Antisense oligonucleotide targeting mir-132 and pharmaceutical use thereof

Abstract

The present disclosure relates to an antisense oligonucleotide targeting miR-132 and pharmaceutical use thereof. Specifically, the present disclosure relates to an antisense oligonucleotide targeting miR-132, a pharmaceutical composition, and pharmaceutical use thereof.

Description

Antisense oligonucleotides targeting miR-132 and their medicinal applications

[0001] This disclosure claims priority to Chinese patent applications filed on July 12, 2024 (2024109332966), August 15, 2024 (2024111182238), January 6, 2025 (2025100142250), March 12, 2025 (202510286757X), and May 7, 2025 (2025105800571). Technical Field

[0002] This disclosure pertains to the field of biomedicine and specifically relates to antisense oligonucleotides targeting miR-132, pharmaceutical compositions, and their pharmaceutical uses. Background Technology

[0003] MicroRNAs (miRNAs) are a class of small non-coding RNA molecules, approximately 20-25 nucleotides in length. miRNAs play a crucial role in gene expression regulation, controlling gene expression by binding to target mRNA molecules, leading to their degradation or inhibiting their translation. miRNAs are closely associated with a variety of diseases, including cancer, cardiovascular disease, neurodegenerative diseases, and immune diseases. Abnormal miRNA expression can contribute to the occurrence and progression of diseases; therefore, miRNAs are considered potential diagnostic biomarkers and therapeutic targets.

[0004] miR-132 plays a crucial role in reversing myocardial hypertrophy and improving heart failure. Studies in mouse and porcine models have demonstrated that inhibiting miR-132 expression significantly improves heart failure associated with myocardial infarction and myocardial hypertrophy. Furthermore, research has shown that targeting miR-132 can also treat fibrosis, including fibrosis of the heart, lungs, liver, and kidneys. Additionally, miR-132 is an important target for treating lipid metabolism disorders. Therefore, this disclosure provides an antisense oligonucleotide targeting miR-132, which can effectively inhibit miR-132 expression, offering a new therapeutic option for the aforementioned diseases. Summary of the Invention

[0005] This disclosure provides a miR-132-targeting antisense oligonucleotide comprising a sequence that differs from the nucleotide sequence shown in any one of SEQ ID NO: 1 to SEQ NO: 105 by no more than 3 nucleotides (e.g., 0, 1, 2, or 3 nucleotides).

[0006] In some implementations, the antisense oligonucleotide consists of 9-25 nucleotides.

[0007] In some embodiments, the antisense oligonucleotide comprises 9-13 nucleotides (e.g., 9, 10, 11, 12, or 13), and the antisense oligonucleotide contains a sequence that differs from the nucleotide sequence shown in any one of SEQ ID NO: 1 to SEQ ID NO: 14 by no more than 1, 2, or 3 nucleotides. In some embodiments, the antisense oligonucleotide contains the nucleotide sequence shown in any one of SEQ ID NO: 1 to SEQ ID NO: 14.

[0008] In some embodiments, the antisense oligonucleotide comprises 10-14 (e.g., 10, 11, 12, 13, or 14) nucleotides, and the antisense oligonucleotide contains a sequence that differs from the nucleotide sequence shown in any one of SEQ ID NO: 15 to SEQ ID NO: 27 by no more than 1, 2, or 3 nucleotides. In some embodiments, the antisense oligonucleotide contains the nucleotide sequence shown in any one of SEQ ID NO: 15 to SEQ ID NO: 27.

[0009] In some embodiments, the antisense oligonucleotide comprises 11-15 nucleotides (e.g., 11, 12, 13, 14, or 15), and the antisense oligonucleotide contains a sequence that differs from the nucleotide sequence shown in any one of SEQ ID NO: 28 to SEQ ID NO: 39 by no more than 1, 2, or 3 nucleotides. In some embodiments, the antisense oligonucleotide contains the nucleotide sequence shown in any one of SEQ ID NO: 28 to SEQ ID NO: 39.

[0010] In some embodiments, the antisense oligonucleotide comprises 12-16 nucleotides (e.g., 12, 13, 14, 15, or 16 nucleotides), and the antisense oligonucleotide contains a sequence that differs from the nucleotide sequence shown in any one of SEQ ID NO: 40 to SEQ ID NO: 50 by no more than 1, 2, or 3 nucleotides. In some embodiments, the antisense oligonucleotide contains the nucleotide sequence shown in any one of SEQ ID NO: 40 to SEQ ID NO: 50.

[0011] In some embodiments, the antisense oligonucleotide comprises 13-17 nucleotides (e.g., 13, 14, 15, 16, or 17), and the antisense oligonucleotide contains a sequence that differs from the nucleotide sequence shown in any one of SEQ ID NO: 51 to SEQ ID NO: 60 by no more than 1, 2, or 3 nucleotides. In some embodiments, the antisense oligonucleotide contains the nucleotide sequence shown in any one of SEQ ID NO: 51 to SEQ ID NO: 60.

[0012] In some embodiments, the antisense oligonucleotide comprises 14-18 nucleotides (e.g., 14, 15, 16, 17, or 18), and the antisense oligonucleotide contains a sequence that differs from the nucleotide sequence shown in any one of SEQ ID NO: 61 to SEQ ID NO: 69 by no more than 1, 2, or 3 nucleotides. In some embodiments, the antisense oligonucleotide contains the nucleotide sequence shown in any one of SEQ ID NO: 61 to SEQ ID NO: 69.

[0013] In some embodiments, the antisense oligonucleotide comprises 15-22 nucleotides (e.g., 15, 16, 17, 18, 19, 20, 21, or 22), the antisense oligonucleotide containing a sequence that differs from the nucleotide sequence shown in any one of SEQ ID NO: 70 to SEQ ID NO: 105 by no more than 1, 2, or 3 nucleotides. In some embodiments, the antisense oligonucleotide contains the nucleotide sequence shown in any one of SEQ ID NO: 70 to SEQ ID NO: 105.

[0014] In some embodiments, the antisense oligonucleotide has an oligonucleotide sequence as shown in any one of SEQ ID NO: 1 to SEQ ID NO: 105.

[0015] In some embodiments, the antisense oligonucleotide is at least partially complementary to the sequence of miR-132 to inhibit its expression. In some embodiments, there are no more than 5, 4, 3, 2, or 1 mismatches between the antisense oligonucleotide and the target sequence. In some embodiments, the antisense oligonucleotide is completely anticomplementary to the sequence of miR-132.

[0016] In some embodiments, at least one nucleoside in the antisense oligonucleotide is a modified nucleoside. In some embodiments, all nucleosides in the antisense oligonucleotide are modified nucleosides. In the context of this disclosure, the unmodified nucleosides include ribonucleosides and deoxyribonucleosides having bases at corresponding positions in the sequence.

[0017] In some embodiments, the modified nucleoside is selected from bridging nucleosides, 2'-F-modified nucleosides, 2'-alkoxy (e.g., C1, C2, C3, C4, C5, C6 alkoxy)-modified nucleosides, 2'-heterospirocyclic (e.g., 4-membered, 5-membered, 6-membered heterospirocyclic)-modified nucleosides, 2'-O-methoxy-ethyl-modified nucleosides, or nucleosides with modified bases. In some embodiments, the bridging nucleoside is a locked nucleoside (LNA) or a restricted ethyl (cET) nucleoside. In some embodiments, the nucleoside with modified bases is a 5-methylcytosine (5mC) nucleoside.

[0018] In some embodiments, the modified nucleoside can be a nucleoside with modified base and modified sugar ring, such as 5-methylcytosine-restricted nucleoside, 5-methylcytosine-restricted ethyl nucleoside, etc.

[0019] In some embodiments, the 2'-4 to 6-membered heterospirocyclic modified nucleosides have the structure shown in formula (I):

[0020] Where Base represents the base at the corresponding position;

[0021] R A express: Where X is C, N, O, or S, n is an integer selected from 1 to 3, and R is a constant. A One or more hydrogens may optionally be substituted with C1-C6 alkyl groups (e.g., C1, C2, C3, C4, C5, or C6 alkyl groups), oxo, hydroxyl, or halogen.

[0022] In some embodiments, the nucleoside having the structure shown in formula (I) has the structure shown in formula (I-1):

[0023] Where n is an integer selected from 1 to 3.

[0024] In some embodiments, the nucleoside having the structure shown in formula (I) has the structure shown in formula (I-2), wherein one or more hydrogens on the spirotetracycle at the 2' position of the sugar ring are optionally substituted with C1-C6 alkyl (e.g., C1, C2, C3, C4, C5, or C6 alkyl), oxo, hydroxyl, or halogen.

