Modulators of FXII-upar

Abstract

The present disclosure describes cyclic peptide modulators of Factor XII(FXII) -uPAR signalling. Also described are pharmaceutical compositions comprising the cyclic peptides and their use in treating conditions, diseases and / or disorders responsive to FXII-uPAR modulation, including carcinoma, ovarian cancer, venous thromboembolisms and wound healing.

Description

[0001] Modulators of FXII-uPAR

[0002] Cross Reference to the related application

[0003] This application claims the benefit of US provisional application no. 63 / 668003, the entire contents of which are incorporated herein by reference.

[0004] Field of the invention

[0005] The invention relates to modulators of the Factor XI l-Urokinase plasminogen activator receptor (FXII-uPAR) signalling axis and pharmaceutical compositions comprising modulators of FXII-uPAR signalling. The invention further relates to methods of treatment of diseases moderated by FXII-uPAR.

[0006] Sequence listing

[0007] A sequence listing in ST. 26 format is filed herewith, the entire contents of which are incorporated herein by reference.

[0008] Background of the invention

[0009] Chronic, non-healing diabetic wounds represent a major health care burden and are associated with high morbidity and mortality. As of 2017, the cost to the Australian healthcare system was estimated to be a staggering 3.2 billion dollars annually and is predicted to rise significantly with an ageing population and a growing obesity crisis in the developed world.

[0010] The current standard of care for the treatment of recalcitrant wounds involves the topical administration of growth factors, however, these treatments have limited clinical efficacy. Moreover, these approaches only influence wound healing endpoints (e.g., proliferation and remodelling) but do not prevent upstream events such as excessive neutrophil activation, Neutrophil extracellular trap (NET) formation and cytokine expression, all of which are persistent hallmarks of non-healing wounds. The sum of these activities leads to delayed wound healing in vivo.

[0011] New treatments for wounds, and in particular chronic diabetic wounds are needed. Diabetics are at increased risk of developing venous thromboembolism (VTE).

[0012] The increased risk ranges from 40% in a large prospective cohort from the US to 50% in a meta-analysis of more than 63,000 patients. The VTE Treatment Market size exceeded USD 950 million in 2020 and is expected to expand at over 8.7% CAGR from 2021 to 2027. The risk of VTE appears to be elevated in both type 1 and type 2 diabetic patients.

[0013] New treatments to minimise or prevent venous thromboembolism are needed.

[0014] Ovarian cancer is the leading cause of death in woman. Effective strategies to treat ovarian cancer are lacking.

[0015] Epithelial ovarian cancer (EOC) is the leading cause of cancer related death in women. Effective strategies to treat this disease are lacking due to the complexity of pathways that contribute to EOC biology.

[0016] New treatments for ovarian cancer and related cancers are needed.

[0017] Reference to any prior art in the specification is not an acknowledgment or suggestion that this prior art forms part of the common general knowledge in any jurisdiction or that this prior art could reasonably be expected to be understood, regarded as relevant, and / or combined with other pieces of prior art by a skilled person in the art.

[0018] Summary of the invention

[0019] Surprisingly the inventions have discovered that the cyclic peptides as disclosed herein modulate the binding of FXII to uPAR which modulates signalling. Peptides of the invention may disrupt the binding of FXII to uPAR preventing signalling. Due to its novel mechanism of action the use of cyclic peptides of the invention to perturb the FXII-uPAR signalling axis may address a critical unmet need in the treatment of recalcitrant wounds and VTE in patients with diabetes and improve the outcomes in women who suffer from ovarian cancer.

[0020] In a first aspect there is provided a peptide having the structure selected from: or a functional variant, or functional fragment thereof.

[0021] In embodiments, the peptide is selected from SEQ ID no 1 and SEQ ID no 2, or a functional variant or functional fragment thereof.

[0022] In embodiments, the peptide is SEQ ID no 1 , or a functional variant or functional fragment thereof.

[0023] In embodiments, the peptide is SEQ ID no 2, or a functional variant or functional fragment thereof. In embodiments the peptide is selected from SEQ ID nos 1 to 2, and the functional variant or functional fragment has at least about 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID no 1 to 2. In embodiments the peptide is selected from SEQ ID no 1 or SEQ ID no 2.

[0024] In embodiments the peptide is a cyclic peptide or functional variant or functional fragment thereof, wherein the peptide is cyclised via a thioether bond.

[0025] In embodiments there is provided the cyclic peptide of functional variant or functional fragment thereof as herein described wherein the amino acid sequence has at least 2, at least 3, at least 4, or at least 5 amino acid substitutions. In some embodiments the peptide or functional variant or functional fragment at least 1 amino acid substitution compared to any one of SEQ ID nos 1 or 2. In some embodiments the peptide comprises any one of SEQ ID nos 1 or 2.

[0026] In a further aspect there is provided a pharmaceutical composition comprising the peptide, functional variant or functional fragment thereof as herein described and one or more pharmaceutically acceptable excipients.

[0027] In a further aspect there is provided a method of modulating FXI I- uPAR signalling, comprising contacting a cell, and / or the bloodstream and / or a blood vessel wall and / or sample with the peptide, functional variant, or functional fragment thereof or the pharmaceutical composition as herein described.

[0028] In another aspect there is provided a method of preventing or treating a condition or disorder responsive to modulating FXII-uPAR signalling and / or binding comprising administration to a subject in need thereof of the peptide, functional variant, or functional fragment thereof or the pharmaceutical composition as herein described. In embodiments the condition or disorder is cancer, preferably carcinoma, more preferably epithelial ovarian cancer, epithelial fallopian tube cancer or epithelial peritoneal cancer.

[0029] In embodiments the methods as described herein inhibit FXII-uPAR signalling.

[0030] In alternative embodiments the condition is a wound or a venous thromboembolism (VTE). In embodiments the subject is a diabetic or non-diabetic.

[0031] In a further aspect there is a provided a method of promoting wound healing in a subject in need thereof, the method comprising administration of the peptide, functional variant or functional fragment thereof or the pharmaceutical composition as herein described.

[0032] In a further aspect, there is provided use of the peptide, functional variant or functional fragment thereof, or pharmaceutical composition as described herein, in the manufacture of a medicament for: treatment of a condition or disease responsive to the modulation of FXII-uPAR signalling; and / or treatment of cancer, venous thromboembolism or a wound; and / or promoting wound healing.

[0033] In a further aspect there is provided use of the peptide, functional variant or functional fragment thereof, or pharmaceutical composition as described herein, for: treatment of a condition or disease responsive to the modulation of FXII-uPAR signalling; and / or treatment of cancer, venous thromboembolism or a wound; and / or promoting wound healing.

[0034] In a further aspect there is provided the peptide, functional variant or functional fragment thereof, or pharmaceutical composition as described herein for use as a modulator of FXII-uPAR signalling; as a medicament; in the treatment of a disease responsive to the inhibition of FXII-uPAR signalling; in the treatment of cancer, venous thromboembolism or a wound.

[0035] In embodiments the peptide, functional variant or functional fragment thereof, or pharmaceutical composition as described herein for use is to be administered to a subject who is diabetic or non diabetic. In a further aspect there is provided the peptide, functional variant or functional fragment thereof, or pharmaceutical composition as described herein when used as a modulator of FXII-uPAR signalling; as a medicament; in the treatment of a disease responsive to the modulation of FXII-uPAR signalling; in the treatment of cancer, venous thromboembolism or a wound.

[0036] In embodiments the condition or disease responsive to the modulation of FXII- uPAR signalling is chronic kidney disease, ischaemic stroke, sickle cell disease, inflammatory skin diseases including but not limited to atopic dermatitis and psoriasis; inflammatory lung diseases such as ARDS, fibrosis; bacterial and viral infections; sepsis; disseminated intravascular coagulation; pulmonary intravascular coagulation; neutropenia.

[0037] In embodiments the medicament, peptide for use, or peptide when used is for the treatment of a disease or condition responsive to the inhibition of FXII-uPAR signalling.

[0038] In embodiments the peptide, functional variant or functional fragment thereof, or pharmaceutical composition as described herein when used is to be administered to a subject who is diabetic.

[0039] As used herein, except where the context requires otherwise, the term "comprise" and variations of the term, such as "comprising", "comprises" and "comprised", are not intended to exclude further additives, components, integers or steps.

[0040] Further aspects of the present invention and further embodiments of the aspects described in the preceding paragraphs will become apparent from the following description, given by way of example and with reference to the accompanying drawings. Brief description of the drawings

[0041] Figure 1 shows a graph of the inhibition of Neutrophil Chemotaxis following dosing 10pM of D04 in FXII activated neutrophils using Boyden chamber assay. In the figure UT= Untreated. fMLP = N-formylmethionine-leucyl-phenylalanine (potent neutrophil activator).

[0042] Figure 2 shows a graph of the inhibition of reactive oxygen species in FXII activated neutrophils following a 10pM dose of D04. In the figure UT= Untreated. fMLP = N-formylmethionine-leucyl-phenylalanine (potent neutrophil activator) and DPI (positive control) = diphenyleneiodonium, N0X2 inhibitor.

[0043] Figure 3 shows a graph of the results of the ex vivo wound healing assay using murine skin epithelial cells (MSECs) and the impact of D04 on Keratinocyte Migration in the Presence of Neutrophils.

