Use of osnpf7.2 gene in improving drought tolerance in rice breeding
By overexpressing the OsNPF7.2 gene and its encoded protein in rice, and using the OsNPF7.2 gene overexpression vector and CRISPR/Cas9 technology to edit the rice genome, the shortcomings of drought-resistant rice breeding were solved, and the drought resistance and yield of rice were improved.
Patent Information
- Application Number
- PCT/CN2024/120236
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-07-08
- Filing Date
- 2024-09-22
- Publication Date
- 2026-01-15
AI Technical Summary
In the existing technology, there are limited methods for breeding drought-resistant rice, and there are no reports on the application of the nitrate transporter OsNPF7.2 gene for drought-resistant breeding, resulting in insufficient yield and drought resistance of rice under drought conditions.
By overexpressing the OsNPF7.2 gene and its encoded protein in rice, and using the OsNPF7.2 gene overexpression vector and CRISPR/Cas9 technology to edit the rice genome, we obtained OsNPF7.2 overexpressing rice materials and mutant rice, thereby improving the drought resistance of rice.
Under drought conditions, OsNPF7.2 overexpressing rice materials and IR64 type OsNPF7.2 near-isogenic lines showed better drought resistance and higher yield per plant, reducing the risk of agricultural production losses.
Smart Images

Figure CN2024120236_15012026_PF_FP_ABST
Abstract
Description
Application of OsNPF7.2 gene in improving drought resistance breeding of rice Technical Field
[0001] This invention belongs to the field of bioengineering technology, specifically the application of the OsNPF7.2 gene in improving drought resistance breeding of rice. Background Technology
[0002] Rice is one of the most important food crops for humankind, with nearly half of the world's population relying on it as their staple food. Rice cultivation plays a vital role in ensuring food security. However, rice growth and development are frequently affected by drought stress, especially during the tillering, heading, and grain-filling stages, severely reducing yields. With the increasing scarcity of freshwater resources and the growing severity of water pollution, drought has become a key factor restricting both the quantity and quality of rice production. Therefore, countries worldwide are exploring sustainable solutions to improve crop drought resistance.
[0003] The nitrate transporter (NPF) gene family participates in a variety of biological processes, and its main function is to transport substances. In rice, the nitrate transporter OsNPF7.2 is an important component in regulating the nitrogen fertilizer use efficiency of rice and plays an important role in nitrogen absorption. Overexpression of OsNPF7.2 can significantly improve the nitrogen fertilizer use efficiency and yield of rice (Wang et al., 2018). However, there are no reports on the practical application of the OsNPF7.2 gene in drought-resistant breeding.
[0004] Although some progress has been made in drought-resistant rice cultivation and some candidate drought-resistant genes have been screened, there are few reports of successfully transferring these candidate genes into rice and obtaining drought-resistant lines. Moreover, the screening of drought-resistant genes has focused on the related mechanisms of rice water regulation, and there are few experiments on other transfer genes as resistance genes.
[0005] Summary of the Invention
[0006] To address the aforementioned problems, the present invention aims to: 1) provide the application of the rice OsNPF7.2 gene and its encoded protein in improving plant drought resistance breeding; 2) provide a method for screening rice materials overexpressing the OsNPF7.2 gene; and 3) provide a method for breeding drought-resistant rice. To achieve these objectives, the technical solution adopted by the present invention is as follows:
[0007] The application of the rice OsNPF7.2 gene and its encoded protein in improving plant drought resistance breeding involves overexpressing the OsNPF7.2 gene shown in SEQ ID NO:4 in rice to obtain OsNPF7.2 overexpressing rice materials; the sequence of the protein encoded by the OsNPF7.2 gene is shown in SEQ ID NO:2.
[0008] Preferably, the IR64 type OsNPF7.2 gene is introduced into japonica rice through hybridization.
[0009] Preferably, the OsNPF7.2 gene shown in SEQ ID NO:4 is knocked out in rice to obtain mutant rice.