[0025] Where Base represents the base at the corresponding position.

[0026] In some embodiments, the modified nucleoside is selected from lock nucleosides, 5-methylcytosine nucleosides, 2'-fluoro-modified nucleosides, 2'-methoxy-modified nucleosides, and nucleosides having the structure shown in formula (I).

[0027] In some embodiments, the modified nucleoside is selected from lock nucleosides, 5-methylcytosine nucleosides, 2'-fluoro-modified nucleosides, 2'-methoxy-modified nucleosides, and 2'-O-methoxy-ethyl-modified nucleosides.

[0028] In some embodiments, two adjacent nucleosides in the antisense oligonucleotide are linked by a phosphodiester group.

[0029] In some embodiments, at least one phosphodiester group in the antisense oligonucleotide is a phosphodiester group with a modifying group. The modifying group imparts increased stability to the antisense oligonucleotide in a biological sample or environment. In some embodiments, the antisense oligonucleotide comprises multiple phosphodiester groups with modifying groups. In some embodiments, all phosphodiester groups in the antisense oligonucleotide are phosphodiester groups with modifying groups.

[0030] In some embodiments, the phosphate diester group having the modifying group is a thiophosphate diester group.

[0031] In some embodiments, the antisense oligonucleotide has or comprises a sequence as shown in any one of SEQ ID NO: 106 to SEQ ID NO: 180.

[0032] In some embodiments, the antisense oligonucleotide has a sequence as shown in any one of SEQ ID NO: 106 to SEQ ID NO: 111.

[0033] In some embodiments, the antisense nucleotide further comprises one or more delivery groups linked to the antisense oligonucleotide. In the context of this disclosure, "linked" includes both covalent and non-covalent linkages. The delivery group is capable of delivering the antisense oligonucleotide of this disclosure to a site where miR-132 gene expression is present. In some embodiments, the delivery group is a delivery group capable of delivering the antisense oligonucleotide of this disclosure to cardiac tissue, such as to cardiomyocytes.

[0034] In some embodiments, the delivery group is a lipophilic group, and the one or more lipophilic groups are attached to any one or more nucleotides in the antisense oligonucleotide.

[0035] In some embodiments, the lipophilic group is linked to a base of the nucleotide. In some embodiments, the lipophilic group is linked to a sugar ring of the nucleotide. In some embodiments, the lipophilic group is linked to an internucleotide linker between two adjacent nucleosides. In some embodiments, the lipophilic group comprises a saturated or unsaturated C group. 4-30A hydrocarbon chain, and optionally a functional group selected from halogens, alkoxy groups, hydroxyl groups, amines, carboxylic acids, sulfonates, phosphates, thiols, azides, and alkynes.

[0036] In some embodiments, the lipophilic group comprises saturated or unsaturated C. 6-18 Hydrocarbon chain. In some embodiments, the lipophilic group comprises saturated or unsaturated C atoms. 16 Hydrocarbon chain.

[0037] In some embodiments, the delivery group comprises a targeting ligand that targets the liver. In some embodiments, the targeting ligand binds to the desialylate glycoprotein receptor (ASGPR). In some embodiments, the targeting ligand comprises a galactose cluster or a cluster of galactose derivatives selected from N-acetyl-galactosamine (GalNAc), N-trifluoroacetylgalactosamine, N-propionylgalactosamine, N-butyrylgalactosamine, or N-isobutyrylgalactosamine. In some embodiments, the delivery group may be a delivery group as disclosed in PCT application WO2023274395A1, the entire contents of which are incorporated herein by reference. In some specific embodiments, the delivery group has a structure as shown in formula (II):

[0038] In some embodiments, the delivery group is attached to the 3' end and / or 5' end of the antisense oligonucleotide.

[0039] On the other hand, this disclosure provides a pharmaceutical composition comprising the antisense oligonucleotide described herein and one or more pharmaceutically acceptable excipients, such as vehicles, carriers, diluents, and / or delivery polymers. Various drug delivery systems are known and can be used with the antisense oligonucleotide of this disclosure, such as encapsulation in liposomes, microparticles, microcapsules, recombinant cells capable of expressing the antisense oligonucleotide of this disclosure, receptor-mediated endocytosis, and constructing nucleic acids as part of retroviruses or other vectors.

[0040] In some embodiments, the pharmaceutical composition may further comprise pharmaceutically acceptable excipients and / or adjuvants, which may be one or more formulations or compounds conventionally used in the art. For example, the pharmaceutically acceptable excipients may include at least one of pH buffers, protectants, and osmotic pressure regulators.

[0041] In some embodiments, the unit dose of the pharmaceutical composition is 0.001 mg to 1000 mg.

[0042] In some embodiments, the pharmaceutical composition contains 0.01-99.99% of the antisense oligonucleotide of this disclosure or its pharmaceutically acceptable salt or isotopic substitution, based on the total weight of the composition. In some embodiments, the pharmaceutical composition contains 0.1-99.9% of the antisense oligonucleotide of this disclosure or its pharmaceutically acceptable salt or isotopic substitution. In some embodiments, the pharmaceutical composition contains 0.5%-99.5% of the aforementioned antisense oligonucleotide or its pharmaceutically acceptable salt or isotopic substitution. In some embodiments, the pharmaceutical composition contains 1%-99% of the antisense oligonucleotide of this disclosure or its pharmaceutically acceptable salt or isotopic substitution. In some embodiments, the pharmaceutical composition contains 2%-98% of the antisense oligonucleotide of this disclosure or its pharmaceutically acceptable salt or isotopic substitution.

[0043] In some embodiments, the pharmaceutical composition contains 0.01% to 99.99% pharmaceutically acceptable excipients based on the total weight of the composition. In some embodiments, the pharmaceutical composition contains 0.1% to 99.9% pharmaceutically acceptable excipients. In some embodiments, the pharmaceutical composition contains 0.5% to 99.5% pharmaceutically acceptable excipients. In some embodiments, the pharmaceutical composition contains 1% to 99% pharmaceutically acceptable excipients. In some embodiments, the pharmaceutical composition contains 2% to 98% pharmaceutically acceptable excipients.

[0044] In some embodiments, when the antisense oligonucleotides or pharmaceutical compositions of this disclosure come into contact with cells expressing a target gene, they inhibit the expression of the target gene by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%.

[0045] In some embodiments, when the antisense oligonucleotides or pharmaceutical compositions of this disclosure come into contact with cells expressing a target gene, the percentage of residual mRNA expression of the target gene induced by the antisense oligonucleotides or pharmaceutical compositions of this disclosure is determined by, for example, psiCHECK activity screening and luciferase reporter gene assay, other methods such as PCR or branched DNA (bDNA) based methods, or protein-based methods such as immunofluorescence analysis, such as Western blotting or flow cytometry, to be no higher than 99%, no higher than 95%, no higher than 90%, no higher than 85%, no higher than 80%, no higher than 75%, no higher than 70%, no higher than 65%, no higher than 60%, no higher than 55%, no higher than 50%, no higher than 45%, no higher than 40%, no higher than 35%, no higher than 30%, no higher than 25%, no higher than 20%, no higher than 15%, or no higher than 10%.

[0046] In some embodiments, when the antisense oligonucleotides or pharmaceutical compositions of this disclosure come into contact with cells expressing a target gene, as determined by, for example, psiCHECK activity screening and luciferase reporter gene assay, other methods such as PCR or branched DNA (bDNA) based methods, or protein-based methods such as immunofluorescence assays, such as Western blotting, or flow cytometry, the antisense oligonucleotides of this disclosure reduce off-target activity by at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, or at least 75% while maintaining target activity.

[0047] In some embodiments, when the antisense oligonucleotides or pharmaceutical compositions of this disclosure come into contact with cells expressing a target gene, the antisense oligonucleotides, as determined by, for example, psiCHECK activity screening and luciferase reporter gene assays, other methods such as PCR or branched DNA (bDNA) based methods, or protein-based methods such as immunofluorescence assays, such as Western blotting, or flow cytometry, reduce off-target activity by at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, or at least 75% while reducing target activity by at least 20%, at least 19%, at least 15%, at most 10%, at most 5%, or more than 1%.

[0048] In some embodiments, when the antisense oligonucleotides or pharmaceutical compositions of this disclosure come into contact with cells expressing a target gene, the off-target activity is reduced by at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, or at least 80% while increasing the target activity by at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, or at least 75%.

[0049] On the other hand, this disclosure provides a method for reducing miR-132 expression in vitro or in vivo, comprising administering an effective amount or effective dose of the antisense oligonucleotide and / or pharmaceutical composition of this disclosure to a subject or target cells.

