTCCTCCTCTAAGTACACCTACCGCCGCAAGCTGACCAACCCCCTGGAGGAGGCCCAGAGCATCGACCTGCACATCGAGATCGAGGAGCAGACCATCGGGGTGGACGTGCACGCTTTGGGCCACTGGTTCGATGGCCGGCTGAACCTGAAGACCAGCTTCCACTGCTACGGCGCCTGCACCAAGTACGAGTACCCCTGGCACACCGCCAAGTGCCACTACGAGCGCGACTACCAGTACGAGACCAGCTGGGGGTGCAACCCCTCCGACTGCCCCGGCGTGGGCACCGGATGCACCGCCTGCGGCCTGTATCTGGACCAGCTGAAGCCCGTGGGCAGCGCCTACAAGATCATCACCATCCGGTACTCCCGGCGGGTGTGTGTGCAGTTTGGGGAGGAAAATCTGTGCAAGATTATCGACATGAACGACTGCTTCGTGTCCCGGCACGTGAAGGTGTGCATCATCGGCACCGTGAGCAAGTTCAGCCAGGGCGACACCCTGCTGTTCTTCGGCCCCCTGGAGGGGGGCGGGCTGATCTTCAAGCACTGGTGCACCAGCACCTGCCAGTTCGGCGACCCCGGCGACATCATGTCCCCCCGCGACAAGGGCTTCCTGTGCCCCGAGTTCCCCGGTAGTTTCCGGAAGAAGTGCAACTTCGCCACCACCCCCATCTGCGAGTACGACGGGAACATGGTGTCCGGCTACAAGAAGGTGATGGCCACCATCGACTCCTTCCAGAGCTTCAACACCTCCACCATGCATTTCACCGACGAGCGAATCGAGTGGAAGGACCCCGACGGCATGCTGCGGGATCACATCAACATCCTGGTGACAAAGGACATAGACTTCGACAACCTCGGGGAGAACCCTTGCAAGATCGGGCTGCAGACCAGCTCCATCGAGGGCGCCTGGGGCAGCGGCGTGGGCTTCACCCTGACCTGTCTGGTGAGCCTGACAGAGTGCCCCACCTTCCTCACCAGCATCAAGGCCTGCGACAAGGCCATCTGCTACGGCGCCGAGTCCGTGACCCTGACCCGCGGACAGAACACCGTGAAGGTAAGCGGGAAGGGGGGCCACAGCGGCAGCACCTTCCGGTGCTGCCACGGGGAGGACTGCAGCCAGATCGGGCTGCACGCCGCCGCCCCCCACCTGGACAAGGTGAACGGCATCTCCGAGATCGAAAACTCTAAGGTGTACGACGACGGCGCCCCCCAGTGCGGCATCAAGTGCTGGTTCGTGAAGTCCGGGGAGTGGATCTCTGGCATCTTCAGCGGGAACTGGATCGTGCTGATCGTGCTGTGCGTGTTCCTGCTGTTCTCCCTGGTGCTGCTGAGCATCCTGTGCCCGGTGCGCAAGCACAAGAAGTCCTAATAAGCTGGAGCCTCGGTGGCCATGCTTCTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAAAGTCTGACTCAGTAGATGTTTTCTTGGGTTAATTGAGGCCTGAGTATAAGGTGACTTATACTTGTAATCTATCTAAACGGGGAACCTCTCTAGTAGACAATCCCGTGCTAAATTGTAGGACTGCCCTTTAATAAATACTTCTATATTTAAAGAGGTATTTATGAAAAGCGGAATTTATCAGATTAAAAATACTTTCTCTAGAGTCGACCTGCAGATAACAGCATATCTAGGATATCAAAAGCG GCCGC| SEQ ID NO: 14 | HTNV T4 Np |CATAATACGACTCACTATAGGGAATTCTAGAGAAAATTTCGTCTGGATTAGTTACTTATCGTGTAAAATCTGATAAATGGAATTGGTTCTACATAAATGCCTAACGACTATCCCTTTGGGGAGTAGGGTCAAGTGACTCGAAACGATAGACAACTTGCTTTAACAAGTTGGAGATATAGTCTGCTCTGCATGGTGACATGCAGCTGGATATAATTCCGGGGTAAGATTAACGACCTTATCTGAACATAACGCTACCGTTTAATATTGCGTCATATAAAAAAAAAAAACCAAAAAAAAAAAACAAAAAAAAAAAATAATTGACTAATTAAAACAGCGGATGGGTACCCCACCATCCGACCCACTGGGTGTAGTACTCTGGTACTTCGTACCTTTGTACGCCTGTTCTTCCCATTGTACCCTTCCTGAACTTCCAACCCAAGTAACGTTAGAAGCTCAACATTTAGTACAACAGGAAGCACCACATCCAGTGGTGTTTAGTACAAGCACTTCTGTTTCCCCGGAGCGAGGTATAGGCTGTACCCACTGCCAAAAACCTTTAACCGTTATCCGCCAACCAACTACGTAAAAGCTAGTAGTATTATGTTTTTAACTAGGCGTTCGATCAGGTGGATTTCCCCTCCACTAGTTTGGTCGATGAGGCTAGGAATTCCCCACGGGTGACCGTGTCCTAGCCTGCGTGGCGGCCAACCCGGACTCACTATTTGTTTTCGCGCCCAGTTGCAAAAAGTGTCGCCGGGACGCCTTTTTATAGACATGGTGTGAAGACTCGCATGTGCTTGGTTGTGATTCCTCCGGCCCCTGAATGCGGCTAACCTTAACCCTGGAGCCTTGTGTCACAAACCAGTGATGATAAGGTCGTAATGAGCAATTCCGGGACGGGACCGACTACTTTGGGTGTCCGTGTTTCTTATTTTTCTTATTATTGTCTTATGGTCACAGCATATATATAACATATACTGTGATCATGGCCACCATGGAGGAGCTGCAGAGAGAGATCAACGCCCACGAGGGCCAGCTGGTGATCGCCAGACAGAAGGTGAGAGACGCCGAGAAGCAGTACGAGAAGGACCCCGACGAG CTGAACAAGAGAACCCTGACCGACAGAGAGGGCGTGGCCGTGAGCATCCAGGCCAAGATCGACGAGCTGAA GAGACAGCTGGCCGACAGAATCGCCACCGGCAAGAACCTGGGCAAGGAGCAGGACCCTACCGGCGTGGAGC CCGGCGACCACCTGAAGGAGAGAAGCATGCTGTCCTACGGCAACGTGCTGGACCTGAACCACCTGGACATCG ACGAGCCCACCGGCCAGACCGCCGACTGGCTGAGCATCATCGTGTACCTGACCAGCTTCGTGGTGCCCATCCT GCTGAAGGCCCTGTACATGCTGACCACCAGAGGCAGACAGACCACCAAGGACAACAAGGGCACCAGAATCA GATTTAAGGACGACAGCAGCTTCGAGGACGTGAACGGCATCAGAAAGCCTAAGCACCTGTACGTGAGCCTGC CCAACGCCCAGAGCAGCATGAAGGCCGAGGAGATCACCCCCGGCAGATACAGGACCGCCGTGTGCGGCCTG TACCCCGCCCAGATCAAGGCCAGACAGATGATCAGCCCCGTGATGAGCGTGATCGGCTTCCTGGCCCTGGCCA AGGACTGGAGCGACAGAATCGAGCAGTGGCTGATCGAGCCCTGCAAGCTGCTGCCCGATACCGCCGCCGTGA GCCTGCTGGGCGGCCCCGCCACCAACAGGGACTATCTGAGACAGAGGCAGGTGGCCCTGGGCAACATGGAG ACCAAGGAGAGCAAGGCCATCAGACAGCACGCCGAGGCCGCCGGCTGCAGCATGATCGAGGACATCGAGAG CCCCAGCAGCATCTGGGTGTTCGCCGGCGCCCCTGACAGATGCCCCCCTACCTGCCTGTTCATCGCCGGCATC GCCGAGCTGGGCGCCTTCTTCAGCATCCTGCAGGACATGAGAAACACCATCATGGCCAGCAAGACCGTGGGC ACCAGCGAGGAGAAGCTGAGAAAGAAGTCCAGCTTCTACCAGAGCTACCTGAGGAGAACCCAGAGCATGGG CATCCAGCTGGGCCAGAGAATCATCGTGCTGTTTATGGTGGCCTGGGGCAAGGAGGCCGTGGACAACTTTCA CCTGGGCGACGACATGGACCCCGAGCTGAGAACCCTGGCCCAGTCCCTGATCGACGTGAAGGTGAAGGAGA TCAGCAACCAGGAGCCCCTGAAGCTGTAATAAGCTGGAGCCTCGGTGGCCATGCTTCTTGCCCCTTGGGCCTC CCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAAAGTCTGACTCAGTAGATGTTTT CTTGGGTTAATTGAGGCCTGAGTATAAGGTGACTTATACTTGTAATCTATCTAAACGGGGAACCTCTCTAGTAG ACAATCCCGTGCTAAATTGTAGGACTGCCCTTTAATAAATACTTCTATATTTAAAGAGGTATTTATGAAAAGCG GAATTTATCAGATTAAAAATACTTTCTCTAGAGTCGACCTGCAGATAACAGCATATCTAGGATATCAAAAGCG GCCGC