[0010] Preferably, the protein encoded by the OsNPF7.2 gene is used to regulate the effective tiller number and yield per plant in rice in dryland fields.
[0011] Preferably, the OsNPF7.2 overexpressing rice material has increased effective tiller number and yield per plant in dryland, while the mutant rice has decreased yield per plant in dryland.
[0012] Preferably, the rice variety is Zhonghua 11.
[0013] A method for screening OsNPF7.2 gene overexpressing rice materials, comprising the following steps to obtain OsNPF7.2 overexpressing rice materials as described above:
[0014] Construct an OsNPF7.2 overexpression vector;
[0015] The constructed OsNPF7.2 overexpression vector was transformed into Agrobacterium EHA105 via heat shock transformation.
[0016] Positive identification of T0 generation transgenic rice was performed using PCR amplification, and rice materials overexpressing OsNPF7.2 were screened out.
[0017] Preferably, the positive identification of T0 generation transgenic rice using PCR amplification includes:
[0018] Genomic DNA was extracted from T0 generation transgenic rice, and PCR amplification was performed using primer pairs NPTII-F and NPTII-R to identify positive transgenic plants.
[0019] The expression level of OsNPF7.2 in positive plants was detected by real-time quantitative PCR using primers qOsNPF7.2-F and qOsNPF7.2-R. Ubiquitin 1 was used as an internal reference gene, and primers qUBQ-F and qUBQ-R were used to obtain two transgenic lines with certain differences in expression levels. The line with lower expression level was named Native-OE1, and the line with higher expression level was named Native-OE2.
[0020] Preferably, the construction of the OsNPF7.2 overexpression vector includes:
[0021] An OsNPF7.2 overexpression vector containing the promoter shown in SEQ ID NO:3 and ID NO:1, as well as the OsNPF7.2 gene coding region shown in SEQ ID NO:1, was constructed.
[0022] A method for breeding drought-resistant rice, based on OsNPF7.2 overexpression rice material as described in any of the above-mentioned methods, includes the following steps:
[0023] The donor parent, indica rice IR64, was crossed with the recipient parent, japonica rice Koshihikari, to obtain a hybrid variety with the IR64 type OsNPF7.2 gene;
[0024] By backcrossing the hybrid variety and the recipient parent for n generations, where n is an integer greater than zero, a near-isogenic line containing the IR64 type OsNPF7.2 gene is obtained, thus producing drought-resistant japonica rice.
[0025] The beneficial effects of this invention lie in obtaining a rice OsNPF7.2 deletion mutant through targeted editing, and discovering that the nitrate transport protein encoded by this gene, in addition to its traditional material transport function, also plays an important regulatory role in the drought resistance physiology of rice. This invention utilizes the advantages of this gene to obtain OsNPF7.2 overexpression lines and IR64-type OsNPF7.2 near-isogenic lines. Under drought conditions, both lines exhibit better tolerance and higher yield per plant compared to wild-type rice. This demonstrates that the technical solution provided by this method can fully utilize the advantages of the OsNPF7.2 gene, improve the drought resistance of rice, reduce the risk of agricultural production losses, and has significant economic value and application prospects. Attached Figure Description
[0026] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate embodiments consistent with the present invention and, together with the description, serve to explain the principles of the invention. To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, those skilled in the art can obtain other drawings based on these drawings without any creative effort.