[0050] On the other hand, this disclosure provides a method for treating and / or preventing diseases associated with miR-132 expression in a subject, comprising administering to the subject an effective amount or effective dose of the antisense oligonucleotide and / or pharmaceutical composition of this disclosure.

[0051] On the other hand, this disclosure provides for the use of the antisense oligonucleotides and / or pharmaceutical compositions described herein in the preparation of treatments and / or preventative medicines for related diseases. In some embodiments, the related diseases are those associated with miR-132 expression and are used in medicines for these diseases.

[0052] On the other hand, this disclosure provides the use of the antisense oligonucleotides and / or pharmaceutical compositions described herein in the preparation of medicaments for inhibiting the expression of miR-132.

[0053] In some embodiments, the associated disease is a disease related to miR-132. In some embodiments, the disease is heart failure, fibrotic disease, or lipid metabolism disorder, wherein the fibrotic disease can be, for example, cardiac fibrosis, pulmonary fibrosis, liver fibrosis, and kidney fibrosis. The lipid metabolism disorder can be, for example, metabolic syndrome (MS), cardiovascular disease, obesity, hepatitis, non-alcoholic fatty liver disease, kidney disease, etc.

[0054] On the other hand, this disclosure discloses a method for in vivo delivery of an antisense oligonucleotide that inhibits miR-132 expression and / or replication, the method comprising administering the antisense oligonucleotide and / or pharmaceutical composition of this disclosure to a subject.

[0055] The antisense oligonucleotides or pharmaceutical compositions and methods disclosed herein can reduce the expression level of miR-132 in cells, cell populations, tissues, or subjects, including administering a therapeutically effective amount of the antisense oligonucleotides or pharmaceutical compositions of this disclosure to a subject, thereby inhibiting the expression of miR-132 in the subject.

[0056] In some embodiments, the subject has been identified as having pathological upregulation of the target gene in the targeted cells or tissues prior to administration of the antisense oligonucleotide and / or pharmaceutical composition of this disclosure.

[0057] The subjects mentioned in this disclosure are those who are diagnosed with (or suspected of having, or are susceptible to) a disease or condition that would benefit from a reduction or inhibition of miR-132 expression.

[0058] The oligonucleotides and / or pharmaceutical compositions disclosed herein can be administered via local administration (e.g., direct injection, implantation, or topical delivery) or systemic administration. This includes administration via subcutaneous, intravenous, intraperitoneal, or parenteral routes, such as intracranial (e.g., intraventricular, intraparenchymal, and intrasheathic), intramuscular, transdermal, airway (aerosol), nasal, oral, rectal, buccal, and sublingual administration, or any suitable route of administration common in the art.

[0059] In an optional embodiment, the pharmaceutical composition provided in this disclosure can be administered by injection, for example, intravenous, intramuscular, intradermal, subcutaneous, duodenal, or intraperitoneal injection.

[0060] In an optional implementation, the conjugate can be packaged in a kit after the delivery group is linked to an antisense oligonucleotide to form a conjugate.

[0061] On the other hand, this disclosure provides a cell containing the antisense oligonucleotides of this disclosure. This cell cannot develop into a complete plant or animal.

[0062] On the other hand, this disclosure provides a kit comprising the antisense oligonucleotide and / or pharmaceutical composition of this disclosure. Alternatively, in an embodiment, the conjugate may be packaged in the kit after the delivery group is linked to the antisense oligonucleotide to form a conjugate.

[0063] This disclosure also provides a method for silencing miR-132 in cells, the method comprising the step of contacting (e.g., introducing) the antisense oligonucleotide agent and / or pharmaceutical composition of this disclosure into the cells.

[0064] This disclosure also provides a method for silencing miR-132 in cells, either in vivo or in vitro, the method comprising the step of introducing an antisense oligonucleotide and / or pharmaceutical composition according to this disclosure into the cells.

[0065] In some embodiments, the effective amount or dose of the antisense oligonucleotide and / or pharmaceutical composition is about 0.001 mg / kg body weight to about 200 mg / kg body weight, about 0.01 mg / kg body weight to about 100 mg / kg body weight, or about 0.5 mg / kg body weight to about 50 mg / kg body weight.

[0066] This disclosure also provides a method for preparing an antisense oligonucleotide or pharmaceutical composition, comprising: synthesizing the antisense oligonucleotide or pharmaceutical composition described in this disclosure.

[0067] The pharmaceutically acceptable salts of the compounds described in this disclosure are selected from inorganic or organic salts, and the compounds described in this disclosure can react with acidic or basic substances to form the corresponding salts. The compounds described in this disclosure include the antisense oligonucleotides of this disclosure. In some embodiments, the compounds of this disclosure are present in the form of sodium salts. In some embodiments, one or more phosphodiester groups or phosphodiester groups with modifying groups in the antisense oligonucleotides of this disclosure form sodium phosphodiester salts. In some specific embodiments, all phosphodiester groups or phosphodiester groups with modifying groups in the antisense oligonucleotides of this disclosure form sodium phosphodiester salts.

[0068] On the other hand, without specifying the configuration, the compounds disclosed herein may exist in specific geometric or stereoisomeric forms. This disclosure contemplates all such compounds, including cis and trans isomers, (-)- and (+)- enantiomers, (R)- and (S)- enantiomers, diastereomers, (D)- isomers, (L)- isomers, and racemic mixtures thereof, as well as other mixtures, such as mixtures enriched with enantiomers or diastereomers, all of which are within the scope of this disclosure. Additional asymmetric carbon atoms may be present in substituents such as alkyl groups. All such isomers and mixtures thereof are included within the scope of this disclosure.

[0069] Furthermore, without specifying the configuration, the compounds and intermediates of this disclosure may also exist in different tautomer forms, and all such forms are included within the scope of this disclosure. The terms "tautomer" or "tautomer form" refer to structural isomers with different energies that can interconvert via low energy barriers.

[0070] The compounds disclosed herein may be asymmetric, for example, having one or more stereoisomers. Unless otherwise stated, all stereoisomers include, for example, enantiomers and diastereomers. The compounds containing asymmetric carbon atoms of this disclosure can be isolated in optically active pure form or in racemic form. The optically active pure form can be resolved from racemic mixtures or synthesized using chiral starting materials or chiral reagents.

[0071] Optically active (R)- and (S)- isomers, as well as D- and L- isomers, can be prepared by chiral synthesis, chiral reagents, or other conventional techniques. To obtain an enantiomer of a compound disclosed herein, it can be prepared by asymmetric synthesis or derivatization with a chiral auxiliary, wherein the resulting diastereomeric mixture is separated and the auxiliary group is cleaved to provide the desired enantiomer in pure form. Alternatively, when the molecule contains a basic functional group (such as an amino group) or an acidic functional group (such as a carboxyl group), a salt of the diastereomeric isomer is formed with a suitable optically active acid or base, followed by diastereomeric resolution using conventional methods known in the art, and then the pure enantiomer is recovered. Furthermore, the separation of enantiomers and diastereomeric isomers is typically accomplished by using chromatography employing a chiral stationary phase and optionally combined with chemical derivatization (e.g., from amines to carbamates).

[0072] This disclosure also includes compounds identical to those described herein, but in which one or more atoms are labeled with isotopes whose atomic weights or mass numbers differ from those commonly found in nature. Examples of isotopes that can be incorporated into compounds of this disclosure include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, sulfur, fluorine, iodine, and chlorine, such as... 2 H, 3 H, 11 C 13 C 14 C 13 N、 15 N、 15 O、 17 O、 18 O、 31 P, 32 P, 35 S, 18 F, 123 I, 125 I and 36 Cl, etc.

[0073] Unless otherwise specified, in the chemical structure of the compounds described in this disclosure, the bonds are... This indicates that the configuration is not specified; that is, if chiral isomers exist in the chemical structure, the bond... It can be Or simultaneously include Two configurations. Although all structural formulas described herein are represented in certain isomer forms for simplicity, this disclosure can include all isomers, such as tautomers, rotatimers, geometric isomers, diastereomers, racemates, and enantiomers. In the chemical structure of the compounds described herein, bonds... No configuration was specified, i.e., key The configuration can be E-type or Z-type, or it can contain both E-type and Z-type configurations.

[0074] Terminology Explanation

[0075] To facilitate understanding of this disclosure, some technical and scientific terms are specifically defined below. Unless otherwise expressly defined herein, all other technical and scientific terms used herein have the meanings commonly understood by one of ordinary skill in the art to which this disclosure pertains.

