NAD-capped rnas in human mitochondria and their applications in cancer diagnosis

Abstract

A method for diagnosing cancer in a subject suspected of having cancer, the method including: i) providing a test sample comprising total extracted RNA obtained from the subject; ii) quantifying expression levels of dinucleotide (NAD) -capped mtNRH1 RNAs having SEQ IDs NO: 1-4, and / or dinucleotide (NAD) -capped mtNRL1 RNAs having SEQ ID NOs: 5-10; and iii) diagnosing cancer in the subject based on the expression level of NAD-capped mtNRH1 RNAs and / or NAD-capped mtNRL1 RNAs in the test sample and test kits useful for practicing the method.

Description

NAD-capped RNAs in human mitochondria and their applications in cancer diagnosisCROSS REFERENCE OF RELATED APPLICATION

[0001] The present application claims priority to U.S. Provisional Application No. 63 / 670,163, filed on July 12, 2024. The disclosure of this priority application is incorporated herein by reference in its entirety. REFERENCE TO SEQUENCE LISTING

[0002] The Sequence Listing identified as Sequence_Listing_P26318PCT. xml; Size: 28 kilobytes; and Date of Creation: June 30, 2025, filed herewith, is hereby incorporated by reference in its entirety.

[0003] The application is supported by the Research Grants Council of Hong Kong GRF grant nos. C2009-19GF and C2003-22WF.TECHNICAL FIELD

[0004] The present disclosure generally relates to the field of molecular biology and medical diagnostics, and more specifically to methods and a kit for detecting NAD-capped RNAs in mitochondria for cancer diagnosis.BACKGROUND

[0005] Mitochondria are known as the “powerhouses of the cell” . Its main function is to produce energy through oxidative phosphorylation (OXPHOS) . During OXPHOS, the reducing power, such as NADH formed from NAD in the citric acid cycle (TCA cycle) and other biochemical reactions, is used to generate ATP.

[0006] The circular double-stranded human mitochondrial DNA has approximately 16.6 kb in size and is composed of the heavy (H) and light (L) strands. The two strands encode a few dozen RNAs and proteins that are mainly involved in the TCA cycle and OXPHOS. Its major non-coding region (NCR) contains the heavy-strand promoter (HSP) and light-strand promoter (LSP) for initiation of transcription for the two strands, respectively. In addition, LSP2 is a recently identified light strand promoter in human mitochondrial DNA, which is located within the NCR of the mitochondrial genome and has the potential to initiate transcription of all L-strand genes.

[0007] The RNA polymerase in mitochondria is responsible for transcribing the genome-length polycistronic transcripts from the aforementioned promoters. The transcripts are then processed to form mature RNAs. In addition, short RNA transcripts are produced from LSP by the polymerase and are used as RNA primers to initiate mtDNA replication. Expression (transcription) and replication of mtDNA needs to be coordinated for normal function of mitochondria and cells.

[0008] Eukaryotic mRNAs typically contain a methyl-guanosine cap (the m7G cap) . The cap is formed on a nascent transcript and plays a critical role in almost all steps of gene expression. Recently, some RNAs in both prokaryotes and eukaryotes have been found to have a non-canonical cap, such as the nicotinamide adenine dinucleotide (NAD) cap. These NAD-capped RNAs (NAD-RNAs) may influence RNA stability and function, and their dysregulation is potentially linked to disease states involving mitochondrial dysfunction.

[0009] There is thus a need to identify NAD-capped RNAs in mitochondria and explore their potential applications in cancer diagnosis.SUMMARY

[0010] The methods and kits described herein rely on the discovery that two NAD-capped RNAs from the mitochondrial genome, herein termed mtNRH1 and mtNRL1, show significantly higher expression in cancer samples relative to corresponding normal samples. The NAD-capped RNAs refers to RNA molecules that bear a 5’ cap of NAD which is a non-canonical cap incorporated by RNA polymerases during transcription initiation.

[0011] In certain embodiments, the representative NAD-capped mtNRH1 sequences (5’ to 3’) comprise:

[0012]

[0013]

[0014]

[0015]

[0016] The representative NAD-capped mtNRL1 sequences (5’ to 3’) comprise:

[0017]

[0018]

[0019]

[0020]

[0021]

[0022]

[0023] SEQ ID NOs: 1-4 and SEQ ID NOs: 5-10 correspond to variants or isoforms of mtNRH1 and mtNRL1, respectively.

[0024] In a first aspect, provide herein is a method for diagnosing cancer in a subject suspected of having cancer, the method comprising: i) providing a test sample comprising total extracted RNA obtained from the subject; ii) quantifying expression levels of nicotinamide adenine dinucleotide (NAD) -capped  mtNRH1 RNAs having SEQ IDs NO: 1-4, and / or nicotinamide adenine dinucleotide (NAD) -capped mtNRL1 RNAs having SEQ ID NOs: 5-10; and iii) diagnosing cancer in the subject based on the expression level of NAD-capped  mtNRH1 RNAs and / or NAD-capped mtNRL1 RNAs in the test sample.

[0025] In certain embodiments, the test sample is derived from or comprises a tissue, a cell, a body fluid, or a biopsy obtained from the subject.

[0026] In certain embodiments, the cell is derived from a primary cell, a cultured cell, or an engineered cell.

[0027] In certain embodiments, the expression levels of NAD-capped mtNRH1 RNAs and / or NAD-capped mtNRL1 RNAs are quantified by reverse transcription quantitative PCR (RT-qPCR) or nucleic acid hybridization method.

[0028] In certain embodiments, the primers for amplifying NAD-capped mtNRL1 RNAs comprise the sequences: mtNRL1_F: 5’-GATAAAATTTGAAATCTGGTTAGGC-3’ (SEQ ID NO: 11) and mtNRL1_R: 5’-TTCTGGCCACAGCACTTAAAC-3’ (SEQ ID NO: 12) , and the primers for amplifying NAD-capped mtNRH1 RNAs comprise the sequences: mtNRH1_F: 5’-AGACACCCCCCACAGTTTATG-3’ (SEQ ID NO: 13) and mtNRH1_R: 5’-GTGATGTGAGCCCGTCTAAAC-3’ (SEQ ID NO: 14) . In certain embodiments, the primers can comprise any other sequences as long as they specifically bind to the conserved sequences of SEQ ID NOs: 1-4 and / or SEQ ID NOs: 5-10, respectively. In certain embodiments, the probes for nucleic acid hybridization are derived from SEQ ID NOs: 1-4 and / or 5-10 and specifically hybridize to these sequences.