[0027] In the attached image:
[0028] Figure 1 shows the results of real-time fluorescence PCR detection of drought-induced expression of OsNPF7.2 in rice roots;
[0029] Figure 2 shows the results of drought resistance identification of rice OsNPF7.2 mutant; (A) is a schematic diagram of the gene structure of OsNPF7.2 mutant, (B) is the panicle phenotype of OsNPF7.2 mutant under paddy field and drought conditions, (C) is the seed setting rate of OsNPF7.2 mutant under paddy field conditions, (D) is the seed setting rate of OsNPF7.2 mutant under drought conditions, (E) is the yield per plant of OsNPF7.2 mutant under paddy field and drought conditions, (F) is the yield per plant of OsNPF7.2 mutant under paddy field conditions, and (G) is the yield per plant of OsNPF7.2 mutant under drought conditions. Figure 3 shows the results of drought resistance identification of the Native-OE rice OsNPF7.2 overexpression line; (A) is the expression level of the OsNPF7.2 overexpression line, (B) is the number of effective tillers of the ZH11 and OsNPF7.2 overexpression lines in paddy fields, (C) is the number of effective tillers of the ZH11 and OsNPF7.2 overexpression lines in dry fields, (D) is the yield per plant of the ZH11 and OsNPF7.2 overexpression lines (scale bar is 10cm), (E) is the yield per plant of the ZH11 and OsNPF7.2 overexpression lines in paddy fields, and (F) is the yield per plant of the ZH11 and OsNPF7.2 overexpression lines in dry fields.
[0030] Figure 4 shows the drought resistance identification results of the near-isogenic line NIL of Japonica rice IR64 type OsNPF7.2. Among them, (A) is the field phenotype and yield per plant of Koshi and near-isogenic line (NIL) in paddy fields, with a scale bar of 10 cm; (B) is the number of effective tillers of Koshi and NIL in paddy fields; (C) is the yield per plant of Koshi and NIL in paddy fields; (D) is the field phenotype and yield per plant of Koshi and NIL in dry fields, with a scale bar of 10 cm; (E) is the number of effective tillers of Koshi and NIL in dry fields; and (F) is the yield per plant of Koshi and NIL in dry fields. Detailed Implementation
[0031] The following embodiments are used to illustrate the present invention, but are not intended to limit the scope of the invention. Modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and substance of the invention are all within the scope of protection of the present invention. Unless otherwise specified, the experimental materials, reagents, instruments, etc., used in the various embodiments are commercially available; unless specifically specified, all technical means in the embodiments of the present invention are conventional means well known to those skilled in the art.
[0032] We dehydrated wild-type rice Zhonghua 11 (ZH11) after two weeks of hydroponic cultivation and set up a control group without dehydration. Root samples were collected at 0, 0.5, 1, 2, 4, and 6 hours after dehydration. Real-time quantitative PCR was used to detect the expression level of the nitrate transporter gene OsNPF7.2 (LOC_Os02g47090). The results showed that the expression level of OsNPF7.2 was upregulated by drought starting from 0.5 hours after dehydration and remained elevated at 6 hours (Figure 1), indicating that OsNPF7.2 may be involved in the drought stress response of rice.
[0033] Using a 2006 bp upstream fragment of the OsNPF7.2 gene as the promoter (SEQ ID NO:3), the promoter, the coding region of the OsNPF7.2 gene, and the vector were linked. The vector was transformed into ZH11 via Agrobacterium-mediated transformation, resulting in OsNPF7.2 overexpression lines (Native-OE1, Native-OE2) as shown in Figure 3A. Drought resistance was assessed in the above overexpression lines and wild-type rice. The results, as shown in Figure 3, indicate that the overexpression lines produced more effective tillers and higher yields per plant under drought conditions, suggesting that overexpression of the NPF7.2 gene in rice can improve drought resistance.
[0034] Using japonica rice 'Yueguang' as the recipient parent and indica rice 'IR64' as the donor parent, the offspring of the two were backcrossed multiple times to obtain near-isogenic japonica rice lines (NILs) containing the IR64-type OsNPF7.2 gene and a nearby exogenous fragment smaller than 0.78M. Drought resistance was identified in the near-isogenic lines and the recipient parent, and the results are shown in Figure 4. The results show that under drought conditions, the near-isogenic lines have more effective tillers and higher yield per plant, indicating that the IR64-type OsNPF7.2 gene is more conducive to rice response to drought stress, and japonica rice varieties with high drought resistance can be obtained.
