KL2-type acinetobacter baumannii phage and screening method therefor, phage composition and use, and drug

By screening and applying KL2-type Acinetobacter baumannii phages AB_SZL2 and AB_SZL3, combined with PCR detection and pharmaceutical vectors, the treatment challenge of multidrug-resistant Acinetobacter baumannii infection was solved, achieving efficient eradication and reduction of drug resistance.

WO2026011445A1PCT designated stage Publication Date: 2026-01-15SHENZHEN INST OF ADVANCED TECH

Patent Information

Application Number
PCT/CN2024/105325
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-07-09
Filing Date
2024-07-12
Publication Date
2026-01-15

AI Technical Summary

Technical Problem

Current technologies are insufficient to effectively treat infections caused by multidrug-resistant Acinetobacter baumannii (KL2 type), especially in intensive care units where antibiotic treatment is limited and carries the risk of drug resistance, leading to high treatment difficulty and mortality.

Method used

We developed and screened KL2 type Acinetobacter baumannii phages AB_SZL2 and AB_SZL3, and used phage compositions for targeted killing. We then combined PCR detection with pharmaceutically acceptable vectors to prepare drugs for treatment and environmental disinfection.

Benefits of technology

It achieves precise targeted killing of Acinetobacter baumannii type KL2, significantly reducing the risk of hospital-acquired infections, improving treatment efficacy, and reducing the risk of drug resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2024105325_15012026_PF_FP_ABST
    Figure CN2024105325_15012026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to the technical field of phages. Provided are a KL2-type Acinetobacter baumannii phage and a screening method therefor, a phage composition and the use, and a drug. The KL2-type Acinetobacter baumannii phage is named AB_SZL2, and is deposited in the China Center for Type Culture Collection with the deposit number CCTCC NO: M20241522; or the KL2-type Acinetobacter baumannii phage is named AB_SZL3, and is deposited in the China Center for Type Culture Collection with the deposit number CCTCC NO: M20241523. The KL2-type Acinetobacter baumannii phage can accurately target KL2-type Acinetobacter baumannii, and has an efficient bactericidal effect, thereby reducing the harm of KL2-type Acinetobacter baumannii and effectively addressing the problem of the antibiotic resistance of KL2-type Acinetobacter baumannii.
Need to check novelty before this filing date? Find Prior Art

Description

KL2 type Acinetobacter baumannii phage, its screening methods, phage compositions, and applications in pharmaceuticals. Technical Field

[0001] This invention relates to the field of phage technology, and more particularly to a KL2 type Acinetobacter baumannii phage, its screening method, phage composition, and its applications in pharmaceuticals. Background Technology

[0002] Acinetobacter baumannii has become a major global public health challenge due to its high incidence and strong transmissibility in hospital settings, as well as its resistance to multiple antibiotics (resistance rates as high as 70% with routinely monitored antibiotics). Particularly in intensive care units (ICUs), the risk of Acinetobacter baumannii infection increases due to patients' prevalent underlying diseases, weakened immunity, and frequent invasive procedures. Once infection occurs, it can cause severe hospital-acquired pneumonia, bloodstream infections, etc., which are difficult to treat and have high mortality rates. Hospital-acquired Acinetobacter baumannii pneumonia is one of the greatest challenges faced by physicians, as its severe antimicrobial resistance severely limits treatment options and often leads to poor prognosis. Ventilator-associated pneumonia (VAP) caused by multidrug-resistant Acinetobacter baumannii (MDRAB) has a significantly lower rate of successful weaning from mechanical ventilation compared to susceptible strains. Currently, infections caused by carbapenem-resistant Acinetobacter baumannii (CRAB) are primarily treated with antibiotics. Guidelines for treating antimicrobial resistance recommend polymyxin and tigecycline alone or in combination for CRAB infections. Although antibiotics have shown some positive effects in treating CARB-induced pneumonia, the risk of resistance remains (CRAB can rapidly develop resistance to polymyxin). Furthermore, polymyxin has severe nephrotoxicity and neurotoxicity, while tigecycline is difficult to achieve effective concentrations in the lungs, limiting the clinical use of these two drugs. In addition, the capital investment and pipeline size for developing new antibiotics are insufficient to meet the growing clinical demand given the severe antibiotic resistance crisis. Therefore, infections caused by MDRAB have few clinically available antibiotics, are highly invasive, and have a significant disease burden, making a new approach urgently needed to treat MDRAB-induced pneumonia.

[0003] Bacteriophages are a class of viruses that can infect and kill bacteria. Utilizing this property, the clinical application of bacteriophages to treat bacterial infections is called phage therapy. In clinical practice, phage therapy typically uses a phage cocktail, a mixture of several phages. This prevents the development of phage resistance in bacteria, thereby increasing the success rate of clearing bacterial infections. More importantly, phage cocktails with selected, fixed phage combinations can broadly lyse clinically prevalent strains of specific bacteria, showing potential for development into drugs.

[0004] Acinetobacter baumannii possesses a thick capsular polysaccharide (CPS) layer on its surface, and the CPS it produces exhibits high diversity. These CPS molecules, as major antigens on the surface of Acinetobacter baumannii, play a crucial role in host recognition and the infection process of bacteriophages. The CPS structure of Acinetobacter baumannii is determined by the capsular gene locus K locus (KL type) on its chromosome. Genomic sequence analysis has identified as many as 237 KL types. Among them, KL2, KL3, and KL7 types of Acinetobacter baumannii are particularly common and are associated with multidrug resistance. In particular, KL2 type Acinetobacter baumannii exhibits a higher level of drug resistance compared to other capsular types, leading to more severe clinical symptoms and significantly associated with an increased risk of patient death, posing a significant threat to public health. Therefore, developing a bacteriophage specifically targeting KL2 type Acinetobacter baumannii is particularly urgent and holds significant practical application potential.

