Phytogenic additive and application thereof in promoting growth and combating coccidiosis

Trifolium pratense extract is used as a feed supplement to combat coccidiosis in poultry by inhibiting Eimeria parasites and promoting growth, offering a safer and more effective alternative to conventional drugs.

WO2026011111A1PCT designated stage Publication Date: 2026-01-08ACAD SINICA +3
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/036403
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-07-04
Filing Date
2025-07-03
Publication Date
2026-01-08

AI Technical Summary

Technical Problem

Current anticoccidial drugs and vaccines are inadequate for effectively preventing and controlling coccidiosis in poultry, leading to significant economic losses and the emergence of drug-resistant strains of Eimeria species, which disrupt the gut microbiota and cause intestinal disorders.

Method used

A phytogenic additive derived from Trifolium pratense (red clover) or its extract (TPE) is used as a feed supplement to reduce intestinal infections, inhibit Eimeria parasite sporulation and invasion, and promote growth in poultry by modulating primary metabolism.

Benefits of technology

The TPE supplement effectively suppresses oocyst sporulation and sporozoite invasion, reduces intestinal lesions, and enhances weight gain in Eimeria-infected chickens, outperforming commercial coccidiostats in efficacy and safety.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025036403_08012026_PF_FP_ABST
    Figure US2025036403_08012026_PF_FP_ABST
Patent Text Reader

Abstract

The present disclosure provides a composition comprising an effective amount of a Trifolium pratense (TP) extract (TPE) or an active ingredient(s) contained therein (TP API), or a combination of TP and TPE or TP and TP API. The present disclosure further provides uses of the composition.
Need to check novelty before this filing date? Find Prior Art

Description

PATENT Attorney Docket No.: G4590-19600PCT PHYTOGENIC ADDITIVE AND APPLICATION THEREOF IN PROMOTING GROWTH AND COMBATING COCCIDIOSIS Priority Information

[0001] This application claims benefit of and priority to U.S. Provisional Patent Application No. 63 / 667,739, filed July 4, 2024, the contents of which is incorporated by reference in its entirety. Sequence Listing

[0002] The instant application contains a Sequence Listing which is submitted electronically in XML format and is hereby incorporated by reference in its entirety. The XML copy, created on July 1, 2025, is named “G4590-19600PCT_20250701_SeqListing.xml” and is 2,929 bytes in size. Field of the Invention

[0003] The present disclosure relates generally to a phytogenic field. Particularly, the present disclosure relates to Trifolium pratense, an extract thereof or an active ingredient(s) contained therein and methods for providing the same in promoting growth and preventing or treating coccidiosis in poultry. Background of the Invention

[0004] Coccidiosis has become one of the most severe contagious parasite intestinal diseases in the poultry industry worldwide, causing reduced feed intake, digestive disorders, growth retardation, hemorrhagic diarrhea, and in severe cases, even death. Coccidiosis is caused by a protozoan parasite of the genus Eimeria. Currently, seven species of Eimeria with different pathogenicities have been identified from chickens, i.e. Eimeria acervulina, Eimeria tenella, Eimeria maxima, Eimeria brunetti, Eimeria necatrix, Eimeria praecox, and Eimeria mitis (Tewari, A. K., and B. R. Maharana.2011. Control of poultry coccidiosis: changing trends. J. Parasit. Dis. 35:10−17). Chicken Eimeria also increases the susceptibility of the host to other pathogens, of which Clostridium perfringens is commonly co-infected with some Eimeria species to cause necrotic enteritis (Williams, R. B., R. N. Marshall, R. R. La Ragione, and J. Catchpole. 2003. A new method for the experimental production of necrotic enteritis and its use for studies on the relationships between necrotic enteritis, coccidiosis and anticoccidial vaccination of chickens.PATENT Attorney Docket No.: G4590-19600PCT Parasitol. Res. 90:19−26), while perturbing the integrity of the normal gut microbiota, resulting in the proliferation of pathogenic bacteria, which affects chicken growth (Huang, G., X. Tang, F. Bi, Z. Hao, Z. Han, J. Suo, S. Zhang, S. Wang, C. Duan, Z. Yu, F. Yu, Y. Yu, Y. Lv, X. Suo, and X. Liu.2018. Eimeria tenella infection perturbs the chicken gut microbiota from the onset of oocyst shedding. Vet. Parasitol. 258:30−37). Moreover, coccidiosis costs the global poultry industry more than US$13 billion annually, including losses during production and costs for prophylaxis and treatment (Blake, D. P., J. Knox, B. Dehaeck, B. Huntington, T. Rathinam, V. Ravipati, S. Ayoade, W. Gilbert, A. O. Adebambo, I. D. Jatau, M. Raman, D. Parker, J. Rushton and F. M. Tomley.2020. Re-calculating the cost of coccidiosis in chickens. Veterinary Research, 51:1-14.).

[0005] Accordingly, many commercially available anticoccidial drugs and vaccines have been used to prevent and control coccidiosis; however, they are still inadequate for curbing the disease (Qaid, M. M., S. I. Al-Mufarrej, M. M. Azzam, M. A. Al-Garadi, H. H. Albaadani, I. A. Alhidary, and R. S. Aljumaah.2021. Anti-coccidial effect of Rumex nervosus leaf powder on broiler chickens infected with Eimeria tenella oocyst. Animals. 11:167−183). Recently, issues such as delays in chemical drug discovery, drug resistance and drug residues have led to the development of safe and effective anticoccidial herbal medicines and phytochemicals (Muthamilselvan, T., T. F. Kuo, Y. C. Wu, and W.C. Yang. 2016. Herbal remedies for coccidosis control: a review of plants, compounds, and anticoccidial actions. Evid. Based. Complement. Alternat. Med.2016:2657981). The increasing issue of drug-resistant strains of Eimeria species still occurs and thus there is an unmet need to develop a substitute and an alternative approach to the conventional coccidiostat in the poultry industry. Summary of the Invention

[0006] In the present disclosure, it is at least found that a phytogenic additive supports an animal's health and prevents or treat diseases. For example, T. pratense (TP) or T. pratense extract (TPE) for use as a feed or feed additive or supplement in poultry is provided.

[0007] In one aspect, the present disclosure provides a method of reducing, preventing or treating an intestinal infection in a subject, comprising administering to the subject an effective amount of a composition comprising a TP, a TPE, an active ingredient(s) contained therein (TP_API), or a combination of a TP and TPE or TP and TP_API. In one embodiment, the method further decreases the occurrence of intestinal infection. In some embodiments, the intestinalPATENT Attorney Docket No.: G4590-19600PCT infection is associated with at least one protozoan microorganism selected from the group consisting of Eimeria acervulina, Eimeria tenella, Eimeria maxima, Eimeria brunetti, Eimeria necatrix, Eimeria praecox, Eimeria mitis or any combination thereof.

[0008] In one aspect, the present disclosure provides a method of preventing or treating a disease associated with protozoan parasite of the genus Eimeria in a subject, comprising administering to the subject an effective amount of a composition comprising a TP, a TPE, an active ingredient(s) contained therein (TP_API), or a combination of TP and TPE or TP and TP_API. In some embodiments, the Eimeria is selected from the group consisting of Eimeria acervulina, Eimeria tenella, Eimeria maxima, Eimeria brunetti, Eimeria necatrix, Eimeria praecox, Eimeria mitis or any combination thereof.

[0009] In one aspect, the present disclosure provides a method of inhibiting an oocyst sporulation of a protozoan parasite or preventing a sporozoite invasion or reproduction in a subject, comprising administering to the subject an effective amount of a composition comprising a TP, a TPE, TP_API or a combination of TP and TPE or TP and TP_API.

[0010] In another aspect, the present disclosure provides a method of preventing or treating coccidiosis in a subject, comprising administering to the subject an effective amount of a composition comprising a TP, TPE, TP_API or a combination of TP and TPE or TP and TP_API.

[0011] In another aspect, the present disclosure provides a method of promoting growth of a subject, comprising administering to the subject an effective amount of a composition comprising a TP, a TPE, TP_API or a combination of TP and TPE or TP and TP_API. In one embodiment, a body weight gain of the poultry is restored. In at least one embodiment of the present disclosure, primary metabolome in the poultry is modulated. In some embodiments, the modulation of the primary metabolism comprises increasing or decreasing at least a level of an amino acid and its derivative, a level of a carbohydrate, a level of a fatty acid, a level of nucleotide, a level of an organic acid, a level of a sterol, and a level of urea cycle-related metabolite or any combination thereof.

[0012] In another aspect, the present disclosure provides a method of reducing, preventing or treating an intestinal infection, preventing or treating a disease associated with protozoan parasite of the genus Eimeria, inhibiting an oocyst sporulation of a protozoan parasite or preventing a sporozoite invasion or reproduction, preventing or treating coccidiosis, and / or promoting growthPATENT Attorney Docket No.: G4590-19600PCT of a subject, comprising administering to the subject an effective amount of a composition comprising sissotrin, ononin or sissotrin in combination with ononin.

[0013] In some embodiments, the active ingredient(s) in TP_API described herein comprises one or more of the following components: sissotrin, ononin, formononetin, malic acid, pantothenic acid, stearic acid and tryptophan. In further embodiment, the active ingredient(s) in TP_API comprises sissotrin, ononin or sissotrin and ononin.

[0014] In one embodiment, the subject described herein is poultry. In some embodiment, the poultry is a chicken, a duck, a turkey, a quail, an ostrich or a goose. In a further embodiment, the poultry is a chicken.

[0015] In some embodiments, the protozoan parasite described herein is Eimeria acervulina, Eimeria tenella, Eimeria maxima, Eimeria brunetti, Eimeria necatrix, Eimeria praecox or Eimeria mitis or any combination thereof.

[0016] In some embodiments, the composition described herein is in a powder form (e.g., a dried powder) or a liquid form (e.g., aqueous solution, oil suspension), or a granule form.

[0017] In one embodiment, the composition described herein is used as an additive (such as a feed additive) or a supplement (such as a feed supplement). In one embodiment, the feed additive or feed supplement comprises a composition comprising a TP, a TPE, TP_API or a combination of TP and TPE or TP and TP_API, wherein the TP, a TPE, TP_API or a combination of the TP and TPE or TP and TP_API ranges from about 0.0001 wt% to about 5 wt% of the total dry weight of the feed additive or feed supplement.

[0018] In some embodiments, the TP, a TPE, TP_API or a combination of TP and TPE or TP and TP_API in the additive or a supplement is in a range from about 0.0001 wt% to about 5 wt% based on the total dry weight of the additive or a supplement, e.g., about 0.0001 wt%, about 0.0002 wt%, about 0.0003 wt%, about 0.0004 wt%, about 0.0005 wt%, about 0.0006 wt%, about 0.0007 wt%, about 0.0008 wt%, about 0.0009 wt%, about 0.001 wt%, about 0.002 wt%, about 0.003 wt%, about 0.004 wt%, about 0.005 wt%, about 0.006 wt%, about 0.007 wt%, about 0.008 wt%, about 0.009 wt%, about 0.01 wt%, about 0.015 wt%, about 0.02 wt%, about 0.03 wt%, about 0.04 wt%, about 0.05 wt%, about 0.1 wt%, about 0.2 wt%, about 0.5 wt%, about 1 wt%, about 1.2 wt%, aboutPATENT Attorney Docket No.: G4590-19600PCT 1.5 wt%, about 2 wt%, about 2.5 wt%, about 3 wt%, about 3.5 wt%, about 4 wt%, about 4.5 wt% and about 5 wt%.