[0044] Figure 4A and 4B are micrographs with a scale of 100 pm of Hematoxylin and eosin-stained section from Day 2 SD wounds in Wild Type Diabetic tissue.

[0045] Figure 5 shows the results of a microfluidic assay for measurement of real-time thrombus formation for whole blood and for whole blood dosed with D04 (green line, lower line in both graphs). Figure 5A shows a graph of the assay results when nondiabetic human whole blood was perfused over collagen-coated microchannels at a steady venous shear rate; and Figure 5B shows the results of the assay when Diabetic human blood is used.

[0046] Figure 6 shows a western blot showing the inhibition of markers of Epithelial to mesenchymal transition (EMT) in Ovarian cancer, Figure 6A shows inhibition in E- cadherin and [3-actin and Figure 6B shows the inhibition in Vimentin and [3-actin.

[0047] Figure 7 shows the proposed mechanism of enhanced wound healing by D04.

[0048] Figure 8 shows the inhibition of phosphorylation of Akt in SKOV3 Cells in the presence of FXII and FXII / Neutrophils.

[0049] Figure 9 shows the inhibition of EMTin Ovarian Cancer Cells

[0050] Figure 10 shows a graph showing the inhibition of EMT in Ovarian Cancer Cells. Detailed description of the embodiments

[0051] The inventors of the present disclosure have surprisingly discovered that peptides having the structures as herein defined are able to bind human FXI I, in particular, the inventors have found that the cyclic peptide D04 is able to modulate FXI I- uPAR signalling.

[0052] Peptides of the invention

[0053] Throughout the specification peptide 56 may be alternatively referred to as D04 or SEQ ID no 1 . Peptide 55 may be alternatively referred to as D03, or SEQ ID no 2. A peptide of the invention may be isolated, purified, substantially purified, enriched, synthetic or recombinant.

[0054] The present invention also provides a peptide comprising an amino acid sequence having at least 70% sequence identity to any one of SEQ ID NOs:1 or 2, or a biologically active fragment or variant thereof, or a pharmaceutically acceptable salt thereof.

[0055] In some embodiments, the amino acid sequence has at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NO:1 or 2. For example, the amino acid sequence may have at least 70%, at least 71 %, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81 %, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, at least 90% sequence identity to any one of SEQ ID NO:1 or 2.

[0056] In some embodiments, the amino acid sequence of the peptide is any one of SEQ ID NO:1 or 2, that is, the amino acid sequence has 100% sequence identity to any one of SEQ ID NO:1 or 2.

[0057] The present invention also provides a peptide comprising an amino acid sequence having at least 1 amino acid substitution compared to any one of SEQ ID NO 1 or 2, more or a pharmaceutically acceptable salt thereof.

[0058] In some embodiments, the amino acid sequence has at least 1 , at least 2, at least 3, at least 4, at least 5 or at least 6 amino acid substitutions compared to any one of SEQ ID Nos 1 or 2. For example, the amino acid sequence may have 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid substitutions compared to any one of SEQ ID NO: 1 or 2.

[0059] As used herein, the term “biologically active fragment” or “functional fragment” refers to a portion of the peptide of the invention that retains substantially similar functional activity and / or substantially the same biological function or activity as the polypeptide, for example as shown in assays disclosed herein. As used herein, the term “biologically active variant" or “functional variant’ is intended to encompass peptides having an amino acid sequence sufficiently similar to a peptide of the invention. The term “sufficiently similar” means a first amino acid sequence that contains a sufficient or minimum number of identical or equivalent amino acid residues relative to a second amino acid sequence such that the first and second amino acid sequences have a common structural domain and / or common functional activity. Preferably, variants will be sufficiently similar to the amino acid sequence of the preferred peptides of the invention. Variants include polypeptides that differ in amino acid sequence due to mutagenesis.

[0060] As used herein, the terms “substantially similar functional activity’’ and “substantially the same biological function or activity” each mean that the degree of biological activity is within about 50% to 100% or more, within 80% to 100% or more, or within about 90% to 100% or more, of that biological activity demonstrated by the peptide to which it is being compared when the biological activity of each peptide is determined by the same procedure or assay.

[0061] Definitions

[0062] It will be understood that the invention disclosed and defined in this specification extends to all alternative combinations of two or more of the individual features mentioned or evident from the text or drawings. All of these different combinations constitute various alternative aspects of the invention.

[0063] One skilled in the art will recognize many methods and materials similar or equivalent to those described herein, which could be used in the practice of the present invention. The present invention is in no way limited to the methods and materials described. It will be understood that the invention disclosed and defined in this specification extends to all alternative combinations of two or more of the individual features mentioned or evident from the text or drawings. All of these different combinations constitute various alternative aspects of the invention.

[0064] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, preferred methods and materials are described. For the purposes of the present invention, the following terms are defined below.

[0065] The articles “a” and “an” are used herein to refer to one or to more than one (i.e. to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element.

[0066] As used herein, the term “and / or”, e.g., “X and / or Y” will be understood to mean either “X and Y” or “X or Y” and shall be taken to provide explicit support for both meanings or for either meaning.

[0067] As used herein, the term “about’ refers to a quantity, value, dimension, size, or amount that varies by as much as 30%, 25%, 20%, 15% or 10% to a reference quantity, value, dimension, size, or amount.

[0068] As used herein, unless the context requires otherwise, the term “comprise", and variations such as “comprises" and “comprising", will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.

[0069] As used herein, the term “amino acid” refers to a compound having an amino group and a carboxylic acid group. The amino acid may be a L- or D- isomer or mixtures thereof. The amino acid may have a naturally occurring side chain (see Table 1 ) or a non-proteinogenic side chain. The amino acid may also be further substituted in the a- position with a group selected from -Ci-ealkyl, -(CH2)nCORa, -(CH2)nRb and -POsH, where n is an integer selected from 1 to 8, Rais -OH, -NH2, -NHC-i-salkyl, -OC-i-salkyl or - Ci-3alkyl and Rbis -OH, -SH, -SCi-3alkyl, -OCi-3alkyl, -NH2, -NHCi-3alkyl or -NHC(C=NH)NH2 and where each alkyl group may be substituted with one or more groups selected from -OH, -NH2, -NHCi-salkyl, -OCi salkyl, -SH, -SCi salkyl, -CO2H, - CO2Ci-3alkyl, -CONH2 and -CONHCi-3alkyl.

[0070] Amino acid structure and single and three letter abbreviations used throughout the specification are defined in Table 1 , which lists the twenty proteinogenic naturally occurring amino acids which occur in proteins as L-isomers, with the exception of glycine (Gly, G) which is achiral. Table 1

[0071] As used herein, the term “non-proteinogenic amino acid” refers to an amino acid having a side chain that does not occur in the naturally occurring L-a-amino acids recited in Table 1 . Examples of non-proteinogenic amino acids and derivatives include, but are not limited to, norleucine, 4-aminobutyric acid, 4-amino-3-hydroxy-5- phenylpentanoic acid, 6-aminohexanoic acid, f-butylglycine, norvaline, phenylglycine, cyclohexylalanine, pyridylalanines, ornithine, citrulline, sarcosine, 4-amino-3-hydroxy-6- methylheptanoic acid, 2-thienyl alanine, substituted variants of the aromatic amino acids tyrosine, phenylalanine and tryptophan, and / or D-isomers of natural amino acids

[0072] D-isomers of the proteinogenic naturally occurring amino acids may be denoted herein using the corresponding lower case letter of the single letter code included in Table 1 above. For example, in amino acid sequences included herein ‘a’ denotes D- alanine, and ‘y’ denotes D-tyrosine, and so on.

[0073] As used herein, the term “a-amino acid” refers to an amino acid that has a single carbon atom (the a-carbon atom) separating a carboxyl terminus (C-terminus) and an amino terminus (N-terminus). An a-amino acid includes naturally occurring and non- naturally occurring L-amino acids and their D-isomers and derivatives thereof such as salts or derivatives where functional groups are protected by suitable protecting groups.

[0074] Similarly, the term “fi-amino acid” refers to an amino acid that has a two carbon chain separating a carboxyl terminus (C-terminus) and an amino terminus (N-terminus). Either or both of the carbons between the C- and N-termini may by substituted with any amino acid side-chain described herein. In embodiments, one or more a-amino acids may be substituted by suitable [3-amino acid(s).

[0075] As used herein, the term “hydrophobic amino acid’ refers to an amino acid having a side chain which is non-polar. Examples include, but are not limited to, glycine, alanine, valine, leucine, isoleucine, proline, methionine, phenylalanine, tryptophan, aminoisobutyric acid, cyclohexylalanine, cyclopentylalanine, norleucine, norvaline, fe / t- butylglycine and ethylglycine, especially alanine, valine, leucine, isoleucine, proline, methionine, phenylalanine, tryptophan and aminoisobutyric acid.

[0076] As used herein, the term “hydrophilic amino acid’ refers to an amino acid having a side chain which is polar or charged. Examples include, but are not limited to, serine, threonine, cysteine, tyrosine, asparagine, glutamine, aspartic acid, glutamic acid, lysine, arginine, histidine and ornithine. As used herein, the term “polar uncharged amino acid” refers to an amino acid having a side chain that has a dipole moment. Examples include, but are not limited to, serine, threonine, cysteine, tyrosine, asparagine and glutamine.