[0005] Therefore, existing technologies still need to be improved and developed.

[0006] Summary of the Invention

[0007] In view of the shortcomings of the prior art, the purpose of this invention is to provide a KL2 type Acinetobacter baumannii phage, a screening method thereof, a phage composition, and its application and drug, which are intended to kill KL2 type Acinetobacter baumannii and reduce the harm of KL2 type Acinetobacter baumannii.

[0008] The technical solution of the present invention is as follows:

[0009] In a first aspect, the present invention provides a KL2 type Acinetobacter baumannii phage, wherein the KL2 type Acinetobacter baumannii phage is named AB_SZL2 and deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: M 20241522; or, the KL2 type Acinetobacter baumannii phage is named AB_SZL3 and deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: M 20241523.

[0010] A second aspect of the present invention provides a method for screening KL2 type Acinetobacter baumannii phage as described above, comprising the following steps:

[0011] The host bacterial culture and culture medium were poured onto a plate, and then the KL2 type Acinetobacter baumannii phage was spotted onto the plate and cultured overnight to obtain the first round of phage products.

[0012] The first round of phage products were cultured with host bacteria to obtain phage-resistant strains;

[0013] A second round of screening was conducted on the phage-resistant strains using a phage library to obtain KL2 type Acinetobacter baumannii phages that overcame phage resistance.

[0014] A third aspect of the present invention provides a phage composition comprising at least one KL2 type Acinetobacter baumannii phage as described above.

[0015] In a fourth aspect, the present invention provides a medicament wherein the active ingredient of the medicament comprises the KL2 type Acinetobacter baumannii phage as described above and / or the phage composition as described above.

[0016] Optionally, the drug may also include a pharmaceutically acceptable carrier.

[0017] Optionally, the pharmaceutically acceptable carrier includes at least one of the following: excipients, glidants, diluents, preservatives, colorants, flavoring agents, wetting agents, suspending agents, stabilizers, isotonic agents, solvents, and emulsifiers.

[0018] Optionally, the drug further includes antibiotics; and / or,

[0019] The dosage form of the drug is selected from one of the following: solution, aerosol, pill, tablet, capsule, powder, lozenge, and paste.

[0020] A fifth aspect of the present invention provides the use of the KL2 type Acinetobacter baumannii phage and / or the phage composition described above in the present invention in the treatment of KL2 type Acinetobacter baumannii phage in the biosphere, said use being for non-disease treatment purposes.

[0021] Optionally, the method of application includes the steps of:

[0022] Samples are taken from the biosphere to obtain the samples to be tested;

[0023] The presence of a predetermined amount of Acinetobacter baumannii type KL2 in the sample was detected by PCR.

[0024] If a predetermined amount of Acinetobacter baumannii type KL2 is present, the Acinetobacter baumannii type KL2 phage of claim 1 and / or the phage composition of claim 2 are applied to the biosphere to eliminate the Acinetobacter baumannii type KL2.

[0025] Optionally, the primer pairs used in the PCR detection include a first primer pair and a second primer pair;

[0026] The first primer pair is:

[0027] Positive: TTGCTATAGTCCCAACGTTTATATTCCCATC;

[0028] Reverse: CCTGTCCCTACATATTCCATATATATTGTAGAGTC;

[0029] The second primer pair is:

[0030] Positive: TGATTGCTAAAAAAGATCTTGGGAAAGTGG;

[0031] Reverse: ACAAAGGCAACCCTGCTAGC.

[0032] Beneficial effects: The KL2 type Acinetobacter baumannii phage provided by this invention can accurately target KL2 type Acinetobacter baumannii and has a highly efficient bactericidal effect, thereby reducing the harm of KL2 type Acinetobacter baumannii and effectively solving the problem of antibiotic resistance of KL2 type Acinetobacter baumannii. Attached Figure Description

[0033] Figure 1 is a pie chart of the capsular genotypes of multidrug-resistant Acinetobacter baumannii isolated clinically in Example 1.

[0034] Figure 2 shows the results of changes in phage sensitivity of the in vitro induced phage-resistant strain in Example 1.

[0035] Figure 3 shows the sensitivity results of AB_SZL2 and AB_SZ3 in Example 1.

[0036] Figure 4 shows the genome maps of AB_SZL2 and AB_SZ3 bacteriophages in Example 2.

[0037] Figure 5 is a transmission electron microscope image of AB_SZL2 in Example 2.

[0038] Figure 6 is a transmission electron microscope image of AB_SZL3 in Example 2.

[0039] Figure 7 shows the timeline of clinically isolated pathogens in Example 3 (A) and the phage sensitivity changes of clinical strains (B).

[0040] Figure 8 shows the results of the genome comparison between the resistant strain and the original strain NAB01B in Example 4, where A is the mutation result of the gtrOC3 gene and B is the mutation result of the wzy gene.