[0019] In one embodiment, the TPE is an alcoholic TPE. In a further embodiment, the TPE is an ethanolic TPE. In another further embodiment, the TPE is an about 50% to 99.5% ethanol TPE. For example, the TPE is an about 55% to 99.5% ethanol TPE, about 60% to 99.5% ethanol TPE, about 65% to 99.5% ethanol TPE, about 70% to 99.5% ethanol TPE, about 75% to 99.5% ethanol TPE, about 80% to 99.5% ethanol TPE, about 85% to 99.5% ethanol TPE, about 90% to 99.5% ethanol TPE, about 95% to 99.5% ethanol TPE, about 50% to 95% ethanol TPE, about 50% to 90% ethanol TPE, about 50% to 85% ethanol TPE, about 50% to 80% ethanol TPE, about 50% to 75% ethanol TPE, about 50% to 70% ethanol TPE, about 50% to 65% ethanol TPE, about 50% to 60% ethanol TPE, about 50% to 55% ethanol TPE, about 55% to 95% ethanol TPE, about 60% to 90% ethanol TPE, and / or about 65% to 80% ethanol TPE. Preferably, the TPO is an about 70% ethanol TPE.

[0020] In one embodiment, the TP_API is obtained by separating TPE with medium-pressure liquid chromatography (MPLC) (preferably on a C18 Cartridge with particle size 35-45 μm, column size 120 g, ethanol gradients 0-95%, and flow rate 20 mL / min) to obtain the TP_API at 14 to 17 mins. The selection of the column and the adjustment of parameters can be modified according to the actual conditions. These adjustments are within the understanding and capabilities of skilled person in the field. The collected API at the indicated retention times were dried by vacuum and measured the weights and calculated its content ratio in the TPE. In one embodiment, the TP_API is in a relative amount of about 0.5% to 10% (preferably about 1% about 5%, more preferably about 3.5%) of the TPE.

[0021] In one embodiment, the TPE comprises ononin in a relative amount of about 0.25% to about 5% (preferably about 0.2% to about 4%, about 0.25% to about 3.5%, about 0.25% to about 3%, about 0.25% to about 2.5%, about 0.25% to about 2%, about 0.5% to about 4%, about 0.5% to about 3%, about 0.5% to about 2%, about 1% to about 5%, about 1% to about 4%, about 1% to about 3.5%, about 1% to about 3%, about 1% to about 2%, about 1.5% to about 5%, about 1.5% to about 4%, about 1.5% to about 3.5%, about 1.5% to about 3%, about 1.5% to about 2%; more preferably about 1.81%) of the TPE, as measured by their relative weight content.PATENT Attorney Docket No.: G4590-19600PCT

[0022] In one embodiment, the TP_API comprises ononin in a relative amount of about 10% to about 40% (preferably about 10% to about 30%, about 10% to about 35%, about 10% to about 30%, about 10% to about 25%, about 15% to about 40%, about 15% to about 35%, about 15% to about 30%, about 15% to about 25%, about 20% to about 40%, about 20% to about 35%, about 20% to about 30% or about 20% to about 25%; more preferably about 21.6%) of the TP_API, as measured by their relative weight content.

[0023] In one embodiment, the TPE comprises sissotrin in a relative amount of about 0.25% to about 5% (preferably about 0.25% to about 4%, about 0.25% to about 3.5%, about 0.25% to about 3%, about 0.25% to about 2.5%, about 0.25% to about 2%, about 0.5% to about 4%, about 0.5% to about 3.5%, about 0.5% to about 3%, about 0.5% to about 2.5%, about 0.5% to about 2%, about 0.5% to about 1.5%, about 1% to about 5%, about 1% to about 4.5%, about 1% to about 4%, about 1% to about 3.5%, about 1% to about 3%, about 1% to about 2.5%, about 1% to about 2% or about 1% to about 1.5%; more preferably about 1.124%) of the TPE as measured by their relative weight content.

[0024] In one embodiment, the TP_API comprises sissotrin in a relative amount of about 0.1% to about 2% (preferably about 0.1% to about 1.5%, about 0.1% to about 1.0%, about 0.2% to about 2%, about 0.2% to about 1.5%, about 0.2% to about 1.0%, about 0.2% to about 0.8%, about 0.2% to about 0.6%, about 0.4% to about 2%, about 0.4% to about 1.5%, about 0.4% to about 1.0%, about 0.4% to about 0.8% or about 0.4% to about 0.6%; more preferably about 0.53%) of the TP_API as measured by their relative weight content.

[0025] In one embodiment, the TPE comprises ononin in a relative amount of about 0.25% to about 5% (preferably about 0.2% to about 4%, about 0.25% to about 3.5%, about 0.25% to about 3%, about 0.25% to about 2.5%, about 0.25% to about 2%, about 0.5% to about 4%, about 0.5% to about 3%, about 0.5% to about 2%, about 1% to about 5%, about 1% to about 4%, about 1% to about 3.5%, about 1% to about 3%, about 1% to about 2%, about 1.5% to about 5%, about 1.5% to about 4%, about 1.5% to about 3.5%, about 1.5% to about 3%, about 1.5% to about 2%; more preferably about 1.81%) of the TPE and sissotrin in a relative amount of about 0.25% to about 5% (preferably about 0.2% to about 4%, about 0.25% to about 3.5%, about 0.25% to about 3%, about 0.25% to about 2.5%, about 0.25% to about 2%, about 0.5% to about 4%, about 0.5% to about 3.5%, about 0.5% to about 3%, about 0.5% to about 2.5%, about 0.5% to about 2%, about 0.5% toPATENT Attorney Docket No.: G4590-19600PCT about 1.5%, about 1% to about 5%, about 1% to about 4.5%, about 1% to about 4%, about 1% to about 3.5%, about 1% to about 3%, about 1% to about 2.5%, about 1% to about 2% or about 1% to about 1.5%; more preferably about 1.124%) of the TPE, as measured by their relative weight content.

[0026] In one embodiment, the TP_API comprises ononin in a relative amount of about 10% to about 40% (preferably about 10% to about 30%, about 10% to about 35%, about 10% to about 30%, about 10% to about 25%, about 15% to about 40%, about 15% to about 35%, about 15% to about 30%, about 15% to about 25%, about 20% to about 40%, about 20% to about 35%, about 20% to about 30% or about 20% to about 25%; more preferably about 21.6%) of the TP_API and sissotrin in a relative amount of about 0.1% to about 2% (preferably about 0.1% to about 1.5%, about 0.1% to about 1.0%, about 0.2% to about 2%, about 0.2% to about 1.5%, about 0.2% to about 1.0%, about 0.2% to about 0.8%, about 0.2% to about 0.6%, about 0.4% to about 2%, about 0.4% to about 1.5%, about 0.4% to about 1.0%, about 0.4% to about 0.8% or about 0.4% to about 0.6%; more preferably about 0.53%) of the TP_API as measured by their relative weight content.

[0027] In one embodiment, the TP or TPE comprises one or more of the following components: sissotrin, ononin, formononetin, malic acid, pantothenic acid, stearic acid and tryptophan.

[0028] In at least one embodiment, the TPE has one or more the following characteristics: about 15% to about 1% of malic acid and about 85% to about 99% of formononetin in relative amount; about 10% to about 0.5% of pantothenic acid and about 90% to about 99.5% of formononetin in relative amount; about 60% to about 90% of formononetin and about 10% to about 40% of stearic acid in relative amount; about 25% to about 1% of tryptophan and about 75% to about 99% of formononetin in relative amount; about 80% to about 50% of ononin and about 20% to about 50% of sissotrin in relative amount; and about 80% to about 50% of formononetin and about 20% to about 50% sissotrin in relative amount.

[0029] In at least one embodiment, the TPE has one or more the following characteristics:PATENT Attorney Docket No.: G4590-19600PCT a ratio of malic acid to formononetin of about 0.047 to about 1 or less of the TPE in relative amount; a ratio of pantothenic acid to formononetin of about 0.026 to about 1 or less of the TPE in relative amount; a ratio of formononetin to stearic acid of about 2.318 to about 1 or less of the in relative amount; a ratio of tryptophan to formononetin of about 0.142 to about 1 or less of the TPE in relative amount; a ratio of ononin to sissotrin of about 3.214 to about 1 or less of the TPE in relative amount; and a ratio of formononetin to sissotrin of about 3.149 to about 1 or less of the TPE in relative amount.

[0030] In at least one embodiment, the TPE has one or more the following characteristics: a ratio of malic acid to formononetin of about 0.047 to about 1 of the TPE in relative amount; a ratio of pantothenic acid to formononetin of about 0.026 to about 1 of the TPE in relative amount; a ratio of formononetin to stearic acid of about 2.318 to about 1 of the TPE in relative amount; a ratio of tryptophan to formononetin of about 0.142 to about 1 of the TPE in relative amount; a ratio of ononin to sissotrin of about 3.214 to about 1 of the TPE in relative amount; and a ratio of formononetin to sissotrin of about 3.149 to about 1 of the TPE in relative amount. Brief Description of the Drawings

[0031] Figure 1. HPLC chromatogram of Trifolium pratense ethanolic extract at 254 nm. Compound identification: 1 ononin (17.28 min), 2 sissotrin (26.18 min), 3 formononetin (38.70 min), 4 biochanin A (43.94 min).

[0032] Figures 2A-2C. Effects of TPE, sissotrin, and ononin treatments on the activities of E. tenella sporozoite infection. The genome copy numbers of sporozoites were quantified by real- time PCR using three study models: pretreated-sprozoites invasion activity assay (Figure 2A), infection activity in pre-exposure cells (Figure 2B), and infection activity in post-exposure cells (Figure 2C). These models were used as indicators for evaluating the efficiency of tested extracts in reducing the sporozoites infection in MDBK cells. All experimental data are presented as box plots. Assays were performed in quadruplicate and statistical differentiation was calculated by intragroup comparing the non-treated group (vehicle), the amprolium at 125 µg / mL (AMP125) group, and the TPE 60 µg / mL treated group (TPE60), the sissotrin (5 µg / mL) group and the ononinPATENT Attorney Docket No.: G4590-19600PCT (5 µg / mL) group through Kruskal–Wallis test and Dunn's Multiple Comparison post hoc tests. Significance effects are marked with asterisks (*, P < 0.05).

