Bacterial strain, composition, and application
By using visceral Odella bacteria strains and their metabolites to modulate the immune system, the toxicity problem of existing cancer therapies has been solved, and the efficacy of tumor immunotherapy has been enhanced, especially when used in combination with immune checkpoint inhibitors to significantly inhibit tumor growth.
Patent Information
- Application Number
- PCT/CN2025/106541
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-07-02
- Filing Date
- 2025-07-01
- Publication Date
- 2026-01-08
AI Technical Summary
Existing cancer therapies, such as immunotherapy, produce toxicity and undesirable autoimmune responses when administered systemically, and there is a lack of gut microbiota that can significantly enhance the efficacy of immunotherapy for different types of cancer.
The study utilizes Odoribacter splanchnicus strains and their metabolites to modulate the immune system, inhibit tumor growth, and enhance the efficacy of immunotherapy, in combination with immune checkpoint inhibitors such as anti-PD-1 antibodies.
It significantly inhibits tumor growth, improves the response rate to immunotherapy, reduces tumor size and weight, enhances the local immune response to tumors, and improves the therapeutic effect of immunosuppressive drugs.
Smart Images

Figure PCTCN2025106541-FTAPPB-I100001 
Figure PCTCN2025106541-FTAPPB-I100002 
Figure PCTCN2025106541-FTAPPB-I100003
Abstract
Description
Strain, composition and application TECHNICAL FIELD
[0001] The present application relates to the technical field of microorganisms and their applications, and in particular to a strain, a composition and application thereof. BACKGROUND
[0002] Current cancer therapies often employ immunotherapy, surgery, chemotherapy, radiation therapy, or a combination thereof. While these drugs have shown great benefit for cancer patients, many cancers remain refractory to conventional therapies. Currently, many conventional cancer therapies are administered systemically and adversely affect healthy tissues, resulting in significant side effects. However, despite such therapies, the microenvironment surrounding tumors remains highly immunosuppressive. In addition, systemic alterations in immune regulation elicit immune dysfunction, including the onset of opportunistic autoimmune diseases and immune-related adverse events.
[0003] Significant efforts have been made in the art to develop cytotoxic drugs that specifically target cancer cells. In recent years, oncology has undergone a great shift in which the clinical problem of cancer is not only considered to be the accumulation of genetic abnormalities in cancer cells, but also the tolerance of the immune system to these abnormal cells. Therefore, recent anticancer therapies have been specifically designed to target the immune system rather than cancer cells. Such therapies aim to reverse cancer immune tolerance and stimulate an effective anti-tumor immune response. For example, current immunotherapies include immune-stimulating molecules that are pattern recognition receptor (PRR) agonists or immune-stimulatory monoclonal antibodies that target various immune cell populations infiltrating the tumor microenvironment. However, despite their immune-targeting design, these therapies are often developed in the clinic as conventional anticancer drugs that are administered systemically (e.g., intravenous infusion every 2-3 weeks), such that many immunotherapies produce toxicity due to high dose requirements and also often result in undesirable autoimmune responses or other immune-related adverse events.
[0004] Recent studies have shown that the presence of certain types of intestinal microorganisms in mice can enhance the anti-tumor effect of cancer immunotherapy without increasing toxic side effects. But so far, the research using specific intestinal microorganisms has mostly focused on the diagnosis of intestinal diseases such as colon cancer, and the development of therapeutic drugs using feces is still in the early stages. There is still a lack of intestinal microorganisms that can significantly enhance the effect of immunotherapy for different types of cancers such as lung cancer and liver cancer.
[0005] On the other hand, the development of immune checkpoint inhibitors (ICIs) targeting the PD-1 / PD-L1 interaction has changed the treatment landscape for patients with advanced non-small cell lung cancer (NSCLC). Landmark trials in previously treated patients with advanced NSCLC have shown higher overall survival (OS) with PD-1 / PD-L1 blockade compared with standard chemotherapy. Following unprecedented OS results in a phase III randomized trial in previously untreated patients with advanced NSCLC, ICIs were approved for first-line treatment, both as monotherapy in patients with PD-L1 expression ≥ 50% on tumor cells and in combination with platinum doublet chemotherapy regardless of PD-L1 expression. However, only a minority (about 35%) of patients benefit from sustained response to ICIs. Most NSCLC patients develop primary or secondary resistance, or occasional accelerated progression of disease. Moreover, current biomarkers for response to ICIs are unsatisfactory due to low sensitivity and specificity. SUMMARY
[0006] To solve at least one of the above technical problems, the present application provides a strain, a composition and applications thereof. The present application covers the use of the cell body of a microbial strain of Odoribacter splanchnicus and its extract, metabolite (e.g. fermentation broth) in the preparation of a medicament for preventing and / or treating tumors and its role in the preparation of a medicament for inhibiting the growth rate of tumors (inhibiting the size and size of tumors).
[0007] According to a first aspect of the present application, a strain is provided, the strain being a strain of Odoribacter splanchnicus, the strain having a 16S rRNA of a nucleotide sequence as set forth in SEQ ID NO: 3 or a 16S rRNA having at least 95%, 95.1%, 95.2%, 95.3%, 95.4%, 95.5%, 95.6%, 95.7%, 95.8%, 95.9%, 96%, 96.1%, 96.2%, 96.3%, 96.4%, 96.5%, 96.6%, 96.7%, 96.8%, 96.9%, 97%, 97.1%, 97.2%, 97.3%, 97.4%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% sequence identity thereto.
[0008] In some embodiments, the strain is the strain deposited on December 23, 2022 at the Guangdong Microbial Culture Collection Center, with the deposit name Odoribacter splanchnicus MNH 30639 and the deposit number GDMCC No: 63075.
[0009] In some embodiments, the strain is a strain with an average genetic similarity ANI value of at least 95%, 95.1%, 95.2%, 95.3%, 95.4%, 95.5%, 95.6%, 95.7%, 95.8%, 95.9%, 96%, 96.1%, 96.2%, 96.3%, 96.4%, 96.5%, 96.6%, 96.7%, 96.8%, 96.9%, 97%, 97.1%, 97.2%, 97.3%, 97.4%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% to the genome of the strain MNH 30639.
[0010] In some embodiments, the strain is isolated from healthy human feces.
[0011] In some embodiments, the strain forms visible colonies on MPYG solid plate medium after anaerobic culture at 37°C for 48h; the colonies are round, with regular and smooth edges, translucent, and no secretion is formed around the colonies.
[0012] In some embodiments, the strain is a gram-negative bacterium, with cells in short rod or bifurcated short rod shape, without spores and flagella.
[0013] In some embodiments, the strain can grow at 30°C to 42°C.
[0014] In some embodiments, the strain can grow at 30°C, 31°C, 32°C, 33°C, 34°C, 35°C, 36°C, 37°C, 38°C, 39°C, 40°C, 41°C, or 42°C.
[0015] In some embodiments, the optimal growth temperature of the strain is 37°C.
[0016] In some embodiments, the strain can grow at a pH of 6.0 to 10.0.
[0017] In some embodiments, the strain can grow at pH = 6.0, 7.0, 8.0, 9.0 or 10.0.
[0018] In some embodiments, the optimal growth pH of the strain is 8.0.
[0019] In some embodiments, the strain does not grow on media with NaCl content exceeding 1 w / v %.
[0020] In some embodiments, the strain does not grow on media with bile salt content exceeding 0.10 w / v %.
[0021] In some embodiments, the strain does not grow under aerobic conditions.
[0022] In some embodiments, the strain can grow under anaerobic conditions.
[0023] In some embodiments, the strain is an anaerobic bacterium.
[0024] In some embodiments, the strain is a strict anaerobic bacterium.
[0025] In some embodiments, the strain is sensitive to erythromycin, lincomycin.
[0026] In some embodiments, the strain is resistant to ampicillin, cotrimoxazole, chloramphenicol, ciprofloxacin, ceftriaxone, gentamicin, tetracycline and penicillin.
[0027] In some embodiments, the strain has 100% integrity of butyrate production pathway.
[0028] In some embodiments, the strain has 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% integrity of butyrate production pathway.
[0029] In some embodiments, the strain can produce short chain fatty acids.
[0030] In some embodiments, the short chain fatty acids have 2-5 carbon atoms.
[0031] In some embodiments, the short chain fatty acids have the formula CH3[CH2] n COOH, n = 0-3.
[0032] In some embodiments, the short-chain fatty acid comprises any one of acetic acid, propionic acid, isobutyric acid, butyric acid, isovaleric acid, valeric acid, caproic acid, enanthic acid, caprylic acid, pelargonic acid, or capric acid.
[0033] In some embodiments, the strain has one or more of the following modulating immune activity effects:
[0034] inducing macrophage differentiation, in some embodiments, to Ml type macrophages;
[0035] inducing secretion of cytokines;
[0036] promoting transcriptional activity of IFN beta.
[0037] In some embodiments, the cytokine comprises one or more of proinflammatory factors, chemotactic factors, and anti-inflammatory factors.
[0038] In some embodiments, the cytokine comprises one or more of the following cytokines: IFN beta, IL-10, IL-12 / IL-13 P40, IL-6, MCP-1, RANTES, IL-1 beta, IL-1 beta, IP-10, and IL-8.
[0039] In some embodiments, the strain is capable of inhibiting histone deacetylase.
[0040] In some embodiments, the strain has one or more of the following tumor inhibiting effects: 1) inhibiting tumor volume growth; 2) inhibiting tumor weight increase; 3) inhibiting tumor cell growth; 4) increasing tumor growth inhibition rate; 5) increasing tumor response rate to treatment; 6) inhibiting histone deacetylase activity; 7) activating local immunity in the subject by increasing the proportion of Ml macrophages in tumor tissue, thereby exerting an anti-tumor effect; 8) exerting a growth inhibitory effect on tumor cells by relieving immune suppression in the tumor microenvironment by inhibiting MDSC cells in the tumor tissue; 9) increasing the therapeutic effect of immunosuppressive drugs, preferably, the immunosuppressive drug comprises an immune checkpoint inhibitor, preferably an anti-PD-1 antibody; and, 10) inhibiting tumors by exerting an immunomodulatory effect on the immune system of the subject, preferably, the modulating the immune system of the subject comprises inducing secretion of cytokines.
[0041] In some embodiments, the tumor is selected from one or more of refractory tumors or recurrent tumors.
[0042] In some embodiments, the tumor is selected from one or more of solid tumors, glandular tumors, and metastatic tumors.
[0043] In some embodiments, the tumor is selected from one or more of liver cancer, colon cancer, rectal cancer, colorectal cancer, lung cancer.
[0044] According to a second aspect of the present application, there is provided a microbial inoculant comprising a live strain, an attenuated strain, an irradiated strain of the strain of the first aspect, or a metabolite of the strain or a supernatant of the strain.
[0045] In some embodiments, the culture of the strain is a solid culture, a fermentation culture, or a supernatant of a fermentation culture.
[0046] According to a third aspect of the present application, there is provided a composition comprising a live strain, an attenuated strain, an irradiated strain of the strain of the first aspect, or a metabolite of the strain or a supernatant of the strain.
[0047] In some embodiments, the culture of the strain is a solid culture, a fermentation culture, or a supernatant of a fermentation culture.
[0048] In some embodiments, the strain is present in an amount of 1 x 10 4 to 9 x 10 10 CFU / mL.
[0049] In some embodiments, the strain is present in an amount of: 1 x 10 4 , 2 x 10 4 , 3 x 10 4 , 4 x 10 4 , 5 x 10 4 , 6 x 10 4 , 7 x 10 4 , 8 x 10 4 , 9 x 10 4 , 1 x 10 5 , 2 x 10 5 , 3 x 10 5 , 4 x 10 5 , 5 x 10 5 , 6 x 10 5 , 7 x 10 5 , 8 x 10 5 , 9 x 10 5 , 1 x 10 6 , 2 x 10 6 , 3 x 10 6 , 4 x 10 6 , 5 x 10 6 , 6 x 10 6 , 7 x 10 6 , 8 x 10 6 , 9 x 10 6 , 1 x 10 7 , 2 x 10 7 , 3 x 107 , 4 x 10 7 , 5 x 10 7 , 6 x 10 7 , 7 x 10 7 , 8 x 10 7 , 9 x 10 7 , 1 x 10 8 , 2 x 10 8 , 3 x 10 8 , 4 x 10 8 , 5 x 10 8 , 6 x 10 8 , 7 x 10 8 , 8 x 10 8 , 9 x 10 8 , 1 x 10 9 , 2 x 10 9 , 3 x 10 9 , 4 x 10 9 , 5 x 10 9 , 6 x 10 9 , 7 x 10 9 , 8 x 10 9 , 9 x 10 9 , 1 x 10 10 , 2 x 10 10 , 3 x 10 10 , 4 x 10 10 , 5 x 10 10 , 6 x 10 10 , 7 x 10 10 , 8 x 10 10 , 9 x 10 10 CFU / mL.
[0050] In some embodiments, the content of the strain in the composition is 1 x 10 7 ~ 1 x 10 10 CFU / mL per unit dose.
[0051] In some embodiments, the content of the strain in the composition is 1.3 x 10 7 , 1.3 x 10 8 , 1.3 x 10 9 , 1.3 x 10 9 , or 1.3 x 10 10 CFU / mL per unit dose.
[0052] In some embodiments, the composition has a cell content-dependent effect on the tumor when the cell content of the strain is in the range of 1.3 x 10 7 CFU / mL ~ 1.3 x 10 9 CFU / mL, and the lower the cell content, the more significant the anti-tumor effect.
[0053] In some embodiments, the composition comprises at least 50% more viable bacteria.
[0054] In some embodiments, the composition comprises at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more viable bacteria.
[0055] In some embodiments, the composition comprises at least 90% more viable bacteria.
[0056] In some embodiments, the composition further comprises a pharmaceutically or nutritionally acceptable carrier.
[0057] In some embodiments, the composition is in a formulation selected from one or more of the following: a liquid formulation, a solid formulation, a lyophilized formulation, a spray formulation, and an electrostatic spray formulation.
[0058] In some embodiments, the composition further comprises a co-drug, the co-drug comprising an immune checkpoint molecule modulator.
[0059] In some embodiments, the immune checkpoint molecule modulator is selected from one or more of the following: an anti-PD-1 antibody, an anti-CTLA-4 antibody, an anti-PD-L1 antibody, and a PD-L1 inhibitor.
[0060] In some embodiments, the PD-L1 inhibitor is selected from durvalumab, atezolizumab, or avelumab.
[0061] In some embodiments, the anti-PD-1 antibody or anti-PD-L1 antibody is selected from pembrolizumab, teprotumumab, sintyrosimab, tislelizumab, or camrelizumab, or nivolumab.
[0062] In some embodiments, the effective dose of the anti-PD-1 antibody is 1-100 mg / kg.
[0063] In some embodiments, the effective dose of the anti-PD-1 antibody includes, but is not limited to, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 6 mg / kg, 7 mg / kg, 8 mg / kg, 9 mg / kg, 10 mg / kg, 11 mg / kg, 12 mg / kg, 13 mg / kg, 14 mg / kg, 15 mg / kg, 16 mg / kg, 17 mg / kg, 18 mg / kg, 19 mg / kg, 20 mg / kg, 21 mg / kg, 22 mg / kg, 23 mg / kg, 24 mg / kg, 25 mg / kg, 26 mg / kg, 27 mg / kg, 28 mg / kg, 29 mg / kg, 30 mg / kg, 31 mg / kg, 32 mg / kg, 33 mg / kg, 34 mg / kg, 35 mg / kg, 36 mg / kg, 37 mg / kg, 38 mg / kg, 39 mg / kg, 40 mg / kg, 41 mg / kg, 42 mg / kg, 43 mg / kg, 44 mg / kg, 45 mg / kg, 46 mg / kg, 47 mg / kg, 48 mg / kg, 49 mg / kg, 50 mg / kg, 51 mg / kg, 52 mg / kg, 53 mg / kg, 54 mg / kg, 55 mg / kg, 56 mg / kg, 57 mg / kg, 58 mg / kg, 59 mg / kg, 60 mg / kg, 61 mg / kg, 62 mg / kg, 63 mg / kg, 64 mg / kg, 65 mg / kg, 66 mg / kg, 67 mg / kg, 68 mg / kg, 69 mg / kg, 70 mg / kg, 71 mg / kg, 72 mg / kg, 73 mg / kg, 74 mg / kg, 75 mg / kg, 76 mg / kg, 77 mg / kg, 78 mg / kg, 79 mg / kg, 80 mg / kg, 81 mg / kg, 82 mg / kg, 83 mg / kg, 84 mg / kg, 85 mg / kg, 86 mg / kg, 87 mg / kg, 88 mg / kg, 89 mg / kg, 90 mg / kg, 91 mg / kg, 92 mg / kg, 93 mg / kg, 94 mg / kg, 95 mg / kg, 96 mg / kg, 97 mg / kg, 98 mg / kg, 99 mg / kg, and 100 mg / kg.
[0064] In some embodiments, the anti-CTLA-4 antibody is ipilimumab.
[0065] In some embodiments, the effective dose of the anti-CTLA-4 antibody is 1-100 mg / kg.