[0029] In certain embodiments, an increased expression level of NAD-capped mtNRH1 RNAs and / or NAD-capped mtNRL1 RNAs in the test sample relative to a corresponding reference value indicates the subject has cancer.

[0030] In certain embodiments, the cancer is diagnosed when the expression level of NAD-capped mtNRH1 RNAs and / or NAD-capped mtNRL1 RNAs are at least 2-fold higher in the test sample relative to a corresponding reference value.

[0031] In certain embodiments, the cancer is lung cancer or breast cancer.

[0032] In certain embodiments, the lung cancer is non-small cell lung cancer (NSCLC) or small cell lung cancer (SCLC) .

[0033] In certain embodiments, the method further comprises after providing the test sample: biotinylating NAD-capped RNAs in the sample thereby forming biotinylated NAD-capped RNAs; and purifying the biotinylated NAD-capped RNAs using streptavidin beads thereby forming purified biotinylated NAD-capped RNAs.

[0034] In certain embodiments, biotinylating the NAD-capped RNAs comprises contacting the test sample with adenosine diphosphate ribosyl-cyclase and HO (CH2) mN3 thereby forming azido conjugated RNAs, wherein m is a whole number selected from 2-12; and contacting the azido conjugated RNAs with a biotinylated alkyne thereby forming biotinylated NAD-capped RNAs.

[0035] In certain embodiments, the biotinylated alkyne has Formula 1: wherein: X is -O-or -NH-; A is a linker; and R1 is selected from the group consisting of:

[0036] In certain embodiments, the linker is *- (C=O) (CH2) nNH (C=O) (CH2) p (OCH2CH2O) q (CH2) r-**, wherein n is a whole number selected from 1-8; p is a whole number selected from 1-8; q is a whole number selected from 1-20; r is a whole number selected from 2-10; *represents the site of attachment of R1 and **represents the site of attachment of X.

[0037] In certain embodiments, m is 3 and the biotinylated alkyne is:

[0038] In certain embodiments, the sample comprises the purified biotinylated NAD-capped RNAs is spiked with a known amount of Escherichia coli RNA containing NAD-capped RNA as an internal control for normalization.

[0039] In a second aspect, provided herein is a kit for diagnosing cancer in a subject suspected of having cancer through the detecting NAD-capped RNAs in mitochondria, comprising: i) reagents for biotinylating NAD-capped RNAs; ii) streptavidin beads for purifying biotinylated NAD-capped RNAs; iii) primers for amplifying NAD-capped mtNRH1 RNAs that are represented by SEQ ID  NO: 1-4 and / or mtNRL1 RNAs that are represented by SEQ ID NO: 5-10, and / or probes for detecting SEQ ID NOs: 1-4 and / or 5-10; and iv) optionally Escherichia coli RNA containing NAD-capped acpP RNA for  normalization.

[0040] In certain embodiments, the kit comprises reverse transcriptase and PCR reagents.

[0041] In certain embodiments, the reagents for biotinylating NAD-capped RNAs comprise reagents for SPAAC-based or CuAAC-based reactions.

[0042] In certain embodiments, the reagents for biotinylating NAD-capped RNAs comprise: HO (CH2) mN3, wherein m is a whole number selected from 2-12 and a biotinylated alkyne having Formula 1: wherein: X is -O-or -NH-; A is *- (C=O) (CH2) nNH (C=O) (CH2) p (OCH2CH2O) q (CH2) r-**, wherein n is a whole  number selected from 1-8; p is a whole number selected from 1-8; q is a whole number selected from 1-20; r is a whole number selected from 2-10; *represents the site of attachment of R1 and **represents the site of attachment of X; and R1 is selected from the group consisting of:

[0043] In certain embodiments, the cancer is lung cancer or breast cancer.

[0044] In certain embodiments, the primers for amplifying NAD-capped mtNRL1 comprise the sequences: mtNRL1_F: 5’-GATAAAATTTGAAATCTGGTTAGGC-3’ (SEQ ID NO: 11) and mtNRL1_R: 5’-TTCTGGCCACAGCACTTAAAC-3’ (SEQ ID NO: 12) .

[0045] In certain embodiments, the primers for amplifying NAD-capped mtNRH1 RNAs comprise the sequences: mtNRH1_F: 5’-AGACACCCCCCACAGTTTATG-3’ (SEQ ID NO: 13) and mtNRH1_R: 5’-GTGATGTGAGCCCGTCTAAAC-3’ (SEQ ID NO: 14) .

[0046] In a third aspect, provided herein is use of agents that specifically bind to NAD-capped mtNRH1 RNAs that are represented by SEQ ID NO: 1-4 and / or NAD-capped mtNRL1 RNAs that are represented by SEQ ID NO: 5-10 in the manufacture of a kit for diagnosing cancer in a subject suspected of having cancer.

[0047] In certain embodiments, the NAD-capped mtNRH1 RNAs and / or NAD-capped mtNRL1 RNAs are captured by: i) biotinylating NAD-capped RNAs in a test sample comprising extracted total RNA; and ii) purifying the biotinylated NAD-capped RNAs using streptavidin beads.

[0048] In certain embodiments, a strain-promoted azide-alkyne cycloaddition (SPAAC) -based or a copper-catalyzed azide-alkyne cycloaddition (CuAAC) -based reaction are performed to biotinylate the NAD-capped RNAs.

[0049] In certain embodiments, the agents are primers that specifically amplify SEQ ID NOs: 1-4 and / or 5-10, or nucleotide probes that specifically bind to SEQ ID NO: 1-4 and / or 5-10.

[0050] In certain embodiments, the cancer is lung cancer or breast cancer.

[0051] In certain embodiments, the lung cancer is non-small cell lung cancer (NSCLC) and small cell lung cancer (SCLC) .BRIEF DESCRIPTION OF THE DRAWINGS

[0052] Figure 1: Schematic diagram of the CuAAC-NAD reaction. ADPRC catalyzes the reaction replacing the nicotinamide moiety of NAD+ with 4-Pentyn-1-ol, followed by CuAACbased biotinylation with biotin-PEG3-azide.