[0033] Figures 3A-3C. Effects of TPE and TP_API treatments on the activities of E. tenella sporozoite infection. The genome copy numbers of sporozoites were quantified by real-time PCR using three study models: pretreated-sprozoites invasion activity assay (Figure 3A), infection activity in pre-exposure cells (Figure 3B), and infection activity in post-exposure cells (Figure 3C). These models were used as indicators for evaluating the efficiency of tested extracts in reducing the sporozoites infection in MDBK cells. All experimental data are presented as box plots. Assays were performed in quadruplicate and statistical differentiation was calculated by intragroup comparing the non-treated group (vehicle), the amprolium at 125 µg / mL (AMP125) group, the TPE at 60 µg / mL group (TPE60), and the TP_API at 40 µg / mL group through Kruskal–Wallis test and Dunn's Multiple Comparison post hoc tests. Significance effects are marked with asterisks (*, P < 0.05).

[0034] Figures 4A-4C. The relative percentage of body weight gain before and after chickens challenged with E. acervulina (Figure 4A) E. tenella (Figure 4B) and E. maxima (Figure 4C) that underwent AMP, TP and TPE treatments. N = 12 animals per group. All values are presented as box plots and Kruskal–Wallis test and Dunn's Multiple Comparison post hoc test were performed to determine the statistical differences of unmedicated non-challenged group (UUC), unmedicated challenged group (UCC), reference group (AMP 125ppm) and treatment groups (TP 500ppm, TP 1000ppm and TPE 100ppm). Significant effects are marked with asterisks (**, P < 0.01).

[0035] Figures 5A-5C. The lesion score reduction of coccidia-infected chickens after treatment with AMP, TP or TPE at the indicated doses. All birds were sacrificed on the 7th day post-challenge, and the gut tissue samples were obtained for scoring based on the lesion index of particular Eimeria spp. N = 12 animals per group. The variations of lesion scores on chickens challenged with E. acervulina (Figure 5A) E. tenella (Figure 5B) and E. maxima (Figure 5C) are presented as a box plot. Kruskal–Wallis test and Dunn's Multiple Comparison post hoc test were performed to determine the statistical differentiation of the non-medicated challenged group (UCC), the reference group (AMP 125ppm) and the treatment groups (TP 500 ppm, TP 1000 ppm and TPE 100 ppm). Significant effects are marked with asterisks (*, P < 0.05; **, P < 0.01).PATENT Attorney Docket No.: G4590-19600PCT

[0036] Figures 6A-6C. Effects of TP and TPE on suppression of oocyst development after coccidian inoculation. The output of OPG on day 5 post-infection with E. acervulina (Figure 6A), and day 6 post-infection with E. tenella (Figure 6B), and E. maxima (Figure 6C) were obtained by the McMaster egg counting method and presented as a box plot. N = 4 cages of fecal samples per group. Kruskal–Wallis test and Dunn's Multiple Comparison post hoc test were performed to determine the statistical differentiation of the non-medicated challenged group (UCC), the reference group (AMP 125 ppm), and the treatment groups (TP 500 ppm, TP 1000 ppm and TPE 100 ppm). Significant effects are marked with asterisks (*, P < 0.05).

[0037] Figures 7A-7D. Effects on the primary metabolome in chickens challenged with E. tenella (Figures 7A, 7B) and E. acervulina (Figures 7C, 7D), respectively. PLS-DA analysis of serum primary metabolome in healthy (control) chickens and chickens infected with E. tenella (vehicle) (Figure 7A: Score plot; Figure 7B: Loading plot). PLS-DA analysis of serum primary metabolites in healthy (control) chickens and chickens infected with E. acervulina (vehicle) (Figure 7C: Score plot; Figure 7D: Loading plot).

[0038] Figures 8A-8B. Effect of dietary supplementation of TP on the primary metabolome in chickens challenged with E. tenella. Score plot (Figure 8A) and loading plot (Figure 8B) of the chicken serum metabolome in E. tenella challenged chickens with vehicle, amprolium (AMP125) (control), or TP500 treatment obtained by PLS-DA analysis.

[0039] Figures 9A-9B. Effect of dietary supplementation of TP on the primary metabolome in chickens challenged with E. acervulina. Score plot (Figure 9A) and loading plot (Figure 9B) of chicken serum metabolome in E. acervulina-challenged chickens with vehicle, amprolium (AMP125) (control), or TP500 treatment obtained by PLS-DA analysis. Detailed Description of the Invention

[0040] The terminology herein is used to describe specific embodiments of the invention, but their usage does not delimit the invention, except as outlined in the claims. It is to be understood that both the foregoing general description and the following detailed description are examples and explanatory only and are not restrictive of the subject matter claimed in this application.

[0041] Terms such as "a", "an" and "the" are not intended to refer to only a singular entity, but include the general class of which a specific example may be used for illustration.PATENT Attorney Docket No.: G4590-19600PCT

[0042] In this application, the use of "or" means "and / or" unless stated otherwise.

[0043] The term "feed" refers to food given to domestic livestock, and pet (companion animal) food.

[0044] The term "poultry" described herein may be used with all types of poultry, including other livestock, such as ducks, and turkeys. In one embodiment, the poultry of the present disclosure is a chicken.

[0045] As used herein, the term "about" when referring to the numerical value is meant to encompass variations of ±20%, ±10%, ±5%, ±1%, ±0.5%, or ±0.1% from the numerical value. Such variations in the numerical value may occur by, e.g., the experimental error, calculation errors, routine minor adjustments, the typical error in measuring or handling procedures for making ingredients, supplements, compositions, or formulations, the differences in the source, manufacture, or purity of starting materials or ingredients used in the present disclosure, or like considerations.

[0046] As used herein, the term "comprising" or "comprises" is used in reference to compositions, methods, and respective component(s) thereof, which are included in the present disclosure, yet open to the inclusion of unspecified elements or steps, whether essential or not.

[0047] As used herein, the term "treatment" refers to the use of an effective agent to the poultry in need thereof with the purpose to cure, alleviate, relieve, remedy, ameliorate, reduce, or prevent the disease, the symptoms thereof, or the predispositions towards it.

[0048] As used herein, the term "preventing" or "prevention" refers to preventive or avoidance measures for a disease or symptoms or conditions of a disease, which include but are not limited to, applying or administering one or more active agents to the poultry which has not yet been diagnosed as the poultry suffering from the disease or the symptoms or conditions of the disease but may be susceptible or prone to the disease. The preventive measures of the present disclosure are provided to avoid, prevent, or postpone the occurrence of the disease or the symptoms or conditions of the disease.

[0049] As used herein, the phrase "an effective amount" refers to the amount of an active agent that is required to confer a desired preventive or therapeutic effect on the poultry in need thereof. Effective doses may vary, as recognized by those skilled in the art, depending on routes ofPATENT Attorney Docket No.: G4590-19600PCT administration, additional herbal ingredient usage, the possibility of co-usage with other phytogenic supplements, and the condition to be treated.

[0050] As used herein, the term "administering" or "administration" refers to the placement of an active agent into an animal by a method or route which results in at least partial localization of the active agent at the desired site to produce the desired effect. The active agent described herein may be administered by any appropriate route known in the art. For example, the feed composition of the present disclosure is administered to the animal by oral administration.

[0051] The term "relative amount" (or relative quantity or relative intensity) is used to compare values or express a quantity in proportion to another value.

[0052] The numeral ranges used herein are inclusive and combinable, any numeral value that falls within the numeral scope herein could be taken as a maximum or minimum value to derive the sub-ranges therefrom. For example, it should be understood that the numeral range "0.0001% to 99.9%" comprises any sub-ranges between the minimum value of 0.0001% to the maximum value of 99.9%, such as the sub-ranges from 10% to 90%, from 20% to 80%, from 30% to 70% and so on. In addition, a plurality of numeral values used herein can be optionally selected as maximum and minimum values to derive numerical ranges. For instance, the numerical ranges of 40% to 60%, 40% to 50%, and 50% to 60% can be derived from the numeral values of 40%, 50%, and 60%.

[0053] The term "TP" used herein refers to Trifolium pratense. Examples of the form of the TP include, but are not limited to, TP powder, TP solution, TP emulsion, TP granule and TP tablet.

[0054] The term "TPE" used herein refers to a TP extract obtained from extraction of TP with an organic solvent. Examples of the solvent include, but are not limited to, methanol, ethanol, propanol, hexane, acetone and ethyl acetate.

[0055] The term "TP_API" used herein refers to one or more active ingredients contained in TP. Examples of the active ingredients contained in TP include, but are not limited to, sissotrin, ononin, formononetin, malic acid, pantothenic acid, stearic acid and tryptophan and one or more of any combinations of the above active ingredients.

[0056] Coccidiosis, caused by a protozoan parasite of the genus Eimeria, is one of the most severe contagious parasite diseases affecting the poultry industry worldwide. Using phytogenicsPATENT Attorney Docket No.: G4590-19600PCT to prevent chicken coccidiosis is a strategy aimed at combating the increasing issue of drug- resistant strains of Eimeria spp.

[0057] The present disclosure demonstrates the anticoccidial activities of a medicinal herb, Trifolium pratense (TP) (such as TP in the form of powder, solution, granule or tablet form), and its extract (designated TPE; such as TPE ethanolic extract) and the TP_API against Eimeria spp.

[0058] In this disclosure, the TP or TPE or TP_API or a combination of TP and TPE or TP and TP_API for use as a feed additive in chickens is provided. The present disclosure shows that using TP or TPE as a feed additive in chickens decreases intestinal infection occurrence and improves growth performance compared to chickens fed with a control diet or the control diet group supplemented with a commercial coccidiostat, amprolium. Suppressing Eimeria-induced oocyst sporulation and sporozoite invasion, reduction of oocyst output and lesion score, recovery of weight gain, and modulation of primary metabolism were found to be a relevant action of the TP or TPE or TP_API or a combination of TP and TPE or TP and TP_API in improving growth performance and disease prevention in Eimeria-infected chickens.

[0059] Trifolium pratense L (Leguminosae), also known as red clover, is an herbaceous, short- lived perennial plant that is distributed all over the world. With characteristics that lend themselves to easy adaptation to the environment, such as rapid growth and resistance to acidic and humid conditions, T. pratense can grow in many different habitats and climates. Therefore, T. pratense is considered to be an important highly productive forage legumes for cattle and sheep in Europe and the United States. T. pratense is used in traditional medicine to treat menopausal symptoms, asthma, and even lower the risk of cancer and heart disease in a variety of cultures.

[0060] The extract of Trifolium pratense (TPE) reveals anti-coccidial effect in vitro and in vivo, and provides the chemical fingerprints of the TPE. The TPE is further isolated and purified to obtain active compounds.