[0035] Example 1: Detection of OsNPF7.2 transcriptional levels
[0036] 1.1 Rice seedling cultivation
[0037] Soak the seeds of Zhonghua 11 (ZH11) in tap water and incubate them in a 37℃ incubator until the seeds show white sprouts. Change the tap water every day during this period. Germinated seeds were sown in black 96-well plates. Tap water was added to the culture boxes to ensure the seeds were completely submerged. The plates were then placed in rice culture incubators. Once the seed roots reached 3-4 cm in length, rice seedlings were cultured for 10 days using a modified Kimura nutrient solution (1 mM NH4Cl, 1 mM KNO3, 0.18 mM KH2PO4, 0.0914 mM K2SO4, 0.363 mM CaCl2, 0.548 mM MgSO4, 1.2 mM Na2SiO3·9H2O, 20 μM FeSO4-EDTA, 0.079 μM Na2MoO4·2H2O, 46.2 μM H3BO3, 0.32 μM CuSO4·5H2O, 9.15 μM MnCl2·4H2O, 0.765 μM ZnSO4·7H2O, pH = 5.8). The nutrient solution was changed daily during this period. Two hours after changing the nutrient solution on the 10th day, the rice seedlings were divided into two parts. One part was placed in a culture box with deionized water, and the other part was placed in a waterless culture box. Root samples were taken at 0, 0.5, 1, 2, 4 and 6 hours after treatment. The samples were then flash-frozen in liquid nitrogen for RNA extraction.
[0038] 1.2 OsNPF7.2 transcriptional expression level detection
[0039] The specific steps for extracting RNA from the sample are as follows: In a mortar pre-cooled by liquid nitrogen, the rice material was rapidly frozen in liquid nitrogen and ground into a fine powder. 50-100 mg of the powder was placed in a centrifuge tube free of RNase. 1 mL of Trizol was added, vortexed, and allowed to stand for 5 min. 200 μL of chloroform was added, vortexed to mix, and allowed to stand for 3 min. The mixture was then centrifuged at 12000 rpm and 4°C for 15 min. Approximately 400 μL of the supernatant was collected and placed in a new RNase-free centrifuge tube. An equal volume (400 μL) of isopropanol was added, inverted to mix, and allowed to stand for 20-30 min. The mixture was then centrifuged at 12000 rpm and 4°C for 10 min. The supernatant was discarded, and 1 mL of 75% ethanol (using RNase-free ethanol) was added. Wash the precipitate with water, centrifuge at 7500 rpm and 4°C for 5 min. Depending on the amount of precipitate, the washing process can be repeated once. Discard the supernatant and let it stand at room temperature for 5-10 min to air dry the precipitate. Note that it should not be too dry, otherwise it will affect RNA dissolution. Add 100 μL of RNase-Free Water. To better dissolve the RNA, you can heat it in a metal bath at 56°C for 10 min to dissolve it completely.
[0040] Reverse transcription was performed using the Toyobo Reverse Transcription Kit to obtain cDNA. The specific steps were as follows: Take 1 μg of RNA, add a certain amount of RNase-Free Water, and make up the volume to 6 μL. Incubate briefly at 65°C for 5 min to denature the RNA. After the denaturation, immediately place on ice. Add 2 μL of 4×DN Master Mix (add gDNA Remover at a ratio of 1:50 and mix well before use), gently tap to mix, and incubate briefly at 37°C for 5 min to remove residual genomic DNA. After the denaturation, place on ice. Add 2 μL of 5×RT Master Mix II, gently tap to mix, and incubate briefly at 37°C for 15 min; 50°C for 5 min; 98°C for 5 min; and incubate at 4°C.
[0041] Real-time quantitative PCR was performed using Toyobo THUNDERBIRD SYBR qPCR Mix. Primers qOsNPF7.2-F and qOsNPF7.2-R were used to detect the expression level of OsNPF7.2 after dehydration treatment in rice roots. Ubiquitin 1 was used as an internal control gene. Primers qUBQ-F and qUBQ-R were used. The reaction volume (20 μL) consisted of: 10 μL 2x THUNDERBIRD SYBR qPCR Mix, 1.5 μL 5 μM forward primer, 1.5 μL 5 μM reverse primer, 1 μL cDNA, and 6 μL ddH2O. The expression level was detected using a Bio-Rad CFX96 Touch real-time quantitative PCR system. The specific primer sequences are as follows:
[0042] qOsNPF7.2-F:GGGCCACCTCGACTACTTCT
[0043] qOsNPF7.2-R:GAGAGCACGGTCTTGAGCTT
[0044] qUBQ-F:ACGATTGATTTAACCAGTCCATGA
[0045] qUBQ-R:AACCAGCTGAGGCCCAAGA
[0046] Example 2 uses the CRIPSR-Cas9 gene editing system to obtain two OsNPF7.2 deletion mutants.