[0076] As used herein, "antisense oligonucleotide" (ASO) refers to an oligonucleotide molecule capable of degrading or inhibiting (e.g., under appropriate conditions) the expression of a target RNA in a sequence-specific manner. The antisense oligonucleotides described herein are single-stranded and at least partially complementary to the targeted RNA (as an example, a precursor or mature form of miR-132). The antisense oligonucleotide may contain one or more modified nucleotides and / or one or more non-phosphodiester groups linked together. As used herein, the term "oligonucleotide" refers to an oligomeric compound comprising a plurality of nucleotides linked together. In some embodiments, one or more nucleotides in the oligonucleotide are modified. In some embodiments, the oligonucleotide comprises ribonucleic acid (RNA) or deoxyribonucleic acid (DNA).

[0077] In the context of this disclosure, “miR-132” refers to the sequence of MIR132 with NCBI GENE ID 406921 (or an equivalent database number), including its pri-miRNA sequence, pre-miRNA sequence, and miRNA sequence, such as the mature hsa-mir-132-5P sequence: 5'-ACCGUGGCUUUCGAUUGUUACU-3' and the mature hsa-mir-132-3P sequence: 5'-UAACAGUCUACAGCCAUGGUCG-3'.

[0078] In the context of describing the antisense oligonucleotides described herein, the term "nucleotide sequence that differs from the nucleotide sequences shown in SEQ ID NO: 1 to SEQ ID NO: 105 by no more than 3 nucleotides" means that "difference" in this disclosure does not include nucleotides containing different modifications; that is, nucleotides containing the same bases but with different modifications are not considered differing nucleotides in this disclosure. Other similar descriptions of the antisense oligonucleotides of this disclosure in the context of this disclosure should also be understood in the same way.

[0079] In this disclosure, the "5' region" of the antisense oligonucleotide, also known as the "5' end" or "5' terminus," can be used interchangeably. For example, the nucleotides at positions 2 to 8 of the 5' region can be replaced with the nucleotides at positions 2 to 8 of the 5' terminus. Similarly, the "3' region," "3' terminus," and "3' terminus" can also be used interchangeably.

[0080] Unless otherwise specified, in the context of this disclosure, "G", "C", "A", "T" and "U" represent nucleotides, which respectively contain the bases of guanine, cytosine, adenine, thymidine, and uracil. It is well known to those skilled in the art that substitutions of bases T and U do not significantly affect the properties of antisense oligonucleotides, and T in the sequences of this disclosure can be arbitrarily replaced with U; the resulting sequences are also within the scope of protection of this disclosure. In the sequences disclosed herein, for the same nucleic acid chain, the direction from the 5' end to the 3' end is defined as left to right. The lowercase letter m indicates that the nucleoside adjacent to the left of the letter m is a 2'-methoxy modified nucleoside; the lowercase letter f indicates that the nucleoside adjacent to the left of the letter f is a 2'-fluoro modified nucleoside; the lowercase letter s indicates that the two nucleosides adjacent to the letter s are linked by a phosphothioester group; d indicates that the nucleoside adjacent to the right of the letter d is a deoxyribonucleoside; cEt indicates that the nucleoside in parentheses adjacent to its right is a restricted ethyl (cEt) nucleoside; LNA indicates that the nucleoside in parentheses adjacent to its right is a locked nucleoside; (d5mC) represents 5-methylcytosine deoxyribonucleoside; MOE indicates that the nucleoside in parentheses adjacent to its right is a 2'-O-methoxy-ethyl (MOE) modified nucleoside; NA0274 indicates that the nucleoside in parentheses adjacent to its right has the structure shown in formula (I-2).

[0081] Unless otherwise specified, the two nucleosides are linked by a phosphodiester group. Unless otherwise specified, the terms "antisense oligonucleotide," "nucleotide," "compound," "chemical modification," "oligonucleotide," and "nucleoside" in this disclosure can exist independently as salts, mixed salts, or non-salts (e.g., free acids or free bases). In the context of this disclosure, "compound" includes the antisense oligonucleotides of this disclosure. When present in salt or mixed salt form, it may be a pharmaceutically acceptable salt. The term "pharmaceutically acceptable salt" includes pharmaceutically acceptable acid addition salts and pharmaceutically acceptable base addition salts. When present in salt form, some groups may ionize to form anions / cations; for example, phosphodiester groups and thiophosphonate diester groups may exist in anionic form. Unless otherwise specified, the salt forms of the following structures are also within the scope of protection of this disclosure. Unless otherwise specified, the 3' position of the first nucleotide at the 3' end of each chain is a hydroxyl group; the 5' position of the first nucleotide at the 5' end of each chain is a hydroxyl group.

[0082] The above-mentioned modifications and linking groups have the structures shown in Table 1 below, where Base represents the base at the corresponding position:

[0083] Table 1.

[0084] The terms "lipophilic group" or "lipophilic moiety" broadly refer to any compound or chemical part that has an affinity for lipids. One way to characterize the lipophilicity of a lipophilic moiety is through the octanol-water partition coefficient logK. ow K ow This represents the ratio of the concentration of a chemical substance in the octanol phase to its concentration in the aqueous phase at equilibrium in a two-phase system. In principle, logK... ow When the value exceeds 0, the chemical substance exhibits lipophilicity. Typically, the logK of the lipophilic portion... ow Values ​​exceeding 1, 1.5, 2, 3, 4, 5, or 10, such as the logK of 6-aminohexanol. ow The logK of cholesterol-based N-(hexyl-6-ol)carbamate is approximately 0.7. ow It is 10.7.

[0085] The lipophilicity of a molecule can be altered relative to the functional groups it carries. For example, adding a hydroxyl or amino group to the end of the lipophilic moiety can increase or decrease the partition coefficient (e.g., logK) of the lipophilic moiety. owThe lipophilic moiety can be aliphatic, cyclic (e.g., alicyclic), or polycyclic (e.g., polycyclic alicyclic compounds), such as steroids (e.g., sterols) or straight-chain or branched aliphatic hydrocarbons. The lipophilic moiety may generally comprise a hydrocarbon chain, which may be cyclic or acyclic. The hydrocarbon chain may contain various substituents and / or one or more heteroatoms, such as oxygen or sulfur atoms. Such lipophilic aliphatic moieties include, but are not limited to, saturated or unsaturated C4-C... 30 Hydrocarbons (e.g., C) 10 -C 30 Hydrocarbons), saturated or unsaturated fatty acids, waxes (e.g., monohydric esters of fatty acids and fatty diamides), terpenes (e.g., C464 ... 10 Terpenes, C 15 Sesquiterpenes, C 20 Diterpenes, C 30 Triterpenes and C 40 Tetraterpenes and other polycyclic hydrocarbons; for example, the lipophilic moiety may be optionally substituted C 10-30 Straight-chain alkyl; for example, the lipophilic moiety may be an optionally substituted C. 14-24 Straight-chain alkyl groups.

[0086] As used herein, the terms “complementary” or “reverse complementary” are used interchangeably and have the meaning known to those skilled in the art: in a double-stranded nucleic acid molecule, the bases of one strand are paired in a complementary manner with the bases of the other strand. In DNA, the purine base adenine always pairs with the pyrimidine base thymine (or uracil in RNA); the purine base guanine always pairs with the pyrimidine base cytosine. Each base pair consists of one purine and one pyrimidine. When adenine on one strand always pairs with thymine (or uracil) on the other strand, and guanine always pairs with cytosine, the two strands are considered complementary, and the sequence of the complementary strand can be inferred from its sequence. Correspondingly, “mismatch” in the art means, in the case of a double-stranded nucleic acid, that the bases at corresponding positions are not paired in a complementary manner.

[0087] As used herein, the term “inhibition” may be used interchangeably with “reduction,” “silencing,” “downregulation,” “blocking,” and other similar terms, and includes any level of inhibition. Inhibition can be assessed by a reduction in one or more of these variables at an absolute or relative level compared to a control level. This control level can be any type of control level used in the art, such as a baseline level before administration or a level determined from a subject, cell, or sample that has been treated untreated or with a control (e.g., a buffer-only control or an inert control). For example, the degree of inhibition of target gene expression by antisense oligonucleotides can be characterized by residual mRNA expression levels such as not exceeding 99%, not exceeding 95%, not exceeding 90%, not exceeding 85%, not exceeding 80%, not exceeding 75%, not exceeding 70%, not exceeding 65%, not exceeding 60%, not exceeding 55%, not exceeding 50%, not exceeding 45%, not exceeding 40%, not exceeding 35%, not exceeding 30%, not exceeding 25%, not exceeding 20%, not exceeding 15%, or not exceeding 10%. The inhibition rate of target gene expression can be measured using Dual- The Luciferase Assay System was used to detect the chemiluminescence values ​​of fireflies (Fir) and kidneys (Ren), and the relative value Ratio = Ren / Fir was calculated. In this disclosure, the proportion of remaining mRNA expression (or remaining activity %) = Ratio (antisense oligonucleotide treatment group) / Ratio (antisense oligonucleotide control group), and the inhibition rate (%) = 100% - remaining mRNA expression (%).