[0061] The compounds in the TPE is further isolated and purified. The present disclosure determines the metabolite ratios in the total extract of T. pratense (TPE). For example, the small chemical metabolites in TPE were analyzed using LC / Q-TOF mass spectrometer (Agilent 6545XT) coupled with a BEH C18 column. The mass spectra data and the metabolite contents were calculated based on the peak intensities and analyzed by Agilent LC / MS Data Acquisition software, Agilent Qualitative Analysis software, and Agilent Profinder software.PATENT Attorney Docket No.: G4590-19600PCT

[0062] The chemical constituents in the TP or TPE includes sissotrin, ononin, formononetin, malic acid, pantothenic acid, stearic acid and tryptophan, and they are in one or more of the following ratios: ^ a ratio of malic acid to formononetin of 0.047 to 1 or less ^ a ratio of pantothenic acid to formononetin of 0.026 to 1 or less ^ a ratio of formononetin to stearic acid of 2.318 to 1 or less ^ a ratio of tryptophan to formononetin of 0.142 to 1 or less ^ a ratio of ononin to sissotrin of 3.214 to 1 or less ^ a ratio of formononetin to sissotrin of 3.149 to 1 or less

[0063] It is observed that sissotrin and ononin are the major bioactive compounds. The present disclosure uses the three indicated model assays to examine the compound effects against Eimeria oocyst sporulation and sporozoite invasion along with TPE and a commercial anti-coccidian drug amprolium (AMP) for comparison. The data provided herein shows that treatment with either compound by 5 µg / mL significantly suppressed sporozoite invasion and reproduction compared to the vehicle control (P < 0.05), and the effects were similar or better than that of TPE (50 µg / mL). The compounds' bioactivities support the TPE effect in animals against Eimeria infections. These two isoflavone glycosides are suggested to be developed into anti-coccidial agents.

[0064] The present disclosure illustrates that the TP or TPE or its composition exhibits significant suppressive activity against E. maxima oocyst sporulation and E. tenella sporozoite invasion and reproduction in Madin-Darby bovine kidney. Furthermore, administration of basal chicken diets containing TP powder or TPE to Eimeria-infected chickens significantly reduce the output of oocysts and severity of intestinal lesions. Dietary supplementation with TP significantly improved relative weight gain in E. tenella- and E. acervulina-infected chickens. The anticoccidial activities of TP and TPE on E. acervulina, E. tenella and E. maxima were further supported by anticoccidial index scores, which showed greater efficacy than those of amprolium, a commercial coccidiostat used in poultry. TP supplementation positively impacted the primary metabolism of chickens challenged with E. tenella or E. acervulina. The chemical fingerprints of TPE were established using liquid column chromatography; TPE contained four major compounds: ononin, sissotrin, formononetin, and biochanin A. In addition, various spectrometric methods were used to ensure the batch-to-batch consistency of TP / TPE. In conclusion, T. pratense is demonstrated to bePATENT Attorney Docket No.: G4590-19600PCT a novel phytogenic supplement that can be used to control Eimeria-induced coccidiosis in poultry (such as chickens).

[0065] The TP, TPE, TP_API, or its composition described herein can be made into a liquid or solid form. If it is a liquid, it can be made with a water, polyol (like glycerol, ethylene glycol, or propylene glycol), a salt (such as sodium chloride, sodium benzoate, or potassium sorbate), or a sugar or sugar derivative (like dextrin, glucose, sucrose, or sorbitol). For example, one version of the product is a liquid with the TP, TPE, TP_API, or its composition described herein and one or more formulating agents like water, glycerol, ethylene glycol, propylene glycol, sodium chloride, sodium benzoate, potassium sorbate, dextrin, glucose, sucrose, and sorbitol. This liquid can be sprayed onto animal feed after it has been made into pellets, or it can be added to the animals' drinking water.

[0066] For example, a solid formulation could take the form of granules, spray-dried powder, or agglomerates. The formulating agent might include a variety of salts (organic or inorganic zinc, sodium, potassium, or calcium salts like calcium acetate, calcium benzoate, calcium carbonate, calcium chloride, calcium citrate, calcium sorbate, calcium sulfate, potassium acetate, potassium benzoate, potassium carbonate, potassium chloride, potassium citrate, potassium sorbate, potassium sulfate, sodium acetate, sodium benzoate, sodium carbonate, sodium chloride, sodium citrate, sodium sulfate, zinc acetate, zinc benzoate, zinc carbonate, zinc chloride, zinc citrate, zinc sorbate, zinc sulfate), starch, or a sugar or sugar derivative (such as sucrose, dextrin, glucose, lactose, sorbitol).

[0067] For example, the solid composition may be in granulated form in one embodiment. The granule may have a matrix structure with homogeneously mixed components. However, the granule typically consists of a core particle and one or more coatings, usually salt and / or wax coatings. Examples of waxes include polyethylene glycols, polypropylenes, Carnauba wax, Candelilla wax, beeswax, hydrogenated plant oil or animal tallow (such as hydrogenated ox tallow, hydrogenated palm oil, hydrogenated cotton seeds, and / or hydrogenated soybean oil), fatty acid alcohols, mono-glycerides and / or di-glycerides (such as glyceryl stearate, which is a mixture of stearic and palmitic acid), microcrystalline wax, paraffins, and fatty acids (such as hydrogenated linear long-chained fatty acids and their derivatives).

[0068] The TP, TPE, TP_API, or its composition can be added into feed or drinking water as an additive or a supplement, but is not limited thereto. That is, the T. pratense or the T. pratensePATENT Attorney Docket No.: G4590-19600PCT extract can be prepared in any form suitable for the feed composition based on the actual needs. In at least one embodiment of the present disclosure, the feed composition can be formulated in the form of non-dried, dried, crushed, or granulated. For example but not limited thereto, the T. pratense or the T. pratense extract can be mixed with a liquid carrier suitable for the feed composition, or the T. pratense or the T. pratense extract can be absorbed into a carrier material suitable for the feed composition.

[0069] Without intent to limit the scope of the disclosure, exemplary instruments, methods and their related results according to the embodiments of the present disclosure are given below. It is noted that titles or subtitles may be used in the examples for convenience of a reader, which in no way should limit the scope of the disclosure. Moreover, certain theories are proposed and disclosed herein; however, in no way they, whether they are right or wrong, should limit the scope of the disclosure so long as the disclosure is practiced according to the disclosure without regard for any particular theory or scheme of action. EXAMPLE

[0070] Materials and Methods

[0071] Preparation of T. pratense Plant Samples and Extracts

[0072] The T. pratense plants grown in Changhua County, Taiwan, were harvested, dried, and crushed into an appropriate size for supplementing the basal diet of chickens. This preparation was designated TP. The total crude extracts of TP plants were prepared from dried plant materials using 70% ethanol at ambient temperature for 3 days and the extraction were repeated 3-4 times. A rotary evaporator concentrated the collected extracts to obtain dry extracts. These extracts were designated TPE. HPLC was used to monitor the quality of batch-to-batch TP and TPE.

[0073] Establishment of Chemical Fingerprints of TPE

[0074] The chemical fingerprint of TPE was established using a Shimadzu LC-40AD prominence liquid chromatograph containing an auto-injector (SIL-40AD VP), column oven (CTO-40S), and a VP diode array detector HPLC system (SPD-M40A) (Shimadzu Corporation, Kyoto, Japan). Samples were separated using a Luna C18 (2) 100 Å, (250 mm × 4.6 mm, 5 μm) column (Phenomenex, California, USA). The mobile phase consisted of distilled water (A) and acetonitrile (ACN) (B) with the following three gradient steps: 0–35 min, 20–37% B; 35–45 min,PATENT Attorney Docket No.: G4590-19600PCT 37–100% B; 45–50 min, 100% B, with a flow rate of 1 mL / min. The UV absorption was measured at 254 nm, and the column temperature was maintained at 40°C.

[0075] The four major compounds, ononin, sissotrin, formononetin, and biochanin A present in TPE were purified using preparative reverse phase HPLC using a C18column (250 mm × 10 mm; 5 μm, YMC-Triart C18; YMC, Kyoto, Japan) and the chemical purity and structure were confirmed by mass spectrometry and1H and13C NMR spectrometry, and compared with the spectral data in the literature. The percentages of the four compounds in TPE were determined using their respective calibration curves established by the measured peak area intensity of the specific compound in the chromatogram versus a serial dilution of the compound with the corresponding concentrations injected into the column for analysis.

[0076] Preparation of T. pratense-derived Active Pharmaceutical Ingredient (TP_API)

[0077] The ethanol extract of T. pratense was mixed with C18 powder to get a dry sample. This dry sample was firstly separated by medium-pressure liquid chromatography (MPLC) on a FlashPure ID C18 Cartridge with particle size 35-45 μm, column size 120 g (BUCHI, Flawil, Switzerland) and flow rate 20 mL / min. The mobile phase condition with step-wise elution gradients of solvent A (double distilled water) and solvent B (95% ethanol) from 0 to 60 min and monitored at 245 and 360 nm using an equipped UV detector. The active ingredient (API) was obtained at 14 to 17 min which was about 3.5% of the total crude extract. The two bioactive compounds, ononin and sissotrin, were quantitatively determined as approximately of 21.6% and 0.53% in the TP_API.

[0078] Cell Culture

[0079] Madin-Darby bovine kidney (MDBK) cells were a gift from Dr. Ming-Chu Cheng (Department of Veterinary Medicine, National Pingtung University of Science and Technology, Taiwan). They were routinely maintained in growth medium consisting of Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 25 mM D-glucose and 4 mM L-glutamine (Gibco, USA), 10% fetal bovine serum (Gibco, USA) and 100 U / mL penicillin / 100 μg / mL streptomycin antibiotic (Gibco, USA) at 37℃ in 5% CO2.

[0080] Preparation of Oocysts and SporozoitesPATENT Attorney Docket No.: G4590-19600PCT

[0081] E. tenella (isolate PT-Te002), E. acervulina (isolate TT-Ac003), E. maxima (isolate TN-Ma005), E. necatrix (isolate ML-ne001), and E. brunetti (isolate PT-br002) were isolated from the field in Taiwan. All species of Eimeria were routinely maintained for propagation in healthy 3-week-old chicks every 2-3 months to obtain the respective oocysts as described (Lien, Y. Y., S. C. Sheu, H. J. Liu, S. C. Chen, M. Y. Tsai, S. C. Luo, K. C. Wu, S. S. Liu, and H. Y. Su. 2007. Cloning and nucleotide sequencing of the second internal transcribed spacer of ribosomal DNA for three species of Eimeria from chickens in Taiwan. Vet. J.173:184−189).

[0082] Oocysts were obtained from the chickens 7 days post-infection with coccidia; the purification procedure was as previously described with some modifications (Molan, A. L., Z. Liu, and S. De.2009. Effect of pine bark (Pinus radiata) extracts on sporulation of coccidian oocysts. Folia. Parasitol.56:1−5). First, feces from the infected host were processed by homogenization with tap water. Then homogenates (10 mL) were added into saturated sodium chloride solution (20 mL), gently mixed, and centrifugated at 150-200 ×g for 1 min. After centrifugation, the top layer was collected and washed twice with 30 mL sterile deionized water and centrifuged at 1,200 ×g for 2 min to precipitate the oocyst. The partially purified oocysts were resuspended in 2.5% potassium dichromate (w / v) with gentle agitation at room temperature to sporulate for 72 h. All parasites were stored at 4℃ for the subsequent experiments.

[0083] The process to recover sporozoites of E. tenella was as described in Lien et al. (2007) with some modifications. Briefly, the walls of the purified sporulated oocysts were broken by vortexing with 1-mm glass beads (Genechain Industrial, Taiwan) to release the contents of the oocysts. After that, the excysted sporozoites were isolated by centrifugation at 750 × g for 1 min in a gradient packing column with Percoll (GE Healthcare, USA) solution with concentrations from 50% to 80%. The pelleted sporozoites obtained from the 70% layer were collected and washed three times with PBS, then re-suspended with sterile PBS for the following experiments.