[0066] In some embodiments, the effective dose of the anti-CTLA-4 antibody includes, but is not limited to, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 6 mg / kg, 7 mg / kg, 8 mg / kg, 9 mg / kg, 10 mg / kg, 11 mg / kg, 12 mg / kg, 13 mg / kg, 14 mg / kg, 15 mg / kg, 16 mg / kg, 17 mg / kg, 18 mg / kg, 19 mg / kg, 20 mg / kg, 21 mg / kg, 22 mg / kg, 23 mg / kg, 24 mg / kg, 25 mg / kg, 26 mg / kg, 27 mg / kg, 28 mg / kg, 29 mg / kg, 30 mg / kg, 31 mg / kg, 32 mg / kg, 33 mg / kg, 34 mg / kg, 35 mg / kg, 36 mg / kg, 37 mg / kg, 38 mg / kg, 39 mg / kg, 40 mg / kg, 41 mg / kg, 42 mg / kg, 43 mg / kg, 44 mg / kg, 45 mg / kg, 46 mg / kg, 47 mg / kg, 48 mg / kg, 49 mg / kg, 50 mg / kg, 51 mg / kg, 52 mg / kg, 53 mg / kg, 54 mg / kg, 55 mg / kg, 56 mg / kg, 57 mg / kg, 58 mg / kg, 59 mg / kg, 60 mg / kg, 61 mg / kg, 62 mg / kg, 63 mg / kg, 64 mg / kg, 65 mg / kg, 66 mg / kg, 67 mg / kg, 68 mg / kg, 69 mg / kg, 70 mg / kg, 71 mg / kg, 72 mg / kg, 73 mg / kg, 74 mg / kg, 75 mg / kg, 76 mg / kg, 77 mg / kg, 78 mg / kg, 79 mg / kg, 80 mg / kg, 81 mg / kg, 82 mg / kg, 83 mg / kg, 84 mg / kg, 85 mg / kg, 86 mg / kg, 87 mg / kg, 88 mg / kg, 89 mg / kg, 90 mg / kg, 91 mg / kg, 92 mg / kg, 93 mg / kg, 94 mg / kg, 95 mg / kg, 96 mg / kg, 97 mg / kg, 98 mg / kg, 99 mg / kg, and 100 mg / kg.
[0067] In some embodiments, the composition is a drug, health product or food.
[0068] According to a fourth aspect of the present application, there is provided use of the strain of the first aspect, the microbial inoculant of the second aspect or the composition of the third aspect in the preparation of a medicament, health product or food for modulating immune activity or preventing and / or treating a tumor.
[0069] In some embodiments, the prevention and / or treatment of the tumor comprises one or more of the following: 1) inhibiting tumor volume growth; 2) inhibiting tumor weight increase; 3) inhibiting tumor cell growth; 4) increasing tumor growth inhibition rate; 5) increasing tumor response rate to treatment; 6) inhibiting histone deacetylase activity; 7) activating local immunity of the subject by increasing the proportion of Ml macrophages in tumor tissue, thereby exerting an anti-tumor effect; 8) exerting growth inhibition effect on tumor cells by relieving immune suppression in the tumor microenvironment through inhibition of MDSC cells in the tumor tissue; 9) increasing the therapeutic effect of an immunosuppressive drug, preferably, the immunosuppressive drug comprises an immune checkpoint inhibitor, preferably an anti-PD-1 antibody; and, 10) inhibiting the tumor by exerting immune regulation on the immune system of the subject, preferably, the immune regulation on the immune system of the subject comprises inducing secretion of cytokines.
[0070] In some embodiments, the tumor is selected from one or more of the following: a solid tumor, an adenoma, and a metastatic tumor.
[0071] In some embodiments, the tumor is selected from one or more of the following: a solid tumor, an adenoma, and a metastatic tumor.
[0072] In some embodiments, the tumor is selected from one or more of the following: a liver cancer, a colon cancer, a rectal cancer, a colorectal cancer, and a lung cancer.
[0073] According to a fifth aspect of the present application, there is provided use of the strain of the first aspect, the microbial inoculum of the second aspect, or the composition of the third aspect in the preparation of a medicament for treating and / or preventing a disease mediated by HDAC activity.
[0074] In some embodiments, the disease mediated by HDAC activity is selected from one or more of the following: a tumor, a metabolic disease, diabetes, an autoimmune disease, an infectious disease, a central nervous system disease, and an inflammatory bowel disease.
[0075] In some embodiments, the tumor is selected from one or more of the following: a solid tumor, an adenoma, and a metastatic tumor.
[0076] In some embodiments, the tumor is selected from one or more of the following: a solid tumor, an adenoma, and a metastatic tumor.
[0077] In some embodiments, the tumor is selected from one or more of the following: a liver cancer, a colon cancer, a rectal cancer, a colorectal cancer, and a lung cancer.
[0078] According to a sixth aspect of the present application, there is provided a method for inhibiting tumor growth, comprising administering to a subject an effective amount of the strain of the first aspect, the microbial inoculum of the second aspect, or the composition of the third aspect.
[0079] In some embodiments, the inhibiting tumor growth comprises one or more of: 1) inhibiting tumor volume growth; 2) inhibiting tumor weight increase; 3) inhibiting tumor cell growth; 4) increasing tumor growth inhibition rate; 5) increasing tumor response rate to treatment; 6) inhibiting histone deacetylase activity; 7) activating local immunity of the subject by increasing the proportion of Ml macrophages in tumor tissue, thereby exerting an anti-tumor effect; 8) exerting growth inhibition effect on tumor cells by relieving immune suppression in tumor microenvironment through inhibiting MDSC cells in tumor tissue; 9) increasing the therapeutic effect of immunosuppressive drugs, preferably, the immunosuppressive drugs comprise immune checkpoint inhibitors, preferably anti-PD-1 antibodies; and, 10) inhibiting tumor by exerting immune regulation effect on the immune system of the subject, preferably, the regulating the immune system of the subject comprises inducing secretion of cytokines.
[0080] In some embodiments, the tumor is selected from one or more of: refractory tumor or recurrent tumor.
[0081] In some embodiments, the tumor is selected from one or more of: solid tumor, adenoma, and metastatic tumor.
[0082] In some embodiments, the tumor is selected from one or more of: liver cancer, colon cancer, rectal cancer, colorectal cancer, and lung cancer.
[0083] According to a seventh aspect of the present application, there is provided a method for treating and / or preventing a disease mediated by HDAC activity, comprising administering to a subject an effective amount of the strain of the first aspect, the microbial inoculum of the second aspect, or the composition of the third aspect.
[0084] In some embodiments, the disease mediated by HDAC activity is selected from one or more of: tumor, metabolic disease, diabetes, autoimmune disease, infectious disease, central nervous system disease, and inflammatory bowel disease.
[0085] In some embodiments, the tumor is selected from one or more of: refractory tumor or recurrent tumor.
[0086] In some embodiments, the tumor is selected from one or more of: solid tumor, adenoma, and metastatic tumor.
[0087] In some embodiments, the tumor is selected from one or more of: liver cancer, colon cancer, rectal cancer, colorectal cancer, and lung cancer.
[0088] The strain MNH 30639 has been preserved in the Guangdong Microbial Culture Collection Center, and the preservation name is MNH 30639, the classification name is proposed as Odoribacter splanchnicus, the preservation number is GDMCC 63075, the preservation time is December 23, 2022, and the preservation address is the 5th floor of Building 59, 100, Xianlie Middle Road, Guangzhou, Guangdong Microbiology Institute of Guangdong Academy of Sciences. Beneficial effects:
[0089] 1. The strain provided by the present application belongs to a strain of Odoribacter splanchnicus, and the nucleotide sequence of its 16S rRNA is not completely consistent with the nucleotide sequence of the 16S rRNA of the existing species.
[0090] 2. The strain provided by the present application has a complete butyric acid production pathway, and can produce one or more of acetic acid, propionic acid, isobutyric acid, butyric acid, or isovaleric acid, valeric acid, hexanoic acid, heptanoic acid, octanoic acid, nonanoic acid, or decanoic acid during growth; short-chain fatty acids are the preferred energy source for intestinal epithelial cells, can inhibit the occurrence of enteritis, and maintain and promote the recovery of intestinal function; butyric acid can inhibit histone deacetylase inhibitors, induce differentiation and apoptosis of tumor cells, and has an anticancer effect.
[0091] Specifically, the supernatant of the strain is added to histone deacetylase for activity detection, and the supernatant of the strain has a significant inhibitory effect on histone deacetylase.
[0092] 3. The strain provided by the present application can promote macrophage differentiation, induce increased expression of inflammatory cytokines, promote IFN beta transcriptional activity, and enhance immune activity. It can inhibit tumors by regulating the immune system of the subject to play an immunoregulatory role.
[0093] Specifically, after macrophages and the strain are co-cultured, the macrophages obviously exhibit the characteristics of differentiation into M1 type macrophages. Among them, the contents of pro-inflammatory factors IL-6, IL-1beta, IL-8 and IL-12 / IL-13P40 are significantly increased, TNF is up-regulated, the contents of chemotactic factors MCP-1 and RANTES are significantly increased, MIG and IP-10 are up-regulated, and the content of anti-inflammatory factor IL-10 is significantly increased.
[0094] Specifically, after peripheral blood mononuclear cells and the strain are co-cultured, MNH30639 can induce significant increases in the expression of inflammatory factors RANTES, IL-1beta, IP-10 (CXCL-10), IL-6, and IL-8, and there is a trend of increased expression of TNF alpha and MCP-1.
[0095] Specifically, the supernatant of the strain is added to THP-1 cells carrying a reporter gene of the IFN beta gene promoter that has been constructed, and MNH30639 can significantly promote the transcriptional activity of IFN beta, and has potential functions in immune regulation, antiviral, and antitumor.
[0096] 4. The strain provided in the present application can inhibit the activity of histone deacetylase, and further has potential effects on T cell activation and antitumor.
[0097] Specifically, the supernatant of MNH30639 has a significant inhibitory effect on HDAC activity.
[0098] 5. The strain provided in the present application can inhibit tumor cell growth, including one or more of the following: inhibiting tumor volume growth; inhibiting tumor weight increase; inhibiting tumor cell growth; increasing tumor growth inhibition rate; increasing tumor response rate to treatment; playing an antitumor role by inhibiting MDSC cells and relieving immune suppression in the tumor microenvironment; and increasing the proportion of M1 macrophages in tumor tissue serum tumor associated material (TAM), activating local immunity of the tumor, and playing an antitumor role.
[0099] Specifically, after H22 mouse hepatoma cells are inoculated into mice to grow into tumors subcutaneously, the tumor volume and weight are significantly lower than those of the control group, the tumor growth inhibition rate and response rate are significantly higher than those of the control group, the MDSC cells in the tumor tissue are significantly down-regulated, and the proportion of M1 macrophages is up-regulated, thereby having a significant inhibitory effect on tumor growth.
[0100] Specifically, the supernatant of the strain is added to human colorectal cancer cells for culture, and the strain has a significant inhibitory effect on human colorectal cancer cells, and is effective on both microsatellite stable and microsatellite unstable colorectal cancer cells.
[0101] 6. Improve the therapeutic effect of immunosuppressive drugs, such as PD-1 inhibitors.
[0102] Specifically, the combination of anti-PD-1 antibody and the strain is used for treating tumors, especially refractory tumors, such as lung cancer model mice, and the tumor volume of the combination group is significantly down-regulated compared with the use of anti-PD-1 antibody alone, the tumor volume is reduced, and the response rate is significantly improved.
[0103] In summary, the strain can promote macrophage differentiation, induce increased expression of inflammatory cytokines, promote IFNβ transcriptional activity, enhance immune activity; and the strain can produce short-chain fatty acids including acetic acid, inhibit histone deacetylase activity; can inhibit tumor cell growth, such as liver cancer and colorectal cancer, can significantly reduce the size and weight of the tumor, and can especially improve the response rate of lung cancer model mice to immunotherapy drugs. It has good application prospects in immunomodulation, antitumor or adjuvant of antitumor drugs. Through the combination of new drug development, diagnostic technology and treatment technology, it is expected to bring huge industrial ripple effects. BRIEF DESCRIPTION OF DRAWINGS
[0104] Figure 1 shows the microscopic morphology of the strain MNH30639.
[0105] Figure 2 shows the columnar distribution of the optical density (OD) value of the strain MNH30639 under different pH conditions.
[0106] Figure 3 shows the columnar distribution of the optical density (OD) value of the strain MNH30639 under different NaCl content conditions.
[0107] Figure 4 shows the columnar distribution of the optical density (OD) value of the strain MNH30639 under different bile salt content conditions.
[0108] Figure 5 shows the phylogenetic tree of the strain MNH30639.
[0109] Figure 6 shows the columnar distribution of the cytokine concentration (pg / mL) in the supernatant of macrophages in the presence of the strain MNH30639. Figures 6A-6G are columnar distribution of IL-6, IL-12 / IL-13P40, IL-1β, IL-8, MCP-1, RANTES, and IL-10 concentration (pg / mL), respectively.
[0110] Figure 7 shows the columnar distribution of the cytokine concentration (pg / mL) in the supernatant of peripheral blood mononuclear cells PBMC in the presence of the strain MNH30639. Figures 7A-7G are columnar distribution of TNF-α, RANTES, IL-8, MCP-1, IL-1β, IP-10, and IL-6 concentration (pg / mL), respectively.
[0111] Figure 8 shows the columnar distribution of the relative fluorescence value (Relative LuMinescence) of IFNβ expression in the presence of the strain MNH30639.
[0112] Figure 9 shows the columnar distribution of the relative activity of deacetylase (Histone deacetylases, HDAC) in the presence of the strain MNH30639.
[0113] Figure 10 shows the tumor volume curve of H22 hepatocarcinoma model mice in the experimental group and the control group when using strain MNH30639 alone. The abscissa represents days, and the ordinate represents the average tumor volume. The data in the figure are shown as mean ± standard deviation (mean ± SD), and statistical analysis is analyzed by two-way ANOVA (2way ANOVA) with Sidak multiple comparison, and the significant difference is represented by *, p < 0.05.
[0114] Figure 11 shows the columnar distribution of the end-point tumor volume of H22 hepatocarcinoma model mice in group A (MNH30639) and group B (control group) at the end of the experiment when using strain MNH30639 alone. The data in the figure are shown as mean ± standard deviation (mean ± SD), and statistical analysis is analyzed by t test (Student’s t test) analysis method, and the significant difference is represented by *, p < 0.05, **p < 0.01.
[0115] Figure 12 shows the columnar distribution of the tumor inhibition rate of H22 hepatocarcinoma model mice in group A (MNH30639) and group B (control group) at the end of the experiment when using strain MNH30639 alone. The data in the figure are shown as mean ± standard deviation (mean ± SD), and statistical analysis is analyzed by t test (Student’s t test) analysis method, and the significant difference is represented by *, p < 0.05, **p < 0.01.
[0116] Figure 13 shows the tumor volume curve of H22 hepatocarcinoma model mice in group A (MNH30639) and group B (control group) at the end of the experiment when using strain MNH30639 alone. Figure 13A is group A (MNH30639), and Figure 13B is group B (control group). The data in the figure are shown as mean ± standard deviation (mean ± SD), and statistical analysis is analyzed by t test (Student’s t test) analysis method, and the significant difference is represented by *, p < 0.05, **p < 0.01.
[0117] Figure 14 shows the average proportion of immune cells in the tumor tissue of H22 hepatocarcinoma model mice in the experimental group and the control group at the end of the experiment when using strain MNH30639 alone. Figure 14A shows the proportion of MDSC cells in the tumor tissue, and Figure 14B shows the proportion of M1 macrophages in the tumor tissue. The data are analyzed by CyExpert, and the statistical processing is performed by Graphpad Prism V9. Statistical analysis is analyzed by T test (Student’s t test), *p < 0.05, **p < 0.01, ***p < 0.001.
[0118] Figure 15 shows the tumor volume curve of C57BL / 6J lung cancer model mice in each group at different intervention time points when anti-PD-1 antibody is combined with MNH30639. The abscissa is days, and the ordinate is the average tumor volume. The data are presented as mean ± standard deviation (MM3) of the tumor volume of mice. Statistical analysis was performed by two-way ANOVA and Dunnett's multiple comparison analysis at the end of the experiment. Significant analysis: no significant difference (ns), p value ≥ 0.05; *, p value < 0.05; **, p value < 0.01; ***, p value < 0.001; ****, p value < 0.0001, compared with group A (negative control).
[0119] Figure 16 shows the columnar distribution of the endpoint tumor volume of C57BL / 6J lung cancer model mice in each group at the end of the experiment. The data are presented as mean ± standard deviation (MM3) of the tumor volume of mice. Statistical analysis was performed by two-way ANOVA and Dunnett's multiple comparison analysis at the end of the experiment. Significant analysis: no significant difference (ns), p value ≥ 0.05; *, p value < 0.05; **, p value < 0.01; ***, p value < 0.001; ****, p value < 0.0001, compared with group A (negative control).
[0120] Figure 17 shows the columnar distribution of the tumor inhibition rate of C57BL / 6J lung cancer model mice in each group at the end of the experiment. The data are presented as mean ± standard deviation (MM3) of the tumor volume of mice. Statistical analysis was performed by two-way ANOVA and Dunnett's multiple comparison analysis at the end of the experiment. Significant analysis: no significant difference (ns), p value ≥ 0.05; *, p value < 0.05; **, p value < 0.01; ***, p value < 0.001; ****, p value < 0.0001, compared with group A (negative control).
[0121] Figure 18 shows the response rate of C57BL / 6J lung cancer model mice when anti-PD-1 antibody is combined with MNH30639. Figure 18A is group A (negative control), Figure 18B is the growth curve of C57BL / 6J lung cancer model mice when anti-PD-1 antibody is used alone, and Figure 18C is the growth curve of C57BL / 6J lung cancer model mice when combined with MNH30639. The data are shown as single mouse tumor volume (MM3).
[0122] Figure 19 shows the tumor volume growth curve of each group of BALB / c liver cancer model mice using different doses of strain MNH30639. The horizontal axis represents days, and the vertical axis represents the average tumor volume. The data in the figure are shown as mean ± standard deviation (mean ± SD), and statistical analysis is performed using two-way ANOVA with Dunnett's multiple comparison analysis. Significant differences are indicated by *, p < 0.05.
[0123] Figure 20 shows the columnar distribution of the endpoint tumor volume of each group of BALB / c liver cancer model mice at the end of the experiment using different doses of strain MNH30639. The data in the figure are shown as mean ± standard deviation (mean ± SD), and statistical analysis is performed using one-way ANOVA with Dunnett's multiple comparison analysis. Significant differences are indicated by *, p < 0.05, **, p < 0.01, and no significant difference is not indicated.