[0088] The term "pharmaceutically acceptable salt" includes pharmaceutically acceptable acid addition salts and pharmaceutically acceptable base addition salts.

[0089] "Pharmaceutically acceptable acid addition salts" refer to salts formed with inorganic or organic acids that retain the bioavailability of the free base without other side effects. Inorganic acid salts include, but are not limited to, hydrochlorides, hydrobroms, sulfates, nitrates, and phosphates; organic acid salts include, but are not limited to, formates, acetates, 2,2-dichloroacetate, trifluoroacetate, propionates, hexanoates, octanoates, decanoates, undecenoates, glycolates, gluconates, lactates, sebates, adipates, glutarate, malonates, oxalates, maleates, succinates, fumarates, tartrates, citrates, palmitates, stearates, oleates, cinnamates, laurates, malates, glutamates, pyroglutamates, aspartate, benzoates, methanesulfonates, benzenesulfonates, p-toluenesulfonates, alginates, ascorbic acid salts, salicylates, 4-aminosalicylic acid salts, and naphthalene disulfonates. These salts can be prepared by methods known in the art.

[0090] "Pharmaceutically acceptable base addition salts" refer to salts formed with inorganic or organic bases that retain the bioavailability of the free acid without other side effects. Salts derived from inorganic bases include, but are not limited to, sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, and aluminum salts. In some implementations, the inorganic salts are ammonium, sodium, potassium, calcium, and magnesium salts. Salts derived from organic bases include, but are not limited to, the following: primary amines, secondary amines, and tertiary amines; substituted amines, including naturally occurring substituted amines, cyclic amines, and basic ion exchange resins, such as ammonia, isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, diethanolamine, triethanolamine, dimethylethanolamine, 2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine, choline, betaine, ethylenediamine, glucosamine, methylglucosamine, theobromine, purine, piperazine, piperidine, N-ethylpiperidine, polyamine resins, etc. Some embodiments include organic bases such as isopropylamine, diethylamine, ethanolamine, trimethylamine, dicyclohexylamine, choline, and caffeine. These salts can be prepared by methods known in the art.

[0091] "Effective amount" or "effective dose" refers to the amount of a drug, compound, or pharmaceutical composition necessary to achieve any one or more beneficial or desired therapeutic outcome. For prophylactic use, beneficial or desired outcomes include eliminating or reducing risk, lessening severity, or delaying the onset of symptoms, including the disease itself, its complications, and the biochemical, histological, and / or behavioral symptoms of intermediate pathological phenotypes presented during the development of the disease. For therapeutic use, beneficial or desired outcomes include clinical outcomes such as reducing the incidence of miR-132-related symptoms or improving one or more symptoms of said symptoms, reducing the dosage of other agents required to treat the disease, enhancing the efficacy of another agent, and / or delaying the progression of miR-132-related symptoms in patients.

[0092] As used herein, the terms “patient,” “subject,” or “individual” are used interchangeably and include human or non-human animals, such as mammals, such as humans or monkeys.

[0093] The antisense oligonucleotides provided in this disclosure can be obtained using conventional preparation methods in the art (e.g., solid-phase synthesis and liquid-phase synthesis). Solid-phase synthesis is already available as a commercially available custom service. Modified nucleotide groups can be introduced into the antisense oligonucleotides described in this disclosure using appropriately modified nucleoside monomers. Methods for preparing appropriately modified nucleoside monomers and methods for introducing modified nucleotide groups into antisense oligonucleotides are also well known to those skilled in the art.

[0094] The term “chemical modification” or “modification” includes all alterations to nucleotides by chemical means, such as the addition or removal of a chemical moiety, or the substitution of one chemical moiety for another.

[0095] The term "base" includes any known DNA and RNA base, base analogues such as purines or pyrimidines, and also includes natural compounds such as adenine, thymine, guanine, cytosine, uracil, hypoxanthoside, and natural analogues.

[0096] The terms “about” and “approximately” mean that a numerical value is within an acceptable margin of error for a specific value as determined by a person skilled in the art, the numerical value depending in part on how it is measured or measured (i.e., the limits of the measurement system). For example, “about” may mean within or above 1 standard deviation. Alternatively, “about” or “substantially includes” may mean a range of up to 20%, such as between 1% and 15%, between 1% and 10%, between 1% and 5%, between 0.5% and 5%, or between 0.5% and 1%. In this disclosure, each instance of a number or range of values ​​preceded by the term “about” also includes embodiments of a given number. Unless otherwise stated, when a specific value appears in this application and claims, the meaning of “about” or “substantially includes” should be assumed to be within an acceptable margin of error for that specific value.

[0097] Unless otherwise stated, "optionally," "optionally," "optional," or "optional" means that the event or situation described below may but does not have to occur, and this description includes the possibility that the event or situation may or may not occur. For example, "optionally, R1 and R2 are directly connected to form a loop" means that R1 and R2 being directly connected to form a loop may occur but is not required to exist, and this description includes both the case where R1 and R2 are directly connected to form a loop and the case where R1 and R2 are not connected to form a loop.

[0098] In the chemical structural formula disclosed herein, It can be connected with one or more groups according to the scope of the invention described herein.

[0099] The terms “connection” or “linkage” can be used interchangeably when referring to a link between two molecules, meaning that the two molecules are connected by a covalent bond or by a non-covalent bond (e.g., a hydrogen bond or an ionic bond), including direct and indirect links.

[0100] The term "direct link" refers to the connection between a first compound or group and a second compound or group without any intercalating atoms or atomic groups.

[0101] The term "indirect link" refers to the connection between a first compound or group and a second compound or group through an intermediate group, compound, or molecule (e.g., a linking group).

[0102] "Being replaced by one or more..." means that it can be replaced by a single or multiple substituents. When replaced by multiple substituents, it can be a plurality of identical substituents or a combination of one or a plurality of different substituents.

[0103] The term "spirocyclic" refers to a compound in which two rings share a single atom. Non-limiting examples of spirocyclic alkyl compounds include:

[0104] The term "heterospirocycle" refers to a spirocycle that consists of atoms other than carbon atoms, such as, but not limited to, C, N, O, and S.

[0105] The term "fused cycloalkyl" refers to a compound in which two or more rings are fused together by sharing two adjacent atoms. Non-limiting examples of fused cycloalkyl groups include:

[0106] The term "bridged ring" or "bridged linkage" refers to a structure formed by two or more cyclic structures sharing two non-adjacent ring atoms. Depending on the number of rings, bridged alkyl groups can be classified as bicyclic, tricyclic, tetracyclic, or polycyclic, preferably bicyclic, tricyclic, or tetracyclic, and more preferably bicyclic or tricyclic. Non-limiting examples of bridged alkyl groups include:

[0107] prefix "C" u-v "" indicates that the following group has u to v carbon atoms. For example, "C 1-6 "Alkyl" means that an alkyl group has 1 to 6 carbon atoms, specifically alkyl groups with 1, 2, 3, 4, 5 or 6 carbon atoms.

[0108] "Alkyl" refers to a saturated aliphatic hydrocarbon group, including straight-chain and branched groups with 1 to 20 carbon atoms. Alkyl groups containing 1 to 6 carbon atoms are also included. Non-limiting examples include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, sec-butyl, n-pentyl, 1,1-dimethylpropyl, 1,2-dimethylpropyl, 2,2-dimethylpropyl, and their various branched isomers. Alkyl groups can be substituted or unsubstituted; when substituted, the substituent can be replaced at any usable connection point, preferably one or more of the following groups, independently selected from halogens, hydroxyl groups, oxo groups, cyano groups, amino groups, and C4 groups. 1-6 Alkyl, C 1-6 Alkoxy, 3- to 6-membered cycloalkyl, or 3- to 6-membered heterocycloalkyl, wherein the alkyl, alkoxy, cycloalkyl, or heterocycloalkyl may optionally be substituted with halogen, hydroxyl, nitro, cyano, or amino.

[0109] The term "alkenyl" refers to an unsaturated aliphatic straight-chain or branched hydrocarbon group containing one or more carbon-carbon double bonds. Exemplary alkenyl groups include C2-C8, C2-C7, C2-C6, C2-C4, and C3-C6 groups. 12And C3-C6 alkenyl groups. Including but not limited to, vinyl (i.e., vinyl), 1-propenyl, 2-propenyl (i.e., allyl), 2-methyl-1-propenyl, 1-butenyl, 2-butenyl (i.e., crotonyl), etc. Alkenyl groups used in any context herein may optionally be substituted in the same manner as alkyl groups.