[0084] Oocyst Sporulation Inhibition Assay

[0085] Sporulation-estimated criteria and inhibition assay were according to Molan et al. (2009) with some modifications. Briefly, unsporulated oocysts were prepared as stock solution (5,000 oocysts / mL), from which 200 μL was added to wells of a 48-well plate, and TPE and TP_API were added to give a final concentration of 50 µg / mL and 40 µg / mL, respectively. The commercial anticoccidial drug amprolium (final concentration 125 µg / mL) (China Chemicals andPATENT Attorney Docket No.: G4590-19600PCT Pharmaceutical, Taiwan) and PBS were used as reference and vehicle controls, respectively. All inhibition assays were performed in triplicate. The plates were incubated at room temperature with gentle shaking for 48 h. After that, the percentage of sporulation in total oocysts was calculated by using the McMaster egg counting technique.

[0086] Cell Viability Assay

[0087] The cell viability of tested cells was evaluated according to the method reported by Mosmann (Mosmann, T. 1983. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J. Immunol. Methods.65:55−63). Confluent MDBK cells in 96-well plates were treated with the indicated concentrations of plant extract, TP_API, compound, or amprolium and incubated at 37℃ in 5% CO2for 72 h. After that, 25 µL of MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) reaction reagent (5 mg / mL of stock, SIGMA, USA) was added into each well and incubated for 4 h. The precipitated formazan crystals were dissolved in 100 µL of DMSO (Sigma, USA) for 1 min at 37℃. The absorption value of dissolved purple formazan in each assay was recorded using a SPECTROstar Nano spectrophotometer (BMG Labtech, Germany) at 570 nm. Cell survival after treatment was calculated by following formula: viable cell number (%) = OD570of treated cell culture / OD570of vehicle control × 100. All assays were performed in quadruplicate.

[0088] Sporozoite Invasion and Reproduction Inhibition Assay in MDBK Cells

[0089] Sporozoites of E. tenella were used as a model for estimating the invasion and reproduction inhibition activity of TP extract, TP_API, and two derived compounds, sissotrin and ononin (Taha, S., T. Nguyen-Ho-Bao, A. Daugschies, and Z. Renteria-Solis.2021. In vitro infection of Madin-Darby bovine kidney (MDBK) cells with Eimeria acervulina sporozoites: quantitative analysis of parasite cellular invasion and replication using real-time polymerase chain reaction (PCR). Parasitol. Res.120:2689−2693). Amprolium was used as a reference control and PBS was used a vehicle control. Each experiment was performed in quadruplicate. The concentrations of TPE, TP_API, sissotrin, ononin, and amprolium used in this study were 60 μg / mL, 5 μg / mL, 5 μg / mL and 125 μg / mL, respectively, which were pre-confirmed to be non-toxic to MDBK cells by cell viability assay. Three experimental models were used, as described below:PATENT Attorney Docket No.: G4590-19600PCT

[0090] Model 1: Pretreated-Sporozoites Invasion Activity Assay. E. tenella sporozoites were pre-incubated with TPE, TP_API, sissotrin, ononin, amprolium or PBS at 37℃ for 4 h. The treated sporozoites were collected by centrifugation and washed three times with sterile PBS before resuspension in DMEM with 2% FBS. For sporozoite invasion activity assay, MDBK cells were seeded into 96-well plates with a density of 5 × 104cells / well in growth medium. After incubation for 24 h, the confluent cells were inoculated with pre-treated sporozoites at MOI 0.1 and incubated at 37℃ in 5% CO2. Twenty-four hours post-infection (hpi), the infected cells were washed once with sterile PBS, and fresh medium was added for continued 24 h incubation. At 48 hpi, the cells were trypsinized by 0.25% Trypsin-EDTA (Gibco, USA) and washed twice with sterile PBS. The total DNA of collected cells was extracted using the DNeasy Blood & Tissue kit (Qiagen, Germany) following the manufacturer’s instructions.

[0091] Model 2: Infection Activity in Pre-Exposure Cells. MDBK cells seeded in 96-well plates were first treated with TPE, TP_API, sissotrin, ononin, amprolium or PBS before sporozoite infection. After incubation at 37℃ in 5% CO2for 2 h, the cells were washed with sterile PBS three times to rinse out the extracts. After being replenished with fresh growth medium, the cells were infected with fresh sporozoites at MOI 0.1 and incubated for 48 h. Then, the cells were collected after washing with PBS three times and trypsinized. The total DNA of collected cells was extracted using the DNeasy Blood & Tissue kit (Qiagen, Germany) following the manufacturer’s instructions.

[0092] Model 3: Infection Activity in Post-Exposure Cells. After co-cultivation of MDBK cells and sporozoites at MOI 0.1 for 6 h at 37℃ in 5% CO2, the cultured media in wells were replaced with fresh medium containing TPE, TP_API, sissotrin, ononin, amprolium or PBS for 4 h. After incubation, the cells were washed three times with sterile PBS and cultured in fresh medium for 38 h. Then, the cells were collected after washing with PBS three times and trypsinized. The total DNA of collected cells was extracted using the DNeasy Blood & Tissue kit (Qiagen, Germany) following the manufacturer’s instructions.

[0093] Quantification of Sporozoite in MDBK Cells

[0094] Eimeria tenella sporozoite in MDBK cells were determined by absolute quantification of sporozoite genomic DNA copies by real-time PCR assay with the standard curve established from the model plasmid. The model plasmid included was the E. tenella gene qEt from internalPATENT Attorney Docket No.: G4590-19600PCT transcribed spacer 1, which was chosen as the target gene and amplified with primers qEt-F: TGGAGGGGATTATGAGAGGA and qEt-R: CAAGCAGCATGTAACGGAGA and KAPA HiFi HotStart ReadyMix kit (Roche, Switzerland) by conventional PCR method to produce 147- bp gene fragment (Kawahara, F., K. Taira, S. Nagai, H. Onaga, M. Onuma, and T. Nunoya.2008. Detection of five avian Eimeria species by species-specific real-time polymerase chain reaction assay. Avian. Dis. 52:652−656). The resulting fragment was purified by FavorPrep Gel purification kit (Favorgen, Taiwan) and subcloned into T-vector by T-A cloning kit (Yeastern Biotech, Taiwan) to generate a model plasmid designated pTA-qET. Blue-white screening was performed to select the plasmid-transformed ECOS 101 DH5a competent cells (Yeastern Biotech, Taiwan). The plasmid DNAs were extracted using the Plasmid Miniprep Purification kit (GeneMark, Taiwan), and the concentrations of plasmid DNAs were measured by EzDrop 1000 (Blue-ray Biotech, Taiwan). The plasmid DNA sequence was confirmed by Sanger’s sequencing method and BLAST sequence alignment analysis.

[0095] Lightcycler 480 II system (Roche, Switzerland) was used for quantitative real-time PCR assay. The total 20 µL of the reaction mixture consisted of 10 µL SYBR Fast qPCR 2× Master Mix (KAPA Biosystems), 0.4 µL qEt-F (10 µM stock), 0.4 µL qEt-R (10 µM stock), 1 µL template DNA and 8.2 µL PCR-grade water. The thermal cycling condition of the RT-PCR reaction was conducted as described below: 3 min at 95℃, followed by 40 cycles of 10 sec at 95℃, 20 sec at 62℃, and 1 sec at 72℃. The dissociation curve was created by applying the melting curve program of a system involving a temperature range from 61 to 95℃. Serial dilutions of model plasmid DNA from 10-1to 10-5-fold were applied as templates with the same real-time PCR conditions to generate a quantified standard curve.

[0096] In vivo Trials of Anticoccidial Activity

[0097] The in vivo trials were designed and performed following the relevant guidelines and regulations laid out by the Institutional Animal Care and Use Committee of National Pingtung University of Science and Technology of Taiwan, with the authorization numbers #NPUST-111- 067 and #NPUST-110-062. Three independent in vivo experiments were conducted to analyze the anticoccidial activity of herbal extracts against E. acervulina, E. tenella and E. maxima, respectively. Briefly, in each trial, a total of 72 one-day-old Leghorn male chicks were randomly divided into 6 treatment groups with 4 replicated cages of 3 birds each. Negative controlPATENT Attorney Docket No.: G4590-19600PCT (unmedicated, unchallenged control, UUC) and infection control (unmedicated, challenged control, UCC) birds were fed standard chicken diets without any additives. Birds in the reference group were fed basal diets containing 125 ppm amprolium (AMP125). The other three groups of birds received basal chicken diets containing 500 ppm or 1,000 ppm of TP (TP500, TP1000), or 100 ppm of TPE (TPE100). All chickens had access to feed and water ad libitum during the experimental period. Chickens of all groups except the UUC group were oral challenged with purified sporulated oocysts at 3 weeks of age. Experiment 1 was challenge with 1 × 105oocysts of E. acervulina per chick, experiment 2 was challenge with 2 × 104oocysts of E. tenella per chick, and experiment 3 was challenge with 2.5 × 104oocysts of E. maxima per chick. The body weight of each chicken was recorded on the day of the challenge and the day of sacrifice to evaluate growth rates by calculating the percentage of relative body weight gain before and after challenge. The survival rates were observed after oocyst inoculation until sacrifice. Chicken feces from each cage were collected at day 5 post-infection for E. acervulina, or at day 6 post-infection for E. tenella and E. maxima. Fecal oocyst numbers for the relevant groups were expressed as oocysts per gram of feces (OPG) obtained by the McMaster egg counting technique. All birds were sacrificed at 4 weeks of age (the 7thday after challenge). On the day of animal sacrifice, serum samples were collected for primary metabolome analysis and gut samples were collected to assess lesions and scored following the index descriptions in Johnson and Reid, 1970.

[0098] Data Analysis

[0099] The dataset obtained in the in vitro experiments, including percentage in oocyst sporulation inhibition assay and genome copy numbers in the sporozoite invasion and reproduction inhibition assays, was presented as the median values and box plots. The sporulation percentage values of each group were obtained through calculation with the formulas: sporulation rate (%) = 100 × (sporulating oocysts / total number of counted oocysts).

[0100] The experimental data from the in vivo trials were expressed as the anticoccidial Index (ACI) and box plots. The ACI was utilized to determine the anticoccidial efficacy of TP / TPE by calculating the experimental parameters recorded from in vivo trials following a previously described formula (McManus, E. C., W. C. Campbell, and A. C. Cuckler. 1968. Development of resistance to quinoline coccidiostats under field and laboratory conditions. J. Parasitol. 54:1190−1193). The ACI of each group = % SR + % RWG – (10 × LS + 0.4 × ROPG), where SRPATENT Attorney Docket No.: G4590-19600PCT is survival rate and RWG is relative weight gain between the trial group and the UUC group. The RWG was calculated using the formula: RWG (%) = 100 × (average body weight gain of treated group / average body weight gain of UUC group). The LS is average lesion score of each group, and ROPG is relative OPG obtained between the trial group and the UCC group, ROPG = (average of OPG of treated group / average of OPG of UCC group) × 100.