[0124] Figure 21 shows the columnar distribution of the tumor growth inhibition (TGI) of each group of BALB / c liver cancer model mice at the end of the experiment using different doses of strain MNH30639. The data in the figure are shown as mean ± standard deviation (mean ± SD), and statistical analysis is performed using one-way ANOVA with Dunnett's multiple comparison analysis. Significant differences are indicated by *, p < 0.05, **, p < 0.01, and no significant difference is not indicated.
[0125] Figure 22 shows the columnar graph of the endpoint tumor volume of BALB / c liver cancer model mice when anti-PD-1 antibody is combined with MNH30639. The data in the figure are shown as mean ± standard deviation (mean ± SD), and statistical analysis is performed using one-way ANOVA with Dunnett's multiple comparison analysis. Significant differences are indicated by *, p < 0.05, **, p < 0.01, and no significant difference is not indicated.
[0126] Figure 23 shows the columnar graph of the tumor growth inhibition (TGI) of BALB / c liver cancer model mice when anti-PD-1 antibody is combined with MNH30639. The data in the figure are shown as mean ± standard deviation (mean ± SD), and statistical analysis is performed using one-way ANOVA with Dunnett's multiple comparison analysis. Significant differences are indicated by *, p < 0.05, **, p < 0.01, and no significant difference is not indicated.
[0127] Figure 24 shows the tumor volume curve of H22 liver cancer model mice in group A (negative control), group B (PD-1), and group C (MNH30609 + PD-1). The data in the figure are shown as mean ± standard deviation (mean ± SD), and the response rate is calculated.
[0128] Figure 25 shows the column chart of the endpoint tumor volume of BALB / c colorectal cancer model mice when anti-PD-1 antibody is combined with MNH30639. The data in the figure is shown as mean ± standard deviation (mean ± SD), statistical analysis is analyzed by one way ANOVA with Dunnett's multiple comparison, the significant difference is indicated by *, *p<0.05, **p<0.01, no significant, not indicated.
[0129] Figure 26 shows the column chart of the endpoint tumor growth inhibition (TGI) of BALB / c colorectal cancer model mice when anti-PD-1 antibody is combined with MNH30639. The data in the figure is shown as mean ± standard deviation (mean ± SD), statistical analysis is analyzed by one way ANOVA with Dunnett's multiple comparison, the significant difference is indicated by *, *p<0.05, **p<0.01, no significant, not indicated.
[0130] Figure 27 shows the tumor volume curve change graph of BALB / c liver cancer model mice when MNH30639 freeze-dried powder (FDS) is combined with anti-PD-1 antibody. The abscissa is days, and the ordinate is the average tumor volume. The data in the figure is shown as mean ± standard deviation (mean ± SD), statistical analysis is analyzed by two-factor variance (2way ANOVA) with Dunnett's multiple comparison, the significant difference is indicated by *, *p<0.05.
[0131] Figure 28 shows the column chart of the endpoint tumor volume of BALB / c colorectal cancer model mice when anti-PD-1 antibody is combined with MNH30639-FDS. The data in the figure is shown as mean ± standard deviation (mean ± SD), statistical analysis is analyzed by one way ANOVA with Dunnett's multiple comparison, the significant difference is indicated by *, *p<0.05, **p<0.01, no significant, not indicated.
[0132] Figure 29 shows the column chart of the endpoint tumor growth inhibition (TGI) of BALB / c colorectal cancer model mice when anti-PD-1 antibody is combined with MNH30639-FDS. The data in the figure is shown as mean ± standard deviation (mean ± SD), statistical analysis is analyzed by one way ANOVA with Dunnett's multiple comparison, the significant difference is indicated by *, *p<0.05, **p<0.01, no significant, not indicated.
[0133] Figure 30 shows the tumor volume curve of CT-26 colorectal cancer model mice in group A (negative control), group B (PD-1) and group C (MNH30609-FDS + PD-1). The data in the figure are shown as mean ± standard deviation (mean ± SD), and the response rate is calculated.
[0134] Figure 31 shows the average cell viability of colorectal cancer cells in the presence of strain MNH30639. Figure 31A shows the activity of SW480 cells, and Figure 31B shows the activity of HCT116 cells.
[0135] Figure 32 shows the tumor volume curve of liver cancer model mice in the presence of strain MNH30639. Figure 32A shows the tumor volume curve of liver cancer mouse homologous tumor model, and Figure 32B shows the tumor inhibition rate of liver cancer model mice.
[0136] Figure 33 shows the results of flow cytometry analysis of CD8+ T cell TNF-α. Figure 33A is a comparison between MM01 and MNH30639, and Figure 33B is a statistical result of 34A.
[0137] Figure 34 shows the results of QPCR detection of M2 marker CD206 and Arg1 expression in RAW264.7 cells. DETAILED DESCRIPTION
[0138] In order to make the purpose, technical solutions and advantages of the present application clearer, the present application will be further described in detail below in combination with examples. The specific examples described herein are only used to explain the present application and do not constitute any limitation on the present application. In addition, in the following description, the description of well-known structures and techniques is omitted to avoid unnecessary confusion of the concept of the present application. Such structures and techniques are also described in many publications.
[0139] Multiple studies have shown that histone acetylation plays an important role in the occurrence and development of tumors. Short-chain fatty acids (SCFA) mediated histone deacetylase (HDAC) inhibition can achieve anti-tumor effect by regulating the body's immune response. Studies have shown that in vitro treatment of human macrophages with acetate significantly reduced their overall HDAC activity and increased overall histone acetylation associated with reduced production of inflammatory cytokines IL-6, IL-8 and TNFa. Similarly, butyrate and propionate reduced LPS-induced TNFa production in human peripheral blood mononuclear cells in vitro in a manner similar to trichostatin A (TSA). These results suggest that in rodents and humans, SCFA can effectively control the release of pro-inflammatory cytokines by inhibiting HDAC. Activation of NF-κB is one of the main pathways for the release of inflammatory cytokines. Butyrate and propionate reduce NF-κB activity in monocytes in a similar manner to TSA, indicating that the anti-inflammatory effects of SCFA can be mediated by regulating NF-κB through HDAC inhibition. These properties of SCFAs enhance their immunomodulatory effects and support anti / pro-inflammatory hemostasis. SCFAs have local functions in the gut with bacterial colonization of the gut, affecting gut immune cells and regulating the immune system through the multi-protein inflammasome complex. SCFAs are essential for immune regulation. Butyrate has systemic anti-inflammatory functions by changing the adhesion, migration and cytokine expression of immune cells, and affecting cell processes such as proliferation, activation and apoptosis.
[0140] In recent years, histone deacetylase inhibitors (HDACIs) are considered a new type of anticancer drug. They can promote the differentiation and apoptosis of cancer cells, prevent cell cycle, and inhibit angiogenesis. SCFA, as a histone deacetylase inhibitor, can induce the differentiation and apoptosis of tumor cells, and has an anticancer effect.
[0141] Definitions
[0142] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The following definitions are applied, for the purpose of interpreting this specification, and the singular form also includes the plural form, and vice versa, as appropriate, unless otherwise indicated.
[0143] The expressions "one" and "a" as used herein, unless otherwise indicated, include plural referents.
[0144] The term "about" as used herein is as understood by one of ordinary skill in the art and varies according to the context in which it is used. If one of ordinary skill in the art is not aware of the context in which the term is used, "about" will mean the particular value up to plus or minus 10%.
[0145] The term "increase" or "boost" or "enhance" as used herein refers to a change such that depending on the case, the difference is at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 2-fold, 4-fold, 10-fold, 100-fold, 10 3 fold, 10 4 fold, 10 5 fold, 10 6 fold, and / or 10 7 fold after treatment compared to the pre-treatment state. Properties that can be increased include the number of immune cells, bacterial cells, stromal cells, myeloid-derived suppressor cells, fibroblasts, metabolites; levels of cytokines; or other physical parameters (e.g., tumor size).
[0146] The term "decrease" or "reduce" or "lower" as used herein refers to a change such that depending on the case, the difference is at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% with the pre-treatment state compared to the post-treatment state, 90%, 1 / 100, 1 / 1000, 1 / 10,000, 1 / 100,000, 1 / 1,000,000, or not detectable. Properties that can be decreased include the number of immune cells, bacterial cells, stromal cells, myeloid-derived suppressor cells, fibroblasts, metabolites; levels of cytokines; or other physical parameters (e.g., tumor size).
[0147] The term "HDACs (Histone Deacetylase)" as used herein can specifically remove acetyl groups on lysines in histones and non-histone proteins, thereby inhibiting or promoting transcriptional activity, depending on the cellular promoter and chromatin state. HDACs are generally classified into four classes according to homology with the yeast histone deacetylases: Class I (HDAC1, 2, 3, and 8), Class II (HDAC4, 5, 6, 7, 9, and 10), Class III (SIRH-7), and Class IV (HDAC11).
[0148] The term "metabolite" as used herein refers to a compound, composition, molecule, ion, co-factor, catalyst, or nutrient from any cellular or microbial metabolic reaction used as a substrate or as a product in any cellular or microbial metabolic reaction. In some embodiments, metabolites of the strains described herein include short chain fatty acids, such as acetic acid, propionic acid, isobutyric acid, butyric acid, or isovaleric acid.
[0149] The term "immunotherapy" as used herein refers to a process of aiding in the treatment of a disease by inducing, enhancing or suppressing an immune response in a cell, tissue or organ.
[0150] The term "immunotherapeutic drug" as used herein refers to an active substance for immunotherapy, including but not limited to immune checkpoint molecule modulators (e.g., anti-PD-1 antibodies, anti-CTLA-4 antibodies, anti-PD-L1 antibodies, PD-L1 inhibitors; the PD-L1 inhibitors include durvalumab, atezolizumab or avelumab; the anti-PD-1 antibodies or anti-PD-L1 antibodies include pembrolizumab, tepilumab, sintilimab, tislelizumab or camrelizumab or nivolumab; the anti-CTLA-4 antibodies are ipilimumab), interleukins (e.g., IL-2, IL-7, IL-12, IL-15), cytokines (e.g., interferons, G-CSF, imiquimod), chemokines (e.g., CCL3, CCL26, CXCL7), vaccines (e.g., peptide vaccines, dendritic cell (DC) vaccines, EGFRvIII vaccines, mesothilin vaccines, G-VAX, Listeria vaccines).
[0151] The term "isolated" or "purified" as used herein refers to a bacterium or other entity or substance that has been: (1) separated from at least some of the components with which it was associated when initially produced (whether in nature or in an experimental setting), and / or (2) produced, prepared, purified and / or manufactured by the hand of man. Isolated or purified bacteria can be separated from at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90% or more of the other components with which they were originally associated.
[0152] A "strain" refers to a member of a bacterial species that has genetic characteristics that allow it to be distinguished from closely related members of the same bacterial species. The genetic characteristics can be the absence of all or part of at least one gene, the absence of all or part of at least one regulatory region (e.g., promoter, terminator, riboswitch, ribosome binding site), the absence of at least one native plasmid ("curing"), the presence of at least one recombinant gene, the presence of at least one mutated gene, the presence of at least one exogenous gene (a gene from another species), the presence of at least one mutated regulatory region (e.g., promoter, terminator, riboswitch, ribosome binding site), the presence of at least one non-native plasmid, the presence of at least one antibiotic resistance cassette, or a combination thereof. Genetic characteristics between different strains can be identified by PCR amplification, optionally followed by DNA sequencing of the genomic region of interest or the entire genome. In cases where a strain gains or loses antibiotic resistance or gains or loses biosynthetic capabilities (e.g., an auxotrophic strain) compared to another strain of the same species, the strains or nutrients / metabolites can be distinguished by selection or counter-selection using antibiotics. The term "enteric strain" as used herein refers to a strain that is present in the digestive tract, in particular a strain that is specifically present in the intestine, wherein such enteric microorganism can be one or more selected from the group consisting of Bacteroides, Actinomyces, Firmicutes, Bifidobacterium, Lactobacillus, Betaproteobacteria, Deltaproteobacteria, Gammaproteobacteria, Epsilonproteobacteria, and Enterobacteriaceae.
[0153] The term "colony forming unit" (cfu) as used herein refers to an estimate of the number of viable microbial cells in a given sample.
[0154] The term "colony" as used herein refers to a macroscopically visible, morphologically, architecturally, etc. characterized group of daughter cells of a single cell that has grown and multiplied to a certain extent on the surface of a solid culture medium.
[0155] The term "gram-positive bacteria" as used herein refers to bacterial cells that stain purple (positive) in a Gram stain assay. The Gram stain binds to the abundant peptidoglycan in the cell wall of gram-positive bacteria. In contrast, the cell wall of "gram-negative bacteria" has a thin layer of peptidoglycan, so gram-negative bacteria do not retain the stain and allow the counterstain in the Gram stain assay to be absorbed.
[0156] The term "tolerant" as used herein refers to the viability of an organism in a particular environmental factor (e.g., temperature, light, pH, salt concentration, etc.).
[0157] As used herein, the term "16S rRNA" or "16S ribosomal ribonucleic acid" is ubiquitous in prokaryotic cells, and has high content and copy number (more than 80% of total bacterial RNA), is easy to obtain template, has high functional homology, and has moderate genetic information, and is suitable as a standard for bacterial diversity analysis. When the 16S rRNA gene sequence similarity of two strains is less than 99%, they can be judged to belong to different species; when the 16S rRNA gene sequence similarity of two strains is less than 95%, they can be judged to belong to different genera.
[0158] As used herein, the term "sequence identity" refers to the degree of identity between two amino acid or nucleotide sequences (e.g., a query sequence and a reference sequence), generally expressed as a percentage. Typically, before calculating the percentage of identity between two amino acid or nucleotide sequences, sequence alignment is performed and gaps (if any) are introduced. If the amino acid residues or bases in the two sequences are the same at a certain alignment position, the two sequences are considered to be identical or matched at that position; if the amino acid residues or bases in the two sequences are different, the two sequences are considered to be not identical or mismatched at that position. In some algorithms, the number of matching positions is divided by the total number of positions in the alignment window to obtain sequence identity. In other algorithms, the number and / or length of gaps are also taken into account. Commonly used sequence alignment algorithms or software include DANMAN, CLUSTALW, MAFFT, BLAST, MUSCLE, etc. For the purposes of the present application, the published alignment software BLAST (available at https: / / www.ncbi.nlm.nih.gov / ) can be used to obtain the best sequence alignment and calculate the sequence identity between two amino acid or nucleotide sequences by using the default settings.
[0159] As used herein, the term "Average nucleotide identity (ANI)" refers to the similarity of homologous genes between two bacterial genomes, which has the advantages of convenience, low error rate and high resolution, and is commonly used to solve the problem of microbial classification.
[0160] As used herein, the term "unit dose" refers to the unit dose form commonly used in pharmaceutical formulation, such as unit dose tablets, capsules, granules, oral solutions, etc. For tablets, the unit dose refers to each tablet; for capsules, the unit dose refers to each capsule; for granules, the unit dose refers to each bag (package); for oral solutions, the unit dose refers to each bottle (vial).
[0161] The terms "administering" or "administration" as used herein refer broadly to the route by which a composition (e.g., a pharmaceutical composition) is given to a subject. Examples of routes of administration include oral administration, rectal administration, topical administration, inhalation (nasal) or injection. Injection administration includes intravenous (IV), intramuscular (IM), intratumoral (IT) and subcutaneous (SC) administration. The compositions described herein can be administered by any effective route in any form, including, but not limited to, intratumorally, orally, parenterally, enterally, intravenously, intraperitoneally, topically, transdermally (e.g., using any standard patch), intradermally, intraocularly, intranasally, locally, non-orally, e.g., aerosol, inhalation, subcutaneously, intramuscularly, buccal, sublingual, (trans)rectal, vaginal, intraarterially, and intrathecally, the pharmaceutical compositions described herein are administered orally, rectally, intratumorally, topically, intravesically, by injection into or near a draining lymph node, intravenously, by inhalation or aerosol, or subcutaneously.
[0162] In another preferred embodiment, the compositions described herein are administered orally, intratumorally, or intravenously. The pharmaceutical compositions described herein are administered orally, rectally, intratumorally, topically, intravesically, by injection into or near a draining lymph node, intravenously, by inhalation or aerosol, or subcutaneously.
[0163] In another preferred embodiment, the pharmaceutical compositions described herein are administered orally, intratumorally, or intravenously.
[0164] The term "antibiotic" as used herein refers to a substance used to treat and / or prevent bacterial infection by killing bacteria, inhibiting the growth of bacteria, or reducing the viability of bacteria. "Antibiotic susceptibility" refers to the degree to which a bacterium is susceptible to an antimicrobial. Different pathogenic bacteria have different susceptibilities to different antimicrobials. A bacterium is "susceptible" to an antimicrobial if it is inhibited or killed by that antimicrobial at a small dose; conversely, it is "not susceptible" or has "antibiotic resistance."
[0165] The term "toxic gene" as used herein refers to a gene in a microbial genome that encodes a gene that is capable of causing a toxic response to a host. These genes cause a toxic effect by encoding a specific protein or expressing a non-coding RNA. Toxic genes are widespread in various organisms.
[0166] The term "metabolic gene cluster" as used herein refers to genes from multiple different enzyme families involved in the same metabolic pathway that are distributed in close proximity or adjacent to each other on the same chromosome.
[0167] The term "short chain fatty acid" as used herein generally refers to a fatty acid having no more than ten carbon atoms, preferably no more than six carbon atoms and having a fatty acid. A "fatty acid" is a carboxylic acid having an aliphatic tail (or aliphatic chain) and can be saturated or unsaturated. Short chain fatty acids can include fatty acids having 1 carbon atom, 2 carbon atoms, 3 carbon atoms, 4 carbon atoms, 5 carbon atoms, 6 carbon atoms, or more. Examples of short chain fatty acids include, but are not limited to, formic acid, acetic acid, propionic acid, butyric acid, isobutyric acid, valeric acid, isovaleric acid, caproic acid, and can also include salts or esters thereof. In the present application, unless otherwise specified, when referring to "butyric acid," n-butyric acid is meant, when referring to "valeric acid," n-valeric acid is meant, and when referring to "caproic acid," n-caproic acid is meant.