[0110] The term "alkynyl" refers to an unsaturated aliphatic straight-chain or branched hydrocarbon group containing one or more carbon-carbon triple bonds. Exemplary alkynyl groups include C2-C8, C2-C7, C2-C6, C2-C4, and C3-C6 groups. 12 And C3-C6 ynyl groups. Including but not limited to ethynyl, prop-1-ynyl, but-1-ynyl, pent-1-ynyl, pent-4-ynyl, and pent-1,4-diynyl. The ynyl group used in any context herein may optionally be substituted in the same manner as the alkyl group.

[0111] The term "cycloalkyl" refers to a saturated or partially unsaturated monocyclic or polycyclic cyclic hydrocarbon substituent, wherein the cycloalkyl ring contains 3 to 20 carbon atoms, preferably 3 to 6 carbon atoms. Non-limiting examples of monocyclic cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexyl, cyclohexenyl, cyclohexadienyl, etc.; polycyclic cycloalkyl groups include spirocyclic, fused, and bridged cycloalkyl groups. Cycloalkyl groups can be substituted or unsubstituted; when substituted, the substituent can be replaced at any usable connection point, preferably one or more of the following groups, independently selected from halogens, hydroxyl groups, oxo groups, cyano groups, amino groups, C6 groups, etc. 1-6 Alkyl, C 1-6 Alkoxy, 3- to 6-membered cycloalkyl, or 3- to 6-membered heterocycloalkyl, wherein the alkyl, alkoxy, cycloalkyl, or heterocycloalkyl may optionally be substituted with halogen, hydroxyl, nitro, cyano, or amino.

[0112] The term "heterocycloalkyl" refers to a saturated or partially unsaturated monocyclic or polycyclic hydrocarbon substituent containing 3 to 20 ring atoms, one or more of which are selected from nitrogen, oxygen, or S(O). m (where m is an integer from 0 to 2) heteroatoms, but excluding the ring portion of -OO-, -OS-, or -SS-, with the remaining ring atoms being carbon. Preferably, it contains 3 to 12 ring atoms, of which 1 to 4 are heteroatoms; more preferably, it contains 3 to 7 ring atoms. Non-limiting examples of "heterocyclic groups" include:

[0113] wait.

[0114] The heterocyclic alkyl ring may be fused to an aryl or heteroaryl ring, wherein the ring attached to the parent structure is a heterocyclic alkyl ring, and non-limiting examples include:

[0115] wait.

[0116] The heterocyclic group can be optionally substituted or unsubstituted. When substituted, the substituent is preferably one or more of the following groups, independently selected from halogen, hydroxyl, oxo, cyano, amino, C... 1-6 Alkyl, C 1-6 Alkoxy, 3- to 6-membered cycloalkyl or 3- to 6-membered heterocyclic group, wherein the alkyl, alkoxy, cycloalkyl or heterocyclic group is optionally substituted with halogen, hydroxyl, nitro, cyano or amino.

[0117] The term "aryl" refers to a 6- to 14-membered all-carbon monocyclic or fused polycyclic (i.e., a ring sharing adjacent carbon atom pairs) group having a conjugated π-electron system, preferably 6- to 12-membered, such as phenyl and naphthyl.

[0118] The aryl ring may be fused to a heteroaryl, heterocyclic, or cycloalkyl ring, wherein the ring connected to the parent structure is an aryl ring, and non-limiting examples include:

[0119] The aryl group can be substituted or unsubstituted. When substituted, the substituent is preferably one or more of the following groups, independently selected from halogen, hydroxyl, oxo, nitro, cyano, C 1-6 Alkyl, C 1-6 Alkoxy, C 2-6 alkenyloxy group, C 2-6 Alkyne group, 3- to 6-membered cycloalkoxy group, 3- to 6-membered heterocycloalkoxy group, C 3-8 Cycloalkenyloxy, 5- to 6-membered aryl or heteroaryl, wherein the C 1-6 Alkyl, C 1-6 Alkoxy, C 2-6 alkenyloxy group, C 2-6 The alkynyl group, 3 to 6 cycloalkoxy group, 3 to 6 heterocycloalkoxy group, 3 to 8 cycloalkenyl group, 5 to 6 aryl group, or heteroaryl group may be selected from one or more halogens, hydroxyl groups, cyano groups, amino groups, C6 groups, etc. 1-6 Alkyl or C 1-6 Alkyl-substituted.

[0120] The term "heteroaryl" refers to a heteroaryl system comprising 1 to 4 heteroatoms and 5 to 14 ring atoms, wherein the heteroatoms are selected from oxygen, sulfur, and nitrogen. Heteroaryl groups are preferably 5 to 12-membered, more preferably 5- or 6-membered. For example, non-limiting examples include: imidazolyl, furanyl, thiophene, thiazolyl, pyrazolyl, oxazolyl, pyrroleyl, tetrazolyl, pyridyl, pyrimidinyl, thiadiazole, and pyrazine. wait.

[0121] The heteroaryl ring may be fused to an aryl, heterocyclic, or cycloalkyl ring, wherein the ring connected to the parent structure is a heteroaryl ring, and non-limiting examples include:

[0122] The heteroaryl group can be optionally substituted or unsubstituted. When substituted, the substituent is preferably one or more of the following groups, independently selected from halogens, hydroxyl groups, cyano groups, amino groups, C4 groups, etc. 1-6 Alkyl or C 1-6 Alkyl group.

[0123] The term "alkoxy" refers to -O- (alkyl), where alkyl is defined as described above. Non-limiting examples of alkoxy groups include: methoxy, ethoxy, propoxy, and butoxy. Alkoxy groups can be optionally substituted or unsubstituted; when substituted, the substituent is preferably one or more of the following groups, independently selected from halogens, hydroxyl groups, oxo groups, cyano groups, amino groups, and C- groups. 1-6 Alkyl, C 1-6 Alkoxy, 3- to 7-membered cycloalkyl or 3- to 7-membered heterocyclic group, wherein the alkyl, alkoxy, cycloalkyl or heterocyclic group is optionally substituted with halogen, hydroxyl, nitro, cyano or amino.

[0124] The term "hydroxyl group" refers to the -OH group.

[0125] The term "halogen" refers to fluorine, chlorine, bromine, or iodine.

[0126] The term "cyano" refers to -CN.

[0127] The term "amino" refers to -NH2.

[0128] The term "nitro" refers to -NO2.

[0129] The term "oxo" refers to the =O substituent.

[0130] The term "substituted" means that any one or more hydrogen atoms on a specified atom (typically carbon, oxygen, and nitrogen atoms) are replaced by any group defined herein, preferably up to five, more preferably one to three hydrogen atoms, independently of each other by the corresponding number of substituents, provided that the substitution does not exceed the normal valence of the specified atom and the substitution yields a stable compound. When the substituent is a ketone or oxo (i.e., =O), two (2) hydrogen atoms on the atom are substituted. Non-limiting examples of substituents include C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, cyano, hydroxyl, oxo, carboxyl, cycloalkyl, cycloalkenyl, heterocyclic, heteroaryl, aryl, ketone, alkoxycarbonyl, aryloxycarbonyl, heteroaryloxycarbonyl, or halogens (e.g., F, Cl, Br, I). When the substituent is a ketone or oxo (i.e., =O), two (2) hydrogen atoms on the atom are substituted. Attached Figure Description

[0131] Figure 1 shows the liver body ratio in mice given the antisense oligonucleotide, solvent, and positive control molecule of this disclosure, respectively. ** indicates P < 0.01.

[0132] Figure 2 shows the expression levels of ALT, AST, UREA, and CREA in rats after being given the antisense oligonucleotide, solvent, and positive control molecules disclosed herein, respectively. * indicates P<0.05, ** indicates P<0.01, and *** indicates P<0.001.

[0133] Figure 3 shows the liver / body weight ratio in rats after administration of the antisense oligonucleotide, solvent, and positive control molecule of this disclosure, respectively. *** indicates P<0.001.

[0134] Figure 4 shows the ejection fraction and shortening fraction in TAC heart failure model mice and sham-operated mice after administration of the antisense oligonucleotides and solvents of this disclosure. * indicates P<0.05, ** indicates P<0.01, and **** indicates P<0.0001. Detailed Implementation

[0135] The present disclosure is further described below with reference to embodiments, but these embodiments are not intended to limit the scope of the disclosure. Experimental methods in the embodiments of this disclosure that do not specify specific conditions are generally performed under conventional conditions, such as those described in Cold Spring Harbor's Antibody Technology Manual or Molecular Cloning Manual; or under conditions recommended by the raw material or commercial manufacturer. Reagents whose specific source is not specified are available from any molecular biology reagent supplier at the quality / purity required for molecular biology applications. Unless otherwise stated, all reagents used in the following embodiments are commercially available products.