[0041] Figure 9 shows the characterization results of the phage-resistant strain in Example 4, where A is the result of changes in antibiotic sensitivity of Acinetobacter baumannii; B is the result of changes in growth of Acinetobacter baumannii; C is the result of changes in cell wall integrity of Acinetobacter baumannii; D is the result of changes in biofilm formation ability of Acinetobacter baumannii; E is the result of changes in virulence of Acinetobacter baumannii strains against HeLa cells; F is the result of changes in virulence of Acinetobacter baumannii strains against A549 cells; and G is a scanning electron microscope image of the Acinetobacter baumannii capsule.

[0042] Figure 10 shows the positive detection results of the gtr3 gene in the clinical Acinetobacter baumannii strain in Example 5. Detailed Implementation

[0043] This invention provides a KL2 type Acinetobacter baumannii bacteriophage, its screening method, a bacteriophage composition, and its applications in pharmaceuticals. To make the objectives, technical solutions, and effects of this invention clearer and more explicit, the invention is further described in detail below. It should be understood that the specific embodiments described herein are only for explaining the invention and are not intended to limit the invention.

[0044] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used herein in the description of this invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

[0045] This invention provides a KL2 type Acinetobacter baumannii phage, wherein the KL2 type Acinetobacter baumannii phage is named AB_SZL2, deposited at the China Center for Type Culture Collection (CCTCC), located at Wuhan University, Wuhan, China, with a deposit date of July 8, 2024, and accession number CCTCC NO: M 20241522; or, the KL2 type Acinetobacter baumannii phage is named AB_SZL3, deposited at the China Center for Type Culture Collection (CCTCC), located at Wuhan University, Wuhan, China, with a deposit date of July 8, 2024, and accession number CCTCC NO: M 20241523.

[0046] The KL2 type Acinetobacter baumannii phage provided in this invention can precisely target KL2 type Acinetobacter baumannii and has a highly efficient bactericidal effect, thereby reducing the harm of KL2 type Acinetobacter baumannii and effectively solving the problem of antibiotic resistance of KL2 type Acinetobacter baumannii.

[0047] This invention also provides a method for screening KL2 type Acinetobacter baumannii phage as described above, comprising the following steps:

[0048] The host bacterial culture and culture medium were poured onto a plate, and then the KL2 type Acinetobacter baumannii phage was spotted onto the plate and cultured overnight to obtain the first round of phage products.

[0049] The first round of phage products were cultured with host bacteria to obtain phage-resistant strains;

[0050] A second round of screening was conducted on the phage-resistant strains using a phage library to obtain KL2 type Acinetobacter baumannii phages that overcame phage resistance.

[0051] The CPS structure of Acinetobacter baumannii is determined by the capsule gene locus K locus (KL type) on its chromosome. Genomic sequence analysis has identified as many as 237 KL types. In particular, Acinetobacter baumannii type KL2 exhibits higher levels of drug resistance compared to other capsule types, leading to more severe clinical symptoms and significantly associated with an increased risk of patient death, posing a significant threat to public health. Therefore, developing a fixed-formulation phage cocktail specifically targeting Acinetobacter baumannii type KL2 is particularly urgent and has significant practical application prospects. Based on this, embodiments of the present invention also provide a phage composition comprising at least one Acinetobacter baumannii type KL2 phage as described in the embodiments of the present invention. Specifically, the phage composition includes AB_SZL2 and AB_SZL3, in which case the phage composition can also be referred to as a phage cocktail.

[0052] The phage composition provided in this invention can precisely target Acinetobacter baumannii type KL2 and efficiently kill it. In vitro experiments have confirmed that the phage composition including AB_SZL2 and AB_SZL3 has a broad-spectrum lytic ability against KL2 MDRAB, capable of lysing more than 90% of the bacteria. When applied to humans, it can significantly improve clinical efficacy; when applied in hospital environments, it can significantly reduce the content of Acinetobacter baumannii type KL2 in the hospital environment, reducing the probability of nosocomial infections.

[0053] The present invention also provides a drug wherein the active ingredient of the drug comprises the KL2 type Acinetobacter baumannii phage as described above, or comprises the phage composition as described above, or comprises the KL2 type Acinetobacter baumannii phage as described above and the phage composition as described above.

[0054] The drug provided in this invention can precisely target Acinetobacter baumannii type KL2 and efficiently kill Acinetobacter baumannii type KL2, and can be used to treat infections caused by Acinetobacter baumannii type KL2.

[0055] In some embodiments, the drug also includes a pharmaceutically acceptable carrier.

[0056] In some embodiments, the pharmaceutically acceptable carrier includes at least one of excipients, flow aids, diluents, preservatives, colorants, flavoring agents, wetting agents, suspending agents, stabilizers, isotonic agents, solvents, and emulsifiers.

[0057] In some embodiments, the drug further includes antibiotics. This allows for combination therapy, further enhancing efficacy. In some specific embodiments, the antibiotics include, but are not limited to, at least one of polymyxin, tigecycline, piperacillin / tazobactam, ceftazidime, cefoperazone, cefepime, cefotaxime, imipenem, meropenem, amikacin, tobramycin, ciprofloxacin, levofloxacin, minocycline, trimethoprim-sulfamethoxazole, fluconazole, itepamil, cefoperazone-sulbactam, oxazolidin, etalumamine, linezolid, isepamilin, and causticin.

[0058] In some embodiments, the dosage form of the drug is selected from one of the following: solution, aerosol, pill, tablet, capsule, powder, lozenge, and paste.