[0168] The term "composition" as used herein can be prepared into a dosage form suitable for use in the compositions of the present application using techniques well known to those skilled in the art. Dosage forms include, but are not limited to, solutions, emulsions, suspensions, powders, lozenges, pills, troches, tablets, chewing gum, capsules, aerosol sprays, and other similar or suitable dosage forms for use in the present application.
[0169] The term "macrophage" as used herein refers to a cell having phagocytic ability, including, but not limited to, macrophages, neutrophils, and the like. The term "macrophage" is a type of white blood cell found in tissues that originates from monocytes.
[0170] The term "cytokine" as used herein refers to a protein released by a cell population that acts as an intercellular mediator on another cell or has autocrine effects on the cell producing the protein. Examples of such cytokines include lymphokines, monokines; interleukins ("IL", such as IL-1, IL-1 alpha, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL 10, IL-11, IL-12, IL-13, IL-15, IL-17A-F, IL-18, IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-28, IL-29, IL-31, including PROLEUKIN rIL-2); tumor necrosis factors (such as TNF-alpha or TNF-beta, TGF-beta 1, TGF-beta 2, TGF-beta 3).
[0171] The term "interferon (IFN) receptor protein" as used herein refers to a class of cytokines secreted by host cells that modulate immune responses. Viruses, bacterial endotoxins, synthetic double-stranded RNAs, and the like can stimulate the production of interferons. IFNβ belongs to type I interferons, which can promote the activity of NK cells, macrophages, T lymphocytes, thereby exerting anti-viral, anti-tumor, immunomodulatory, and the like effects.
[0172] The term "histone deacetylase" and "HDAC" as used herein means any one of the family of enzymes that can remove acetyl groups from lysine residues on the N-terminus of histones. Unless otherwise indicated herein, the term "histone" means any histone protein from any species, including H1, H2A, H2B, H3, H4, and H5. Human HDAC proteins or gene products include, but are not limited to, HDAC-1, HDAC-2, HDAC-3, HDAC-4, HDAC-5, HDAC-6, HDAC-7, HDAC-8, HDAC-9, HDAC-10, and HDAC-11.
[0173] The term "histone deacetylase inhibitor" or "inhibitor of histone deacetylase" as used herein is intended to refer to a compound that can interact with a histone deacetylase and inhibit its activity, particularly its enzymatic activity. Inhibiting the activity of a histone deacetylase is intended to mean decreasing the activity of a histone deacetylase to remove acetyl groups from histones. Such inhibition is preferably specific, i.e., the histone deacetylase can decrease the activity of a histone deacetylase to remove acetyl groups from histones at a concentration that is lower than that required to produce some unrelated biological effect.
[0174] The term "myeloid-derived suppressor cells (MDSCs)" as used herein are pathologically activated neutrophils and monocytes with potent immunosuppressive activity. They are involved in the modulation of immune responses in many pathological conditions and are strongly associated with poor clinical outcomes in cancer. MDSCs interact with other immune cell types, including T cells, dendritic cells, macrophages, and natural killer cells, to modulate their function. Myeloid-derived suppressor cells can both suppress the cytotoxic activity of natural killer (NK) cells and NKT cells and suppress CD4+ and CD8+ T cell-mediated adaptive immune responses. Although the mechanisms of their action are not yet clear, clinical and experimental evidence suggests that cancer tissues with high infiltration of myeloid-derived suppressor cells are associated with poor prognosis and resistance to therapy in patients.
[0175] The term "subject" as used herein refers to any mammal. A subject or patient described as "in need of" refers to a human in need of treatment (or prevention) of a disease. Mammals (i.e., mammals) include humans, laboratory animals (e.g., primates, rats, mice), farm animals (e.g., cows, sheep, goats, pigs) and household pets (e.g., dogs, cats, rodents). The subject can be a human. The subject can be a non-human mammal, including but not limited to a dog, a cat, a cow, a horse, a pig, a donkey, a goat, a camel, a mouse, a rat, a guinea pig, a sheep, a camel, a monkey, a gorilla, or a chimpanzee. The subject or patient can be healthy, or can have a metabolic disease at any stage of development.
[0176] The term "treat" a disease in a subject or "treat" a subject having or suspected of having a disease, as used herein, refers to administering a drug treatment to the subject, e.g., administering one or more agents, to thereby reduce or prevent worsening of at least one symptom of the disease. Thus, in one embodiment, "treat" refers to, inter alia, delaying progression, accelerating remission, inducing remission, increasing remission, accelerating recovery, increasing efficacy of, or decreasing resistance to, alternative therapies, or combinations thereof.
[0177] The term "prevent" as used herein is art-recognized and, when used in connection with a condition such as local recurrence, is well-understood in the art and includes administration that reduces or delays the onset of symptoms of a medical condition in a subject relative to a subject that does not receive the composition. Thus, prevention of cancer includes, e.g., reducing the number of detectable tumors in a patient population that receives prophylactic treatment relative to an untreated control population, and / or delaying the appearance of detectable tumors in a treated population relative to an untreated control population, e.g., by a statistically and / or clinically significant amount. The compositions of the present application can be administered as a food, e.g., a nutritional supplement. Generally, the compositions of the present application are used to treat humans, although they can be used to treat animals, including monogastric mammals, e.g., poultry, swine, cats, dogs, horses, or rabbits. The compositions of the present application can be used to enhance the growth and performance of animals. If administered to an animal, oral gavage can be used.
[0178] The term "response rate" as used herein in the context of solid tumors refers to the extent of tumor volume reduction at a given time point, e.g., 23 days.
[0179] The term "supernatant," "sterile supernatant," or "culture supernatant" as used herein refers to the remaining portion after removal of the bacterial cells from a bacterial culture, which contains various metabolites produced by the bacteria. Methods for obtaining supernatant from cell cultures can include centrifugation and / or sterile filtration.
[0180] The term "co-administration" as used herein refers to the administration of the above pharmaceutical combination in a manner that the individual active ingredients are administered to the subject simultaneously or within a period of time in which the active ingredients can act synergistically.
[0181] The compositions provided herein can comprise a pharmaceutically acceptable excipient, diluent or carrier. Acceptable carriers or diluents for therapeutic use are well known in the pharmaceutical art, and are described, e.g., in Remington's Pharmaceutical Sciences, Mack Publishing Company, New Jersey. Examples of suitable carriers, excipients, or diluents include lactose, starch, glucose, methyl cellulose, magnesium stearate, mannitol, sorbitol, and the like. Examples of suitable diluents include ethanol, glycerol, and water. The choice of pharmaceutical carrier, excipient, or diluent can be selected with respect to the intended route of administration and standard pharmaceutical practice. The pharmaceutical compositions can comprise as
[0182] In certain embodiments, the bacterial strain in the above compositions provided herein is lyophilized. In certain embodiments, the bacterial strain in the above pharmaceutical compositions provided herein is spray-dried. In certain embodiments, the bacterial strain in the above pharmaceutical compositions provided herein is lyophilized or spray-dried and wherein it is viable. In certain embodiments, the bacterial strain in the above pharmaceutical compositions provided herein is lyophilized or spray-dried and wherein it is capable of partially or completely colonizing the intestine. In certain embodiments, the lyophilized bacterial strain is reconstituted prior to administration in some cases. In some cases, reconstitution is performed by using a diluent as described herein.
[0183] In some embodiments, the pharmaceutical composition provided by the present application is administered orally. Oral administration can involve swallowing, so that the compound enters the gastrointestinal tract, and / or buccal, lingual, or sublingual administration by which the compound enters the blood stream directly from the mouth. Pharmaceutical dosage forms suitable for oral administration include solid tablets, solid particles, semi-solid and liquid (including multiple or dispersed systems), such as capsules; soft or hard gelatin capsules; lozenges (including liquid filled); chews; gels; fast dispersing dosage forms; ovules; sprays; and buccal / mucoadhesive patches.
[0184] In some embodiments, the pharmaceutical formulation is an enteric formulation, i.e., a formulation resistant to gastric juices (e.g., resistant to stomach pH) suitable for delivering the composition of the present application to the intestine by oral administration. Enteric formulations can be particularly useful when the bacteria or another component of the composition is sensitive to acid, e.g., susceptible to degradation under stomach conditions.
[0185] In some embodiments, the enteric formulation comprises an enteric coating. In some embodiments, the formulation is an enteric coated dosage form. For example, the formulation can be an enteric tablet or enteric capsule, etc. The enteric coating can be a conventional enteric coating, e.g., a conventional coating for tablets, capsules, etc. for oral delivery. The formulation can comprise a film coating, e.g., a film layer of an enteric polymer, e.g., an acid insoluble polymer. In some embodiments, the enteric formulation is enteric in nature, e.g., gastroenteric, without the need for an enteric coating. In some embodiments, the formulation is an inherently enteric capsule.
[0186] In some embodiments, the formulation is a soft capsule. Soft capsules are capsules that have a certain elasticity and softness due to the addition of softening agents such as glycerol, sorbitol, maltitol and polyethylene glycol present in the capsule shell. Soft capsules can be produced, for example, on a gelatin or starch basis. Gelatin-based soft capsules are commercially available from various suppliers. Depending on the method of administration, e.g., oral or rectal administration, soft capsules can have various shapes, which can be, for example, round, oval, oblong or torpedo-shaped. Soft capsules can be produced by conventional processes, for example, by the Scherer process, the Accogel process or the drop or blow molding process.
[0187] In certain embodiments, the composition of the present application is administered to the gastrointestinal tract through a tube, e.g., a nasogastric tube, an orogastric tube, a gastric tube, a jejunostomy tube (J-tube), a percutaneous endoscopic gastrostomy (PEG), or a port, e.g., a chest wall port leading to the stomach, the jejunum, and other suitable access ports.
[0188] In certain embodiments of the application, the treatment according to the application is accompanied by an evaluation of the patient's intestinal microbiota. If the strain transfer and / or partial or complete colonization according to the application is not achieved, and thus no efficacy is observed, the treatment can be repeated if the transfer and / or partial or complete colonization is successful and efficacy is observed, the treatment can be stopped.
[0189] The term "electrostatic spraying" as used herein refers to the formation of droplets and charging of the fluid to be sprayed by means of a high-voltage, electrostatic device, the surface of the charged droplets forming escaping, atomized small droplets as a result of the high electrostatic field.
[0190] The following examples and figures are provided to aid the understanding of the present application, but should not be construed as limiting in any way. Indeed, various modifications and changes can be made thereto without departing from the spirit of the present application. The scope of the present application is defined by the appended claims.
[0191] Examples
[0192] Some of the medium components involved in the examples of the present application are as follows:
[0193] MM01 liquid medium, components: peptone 5 g / L, trypticase 5 g / L, yeast extract 10 g / L, beef extract 5 g / L, glucose 5 g / L, K2HPO4 2 g / L, Na-acetate 2 g / L, Tween 80 1 mL / L, hemin 5 mg / L, L-cysteine hydrochloride 0.5 g / L, vitamin K1 1 μL / L, inorganic salt solution 8 ml / L (including CaCl20.25 g, K2HPO41 g, KH2PO41 g, MgSO40.5 g, NaHCO 10 g, NaCl 2 g per 1 L).
[0194] MM01 solid medium, components: peptone 5 g / L, trypticase 5 g / L, yeast extract 10 g / L, beef extract 5 g / L, glucose 5 g / L, K2HPO4 2 g / L, Na-acetate 2 g / L, Tween 80 1 mL / L, hemin 5 mg / L, L-cysteine hydrochloride 0.5 g / L, vitamin K1 1 μL / L, inorganic salt solution 8 ml / L (including CaCl20.25 g, K2HPO41 g, KH2PO41 g, MgSO40.5 g, NaHCO 10 g, NaCl 2 g per 1 L), agar 15 g / L.
[0195] AC liquid medium, components: peptone 20 g / L, glucose 5 g / L, yeast extract 3 g / L, beef extract 3 g / L, vitamin C 0.2 g / L, pH 7.0.
[0196] Anaerobic Blood Agar plates (purchased from Hangzhou Microorganism Science and Technology Co., Ltd.) with the following composition: casein enzymatic digest 10 g / L, heart-pancreatic digest 3 g / L, corn starch 1 g / L, meat peptone 5 g / L, yeast extract 5 g / L, sodium chloride 5 g / L, agar 15 g / L, sterile defibrinated sheep blood 50-100 mL / L, distilled water 1000 mL, final pH 7.3 ± 0.2.
[0197] Columbia Blood Agar plates (purchased from Hangzhou Microorganism Science and Technology Co., Ltd.) with the following composition: trypticase peptone 12 g / L, animal tissue protein digest 5 g / L, corn starch 1 g / L, beef extract 3 g / L, yeast extract 3 g / L, sodium chloride 5 g / L, agar 13.5 g / L, polymyxin B 0.01 g / L, nalidixic acid 0.01 g / L, sterile defibrinated sheep blood or 50-100 mL / L, pH 7.3 ± 0.2.
[0198] Chocolate Agar plates (purchased from Hangzhou Microorganism Science and Technology Co., Ltd.) with the following composition: multivalent peptone 18 g / L, starch 1 g / L, sodium chloride 5 g / L, agar 15 g / L, defibrinated sheep blood 40 g / L, pH 7.4 ± 0.2.
[0199] Trypticase Soy Broth (TSB) liquid medium with the following composition: trypticase peptone 17 g / L, soy papain hydrolysate 3 g / L, potassium phosphate dibasic 2.5 g / L, sodium chloride 5 g / L, glucose 2.5 g / L, pH 7.3 ± 0.2.
[0200] The MPYG medium involved in the embodiments of the present application adopts the PYG MEDIUM (modified) formula of Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Cultures (https: / / www.dsmz.de / microorganisms / medium / pdf / DSMZ_Medium104.pdf).
[0201] The solvent (also referred to as PBS-Cys (Gly)) involved in the embodiments of the present application is prepared by uniformly mixing PBS-Cys (phosphate buffered saline containing 0.05% cysteine hydrochloride) and 100% glycerol at a ratio of 3:1.
[0202] Example 1. Isolation and preservation of strains
[0203] 1. Isolation of strain MNH 30639
[0204] The enteric bacterial strain MNH30639 involved in the present application is isolated from a stool sample of a healthy volunteer in Guangzhou, Guangdong Province.
[0205] Specifically, the isolation method of the strain is as follows:
[0206] The donor takes 2-5 grams of fresh feces, puts it into a sample collection and preservation tube, shakes and homogenizes it, and then places the treated fecal sample in an ice box. It is delivered to the laboratory within 24 hours for strain isolation.
[0207] Physiological saline is dispensed in a biological safety cabinet, 9 mL / tube; strain isolation medium is prepared, including anaerobic blood agar plates, Columbia blood agar plates, chocolate agar plates, etc., and is transferred into an anaerobic workstation 24 hours in advance. The sample information, medium type, and isolation date are labeled.
[0208] Fresh fecal samples are taken and placed in an anaerobic operation station (Don Whitley Scientific A95). A vortex shaker is used to shake for 1 minute to mix evenly. 1 mL of the sample is taken and mixed with 9 mL of physiological saline to prepare a 10 -1 dilution solution, which is then gradient diluted to 10 -6 dilution solution, which is then gradient diluted to 10
[0209] 10 -6 dilution solution is dropped into the isolation medium, including anaerobic blood agar plates, Columbia blood agar plates, and chocolate agar plates. The drop size is 100 μL / dish, and the plate is evenly coated. After the plate surface is dry, the plate is inverted and cultured at 37°C for 3-5 days.
[0210] The growth of the strain in the isolation medium is observed, and a sterile toothpick is used to pick single colonies for strain purification. The purified strain is cultured anaerobically at 37°C.
[0211] The purified culture strain is prepared into a 20% glycerol / water-bacteria solution and stored at -86°C.
[0212] 2. Preservation of strain MNH 30639
[0213] Strain MNH30639 has been preserved in the Guangdong Microbial Culture Collection Center, with the preservation name MNH 30639, the preservation number GDMCC 63075, the preservation time December 23, 2022, and the preservation address: 5th Floor, Building 59, 100 Middle Liangma Street, Guangzhou, Microbiology Institute of Guangdong Province Academy of Sciences.
[0214] Example 2. Microscopic morphological observation of strain MNH30639
[0215] The low-temperature preserved strain MNH30639 in Example 1 was inoculated into MPYG solid plate culture medium, and after anaerobic culture at 37℃ for 48h, visible colonies were formed on the plate culture medium. The colonies were round, regular and smooth in edge, and semitransparent. No secretion was formed around the colonies. Gram staining method showed that the strain MNH30639 was a gram-negative bacterium. Microscopic morphological observation found that the strain had no spores, no flagella, no movement, and was short rod-shaped. The colony morphology photograph of the strain MNH30639 cultured on the MPYG solid plate for 48h is shown in Figure 1.
[0216] The strain MNH30639 was cultured at pH = 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0 or 10.0, respectively. The results are shown in Figure 2. The strain MNH30639 can grow in the range of pH = 6.0 to 10.0, and the optimal growth pH is 8.0.
[0217] The strain MNH30639 was cultured at 30℃, 32℃, 34℃, 36℃, 38℃, 40℃ or 42℃, respectively. The experimental results showed that the strain MNH30639 can grow in the range of 30-42℃, and the optimal growth temperature is 37℃.
[0218] The strain MNH30639 was cultured at a mass / volume ratio of NaCl content of 0%, 1%, 2%, 3%, 4%, 5% or 6%, respectively. The results are shown in Figure 3. The strain MNH30639 can tolerate up to 1% NaCl.