[0053] Figure 2: Schematic diagram of the SPAAC-NAD reaction. ADPRC catalyzes the reaction replacing the nicotinamide moiety of NAD+ with 3-azido-1-propanol, followed by SPAAC-based biotinylation with biotin-PEG4-DBCO.

[0054] Figure 3: RT-qPCR analysis of mtNRH1 and mtNRL1 expression levels between normal cell (HEK293T) and cancer cell (NCI-H2087) .

[0055] Figure 4: RT-qPCR analysis of mtNRH1 and mtNRL1 expression levels between breast cancer tissue and adjacent normal tissue.DETAILED DESCRIPTION

[0056] It should be appreciated that this disclosure is not limited to the particular embodiments described herein as well as the experimental conditions described, as such may vary. It is also to be understood that the terminology used herein is for the purpose of describing certain embodiments only and is not intended to be limiting.

[0057] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any compositions, methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention.

[0058] The use of the terms “a, ” “an, ” “the, ” and similar referents in the context of describing the presently claimed invention (especially in the context of the claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context.

[0059] Use of the term “about” is intended to describe values either above or below the stated value in a range of approx. + / -10%; in other embodiments the values may range in value either above or below the stated value in a range of approx. + / -5%; in other embodiments the values may range in value either above or below the stated value in a range of approx. + / -2%; in other embodiments the values may range in value either above or below the stated value in a range of approx. + / -1%.

[0060] Nicotinamide adenine diphosphate (NAD) is a novel messenger RNA 5’ cap in Escherichia coli, yeast, mammals, and plants. Transcriptome-wide identification of NAD-capped RNAs (NAD-RNAs) was accomplished through NAD captureSeq or other methods such as NAD tagSeq, which combines chemoenzymatic RNA enrichment with high-throughput sequencing or Nanopore direct RNA sequencing. In particular, the methodology of NAD captureSeq includes an enzymatic reaction followed by click chemistry to specifically biotinylate NAD-RNAs for subsequent purification. First, adenosine diphosphate-ribosylcyclase (ADPRC) catalyzes a transglycosylation reaction of NAD+ to replace the nicotinamide moiety with an alkynyl alcohol. Then alkyne product is further modified by click chemistry-mediated biotinylation.

[0061] Typically, CuAAC-NAD reaction and SPAAC-NAD reaction including an enzymatic reaction followed by click chemistry can specifically biotinylate NAD-RNAs for subsequent purification. For CuAAC, adenosine diphosphate-ribosylcyclase (ADPRC) catalyzes a transglycosylation reaction of NAD to replace the nicotinamide moiety with an alkynyl alcohol. The alkyne product is further modified by click chemistry-mediated biotinylation through a copper-catalyzed azide-alkyne cycloaddition (CuAAC) reaction. Finally, the biotinylated NAD-RNAs can be captured using streptavidin beads and subjected to high-throughput sequencing. Figure 1 shows a schematic diagram of the CuAAC-NAD reaction.

[0062] The strain-promoted azide–alkyne cycloaddition (SPAAC) reaction is an alternative approach for click chemistry that does not require a Cu2+ catalyst. ADPRC can catalyze the replacement of nicotinamide by various nucleophiles through transglycosylation, providing the possibility of formation of azide-functionalized NAD+. The SPAAC reaction would subsequently label this azide-functionalized NAD+ using cyclooctyne linked to a biotin group. Figure 2 shows schematic illustration of the SPAAC reaction to profile NAD-capped RNAs.

[0063] The detailed description for both SPAAC-NAD and CuAAC-NAD processes are described in e.g., H. Hu, et al., SPAAC-NAD-seq, a sensitive and accurate method to profile NAD-capped transcripts, Proc. Natl. Acad. Sci. U.S.A. + 118 (13) e2025595118, https:  / / doi. org / 10.1073 / pnas. 2025595118 (2021) . The disclosures of this article are incorporated herein by reference in their entirety.

[0064] Provide herein is a method for diagnosing cancer in a subject suspected of having cancer, the method comprising: i) providing a test sample comprising total extracted RNA obtained from the subject; ii) quantifying expression levels of nicotinamide adenine dinucleotide (NAD) -capped  mtNRH1 RNAs having or represented by SEQ IDs NO: 1-4, and / or nicotinamide adenine dinucleotide (NAD) -capped mtNRL1 RNAs having or represented by SEQ ID NOs: 5-10; and iii) diagnosing cancer in the subject based on the expression level of NAD-capped  mtNRH1 RNAs and / or NAD-capped mtNRL1 RNAs in the test sample.

[0065] The method provides a novel approach for diagnosing cancer in a subject suspected of having cancer by using the unique properties of NAD-capped mitochondrial RNAs as potential biomarkers. The term diagnosing cancer refers to the identification of cancer in a subject, particularly malignancies such as lung cancer (including non-small cell lung cancer (NSCLC) and small cell lung cancer (SCLC) ) and breast cancer, through the detection of elevated expression levels of specific NAD-capped RNAs, herein namely mtNRH1 and mtNRL1, in a test sample compared to a corresponding reference value. The reference value represents the baseline expression levels of NAD-capped mtNRH1 and / or mtNRL1 RNAs in biological samples from healthy individuals or noncancerous tissue from the same subject. This value, determined through methods such as qPCR, is quantified, normalized and analyzed to establish a typical range or threshold (e.g., mean ± standard deviation) . This reference value serves as a comparator to identify significantly elevated expression levels in a test sample, enabling cancer diagnosis when NAD-capped mtNRH1 and / or mtNRL1 RNA levels exceed the reference value.

[0066] A subject suspected of having cancer is a human or other mammalian animals presenting clinical signs, symptoms, or preliminary diagnostic evidence-such as abnormal imaging, palpable lumps, unexplained weight loss, or genetic risk factors. The test sample can be a biological specimen obtained from this subject, which may include tissue (e.g., tumor tissue) , cells (e.g., primary cells isolated directly from the subject, cultured cells maintained in vitro, or engineered cells modified for research or therapeutic purposes) , body fluids (e.g., blood, plasma, serum, saliva, urine, or cerebrospinal fluid) , or a biopsy (e.g., fine-needle aspirate or core biopsy) .