[0059] This invention also provides an application of the KL2 type Acinetobacter baumannii phage described above in the present invention for treating KL2 type Acinetobacter baumannii phage in the biosphere; or, this invention also provides an application of the phage composition described above in the present invention for treating KL2 type Acinetobacter baumannii phage in the biosphere; or, this invention also provides an application of the KL2 type Acinetobacter baumannii phage described above in the present invention and the phage composition described above in the present invention for treating KL2 type Acinetobacter baumannii phage in the biosphere, wherein the application is for non-disease treatment purposes.

[0060] In this embodiment, the biosphere refers to the sum of all living organisms on Earth and their environment. The KL2 type Acinetobacter baumannii phage or phage composition is used for non-therapeutic purposes to kill KL2 type Acinetobacter baumannii, such as killing KL2 type Acinetobacter baumannii in hospital environments, other environments, or on object surfaces. That is, when it is necessary to kill KL2 type Acinetobacter baumannii in the air or on certain object surfaces, the above-mentioned KL2 type Acinetobacter baumannii phage or phage composition can be used.

[0061] In some implementations, the method of the application includes the steps of:

[0062] Samples are taken from the biosphere to obtain the samples to be tested;

[0063] The presence of a predetermined amount of Acinetobacter baumannii type KL2 in the sample was detected by PCR.

[0064] If a predetermined amount of Acinetobacter baumannii type KL2 is present, the Acinetobacter baumannii type KL2 phage of claim 1 and / or the phage composition of claim 2 are applied to the biosphere to eliminate the Acinetobacter baumannii type KL2.

[0065] In this embodiment, PCR detection can rapidly detect and identify Acinetobacter baumannii type KL2, and combine it with Acinetobacter baumannii type KL2 baumannii phage (or phage composition) to achieve timely eradication of Acinetobacter baumannii type KL2. In other words, when PCR detection indicates that the content of Acinetobacter baumannii type KL2 at a certain location in the biosphere has reached a certain level (i.e., a preset level), and eradication treatment is required, Acinetobacter baumannii type KL2 baumannii phage (or phage composition) is used for timely and effective eradication.

[0066] In some embodiments, the primer pairs used in the PCR detection include a first primer pair and a second primer pair;

[0067] The first primer pair is:

[0068] Forward (denoted as gtr3_F): TTGCTATAGTCCCAACGTTTATATTCCCATC;

[0069] Reverse (denoted as gtr3_R): CCTGTCCCTACATATTCCATATATATTGTAGAGTC;

[0070] The second primer pair is:

[0071] Forward (denoted as pgt1_F): TGATTGCTAAAAAAGATCTTGGGAAAGTGG;

[0072] Reverse (pgt1_R): ACAAAGGCAACCCTGCTAGC.

[0073] Currently, there is a lack of rapid and accurate detection methods for Acinetobacter baumannii type KL2, which limits the ability to quickly identify KL2 type Acinetobacter baumannii in the early stages of infection, potentially leading to delayed application of phage therapy and missing critical treatment periods. In this embodiment, the Acinetobacter baumannii K locus database was used to analyze the capsular polysaccharide synthesis gene clusters, and Kaptive software (version 2.0.4) was used for KL type identification. By comparing the gene clusters of different KL types in the Kaptive database, it was found that the gtr3 and gtr4 genes are specifically located in KL2 and KL81. Furthermore, compared to KL81, KL2 only lacks the pgt1 gene, indicating that detecting the gtr3 and pgt1 genes has the potential to identify KL2. Further, by designing the above primer pairs, the combined detection of the gtr3 and pgt1 genes can accurately and rapidly identify Acinetobacter baumannii type KL2.

[0074] The present invention will be further described below through specific embodiments.

[0075] Example 1

[0076] (1) Capsule gene analysis of MDRAB strains:

[0077] A total of 136 MDRAB strains were collected from multiple hospitals. All strains underwent next-generation sequencing, and the capsule genes of these strains were analyzed using Kaptive software (version 2.0.4). The results showed that KL2, KL7, KL77, and KL3 types were the most prevalent (as shown in Figure 1).

[0078] (2) Separation and purification of AB_SZL2 and AB_SZL3:

[0079] Take 6 mL of collected hospital sewage, centrifuge at 8000 g for 10 min, take the supernatant and filter it through a 0.22 μm filter membrane to obtain the filtrate;

[0080] Take 2 mL of filtrate and add 1 mL of 3×LB broth and 200 μL of overnight incubated host culture (final OD). 600 Approximately 0.1 g of the mixture was incubated for 5 hours to obtain a mixed culture medium.

[0081] Take 1 mL of mixed culture medium, centrifuge at 12000 rpm / min for 3 min, filter through a 0.22 μm filter membrane, take 10 μL of supernatant, spot on a plate, and observe the results after 6 h (or overnight); at the same time, take 500 μL of supernatant, add 3 mL of LB broth and 200 μL of host bacteria solution for further enrichment, spot on a plate after 5 h (or overnight), repeat the enrichment 3 times. If obvious phage plaques are seen in the spotting experiment, the solution should be inoculated onto an LB plate containing host bacteria, serially diluted or streaked (in order to find individual phage plaques)

[0082] Select a single phage plaque, inoculate it repeatedly 3 times, and finally store the purified phage at 4°C.