[0136] Example 1. Design of miR-132 antisense oligonucleotides

[0137] The antisense oligonucleotide sequences in the embodiments of this disclosure are shown in Tables 2 and 3 below. The unmodified antisense oligonucleotide sequences of 9-22 nucleotides in length are designed with human miR-132 (NR_029674.1) as the target sequence to meet the general rules of active antisense oligonucleotides. Table 2 shows the unmodified antisense oligonucleotide sequences, and Table 3 shows the modified antisense oligonucleotide sequences.

[0138] Table 2. Antisense oligonucleotide sequences of this disclosure

[0139] In Table 2, G, C, A, and T represent nucleosides with or without modifications, including guanine, cytosine, adenine, and thymidine. In the sequences in Table 1, T can be arbitrarily replaced with the base U (uracil), and the resulting sequences are also within the scope of protection of this disclosure.

[0140] Table 3. Antisense oligonucleotide sequences of this disclosure

[0141] In Table 3, within the same nucleic acid sequence, from left to right along the 5' to 3' direction, G, C, A, and T represent nucleosides containing guanine, cytosine, adenine, and thymine, respectively. The sequence direction from left to right indicates the 5' to 3' direction. A lowercase letter f indicates that the nucleoside adjacent to the left of f is 2'-fluoromodified; a lowercase letter m indicates that the nucleoside adjacent to the left of m is 2'-methoxymodified; a lowercase letter s indicates that the two nucleosides adjacent to s are linked by a phosphothioester group; and d indicates that the nucleoside to the right of d... The adjacent nucleoside on the right is a deoxyribonucleoside; cEt indicates that the nucleoside in parentheses on the right is a restricted ethyl (cEt) nucleoside; cEt(5mC) indicates 5-methylcytosine (5mC) restricted ethyl nucleoside; LNA indicates that the nucleoside in parentheses on the right is a locked nucleoside; LNA(5mC) indicates 5-methylcytosine (5mC) locked nucleoside (LNA); (d5mC) indicates 5-methylcytosine deoxyribonucleoside; MOE indicates that the nucleoside in parentheses on the right is a 2'-O-methoxy-ethyl (MOE) modified nucleoside. Unless otherwise specified, two adjacent nucleosides are linked by a phosphodiester group, and NA0274 indicates that the nucleoside in parentheses on the right has the structure shown in formula (I-1). Unless otherwise specified, the 3' position of the first nucleotide at the 3' end of each chain is a hydroxyl group; the 5' position of the first nucleotide at the 5' end of each chain is a hydroxyl group.

[0142] The deoxyribonucleosides, 2'-fluoro-modified nucleosides, restricted ethyl (cEt) nucleosides, lock nucleosides, 5-methylcytosine nucleosides, thiophosphate diester groups, and 2'-O-methoxy-ethyl (MOE)-modified nucleosides have phosphate diester group structures as shown in Table 1. When the antisense oligonucleotides of this disclosure exist in salt form, such as in sodium salt form, the salt form structures corresponding to the structures in Table 1 are also within the protection scope of this disclosure.

[0143] Example 2. Synthesis of the antisense oligonucleotide of this disclosure

[0144] The antisense oligonucleotides disclosed herein can be prepared or obtained commercially by any conventional oligonucleotide synthesis method in the art, such as the usual phosphoramidite solid-phase synthesis method. The antisense oligonucleotides used in the embodiments of this disclosure were all commercially ordered from Sangon Biotech (Shanghai) Co., Ltd.

[0145] Example 3. Inhibitory activity of the antisense oligonucleotide of this disclosure against miR-132 in AC16 cells.

[0146] The antisense oligonucleotides of this disclosure were screened for in vitro activity in AC16 cells (purchased from Hunan Fenghui Biotechnology Co., Ltd.) using two concentration gradients (100 nM and 10 nM) and administered via free uptake.

[0147] AC16 cells were cultured in DMEM medium containing 10% fetal bovine serum at 37°C and 5% CO2. AC16 cells were then seeded into 96-well plates at a density of 1.5 × 10⁶ cells per well. 4 100 μL of culture medium per well for each cell. 16 hours after inoculation, antisense oligonucleotides were added to the cell culture medium at the given concentration. After 48 hours of treatment, total RNA was extracted from the cells using a high-throughput cell RNA extraction kit (MagMAX™ mirVana™ Total RNA Isolation Kit, Thermo, A27828). Then, miRNA reverse transcription experiments (Sangon Biotech, B532453-0020) and quantitative real-time PCR (Thermo, 4444557) were performed to determine the expression level of human miR-132. The expression level of human miR-132 was corrected according to the U6 internal reference gene level.

[0148] The instruments involved in this experiment are shown in Table 4:

[0149] Table 4. Experimental Apparatus

[0150] In the real-time quantitative PCR detection, Q-PCR was used, and its primer information is shown in Table 5.

[0151] Table 5. Primer sequence information table

[0152] Results analysis method:

[0153] After the Q-PCR assay is completed, the corresponding Ct value is obtained according to the threshold automatically set by the system. The expression of a specific gene can be relatively quantified by comparing Ct values: comparing Ct refers to calculating the difference in gene expression between the Ct value and that of the internal reference gene, also known as 2^(2π / 3). (-△△Ct) △△Ct=[(Ct experimental group target gene - Ct experimental group internal reference) - (Ct control group target gene - Ct control group internal reference)].

[0154] The results were expressed as the percentage of human miR-132 activity remaining in cells treated with the antisense oligonucleotides of this disclosure (specifically, a value of 2^ (-△△Ct)The results are expressed as (×100). The results are shown in Table 6. Table 6 shows that the oligonucleotides of this disclosure have good miR-132 inhibitory activity.

[0155] Table 6. Remaining activity of miR-132 in AC16 cells

[0156] Example 4. Inhibitory activity of the antisense oligonucleotide of this disclosure against miR-132 in AC16 cells.

[0157] The inhibitory activity of the antisense oligonucleotides disclosed herein against miR-132 in AC16 cells was tested using the same method as in Example 3, the only difference being the concentrations used: 100 nM and 20 nM. The results are shown in Table 7.

[0158] The results in Table 7 show that the antisense oligonucleotides disclosed herein have good miR-132 inhibitory activity.

[0159] Table 7. Remaining activity of miR-132 in AC16 cells

[0160] Example 5. Inhibitory activity of the antisense oligonucleotides disclosed herein against miR-132 in AC16 cells.

[0161] The inhibitory activity of the antisense oligonucleotides of this disclosure against miR-132 in AC16 cells was tested using the same method as in Example 3, the only difference being the concentration used was 100 nM. The results are shown in Table 8. Table 7 shows that the antisense oligonucleotides of this disclosure have good miR-132 inhibitory activity.

[0162] Table 8. Remaining activity of miR-132 in AC16 cells

[0163] Example 6. Inhibitory activity of the antisense oligonucleotide of this disclosure against miR-132 in mouse heart.

[0164] Male C57BL / 6J mice (purchased from Zhejiang Vital River Laboratory Animal Technology Co., Ltd.) aged 6-8 weeks were acclimatized (temperature 22±2℃, humidity 50±10%, 12h light / dark cycle, standard feed and water) and then divided into an experimental group (n=3, 63 mice in total) and a solvent group (n=3, 9 mice in total). Mice in the experimental group received a single intravenous injection of the test compound at a dose of 2.5 mg / kg via tail vein, while the solvent group received an equal volume of physiological saline. Four hours (4h) after administration, on day 7 (D7), and day 13 (D13), the mice were euthanized, and 20 mg of heart tissue was immediately harvested, rinsed with RNase-free physiological saline, and the surface moisture was aspirated before being transferred to a solution containing 10 times its volume of physiological saline. The solution was stored overnight in an EP tube at 4°C, and then transferred to -80°C for storage.

[0165] Total RNA was extracted from heart tissue using the MagMAX™ mirVana™ Total RNA Isolation Kit (A27828, Thermo Fisher) and a nucleic acid extractor. Then, stem-loop reverse transcription was performed using a miRNA first-strand cDNA synthesis (stem-loop method) kit (B532453-0020, Sangon Biotech). The primers used were: miR-132RT primer: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCGACCA (SEQ ID NO: 187); U6 RT primer: GTCGTATGCAGAGCAGGGTCCGAGGTATTCGCACTGCATACGACAAAATATGG (SEQ ID NO: 188).