[0067] In certain embodiments, the test sample to be analyzed already comprises total extracted RNA including all RNA molecules, namely, messenger RNA (mRNA) , ribosomal RNA (rRNA) , transfer RNA (tRNA) , and mitochondrial RNA. In certain embodiments, the test sample is extracted from a subject suspected of having cancer. This can be achieved using any method capable of extracting intact RNAs to ensure the integrity of NAD-capped RNAs for downstream analysis. For example, extraction may be performed using TRIzol reagent, a monophasic solution of phenol and guanidine isothiocyanate that disrupts cells and solubilizes RNA, followed by phase separation and precipitation. Other suitable methods include acid phenol / chloroform extraction, which separates RNA from DNA and proteins, or column-based purification techniques, such as silica-based spin columns, which bind RNA selectively for high-purity isolation.

[0068] The method then involves quantifying expression levels of NAD-capped mtNRH1 RNAs and NAD-capped mtNRL1 RNAs, which having or represented by SEQ ID NOs: 1-4 for mtNRH1 and / or SEQ ID NOs: 5-10 for mtNRL1. These sequences correspond to variants or isoforms of mtNRH1 and mtNRL1. Without being bound by any theory, it is hypothesized that mtNRH1 and mtNRL1 are upregulated in cancer cells due to altered mitochondrial metabolism or gene expression. In certain embodiments, quantification is achieved using reverse transcription quantitative PCR (RT-qPCR) , where the purified RNA is reverse-transcribed into cDNA using a reverse transcriptase enzyme and primers, followed by amplification with gene-specific primers binding to the conserved sequences of SEQ ID NOs: 1-4 and 5-10, respectively. In certain embodiments, the primers for amplifying NAD-capped mtNRL1 RNAs comprise the sequences: mtNRL1_F: 5’-GATAAAATTTGAAATCTGGTTAGGC-3’ (SEQ ID NO: 11) and mtNRL1_R: 5’-TTCTGGCCACAGCACTTAAAC-3’ (SEQ ID NO: 12) , and the primers for amplifying NAD-capped mtNRH1 RNAs comprise the sequences: mtNRH1_F: 5’-AGACACCCCCCACAGTTTATG-3’ (SEQ ID NO: 13) and mtNRH1_R: 5’-GTGATGTGAGCCCGTCTAAAC-3’ (SEQ ID NO: 14) . It should be understood that other primers are also suitable for the method as long as they can specifically bind to SEQ ID Nos: 1-10.

[0069] Alternatively, a DNA hybridization method, such as microarray analysis or Northern blotting, may be used, where labeled probes complementary to these sequences detect and measure RNA abundance. Expression levels are usually normalized to an internal control, such as a spiked Escherichia coli RNA containing NAD-capped RNA (e.g., acpP RNA) , to account for technical variability, and reported as relative quantities or fold changes.

[0070] In certain embodiments, the method comprises after providing the test sample: biotinylating NAD-capped RNAs in the sample thereby forming biotinylated NAD-capped RNAs; and purifying the biotinylated NAD-capped RNAs using streptavidin beads thereby forming purified biotinylated NAD-capped RNAs. In certain embodiments, biotinylating the NAD-capped RNAs comprises contacting the test sample and / or a control sample with adenosine diphosphate ribosyl-cyclase and HO (CH2) mN3 thereby forming azido conjugated RNAs, wherein m is a whole number selected from 2-12; and contacting the azido conjugated RNAs with a biotinylated alkyne thereby forming biotinylated NAD-capped RNAs.

[0071] In certain embodiments, the biotinylated alkyne has Formula 1: wherein: X is -O-or -NH-; A is a linker; and R1 is selected from the group consisting of:

[0072] In certain embodiments, the linker is *- (C=O) (CH2) nNH (C=O) (CH2) p (OCH2CH2O) q (CH2) r-**, wherein n is a whole number selected from 1-8; p is a whole number selected from 1-8; q is a whole number selected from 1-20; r is a whole number selected from 2-10; *represents the site of attachment of R1 and **represents the site of attachment of X.

[0073] In certain embodiments, m is 3 and the biotinylated alkyne is:

[0074] In certain embodiments, the purified biotinylated NAD-capped RNAs is spiked with a known amount of Escherichia coli RNA containing NAD-capped RNA as an internal control for normalization.

[0075] Finally, cancer can be diagnosed in the subject when an increased expression level of NAD-capped mtNRH1 RNAs and / or NAD-capped mtNRL1 RNAs is detected in the test sample relative to a corresponding reference value.

[0076] An increased expression level is a statistically significant elevation in NAD-capped RNA abundance in the test sample compared to a corresponding reference value which is a value established in normal subjects or an intra-subject control value derived from noncancerous tissue or sample from the same subject. For example, the expression levels of NAD-capped mtNRH1 RNAs and / or NAD-capped mtNRL1 RNAs in the test sample are at least 2-fold such as 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5 and 15-fold higher than the corresponding reference value. In certain embodiments, the expression levels of NAD-capped mtNRH1 RNAs and / or NAD-capped mtNRL1 RNAs in the test sample are about 2 to 33-fold higher, such as 2 to 32, 2 to 30, 2 to 25, 2 to 20, 2 to 15, 2 to 10, or 2 to 5-fold higher than the corresponding reference value. In certain embodiments, the expression levels of NAD-capped mtNRH1 RNAs and / or NAD-capped mtNRL1 RNAs are about 3 to 30-fold higher, for example, 3 to 25, 3 to 20, 3 to 15, or 3 to 10-fold higher than the corresponding reference value. In yet another embodiment, the expression levels of NAD-capped mtNRH1 RNAs and / or NAD-capped mtNRL1 RNAs are about 5 to 25, such as 5 to 20, 5 to 15, or 5 to 10-fold higher than the corresponding reference value.