[0219] The strain MNH30639 was cultured at a mass / volume ratio of bile salt content of 0%, 0.1%, 0.15%, 0.2%, 0.25%, 0.3% or 0.4%, respectively. The results are shown in Figure 4. The strain MNH30639 is not tolerant to bile salts and cannot grow when the bile salt concentration is ≥0.10%.
[0220] The strain MNH30639 was cultured under aerobic and anaerobic conditions for a period of time. It was found that the strain MNH30639 cannot grow under aerobic conditions, but grows well under anaerobic conditions, so it belongs to obligate anaerobic bacteria.
[0221] Example 3. Antibiotic sensitivity test of strain MNH30639
[0222] The antibiotic sensitivity test of the strain MNH30639 was performed by the paper disc diffusion method. The test results are shown in Table 1. As shown in Table 1, the strain MNH30639 is sensitive to erythromycin, lincomycin and other antibiotics, and resistant to ampicillin, trimethoprim, chloramphenicol, ciprofloxacin, ceftriaxone, gentamicin, tetracycline and penicillin.
[0223] Table 1. Antibiotic sensitivity test results of strain MNH30639
[0224] Example 4. Identification of strain MNH30639
[0225] 1. 16S rRNA sequencing identification
[0226] The isolated strain (named as MNH30639) was subjected to 16S rRNA analysis for preliminary determination of its taxonomic status. Genomic DNA extraction was performed on the strain, and the extracted genomic DNA template was used for amplification of 16S rRNA using primers 1492R (SEQ ID NO: 1, AGAGTTTGATCATGGCTCAG-3) and 27F (SEQ ID NO: 2, TAGGGTTACCTTGTTACGACTT). The amplified PCR product was purified and then subjected to ABI3730XL sequencing to obtain a 1423 bp 16S rRNA sequence, the sequence of which is shown in SEQ ID NO: 3:
[0227] Homologous comparison and analysis of the 16S rRNA sequence with the NCBI Nucleotide collection (nr / nt) database showed that the closest species to it was Odoribacter splanchnicus, with a similarity of 99.58%. Therefore, the species classification information of the strain was preliminarily determined, i.e., MNH30639 was preliminarily determined to be Odoribacter splanchnicus.
[0228] 2. Phylogenetic tree construction of strain MNH30639
[0229] Multiple sequence alignment was performed on the sequence shown in SEQ ID NO: 3 and the 16S rRNA sequences of the genera with close phylogenetic relationships, and a phylogenetic tree was constructed using MEGA5 software, and the results are shown in Figure 5.
[0230] 3. ANI comparison analysis of strain MNH30639
[0231] The genome of strain MNH30639 was subjected to sequence fragmentation by ultrasonic method, with a fragmentation length range of ~ 350 bp, and then an IlluMina sequencing library was constructed using a standard DNA library construction kit (NEB UltraTM). The constructed sequencing library was subjected to double-end 150 bp sequencing on a NovaSeq (IlluMina) platform. A total of 1.17 Gbp sequencing data was obtained, of which the Q20 accounted for 96.96%.
[0232] The raw sequencing data of the genome was filtered using fastp (version: 0.20.0), and the filtered raw data was used for genome assembly using SPAdes (version: v3.14.0). The total length of the assembled genome was 4.52 Mbp, the N50 length was 133.4 kbp, and the GC content was 43.23%.
[0233] The genome gene prediction analysis was performed using the prokaryotic analysis software genome annotation process prokka (version: 1.14.5). A total of 3840 CDS sequences were predicted, with an average CDS sequence length of 1046 bp. Identification was performed using GTDB, and the results showed that the species with the highest genome similarity was Odoribacter splanchnicus (GCF_000190535.1), with an average nucleotide similarity (ANI) of 99.22% and a gene coverage of 90%. Therefore, it was identified as Odoribacter splanchnicus.
[0234] Example 5. Antibiotic resistance gene analysis of strain MNH30639
[0235] The RGI process (version: 4.2.2) was used to analyze potential antibiotic resistance genes in the genome of strain MNH30639, and the antibiotic resistance gene database used was CARD (version: 3.0.0, https: / / card.McMaster.ca / analyze / rgi). For detailed comparison information, refer to Table 2.
[0236] Table 2. List of drug resistance gene information
[0237] Example 6. Analysis of potential virulence genes of strain MNH30639
[0238] NCBI blastp (version: 2.7.1+) and the virulence factor database VFDB (virulence factor database, http: / / www.Mgc.ac.cn / cgi-bin / VFs / v5 / Main.cgi, updated on September 19, 2019) were used to analyze and compare potential virulence factors and related genes in the genome. For detailed comparison results, refer to Table 3.
[0239] Table 3. List of potential virulence genes of MNH30639
[0240] Example 7. Analysis of potential metabolic gene clusters
[0241] 1. Analysis of potential primary metabolic gene clusters
[0242] The potential primary metabolism gene clusters in the genome were analyzed using gutSMASH5 (version: 1.0.0). The detailed comparison results are shown in Table 4.
[0243] Table 4. MNH30639 potential primary metabolism gene cluster list
[0244] 2. Potential secondary metabolism gene clusters
[0245] The potential secondary metabolism gene clusters in the genome were analyzed using antiSMASH6 (version: 6.0.1). The detailed comparison results are shown in Table 5.
[0246] Table 5. MNH30639 potential secondary metabolism gene cluster list.
[0247] Example 8. Analysis of potential butyric acid-producing genes
[0248] The butyric acid-producing ability of the strain MNH30639 was evaluated, the genes related to the butyric acid-producing pathway described in Vital M et al. in Revealing the Bacterial Butyrate Synthesis Pathways by Analyzing (Meta)genoMic Data [J]. Mbio, 2014, 5(2): 1-11 were used as the reference database, the genome sequence of this strain was compared with the reference database using NCBI blastp (version: 2.7.1+), the detailed comparison results are shown in Table 6, and the integrity of the butyric acid-producing pathway was calculated. It was found through calculation that the integrity of the butyric acid-producing pathway of this strain was 100%, proving that the strain MNH30639 had potential ability to produce butyric acid.
[0249] Table 6. MNH30639 potential butyric acid-producing gene list.
[0250] Example 9. Determination of short-chain fatty acids (SCFA) of strain MNH30639
[0251] SCFA detection method:
[0252] Sample pretreatment
[0253] 1. Take the sample in a 2 mL EP tube, add 1 mL of pure water, vortex for 10 s;
[0254] 2. Add steel balls, treat with a 40 Hz grinder for 4 minutes, ultrasonic for 5 minutes (ice water bath), repeat 3 times;
[0255] 3. Centrifuge the sample at 5000 rpm for 20 minutes at 4°C;
[0256] 4. Transfer 0.8 mL of supernatant into a 2 mL EP tube;
[0257] 5. Add 0.1 mL of 50% H2SO4, add 0.8 mL of extraction solution (containing internal standard 2-methylvaleric acid, 25 mg / L, methyl tert-butyl ether), vortex for 10 s, shake for 10 min, and ultrasonic for 10 min (ice water bath);
[0258] 6. Centrifuge the sample at 10000 rpm for 15 minutes at 4°C;
[0259] 7. Stand at -20°C for 30 minutes;
[0260] 8. Take the supernatant into a sample bottle, and detect by GC-MS (Shimadzu GC2030-QP2020 NX gas chromatograph-mass spectrometer). The capillary used is Agilent HP-FFAP capillary (30Mx250μMx0.25μM, J&W Scientific, FolsoM, CA, USA). The detection results are shown in Table 7.
[0261] Table 7. Determination of short-chain fatty acids (SCFA) of strain MNH30639
[0262] Example 10. Detection of immune activity regulation of strain MNH30639
[0263] 1. Regulation of macrophage immune activity by strain MNH30639
[0264] The experimental method is as described in the experimental method of experimental example 1 in patent document CN112618576A.
[0265] Test strain: After thawing the glycerol stock of MNH30639 strain at 37°C, inoculate it on anaerobic blood agar plates under anaerobic conditions for activation, inoculate the activated strain into MM01 liquid medium, centrifuge after anaerobic culture, resuspend the bacterial pellet with appropriate PBS, and perform MNH30639 bacterial flow counting according to the “LIVE / DEAD Bacterial Cell Viability Assay Kit Instructions” (LIVE / DEAD BacLight Bacterial Viability Kit), to obtain a strain sample that meets the experimental requirements.
[0266] THP-1 cells (Wuhan Punsai Life Science Co., Ltd.) were treated with phorbol ester (PMA) at a final concentration of 5 ng / mL, and differentiated into M0 macrophages for 48 hours.
[0267] Bacterial strain MNH30639 was added at an MOI (live bacteria:cells) ratio of 10:1. A control group of M1 macrophages was also established (M0 macrophages were induced for 24 hours with 20 ng / mL IFNγ and 10 pg / mL LPS). After 1 hour of culture, a mixed antibiotic regimen (1 mg / mL ampicillin; 5 mg / mL streptomycin; 1 mg / mL colistin) was added to kill the bacteria, and the culture was continued for another 23 hours. The supernatant was then collected.
[0268] Using BD TM Cell Counting Microsphere Array (CBA) Human Soluble Protein Master Buffer Kit (BD) TM The Cytometric Bead Array (CBA) Human Soluble Protein Master Buffer Kit was used. After reacting the supernatant sample with the detection protein according to the instructions, the concentrations of cytokines IL-12 / IL-13P40, IL-6, MCP-1, RANTES, IL-1β, and IL-8 in the supernatant were detected by flow cytometry (see Figure 6 for the results).
[0269] As shown in Figure 6, after co-culturing macrophages with MNH30639, the macrophages clearly exhibited characteristics of differentiating into M1-type macrophages. Specifically, the levels of pro-inflammatory cytokines IL-6, IL-1β, IL-8, and IL-12 / IL-13P40 were significantly increased; the levels of chemokines MCP-1 and RANTES were significantly increased; and the level of the anti-inflammatory cytokine IL-10 was significantly increased.
[0270] 2. Regulation of the immunomodulatory activity of strain MNH30639 on primary PBMCs
[0271] The experimental method is based on the experimental method described in Experimental Example 2 of the prior art CN112618576B.
[0272] Test strains: After thawing the MNH30639 strain in glycerol cryovials at 37°C, the strains were activated by inoculating them onto anaerobic blood agar plates under anaerobic conditions. The activated strains were then inoculated into MM01 liquid medium, anaerobically cultured, and centrifuged. The bacterial pellet was resuspended in an appropriate amount of PBS. Flow cytometry counting of MNH30639 bacteria was performed according to the instructions of the LIVE / DEAD BacLight Bacterial Viability Kit to obtain strain samples that met the experimental requirements.
[0273] Primary PBMCs purchased from TPCS (batch number A19Z289100) were resuscitated and cultured in PRMI1640 complete medium (10% heat-inactivated FBS, containing 1% L-glutamine, 0.1% ps (penicillin-streptomycin mixture), 10 mg / mL DNAse, which functions to avoid agglutination).
[0274] Primary PBMCs were co-incubated with MNH30639 for 24 hours. Bacteria were added at a ratio of MOI (viable bacteria: cell number) = 1:1, and a PBS control group (PBS co-cultured with primary PBMCs for 24 hours) was set up. The bacteria were killed after anaerobic culture for 1 hour. The culture was continued for 23 hours, and the supernatant was collected.
[0275] BD Cytometric Bead Array (CBA) Human Soluble Protein Master Buffer Kit was used to detect the concentrations of cytokines TNF-a, MIG, MCP-1, IL-2, IL12 / IL-23P40, IP-10, IL-6, RANTES, IL-1β, and IL-8 in the supernatant using a flow cytometer. TM Cell Counting Microsphere Array (CBA) Human Soluble Protein Master Buffer Kit (BD TM Cytometric Bead Array (CBA) Human Soluble Protein Master Buffer Kit), and the concentrations of cytokines TNF-a, MIG, MCP-1, IL-2, IL12 / IL-23P40, IP-10, IL-6, RANTES, IL-1β, and IL-8 in the supernatant were detected using a flow cytometer.
[0276] The results are shown in Figure 7. MNH30639 can induce significant increases in the expression of pro-inflammatory factors RANTES, IL-1β, IP-10 (CXCL-10), IL-6, and IL-8, and promote the expression of TNF-a and MCP-1.
[0277] 3. Effect of strain MNH30639 on IFNβ expression
[0278] Interferon (IFN) receptor proteins are a class of cytokines secreted by host cells and can regulate immune responses. Viruses, bacterial endotoxins, and artificially synthesized double-stranded RNA can stimulate the production of interferons. Macrophages, lymphocytes, and somatic cells in the human body can produce interferons. Among them, IFNβ belongs to type I interferons, which can promote the activity of NK cells, macrophages, and T lymphocytes, thereby playing roles in antiviral, antitumor, and immune regulation. To verify whether Kristen's bacteria MNH30639 can promote the expression of IFNβ, the THP-1 cells carrying the IFNβ gene promoter reporter gene (cell line built by the Muen Company) were used to evaluate the effect of MNH30639 on the transcriptional activity of IFNβ.
[0279] The construction steps of THP-1 cells carrying the IFNβ gene promoter reporter include: reporter gene insertion into a vector, vector infection of cells, and screening of a cell line expressing the reporter gene (for details, see the literature: Huashan Du, Tianmin Xu, Manhua Cui“cGAS-STING signaling in cancer immunity and immunotherapy”Biomedicine & Pharmacotherapy 133 (2021) 110972; Jiang et al.“cGAS-STING, an important pathway in cancer immunotherapy”Journal of Hematology & Oncology (2020) 13:81; Khiem C. Lam et al.“Microbiota triggers STING-type I IFN-dependent monocyte reprogramming of the tumor microenvironment”Cell 184, 5338-5356).
[0280] Preparation of strain MNH30639 culture supernatant: inoculate strain MNH30639 in MM01 liquid medium, cultivate anaerobically at 37°C for 48 hours, centrifuge to remove bacterial bodies, filter the culture supernatant with a 0.22 μm filter, aliquot, and collect the samples at -80°C for low-temperature preservation, ready for use.
[0281] Control (control): DMEM complete medium (10% FBS) containing 10% volume of MM01 bacterial culture medium;
[0282] MSA-2 group (positive control group): DMEM complete medium containing 10 μM MSA-2;
[0283] MNH30639 group: DMEM complete medium containing 10% volume of MNH30639 bacterial culture supernatant.
[0284] THP-1-IFNβ-promoter reporter cells were inoculated in a 96-well plate at 1×10 5 cells per well. The cells were treated according to the set group. After 24 hours of continuous culture, the cells were centrifuged at 300g for 5 minutes, the culture supernatant was removed, 50 μL of 1×Luminescence was added for normalization of the control group, and the effect of MNH30639 on IFNβ transcriptional activity was evaluated.
[0285] The experimental results are shown in Figure 8. MNH30639 can significantly promote IFNβ transcriptional activity. Type I interferon IFNβ has been proven to be able to achieve anti-tumor through immune regulation, and has potential functional effects on anti-viral tumors. Therefore, these results show that MNH30639 can achieve anti-tumor through immune regulation, and has potential functional effects on anti-viral tumors.
[0286] The drug prepared from the visceral A. odontoloides provided by the present application can significantly promote IFNβ transcriptional activity. Type I interferon IFNβ has been proven to be able to reconstruct the synergy of tumor microenvironment innate immunity and acquired immunity for the treatment of refractory drug-resistant cancer (see "Targeting the tumor Microenvironment with interferon-β Bridges innate and adaptive immune responses, Yang X1, cancer cell, 2014, doi: 10.1016 / j.ccr.2013.12.004."). Therefore, these results show that MNH30639 or the drug prepared from the visceral A. odontoloides provided by the present application can achieve anti-tumor through immune regulation, and has potential functional effects on anti-viral tumors.
[0287] Example 11. Inhibition of histone deacetylase (HDAC) activity by strain MNH30639
[0288] To verify whether MNH30639 has an inhibitory effect on histone deacetylase activity, the present study used a purchased HDAC inhibitor drug screening kit (Fluorometric) kit from Abeam Company to detect the in vitro HDAC activity inhibition.
[0289] Preparation of MNH30639 culture supernatant: strain MNH30639 was inoculated in liquid medium and cultured anaerobically at 37°C for 48 hours. The bacterial bodies were removed by centrifugation, and the culture supernatant was filtered with a 0.22μM filter, aliquoted, and the collection was stored at -80°C for later use.
[0290] Preparation of samples to be tested:
[0291] 1) Control group, MM01 medium was diluted 10 times with PBS to obtain 10% MM01;
[0292] 2) TSA group, HDAC inhibitor Trichostatin A (TSA) with a concentration of 10μM;
[0293] 3) MNH30639 group, MNH30639 culture supernatant was diluted 10 times with PBS to obtain an experimental sample containing 10% bacterial supernatant.
[0294] Preparation of histone deacetylase detection reaction reagent: according to the kit instructions, prepare an appropriate amount of detection reaction system, 50 μL of reaction reagent is required for each reaction.
[0295] Histone deacetylase activity detection: 50 μL of the sample to be tested was added to a 96-well white plate, then 50 μL of reaction reagent was added, mixed thoroughly, incubated at 37°C for 30 minutes, 10 μL of lysine (Lysine) Developer was added to the reaction well and mixed thoroughly, and the reaction was terminated. The plate was incubated at 37°C for 30 minutes. Finally, the fluorescence intensity of the sample was detected using a microplate reader. The microplate reader was set at Ex. = 350-380 nM and EM. = 440-460 nM. The histone deacetylase inhibitory activity of the sample was analyzed by setting the fluorescence intensity value of the control as 100%, and dividing the fluorescence intensity of the positive control group and MNH30639 by the control and multiplying by 100% to obtain the relative histone deacetylase activity.
[0296] The experimental results are shown in Figure 9. Compared with the histone deacetylase activity of the control group, the supernatant of MNH30639 had a significant inhibitory effect on HDAC activity, similar to the effect of the histone deacetylase inhibitor control group TSA (10 μM). These results suggest that MNH30639 has potential effects on T cell activation and anti-tumor.