[0166] The PCR products were used for Real-Time PCR detection of miR-132 knockdown in cardiac tissue. The primers used were: miR-132 forward primer: AGCCAGCGTAACAGTCTACAGC (SEQ ID NO: 189), miR-132 reverse primer: ATCCAGTGCAGGGTCCGAGG (SEQ ID NO: 190); U6 forward primer: AAGGATGACACGCAAATTC (SEQ ID NO: 191), reverse primer: GAGGCAGGGTCCGAGGT (SEQ ID NO: 192). TB Green Premix Ex Taq II (Tli RNaseH Plus) (RR820A, Takara) was used for real-time quantitative PCR. Results analysis methods:

[0167] After the Q-PCR assay is completed, the corresponding Ct value is obtained according to the threshold automatically set by the system. The expression of a specific gene can be relatively quantified by comparing Ct values: comparing Ct refers to calculating the difference in gene expression between the Ct value and that of the internal reference gene, also known as 2^(2π / 3). (-△△Ct) △△Ct=[(Ct experimental group target gene - Ct experimental group internal reference) - (Ct control group target gene - Ct control group internal reference)].

[0168] The results were expressed as the percentage of miR-132 activity remaining relative to the antisense oligonucleotides treated with this disclosure (specifically, a value of 2^ (-△△Ct)The results are expressed as (×100). The results are shown in Table 9. The results indicate that the antisense oligonucleotides TJA0046, TJA0068, TJA0129, TJA0130, TJA0055, and TJA0047 of this disclosure exhibit superior and longer-lasting miR-132 inhibitory activity compared to the positive molecule TJA0058. At day 13, the residual miR-132 activity in all groups treated with the six antisense oligonucleotides of this disclosure was still below 11% (i.e., the inhibition rate was above 89%). The inhibitory activity of the six antisense oligonucleotides of this disclosure showed a significant statistical advantage over the positive molecule TJA0058 (****P<0.0001, ANOVA detection).

[0169] Table 9. Residual activity of miR-132 in mouse heart tissue

[0170] Example 7. Toxicity study of the antisense oligonucleotides of this disclosure in mice.

[0171] Male C57BL / 6J mice (purchased from Zhejiang Vital River Laboratory Animal Technology Co., Ltd.) aged 6-8 weeks were acclimatized (temperature 22±2℃, humidity 50±10%, 12h light / dark cycle, standard feed and water) and then divided into 8 groups of 3 mice each. The experimental group mice received a single intravenous injection of the test compound at a dose of 500 mg / kg via tail vein, while the solvent group received an equal volume of physiological saline. On day 13 post-administration, the mice were euthanized, and the heart, liver, spleen, lungs, kidneys, and brain tissue were collected and weighed after gross observation.

[0172] The liver weight / body weight results are shown in Figure 1. Compared to the solvent group, the liver body weight of mice administered the positive control molecule TJA0058 was significantly increased (**P<0.01, one-way ANOVA). However, the liver body weight of mice administered the antisense oligonucleotides TJA0046, TJA0068, TJA00129, TJA00130, TJA0055, and TJA0047 disclosed herein showed no statistically significant difference compared to the solvent group. The results in Figure 1 indicate that the antisense oligonucleotides disclosed herein have significantly lower toxicity compared to the positive control molecule TJA0058.

[0173] Example 8. Toxicity study of the antisense oligonucleotides of this disclosure in rats.

[0174] Nine male and nine female SD rats (purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd.) were acclimatized for one week (temperature 22–26℃, humidity 40–70%, 12-hour light / dark cycle, standard feed and water), and divided into three groups of three female and three male rats per group. The solvent group received physiological saline via IV at a dose of 5 mL / kg; the TJA0058 and TJA0046 groups received the disclosed antisense oligonucleotide TJA0058 and positive molecule TJA0046 via IV at a dose of 100 mg / kg, respectively, every two weeks; rat body weight was monitored weekly. Forty-eight hours after the last administration, the rats were fasted overnight, and blood was collected via the orbital venous plexus for serum biochemical analysis to detect ALT, AST, UREA, and CREA. Twenty-eight days after the last administration, the rats were euthanized, and their livers were collected and weighed.

[0175] The Dunnett-t test was used to calculate the significance of differences in this experiment. The results are shown in Figures 2 and 3. The results in Figures 2 and 3 show that after three consecutive administrations, the expression levels of ALT (alanine aminotransferase), AST (aspartate aminotransferase), UREA (urea), and CREA (creatinine) and the liver-to-body ratio in the positive molecule TJA0058 group were significantly increased compared with the solvent group, while the serum biochemical parameters and liver-to-body ratio of the TJA0046 group, which was given the oligonucleotide disclosed in this invention, were not significantly abnormal compared with the solvent group.

[0176] Example 9. Pharmacodynamic evaluation of the antisense oligonucleotides of this disclosure in a TAC heart failure mouse model.

[0177] Male C57BL / 6J mice (8-10 weeks old, purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd.) were acclimatized for 3-5 days (temperature 22-26℃, humidity 40-70%, 12h light / dark cycle, standard feed and water). Based on body weight, the mice were randomly divided into two groups (n=8-12 per group): a sham-operated group and a TAC (Transverse Aortic Constriction) surgery group. In the sham-operated group, only open-chest surgery followed by suturing was performed. In the TAC model group, aortic ligation was performed to establish the model. After modeling, and after a period of recovery, echocardiography was performed on surviving mice in the TAC surgery group. Based on the ejection fraction after modeling, the mice were divided into two groups, ensuring consistent initial ejection fraction, with 8-12 animals in each group. One group received placebo, while the other group received intravenous administration of the disclosed antisense oligonucleotide TJA0046 at a dose of 20 mg / kg every two weeks for 28 days. Ejection fraction (EF%) and shortening fraction (FS%) were measured by echocardiography at the endpoint. The Dunnett-t test was used to calculate statistical significance. The results are shown in Figure 4. Figure 4 indicates that administration of the antisense oligonucleotide TJA0046 disclosed herein effectively increased ejection fraction and shortening fraction in mice, thus demonstrating that the antisense oligonucleotide of this disclosure exhibits significant therapeutic efficacy in TAC heart failure mice.

Claims

1. An antisense oligonucleotide comprising a sequence differing from the nucleotide sequence shown in SEQ ID NO: 83 by no more than 3 nucleotides, the antisense oligonucleotide consisting of 15-22 nucleotides, wherein at least one nucleoside in the antisense oligonucleotide is a modified nucleoside, the modified nucleoside being selected from bridging nucleosides, 2'-F modified nucleosides, 2'-alkoxy modified nucleosides, 2'-heterospirocyclic modified nucleosides, 2'-O-methoxy-ethyl modified nucleosides, or nucleosides with modified bases.

2. The antisense oligonucleotide according to claim 1, wherein two adjacent nucleosides in the antisense oligonucleotide are linked by a phosphodiester group, wherein at least one phosphodiester group is a phosphodiester group with a modifying group; preferably, wherein all phosphodiester groups are phosphodiester groups with modifying groups.

3. The antisense oligonucleotide according to claim 1 or 2, wherein the antisense oligonucleotide comprises a sequence as shown in any one of SEQ ID NO: 106 to SEQ ID NO:

111.

4. The antisense oligonucleotide according to any one of claims 1-3, wherein the antisense oligonucleotide further comprises one or more delivery groups, the delivery groups being linked to the antisense oligonucleotide.

5. A pharmaceutical composition comprising the antisense oligonucleotide of any one of claims 1-4, and a pharmaceutically acceptable excipient thereof.

6. A cell comprising the antisense oligonucleotide of any one of claims 1-4.

7. A kit comprising the antisense oligonucleotide of any one of claims 1-4 and / or the pharmaceutical composition of claim 5.

8. A method for reducing miR-132 expression in vivo or in vitro, comprising administering to a subject or target cells an effective amount or effective dose of the antisense oligonucleotide of any one of claims 1-4 and / or the pharmaceutical composition of claim 5.

9. A method of treating and / or preventing a disease in a subject, comprising administering to the subject an effective amount or effective dose of the antisense oligonucleotide of any one of claims 1-4 and / or the pharmaceutical composition of claim 5; preferably, the disease is heart failure, fibrosis, or a lipid metabolism disorder.

10. A method for in vivo delivery of an antisense oligonucleotide that inhibits miR-132 expression and / or replication, the method comprising administering to a subject the antisense oligonucleotide of any one of claims 1-4 and / or the pharmaceutical composition of claim 5.

11. A method for preparing antisense oligonucleotides or pharmaceutical compositions, comprising: Synthesize the antisense oligonucleotide of any one of claims 1-4 or the pharmaceutical composition of claim 10.

Images