[0077] As used herein, the term “positively charged amino acid’ refers to an amino acid having a side chain capable of bearing a positive charge. Examples include, but are not limited to, lysine, arginine, histidine and ornithine.

[0078] As used herein, the term “negatively charged amino acid’ refers to an amino acid having a side chain capable of bearing a negative charge. Examples include, but are not limited to, aspartic acid and glutamic acid.

[0079] Those skilled in the art will appreciate that a peptide represents a series of two or more amino acids linked through a covalent bond formed between the carboxyl group of one amino acid and the amino group of another amino acid (i.e. the so-called peptide bond).

[0080] In embodiments, one or more of the amide nitrogen atoms (eg those within the peptide backbone) of the peptides described herein may be substituted with an alkyl group (eg an optionally substituted Ci-ealkyl, preferably methyl).

[0081] As used herein, the term “alkyl” refers to a radical of a straight chain or branched saturated hydrocarbon group. Where appropriate, the alkyl group may have a specified number of carbon atoms, for example, Ci salkyl which includes alkyl groups having 1 , 2 or 3 carbon atoms in a linear or branched arrangement. Examples of suitable alkyl groups include methyl, ethyl, n-propyl and / -propyl. Alkyl groups described herein may be optionally substituted. Suitable alkyl substituents include one or more (eg 1 , 2, 3, 4, 5 or 6) of -OH, -SH, -NH2, -NHR, -NR2, halo (eg Cl, Br, F and I).

[0082] The “similarity between two peptides is determined by comparing the amino acid sequence of a first peptide to the sequence of a second peptide. An amino acid of one peptide is similar to the corresponding amino acid of a second peptide if it is identical or a conservative amino acid substitution. Conservative substitutions include those described in Dayhoff, M.O., ed., The Atlas of Protein Sequence and Structure 5, National Biomedical Research Foundation, Washington, D.C. (1978), and in Argos, P. (1989) EMBO J. 8:779-785. For example, amino acids belonging to one of the following groups represent conservative changes or substitutions:

[0083] Ala, Pro, Gly, Gin, Asn, Ser, Thr:

[0084] Cys, Ser, Tyr, Thr;

[0085] Vai, lie, Leu, Met, Ala, Phe;

[0086] Lys, Arg, His;

[0087] Phe, Tyr, Trp, His; and

[0088] Asp, Glu.

[0089] Other conservative amino acid substitutions may also be made by another one of the same class, the classes being as follows:

[0090] Non-polar: Ala, Vai, Leu, lie, Pro, Met Phe, Trp

[0091] Uncharged polar: Gly, Ser, Thr, Cys, Tyr, Asn, Gin

[0092] Acidic: Asp, Glu

[0093] Basic: Lys, Arg, His

[0094] Other conservative amino acid substitutions may also be made as follows:

[0095] Aromatic: Phe, Tyr, His

[0096] Proton Donor: Asn, Gin, Lys, Arg, His, Trp

[0097] Proton Acceptor: Glu, Asp, Thr, Ser, Tyr, Asn, Gin

[0098] Within the scope of the invention is any peptide of the invention as described herein that contains one or more conservative or non-conservative substitutions provided that the peptide retains the ability to bind to FXII in a way that modulates FXII- uPAR binding.

[0099] Modulation of FXII-uPAR signalling may be a down-regulation, ie a disruption or inhibition, or an up-regulation of FXII-uPAR signalling. In some embodiments of the invention the cyclic peptide, functional fragment or functional variant thereof inhibits FXII-uPAR signalling.

[0100] Determining whether a peptide of the invention that contains one or more conservative or non-conservative substitutions retains the ability to treat or prevent conditions or disorders responsive to inhibition of FXII-uPAR binding can be readily determined empirically, for example by any method described herein.

[0101] In embodiments, the peptides of the invention may be modified, for example to improve their pharmacokinetic profile, including modifications known in the art for increasing a peptide’s half-life following administration. Any suitable modification that does not substantially impact the peptide’s activity may be employed. Suitable modifications include conjugation with albumin binding peptides, polyethylene glycols (PEGs), and fatty acids, and / or incorporation into antibodies, Fes, etc.

[0102] The peptides of the present invention may be in the form of pharmaceutically acceptable salts. It will be appreciated however that non-pharmaceutically acceptable salts also fall within the scope of the invention since these may be useful as intermediates in the preparation of pharmaceutically acceptable salts or may be useful during storage or transport. The term “pharmaceutically-acceptable salts” refers to those salts which, within the scope of sound medical judgement, are suitable for use in contact with the tissues of humans and animals without undue toxicity, irritation, allergic response and the like, and are commensurate with a reasonable benefit / risk ratio. Suitable pharmaceutically acceptable salts include, but are not limited to, salts of pharmaceutically acceptable inorganic acids such as hydrochloric, sulfuric, phosphoric, nitric, carbonic, boric, sulfamic, and hydrobromic acids, or salts of pharmaceutically acceptable organic acids such as acetic, trifluoroacetic (TFA), propionic, butyric, tartaric, maleic, hydroxymaleic, fumaric, maleic, citric, lactic, mucic, gluconic, benzoic, succinic, oxalic, phenylacetic, methanesulphonic, toluenesulphonic, benezenesulphonic, salicylic sulphanilic, aspartic, glutamic, edetic, stearic, palmitic, oleic, lauric, pantothenic, tannic, ascorbic, and valeric acids.

[0103] Base salts include, but are not limited to, those formed with pharmaceutically acceptable cations, such as sodium, potassium, lithium, calcium, magnesium, ammonium and alkylammonium. Basic nitrogen-containing groups may be quarternised with such agents as lower alkyl halide, such as methyl, ethyl, propyl, and butyl chlorides, bromides and iodides; dialkyl sulfates like dimethyl and diethyl sulfate; and others.

[0104] A peptide of the invention may be isolated, purified, substantially purified, enriched, synthetic or recombinant. The term “isolated” in the context of the peptide of the invention means the peptide has been identified, separated and / or recovered from a component of its natural environment. As used herein, the term “substantially purified’ in the context of the peptide of the invention means the peptide is substantially free of contaminating agents, for example at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 65%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% free of contaminating agents. As used herein, the term “recombinant’ will be understood to mean the product of artificial genetic recombination. Accordingly, the term “recombinant peptide" in the context of the peptide of the invention is intended to encompass a peptide expressed by artificial recombinant means when it is in an expression system or cell, for example in which it is expressed.

[0105] The peptides of the present invention may be prepared by known chemical methods, including solid-phase and solution-phase peptide synthesis using Fmoc or Boc protected amino acid residues. As shown in Example 1 , the peptides of the invention may advantageously be synthesised by solid-phase peptide synthesis using suitable solid supports, protecting groups and coupling reagents, which allows for facile and rapid synthesis of the peptides.

[0106] The peptides of the present invention may also be prepared by known recombinant DNA technologies, including cell-based and cell-free technologies. In embodiments where the peptides are prepared by recombinant DNA technologies, the peptide may be prepared from a nucleic acid sequence encoding the peptide. Accordingly, the present invention also provides a nucleic acid comprising a nucleotide sequence encoding the peptide of the invention as described herein.

[0107] Cyclic peptides

[0108] Increased stability: Without wishing to be bound by theory the inventors propose that the cyclic peptides of the invention exhibit higher stability compared to peptide inventions of the prior art. Cyclic peptides are more resistant to proteolysis than their linear counterparts.

[0109] As molecules that straddle the void between large antibody biologies and small molecule inhibitors, macrocyclic peptides have emerged as promising chemotypes owing to their potent and selective inhibitory profiles. More specifically, macrocyclic peptides are uniquely adept at inhibiting protein-protein interactions between shallow or ill-defined surfaces that are otherwise difficult to disrupt with small molecule structures. Furthermore, macrocyclic peptides are typically more resistant to proteolysis than their linear counterparts, which may assist the cyclic peptides of this disclosure overcoming at least some past limitations for linear peptides.

[0110] Cyclic peptides are polypeptide chains which are formed by cyclisation of amino acids to form a core macrocycle. A polypeptide chain potentially comprises multiple reactive sites, for example head (or left hand terminus), tail (or right hand terminus) or reactive sites on the side chains of certain amino acids. Cyclisation may be through side-chain to side-chain cyclisation, head-to-tail cyclisation, tail-to-side chain cyclisation or head-to-side chain cyclisation.

[0111] The chemical bonds used to form the cyclisation may be an amide bond formation between a carboxylic acid and amine group. Alternatively, the C-terminal -OH of an amino acid may be converted to an acyl halide, acyl azide, anhydride of activated ester and then reacted with an amine group. Protecting groups may be used to prevent side reactions. In embodiments, the chemical bond used to form the cyclisation may be any nucleophilic amino acid side chain, preferably a cysteine sulfur atom. The nucleophile, typically a thiol functionality may react with a suitably electrophilic carbon atom within the peptide, typically the N-terminal -C(0)CH2X group, where X can be any leaving group, typically a halogen such as a chlorine atom. Accordingly, in embodiments, the peptide is cyclized via formation of a thioether group. The thioether may be formed through reaction between an N-terminal chloroacetyl functionality and a sulfhydryl side chain of a downstream Cys residue.