[0297] Example 12. Verification experiment of the therapeutic effect of strain MNH30639 on liver cancer
[0298] To verify whether strain MNH30639 has a therapeutic effect on tumors, a mouse homologous tumor model was used to perform an experiment to inhibit the growth of liver cancer. The experimental protocol has been reviewed by the Muen Biological Animal Management and Use Committee.
[0299] Test strain: After thawing the glycerol stock of MNH30639 strain at 37°C, inoculate it on anaerobic blood agar plates in an anaerobic workstation for activation. Inoculate the activated strain into MM01 liquid medium and incubate anaerobically to obtain a sufficient number of live bacteria. Centrifuge the cultured bacterial solution to concentrate it, then resuspend the bacterial bodies with solvent to obtain a test material with a purity and live bacterial count (2.0 x 10 9 CFU / mL) that meets the requirements of animal experiments.
[0300] Tumor cells: H22 mouse hepatoma cells, catalog number CBP60230, purchased from Nanjing Kebai Biological Technology Co., Ltd.
[0301] Laboratory animals: BALB / C mice, aged 5-6 weeks, were purchased from Guangdong Sijiajingda Biotechnology Co., Ltd.
[0302] Animal experiments: Animals were kept in normal conditions with a constant supply of food. After the quarantine period, H22 liver cancer cells were subcutaneously inoculated to form an ectopic homologous tumor model. The cell inoculation amount was 2 × 10⁻⁶ cells / year. 5 / mL, 0.1mL / animal. When the average tumor volume reaches 80-100mm... 3 Animals were randomly divided into two groups based on tumor volume stratification: Group A (MNH30639) and Group B (control). Gavage administration began on the day of grouping. The control group received the solvent, while Group A received MNH30639 bacteria. The gavage volume was 0.2 mL / animal / time, administered once daily. General observations were conducted daily during the quarantine period and daily after administration. Animal weight was measured upon receipt and at the end of the quarantine period. Animal weight was also measured each time tumor diameter was measured after tumor inoculation, and before dissection at the experimental endpoint. The day of tumor cell inoculation was considered Day 1. General clinical observations were conducted daily during the experiment. Animal weight was measured upon receipt and at the end of the quarantine period; animal weight was measured twice weekly after tumor inoculation. Tumor diameter was measured daily from the fifth day until grouping; after grouping, tumor diameter was measured every two days. When the average tumor volume reached or exceeded 1000 mm², the tumor diameter was considered the final measurement. 3 (Day 22) The tumor diameter was measured once a day.
[0303] When the average tumor volume of any group of mice is greater than 2000 mm 3 If the test fails, the experiment will be terminated.
[0304] After reaching the experimental endpoint, all surviving mice were dissected and tumor samples were collected. Tumor weight and volume were measured. Statistical analyses and comparisons were then performed on tumor volume curve changes, endpoint tumor volume, endpoint tumor weight, and endpoint tumor inhibition rate (TGI). Tumor inhibition rate was calculated as: (control group average volume - experimental group volume) / control group average volume × 100%. All data are expressed as mean ± SD. Graphpad Prism 8.0.2 software was used for plotting and statistical analysis. For pairwise comparisons, Student's t-test was used. For two-way analysis, two-way ANOVA combined with Sidak multiple comparisons was used. Significance was indicated by *: *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.
[0305] The results are shown in Figure 10. The tumor volume curve of group A (MNH30639) was significantly smaller than that of group B (control group) during the experiment. At the end of the experiment (day 23), the surviving mice were dissected, and the tumor tissues were weighed. The results are summarized in Table 8. At the end of the experiment, the average tumor volume of the control group mice was 1606.36 mm 3 , and the average tumor volume of the MNH30639-treated group mice was 932.30 mm 3 . The tumor volume of the MNH30639-treated group mice was significantly lower than that of the control group (Figure 11). At the end of the experiment, the tumor growth inhibition rate (TGI) of group A (MNH30639) was 43.8%, which was significantly higher than that of the control group (Figure 12). At the end of the experiment, the tumor tissues of the control group weighed about 1.73 g, and the tumor tissues of the MNH30639-treated group weighed about 1.35 g. The response rate of group A was 60.00%, and that of group B was 20.00%. The response rate was significantly improved (Figure 13).
[0306] Table 8. Statistics of the overall condition of mice at the end of the experiment
[0307] Example 13. Analysis of the immune activation of tumor-bearing mice by strain MNH30639
[0308] After preparing the tissues of the tumor-bearing mice in Example 12 into a single-cell suspension, specific molecules labeled with fluorescent molecules were added, and the proportion of cells expressing specific molecules could be detected in a flow cytometer. The proportion of immune cells reflects the immune status of the mice to some extent. The experimental steps are as follows:
[0309] The tumor tissues were rinsed with PBS, cut into small pieces, and pulverized. The pulverized tumor tissues were placed in a 5 mL collagenase IV digestion system (1 mg / mL collagenase IV, 0.1 mg / mL DNase, 10% FBS) and digested at 37°C for 30 minutes. The digested tissue liquid was filtered through a 70 μM filter membrane to prepare a single-cell suspension of the mouse tumor, which was detected by a machine and the total number of cells in the tissue was counted.
[0310] The single-cell suspension of the mouse tumor was taken, and dyes (corresponding antibody combinations) Live / Fc, Tumor-MDSC were added for T cell / MDSC cell staining on the surface of tumor cells. The stained cells were resuspended with PBS and detected by a machine.
[0311] Take the mouse tumor single cell suspension, add the dye (corresponding antibody combination) Live / Fc, T-TAM-Surface in turn for staining, resuspend the cells after staining with PBS; then, according to the instructions of the detection kit, use the fixing solution, membrane breaking solution in turn, use T-TAM-CD206 nuclear staining for staining; resuspend the cells after staining with PBS, and detect on the machine.
[0312] Flow analysis data were processed by CyExpert, and statistical analysis was performed by Graphpad Prism V9. Statistical analysis used one-way ANOVA with Dunnet's Multiple Comparison, ns not significant, *p<0.05, **p<0.01, ***p<0.001.
[0313] The experimental results are shown in Figure 14. The proportion of MDSC cells (myeloid-derived suppressor cells) and M1 macrophages in tumor tissue was significantly down-regulated in the treatment group compared with the control group (Figure 14A), and the proportion of M1 macrophages was up-regulated (Figure 14B). Therefore, MNH30639 can inhibit MDSC cells in mouse tumors, relieve immune suppression in the tumor microenvironment, and play an anti-tumor role. At the same time, MNH30639 increases the proportion of M1 macrophages in tumor tissue-related macrophages (Tumor-associated macrophage, TAM), activates the local immune system of mouse tumors, and plays an anti-tumor role.
[0314] Example 14. Verification experiment of the effect of strain MNH 30639 on the combination of anti-PD-1 antibody and lung cancer treatment
[0315] The effect of strain MNH 30639 combined with anti-PD-1 antibody on treating tumors was verified, and a mouse homologous tumor model was used to inhibit lung cancer growth experiment. The experimental protocol has been reviewed by the Muen Biological Animal Care and Use Committee.
[0316] Test strain: After thawing the glycerol stock of MNH 30639 strain at 37°C, inoculate it on anaerobic blood agar plates under anaerobic conditions for activation. Inoculate the activated strain into MM01 liquid medium and cultivate anaerobically to obtain sufficient number of viable bacteria. Centrifuge the cultured bacteria, resuspend the bacterial bodies with solvent to obtain test material with purity and viable bacteria number (1×10 9 CFU / mL~2×10 10 CFU / mL) meeting the requirements of animal experiment.
[0317] Anti-PD-1 antibody: Anti-PD-1 antibody (RMP1-14) was prepared into a 2 mg / mL solution with normal saline, and was sourced from BioXcell.
[0318] Tumor cells: LLC1 mouse lung cancer cells; source: Wuhan Punsai Life Science and Technology Co., Ltd., item number: CL-0140.
[0319] Experimental animals: The experimental mice were C57BL / 6J mice, purchased from Jiangsu Jicui Yekang Biological Science and Technology Co., Ltd.
[0320] Animal experiments: After the quarantine period, the mice were subcutaneously inoculated with LLC1 mouse lung cancer cells to form an ectopic homologous tumor model. The inoculation volume was 0.1-0.3 mL per mouse. When the average tumor volume reached 60-100 mm 3 , the mice were randomly divided into groups according to the tumor volume:
[0321] Group A (negative control);
[0322] Group B (positive control: anti-PD-1 antibody);
[0323] Group C (MNH 30639 & anti-PD-1 antibody).
[0324] On the day of grouping, the mice in group A were given vehicle and normal saline, the mice in group B were given vehicle and anti-PD-1 antibody, and the mice in group C were given MNH 30639 and anti-PD-1 antibody. The vehicle and MNH 30639 were administered by gavage, with a gavage volume of 0.1-0.3 mL per mouse. The anti-PD-1 antibody and normal saline were administered by intraperitoneal injection, with a dose of 3 mg / kg, and the administration frequency was once every 3 days, for a total of 5 administrations. The animal body weight was measured at the end of the quarantine period and after receiving the animals. The animal body weight was measured twice a week after tumor inoculation, and the animal body weight was measured on the day of intraperitoneal injection. The first day was the day of tumor cell inoculation. From the 5th day to the day of grouping, the tumor diameter was measured once a day. After grouping, the tumor diameter was measured once every 3 days. When the average tumor volume of any group was ≥1000 mm 3 , the tumor diameter was measured once a day, and the tumor growth was recorded.
[0325] When the average tumor volume of any group was ≥1000 mm 3 , and the tumor volume of group C was significantly smaller than that of group A and significantly smaller than that of group B, or the average tumor inhibition rate (TGI) of this group was ≥20% compared with group B, the experiment was terminated. Alternatively, when the average tumor volume of any group of mice was greater than 2000 mm 3 .
[0326] During the experiment, general clinical observations, body weight monitoring, and tumor volume (mm 3) Measurement, after the end of the experiment, all surviving mice were dissected to measure the tumor weight and calculate the tumor volume, and finally the tumor volume curve, the end of the tumor volume, the end of the tumor mass and the end of the tumor inhibition rate were statistically analyzed and compared.
[0327] The tumor volume size change curve during the experiment is shown in Figure 15; at the end of the experiment, the body weight change, tumor volume change, response rate, tumor inhibition rate were analyzed, the tumor volume is shown in Figure 16, the tumor inhibition rate is shown in Figure 17, and the response rate is shown in Figure 18. The overall situation of the mice is shown in Table 9.
[0328] Table 9: Overall situation of mice
[0329] As shown in Figure 16, at the end of the experiment, the tumor volume of groups B (anti-PD-1 antibody group) and C (anti-PD-1 antibody combined with MNH30639) was significantly reduced compared with group A (negative control group). Compared with the anti-PD-1 antibody monotherapy group, the tumor volume of the MNH30639 combined with anti-PD-1 antibody group was reduced, showing a certain combination effect.
[0330] As shown in Figure 17, compared with group A (negative control group), the tumor inhibition rate of groups B (anti-PD-1 antibody group) and C (anti-PD-1 antibody combined with MNH30639) was significantly improved. Compared with the anti-PD-1 antibody monotherapy group, the tumor inhibition rate of the MNH30639 combined with anti-PD-1 antibody group was improved, showing a certain combination effect.
[0331] As shown in Figure 18, compared with group A (negative control group), the anti-PD-1 antibody response rate of groups B (anti-PD-1 antibody group) and C (anti-PD-1 antibody combined with MNH30639) was significantly improved.
[0332] In summary, MNH30639 combined with anti-PD-1 antibody showed better efficacy in treating lung cancer, reducing lung cancer growth in mice, and improving the response rate of anti-PD-1 antibody.
[0333] Example 15. Dose-dependent efficacy of strain MNH 30639 in lung cancer
[0334] To verify whether the effect of strain MNH 30639 on treating tumors has a dose-dependent effect, a liver cancer growth inhibition experiment was performed using a mouse homologous tumor model. The experimental protocol has been reviewed by the Muen Biological Animal Care and Use Committee.
[0335] Test strain: After the glycerol storage tube of MNH 30639 strain was thawed at 37℃, it was inoculated on anaerobic blood agar plates under anaerobic conditions for activation. The activated strain was inoculated in MM01 liquid medium and cultured anaerobically to obtain a sufficient number of viable bacteria. The cultured bacterial solution was centrifuged and concentrated, and then the bacterial body was resuspended with a solvent to obtain a test subject with a purity and viable bacterial count (1×10 9 CFU / mL-2×10 10 CFU / mL) meeting the requirements of animal experiments.
[0336] Tumor cells: H22 mouse hepatoma cells, source: Nanjing Kebai Biotechnology Co., Ltd., product number: CBP60230.
[0337] Experimental animals: Male BALB / c mice were purchased from Guangdong Sijia Jiada Biological Technology Co., Ltd.
[0338] Animal experiments: After the quarantine period, the mice were subcutaneously inoculated with H22 mouse hepatoma cells to form an ectopic homologous tumor model. The inoculation volume was 0.1-0.3 mL per mouse. When the average tumor volume reached 60-100 mm 3 , the mice were randomly divided into groups according to the tumor volume.
[0339] The day of tumor cell inoculation was D1, and on D7, mice with abnormal tumor growth were removed and randomly stratified according to the tumor volume on that day. A total of 5 groups were set up, with 10 mice per group. Group A was the negative control group, group B was the 10 -1 dilution of MNH30639, group C was the 10 -2 dilution of MNH30639, and group D was the 10 -3 dilution of MNH30639. Drug administration began on the day of grouping. The negative control group A was given the negative control PBS-Cys (gly), group B (10 -1 dilution of MNH30639) was given 10 -1 dilution of MNH30639 (1.3×10 9 CFU / mL), group C (10 -2 dilution of MNH30639) was given 10 -2 dilution of MNH30639 (1.3×10 8 CFU / mL), and group D (10 -3 dilution of MNH30639) was given 10 -3 dilution of MNH30639 (1.3×10 7CFU / mL) were administered intragastrically, with a gavage volume of 0.2 mL per mouse per administration, at a frequency of 1 day per administration, for a total of 14 administrations. General clinical observations were performed once daily during the study. Animal body weights were recorded at the time of receipt and quarantine, and twice weekly after tumor inoculation. Tumor diameters were measured once daily from D5 to the time of grouping, and once every two days after the time of grouping.
[0340] The study was terminated when the mean tumor volume of any group reached or exceeded 1000 mm 3 , and the mean tumor volume of any group was significantly smaller than that of Group A or the tumor growth inhibition rate (TGI) of that group reached or exceeded 30%, or when the mean tumor volume of any group of mice reached or exceeded 2000 mm 3 .
[0341] At the end of the study, all surviving mice were necropsied, and tumor weights were measured and tumor volumes were calculated. Statistical analyses and comparisons were performed for tumor volume, tumor volume at endpoint, tumor weight at endpoint, and tumor growth inhibition at endpoint (TGI). TGI = 1 - (individual tumor volume at endpoint - individual tumor volume at the time of grouping) / (mean tumor volume of Group A at endpoint - mean tumor volume of Group A at the time of grouping) x 100%. All data were expressed as mean ± SD, and were plotted and analyzed using Graphpad Prism 8.0.2 software. For comparisons between three or more groups, one-way ANOVA with Dunnett’s Multiple Comparisons Test was used. For two-way comparisons, 2-way ANOVA with Sidak’s Multiple Comparisons Test was used. Significant differences were indicated by *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001.
[0342] At the end of the study, the tumor volume curves of Groups C, D, and E were significantly smaller than that of Group A (the negative control group), and there were no significant differences between Group B and Group A (Figure 19). At the end of the study (D20), the mean tumor volumes of Groups A to D were 1032.63 mm 3 , 861.63 mm 3 , 859.43 mm 3 , and 705.35 mm3 At the end of the experiment, the tumor volumes of groups B to D were not significantly different from that of group A, and the tumor volume of group D was significantly reduced compared with that of group A (as shown in Figure 20). At the end of the experiment, the TGIs of groups B to D were 17.99%, 18.3%, and 34.25%, respectively, and the TGI of group D was significantly increased compared with that of group A (as shown in Figure 21).
[0343] In summary, the anti-tumor effect of MNH30639 in the liver cancer model is dose-dependent, and a low dose can exert a significant anti-tumor effect.
[0344] Example 16. Verification experiment of the effect of strain MNH 30639 on the combination of anti-PD-1 antibody and liver cancer treatment
[0345] The effect of the combination of strain MNH 30639 and anti-PD-1 antibody on the treatment of tumors was verified by inhibiting the growth of liver cancer in a mouse homologous tumor model. The experimental protocol has been reviewed by the ethics committee of the Muen Biological Animal Management and Use Committee.
[0346] Test strain: After thawing the glycerol stock of MNH 30639 strain at 37°C, the activated strain was inoculated into MM01 liquid medium under anaerobic conditions, and the active bacteria were obtained after anaerobic culture. The cultured bacteria were centrifuged and resuspended in solvent to obtain a test substance with a purity and viable bacterial count (1 x 10 9 CFU / mL~2 x 10 10 CFU / mL) meeting the requirements of animal experiments.
[0347] Anti-PD-1 antibody: Anti-PD-1 antibody (RMP1-14) was prepared into a 2 mg / mL solution with physiological saline, and was obtained from BioXcell.
[0348] Tumor cells: H22 mouse liver cancer cells, source: Nanjing Kebai Biological Technology Co., Ltd., item number: CBP60230.
[0349] Experimental animals: Male BALB / c mice were purchased from Guangdong Sijia Jiada Biological Technology Co., Ltd.
[0350] Animal experiment: Normal feeding, after the quarantine period, subcutaneous inoculation of H22 mouse liver cancer cells was performed to form an ectopic homologous tumor model, and the inoculation amount was 0.1-0.3 mL per mouse. When the average tumor volume reached 60-100 mm 3 , the mice were randomly divided into groups according to the tumor volume.