[0047] 2.1 Construction of CRISPR / Cas9 vectors
[0048] The CRISPR-GE website (http: / / skl.scau.edu.cn / ) was used to design knockout target sites and sgRNA primer sequences in the OsNPF7.2 coding region. Two knockout target sites were designed in total. The sequence of target site 1 is as follows:
[0049] AGGCTATCATCTTCAGTCTT
[0050] The sequence of target 2 is as follows: CGTCGTGACGTTGGACGCG
[0051] sgRNA primer sequences were designed for the two targets. The primer sequence for target 1 is as follows:
[0052] OsNPF7.2-U3-F:ggcaGGCTATCATCTTCAGTCTT
[0053] OsNPF7.2-U3-R:aaacAAGACTGAAGATGATAGCC
[0054] The primer sequence for target 2 is as follows:
[0055] OsNPF7.2-U6a-F: gccgCGTCGTGACGTTGGACGCGC
[0056] OsNPF7.2-U6a-R:aaacGCGCGTCCAACGTCACGACG
[0057] The primer pair OsNPF7.2-U3-F / OsNPF7.2-U3-R was denatured and annealed to obtain the primer dimer OsNPF7.2-U3-F / -R, which was then ligated into the pYLsgRNA-U3 vector. The primer pair OsNPF7.2-U6a-F / OsNPF7.2-U6a-R was denatured and annealed to obtain the primer dimer OsNPF7.2-U3-F / -R, which was then ligated into the pYLsgRNA-U6a vector. Subsequently, the two intermediate vectors were ligated into the final vector pYLCRISPR / Cas9-MH using a cut-and-ligate method to obtain the dual-target knockout vector for OsNPF7.2.
[0058] 2.2 Obtaining the OsNPF7.2 mutant in rice
[0059] The constructed OsNPF7.2 knockout vector was transformed into Agrobacterium EHA105 via heat shock transformation. The specific steps were as follows: 100 μL of frozen EHA105 competent cells were thawed on ice; 2 μL of plasmid was added, gently mixed, and placed on ice for 30 min; the cells were then flash-frozen in liquid nitrogen for 5 min and incubated at 37°C for 5 min; 500 μL of antibiotic-free YEP liquid medium was added, and the cells were incubated on a shaker at 28°C and 200 rpm for 2-4 h; 200 μL of the bacterial culture was evenly spread onto double-antibiotic YEP solid medium containing Kan and Rif, and incubated at 28°C for 2-3 days. Genetic transformation of rice was performed using Agrobacterium-mediated transformation to obtain T0 generation transgenic rice.
[0060] 2.3 Identification of mutant materials
[0061] Knockout lines were detected using PCR and sequencing. DNA was extracted from T0 generation transgenic rice. Primers NPF7.2-KO-F (tcctcacccgacaatcacaa) and NPF7.2-KO-R (gaacgtgaccagcatcatcc) were designed within approximately 600 bp before and after the target sequence. PCR amplification was performed using the DNA as a template. The PCR products were sequenced using NPF7.2-KO-F primers. Independent transgenic lines with editing in the region near the target sequence were screened. Homozygous edited lines osnpf7.2-1 and osnpf7.2-2 were obtained through self-crossing after multiple generations. In osnpf7.2-1, AC was replaced with T at target site 1, and a 60 bp deletion was found at target site 2. In osnpf7.2-2, a 1 bp insertion was present at target site 1. Both types of mutations were caused by frameshift during OsNPF7.2 translation, leading to premature translation termination.