[0101] Statistical analyses were conducted by SPSS Software v.22.0 (IBM, USA), using the Kruskal–Wallis test for intragroup statistics followed by the post-hoc Dunn’s multiple comparisons test. Statistical significance was defined as a P value of less than 0.05.

[0102] Primary Metabolome Analysis of Chicken Serum

[0103] The serum samples (50 μL each) from tested chickens were mixed with 80% methanol- containing ribitol (0.2 mg / mL) as an internal standard with vigorous vortexing; then the samples were put in liquid nitrogen for 10 min. The protocol was repeated 3 times to thoroughly remove the protein fraction. After centrifuging at 12,000 ×g for 10 min at 4°C, the supernatants were collected and dried in a vacuum by SpeedVac (Labconco, USA). The dried analytes were incubated with 20 μl methoxyamine (20 mg / mL in pyridine) at 30°C for 90 min for reaction and then derivatized with 100 μL N,O-bis(trimethylsilyl)trifluoroacetamide (BSTFA) containing 1% trimethylchloro-silane (TMCS) at 70°C for 120 min.

[0104] The primary metabolome of chicken serum samples from the UUC, UCC, AMP, and TP groups were performed by gas chromatography / quadrupole time-of-flight (GC / Q-TOF) mass spectrometer (Agilent Technologies, USA) at the Metabolomics Core Facility of the Agricultural Biotechnology Research Center, Academia Sinica, Taiwan. The derivatized samples (0.5 μL) were injected with helium as the carrier gas flow at 1 mL / min into an Agilent J&W DB-5ms column (30 m × 250 μm × 0.25 μm). The GC oven temperature ramp was maintained at 60°C for 1 min, then elevated to 325°C (10°C / min) and held constant for 10 min. The mass range was 50-600 Da, and the data were gathered in full scan mode. Mass spectra were compared against the NIST Chemistry WebBook (National Institute of Standard and Technology) and PubChem (National Center for Biotechnology Information). Peak heights of the mass (mass-to-charge ratio) fragments were normalized to each sample’s internal standard (ribitol).

[0105] Example 1 Chemical Profile of T. pratense ExtractPATENT Attorney Docket No.: G4590-19600PCT

[0106] The HPLC chromatogram of T. pratense ethanolic extract at 254 nm is shown in Figure 1. Four major peaks were identified as ononin (1) (Lewis, P., S. Kaltia, and K. Wähälä.1998. The phase transfer catalysed synthesis of isoflavone-O-glucosides. J. Chem. Soc., Perkin Trans. 1, 16:2481−2484), sissotrin (2) (Lewis, P., S. Kaltia, and K. Wähälä. 1998. The phase transfer catalysed synthesis of isoflavone-O-glucosides. J. Chem. Soc., Perkin Trans. 1, 16:2481−2484), formononetin (3) (Aly, S. H., A. M. Elissawy, A. M. Fayez, O. A. Eldahshan, M. A. Elshanawany, and A. N. B. Singab. 2020. Neuroprotective effects of Sophora secundiflora, Sophora tomentosa leaves and formononetin on scopolamine-induced dementia. Nat. Prod. Res.35:5848−5852), and biochanin A (4) (Wang, L., X. Yang, Y. Zhang, R. Chen, Y. Cui, and Q. Wang. 2019. Anti- inflammatory chalcone−isoflavone dimers and chalcone dimers from Caragana jubata. J. Nat. Prod.82: 2761−2767), respectively, based on our data of MS and1H NMR spectrometry analyses and compared to the published references. The HPLC profile and the four index compounds were used to ensure the batch-to-batch consistency of the TP plant and extracts in the supplementation feeds.

[0107] Example 2 T. pratense Extract and TP_API Inhibited Oocyst Sporulation of Five Eimeria Species

[0108] First, the anticoccidial activity of TPE and TP_API were evaluated using oocyst sporulation inhibition assay. The commercial anticoccidial drug amprolium was used as a reference control. The sporulation levels of oocysts with 50 µg / mL of TPE and 40 µg / mL TP_API treatments are presented as percentage values in Table 1. TP_API treatment showed significant effect on inhibition of oocyst sporulation of E. acervulina, E. tenella, E. brunetti, and E. necatrix (P < 0.05) which were better than those of TPE and AMP treatment groups. TPE and TP_API treatments were shown similar effect on E. maxima. AMP treatment showed some effects but without statistical significance. Such a discrepancy in sporulation levels between the tested Eimeria spp. might be due to the composition of oocyst walls which play a role in mediating the entry of TPE eventually interfering with the sensitivity to TPE or TP_API (Belli, S. I., D. J. P. Ferguson, M. Katrib, I. Slapetova, K. Mai, J. Slapeta, S. A. Flowers, K. B. Miska, F. M. Tomley, M. W. Shirley, M. G. Wallach, and N. C. Smith.2009. Conservation of proteins involved in oocyst wall formation in Eimeria maxima, Eimeria tenella and Eimeria acervulina. Int. J. Parasitol. 39:1063−1070).PATENT Attorney Docket No.: G4590-19600PCT

[0109] Table 1. In vitro effect on Eimeria oocyst sporulation. Groups of E. acervunila E. tenella E. maxima E. necatrix E. brunetti oocysts Median (%) Median (%) Median (%) Median (%) Median (%) Vehicle 82.9a 92.0a 62.0a 93.2a 82.9a AMP125 79.4ab 85.7ab 43.7ab 75.9ab 79.4ab TPE50 72.8abc 91.9abc 18.0bc 49.2abc 72.8abc TP_API40 56.1bc 77.0bc 19.8abc 24.3bc 56.1bc The tests were performed in triplicate. Statistical differentiation was conducted by Kruskal–Wallis test and Dunn’s post hoc multiple comparison test. Numbers with different letters in the same column represent significant differences (P < 0.05).

[0110] Example 3 T. pratense Extract Inhibited Sporozoite Invasion and Reproduction of E. tenella

[0111] The effect of TPE and sissotrin and ononin compounds on the inhibition of E. tenella sporozoite invasion and reproduction were investigated using three models. The first and second models were used to mimic the initial stage of coccidian infection using two prophylactic approaches, pre-exposure to sporozoites (Model 1) and cells (Model 2), respectively. In addition, a third model (Model 3) was used to reveal the therapeutic mechanism by stimulating the reproduction stage of coccidian after sporozoites entered target cells (Thabet, A., A. A. Alnassan, A. Daugschies, and B. Bangoura. 2015. Combination of cell culture and qPCR to assess the efficacy of different anticoccidials on Eimeria tenella sporozoites. Parasitol. Res.14:2155−2163; Marugan-Hernandez, V., G. Jeremiah, K. Aguiar-Martins, A. Burrell, S. Vaughan, D. Xia, N. Randle, and F. Tomley.2020. The growth of Eimeria tenella: characterization and application of quantitative methods to assess sporozoites invasion and endogenous development in cell culture. Front. Cell. Infect. Microbiol. 10:579833). The invasion and reproduction capability was determined according to the decrease in genome copies retained in cells in the treated groups compared with control groups through quantitative real-time PCR. As shown in Figures 2A-2C, under the 3 different model analyses, TPE (60 µg / mL) showed suppression of sporozoites of E. tenella compared to the vehicle control. Using the Kruskal–Wallis test followed by Dunn’s post- hoc test for multiple comparisons, TPE revealed significant reproduction inhibition activity in the Model 2 (P = 0.00) and Model 3 (P = 0.00) simulative of the prophylactic and therapeutic approach (Figure 2B and 2C). Both sissotrin and ononin also reduced sporozoite production. Sissotrin (P = 0.005) and ononin (P = 0.000) in Model 1, and sissotrin (P = 0.048) in Model 3PATENT Attorney Docket No.: G4590-19600PCT showed biological and statistical significance in reduction of sporozoites compared to the vehicle control, indicating that both compounds have sporozoite-cidal effects by directly alleviating the ability of sporozoites to invade or infect cells. The reference control, amprolium, at 125 µg / mL showed significant effects in Model 1, 2 and 3 assays (Figures 2A, 2B, and 2C, respectively). These results indicated that sissotrin and ononin are the two bioactive compounds responsible for the anticoccidial effect of TPE which had similar anticoccidial properties to the commercial drug of amprolium. In summary, TPE has prophylactics properties before coccidial infection and is a therapeutic after coccidial infections.

[0112] Example 4 T. pratense Extract and Derived TP_API Inhibited Sporozoite Invasion and Reproduction of E. tenella

[0113] Three models were used to study the inhibitory effects of TPE and TP_API on the invasion and reproduction of sporozoites. The results are shown in Figures 3A-3C. Multiple comparisons showed that both TPE and TP_API exhibited significant reproduction inhibitory activity in Model 1, Model 2, and Model 3 simulative of preventive and therapeutic approaches (Figures 3A, 3B, and 3C, respectively). Both TPE and TP_API showed biological and statistical significance in reducing sporozoites compared to the vehicle control, indicating that TP_API derived from TPE directly reduced sporozoite invasion and infection and reproduction in MDCK cells. In this batch of study, the effect of amprolium only showed statistical significance in Model 3 assay compared to the vehicle control (Figure 3C). These results indicate that TP_API is the bioactive ingredient responsible for the anti-coccidial effect of TPE which showed better anti- coccidial properties than the commercial drug amprolium.

[0114] Example 5 TP and TPE Exhibited Significant Anti-coccidial Effects in Vivo

[0115] The in vivo effects of TP500, TP1000 and TPE100 compared to AMP125 were measured in E. acervulina, E. tenella, and E. maxima infected chickens. All chickens treated in this study survived the trial period. The measurements of relative weight gain percentage before and after E. acervulina infection showed that the TP / TPE treatment groups had more effect than the UCC group (Figure 4A), and E. tenella-infected chicken group also showed similar resulsts, except for the TP-1000 treatment, which resulted in a slightly lower weight gain than the UCC group (Figure 4B). Both groups were statistically significantly different, with P < 0.01 for E. acervulina-infected chickens and P < 0.05 for the E. tenella-infected chickens. None of thePATENT Attorney Docket No.: G4590-19600PCT TP / TPE treatments showed a statistical difference compared to the reference group of AMP125, indicating that their effects were equivalent to a commercial coccidicide, although they were unable to achieve a level of weight gain similar to the UUC group. In E. maxima-infected chickens, the percentage of relative body weight gain before and after the challenge in the UUC, UCC, and treated groups did not show statistical differences (Figure 4C). Overall, the observations indicate that Trifolium pratense can partially effectively alleviate the phenomenon of weight loss caused by infection with both E. acervulina and E. tenella in chickens.

[0116] The results of lesion score obtained 5- or 6-days post inoculation with Eimeria spp. without or with treatments are shown in Figures 5A-5C. For the E. acervulina-infected groups, chickens treated with AMP 125 ppm, TP 500 ppm, TP 1000 ppm, or TPE 100 ppm all showed significantly fewer lesions compared to the unmedicated control (P < 0.01) (Figure 5A). TPE100 had a larger effect than AMP125 (P < 0.05). E. tenella-infected groups presented similar lesion reduction results in the AMP125 and TP500 groups (Figure 5B), but the TP1000 and TPE100 treatment groups showed no significant difference from the UCC control group. For the E. maxima-infected groups, TP500, TP1000, and TPE100 all showed a significant inhibitory effect, whereas AMP125 did not show a positive effect (Figure 5C). TP and TPE treatments had favorable gut protective activity against tested coccidia.