[0083] (3) Phage screening

[0084] In screening phages, in addition to the conventional double-layer plate method for verifying phage susceptibility, a second round of screening was conducted to overcome phage resistance (which is often the cause of phage therapy failure). First, the clinical isolate NAB01B (isolated from sputum culture in a hospital laboratory) was used for phage susceptibility testing via a spot method (specifically, the host bacterium NAB01B culture and 1.5% LB agar were mixed at a volume ratio of 1:100, poured onto a plate, and 5 μL of phage was spotted onto the plate, incubated overnight at 37°C, and the formation of clear phage plaques was observed; the formation of clear phage plaques indicated susceptibility). This yielded the first round of phages AB_SZL3 and AB_SZL4. Subsequently, the clinical isolate NAB01B was used with 10... 10 The first round of PFU phages was cultured at 37°C and 220 rpm for 24 hours on a shaker to induce the production of phage-resistant strains. 10 μL of the mixed culture was spread onto LB agar and incubated at 37°C for 12 hours. The ten selected resistant monoclonal strains were named NAB01B-R1, NAB01B-R2, NAB01B-R3, NAB01B-R4, NAB01B-R5, NAB01B-R6, NAB01B-R7, NAB01B-R8, NAB01B-R9, and NAB01B-R10. A second round of screening was then conducted using a phage library. These resistant strains were categorized into four groups based on their phage susceptibility (as shown in Figure 2; in Figure 2, the plaque formation rate refers to the ratio of the phage titer on the resistant strain to the titer on the original isolate NAB01B). AB_SZL2 and AB_SZL3 (the accession numbers for both are mentioned above) were screened and identified from a large number of candidate phages. Both of them showed high specificity for both resistant strains and KL2 type MDRAB.

[0085] In vitro experiments (using the droplet method, see above) confirmed the broad-spectrum fragmentation ability of AB_SZL2 and AB_SZL3 on KL2 type MDRAB (as shown in Figure 3).

[0086] Furthermore, this embodiment provides a phage composition (composed of AB_SZL2 and AB_SZL3 in a 1:1 ratio, i.e., 1 PFU:1 PFU) by combining these two phage strains. In vitro experiments (using the droplet method, see above) confirmed the broad-spectrum lytic ability of this phage composition against KL2 type MDRAB, capable of lysing more than 90% of the test bacteria.

[0087] Example 2 Characterization of bacteriophages

[0088] The genome length of AB_SZL2 is 41359 bp. Sequence analysis shows that it belongs to the order Autographiviridae, genus Friunavirus. AB_SZL2 has the highest nucleotide coverage (93%) and similarity (95%) at the Acinetobacter baumannii phage SWH-Ab-3 (GenBank: NC_047883) and ABP57 (GenBank: OR578534). The circular genome diagram of AB_SZL2 is shown in Figure 4, and the transmission electron micrograph of AB_SZL2 is shown in Figure 5, showing that it belongs to the short-tailed phage family.

[0089] The genome length of AB_SZL3 is 44398 bp. Sequence analysis indicates that it belongs to the genus Oblonenskvirus. AB_SZL3 has the highest nucleotide coverage (91%) and similarity (98%) to *Animalobacterium baumannii* phage AbP2 (GenBank: NC_041998). The circular genome diagram of AB_SZL3 is shown in Figure 4. The transmission electron microscopy image of AB_SZL3 is shown in Figure 6, confirming that it belongs to *Myotail* phage.

[0090] Furthermore, analysis of the entire genomes of both phages revealed that they possess a series of genes encoding common phage-related characteristics, including DNA polymerase, DNA helicase, and tail and head structural proteins. They also both possess genes encoding host lysins. Computer simulation analysis of the phage genomes did not identify any potential virulence, antibiotic resistance, or integrase sequences.

[0091] Example 3: Application of the phage composition

[0092] Case 1:

[0093] In June 2022, a 55-year-old male was admitted to the hospital with worsening aspiration pneumonia. The patient was in a vegetative state due to a hemorrhagic stroke, and sputum bacterial cultures revealed a diverse microbial flora, including *Pseudomonas aeruginosa*, *Candida tropicalis*, and *Stenotrophomonas maltophilia*. Despite intravenous antibiotic treatment, including amikacin, rifampin, meropenem, piperacillin / tazobactam, levofloxacin, imipenem, itepamilin, and fluconazole, the lung infection persisted. By July 2022, sputum cultures revealed a nosocomial infection of *Acinetobacter baumannii*. The isolated *Acinetobacter baumannii* strain exhibited a broad antimicrobial spectrum, with moderate sensitivity to polymyxin B, minocycline, and tigecycline. Even with intravenous antibiotic treatment containing polymyxin B, itepamilin, and imipenem, the lung infection remained difficult to eradicate. Since prolonged antibiotic treatment failed to cure the lung infection, the clinicians decided to try phage therapy. After approval from the local hospital's ethics committee and with the family's consent, phage therapy was initiated, specifically 3 × 10⁻⁶ AB_SZL2 and AB_SZL3 each. 9 PFU / dose, with physiological saline as the solvent, was administered via nebulization twice daily. The timeline of bacterial strains isolated from the patient is shown in Figure 7A (where D1 refers to the day phage therapy began, and NAB01B is the original strain isolated before treatment began). The sensitivity of the isolated clinical strains to phages AB_SZL2 and AB_SZL3 is shown in Figure 7B (where plaque formation rate refers to the ratio of the phage titer on the isolated clinical strain to the titer on the original isolate NAB01B). Through combination antibiotics (cefotaxime / sulbactam, 2g / day, intravenous bolus) and three courses of phage therapy lasting 38 days, the patient's pulmonary drug-resistant bacterial infection was successfully cleared. The patient's clinical manifestations and microbiological test results gradually improved, and the infection was ultimately completely cured.