[0062] (3) Drought resistance assessment
[0063] Transgenic rice and wild-type rice were cultivated in paddy fields and dry fields, respectively. Irrigation in the dry fields was stopped 10 days after transplanting; if heavy rainfall occurred during this period, waterlogging was promptly drained. The paddy fields were irrigated normally. At maturity, agronomic traits of different rice materials were investigated, including effective tillering, seed setting rate, thousand-grain weight, and yield per plant. Differences in agronomic traits between different rice materials in paddy and dry fields were compared to evaluate the yield and drought resistance of different rice materials.
[0064] Compared with the wild type, the mutant had a lower seed setting rate in paddy fields, resulting in a slight decrease in yield per plant (Fig. 2B, C, E, F). In dry fields, the difference in seed setting rate between the mutant and the wild type further widened (Fig. 2B, D), resulting in a significant decrease in yield per mutant plant (Fig. 2E, G). This indicates that the drought resistance of rice is reduced after the osnpf7.2 mutation.
[0065] Example 3: Overexpression of OsNPF7.2 can improve drought resistance in rice.
[0066] 3.1 Construction of overexpression vectors
[0067] Using wild-type rice (ZH11) genomic DNA as a template, the OsNPF7.2 promoter was amplified using primer pair NPF7.2pro. The pCAMBIA2300-ocs vector was digested with KpnI and BamHI, and the vector backbone was recovered. The amplified OsNPF7.2 promoter was ligated into the digested pCAMBIA2300-ocs vector using homologous recombination. The vector was sequenced to verify the results, yielding the intermediate vector.
[0068] pCAMBIA2300-NPF7.2promoter-ocs.
[0069] Using ZH11 cDNA as a template, the OsNPF7.2 coding region fragment (SDE ID NO 1) was amplified using primers NPF7.2cds. The correct intermediate vector pCAMBIA2300-NPF7.2promoter-ocs was verified by double digestion with BamHI and SalI and sequencing. The amplified OsNPF7.2 coding region fragment was ligated into the vector pCAMBIA2300-NPF7.2promoter-ocs, and the vector was verified by enzyme digestion to obtain the OsNPF7.2 self-promoter-driven OsNPF7.2 transexpression vector.
[0070] The primer sequences involved are as follows:
[0071] 3.2 Rice genetic transformation
[0072] The constructed OsNPF7.2 overexpression vector was transformed into Agrobacterium EHA105 via heat shock transformation. The specific steps were as follows: 100 μL of frozen EHA105 competent cells were thawed on ice; 2 μL of plasmid was added, gently mixed, and placed on ice for 30 min; the cells were then flash-frozen in liquid nitrogen for 5 min and incubated at 37°C for 5 min; 500 μL of antibiotic-free YEP liquid medium was added, and the cells were incubated on a shaker at 28°C and 200 rpm for 2-4 h; 200 μL of the bacterial culture was evenly spread onto double-antibiotic YEP solid medium containing Kan and Rif, and incubated at 28°C for 2-3 days. Genetic transformation of rice was performed using Agrobacterium-mediated transformation to obtain T0 generation transgenic rice.
[0073] 3.3 Screening of overexpression materials and identification of expression levels
[0074] Positive identification of T0 generation transgenic rice was performed using PCR amplification. Specifically, genomic DNA was extracted from T0 generation transgenic rice, and PCR amplification was performed using primers NPTII-F and NPTII-R to identify positive transgenic plants. Real-time quantitative PCR was used to detect the expression level of OsNPF7.2 in positive plants using primers qOsNPF7.2-F and qOsNPF7.2-R. Ubiquitin 1 was used as an internal reference gene, with primers qUBQ-F and qUBQ-R. Two transgenic lines with different expression levels were obtained; the line with lower expression was named Native-OE1, and the line with higher expression was named Native-OE2.