[0351] Group A (negative control);
[0352] Group B (positive control: anti-PD-1 antibody);
[0353] Group C (MNH 30639 & anti-PD-1 antibody).
[0354] The drug administration started on the day of grouping, the A group and the B group were given the solvent, and the C group was given MNH 30639. The solvent and MNH 30639 were administered by gavage, and the gavage volume was 0.1-0.3 mL per mouse. When the average tumor volume of any group of mice grew to 250 mm 3 ~300 mm 3 , the positive control PD-1 antibody and the negative control physiological saline were administered. The anti-PD-1 antibody and the physiological saline were administered by intraperitoneal injection, the administration dose was 3 mg / kg, the administration frequency was once every 3 days, and a total of 4 times of administration were performed. The animal body weight was measured at the end of the quarantine period; the animal body weight was measured twice a week after tumor inoculation, and the animal body weight was measured on the day of intraperitoneal injection administration; the day of tumor cell inoculation was D1. From D5 to the day before grouping, the tumor diameter was measured once a day; after grouping, the tumor diameter was measured once every 3 days; when the average tumor volume was ≥1000 mm 3 , the tumor diameter was measured once a day, and the tumor growth was recorded.
[0355] When the average tumor volume of any group was ≥1000 mm 3 , and the tumor volume of the H group was significantly smaller than that of the A group and significantly smaller than that of the B group, or the average tumor inhibition rate (TGI) of the group was ≥20% compared with the B group, the experiment was selected to be terminated; or the average tumor volume of any group of mice was greater than 2000 mm 3 .
[0356] During the experiment, general clinical observation, body weight monitoring, and tumor volume (mm 3 ) measurement were performed. After reaching the experimental endpoint, all surviving mice were dissected for sample collection, tumor weight measurement and tumor volume calculation, and finally statistical analysis and comparison of tumor volume curve changes, endpoint tumor volume, endpoint tumor mass, and endpoint tumor inhibition rate were performed.
[0357] At the end of the experiment, the body weight changes, tumor volume changes, response rate, and tumor inhibition rate were analyzed. The tumor volume is shown in Figure 22, the tumor inhibition rate is shown in Figure 23, and the response rate is shown in Figure 24. The overall mouse condition statistics are shown in Table 10.
[0358] Table 10: Overall mouse condition statistics
[0359] As shown in Figure 22, at the end of the experiment, the tumor volume of group C of anti-PD-1 antibody combined with MNH30639 was significantly reduced compared with the control group. Compared with group B of anti-PD-1 antibody monotherapy, the tumor volume of the group of MNH30639 combined with anti-PD-1 antibody was reduced, showing a certain combination effect.
[0360] As shown in Figure 23, compared with the control group, the tumor inhibition rate of group C of anti-PD-1 antibody combined with MNH30639 was significantly improved. Compared with group B of anti-PD-1 antibody monotherapy, the tumor inhibition rate of the group of MNH30639 combined with anti-PD-1 antibody was improved, showing a certain combination effect.
[0361] As shown in Figure 24, compared with the control group, the anti-PD-1 antibody response rate of group B of anti-PD-1 antibody monotherapy and group C of anti-PD-1 antibody combined with MNH30639 was significantly improved.
[0362] In summary, MNH30639 combined with anti-PD-1 antibody showed better therapeutic efficacy for liver cancer, reduced the growth of liver cancer in mice, and improved the anti-PD-1 antibody response rate.
[0363] Example 17. Verification experiment of strain MNH 30639 combined with anti-PD-1 antibody for colorectal cancer treatment
[0364] To verify the effect of strain MNH 30639 combined with anti-PD-1 antibody on tumor treatment, a mouse homologous tumor model was used to perform an experiment of inhibiting the growth of colorectal cancer. The experimental scheme has been reviewed by the ethics committee of Muen Biological Animal Management and Use Committee.
[0365] Test strain: After thawing the glycerol frozen tube of MNH 30639 strain at 37°C, inoculate it on anaerobic blood plates under anaerobic conditions for activation. Inoculate the activated strain into MM01 liquid medium and cultivate anaerobically to obtain a sufficient number of live bacteria. Centrifuge the cultured bacterial solution, resuspend the bacterial bodies with solvent to obtain a test material with a purity and viable bacterial count (1x10 9 CFU / mL~2x10 10 CFU / mL) meeting the requirements of animal experiments.
[0366] Anti-PD-1 antibody: Anti-PD-1 antibody (RMP1-14) was prepared into a 2 mg / mL solution with physiological saline, and was sourced from BioXcell.
[0367] Tumor cells: CT26 mouse colorectal cancer cells, source: American Type Culture Collection (ATCC), item number: CRL-2638 TM .
[0368] Laboratory animals: Male BALB / c mice were used in the experiments and were purchased from Guangdong Sijiajingda Biotechnology Co., Ltd.
[0369] Animal experiments: After normal feeding and quarantine, CT26 mouse liver cancer cells were subcutaneously inoculated to form an ectopic homologous tumor model, with an inoculation volume of 0.1–0.3 mL per mouse. When the average tumor volume reached 60–100 mm², the tumors were successfully induced. 3 At that time, tumors were stratified and randomly grouped according to their volume.
[0370] Group A (negative control);
[0371] Group B (positive control: anti-PD-1 antibody);
[0372] Group C (MNH 30639 & anti-PD-1 antibody).
[0373] On the day of grouping, medication was administered. Groups A and B received the solvent, while group C received MNH 30639. The solvent and MNH 30639 were administered by gavage at a volume of 0.1–0.3 mL per mouse. The average tumor volume of mice in any group reached 160 mm. 3 ~240mm 3 At that time, the positive control PD-1 antibody was administered to groups B and C, and the negative control saline was administered to group A. Both the anti-PD-1 antibody and saline were administered via intraperitoneal injection at a dose of 3 mg / kg, once every 3 days for a total of 4 administrations. Animal weight was measured upon receipt and at the end of the quarantine period. Animal weight was measured twice weekly after tumor inoculation, with the weight measured on the day of intraperitoneal injection. The day of tumor cell inoculation was considered day 1. From day 5 until grouping, tumor diameter was measured daily; after grouping, tumor diameter was measured every 3 days. When the average tumor volume was ≥1000 mm², the tumor was considered complete. 3 The tumor diameter was measured once a day, and the tumor growth was recorded.
[0374] When the average volume of any group of tumors is ≥1000 mm 3 If the tumor volume in group C is significantly smaller than that in both group A and group B, or if the average tumor inhibition rate (TGI) in group C is ≥20% compared to group B, the experiment can be terminated; or if the average tumor volume in any group of mice is greater than 2000 mm², the experiment can be terminated. 3 .
[0375] The experimental process included general clinical observation, weight monitoring, and tumor volume (mm). 3 After reaching the experimental endpoint, all surviving mice were dissected and their tumors were collected. The tumor weight and volume were measured and calculated. Finally, statistical analysis and comparison were performed on the changes in tumor volume curve, endpoint tumor volume, endpoint tumor mass, and endpoint tumor inhibition rate.
[0376] At the end of the experiment, the body weight change, tumor volume change, response rate, tumor inhibition rate were analyzed, the tumor volume is shown in Figure 25, and the tumor inhibition rate is shown in Figure 26. The total condition statistics of mice are shown in Table 11.
[0377] Table 11: Total condition statistics of mice
[0378] As shown in Figure 25, at the end of the experiment, the tumor volume of the MNH30639 combined with anti-PD-1 antibody group was reduced compared with the control group and the anti-PD-1 antibody single drug group, showing a certain combined effect.
[0379] As shown in Figure 26, compared with the control group, the anti-PD-1 antibody group, the MNH30639 single drug group and the anti-PD-1 antibody combined with MNH30639 group, the tumor inhibition rate was significantly improved, and the TGI difference was 28.1%. Compared with the anti-PD-1 antibody single drug group, the tumor inhibition rate of the MNH30639 combined with anti-PD-1 antibody group was improved, showing a certain combined effect.
[0380] Example 18. Verification experiment of freeze-dried bacterial powder of strain MNH 30639 for anti-PD-1 antibody combined colorectal cancer treatment effect
[0381] The effect of freeze-dried bacterial powder of strain MNH 30639 combined with anti-PD-1 antibody on treating tumors was verified, and a mouse homologous tumor model was used to perform an experiment of inhibiting the growth of colorectal cancer. The experimental protocol has been reviewed by the ethics committee of the Muen Biological Animal Management and Use Committee. The freeze-dried bacterial powder was prepared using conventional methods well known in the art.
[0382] Test strain: After the glycerol storage tube of MNH 30639 strain was thawed at 37°C, it was inoculated on anaerobic blood plates under anaerobic conditions for activation, and the activated strain was inoculated in MM01 liquid medium and anaerobically cultured to obtain a sufficient number of live bacteria. The cultured bacterial solution was centrifuged and concentrated, the bacterial bodies were resuspended with a solvent, and freeze-drying treatment was performed to obtain bacterial powder MNH30639-FDS with a purity and viable bacterial count (1x10 9 CFU / g~2x10 10 CFU / g) meeting the requirements of animal experiments. 9 CFU / ml~2x10 10 CFU / ml) meeting the requirements of animal experiments.
[0383] Anti-PD-1 antibody: Anti-PD-1 antibody (RMP1-14) was prepared into a 2 mg / mL solution with physiological saline, and was obtained from BioXcell.
[0384] Tumor cell: CT26 mouse colorectal cancer cell, source: American type culture collection (ATCC), item number: CRL-2638 TM .
[0385] Experimental animal: Male BALB / c mice were purchased from Guangdong Sijia Jiada Biotechnology Co., Ltd.
[0386] Animal experiment: Normal feeding, after the quarantine period, subcutaneous inoculation of CT26 mouse hepatoma cells was performed to form an ectopic homologous tumor model, and the inoculation amount was 0.1-0.3 mL per mouse. When the average tumor volume reached 60-100 mm 3 , the mice were randomly divided into groups according to the tumor volume.
[0387] Group A (negative control);
[0388] Group B (positive control: anti-PD-1 antibody);
[0389] Group C (MNH 30639-FDS & anti-PD-1 antibody).
[0390] Drug administration started on the day of grouping. Group A and group B were given vehicle, and group C was given MNH 30639-FDS. The vehicle and MNH 30639-FDS were administered by gavage, and the gavage volume was 0.1-0.3 mL per mouse. When the average tumor volume of any group of mice grew to 160 mm3-240 mm3, the positive control PD-1 antibody and the negative control physiological saline were administered. The anti-PD-1 antibody and physiological saline were administered by intraperitoneal injection, and the administration dose was 3 mg / kg. The administration frequency was once every 3 days, and a total of 4 administrations were performed. The animal body weight was measured at the end of the quarantine period and every week after tumor inoculation, and the animal body weight was measured on the day of intraperitoneal injection. The day of tumor cell inoculation was D1. From D5 to the day before grouping, the tumor diameter was measured once a day; after grouping, the tumor diameter was measured once every 3 days; when the average tumor volume of any group was ≥1000 mm 3 , the tumor diameter was measured once a day, and the tumor growth was recorded.
[0391] When the average tumor volume of any group was ≥1000 mm 3 , and the tumor volume of group C was significantly smaller than that of group A and significantly smaller than that of group B, or the average tumor inhibition rate (TGI) of this group was ≥20% compared with group B, the experiment was terminated. Or the average tumor volume of any group of mice was greater than 2000 mm 3 .
[0392] During the experiment, general clinical observation, body weight monitoring, and tumor volume (mm 3) Measurement, after the end of the experiment, all surviving mice were dissected to measure the tumor weight and calculate the tumor volume, and finally the tumor volume curve, the end of the tumor volume, the end of the tumor mass and the end of the tumor inhibition rate were statistically analyzed and compared.
[0393] The tumor volume size change curve during the experiment is shown in Figure 27; at the end of the experiment, the body weight change, tumor volume change, response rate and tumor inhibition rate were analyzed, wherein the tumor volume at the end of the experiment is shown in Figure 28, the tumor inhibition rate is shown in Figure 29, and the response rate is shown in Figure 30. The total mouse condition statistics are shown in Table 12.
[0394] Table 12: Total mouse condition statistics
[0395] As shown in Figure 27, the tumor volume size change curve during the experiment shows that compared with the control group A, the anti-PD-1 antibody single drug group B, and the MNH30639-FDS combined with anti-PD-1 antibody group C, the tumor volume is reduced, showing a certain combination effect.
[0396] As shown in Figure 28, at the end of the experiment, compared with the control group A and the anti-PD-1 antibody single drug group B, the MNH30639-FDS combined with anti-PD-1 antibody group C reduced the tumor volume, showing a certain combination effect.
[0397] As shown in Figure 29, compared with the control group A, the anti-PD-1 antibody single drug group B, and the anti-PD-1 antibody combined with MNH30639 group C, the tumor inhibition rate was significantly improved. Compared with the anti-PD-1 antibody single drug group, the tumor inhibition rate of the MNH30639-FDS combined with anti-PD-1 antibody group C was improved, with a difference of 18.3%, showing a certain combination effect.
[0398] As shown in Figure 30, compared with the control group A and the anti-PD-1 antibody group B, the anti-PD-1 antibody combined with MNH30639-FDS group C significantly improved the anti-PD-1 antibody response rate.
[0399] Example 19. Inhibition of human colorectal cancer cell growth by MNH30639 supernatant in vitro
[0400] To verify whether MNH30639 has an effect on the growth of colorectal cancer cells, this experiment uses the CCK-8 method to evaluate its effect on human colorectal cancer cells SW480 and HCT-116. The experimental protocol has been reviewed by the Muen Biological Animal Management and Use Committee.
[0401] SW480 cells are microsatellite stable (MSS) cell lines, MSS colorectal cancer accounts for about 85% of all colorectal cancer and 95% of metastatic colorectal cancer. Its immune microenvironment is mainly immune exempt and immune desert, and the level of tumor lymphocyte infiltration and tumor mutational burden (TMB) is low, which is also considered as a typical "cold tumor". Studies have shown that MSS metastatic colorectal cancer (mCRC) is basically ineffective for single immune checkpoint inhibitors. HCT-116 is a microsatellite instability (MSI) cell line. Tumors with high MSI can attract the attention of the immune system. Under a microscope, a large number of immune system cells can often be seen in these tumors. Immune cells are just blocked and cannot fully play their role. Many patients with MSI-H tumors have a positive response to immunotherapy (or immune checkpoint therapy).
[0402] CCK-8: Cell Counting Kit-8 (CCK-8) is a widely used cell proliferation and cytotoxicity detection reagent based on WST-8
chemical name: 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfonic acid phenyl)-2H-tetrazole monosodium salt
[0403] Preparation of culture supernatant of MNH30639: inoculate strain MNH30639 in liquid medium (MM01), cultivate anaerobically at 37℃ for 48 hours, centrifuge to remove bacterial bodies, filter the culture supernatant with a 0.22μM filter, aliquot, and store the collection at -80℃ for freezing preservation, and wait for use.
[0404] Test sample groups: 1) control group (bacterial culture medium MM01); 2) experimental group (MNH30639 culture supernatant);
[0405] SW480 cells: purchased from Plannova, item number CL-0223B.
[0406] HCT-116 cells: purchased from Promocell, Cat# CL-0096.
[0407] CCK-8 assay: After cell counting, SW480 and HCT116 cells were cultured in RPMI1640 medium containing 10% FBS. At the time of experiment, SW480 and HCT116 cells were plated at 3 x 104cells / well in 96-well flat bottom plates in triplicate. After 24 hours of cell attachment, the old medium (RPMI1640) was removed and replaced with fresh medium containing 10% MM01 or MNH30639 supernatant. The cells were incubated for another 48 hours. The medium was removed and the cells were washed once with PBS. Then, 100 μL of 10% CCK-8 solution was added to each well. After incubation at 37°C in a 5% CO2 incubator for 30 minutes, the absorbance was measured at 450 nm. 4
[0408] Data analysis:
[0409] Results are shown in Figure 31. Compared with MM01, MNH30639 supernatant significantly inhibited the growth of SW480 (Figure 31A) and HCT-116 (Figure 31B) cells, and the activity of SW480 and HCT-116 cells decreased to 23% and 10%, respectively. These results suggest that MNH30639 inhibits the growth of colorectal cancer cells and is effective for both MSS and MSI colorectal cancer cells.
[0410] Example 20. MNH30639 electrostatic spray inhibits the growth of liver cancer
[0411] The H22-BALB / c mouse liver cancer homologous tumor model was used to perform the experiment of inhibiting the growth of liver cancer to explore the anti-tumor efficacy of strain MNH30639 electrostatic spray. The strain MNH30639 electrostatic spray was prepared using conventional methods in the art. The results are shown in Figure 32A and Figure 32B. MNH30639 electrostatic spray can significantly inhibit the growth of tumors, and the efficacy is consistent with that of MNH30639 bacterial solution without obvious difference. It is proved that MNH30639 electrostatic spray can be used as a dosage form for drug development.
[0412] Example 21. Evaluation of the effect of strain MNH30639 on T cell activation
[0413] Experimental method:
[0414] T cells activated in the tumor microenvironment can directly or indirectly kill tumor cells, play an important role in inhibiting the occurrence and development of tumor cells. After T cell activation, immune response is activated by releasing cytokines such as IFN-γ and TNF-α, thereby controlling tumor progression. A large number of studies have shown that certain microorganisms and microbial metabolites can promote the secretion of cytokines such as IFN-γ and TNF-α of T cells, activate immune response, and thus mediate the killing effect of tumor. For mice, the most common method is to isolate single cells from spleen tissue and activate and differentiate into T cells with CD3 / CD28 antibodies. Therefore, this study uses this model, and uses flow cytometry to detect the secretion of IFN-γ and TNF-α of T cells, so as to evaluate the effect of strains on T cell activation.