[0077] In a second aspect, provided herein is a kit for diagnosing cancer in a subject suspected of having cancer by detecting NAD-capped RNAs in mitochondria. The kit is designed to facilitate the identification of NAD-capped mitochondrial RNAs, specifically mtNRH1 and mtNRL1, as biomarkers for cancer. The kit comprises reagents for biotinylating NAD-capped RNAs, through e.g., SPAAC-based or CuAAC-based biotinylating reactions for downstream purification and analysis. For the SPAAC-based approach, reagents include an azide-containing nucleophile, such as 3-azido-1-propanol, and a cyclooctyne-linked biotin compound, such as biotin-PEG4-DBCO, to perform a copper-free strain-promoted azide-alkyne cycloaddition reaction. For the CuAAC-based approach, reagents include an alkynyl alcohol, such as 4-pentyn-1-ol, and a biotin-azide compound, along with copper ions (Cu2+) to catalyze the copper-catalyzed azide-alkyne cycloaddition reaction, attaching biotin to NAD-capped RNAs.

[0078] In certain embodiments, biotinylating the NAD-capped RNAs comprises contacting the test sample and control sample with adenosine diphosphate ribosyl-cyclase and HO (CH2) mN3 thereby forming azido conjugated RNAs, wherein m is a whole number selected from 2-12; and contacting the azido conjugated RNAs with a biotinylated alkyne thereby forming biotinylated NAD-capped RNAs.

[0079] In certain embodiments, the biotinylated alkyne has Formula 1: wherein: X is -O-or -NH-; A is a linker; and R1 is selected from the group consisting of:

[0080] In certain embodiments, the linker is *- (C=O) (CH2) nNH (C=O) (CH2) p (OCH2CH2O) q (CH2) r-**, wherein n is a whole number selected from 1-8; p is a whole number selected from 1-8; q is a whole number selected from 1-20; r is a whole number selected from 2-10; *represents the site of attachment of R1 and **represents the site of attachment of X.

[0081] In certain embodiments, m is 3 and the biotinylated alkyne is:

[0082] In certain embodiments, the kit comprises streptavidin beads for purifying biotinylated NAD-capped RNAs. These beads, which may be magnetic or agarose-based, capture biotinylated RNAs, allowing removal of unbound RNAs and contaminants through washing, followed by elution of purified NAD-capped RNAs. In certain embodiments, the kit contains primers for amplifying NAD-capped mtNRH1 RNAs, represented by SEQ ID NOs: 1-4, and / or NAD-capped mtNRL1 RNAs, represented by SEQ ID NOs: 5-10, and / or probes for detecting SEQ ID NOs: 1-4 and / or 5-10, respectively. Optionally, the kit includes Escherichia coli RNA containing NAD-capped acpP RNA for normalization.

[0083] In certain embodiments, the kit further comprises reverse transcriptase, PCR reagents, and a protocol for performing biotinylating the RNAs, through e.g., SPAAC-based or CuAAC-based reactions. The reverse transcriptase, an enzyme such as Moloney Murine Leukemia Virus (M-MLV) or Avian Myeloblastosis Virus (AMV) reverse transcriptase, converts purified NAD-capped RNAs into complementary DNA (cDNA) for amplification. PCR reagents include essential components, such as a thermostable DNA polymerase (e.g., Taq polymerase) , deoxynucleotide triphosphates (dNTPs) , magnesium chloride, and buffers optimized for polymerase chain reaction. The protocol provides step-by-step instructions for a skilled person to conduct the reactions, including enzymatic transglycosylation with adenosine diphosphate-ribosylcyclase (ADPRC) to modify the NAD cap, followed by either SPAAC or CuAAC reactions to biotinylate the RNAs. It also outlines purification with streptavidin beads, cDNA synthesis, and quantification methods.

[0084] Following biotinylation, the step of purifying the biotinylated NAD-capped RNAs using streptavidin beads isolates the NAD-RNAs from the reaction mixture. Streptavidin beads are solid-phase supports, such as magnetic or agarose beads, coated with streptavidin which has an exceptionally high affinity for biotin. In certain embodiments, the biotinylated NAD-capped RNAs are incubated with streptavidin-coated beads, allowing specific binding, while unbound RNAs and contaminants are removed through washing steps (e.g., with buffers containing urea, Tris·HCl, and Triton X-100, followed by DEPC-treated water) . The bound RNAs are then eluted, for example, by heating (e.g., 80 ℃ for 5 minutes) or using a chemical disruption agent, to release purified NAD-capped RNAs for downstream analysis.

[0085] In certain embodiments, the kit is for diagnosing lung cancer or breast cancer. Lung cancer and breast cancer are significant malignancies where mitochondrial dysfunction and altered RNA expression, particularly of NAD-capped RNAs, may reflect oncogenic processes or metabolic shifts. The kit’s components, including primers or probes targeting NAD-capped mtNRH1 and mtNRL1 RNAs, are designed to detect elevated expression levels in test samples from subjects suspected of having these cancers, compared to a corresponding reference value.

[0086] In certain embodiments, the kit is further specified for lung cancer, which includes non-small cell lung cancer (NSCLC) and small cell lung cancer (SCLC) . NSCLC, encompassing subtypes like adenocarcinoma, squamous cell carcinoma, and large cell carcinoma, and SCLC, a more aggressive neuroendocrine tumor, represent the primary forms of lung cancer. The kit’s reagents and primers or probes are optimized to detect NAD-capped mitochondrial RNAs in samples from subjects suspected of having these lung cancer subtypes.

[0087] In certain embodiments, the kit comprises primers shown in SEQ ID NOs: 11-12 for amplifying NAD-capped mtNRL1 RNAs. In certain embodiments, the kit further comprises primers shown in SEQ ID NOs: 13-14 for amplifying NAD-capped mtNRH1 RNAs. These primers are designed to specifically bind to the conserved sequences of SEQ ID Nos: 1-4 and 5-10, respectively. It should be understood other primers can be easily designed to bind to the conserved sequences of the RNAs given their high similarity to each other.

[0088] Provided herein is the use of agents that specifically bind to NAD-capped mtNRH1 RNAs, having or represented by SEQ ID NO: 1-4, and / or NAD-capped mtNRL1 RNAs, having or represented by SEQ ID NO: 5-10, in the manufacture of a kit for diagnosing cancer in a subject suspected of having cancer.