[0094] Case 2:

[0095] An 89-year-old male patient with a history of diabetes was admitted to the hospital with altered consciousness following a fall. Since admission, repeated sputum cultures revealed multidrug-resistant Klebsiella pneumoniae, multidrug-resistant Pseudomonas aeruginosa, and multidrug-resistant Acinetobacter baumannii, leading to recurrent fever, pneumonia, and urinary tract infections. Various antibiotics were used during treatment, including piperacillin / tazobactam, cefoperazone / sulbactam, cefotaxime, and oxacillin, but none were effective. Tigecycline was attempted, but resulted in liver damage and had to be discontinued. Although combined treatment with meropenem and linezolid provided some relief, the infection recurred after discontinuation of treatment and weaning from mechanical ventilation, requiring reintubation and mechanical ventilation. Therefore, the physician decided to administer phage therapy. With the patient's informed consent and approval from the hospital's ethics committee, the patient received phage therapy against Acinetobacter baumannii and Pseudomonas aeruginosa (specifically, 3 × 10⁻⁶ AB_SZL2 and AB_SZL3 each). 9 PFU (per dose) was administered via nebulization twice daily for 7 days, in combination with antibiotics (meropenem 1.5g / day, intravenous bolus). Nebulization therapy was administered for seven consecutive days, along with intravenous meropenem. Throughout the treatment, the patient tolerated the medication well without significant adverse reactions. Acinetobacter baumannii in the lungs was effectively cleared, and the bacterial load of Pseudomonas aeruginosa decreased. Simultaneously, the patient's clinical symptoms improved, and chest imaging showed a reduction in lung infection and pleural effusion compared to previous images.

[0096] Case 3:

[0097] An 83-year-old male patient with a history of coronary heart disease, diabetes, and kidney disease was admitted to the hospital after sudden loss of consciousness. During his hospitalization, he developed multiple lung infections caused by multidrug-resistant Klebsiella pneumoniae, multidrug-resistant Pseudomonas aeruginosa, Candida albicans, and multidrug-resistant Acinetobacter baumannii. The patient received multiple antibiotic treatments, including cefotaxime, cefoperazone / sulbactam, ethalumamamide, meropenem, linezolid, ciprofloxacin, amikacin, isipamicin, imipenem, ceftazidime, polymyxin B, piperacillin / tazobactam, and fluconazole. However, the lung infections were not well controlled, and the physicians decided to try phage therapy. After obtaining informed consent and approval from the hospital's ethics committee, the patient received 9 days of antibiotic treatment (ciprofloxacin 0.2g / day, intravenous bolus), and concurrently received phage therapy against Pseudomonas aeruginosa and Acinetobacter baumannii (specifically AB_SZL2 and AB_SZL3 3×10⁻⁶ each). 9PFU / dose, with saline solution, administered twice daily via nebulization for 21 days. After several days of Acinetobacter baumannii phage therapy, Acinetobacter baumannii was no longer cultured from the patient's sputum. One week after Acinetobacter baumannii phage therapy, Pseudomonas aeruginosa phage therapy was started. Despite continued administration of Pseudomonas aeruginosa phage, Pseudomonas aeruginosa was still detected in sputum cultures. However, the patient's condition gradually improved; fever subsided, ventilator settings were reduced, and alertness improved upon regaining consciousness.

[0098] Case 4:

[0099] A 91-year-old male with a history of severe hypertension, coronary artery disease, chronic heart failure, chronic pulmonary embolism, and type 2 diabetes was admitted to the hospital due to shortness of breath. A chest CT scan revealed bilateral pneumonia, and he was diagnosed with "severe pneumonia." Upon admission, screening revealed that the patient tested positive for COVID-19. Sputum culture detected filamentous bacilli, broad-spectrum drug-resistant Acinetobacter baumannii, and Candida albicans. The patient received multiple antibiotic treatments, including piperacillin / tazobactam, minocycline, meropenem, vancomycin, cefoperazone / sulbactam, and causticonil. However, these treatments did not completely clear the pathogens from the lungs, and sputum culture still showed a large number of Acinetobacter baumannii (+++), sensitive to polymyxins. Therefore, the physician decided to try phage therapy. After obtaining informed consent and approval from the hospital's ethics committee, the patient received 13 days of antibiotic treatment (levofloxacin 0.5g / day, intravenous bolus) and concurrently received phage therapy against Acinetobacter baumannii (AB_SZL2 and AB_SZL3, 3×10⁻⁶ each). 9 PFU / dose, with saline solution, administered via nebulization twice daily for 14 days. After initiating phage therapy, the patient did not develop fever, and hemodynamics remained stable. Inflammatory markers such as white blood cell count, C-reactive protein, interleukin-6, and procalcitonin rapidly decreased to normal levels from day three. Sputum cultures were negative from day three and remained negative for two consecutive days. Although a small amount of Acinetobacter baumannii (+) was recultured on day six, it was quickly cleared, and subsequent cultures were all negative. On day ten of phage therapy, the patient's family requested a transfer to a general ward for care.