[0112] Alternative means of cyclization include native chemical ligation (NCL) which is an effective method of linking two unprotected peptide fragments. In this context, NCL involves cyclisation of a C-terminal thio-ester and an N-terminal cysteine residue. Alternatively, the cysteine residue may be replaced with a non-natural thio-containing amino acids. Advantageously native chemical ligation typically does not require the use of protecting groups, and the reaction can proceed in aqueous conditions and neutral pH and tolerates the presence of chaotropic reagents, and reducing agents.

[0113] A further means of cyclisation is formation of di-sulfide bonds from cysteine residues present in the peptide. When the peptide comprises more than two cysteine residues orthogonal protecting groups may be used to facilitate regioselective di-sulfide bond formation. A di-sulfide stabilizing reagent such as an arsenous acid derivative, dibromopyridazinedione, disubstituted maleimide, dibromoxylene or perfluoroaryl derivatives may be used to improve the stability of a di-sulfide bond by reducing it to a thioether linkage.

[0114] Further means of cyclisation include but are not limited to biorthogonal reactions, such as Staudinger ligation, a-ketoacid-hydroxylamine ligation (KAHA ligation), serinethreonine ligation, 1 ,2-aminothiol and 2-((alkylthio)(aryl)methylene)malononitrile (TAMM) ligation, strain promoted azide-alkyne cycloaddition, metal catalysed cyclisation such as copper-catalysed azide-alkyne cycloaddition or ruthenium catalyzed azide-alkyne cycloaddition, enzymatic cyclisation for example cyclisation using a subtiligase, sortase, or asparaginyl endopeptidase.

[0115] Pharmaceutical compositions

[0116] The present invention also provides pharmaceutical compositions comprising, consisting essentially of, or consisting of the peptide of the invention as described herein, and at least one pharmaceutically acceptable carrier.

[0117] As used herein, the term “consisting essentially of’ or “consisting of’ in the context of the pharmaceutical composition will be understood to imply that the composition does not comprise any additional active agents other than those specified in the composition.

[0118] The term “pharmaceutically acceptable carried’ as used herein refers to a solid or liquid filler, diluent, excipient, solvent or encapsulating substance that may be safely used in topical or systemic administration. The camer(s) must be “acceptable” in the sense of being compatible with the other ingredients of the composition and not deleterious to the recipient thereof.

[0119] The pharmaceutical composition may be suitably formulated for administration by a particular route. Suitable routes of administration include oral, transmucosal, transdermal, and parenteral administration. In some embodiments, the composition is formulated for oral administration, topical administration such as buccal or sublingual administration or administration by transdermal patch, nasal administration, transdermal administration, or parenteral administration such as subcutaneous, intradermal, intramuscular, intraperitoneal or intravenous administration. In some embodiments, the composition is formulated for oral administration, transdermal administration including administration by transdermal patch, or parenteral administration including subcutaneous, intradermal and intravenous administration. In preferred embodiments, the composition is formulated for oral administration or parenteral administration, especially oral administration or intraperitoneal administration.

[0120] Pharmaceutical formulations include those suitable for oral, rectal, nasal, topical (including buccal and sublingual) or parenteral (including intramuscular, subcutaneous, intradermal and intravenous) administration or in a form suitable for administration by inhalation or insufflation. The peptides of the invention, together with a conventional adjuvant, carrier, excipient, or diluent, may thus be placed into the form of pharmaceutical compositions and unit dosages thereof, and in such form may be employed as solids, such as tablets or filled capsules, or liquids such as solutions, suspensions, emulsions, elixirs, or capsules filled with the same, all for oral use, in the form of suppositories for rectal administration; or in the form of sterile injectable solutions for parenteral (including subcutaneous) use. Such pharmaceutical compositions and unit dosage forms thereof may comprise conventional ingredients in conventional proportions, with or without additional active compounds or principles, and such unit dosage forms may contain any suitable effective amount of the active ingredient commensurate with the intended daily dosage range to be employed. The peptides of the present invention can be administered in a wide variety of oral and parenteral dosage forms. It will be obvious to those skilled in the art that the following dosage forms may comprise, as the active component, either a peptide of the invention or a pharmaceutically acceptable salt or derivative of the peptide of the invention. Pharmaceutical formulations may include formulations of the peptides of the inventions as nano-formulations, nanoparticles or encapsulations. For example, as described in Thimmiah et al., Appl. Sci. 2022, 12(24), 12777.

[0121] For preparing pharmaceutical compositions from the peptides of the present invention, pharmaceutically acceptable carriers can be either solid or liquid. Solid form preparations include powders, tablets, pills, capsules, cachets, suppositories, and dispersible granules. A solid carrier can be one or more substances which may also act as diluents, flavouring agents, solubilizers, lubricants, suspending agents, binders, preservatives, tablet disintegrating agents, or an encapsulating material.

[0122] In powders, the carrier is a finely divided solid which is in a mixture with the finely divided active component.

[0123] In tablets, the active component is mixed with the carrier having the necessary binding capacity in suitable proportions and compacted in the shape and size desired.

[0124] The powders and tablets preferably contain from five or ten to about seventy percent of the active compound. Suitable carriers are magnesium carbonate, magnesium stearate, talc, sugar, lactose, pectin, dextrin, starch, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose, a low melting wax, cocoa butter, and the like. The term “preparation" is intended to include the formulation of the active compound with encapsulating material as carrier providing a capsule in which the active component, with or without carriers, is surrounded by a carrier, which is thus in association with it. Similarly, cachets and lozenges are included. Tablets, powders, capsules, pills, cachets, and lozenges can be used as solid forms suitable for oral administration. For preparing suppositories, a low melting wax, such as admixture of fatty acid glycerides or cocoa butter, is first melted and the active component is dispersed homogeneously therein, as by stirring. The molten homogenous mixture is then poured into convenient sized molds, allowed to cool, and thereby to solidify.

[0125] Liquid form preparations include solutions, suspensions, and emulsions, for example, water or water-propylene glycol solutions. For example, parenteral injection liquid preparations can be formulated as solutions in aqueous polyethylene glycol solution. The peptides according to the present invention may thus be formulated for parenteral administration (e.g. by injection, for example bolus injection or continuous infusion) and may be presented in unit dose form in ampoules, pre-filled syringes, small volume infusion or in multi-dose containers with an added preservative. The compositions may take such forms as suspensions, solutions, or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and / or dispersing agents. Alternatively, the active ingredient may be in powder form, obtained by aseptic isolation of sterile solid or by lyophilization from solution, for constitution with a suitable vehicle, e.g. sterile, pyrogen-free water, before use.

[0126] Aqueous solutions suitable for oral use can be prepared by dissolving the active component in water and adding suitable colorants, flavours, stabilizing and thickening agents, as desired.

[0127] Aqueous suspensions suitable for oral use can be made by dispersing the finely divided active component in water with viscous material, such as natural or synthetic gums, resins, methylcellulose, sodium carboxymethylcellulose, or other well known suspending agents.

[0128] Also included are solid form preparations which are intended to be converted, shortly before use, to liquid form preparations for oral administration. Such liquid forms include solutions, suspensions, and emulsions. These preparations may contain, in addition to the active component, colorants, flavours, stabilizers, buffers, artificial and natural sweeteners, dispersants, thickeners, solubilizing agents, and the like.

[0129] For topical administration to the epidermis, the peptides according to the invention may be formulated as ointments, creams or lotions, or as a transdermal patch. Ointments and creams may, for example, be formulated with an aqueous or oily base with the addition of suitable thickening and / or gelling agents. Lotions may be formulated with an aqueous or oily base and will in general also contain one or more emulsifying agents, stabilizing agents, dispersing agents, suspending agents, thickening agents, or colouring agents.

[0130] Formulations suitable for topical administration in the mouth include lozenges comprising active agent in a flavoured base, usually sucrose and acacia or tragacanth; pastilles comprising the active ingredient in an inert base such as gelatin and glycerin or sucrose and acacia; and mouthwashes comprising the active ingredient in a suitable liquid carrier.

[0131] Solutions or suspensions are applied directly to the nasal cavity by conventional means, for example with a dropper, pipette or spray. The formulations may be provided in single or multidose form. In the latter case of a dropper or pipette, this may be achieved by the patient administering an appropriate, predetermined volume of the solution or suspension. In the case of a spray, this may be achieved for example by means of a metering atomizing spray pump. To improve nasal delivery and retention, the peptides according to the invention may be encapsulated with cyclodextrins, or formulated with their agents expected to enhance delivery and retention in the nasal mucosa.

[0132] Administration to the respiratory tract may also be achieved by means of an aerosol formulation in which the active ingredient is provided in a pressurised pack with a suitable propellant such as a chlorofluorocarbon (CFC) for example, dichlorodifluoromethane, trichlorofluoromethane, or dichlorotetrafluoroethane, carbon dioxide, or other suitable gas. The aerosol may conveniently also contain a surfactant such as lecithin. The dose of drug may be controlled by provision of a metered valve.

[0133] Alternatively, the active ingredient may be provided in the form of a dry powder, for example a powder mix of the active compound in a suitable powder base such as lactose, starch, starch derivatives such as hydroxypropylmethyl cellulose and polyvinylpyrrolidone (PVP).

[0134] Conveniently, the powder carrier will form a gel in the nasal cavity. The powder composition may be presented in unit dose form for example in capsules or cartridges of, e.g., gelatin, or blister packs from which the powder may be administered by means of an inhaler.