[0089] In certain embodiments, the NAD-capped mtNRH1 RNAs and / or NAD-capped mtNRL1 RNAs are provided or extracted through a process described herein to ensure their specific isolation and detection. For example, extracted total RNA from a subject can be provided in a test sample or the total RNA is extracted from a test sample obtained from the subject suspected of having cancer. The test sample may be derived from tissue (e.g., tumor tissue) , cells (e.g., primary, cultured, or engineered cells) , body fluids (e.g., blood, plasma, serum, saliva, urine, or cerebrospinal fluid) , or a biopsy (e.g., fine-needle aspirate or core biopsy) . In certain embodiment, a control sample from the subject is also adopted, which provides a direct comparison between the levels of detected NAD-capped RNAs. The control sample can be obtained from normal tissue, cells, or body fluid of the same subject or a healthy individual. Next, biotinylating the NAD-capped RNAs with methods described herein. For example, a strain-promoted azide-alkyne cycloaddition (SPAAC) -based or copper-catalyzed azide-alkyne cycloaddition (CuAAC) -based reaction is performed to biotinylate NAD-capped RNAs in the extracted RNAs. Finally, the biotinylated NAD-capped RNAs are purified using streptavidin beads.

[0090] In certain embodiments, the agents are primers that specifically bind to the conserved sequences of SEQ ID NOs: 1-4 and / or 5-10 or nucleotide probes that specifically bind to SEQ ID NO: 1-4 and / or 5-10. Alternatively, the agents may be nucleotide probes, such as DNA or RNA oligonucleotides, designed to hybridize specifically to SEQ ID NOs: 1-4 and / or 5-10 under stringent conditions, facilitating detection via methods like Northern blotting or microarrays.

[0091] In certain embodiments, the cancer is lung cancer or breast cancer. Lung cancer encompasses a range of subtypes, while breast cancer includes diverse forms, such as ductal or lobular carcinoma.

[0092] In certain embodiments, the lung cancer includes non-small cell lung cancer (NSCLC) and small cell lung cancer (SCLC) . NSCLC, which comprises subtypes such as adenocarcinoma, squamous cell carcinoma, and large cell carcinoma, represents the majority of lung cancer cases, while SCLC is a more aggressive neuroendocrine tumor. The agents in the kit, such as primers or probes targeting NAD-capped mtNRH1 and mtNRL1 RNAs.

[0093] Examples

[0094] Methods for profiling NAD-RNAs in cells

[0095] Total RNA was extracted from human cell lines NCI-H2087 and HEK-293T using TRIzol reagent (Invitrogen, Cat. No. 15596026) following the manufacturer’s instruction. Then NAD-RNA enrichment via SPAAC click chemistry was carried out as follows: Extracted RNA was incubated with 8.5 μM adenosine diphosphate ribosyl-cyclase (ADPRC) (Sigma, Cat. No. A9106) and 15 μL 3-azido-1-propanol (Sigma, Cat. No. 776130) in a 150 μL reaction (50 mM Na-HEPES, pH 7.0, 5 mM MgCl2) at 37℃ for 30 min. A reaction without ADPRC treatment was conducted in parallel. Reactions were stopped by acid phenol / chloroform extraction (Invitrogen, Cat. No. AM9722) , followed by ethanol precipitation. RNA was then biotinylated via incubation with 1 mM biotin-PEG4-DBCO (Click Chemistry Tools, Cat. No. A105) in 30 μL PBS (pH 7.4) at 37℃ for 1 h, followed by ethanol precipitation.

[0096] Streptavidin-based purification of biotinylated NAD-RNAs Biotinylated RNA was captured using 400 μg MyOne streptavidin T1 beads (Invitrogen, Cat. No. 65601) in 200 μL immobilization buffer (50 mM Tris-Cl, pH 7.5, 500 mM NaCl, 5 mM EDTA) at 37℃ for 15 min. The biotinylated RNA bound beads were washed 6× with urea / SDS buffer (50 mM Tris-Cl, pH 7.5, 8M urea, 10 mM EDTA, 0.5%SDS) . Biotinylated RNA was eluted in 80 μL formamide-based elution buffer (50 mM Tris-Cl, pH 7.5, 47.5%formamide, 10 mM EDTA, 2 mM biotin) at 65℃ for 2.5 min, then ethanol-precipitated with 300 mM NaOAc (pH 5.3) and 50 μg linear acrylamide (Invitrogen, Cat. No. AM9520) . Purified RNA was further cleaned using a Zymo RNA Clean Kit (Cat. No. R1016) and eluted in 9.3 μL H2O.

[0097] 3’A daptor ligation and NudC treatment

[0098] RNA was ligated to a 3’ adaptor (rApp / CNNNNNAGATCGGAAGAGCACACGTCTG / 3SpC; IDT) (SEQ ID NO: 15) in a 20 μL reaction (20%PEG8000, 50 mM Tris-HCl, pH 7.5, 10 mM MgCl2, 1 mM DTT, 1 mM ATP, 1 U / μL T4 RNA Ligase 2, truncated K227Q (NEB, Cat. No. M0351) at 25℃ for 4 h. The diphosphate bond was hydrolyzed using 0.58 μM NudC (6xHis tagged recombinant expression and purified from E. coli) in reaction containing 10 mM Tris-HCl, pH 8.0, 100 mM KCl, 2 mM MgCl2, 1 mM MnCl2, 2 mM DTT, 1 U / μL RNase inhibitor (NEB, Cat. No. M0314) at 37℃ for 20 min, followed by Zymo RNA Clean Kit (Cat no. R1016) purification.