[0415] Experimental preparation:
[0416] 1) 1640 complete medium: DMEM medium containing 10% FBS, 1% Penicillm-Streptomycin (penicillin-streptomycin double-antibiotic solution), 1% L-glutamine, 1% HEPES (4-hydroxyethylpiperazine ethanesulfonic acid, buffer).
[0417] 2) T cell activation medium: 1640 complete medium containing 1 ug / mL CD3 monoclonal antibody and 3 ug / mL CD28 monoclonal antibody.
[0418] 3) MNH30639 culture supernatant preparation: inoculate strain MNH30639 in MM01 liquid medium, cultivate anaerobically at 37°C for 48 hours, centrifuge to remove bacterial bodies, filter the culture supernatant with a 0.22 μm filter, aliquot, and collect the product at -80°C for low-temperature preservation.
[0419] 4) MM01 group: T cell activation medium containing 2.5% volume of MM01 bacterial culture medium.
[0420] 5) MNH30639 group: T cell activation medium containing 2.5% volume of MNH30639 bacterial supernatant.
[0421] 6) T cell dead and live marker staining solution: Live / Fc dye is configured at a ratio of 1:1000, and 100 uL per reaction system.
[0422] 7) T cell surface marker staining solution: CD45-AF700, CD4-APC, CD8-PC5.5 are configured at a ratio of 1:100, and 100 uL per reaction system.
[0423] 8) T cell cytokine staining solution: IFN-γ-PE-Cy7, TNF-α-PE are configured at a ratio of 1:100, and 100 uL per reaction system.
[0424] 9) Cytokine stimulator: 1640 medium containing 2.5 ug / mL of phorbol 12-myristate 13-acetate (PMA), 10 ug / mL of Ionomycin calcium salt and 1x of Brefeldin A (BFA).
[0425] Experimental procedures:
[0426] Isolation and culture of mouse spleen mononuclear cells: The mouse spleen tissue was taken out, grinded with a 5 mL syringe, filtered with a 70 um cell sieve, and centrifuged at 1000 rpm for 5 min. The cells were stained red, and finally reselected with PBS to complete the preparation of the mononuclear cell suspension.
[0427] Co-culture of mouse spleen T cells with strain supernatant: The spleen mononuclear cells were centrifuged and the cells were reselected with T cell activation medium, and then transferred to a 12-well plate. Then the cells were treated according to the conditions of the Control group, the MM01 group and the MNH30639 group, respectively. After 2-3 days of culture, the cells were collected by centrifugation and washed with PBS.
[0428] Cytokine stimulation, membrane rupture and staining of mouse T cells: The cells were collected, cytokine stimulator was added, and the cells were incubated in a 37°C constant temperature incubator for 4 h, then centrifuged at 1000 rpm for 5 min. The supernatant was discarded, and live and dead staining was performed for 30 min. The staining was terminated, the cells were centrifuged at 1000 rpm for 5 min, and the supernatant was discarded. T cell surface staining was performed for 30 min, the staining was terminated, the cells were centrifuged at 1000 rpm for 5 min, and the supernatant was discarded. Cell fixation was performed by adding fixing solution for 20 min, the fixation was terminated, the cells were centrifuged at 1000 rpm for 5 min, and the supernatant was discarded. 1x membrane rupture solution was added, mixed well by repeated blowing, centrifuged at 2000 rpm for 5 min, and the supernatant was discarded. The above operation was repeated. Then T cell cytokine staining was performed for 30 min, centrifuged at 2000 rpm for 5 min, and the supernatant was discarded. Finally, 200 μL of PBS was added to resuspend the cells, and the expression of CD4+, CD8+ T cell IFN-γ, TNF-α was detected by flow cytometry.
[0429] Experimental results and analysis:
[0430] Figure 33 shows the results of flow cytometric analysis of CD8+ T cell TNF-α. The data are shown as mean ± standard deviation (Mean ± SD), and the statistical analysis is performed using the Unpaired T test analysis method. The significant difference is indicated by *, and the significant meaning analysis is: no significant difference (ns), p value ≥ 0.05; *, p value < 0.05; **, p value < 0.01; ***, p value < 0.001; ****, p value < 0.0001.
[0431] Figure 33A shows that the supernatant of MNH30639 can significantly promote the increase of the proportion of TNF-a expressing CD8+ T cells compared with the MM01 group, and Figure 33B is the statistical result of A. These results show that MNH30639 can promote CD8 T cell activation and has the potential to activate T cell anti-tumor immunity.
[0432] Example 22. Evaluation of the effect of strain MNH30639 on inhibition of M2 TAM phenotype
[0433] Experimental methods
[0434] Tumor associated macrophages (TAM) play an important role in the malignant progression of tumors. TAM can be roughly divided into M1 and M2 types, M1 plays a pro-inflammatory role and inhibits tumor growth, while M2 plays an anti-inflammatory role and inhibits anti-tumor immune activation, promoting tumor malignant progression. Therefore, for M2 type macrophages, this study established an in vitro method to induce mouse monocyte macrophage leukemia cells (RAW264.7) with IL-4 to construct an M2 TAM model in vitro, and detected the expression level changes of M2 macrophage biomarkers CD206 and Arg1 by real-time fluorescent quantitative PCR technique, for evaluating the influence of the strain on M2 macrophage phenotype.
[0435] 1) Preparation of MNH30639 culture supernatant: inoculate strain MNH30639 in MM01 liquid medium, cultivate anaerobically at 37°C for 48 hours, centrifuge to remove bacterial bodies, filter the culture supernatant with a 0.22 μm filter, aliquot, and collect the product at -80°C for low temperature preservation.
[0436] 2) DMEM complete medium: DMEM medium: fetal bovine serum (FBS): P / S = 9:1:0.1; for example, 45 mL DMEM medium + 5 mL fetal bovine serum (FBS) + 500 μL P / S (penicillin-streptomycin double-antibiotic solution)
[0437] 3) Control group: DMEM complete medium containing 5% volume of MM01 bacterial culture medium;
[0438] 4) TAM group: DMEM complete medium containing 20 ng / mL IL4 and 5% MM01 bacterial culture medium
[0439] 5) MNH30639 group: DMEM complete medium containing 20 ng / mL IL4 and 5% MNH30639 bacterial culture supernatant.
[0440] After counting RAW264.7 cells, they were seeded into 6-well plates at 5*10⁵ cells / 2 mL per well and incubated at 37°C with 5% CO₂ for 24 hours until adherence. The next day, the old culture medium was aspirated, and 2 mL of the corresponding medium for Control, TAM, and MNH30639 cells was added to each well. The cells were gently mixed and incubated at 37°C with 5% CO₂ for 2 days. After incubation, cells were washed with PBS, and RNA extraction (TAKARA MiniBEST Universal RNA Extraction Kit, TAKARA), reverse transcription (PrimeScript™ RT reagent Kit with gDNA Eraser, TAKARA), and qPCR were performed to detect the expression of CD206 and Arg1, and the internal control GAPDH (TB). Premix Ex Taq TM II, TAKARA). All procedures were performed according to the kit instructions. CD206 primers: F-CTCTGTTCAGCTATTGGACGC; R-CGGAATTTCTGGGATTCAGCTTC; Arg1 primers: F-CATTGGCTTGCGAGACGTAGAC; R-GCTGAAGGTCTCTTCCATCACC; GAPDH primers: F-GTGTTCCTACCCCCAATGTGT; R-ATTGTCATACCAGGAAATGAGCTT
[0441] Experimental results
[0442] Figure 34 shows that IL-4 significantly upregulated the expression of macrophage M2 type biomarkers CD206 and Arg1, indicating that IL-4 successfully induced the M2 type conversion in RAW264.7 cells. Furthermore, culture of strain MNH30639 significantly inhibited the IL-4-induced significant expression of CD206 and Arg1, suggesting that MNH30639 inhibits IL-4-induced M2 type conversion in RAW264.7 cells. These results suggest that MNH30639 has the ability to relieve immunosuppression of M2 macrophages in the tumor microenvironment, thereby promoting the activation of anti-tumor immunity.
[0443] The technical solutions of the present invention are not limited to the specific embodiments described above. Any technical modifications made in accordance with the technical solutions of the present invention fall within the protection scope of the present invention.
Claims
1. A bacterial strain, characterized in that, The strain is a strain of Odoribacter splanchnicus, and the strain has a 16S rRNA of a nucleotide sequence as shown in SEQ ID NO: 3 or a 16S rRNA having at least 95%, 95.1%, 95.2%, 95.3%, 95.4%, 95.5%, 95.6%, 95.7%, 95.8%, 95.9%, 96%, 96.1%, 96.2%, 96.3%, 96.4%, 96.5%, 96.6%, 96.7%, 96.8%, 96.9%, 97%, 97.1%, 97.2%, 97.3%, 97.4%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% sequence identity thereto.
2. The strain according to claim 1, characterized in that, The strain is a strain deposited on December 23, 2022 in the Guangdong Microbial Culture Collection Center, with a deposit name of Odoribacter splanchnicus MNH 30639 and a deposit number of GDMCC No: 63075; or a strain having an average genetic similarity ANI value of at least 95%, 95.1%, 95.2%, 95.3%, 95.4%, 95.5%, 95.6%, 95.7%, 95.8%, 95.9%, 96%, 96.1%, 96.2%, 96.3%, 96.4%, 96.5%, 96.6%, 96.7%, 96.8%, 96.9%, 97%, 97.1%, 97.2%, 97.3%, 97.4%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% with the genome of the strain.
3. The strain according to claim 1, characterized in that, The strain has one or more of the following properties: The colony of the strain is round, with regular and smooth edges, translucent, no secretion is formed around the colony, and it is a gram-negative bacterium, with short rod-shaped or bifurcated short rod-shaped cells, no spores, and no flagella; The optimal growth temperature of the strain is 30-42°C, and the optimal growth temperature is 37°C; The strain can grow in a pH range of 6.0-10.0, and the optimal growth pH is 8.0; The strain does not grow on a medium with a NaCl content of more than 1 w / v%; the strain does not grow on a medium with a bile salt content of more than 0.10 w / v%; the strain is an anaerobic bacterium; the strain is sensitive to erythromycin and lincomycin; the strain is resistant to ampicillin, cotrimoxazole, chloramphenicol, ciprofloxacin, ceftriaxone, gentamicin, tetracycline and / or penicillin; the strain has a nucleotide sequence with an alignment identity of at least 90% to the tetQ gene encoding a tetracycline resistance determinant; the strain has an integrity of the butyric acid pathway of 90-100%, preferably 100%; the strain is capable of producing short chain fatty acids having a carbon atom number of 2-5; Preferably, the short-chain fatty acid has the structural formula CH3[CH2] n COOH, n = 0-3; preferably, the short chain fatty acids comprise any one of acetic acid, propionic acid, isobutyric acid, butyric acid, isovaleric acid, valeric acid, caproic acid, heptanoic acid, octanoic acid, nonanoic acid or decanoic acid.
4. The strain according to claim 1, characterized in that, the strain has one or more of the following immune modulating activities: inducing macrophage differentiation; inducing secretion of cytokines; promoting transcriptional activity of IFNβ; preferably, the cytokines comprise one or more of pro-inflammatory, chemotactic and anti-inflammatory cytokines: preferably, the cytokines comprise one or more of IFNβ, IL-10, IL-12 / IL-13P40, IL-6, MCP-1, RANTES, IL-1β, IP-10 and IL-8.
5. The strain according to claim 1, characterized in that, the strain is capable of inhibiting histone deacetylase.
6. A microbial inoculant comprising the strain of any one of claims 1-5, or an attenuated strain, a radiated strain, a culture of the strain, a metabolite of the strain or a supernatant of the strain; preferably, the culture of the strain is a solid culture, a fermentation culture or a supernatant of a fermentation culture.
7. A composition characterized in that, the composition comprises the strain of any one of claims 1-5, or an attenuated strain, a radiated strain, a culture of the strain, a metabolite of the strain or a supernatant of the strain; preferably, the culture of the strain is a solid culture, a fermentation culture or a supernatant of a fermentation culture.
8. The composition of claim 7, wherein, The content of the strain is 1 x 10 4 ~ 9 x 10 10 CFU / mL, more preferably 1 x 10 7 ~ 9 x 10 10 CFU / mL, further preferably 1.3 x 10 7 , 1.3 x 10 8 , 1.3 x 10 9 , 1.3 x 10 10 CFU / mL; preferably, the composition comprises at least 50% more of the live strain, more preferably 90% more of the live strain.
9. The composition of claim 7, wherein the composition further comprises a pharmaceutically or nutraceutically acceptable carrier; preferably, the composition is in a formulation selected from one or more of a liquid formulation, a solid formulation, a lyophilized formulation, a spray formulation and an electrostatic spray formulation.
10. The composition of claim 7, wherein the composition further comprises a co-drug, the co-drug comprising an immune checkpoint molecule modulator; preferably, the immune checkpoint molecule modulator is selected from one or more of an anti-PD-1 antibody, an anti-CTLA-4 antibody, an anti-PD-L1 antibody, a PD-L1 inhibitor; more preferably, the PD-L1 inhibitor is selected from durvalumab, atezolizumab or avelumab; the anti-PD-1 antibody or anti-PD-L1 antibody is selected from pembrolizumab, tremelimumab, sintilimab, tislelizumab or camrelizumab or nivolumab; the anti-CTLA-4 antibody is ipilimumab; more preferably, the anti-PD-1 antibody is in an effective dosage of 1-100 mg / kg.
11. The composition of claim 7, wherein The composition is a medicine, health product or food.
12. Use of the strain of any one of claims 1-5, the bacterial agent of claim 6 or the composition of any one of claims 7-11 in the preparation of a medicine, health product or food for modulating immune activity or preventing and / or treating a tumor.
13. Use according to claim 12, characterized in that, The preventing and / or treating a tumor comprises one or more of the following: 1) inhibiting tumor volume growth; 2) inhibiting tumor weight increase; 3) inhibiting tumor cell growth; 4) increasing tumor growth inhibition rate; 5) increasing tumor response rate to treatment; 6) inhibiting histone deacetylase activity; 7) activating local immunity of the subject by increasing the proportion of M1 macrophages in tumor tissue to exert an anti-tumor effect; 8) exerting growth inhibition effect on tumor cells by relieving immune suppression in tumor microenvironment through inhibiting MDSC cells in tumor tissue; 9) increasing the therapeutic effect of an immunosuppressive drug, preferably, the immunosuppressive drug comprises an immune checkpoint inhibitor, preferably an anti-PD-1 antibody; and, 10) inhibiting tumor by exerting immune regulation effect on the immune system of the subject, preferably, the modulating the immune system of the subject comprises inducing secretion of cytokines.
14. Use of the strain of any one of claims 1-5, the bacterial agent of claim 6 or the composition of any one of claims 7-11 in the preparation of a medicine for treating and / or preventing a disease mediated by HDAC activity.
15. Use according to claim 14, characterized in that, The disease mediated by HDAC activity is selected from one or more of the following: a tumor, a metabolic disease, diabetes, an autoimmune disease, an infectious disease, a central nervous system disease and an inflammatory bowel disease.
16. Use according to any one of claims 12 to 15, characterized in that, The tumor is selected from a refractory tumor or a recurrent tumor; Preferably, the tumor is selected from one or more of the following: a solid tumor, an adenoma and a metastatic tumor; Preferably, the tumor is selected from one or more of the following: liver cancer, colon cancer, rectal cancer, colorectal cancer, lung cancer; Preferably, the tumor is selected from a tumor caused by viral infection or a tumor caused by bacterial infection; Preferably, the tumor is selected from one or more of the following: a tumor caused by human papillomavirus (HPV) infection, hepatitis B virus (HBV) or hepatitis C virus (HCV) infection, human immunodeficiency virus (HIV) infection, herpes virus type IV (EBV) infection, and Helicobacter pylori (HP) infection, Fusobacterium nucleatum (FN) infection.
17. A method for inhibiting tumor growth, comprising administering to a subject an effective dose of the strain of any one of claims 1-5, the bacterial agent of claim 6 or the composition of any one of claims 7-11.
18. The method of claim 17, wherein, The inhibition of tumor growth comprises one or more of the following: 1) inhibiting tumor volume growth; 2) inhibiting tumor weight increase; 3) inhibiting tumor cell growth; 4) increasing tumor growth inhibition rate; 5) increasing tumor response rate to treatment; 6) inhibiting histone deacetylase activity; 7) activating local immunity of the subject by increasing the proportion of M1 macrophages in tumor tissue, thereby exerting an anti-tumor effect; 8) exerting growth inhibition on tumor cells by relieving immune suppression in the tumor microenvironment by inhibiting MDSC cells in the tumor tissue; 9) improving the therapeutic effect of immunosuppressive drugs, preferably, the immunosuppressive drugs comprise immune checkpoint inhibitors, preferably anti-PD-1 antibodies; and 10) inhibiting tumors by exerting immune regulation on the immune system of the subject, preferably, the regulation of the immune system of the subject comprises inducing secretion of cytokines.
19. A method for treating and / or preventing a disease mediated by HDAC activity, comprising administering to a subject an effective amount of the strain of any one of claims 1-5, the bacterial agent of claim 6, or the composition of any one of claims 7-11.
20. The method of claim 19, wherein, The disease mediated by HDAC activity comprises one or more of the following: tumor, metabolic disease, diabetes, autoimmune disease, infectious disease, central nervous system disease, inflammatory bowel disease.
21. The method of any one of claims 17 to 20, wherein, The tumor comprises solid tumor, adenoma and metastatic tumor. Preferably, the tumor comprises liver cancer, colon cancer, rectal cancer, colorectal cancer, lung cancer.
Citation Information
Patent Citations
Bed system with magnets
KR1020230071542A
Methods and products for treatment of gastrointestinal disorders
US20220257670A1
Transferable microbiota for the treatment of ulcerative colitis
US20230087012A1
Gut commensal bacteria for treatment of human colorectal cancer
WO2019149859A1