[0135] In formulations intended for administration to the respiratory tract, including intranasal formulations, the active compound will generally have a small particle size for example of the order of 1 to 10 microns or less. Such a particle size may be obtained by means known in the art, for example by micronisation. When desired, formulations adapted to give sustained release of the active ingredient may be employed.

[0136] The pharmaceutical preparations can be in unit dosage forms. In such form, the preparation is subdivided into unit doses containing appropriate quantities of the active component. The unit dosage form can be a packaged preparation, the package containing discrete quantities of preparation, such as packeted tablets, capsules, and powders in vials or ampoules. Also, the unit dosage form can be a capsule, tablet, cachet, or lozenge itself, or it can be the appropriate number of any of these in packaged form.

[0137] Factor XII (FXII)

[0138] FXII is an 80 kDa protein and circulates as a catalytically inactive zymogen throughout the vasculature where it orchestrates complex blood coagulation and inflammation events. Intrinsic coagulation is initiated through FXII autoactivation, forming aFXIIa, which subsequently initiates a cascade of serine proteases, ultimately leading to the cleavage of soluble fibrinogen to insoluble fibrin. This insoluble fibrin acts to stabilize the blood clot, preventing blood loss at the site of vascular breach and ultimately fulfilling a critical role in haemostasis. In addition to its protease function zymogen FXII and its cognate receptor, urokinase plasminogen activator receptor (uPAR), have been shown to upregulate key neutrophil functions in vivo and postneutrophil activation, autocrine FXII signals through uPAR. This upregulation leads to phosphorylation of downstream Akt2 resulting in neutrophil adhesion, chemotaxis, and neutrophil extracellular trap (NET) formation. In addition, FXII and uPAR are over expressed in epithelial ovarian cancer cells (EOC) and it has been demonstrated that EOCs and neutrophils synergistically contribute to EOC progression.

[0139] Wound healing

[0140] Peptides of the invention may be useful in promoting wound healing.

[0141] FXII deficient mice, have impaired neutrophil function compared to wild-type (WT) mice and these mice have improved outcomes in models of diabetic wounds. The FXII-uPAR interaction drives key neutrophil function. Activated platelets release zinc from their a-granules elevating the local concentration sufficiently to facilitate FXII-uPAR binding. This binding event triggers downstream phosphorylation of Akt leading to upregulation of key neutrophil functions which include aM[32 expression, calcium mobilisation, and NET formation. FXII also stimulates neutrophil extrusion of NETs that contribute to inflammation and thrombosis. These FXII mediated activities translate into in vivo functions. Sterile punch biopsy wounds on F12— / — mice heal faster than those of wild type (WT) mice.

[0142] Venous Thromboembolism (VTE)

[0143] Peptides of the invention may be useful in treating or preventing VTE.

[0144] Neutrophils have been heavily implicated in the propagation of VTE and FXII deficient mice have been shown to develop smaller thrombi in vivo therefore the FXII- uPAR axis represents a promising strategy for in inhibition of thrombus formation in vivo.

[0145] Factor XII (FXII) contributes to thrombosis and throm bo-inflammatory processes through crosstalk between the intrinsic pathway of coagulation and the kal likrein-kinin system (KKS). FXII circulates throughout the vasculature as a catalytically inactive zymogen where it orchestrates complex blood coagulation and inflammation events. Intrinsic coagulation is initiated through FXII autoactivation, forming aFXIIa, which subsequently initiates a cascade of serine proteases, ultimately leading to the cleavage of soluble fibrinogen to insoluble fibrin. More recently the sophisticated role of zymogen FXII which contributes to a diverse set of pathologies has been delineated. Zymogen FXII is an 80 kDa glycoprotein and in addition to the 30 kDa light chain possessing the catalytic domain, the N-terminal heavy chain is noted to have a collagen type II fibronectin binding domain, an epidermal growth factor domain, a second fibronectin type I finger, and a second epidermal growth factor domain.

[0146] Zymogen FXII has a localised, multiprotein binding site on epithelial cells (ECs) that is composed of urokinase plasminogen activator receptor (uPAR), gC1 qR, and cytokeratin 1 . In a zinc dependant manner FXII binds uPAR and in complex with Integrin (31 results in downstream phosphorylation of Erk1 / 2 and Akt. The sum of these activities has been found to drive cell proliferation and angiogenesis. Cancer (carcinoma), and ovarian cancer uPAR is overexpressed in more than 90% of ovarian cancer patients. As a result, FXII and uPAR represent promising therapeutic targets for treating ovarian cancer. It has also been shown that FXII is upregulated in the peritoneum of EOC patients and promotes EOC dissemination through a process termed epithelial to mesenchymal transition (EMT). Finally, FXII-uPAR upregulate key neutrophil functions, which has recently been linked to tumour growth and metastasis.

[0147] Accordingly, the peptides, functional variants and functional fragments thereof of the invention, which are able to disrupt FXII-uPAR signalling are promising therapeutics for treatment of cancer, in particular the treatment of carcinoma, more preferably ovarian and related cancers.

[0148] In embodiments the cancer is a carcinoma, preferably selected from ovarian epithelial cancer, peritoneal cancer and fallopian tube cancer.

[0149] Cancerous epithelial tumors are also called carcinomas.

[0150] Primary peritoneal cancer and fallopian tube cancers are similar to epithelial ovarian cancer. The peritoneum is a layer of thin tissue that lines the inside of the abdomen. It covers all of the organs within it, such as the bowel and the liver.

[0151] Peritoneal cancer is very similar to epithelial ovarian cancer. This is because the lining of the abdomen and the surface of the ovary come from the same tissue during development from embryos in the womb.

[0152] The fallopian tubes link the ovaries to the womb. Fallopian tube cancer is rare. It has similar symptoms and treatment to epithelial ovarian cancer.

[0153] As used herein, the terms “preventing" or “prevention" are intended to refer to at least the reduction of likelihood of the risk of (or susceptibility to) acquiring a condition, disorder or disease (i.e. , causing at least one of the clinical symptoms of the disease not to develop in a patient that may be exposed to or predisposed to the disease but does not yet experience or display symptoms of the disease). As used herein, the term “therapeutically effective amount’ is generally intended to refer to an amount of an active agent, such as a peptide of the invention, that (i) treats the particular condition, disorder or disease, (ii) attenuates, ameliorates or eliminates one or more symptoms of the particular condition, disorder or disease, or (iii) delays the onset of one or more symptoms of the particular condition, disorder or disease as described herein. The exact dose will depend on the purpose of the treatment, and will be ascertainable by one skilled in the art using known techniques. As is known in the art and described above, adjustments for systemic versus localized delivery, age, body weight, general health, sex, diet, time of administration, drug interaction and the seventy of the condition may be necessary, and will be ascertainable with routine experimentation by those skilled in the art.

[0154] Suitable dosages of a peptide of the invention will vary depending on the specific the condition to be treated and / or the subject being treated. It is within the ability of a skilled physician to determine a suitable dosage, for example by commencing with a sub-optimal dosage and incrementally modifying the dosage to determine an optimal or useful dosage. Alternatively, to determine an appropriate dosage for treatment / prophylaxis, data from cell culture assays or animal studies may be used, wherein a suitable dose is within a range of circulating concentrations that include the ED50 of the active compound with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. A therapeutically / prophylactically effective dose can be estimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e. , the concentration or amount of the compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma maybe measured, for example, by high performance liquid chromatography.

[0155] The peptide of the invention as described herein or the pharmaceutical composition as described herein may be administered, or formulated for administration by, any route described herein. As used herein, the term “administered” means administration of a therapeutically effective dose of the peptide of the invention to the subject. As used herein, the term “formulated for administration" means a therapeutically effective dose of the peptide of the invention is formulated in such a way that is suitable for the route of administration. In preferred embodiments, the peptide of the invention (or pharmaceutical composition) is administered orally or parenterally, especially orally. In other preferred embodiments, the peptide of the invention (or pharmaceutical composition) is formulated for oral or parenteral administration, especially oral administration.

[0156] Although the peptide of the invention finds application in humans, it will be understood that the invention is also useful for veterinary purposes. Thus, in all aspects the invention is useful for domestic animals such as cattle, sheep, horses and poultry; for companion animals such as cats and dogs; and for zoo animals. Therefore, the general term “subject’ or “subject to be / being treated1' will be understood to include all animals (such as humans, apes, dogs, cats, horses, and cows) in need of treatment.

[0157] Examples

[0158] The invention will be further described by way of non-limiting examples. It will be understood to persons skilled in the art of the invention that modifications may be made without departing from the spirit and scope of the invention.

[0159] The practice of the present invention employs, unless otherwise indicated, conventional synthesis, analysis and molecular characterisation techniques within the skill of the art. Such techniques are well known to the skilled worker, and are explained fully in the literature.