[0100] In this embodiment, the phage composition was applied to 4 patients with KL2 type MDRAB pulmonary infection, and good therapeutic effects were achieved in all cases.

[0101] Example 4

[0102] Subsequent analysis was performed on the bacteria isolated from the patient in Case 1 of Example 3 (including NAB01B, NAB02B, NAB03B, NAB04B, NAB05B, NAB06B, and NAB07B). In vitro experiments induced phage resistant strains AB_SZL2 and AB_SZL3. Whole-genome sequencing (combining second- and third-generation sequencing) and functional experiments of the resistant strains in vitro and in vivo revealed mutations in genes involved in the synthesis of extracellular lipopolysaccharide and the capsule (Figure 8). In Figure 8, the gtrOC3 gene encodes a glycosyltransferase involved in extracellular lipopolysaccharide synthesis, and the wzy gene encodes a repeat unit polymerase involved in extracellular capsule synthesis.

[0103] Sensitivity change test:

[0104] The antibiotic susceptibility of Acinetobacter baumannii was tested using the MIC method, performed by the hospital's laboratory department. The results are shown in Figure 9A. In Figure 9A, TZP represents piperacillin / tazobactam; CAZ represents ceftazidime; SCF represents sulbactam and cefoperazone; IPM represents imipenem; MEM represents meropenem; TOB represents tobramycin; CIP represents ciprofloxacin; LEV represents levofloxacin; MIN represents minocycline; PB represents polymyxin; and SXT represents trimethoprim-sulfamethoxazole.

[0105] Growth curve determination:

[0106] The growth curve was obtained by measuring OD600 every 10 minutes under continuous shaking at 37℃ for the logarithmic phase bacterial culture. The results are shown in Figure 9B.

[0107] Cell wall resistance assessment:

[0108] 1×10 7 CFU bacterial culture was placed in a 0.2% sodium dodecyl sulfate (SDS) solution and incubated at 37°C for two hours. The bacterial concentration before and after incubation was measured, and the survival rate was calculated. The structure is shown in Figure 9C.

[0109] Biofilm formation capacity assay:

[0110] The overnight bacterial culture was added to Brain Heart Infusion Broth (BHI) at a volume ratio of 1:100 and incubated at 37°C for 48 hours. The biofilm mass was then measured according to the instructions for using crystal violet solution (Beyotime). The results are shown in Figure 9D.

[0111] Tests on changes in the virulence of strains to HeLa cells:

[0112] 1×10 4 24 hours after seeding HeLa cells into a plate, add 2×10 4CFU cultures were incubated together for 12 hours. The LDH concentration of each group was measured according to the instructions of the lactate dehydrogenase (LDH) assay kit (boxbio). The results are shown in Figure 9E.

[0113] Tests on changes in the virulence of the strain to A549 cells:

[0114] 1×10 4 After seeding A549 cells into a plate for 24 hours, add 2×10 4 After incubating each bacterial culture with CFU for 12 hours, the LDH concentration of each group was measured according to the instructions of the LDH measurement kit (boxbio). The results are shown in Figure 9F.

[0115] Bacterial capsule scanning electron microscopy test:

[0116] NAB01B and NAB01B-R3, after being resuspended in PBS, were fixed with 2.5% glutaraldehyde. The fixed samples were then sent to Tianjin Jingshi Testing Technology Co., Ltd. for scanning electron microscopy to image the surface structure of the strains. The results are shown in Figure 9, G.

[0117] In Figure 9, C, D, E, and F, ns indicates no significant difference; * indicates P<0.05, ** indicates P<0.01, *** indicates P<0.001, and **** indicates P<0.0001.

[0118] The above results indicate that these strains as a whole simultaneously exhibited characteristics of decreased virulence, reduced biofilm formation ability, decreased cell wall integrity, and increased antibiotic sensitivity. This suggests that phage-resistant strains may be accompanied by antibiotic resensitization, weakened growth ability, weakened cell wall function, reduced biofilm formation ability, reduced cytotoxicity, and loss of capsule structure.

[0119] Example 5: Rapid identification of Acinetobacter baumannii type KL2

[0120] Currently, there is a lack of rapid and accurate detection methods for Acinetobacter baumannii type KL2, which limits the ability to quickly identify KL2 MDRAB in the early stages of infection, potentially leading to delayed application of phage therapy and missing critical treatment periods. Therefore, this embodiment uses the Acinetobacter baumannii K locus database to analyze capsular polysaccharide synthesis gene clusters and uses Kaptive software (version 2.0.4) for KL type identification. By comparing gene clusters of different KL types in the Kaptive database, it was found that the gtr3 and gtr4 genes are specifically located in KL2 and KL81. Furthermore, KL2 lacks only the pgt1 gene compared to KL81, indicating that detecting the gtr3 and pgt1 genes has the potential to identify KL2 (see Table 1). Further, primer pairs were designed (as shown in Table 2), and PCR (polymerase chain reaction) was used to validate 149 clinical MDRAB strains from multiple hospitals.

[0121] The reaction procedure for the PCR method is as follows:

[0122] Pre-denaturation: 95℃ for 3 minutes;

[0123] Amplification: 30 cycles, one cycle consisting of 95℃ for 15 seconds, 60℃ for 15 seconds, and 72℃ for 15 seconds;

[0124] Full extension: 72℃ for 5 minutes.