[0075] The primer sequences involved are as follows:
[0076] 3.4 Drought Resistance Assessment
[0077] Transgenic rice and wild-type rice were cultivated in paddy fields and dry fields, respectively. Irrigation in the dry fields was stopped 10 days after transplanting; if heavy rainfall occurred during this period, waterlogging was promptly drained. The paddy fields were irrigated normally. At maturity, agronomic traits of different rice materials were investigated, including effective tillering, seed setting rate, thousand-grain weight, and yield per plant. Differences in agronomic traits between different rice materials in paddy and dry fields were compared to evaluate the yield and drought resistance of different rice materials.
[0078] The results are shown in Figure 3. Figure 3C shows that the OsNPF7.2 overexpressing rice material in dryland has more effective tillers than wild-type rice. Figures 3D and 3F show that the OsNPF7.2 overexpressing rice material in dryland has higher yield per plant than wild-type rice, indicating that overexpressing the OsNPF7.2 gene in rice can improve the drought resistance of rice.
[0079] Example 4: IR64 type OsNPF7.2 can improve the drought resistance of japonica rice.
[0080] (1) Constructing a near-isogenic (NIL) line of japonica rice with IR64 type OsNPF7.2.
[0081] In the indica rice population, OsNPF7.2 exists in several different haplotypes, one of the typical representatives being the IR64 type. Through multiple generations of backcrossing, we introduced the IR64 type NPF7.2 into the japonica rice variety Koshihikari, obtaining a near-isogenic line containing a foreign fragment smaller than 0.78M near the target gene. Irrigation was stopped 10 days after transplanting until rice maturity. During this period, any heavy rainfall was promptly drained from the fields. At maturity, agronomic traits of Koshihikari and near-isogenic lines in paddy fields and dry fields were investigated (Figure 4). It was found that the tillering and yield per plant in the near-isogenic line in paddy fields were not significantly different from Koshihikari. However, in dry fields, the tillering and yield per plant in the near-isogenic line were significantly increased, indicating that the IR64 type OsNPF7.2 can significantly improve the drought tolerance of Koshihikari.
[0082] DNA was extracted from japonica rice (variety Koshihikari) and indica rice (variety IR64). The OsNPF7.2 gene of both varieties was amplified using primer pair NPF7.2-Intron1. Electrophoresis revealed differences between the two varieties. Using Koshihikari as the recipient parent and IR64 as the donor parent, pollen from the donor parent was applied to the pistil of the recipient parent during the flowering and pollination period for hybridization. The resulting offspring were repeatedly backcrossed with the recipient parent until a near-isogenic line of japonica rice with a single fragment of IR64 DNA infiltrated near OsNPF7.2 was obtained. DNA was extracted from near-isogenic lines, and the size of donor parental genomic fragments in near-isogenic lines was detected using 2-28.11-F / R, 2-28.55-F / R, 2-29.33-F / R, and 2-29.50-F / R. Near-isogenic lines with a single DNA fragment of less than 0.78 MIR64 infiltrated near OsNPF7.2 were screened.
[0083] The primer sequences involved are as follows:
[0084] (2) Drought resistance assessment
[0085] Nearly isomorphic lines and Koshihikari rice were cultivated in paddy fields and dry fields, respectively. Irrigation in the dry fields was stopped 10 days after transplanting; if heavy rainfall occurred during this period, waterlogging was promptly drained. The paddy fields were irrigated normally. At maturity, agronomic traits of different rice materials were investigated, including effective tillering, seed setting rate, thousand-grain weight, and yield per plant. Differences in agronomic traits between paddy and dry fields were compared to evaluate the yield and drought resistance of different rice materials.
[0086] The results are shown in Figure 4. Figure 4E shows that the near-isogenic line NIL has more effective tillers than Koshihikari in dryland. Figures 4D and 4F show that NIL has a higher yield per plant than Koshihikari. This indicates that introducing the OsNPF7.2 gene from indica rice into japonica rice can produce drought-resistant japonica rice varieties.