[0160] General methods

[0161] General Synthetic Procedures:

[0162] Fmoc-SPPS: Rink amide resin (Mimotopes), 82 mg, 50 pmol, 0.61 mmol g-1 , 1 eq.) was treated with 40 vol.% piperidine (1 .6 mL) in DMF for 4 min, drained, and then treated with 20 vol.% piperidine in DMF for 12 min (1.6 mL), drained, and washed with DMF (4 x 1 .6 mL). The resin was then treated with a solution of Fmoc-Xaa-OH (400 pmol, 4 eq.) and Oxyma (57 mg, 400 pmol, 4 eq.) in DMF (800 pL), followed by a solution of DIC (63 pL, 400 pmol, 4 eq.) in DMF (800 pL) and shaken at 75 °C for 30 mins. The resin was then drained and washed with DMF (4 x 1.6 mL) before being treated with a solution of 5 vol.% Ac20 and 10 vol.% iPr2NEt in DMF (1 .6 mL) for 5 min at rt, drained, washed with DMF (4 x 1 .6 mL) and drained. These deprotection and coupling steps were repeated for additional amino acids until the target polypeptide was assembled.

[0163] Chloroacetic acid coupling: The fully elongated resin-bound peptide (0.05 mmol) was shaken in a solution of chloroacetic acid (8 eq, 0.5 M), DIC (8 eq., 125 pL, 0.2 M) and Oxyma (8 eq., 0.5 M) in DMF (4 mL) for 15 min at 75 °C. The coupling solution was dispensed, and the resin washed with DMF (3 x 4 mL), CH2CI2 (5 x 4 mL).

[0164] Peptide cleavage from resin: The resin-bound peptide was shaken in a cleavage solution of TFA / iPr3SiH / H2O (90:5:5 v / v / v) for 2 h at rt. The crude product was dispensed, and the resin rinsed with cleavage cocktail (~2 mL). These solutions were combined and concentrated to <1 mL under nitrogen flow. To precipitate the free peptide, Et20 (14 mL) was added to the crude concentrate. The resultant suspension was centrifuged for 4 min at 7000 x g to pellet the free peptide. The supernatant was then decanted, and the precipitation process repeated once more. The crude peptide was dried under nitrogen flow, then re-dissolved in 1 :1 v / v CHsCMF (~6 mL) for cyclization.

[0165] Linear peptide cyclization: To a solution of linear peptide 1 :1 v / v CHsCMF (~6 mL), Hunig’s base (300 pL, 0.3 M) was added and the reaction shaken for 2 h at rt. The cyclic peptide solution was then re-acidified with TFA (240 pL, 0.5 M) and filtered in preparation for purification.

[0166] Preparative Chromatography: Reversed-phase high performance liquid chromatography (RP-HPLC) was performed on a Waters 600E multi-solvent delivery system fitted with a Rheodyne 7725i injection valve (5 mL loading loop), a Waters 500 pump and a Waters 490E programmable wavelength detector operating at 214 nm and 230 nm. Preparative reversed-phase HPLC was performed using a Waters Sunfire C18 column (5 pm, 30 x 150 mm) at a flow rate of 38 mL min-1 . All preparative HPLC used a mobile phase of ultrapure (type 1 ) water (Solvent A) and MeCN (Solvent B) supplemented with 0.1 vol% formic acid (FA) or trifluoroacetic acid (TFA) using gradients as specified. Analytical Chromatography: Liquid Chromatography-Mass Spectrometry (LC-MS) was performed on a Shimadzu 2020 UPLC-MS instrument with a Nexera X2 LC-30AD pump, Nexera X2 SPD-M30A UVA / is diode array detector and a Shimadzu 2020 (ESI) mass spectrometer operating in either positive or negative mode. Separations were performed on a Waters Acquity BEH300 1 .7 pm, 2.1 x 50 mm (C18) column at a flow rate of 0.6 mL min-1 . All separations were performed using a mobile phase of 0.1 vol% FA in water (Solvent A) and 0.1 vol% FA in MeCN (Solvent B) using gradients as specified. Analytical reversed-phase HPLC was performed on a Waters Acquity LIPLC system equipped with a PDA detector (X = 210 - 400 nm), a sample manager FAN and Quaternary Solvent Manager (H-Class) modules. Separations were performed on a Waters Acquity BEH300 1 .7 pm, 2.1 x 50 mm (C18) column at a flow rate of 0.6 mL min-1 . All separations were performed using a mobile phase of 0.1 vol% trifluoroacetic acid (TFA) in water (Solvent A) and 0.1 vol% TFA in MeCN (Solvent B) using gradients as specified.

[0167] Purity determination: Purity of synthetic cyclic peptides was determined by UPLC analysis. Purity was determined to be > 97% from the UPLC chromatograms.

[0168] Statistics

[0169] All data are presented as mean ± standard error of the mean (SEM) unless otherwise indicated. Statistical analysis comparing two groups was performed by Mann- Whitney U test or unpaired two-tailed t test with Welch’s correction to account for unequal SDs, as appropriate. Data were also tested for normality using the Shapiro-Wilk test and for equality of variances using the Bartlett’s test. In cases where normality and equality of variances were not rejected at the significance level of 0.05, the group means were compared using pairwise t test or analysis of variance (ANOVA) with Bonferroni post hoc test. ROS generation over time was calculated with ordinary two- way ANOVA. All statistical analysis was performed using GraphPad Prism software version 8.0. Statistical significance was defined as p< 0.05 unless stated otherwise. Example 1. Synthesis of peptides

[0170] The structures of the peptides are shown in table E1 below.

[0171] FXII-D04 (peptide 56) FXII-D04 was synthesised via Fmoc-strategy SPPS as specified in general methods. The linear sequence N’-yTWQPEWYLKYYSSTTC -C’ was generated by automated SPPS on Rink amide resin (86 mg, 50pmol, capacity: 0.58 mmolg-1 ). Coupling of chloroacetic acid to the N-terminus, cleavage from resin and cyclisation were performed as described in the general methods. The crude cyclic peptide was purified by semi-preparative RP-HPLC (0 to 20 % B + 0.1 % formic acid over 40 min).

[0172] The appropriate fractions were combined and lyophilised to afford 56 as a white solid (12.7 mg, 11 %). LIPLC: Rt = 5.35 min. (0 to 60 vol.% B over 5 min, 0.1 vol.% TFA, > = 214 nm). LRMS (ESI+): m / z = 1130.1 [M + 2H]+. HRMS (ESI+): m / z calcd. For Cio8Hi39N2i03iSiNai [M+H+Na] + 1140.47766, found 1140.47844.

[0173] FXII-D03 (peptide 55)

[0174] 55 was synthesised via Fmoc-strategy SPPS as specified in general methods. The linear sequence N’-yERVWVWRLPRYRC-C’ was generated by automated SPPS on Rink amide resin (86 mg, 50pmol, capacity: 0.58 mmolg-1 ). Coupling of chloroacetic acid to the N terminus, cleavage from resin and cyclisation were performed as described in the general methods. The crude cyclic peptide was purified by semipreparative RP-HPLC (0 to 30 % B + 0.1 % formic acid over 40 min). The appropriate fractions were combined and lyophilised to afford 55 as a white solid (5.1 mg, 5%). LIPLC: Rt = 4.39 min. (0 to 50 vol.% B over 5 min, 0.1 vol.% TFA, = 214 nm). LRMS (ESI+): m / z = 1011 .5 [M + 2H]+. HRMS (ESI+): m / z calcd. For C95H137N29O19S1 , [M+4H]4+ 506.01643, found 506.01610

[0175] Example 2: Assays of human aFXIIa activity

[0176] The enzymatic activity of human aFXIIa (Enzyme Research Laboratories) is followed spectrophotometrically using H-D-Pro-Phe-Arg-p-nitroanilide (L-2120, Bachem) as the chromogenic substrate. The assays are performed in 20 mM HEPES pH 7.6, 150 mM NaCI, 0.1 % (w / v) PEG 8000 and 0.01% (v / v) Triton X-100 with 4 nM human aFXIIa, 200 pM of substrate and varying concentrations of inhibitor (0 to 100 uM). All reactions are initiated by the addition of the protease and carried out at 37 °C in 96-well flat bottom microtiter plates. Reaction progress is monitored at 405 nm for 60 min, with measurements taken every 5 min on a multi-mode microplate reader (Synergy2, Biotek). All measurements are performed in duplicate. ICso values are determined with Prism 8 (GraphPad Software).

[0177] FXIIa amidolytic activity assay.

[0178] Human Factor XII protein (plasma-derived; 20 nM) is pre-incubated with various concentrations of FXII-D04 for 30 minutes. Subsequently, contact activator dextran sulfate (DXS; 15 pg / ml) is added and FXIIa enzymatic activity is measured photometrically using the chromogenic substrate S-2302 (200 pM) at an absorbance wavelength of 405 nm over 60 minutes.

[0179] Plasma Stability

[0180] Plasma stability of FXII-D04 is determined using a slightly modified method previously described by Teufel et al. Positive control: Propantheline bromide. FXII-D04 (5 mM stock in DMSO) is added to human plasma (Sigma Aldrich pooled plasma, citrate as anticoagulant) to a concentration of 200 pM. The peptide is incubated at 37 °C for 0, 1 .5, 3.0, 8.0 or 24 h before being quenched with three volumes of 1 :1 v / v MeOH:MeCN. The samples are centrifuged at 13,500 rpm for 5 minutes before removing an aliquot of the supernatant (20 pL) that is diluted with water (20 pL) and analysed by reversephase UHPLC and mass spectrometry. The area under the starting peptide peak (normalised to total area under the chromatogram) is used to quantify the amount of uncleaved peptide remaining.