[0125] Reaction system: 20.0 μL double-distilled water; 25.0 μL 2×PCR reaction premix (Novizan); 1.0 μL primer gtr3_F (10 μM); 1.0 μL primer gtr3_R (10 μM); 1.0 μL primer pgt1_F (10 μM); 1.0 μL primer pgt1_R (10 μM); 1.0 μL bacterial culture.

[0126] The results suggest that combined detection of gtr3 and pgt1 genes can accurately identify KL2 type MDRAB (as shown in Figure 10 and Table 3).

[0127] Table 1. Genotyping analysis of Acinetobacter baumannii capsules

[0128] Table 2. Primer pairs

[0129] Table 3. Comparison of Kaptive software prediction results and gtr3 and pgt1 gene detection results for clinical Baumann's strains.

[0130] In this context, + indicates positive; - indicates negative; and ND indicates no detection.

[0131] In summary, this invention utilizes an in vitro method of inducing phage resistance in strains and then re-screening for phages to effectively overcome phage resistance. This phage screening strategy effectively overcomes phage resistance and, compared to existing technologies, is more forward-looking and has practical clinical therapeutic significance, significantly improving the efficacy of phage therapy. The phage composition provided by this invention can efficiently kill KL2-type MDRAB in vitro and has shown good results in compassionate clinical trials, making it applicable to the clinical treatment of infections caused by KL2-type MDRAB (not limited to lung infections). This invention also proposes the use of specific primer pairs for rapid detection of KL2-type MDRAB, combined with a phage composition specifically targeting KL2-type MDRAB, which can significantly enhance the clinical application value of phages. In general, the phage composition provided by this invention can precisely target KL2-type Acinetobacter baumannii, significantly improving clinical efficacy (it can also be used in the environment to kill KL2-type Acinetobacter baumannii in vitro). Combined with a rapid detection method for KL2-type MDRAB, this pathogen can be quickly identified, enabling timely treatment.

[0132] It should be understood that the application of the present invention is not limited to the examples above. Those skilled in the art can make improvements or modifications based on the above description, and all such improvements and modifications should fall within the protection scope of the appended claims.

Claims

1. A KL2 type Acinetobacter baumannii phage, characterized in that, The KL2 type Acinetobacter baumannii phage is named AB_SZL2 and deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: M 20241522; or, the KL2 type Acinetobacter baumannii phage is named AB_SZL3 and deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: M 20241523.

2. A method for screening KL2 type Acinetobacter baumannii phage as described in claim 1, characterized in that, Includes the following steps: The host bacterial culture and culture medium were poured onto a plate, and then the KL2 type Acinetobacter baumannii phage was spotted onto the plate and cultured overnight to obtain the first round of phage products. The first round of phage products were cultured with host bacteria to obtain phage-resistant strains; A second round of screening was conducted on the phage-resistant strains using a phage library to obtain KL2 type Acinetobacter baumannii phages that overcame phage resistance.

3. A bacteriophage composition, characterized in that, The phage composition comprises at least one KL2 type Acinetobacter baumannii phage as described in claim 1.

4. A drug, characterized in that, The active ingredient of the drug includes the KL2 type Acinetobacter baumannii phage as described in claim 1 and / or the phage composition as described in claim 3.

5. The drug according to claim 4, characterized in that, The drug also includes a pharmaceutically acceptable carrier.

6. The drug according to claim 5, characterized in that, The pharmaceutically acceptable carrier includes at least one of the following: excipients, glidants, diluents, preservatives, colorants, flavoring agents, wetting agents, suspending agents, stabilizers, isotonic agents, solvents, and emulsifiers.

7. The drug according to claim 4, characterized in that, The drug also includes antibiotics; And / or, the dosage form of the drug is selected from one of the following: solution, aerosol, pill, tablet, capsule, powder, lozenge, paste.

8. The use of the KL2 type Acinetobacter baumannii phage of claim 1 and / or the phage composition of claim 3 in the treatment of KL2 type Acinetobacter baumannii phage in the biosphere, said use for non-disease treatment purposes.

9. The application according to claim 8, characterized in that the method of the application includes the steps of: Samples are taken from the biosphere to obtain the samples to be tested; The presence of a predetermined amount of Acinetobacter baumannii type KL2 in the sample was detected by PCR. If a predetermined amount of Acinetobacter baumannii type KL2 is present, the Acinetobacter baumannii type KL2 phage of claim 1 and / or the phage composition of claim 2 are applied to the biosphere to eliminate the Acinetobacter baumannii type KL2.

10. The application according to claim 9, wherein the primer pair used in the PCR detection includes a first primer pair and a second primer pair; The first primer pair is: Positive: TTGCTATAGTCCCAACGTTTATATTCCCATC; Reverse: CCTGTCCCTACATATTCCATATATATTGTAGAGTC; The second primer pair is: Positive: TGATTGCTAAAAAAGATCTTGGGAAAGTGG; Reverse: ACAAAGGCAACCCTGCTAGC.

Citation Information

Patent Citations

  • Acinetobacter baumannii phage and application thereof

    CN104498443A

  • Acinetobacter baumannii phage and application thereof

    CN116875559A

  • Wide-host-spectrum drug-resistant acinetobacter baumannii bacteriophage as well as composition and application thereof

    CN117448281A

  • Cross-linked polyolefin separator for secondary batteries with improved safety and permeability and method of manufacturing the same

    KR1020200133529A

Cited By

  • Acinetobacter baumannii bacteriophage, depolymerases and preparation method and application thereof

    CN122012417A