[0099] Ligation of 5’ adaptor, reverse transcription and library preparation

[0100] A 5’ adaptor was ligated under the following condition: 20 μL ligation reaction containing the RNA, 3.3 μM 5’-Adaptor (rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCrGrArCrGrArUrC, IDT) (SEQ ID NO: 16) , 15%PEG8000, 50 mM Tris-HCl, pH 7.5, 10 mM MgCl2, 1 mM DTT, 1 mM ATP, and 1 U μL-1 of T4 RNA ligase 1 (NEB, cat no. M0204) was incubated at 25 ℃ for 4 h. The 3’ and 5’ ligated NAD-RNAs were mixed with 200 pmol RT primer (GAGTTCAGACGTGTGCTCTTCCGATCT) (SEQ ID NO: 17) . The mixture was incubated at 70 ℃ for 5 min and chilled on ice. Reverse transcription was performed using 200 pmol RT primer (GAGTTCAGACGTGTGCTCTTCCGATCT) (SEQ ID NO: 18) and 200 U Maxima Reverse Transcriptase (Invitrogen, Cat. No. EP0752) in 40 μL reaction buffer (50 mM Tris-Cl, pH 8.3, 75 mM KCl, 3 mM MgCl2, 10 mM DTT, 1 mM dNTPs, 1 U / μL RNase inhibitor) at 50℃ for 60 min. cDNA was amplified via 12-13 cycles of PCR using Q5 DNA polymerase (NEB, Cat. No. M0491) with primers: Forward: ACACGTTCAGAGTTCTACAGTCCGACG (SEQ ID NO: 19) Reverse: GAGTTCAGACGTGTGCTCTTCCGATCT (SEQ ID NO: 20)

[0101] Sequencing and data analysis

[0102] Libraries were sequenced on an Illumina HiSeq2000 platform, generating 150 bp paired-end reads (Novogene) . The raw sequencing reads underwent quality control using fastp v0.22.0, which involved trimming low-quality bases, removing adapter sequences, and filtering out reads below a specified quality threshold. After preprocessing, the cleaned reads were aligned to the human genome (hg38) using HISAT2, which effectively handles spliced alignments, particularly across exon-exon junctions, thanks to its graph-based approach. The differential expression levels of RNAs were visualized using the Integrative Genomics Viewer (IGV) , a tool that provides a graphical interface for examining alignment data and genomic features. These visualizations in IGV enabled the identification and examination of expression patterns that might not be captured through standard differential expression analyses typically performed by DESeq2 or similar tools.

[0103] NAD-RNA identification criteria: ≥20-fold enrichment in ADPRC-treated vs. untreated samples and >90%of reads with 5’-terminal adenosine. Two NAD-RNAs were identified from the mitochondrial genome and were named mtNRL1 and mtNRH1, respectively.

[0104] By employing pNAD-seq, we detected NAD-RNAs present in human mitochondria. Among the identified NAD-RNAs, mtNRH1 (SEQ ID NO: 1-4) and mtNRL1 (SEQ ID NO: 5-10) were found to be prominently represented.

[0105] The mtNRL1 sequences are mapped to the replication origin (oriH) in the NCR of the mitochondrial genome and these transcripts could be used as primers to initiate replication of the leading strand of mtDNA. Both mtNRL1 and mtNRH1 could potentially mediate transcription of mtDNA for expression of the mitochondrial genes.

[0106] The representative mtNRH1 sequences (5’ to 3’) :

[0107]

[0108]

[0109]

[0110]

[0111] The representative mtNRL1 sequences (5’ to 3’) :

[0112]

[0113]

[0114]

[0115]

[0116]

[0117]

[0118] To compare the expression levels of mtNRH1 and mtNRL1 between cancer cells and normal cells, RT-qPCR was performed (as shown in Fig. 3) . Total RNA was extracted from HEK293T (normal cell) and NCI-H2087 (cancer cell) cell lines, respectively. 100 μg of normal cell RNA and cancer cell RNA were spiked with 100 μg E. coli total RNA. The E. coli RNA contains NAD-capped AcpP (NAD-AcpP) RNA, serving as a control or reference for subsequent analyses. The RNA mixtures were subjected to SPAAC-based tagging, resulting in the biotinylation of NAD-RNAs. The biotinylated NAD-RNAs from each RNA sample were purified and subsequently analysed by reverse transcription quantitative PCR (RT-qPCR) using ChamQ SYBR Color qPCR Master Mix (Vazyme, Cat. No. Q411-03) on an Applied Biosystems StepOne Real-Time PCR System. Primer sequences used for determining the expression level of NAD-AcpP, comprising NAD-AcpP-FWD: GTATGAGCACTATCGAAGAACGC (SEQ ID NO: 21) and NAD-AcpP-REV: CAGCTCAACGGTGTCAAGAGAATC (SEQ ID NO: 22) .

[0119] Quantitative RT-PCR analysis revealed a significant upregulation of mitochondrial NAD-RNAs in NCI-H2087 human lung cancer cells relative to HEK293T control cells, with mtNRL1 exhibiting a 2.58-fold increase and mtNRH1 demonstrating a more pronounced 33.36-fold elevation in transcript levels (Fig. 3) .

[0120] Furthermore, similar RT-qPCR analysis of matched tumour-normal pairs from commercially sourced human breast tissues (Biochain, Cat. No. R8235086-PP-10) confirmed elevated mitochondrial NAD-RNA levels in tumor samples. Specifically, mtNRL1 expression increased 3.26-fold, while mtNRH1 showed a 2.72-fold upregulation compared to adjacent normal breast tissue (Fig. 4) .

[0121] Although the invention has been described with reference to the examples provided above, it should be understood that various modifications can be made without departing from the spirit of the invention.