[0181] Example 3 - Inhibition of Neutrophil Chemotaxis

[0182] Human neutrophil isolation

[0183] Human blood sample studies were performed with blood from healthy individuals in accordance with a protocol approved by the Institutional Review Board (Case 12Z05, IRB # 09-90-195) of University Hospitals Cleveland Medical Center. All participants provided written informed consent. The protocol, amendments, and informed consent forms were approved by the institutional review board. Eligible healthy subjects were 18 years or older, male and female; were not on active medications including immunosuppressive and over the counter nonsteroidal anti-inflammatory drugs (NSAIDs); and were without diagnosis of an acute illness in the past 4 weeks. Whole blood was drawn by venipuncture from healthy individuals into sodium citrate tubes (ratio: 1-part anticoagulant to 9 parts whole blood). Peripheral neutrophils were isolated using a magnetic bead separation system (Miltenyi Biotech) according to the manufacturer’s instructions. Eluted cells were counted using a hemacytometer and trypan blue, centrifuged at 300g for 10 minutes and resuspended in DMEM / F12 containing 2 mM CaCl2 and 2 mM MgCl2 for in vitro signaling and functional assays. Isolation of murine peripheral blood neutrophils.

[0184] Murine peripheral blood was drawn by Inferior Vena Cava venipuncture into sodium citrate tubes (ratio: 1-part anticoagulant to 9-parts whole blood). Peripheral neutrophils were isolated with a magnetic bead separation system (Miltenyi Biotec) according to the manufacturer's instructions. The eluted cells were resuspended in serum-free medium without growth factors.

[0185] Cell culture

[0186] Human epithelial ovarian cancer cells SKOV-3 and OV81 .2 cells (obtained from ATCC) were cultured in DMEM / F12 media supplemented with 3% heat-inactivated fetal bovine serum (FBS), penicillin (100 pg / mL), streptomycin (100 ll / rnl) and maintained at 37 °C in a humidified atmosphere of 5% CO2. Trypsin (0.25%) / EDTA solution was used to detach the cells from the culture flask for passaging.

[0187] Signalling experiments and immunoblotting

[0188] Human epithelial ovarian cancer cells (SKOV-3, OV81.2; 1 x 106) were incubated in 6-well plates, in the absence or presence of 300 pM LRG-20 and YHK9 peptides or 10 pM DLA, LHV and D04 peptides, in various combinations for 24 hours. For some experiments, SKOV-3 cells were co-incubated with untreated neutrophils (2 x 106) or neutrophils that were pre-activated with 200 nM FXII and 15 pM ZnCI2 or 1 pM fMLP for 30 minutes at 37°C. On completion of incubation, cells were immediately lysed using 4X Laemmli buffer containing 10% [3-mercaptoethanol. Egual amounts of protein were subjected to 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and then electroblotting onto 23 polyvinylidene difluoride (PVDF) membrane. Membranes were blocked with 5% (wt / vol) bovine serum albumin and incubated overnight at 4°C with antibodies to phospho-Akt2 (Ser474; 1 :2000 dilution, Cell Signaling Technology), betaactin (1 :40000, Sigma Aldrich), E-cadherin (1 :1000, Cell Signaling Technology) or vimentin (1 :1000, Cell Signaling Technology) in 5% non-fat milk in 1X TBST. Primary antibodies were detected with a horseradish peroxidase-conjugated anti-rabbit immunoglobulin G (1 :5000) for 1 hour at room temperature and blots were scanned using Scion Image (v4.0) software. Measurement of neutrophil reactive oxygen species (ROS)

[0189] To detect the generation of intracellular ROS, purified neutrophils (5 x 105) resuspended in DMEM / F12 media containing no phenol red were incubated with 1 pM fMLP or 200 nM FXII and 15 pM ZnCI2 for 30 minutes at 37°C. Where indicated, D04 was also added in FXII reactions. Equal parts 2X ROS detection solution was added to each sample and fluorescence signal was measured by a microplate reader every 10 minutes for 60 minutes at ex / em 490 / 525 nm. For negative control, neutrophils were pretreated with 10 pM diphenyleneiodonium chloride (DPI), a NADPH oxidase (NOX) inhibitor, for 30 minutes at 37°C, followed by agonist stimulation. Each condition was run in triplicate and ROS generation was expressed as mean relative fluorescence units (RFU) ± SEM.

[0190] It was observed that FXII-D04 significantly reduces reactive oxygen species (ROS) production in neutrophils induced by FXII (Figure 2) and restores keratinocyte migration in the presence of neutrophils in vitro (Figure 3).

[0191] Boyden chamber chemotaxis

[0192] Human neutrophils (1 x 106 / ml) were resuspended in DMEM / F12 containing 0.5% BSA, 2 mM CaCl2 and 2 mM MgCl2 and applied to the top insert of a Boyden chamber (3-pm pore size). Media containing 200 nM FXII and 15 pM ZnCl2, in the absence or presence of 10 pM D04, were added to the lower well. Chemotaxis chambers were incubated for 90 minutes at 37°C. Next, media was aspirated from the top well and the insert itself was transferred to a clean well containing cell detachment solution and incubated for 30 minutes at 37°C. Media containing migratory cells were mixed and transferred to a 96-well plate. Lysis buffer (4X) / CyQuant GR dye solution was added to each well containing cells in a 1 :75 ratio to lysis buffer and allowed to incubate for 20 minutes at room temperature. Fluorescence was determined in a Promega Discover plate reader at ex / em 480 / 520 nm. Cells (1 x 106 / ml) plated directly at the bottom well served as positive control (100% neutrophil migration); an empty bottom well containing 1X lysis buffer / CyQuant GR dye only, served as negative control (0% neutrophil migration). Fluorescence intensity was subtracted from that of the negative control, normalized to the intensity of positive control and expressed as % neutrophil migration. The inventors have demonstrated that D04 is a potent inhibitor of neutrophil chemotaxis in a Boyden Chamber Assay. The results are shown in Figure 1.

[0193] Example 4: Diabetic wound healing

[0194] The inventors have shown that administration of FXII-D04 led to significant improvement of reepithelization rates in an in vivo mouse model of diabetic wound healing. The results of these experiments are shown in Figures 4A and 4B.

[0195] Animals.

[0196] Eight- to 12-week-old male and female mice in a C57BL / 6J background (Jackson Laboratories) were equally used for all studies. Factor XII deficient (F12- / -, FXII KO) mice were previously provided by Dr. Francis J. Castellino of University of Notre Dame. The knockout mice were produced in a C57BL / 6 background and back-crossed 7 generations. These animals were mated with wild-type mice (C57BL / 6, Jackson Laboratories) to make both heterozygous animals and re-derived into F12- / - and littermate wild type (WT) colonies which were maintained by brother / sister mating. Every 10 generations, F12- / - mice were mated with C57BL / 6J to re-derive knockouts from heterozygous mice. The genotyping of F12- / - mice was performed with oligonucleotide primer sets; a common reverse primer in exon 9 of the F12 gene (5‘- GACGAAGCACCATGGACGTG, spanning bp 838-857 of the F12 cDNA), and a forward primer in exon 8 of the F12 gene 5’-GGCCACCACGCATTTTGCCG, spanning bp 801-820 of the F12 cDNA to detect the WT allele (152 bp). Also, the same reverse primer, and a forward primer residing within NEO (5’- GTAATACGACTCACTATAGGGC), were used to detect the null allele (128 bp). Animal care and procedures were reviewed and approved by the Institutional Animal Care and Use Committees at Case Western Reserve University and performed in accordance with the guidelines of the American Association for Accreditation of Laboratory Animal Care and the National Institutes of Health.

[0197] Diabetes induction

[0198] Diabetes mellitus (DM) was induced in wild-type and F12- / - mice with streptozotocin (50 mg / kg body weight, intraperitoneally for 4 days), as previously described.4-6 To better recapitulate a long-term diabetic state that would be reflective of human DM, all animals were maintained diabetic for at least 3 months, their weight and glycated hemoglobin A1 C was closely monitored, and insulin was administered throughout the duration of experiments. At 3-4 months post diabetes induction, all mice underwent wounding, detailed below.

[0199] Skin wound assays

[0200] Full-thickness excisional wounds were made on the dorsal skin of mice under aseptic conditions as previously described in (Stavrou et al J Clin Invest 2018). A fold of the dorsal skin was then picked up and punched with a 6-mm disposable sterile biopsy punch (Acu Punch). Two wounds were generated per mouse and phosphate buffered saline (PBS) or D04 peptide (10 pM in 20% v / v PEG400, 5% v / v solution, 0.9% w / v saline, 0.6% v / v 1M NaOH to pH 7.4), were administered once daily within a hydrogel applied directly onto the wound. Each animal served as its own control because out of 2 wounds created per mouse, one wound received PBS and the other wound was treated with D04. External wound area was determined using an electronic caliper. Wounds were considered closed when their area relative to day 0 was less than 5%. Area was calculated with the formula: area= x length x width x 3.14. A group of animals were used to collect wound exudate with sterile cotton swabs and for wound harvest on Days 0, 2 and 5. Each wound was bisected along the wound length and one half was fixed in 4% paraformaldehyde, embedded in paraffin and stained with hematoxylin and eosin (H&E). The remaining half of each wound was subsequently bisected along the wound margin and was used for RNA sequencing and biobanking for cytokine / chemokine measurements.