[0117] The effects of TP and TPE on the suppression of oocyst development after coccidian inoculation were monitored. The outputs of OPG at day 5 or 6 post-infection with E. acervulina, E. tenella, or E. maxima were obtained by the McMaster egg counting method. The decrease in OPG in the TP500, TP1000, and TPE100 treatment groups were all greater than the AMP125 group in the three types of Eimeria species-infected chickens (Figures 6A-6C). These results were in good agreement with the lower lesion scores shown in Figures 4A-4C. Taken together, all of TP or TPE additives used as feed supplements for the treatment of coccidian obviously improved the outcome of oocyst shedding and also exhibited better inhibition of oocyst development than the reference group, AMP125.

[0118] The anticoccidial index (ACI) was first constructed to evaluate the drug resistance of particular coccidia. It has subsequently become one of the most popular criteria for assessment of the anticoccidial activity of putative additives in livestock research (McManus, E. C., W. C. Campbell, and A. C. Cuckler. 1968. Development of resistance to quinoline coccidiostats underPATENT Attorney Docket No.: G4590-19600PCT field and laboratory conditions. J. Parasitol. 54:1190−1193; Pablos, L. M. D., M. F. B. Dos Santos, E. Montero, A. Garcia-G, A. Parra, and A. Osuna.2010. Anticoccidial activity of maslinic acid against infection with Eimeria tenella in chickens. Parasitol. Res.107:601−604; Ojimelukwe, A. E., D. E. Emedhem, G. O. Agu, F. O. Nduka, and A. E. Abah. 2018. Populations of Eimeria tenella express resistance to commonly used anticoccidial drugs in southern Nigeria. Int. J. Vet. Sci. Med. 6:192−200; Pop, M. L., E. Varga, M. Coroian, M. E. Nedisan, V. Mircean, M. O. Dumitrache, L. Farczadi, I. Fulop, M. D. Croitoru, M. Fazakas, and A. Gyorke.2019. Efficacy of a commercial herbal formula in chicken experimental coccidiosis. Parasit. Vectors.12:343). The effects of supplementing TP in the diets of chickens after challenge with coccidia were established through ACI calculations considering four factors; survival rates, relative weight gain, lesion score and relative OPG output. The ACI scores of each trial group are presented in Table 2. The putative anticoccidial activity of TP against all the tested Eimeria strains was revealed based on the ACI criteria (Qaid, M. M., S. I. Al-Mufarrej, M. M. Azzam, M. A. Al-Garadi, H. H. Albaadani, I. A. Alhidary, and R. S. Aljumaah. 2021. Anti-coccidial effect of Rumex nervosus leaf powder on broiler chickens infected with Eimeria tenella oocyst. Animals.11:167−183). TP or TPE treatment had a better ACI than that of AMP treatment. Furthermore, TP / TPE showed very significant coccidicidal properties against E. maxima (with ACI 156-179) and E. tenella challenge (with ACI 150~168) in chickens, and moderated the anticoccidial effect (with ACI 141 to 143) on infection with E. acervulina. However, the UCC group infected with E. maxima had a relatively higher ACE score of 130, which fell into the range (120 to 140) defined as having partial anticoccidial capability. One possible reason was that E. maxima has a lower virulence than E. tenella and E. acervuline, which might have resulted in no significant difference in relative weight gain in the E. maxima challenge UUC group; therefore the calculated ACI score is relatively higher than those in other UUC groups (Table 2).

[0119] In summary, if an ACI score of 120 is taken as the baseline for no anticoccidial activity, against three different species of Eimeria, most of the TP or TPE treatments resulted in an increase in ACI score of more than 40 compared to their respective UCC group, indicating that TP and TPE possess moderate to very effective anticoccidial activity. These data indicate that the TP plant and its extract are novel phytogenics that possess broad-spectrum coccidicidal activity. Table 2. Effects of TP and TPE treatments on the anticoccidial index (ACI) of chickens challenged with coccidianPATENT Attorney Docket No.: G4590-19600PCT Groups ACI of E. acervulina ACI of E. tenella ACI of E. maxima UCC 98 112 130 AMP125 133 132 143 TP500 143 168 179 TP1000 142 150 156 TPE100 141 160 179 An ACI score below 120 represents a lack of anticoccidial ability, 120 to 140 represents a partial effect, 140 to 160 represents a moderate effect and above 160 represents very effective anticoccidicidal activity.

[0120] Example 6 T. pratense Dietary Supplement Reprogrammed Primary Metabolism in Eimeria-infected Chickens

[0121] The potential effect of TP supplementation on the primary metabolome in sera of chickens challenged with either E. tenella or E. acervulina was investigated using GC / Q-TOF MS. The E. maxima infected groups were not included in this primary metabolome analysis as the ACI of UCC control group was slightly high (up to 130; Table 2).

[0122] Multivariate partial least squares discriminant analysis (PLS-DA) was conducted on a total of 93 metabolites detected in the serum. Figures 7A and 7B show the score plot and loading plot of the overall primary metabolites in healthy (control) chickens and chickens infected with E. tenella and E. acervulina, respectively (vehicle). Both score plots revealed that control versus vehicle can be separated into two distinct groups. The loading plot further suggested that some metabolite outliers might have a biological or pathological role in chickens with E. tenella or E. acervulina infection. Furthermore, the fold-change of the metabolite content in control chickens (control) versus E. tenella or E. acervulina-challenged chickens (vehicle) were compared and the results are shown in the heat map. The range of relative fold-change of metabolites was set between 0.2- to 4.0-fold. The metabolites identified were classified according to their chemical structures and functions, such as amino acids and their derivatives, carbohydrates, fatty acids, nucleotides, organic acids, sterols, urea cycle-related metabolites, and others (the metabolites did not belong to the aforementioned categories). In general, most of the levels of metabolites in chicken sera either declined or increased with E. tenella or E. acervulina infection, suggesting that coccidial infection with either species has obvious impact on primary metabolism in chickens. In terms of the fold- change of the overall metabolite profiles and their relative levels in infected chickens compared to control (healthy) chickens, E. tenella infection had a higher impact on the primary metabolism of chickens than E. acervulina infection. Of note, most proteinogenic amino acids, the buildingPATENT Attorney Docket No.: G4590-19600PCT blocks of protein (with 0.2- to 0.7-fold decrease) and fatty acids (with 0.4- to 0.7-fold decrease) were significantly deregulated in E. tenella-infected chickens, a phenomenon which was not observed in the E. acervulina-infected chicken sera. In contrast, the levels of nucleotide metabolites, such as hypoxanthine, xanthine, inosine, and uracil involved in purine / pyrimidine metabolism were significantly raised (1.7-2.5−fold increase) in E. tenella-infected chicken sera, but not in E. acervulina-infected chickens. These results indicate that E. tenella infection negatively impacted the amino acid and fatty acid metabolisms in chickens. On the other hand, the levels of creatinine and urea in the E. tenella group, and ornithine, urea and allantoin in the E. acervulina group were significantly increased and accumulated, suggesting that the urea metabolism and kidney function of infected chickens might be dysregulated. Together, this metabolomic information partly supports the notion of a negative role for E. tenella as the most pathogenic intracellular protozoan parasite of the Eimeria species, causing cecal coccidiosis leading to serious morbidity and mortality in chickens.

[0123] The serum primary metabolites of the vehicle, were further compared with the AMP125 and TP500 treatment groups. The score plot and loading plot of E. tenella-challenged chicken serum metabolomes with vehicle, AMP, or TP are shown in Figures 8A and 8B. Separated group clusters and some corresponding substance outliers were observed, suggesting that AMP or TP treatment could affect primary metabolism in E. tenella-infected chickens. The heat map data of E. tenella infection (vehicle) was related to both the TP and AMP treatment groups showing that the levels of His, Ser and Tyr in the TP group and His, Ile, Lys, Tyr, and Val in the AMP group which declined in infected chickens (vehicle) were reversely increased after treatment. Notably, trans-4-hydroxy-L-proline, an important metabolite derived from the posttranslational modification of proline that revealed oxidant scavenging activity and stimulation of the expression of anti-oxidative enzymes in the cell (Zhang, Z., P. Liu, W. Su, H. Zhang, W. Xu, and X. Chu.2021. Metabolic engineering strategy for synthetizing trans‑4‑hydroxy‑l‑proline in microorganisms. Microb. Cell Fact.20:87), was found decreased in chicken sera after E. tenella infection, but TP or AMP supplementation was able to elevate its level, suggesting that both treatments had a positive effect on preventing oxidative stress caused by E. tenella infection.

[0124] Among the 10 carbohydrates detected, the increase in lyxose, mannitol, and pinitol levels in chicken sera upon E. tenella challenge could be decreased by AMP or TP treatment.PATENT Attorney Docket No.: G4590-19600PCT Threitol, a signaling metabolite involved in fungus-plant interaction was induced (11-fold) by AMP in infected chickens; however, the reason for this increase is not clear. On the other hand, the reduced levels of arachidonic acid, oleamide, and oleic acid could be increased by AMP treatment (1.6-4.1−fold). TP had negligible effect on fatty acids, except oleamide, which was increased 1.5-fold. Oleamide, an amide of oleic acid, has been reported to possess several biological effects, including anti-inflammation, immunomodulation, and anti-allergy activities among others (Naumoska, K., U. Jug, V. Metliˇcar, and I. Vovk. 2020. Oleamide, a bioactive compound, unwittingly introduced into the human body through some plastic food / beverages and medicine containers. Foods 9:549). The significantly upregulated nucleotide-related metabolites in E. tenella-infected chickens were decreased or returned to normal levels after treatment, especially in the AMP group.