Claims

1. What is Claimed is:1 . A circular RNA molecule comprising any of SEQ ID NO: 1 - 8.

2. The circular RNA molecule of claim 1 comprising an internal ribosome entry site (IRES) sequence operably linked to a protein-coding sequence; wherein the IRES sequence is a viral sequence; and wherein the protein-coding sequence encodes a viral protein.

3. The circular RNA molecule of claim 2, wherein the IRES is a Type 1 IRES.

4. The circular RNA molecule of claim 2, wherein the IRES is an enterovirus IRES.

5. The circular RNA molecule of claim 2, wherein the IRES is a human rhinovirus (HRV) IRES.

6. The circular RNA molecule of claim 2, wherein the viral protein comprises prME and NS5.

7. The circular RNA molecule of claim 2, wherein the viral protein comprises prME, NS5 and NS1.

8. A method of inducing Yellow Fever Virus (YFV) neutralizing antibody titers in a subject, the method comprising administering to the subject a vaccine composition comprising a circular mRNA of any one of claims 1 - 7.

9. The method of claim 8, wherein the mRNA is administered in a lipid nanoparticle (LNP).

10. The method of claim 9, wherein the lipid nanoparticle comprises 45 - 55 mole percent (mol %) ionizable cationic lipid, 5 - 15 mol % non-cationic lipid, 35 - 40 mol % sterol and 1 - 2 mol % PEG-modified lipid.11 . A method of inducing in Yellow Fever Virus (YFV) neutralizing antibody titers in a subject, the method comprising administering to the subject a vaccine composition comprising an mRNA comprising a nucleic acid sequence having at least 95% identity to the nucleic acid sequence of SEQ ID NO: 1 - 8.

12. The method of claim 11 , wherein the mRNA is administered in a lipid nanoparticle (LNP).

13. The method of claim 12, wherein the lipid nanoparticle comprises 45 - 55 mole percent (mol %) ionizable cationic lipid, 5 - 15 mol % non-cationic lipid, 35 - 40 mol % sterol and 1 - 2 mol % PEG-modified lipid.

14. The method of claim 11 , wherein the vaccine composition comprises a 25 pg to 150 pg dose of mRNA.

15. The method of claim 11 , wherein the vaccine composition comprises a 150 pg dose of mRNA.

16. The method of claim 11 , wherein the vaccine composition comprises a 25 pg to 75 pg dose of mRNA.

17. The method of claim 11 , wherein the vaccine composition comprises a 75 pg dose of mRNA.

18. The method of claim 11 , wherein the vaccine composition comprises a 25 pg dose of mRNA.

19. A formulation comprising a circular RNA molecule of any of SEQ ID NO: 1 - 8.

20. A circular RNA molecule comprising any of SEQ ID NO: 9 - 14.21 . The circular RNA molecule of claim 20 comprising an internal ribosome entry site (IRES) sequence operably linked to a protein-coding sequence; wherein the IRES sequence is a viral sequence; and wherein the protein-coding sequence encodes a viral protein.

22. The circular RNA molecule of claim 20, wherein the IRES is a Type 1 IRES.

23. The circular RNA molecule of claim 20, wherein the IRES is an enterovirus IRES.

24. The circular RNA molecule of claim 20, wherein the IRES is a human rhinovirus (HRV) IRES.

25. The circular RNA molecule of claim 20, wherein the viral protein is HNTV glycoprotein or HNTV nucleoprotein.

26. A method of inducing in a Hantaan Orthohantavirus (HTNV) neutralizing antibody titers in a subject, the method comprising administering to the subject a vaccine composition comprising a circular mRNA of any one of claims 20 - 25.

27. The method of claim 26, wherein the mRNA is administered in a lipid nanoparticle (LNP).

28. The method of claim 27, wherein the lipid nanoparticle comprises 45 - 55 mole percent (mol %) ionizable cationic lipid, 5 - 15 mol % non-cationic lipid, 35 - 40 mol % sterol and 1 - 2 mol % PEG-modified lipid.

29. A method of inducing Hantaan Orthohantavirus (HTNV) neutralizing antibody titers in a subject, the method comprising administering to the subject a vaccine composition comprising an mRNA comprising a nucleic acid sequence having at least 95% identity to the nucleic acid sequence of SEQ ID NO: 9 - 14.

30. The method of claim 29, wherein the mRNA is administered in a lipid nanoparticle (LNP).31 . The method of claim 30, wherein the lipid nanoparticle comprises 45 - 55 mole percent (mol %) ionizable cationic lipid, 5 - 15 mol % non-cationic lipid, 35 - 40 mol % sterol and 1 - 2 mol % PEG-modified lipid.

32. The method of claim 29, wherein the vaccine composition comprises a 25 pg to 150 pg dose of mRNA.

33. The method of claim 29, wherein the vaccine composition comprises a 150 pg dose of mRNA.

34. The method of claim 29, wherein the vaccine composition comprises a 25 pg to 75 pg dose of mRNA.

35. The method of claim 29, wherein the vaccine composition comprises a 75 pg dose of mRNA.

36. The method of claim 29, wherein the vaccine composition comprises a 25 pg dose of mRNA.

37. A formulation comprising a circular RNA molecule of any of SEQ ID NO: 9 - 14.

Images