[0201] Histologic samples were photomicrographed on a Leica SCN 400 Slide Scanner equipped with a Hamamatsu line sensor color camera and a 40X / 0.65 objective. Re- epithelialization of the wounds was quantitated in a standardized manner allowing for small differences in original wound size between mice that occur due to experimental variability. The wound gap, defined as the distance between the two epithelial tongues (i.e. the keratinocytes migrating into the wound bed) was measured and subtracted from the total length of the original wound size (i.e. the distance between the normal skin / wounded skin border on each side of the lesion) to provide the total re- epithelialization length. This number was then divided by the original length of the wound to supply the percent re-epithelialization. Therefore, each wound was internally controlled by taking into consideration the original wound size.

[0202] Day 0, 2, and 5 wounds were harvested and suspended in RNase Safe buffer, packed with dry ice and shipped to BGI to be processed for RNA seq, in accordance with the company’s specifications. Results were analyzed using Dr. Tom, a bioinformatics system for data interpretation provided by BGI.

[0203] For wound secretome studies, Day 0, 2, and 5 wound exudate samples were collected and suspended in RIPA lysis buffer containing protease inhibitor cocktail (Roche). Samples were homogenized and cytokines were measured by multiplex ELISA using CodePlex murine innate immune panel kits (IsoPlexis), according to the manufacturer’s specifications. Results were analyzed using IsoSpeak software and formatted in GraphPad Prism9.

[0204] For RNA sequencing of wounds, RNA was isolated using the RNeasy Micro Kit (QIAGEN). RNA quantity and quality were determined using NanoDrop (ThermoFisher Scientific) and Fragment Analyzer (Agilent), respectively. Analyses of the RNA sequencing datasets were performed by BGI and GeneWiz companies. Before sequence alignment, trimgalore (version 0.4.3) with cutadapt package (version 1.12) was used for adaptor trimming and to improve data quality. For transcriptome alignment, STAR with GENCODE reference features were used. Sequencing reads were then mapped to the mouse reference genome (mm10) using STAR aligner. DESeq2 packages were used for differential expression analysis. Variance-stabilizing transformation in DESeq2 was used for normalizing count data. Functional analysis of DEGs was performed using the Dr. Tom Signature Database (BGI).

[0205] Ex vivo wound healing assays

[0206] Keratinocyte migration was examined in a purified system in vitro, in the absence or presence of neutrophils and D04. Mouse skin epithelial cells [(SECs), JB6 Cl 415a cell line, ATCC] were wounded in a scratch-wound assay and the rate of cell migration into scratch wounds was measured with real-time videomicroscopy (IncuCyte, Essen Bioscience), in the absence or presence of 10 pM D04. For some experiments, freshly isolated WT neutrophils, untreated or pre-incubated with 10 pM D04 for 30 minutes, were added to scratch-wounded SEC monolayers immediately following wounding. Epithelial cell wound closure was monitored continuously and quantified at 48 h.

[0207] Example 5: Inhibition of venous thrombus formation

[0208] Utilising a microfluidic platform, the inventors have been able to recapitulate the shear flow rates of venous blood flow and when both nondiabetic blood and diabetic blood are passed over a procoagulant collogen surface large thrombi are observed in the fluidic channels. When the same experiment was performed in the presence of D04 the inventors observe almost complete inhibition of thrombus formation. The results of these experiments are shown in Figure 5.

[0209] Microfluidic assays

[0210] VenaT4 biochips were coated with 100 pg / mL fibrillar collagen and incubated overnight at 4°C. Immediately before loading 30 pL of whole blood, 1 pL of 1 M NaOH was added to bring the pH to 7.4 and placed in an incubator for 60 minutes at 37°C to allow the collagen gel to polymerize. After the gel solidified, the biochip was placed in the VenaFlux Pro microfluidics system. Whole blood from healthy donors was preincubated in the absence or presence of 10 pM D04, and Vioblue Reaffinitty CD41 / CD61 (stains platelets), FITC-CD15 (for neutrophils) and AF555-conjugated fibrinogen. Samples were reconstituted with 7.5 mM calcium chloride (CaCI2, final concentration) and 3.7 mM magnesium chloride (final) and 50 pl were immediately perfused into microchannels and maintained under a venous shear rate of 67 dyne / cm2. Kinetic data utilized a region of interest (ROI) based upon the final thrombus size. Fluorescence intensity over time for each channel was measured and normalized to initial fluorescent intensity at time point t=0. Final images (20x) at t=30 min were used for endpoint thrombus size measurements. Quantitation of neutrophil and platelet rolling, adhesion and aggregation over time, as well as total thrombus area were determined using InstallShield Wizard software (Cellix).

[0211] Example 6 - Activity of compounds of the invention in Epithelial Ovarian Cancer assay

[0212] Utilising aggressive EOC cell lines (SKOV3 and OV81.2) the inventors have shown FXII-D04 restores the expression of a pro-epithelial protein E-cadherin and inhibits the expression of vimentin a mesenchymal protein via western blot (shown in Figure 6).

[0213] Effects of neutrophils on epithelial ovarian cancer cell migration

[0214] To study if the presence of neutrophils has functional consequences on epithelial ovarian cancer cells (EOCs), OV81.2 cells (4 x 105) were first seeded into a 96-well Incucyte plate and were serum-starved for 24 h at full confluency. Using a wound maker, wounds were simultaneously created in all wells. After wounding, media were aspirated from each well and cells were carefully washed at least twice with DMEM / F12 media supplemented with 1 % heat-inactivated fetal bovine serum (FBS) and 10 pM D04. In certain conditions, freshly isolated human neutrophils (8 x 105) pre-treated with media or 10 pM D04 for 30 minutes were added to OV81.2 monolayers, immediately following creation of the scratch area. The repopulation rate was measured with realtime videomicroscopy (IncuCyte) was monitored continuously for 24 h and quantified as relative wound density (% RWD) using the Incucyte® Scratch Wound Analysis Software Module.

[0215] The inventors have demonstrated that FXII-D04 potently inhibits the phosphorylation of downstream Akt (Figure 8) and finally almost completely inhibits the migration of epithelial cells into the wound area in the presence of neutrophils in a scratch wound assay (Figure 9).

[0216] In contrast to FXII-D04, peptide D03 appears to upregulate phosphorylation of downstream Akt (figure 8).

Claims

CLAIMS1 . A peptide, functional variant or functional fragment thereof having the structure selected from:

2. The peptide of claim 1 , wherein the peptide is selected from SEQ ID no 1 or 2, and the functional variant or functional fragment has at least about 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID no 1 or 2.

3. The cyclic peptide of claim 1 or 2 or functional variant or functional fragment thereof, wherein the peptide is cyclised via a thioether bond.

4. The peptide of functional variant or functional fragment thereof any one of claims 1-3 wherein the amino acid sequence has at least 2, at least 3, at least 4, or at least 5 amino acid substitutions compared to any one of SEQ ID nos 1-2.

5. The peptide of any one of claims 1 -4 or functional variant or functional fragment thereof wherein the amino acid sequence has at least 1 amino acid substitution compared to any one of SEQ ID nos 1-2.

6. The peptide according to any one of claims 1 to 4 or functional variant or functional fragment thereof comprising any one of SEQ ID nos 1 or 2.

7. The peptide according to any one of claims 1 -6, or functional variant or functional fragment thereof comprising SEQ ID no 1 .

8. A pharmaceutical composition comprising the peptide, of any one of claims 1 to 7, or functional variant or functional fragment thereof, and one or more pharmaceutically acceptable excipients.

9. A method of modulating FXII binding to uPAR comprising contacting a cell and / or blood and / or a blood vessel wall and / or sample with the peptide of any one of claims 1 to 6, or functional variant or functional fragment thereof, or the pharmaceutical composition of claim 8.

10. A method of preventing or treating a condition or disorder responsive to inhibiting FXII-uPAR signalling comprising administration to a subject in need thereof of the peptide of any one of claims 1 to 6, or functional variant or functional fragment thereof, or the pharmaceutical composition of claim 8.11 . The method of claim 10 wherein the condition or disorder is cancer, preferably carcinoma.

12. The method of claim 11 wherein the carcinoma is epithelial ovarian cancer, epithelial fallopian tube cancer or epithelial peritoneal cancer.

13. The method of claim 10, wherein the condition is a wound or a venous thrombo-embolism (VTE).

14. The method of claim 13 wherein the subject is a diabetic.

15. A method of promoting wound healing in a subject in need thereof, the method comprising administration of the peptide of any one of claims 1 to 6, or functional variant or functional fragment thereof, or the pharmaceutical composition of claim 8.

16. Use of the peptide of any one of claims 1 to 6, or functional variant or functional fragment thereof, in the manufacture of a medicament for the treatment of a condition or disease responsive to the modulation of FXI I- uPAR signalling.

17. The use of claim 16 wherein the condition or disease is a wound, venous thromoembolism (VTE) or cancer, preferably carcinoma.

18. The use of claim 17 wherein the carcinoma is epithelial ovarian cancer, epithelial fallopian tube cancer or epithelial peritoneal cancer.

19. The use of claim 16, wherein the condition is a wound or a VTE, and the subject is a diabetic.

Images