[0125] Allantoin increases in response to different stress conditions and environments (Li, X., X. J. Jiang, D. X. Qi, X. Y. Wang, C. M. Wang, C. Z. Fei, W. Zhou, J. Li, and K. Y. Zhang.2022. Effects of ethanamizuril, sulfachlorpyridazine or their combination on cecum microbial community and metabolomics in chickens infected with Eimeria tenella. Microb. Pathog. 173:105823). The slight increase in allantoin in the E. tenella-infected group was decreased 0.6−0.7-fold in the TP / AMP-treated groups, implying that TP / AMP might attenuate coccidia infection-induced stresses in chickens. Creatinine is a waste product of muscles and is filtered by the glomerular filtration in the kidneys. Therefore, a high level of creatinine in chicken sera can suggest renal dysfunction. An increase in creatinine after E. tenella infection was partially reversed by AMP or TP treatment. Moreover, TP treatment (0.4-fold) showed a more pronounced effect on attenuating urea levels than that of AMP (0.7-fold) in infected chickens, suggesting that TP treatment could protect kidneys damaged by E. tenella infection. Sialic acid (N-acetylneuraminic acid) residues linked to glycoproteins are found in the healthy cell membranes of many poultry and mammals. Sialidase (neuraminidase) is an enzyme that separates sialic acid from glycoproteins, thereby helping E. tenella to increase its ability to invade the host and use the carbon skeleton as an energy source. In the E. tenella-challenged group, the level of N-acetylneuraminic acids (sialic acids) significantly increased (1.7-fold) in comparison to that of the control group, and slightly decreased after AMP treatment, suggesting that AMP inhibits E. tenella invasion.PATENT Attorney Docket No.: G4590-19600PCT

[0126] Primary metabolome analysis of E. acervulina-challenged chickens revealed that the vehicle, AMP, and TP-treated chicken metabolome can be separated into three distinct groups. Furthermore, the loading plot showed some outlier metabolites which might have a role in E. acervulina infection (Figures 9A-9B). The heat maps revealed that most of the 23 amino acids or amino acid derivatives detected were increased (1.5−2.3-fold) after TP or AMP treatment, suggesting amino acid metabolisms were boosted in infected chickens. In previous studies, E. acervulina-infected chickens showed a reduction in the absorption of methionine in the duodenum and jejunum. Therefore, a lower serum methionine level under E. acervulina infection may suggest impaired absorption of dietary methionine. The level of methionine was increased (1.7−2.0-fold) in the AMP and TP group. Similar increased levels of tryptophan in both treatment groups were also observed compared to the infected group. Since tryptophan is an aromatic amino acid (AAA) that plays an important role in immune response regulation (Liu, B. H., X. T. Ma, and J. P. Cai. 2021. Construction and analysis of coexpression network to understand biological responses in chickens infected by Eimeria tenella. Front. Vet. Sci.8: 688684), while methionine is a key player in the oxidative stress response (Campbell, K., J. Vowinckel, M. A. Keller, and M. Ralser.2016. Methionine metabolism alters oxidative stress resistance via the pentose phosphate pathway. Antioxid. Redox. Signal.24:543–547), these data suggest that the TP and AMP supplementation have a positive impact in E. acervulina-challenged chickens. E. acervulina infection also led to some degree of decline in carbohydrates and fatty acids. In previous studies, researchers identified the mannitol cycle as a metabolic pathway found in Eimeria species. This process allows parasites to use mannitol for their production and development. The level of mannitol in the E. acervulina- infected group decreased (0.7-fold) compared to the control group, and increased (3−4-fold) in the TP and AMP-treated groups, which might suggest TP / AMP inhibited mannitol digestion and in turn inhibited the expansion of E. acervulina.

[0127] The invasion of Eimeria species was observed to cause an imbalance in the gut microbial community. The gastrointestinal gut microbiota of chickens provides a protective barrier against opportunistic bacteria. They also produce vitamins, fatty acids, and organic acids to contribute to the development of host cells. In this study, the moderate decrease in fatty acid metabolism in the E. acervulina infection group could be enhanced in both treatment groups. Organic acids have been shown to have multiple therapeutic effects on pathological disorders in poultry birds, such as anticoccidial, antiprotozoal, antimicrobial, and antifungal (Du, H., I. Sarwar,PATENT Attorney Docket No.: G4590-19600PCT S. Ahmad, I. Suheryani, S. Anjum, S. Andlib, M. U. Kakar, and M. A. Arain.2023. Organic acids in poultry industry: a review of nutritional advancements and health benefits. World's Poultry Science Journal. doi.org / 10.1080 / 00439339.2023.2262435). Supplementation of some types of organic acids, such as lactic acid, fumaric acid, formic acid, citric acid, butyric acid, and tartaric acid has been demonstrated to significantly improve the health status and production performance of chickens. Interestingly, we observed that TP and AMP could enhance the contents of organic acids including citric acid, fumaric acid, lactic acid, butanoic acid in E. acervulina-infected birds. These data indicate that TP supplement is beneficial to the host against E. acervulina-infection.

[0128] To understand whether TP treatment could restore some metabolite levels in parasite challenged chickens back to those of the control (healthy) chickens, we analyzed and compared the metabolic profiles of the control chickens versus E. tenella or E. acervuline-infected chickens or versus infected chickens supplemented with T. pretense. We observed metabolites that were either elevated or decreased after E. tenella infection which could be restored by TP supplementation to levels close to those in control chickens. These metabolites included urea cycle metabolites (creatinine, ornithine, and urea), organic acids (2-aminomalonic acid, 2- hydroxybutyric acid, succinic acid, and 2,3,4-trihydroxybutyric acid), and other metabolites, such as glycine, serine, and oleamide. TP supplementation also restored the levels of many forms of fatty acids, organic acids, urea cycle metabolites, etc. in E. acervuline-infected chickens back to those in control chickens. Particularly, the toxic metabolite, urea, was found accumulated in E. tenella- and E. acervuline-infected groups, and TP could reduce its levels in parasite-challenged chickens to close to the healthy control group level, indicating the beneficial or detoxification effect of TP supplementation. We also noticed the level of trans-4-hydroxy-L-proline, which possesses oxidant scavenging activity, was decreased in E. tenella- and E. acervuline-infected groups, and TP supplementation could significantly increase its level, suggesting TP treatment may prevent oxidative stress in chickens caused by Eimeria infection.

[0129] In summary, in the metabolomics study, we observed that the two different species of Eimeria infection exhibited different degrees of effect on the metabolite profiles in respective chickens, and the impact of TP supplementation on the two infected chicken models was different. Eimeria infection is a serious coccidian disease in chickens affecting the host animal's GI system and metabolism significantly. Nevertheless, TP indeed had positive effects on the primary metabolism of infected chickens.PATENT Attorney Docket No.: G4590-19600PCT

[0130] In conclusion, both E. tenella and E. acervulina infections lead to a disruption in most of the detected primary metabolites in chicken sera involved in different metabolic or pathogenic pathways. TP supplementation had an obvious and positive impact on the primary metabolism of chickens under the stress induced by E. tenella and E. acervulina infection in chickens. This study provides strong evidence to support the novel effect of Trifolium pratense and its extracts in control of coccidiosis caused by E. acervulina, E. tenella and E. maxima, and also illuminates the underlying mechanisms by which this effect takes place. We suggest that Trifolium pratense and its extracts may be applied as phytogenic additives in the poultry industry.

Claims

PATENT Attorney Docket No.: G4590-19600PCT Claims What is claimed is:

1. A composition comprising an effective amount of a Trifolium pratense (TP) extract (TPE) or an active ingredient(s) contained therein (TP_API), or a combination of TP and TPE or TP and TP_API.

2. The composition of claim 1, wherein the TPE is an alcoholic TPE, an ethanolic TPE, an about 50% to 99.5% ethanol TPE; preferably, the TPE is an about 70% ethanol TPE.

3. The composition of claim 1, wherein the TPE comprises ononin in a relative amount of about 0.25% to about 5% of the TPE as measured by their relative weight content, or sissotrin in a relative amount of about 0.25% to about 5% of the TPE as measured by their relative weight content, or ononin in a relative amount of about 0.25% to about 5% of the TPE and sissotrin in a relative amount of about 0.25% to about 5% of the TPE as measured by their relative weight content.

4. The composition of claim 1, wherein the TP_API comprises ononin in a relative amount of about 10% to about 40% of the TP_API as measured by their relative weight content, or sissotrin in a relative amount of about 0.1% to about 2% of the TP_API as measured by their relative weight content, or ononin in a relative amount of about 10% to about 40% of the TP_API and sissotrin in a relative amount of about 0.1% to about 2% of the TP_API as measured by their relative weight content.

5. The composition of claim 1, wherein the TPE has one or more the following characteristics: about 15% to about 1% of malic acid and about 85% to about 99% of formononetin of the TPE in relative amount; about 10% to about 0.5% of pantothenic acid and about 90% to about 99.5% of formononetin of the TPE in relative amount;PATENT Attorney Docket No.: G4590-19600PCT about 60% to about 90% of formononetin and about 10% to about 40% of stearic acid of the TPE in relative amount; about 25% to about 1% of tryptophan and about 75% to about 99% of formononetin of the TPE in relative amount; about 80% to about 50% of ononin and about 20% to about 50% of sissotrin of the TPE in relative amount; and about 80% to about 50% of formononetin and about 20% to about 50% sissotrin of the TPE in relative amount.

6. The composition of claim 1, wherein the TPE has one or more the following characteristics: a ratio of malic acid to formononetin of about 0.047 to about 1; a ratio of pantothenic acid to formononetin of about 0.026 to about 1; a ratio of formononetin to stearic acid of about 2.318 to about 1; a ratio of tryptophan to formononetin of about 0.142 to about 1; a ratio of ononin to sissotrin of about 3.214 to about 1; and a ratio of formononetin to sissotrin of about 3.149 to about 1.

7. The composition of claim 1, comprising one or more of the following components: sissotrin, ononin, formononetin, malic acid, pantothenic acid, stearic acid and tryptophan.

8. The composition of claim 1, wherein the TPE, TP_API or a combination of TP and TPE or TP and TP_API is in a range from about 0.0001 wt% to about 5 wt% based on the total dry weight of the composition.

9. The composition of any one of claims 1-8, which is pharmaceutical composition, a feed additive or a feed supplement.

10. A method of preventing or treating a disease associated with a protozoan parasite of the genus Eimeria in a subject, comprising administering to the subject an effective amount of the composition of any one of claims 1-8, ononin, sissotrin or any combination thereof.PATENT Attorney Docket No.: G4590-19600PCT 11. The method of claim 10, which inhibits an oocyst sporulation of the protozoan parasite or preventing a sporozoite invasion or reproduction in the subject.

12. The method of claim 10, which decreases occurrence of an intestinal infection in the subject.

13. The method of claim 10, wherein the protozoan parasite is Eimeria acervulina, Eimeria tenella, Eimeria maxima, Eimeria brunetti, Eimeria necatrix, Eimeria praecox or Eimeria mitis or any combination thereof.

14. The method claim 10, wherein the disease is coccidiosis.

15. A method of promoting growth of a subject, comprising administering to the subject an effective amount of the composition of any one of claims 1-8, ononin, sissotrin or any combination thereof.

16. The method of claim 15, wherein a body weight gain of the subject is restored.

17. The method of claim 15, wherein primary metabolome in the subject is modulated.

18. The method of claim 17, wherein the modulation of the primary metabolism comprises increasing or decreasing at least a level of an amino acid and its derivative, a level of a carbohydrate, a level of a fatty acid, a level of nucleotide, a level of an organic acid, a level of a sterol, and a level of urea cycle-related metabolite or any combination thereof.

19. The method of claim 15, wherein the subject is poultry, preferably a chicken, a duck, a turkey, a quail, an ostrich or a goose.

Citation Information

Patent Citations

  • Red clover total isoflavones sustained-release preparation

    CN101084978A

  • Purpose of trifolium pretense extract as melanogenesis inhibitor

    CN110772462A

  • Badminton shuttlecock shooting apparatus forbadminton practice

    KR102095682B1

  • Product comprising red clover extract and methods for producing the same

    US20180333387A1

  • Isoflavone-Supplemented Chick Diets and Methods of Feeding the Same

    US20190166884A1