[0087] It is understood that the above embodiments only illustrate preferred embodiments of the present invention, and their descriptions are relatively specific and detailed, but they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can freely combine the above technical features without departing from the concept of the present invention, and can also make several modifications and improvements, all of which fall within the protection scope of the present invention. Therefore, all equivalent transformations and modifications made with respect to the scope of the claims of the present invention should fall within the scope of the claims of the present invention.
Claims
1. The application of the rice OsNPF7.2 gene and its encoded protein in improving plant drought resistance breeding, characterized by, The OsNPF7.2 gene shown in SEQ ID NO:4 was overexpressed in rice to obtain OsNPF7.2 overexpressing rice material; the protein sequence encoded by the OsNPF7.2 gene is shown in SEQ ID NO:
2.
2. The application according to claim 1, characterized in that, The IR64 type OsNPF7.2 gene was introduced into japonica rice through hybridization.
3. The application according to claim 1, characterized in that, The OsNPF7.2 gene shown in SEQ ID NO:4 was knocked out in rice to obtain mutant rice.
4. The application according to claim 1 or 3, characterized in that, Application of the protein encoded by the OsNPF7.2 gene in regulating the effective tiller number and yield per plant in rice in dryland fields.
5. The application according to claim 4, characterized in that, The OsNPF7.2 overexpression rice material showed increased effective tiller number and yield per plant in dryland fields, while the mutant rice showed decreased yield per plant in dryland fields.
6. The application according to claim 1, characterized in that, The rice variety is Zhonghua 11.
7. A method for screening rice materials overexpressing the OsNPF7.2 gene, characterized in that, The following steps were used to obtain the OsNPF7.2 overexpression rice material as described in any one of claims 1-6: Construct an OsNPF7.2 overexpression vector; The constructed OsNPF7.2 overexpression vector was transformed into Agrobacterium EHA105 via heat shock transformation. Positive identification of T0 generation transgenic rice was performed using PCR amplification, and rice materials overexpressing OsNPF7.2 were screened out.
8. The method for screening rice materials overexpressing the OsNPF7.2 gene according to claim 7, characterized in that, The positive identification of T0 generation transgenic rice using PCR amplification includes: Genomic DNA was extracted from T0 generation transgenic rice, and PCR amplification was performed using primer pairs NPTII-F and NPTII-R to identify positive transgenic plants. The expression level of OsNPF7.2 in positive plants was detected by real-time quantitative PCR using primers qOsNPF7.2-F and qOsNPF7.2-R. Ubiquitin 1 was used as an internal reference gene, and primers qUBQ-F and qUBQ-R were used to obtain two transgenic lines with certain differences in expression levels. The line with lower expression level was named Native-OE1, and the line with higher expression level was named Native-OE2.
9. The method for screening rice materials overexpressing the OsNPF7.2 gene according to claim 7, characterized in that, The construction of the OsNPF7.2 overexpression vector includes: An OsNPF7.2 overexpression vector containing the promoter shown in SEQ ID NO:3 and ID NO:1, as well as the OsNPF7.2 gene coding region shown in SEQ ID NO:1, was constructed.
10. A method for breeding drought-resistant rice, characterized in that, Based on the OsNPF7.2 overexpression rice material according to any one of claims 1-7, the method includes the following steps: The donor parent, indica rice IR64, was crossed with the recipient parent, japonica rice Koshihikari, to obtain a hybrid variety with the IR64 type OsNPF7.2 gene; By backcrossing the hybrid variety and the recipient parent for n generations, where n is an integer greater than zero, a near-isogenic line containing the IR64 type OsNPF7.2 gene is obtained, thus producing drought-resistant japonica rice.
Citation Information
Patent Citations
Application of AtNRT1.8 gene to strengthening resistance of crops to stress of heavy metals or salts
CN101818168A
Application of nitrate radical transporter gene OsNRT1.8 in rice breeding
CN106337055A
Application of OsNPF6.3 gene to increment of rice tiller number
CN106967730A
OsDR75 gene and application of protein of OsDR75 gene in improvement of drought resistance of rice
CN117683106A
Nucleotide sequences and polypeptides encoded thereby useful for increasing plant size and increasing the number and size of leaves
CN1860233A