Claims

1.A method for diagnosing cancer in a subject suspected of having cancer, the method comprising:i) providing a test sample comprising total extracted RNA obtained from the subject;ii) quantifying expression levels of nicotinamide adenine dinucleotide (NAD) -capped mtNRH1 RNAs having SEQ IDs NO: 1-4, and / or nicotinamide adenine dinucleotide (NAD) -capped mtNRL1 RNAs having SEQ ID NOs: 5-10; andiii) diagnosing cancer in the subject based on the expression level of NAD-capped mtNRH1 RNAs and / or NAD-capped mtNRL1 RNAs in the test sample.2.The method of claim 1, wherein the test sample is derived from or comprises a tissue, a cell, a body fluid, or a biopsy obtained from the subject.3.The method of claim 2, wherein the cell is derived from a primary cell, a cultured cell, or an engineered cell.4.The method of claim 1, wherein the expression levels of NAD-capped mtNRH1 RNAs and / or NAD-capped mtNRL1 RNAs are quantified by reverse transcription quantitative PCR (RT-qPCR) or nucleic acid hybridization method.5.The method of claim 1, wherein the primers for amplifying NAD-capped mtNRL1 RNAs comprise the sequences: mtNRL1_F: 5’-GATAAAATTTGAAATCTGGTTAGGC-3’ (SEQ ID NO: 11) and mtNRL1_R: 5’-TTCTGGCCACAGCACTTAAAC-3’ (SEQ ID NO: 12) , and the primers for amplifying NAD-capped mtNRH1 RNAs comprise the sequences: mtNRH1_F: 5’-AGACACCCCCCACAGTTTATG-3’ (SEQ ID NO: 13) and mtNRH1_R: 5’-GTGATGTGAGCCCGTCTAAAC-3’ (SEQ ID NO: 14) .6.The method of claim 1, wherein an increased expression level of NAD-capped mtNRH1 RNAs and / or NAD-capped mtNRL1 RNAs in the test sample relative to a corresponding reference value indicates the subject has cancer.7.The method of claim 1, wherein the cancer is diagnosed when the expression level of NAD-capped mtNRH1 RNAs and / or NAD-capped mtNRL1 RNAs are at least 2-fold higher in the test sample relative to a corresponding reference value.8.The method of claim 1, wherein the cancer is lung cancer or breast cancer.9.The method of claim 8, wherein the lung cancer is non-small cell lung cancer (NSCLC) or small cell lung cancer (SCLC) .10.The method of claim 1 further comprising after providing the test sample: biotinylating nicotinamide adenine dinucleotide (NAD) -capped RNAs in the sample thereby forming biotinylated NAD-capped RNAs; and purifying the biotinylated NAD-capped RNAs using streptavidin beads thereby forming purified biotinylated NAD-capped RNAs.11.The method of claim 10, wherein biotinylating the nicotinamide adenine dinucleotide (NAD) -capped RNAs comprises contacting the test sample with adenosine diphosphate ribosyl-cyclase and HO (CH2) mN3 thereby forming azido conjugated RNAs, wherein m is a whole number selected from 2-12; and contacting the azido conjugated RNAs with a biotinylated alkyne thereby forming biotinylated NAD-capped RNAs.12.The method of claim 11, wherein the biotinylated alkyne has Formula 1: wherein:X is -O-or -NH-;A is a linker; andR1 is selected from the group consisting of:13.The method of claim 12, wherein the linker is *- (C=O) (CH2) nNH (C=O) (CH2) p (OCH2CH2O) q (CH2) r-**, wherein n is a whole number selected from 1-8; p is a whole number selected from 1-8; q is a whole number selected from 1-20; r is a whole number selected from 2-10; *represents the site of attachment of R1 and **represents the site of attachment of X.14.The method of claim 12, wherein m is 3 and the biotinylated alkyne is: 15.The method of claim 10, wherein the sample comprising the purified biotinylated NAD-capped RNAs is spiked with a known amount of Escherichia coli RNA containing NAD-capped RNA as an internal control for normalization.16.A kit for diagnosing cancer in a subject suspected of having cancer through the detecting NAD-capped RNAs in mitochondria, comprising:i) reagents for biotinylating NAD-capped RNAs;ii) streptavidin beads for purifying biotinylated NAD-capped RNAs;iii) primers for amplifying NAD-capped mtNRH1 RNAs that are represented by SEQ ID NO: 1-4 and / or mtNRL1 RNAs that are represented by SEQ ID NO: 5-10, and / or probes for detecting SEQ ID NOs: 1-4 and / or 5-10; andiv) optionally Escherichia coli RNA containing NAD-capped acpP RNA for normalization.17.The kit of claim 16 further comprising reverse transcriptase and PCR reagents.18.The kit of claim 16, wherein the reagents for biotinylating NAD-capped RNAs comprise reagents for SPAAC-based or CuAAC-based reactions.19.The kit of claim 18, wherein the reagents for biotinylating NAD-capped RNAs comprise: HO (CH2) mN3, wherein m is a whole number selected from 2-12 and a biotinylated alkyne having Formula 1: wherein:X is -O-or -NH-;A is *- (C=O) (CH2) nNH (C=O) (CH2) p (OCH2CH2O) q (CH2) r-**, wherein n is a whole number selected from 1-8; p is a whole number selected from 1-8; q is a whole number selected from 1-20; r is a whole number selected from 2-10; *represents the site of attachment of R1 and **represents the site of attachment of X; andR1 is selected from the group consisting of:20.The kit of claim 16, wherein the cancer is lung cancer or breast cancer.21.The kit of claim 16, wherein the primers for amplifying NAD-capped mtNRL1 comprise the sequences: mtNRL1_F: 5’-GATAAAATTTGAAATCTGGTTAGGC-3’ (SEQ ID NO: 11) and mtNRL1_R: 5’-TTCTGGCCACAGCACTTAAAC-3’ (SEQ ID NO: 12) .22.The kit of claim 16, wherein the primers for amplifying NAD-capped mtNRH1 RNAs comprise the sequences: mtNRH1_F: 5’-AGACACCCCCCACAGTTTATG-3’ (SEQ ID NO: 13) and mtNRH1_R: 5’-GTGATGTGAGCCCGTCTAAAC-3’ (SEQ ID NO: 14) .23.Use of agents that specifically bind to NAD-capped mtNRH1 RNAs that are represented by SEQ ID NO: 1-4 and / or NAD-capped mtNRL1 RNAs that are represented by SEQ ID NO: 5-10 in the manufacture of a kit for diagnosing cancer in a subject suspected of having cancer.24.The use of claim 23, wherein the NAD-capped mtNRH1 RNAs and / or NAD-capped mtNRL1 RNAs are captured by:i) biotinylating NAD-capped RNAs in a test sample comprising extracted total RNA; andii) purifying the biotinylated NAD-capped RNAs using streptavidin beads.25.The use of claim 24, wherein a strain-promoted azide-alkyne cycloaddition (SPAAC) -based or a copper-catalyzed azide-alkyne cycloaddition (CuAAC) -based reaction are performed to biotinylate the NAD-capped RNAs.26.The use of claim 23, wherein the agents are primers that specifically amplify SEQ ID NOs: 1-4 and / or 5-10, and / or nucleotide probes that specifically bind to SEQ ID NO: 1-4 and / or 5-10.27.The use of claim 23, wherein the cancer is lung cancer or breast cancer.28.The use of claim 27, wherein the lung cancer is non-small cell lung cancer (NSCLC) and small cell lung cancer (SCLC) .

Images