Cadherin-17 targeting antigen biding polypeptides, chimeric antigen receptors, car-t cells and methods of treating cadherin-17 positive cancers
CDH17-targeting VHHs and CAR-T cells provide a novel therapeutic approach for gastrointestinal cancers by selectively targeting and eliminating CDH17-positive tumors, overcoming the limitations of existing therapies.
Patent Information
- Application Number
- PCT/US2025/036987
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-07-10
- Filing Date
- 2025-07-09
- Publication Date
- 2026-01-15
AI Technical Summary
Current therapies for gastrointestinal cancers, including neuroendocrine tumors, gastric cancer, pancreatic cancer, and colorectal cancers, are ineffective due to the lack of specific cell surface tumor-associated antigens and corresponding antibodies, limiting the effectiveness of adoptive T cell therapy.
Development of antigen binding polypeptides, specifically variable domain heavy-chain antibodies (VHHs) that target cadherin-17 (CDH17), conjugated with drugs or radioisotopes, and chimeric antigen receptors (CARs) to create CAR-T cells that selectively recognize and kill CDH17-positive cancer cells.
The CDH17-targeting CAR-T cells effectively treat CDH17-positive cancers without significant impact on normal cells, demonstrating potent in vitro and in vivo antitumor activity against gastrointestinal cancer xenografts.
Smart Images

Figure IMGF000027_0001 
Figure IMGF000028_0001 
Figure IMGF000028_0002
Abstract
Description
[0001] CADHERIN-17 TARGETING ANTIGEN BIDING POLYPEPTIDES, CHIMERIC ANTIGEN RECEPTORS, CAR-T CELLS AND METHODS OF TREATING CADHERIN-17 POSITIVE CANCERS
[0002] CROSS-REFERENCE TO RELATED APPLICATIONS
[0003] The present application claims priority under 35 U.S.C. § 119(e) to U.S. Provisional Patent Application No. 63 / 669,461, filed July 10, 2024, which is incorporated herein by reference in its entirety.
[0004] SEQUENCE LISTING
[0005] The XML file named "046483-7455WOl_Seq Listing.xml" created on July 8, 2025, comprising 169,340 bytes, is hereby incorporated by reference in its entirety.
[0006] BACKGROUND
[0007] Gastrointestinal cancers (GICs), including neuroendocrine tumors (NETs), gastric cancer (GC), pancreatic cancer (PC), and colorectal cancers (CRC) pose serious threats to patients, especially the chemoresistant cancers. There are about 5 million new cases of GICs annually worldwide, accounting for 35% of all cancer-related deaths. With conventional therapies, including surgery, chemotherapy and molecularly targeted therapy, the overall survival of patients with metastatic gastrointestinal (GI) cancer remains poor.
[0008] Adoptive T cell therapy involving engineered chimeric antigen receptors (CARs) targeting CD19-expressing leukemia or lymphoma has been shown to eradicate lymphocytic leukemia or lymphoma, and approved by FDA for therapy. However, no such therapies have been well-established to target the GICs manly due to lack of specific cell surface tumor- associated antigens and corresponding antibodies.
[0009] Therefore, there is a need for novel therapies that are effective for the treatment of gastrointestinal cancers. The present study addresses this need. SUMMARY
[0010] In some aspects, the present invention is directed to the following non-limiting embodiments:
[0011] Antigen binding polypeptide
[0012] In some aspects, the present invention is directed to an antigen binding polypeptide.
[0013] In some embodiments, the antigen binding polypeptide comprises a variable domain of a heavy-chain antibody (VHH).
[0014] In some embodiments, the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:2; a CDR 2 comprising the sequence set forth in SEQ ID NO:3; and a CDR 3 comprising the sequence set forth in SEQ ID NO:4.
[0015] In some embodiments, the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:6; a CDR 2 comprising the sequence set forth in SEQ ID NO:7; and a CDR 3 comprising the sequence set forth in SEQ ID NO:8.
[0016] In some embodiments, the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO: 10; a CDR 2 comprising the sequence set forth in SEQ ID NO: 11 ; and a CDR 3 comprising the sequence set forth in SEQ ID NO: 12.
[0017] In some embodiments, the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO: 14; a CDR 2 comprising the sequence set forth in SEQ ID NO: 15; and a CDR 3 comprising the sequence set forth in SEQ ID NO: 16.
[0018] In some embodiments, the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO: 18; a CDR 2 comprising the sequence set forth in SEQ ID NO: 19; and a CDR 3 comprising the sequence set forth in SEQ ID NO:20.
[0019] In some embodiments, the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:22; a CDR 2 comprising the sequence set forth in SEQ ID NO:23; and a CDR 3 comprising the sequence set forth in SEQ ID NO:24.
[0020] In some embodiments, the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:26; a CDR 2 comprising the sequence set forth in SEQ ID NO:27; and a CDR 3 comprising the sequence set forth in SEQ ID NO:28.
[0021] In some embodiments, the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:30; a CDR 2 comprising the sequence set forth in SEQ ID NO:31; and a CDR 3 comprising the sequence set forth in SEQ ID NO:32. In some embodiments, the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:34; a CDR 2 comprising the sequence set forth in SEQ ID NO:35; and a CDR 3 comprising the sequence set forth in SEQ ID NO:36.
[0022] In some embodiments, the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:38; a CDR 2 comprising the sequence set forth in SEQ ID NO:39; and a CDR 3 comprising the sequence set forth in SEQ ID NO:40.
[0023] In some embodiments, the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:42; a CDR 2 comprising the sequence set forth in SEQ ID NO:43; and a CDR 3 comprising the sequence set forth in SEQ ID NO:44.
[0024] In some embodiments, the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:46; a CDR 2 comprising the sequence set forth in SEQ ID NO:47; and a CDR 3 comprising the sequence set forth in SEQ ID NO:48.
[0025] In some embodiments, the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:50; a CDR 2 comprising the sequence set forth in SEQ ID NO:51; and a CDR 3 comprising the sequence set forth in SEQ ID NO:52.
[0026] In some embodiments, the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:54; a CDR 2 comprising the sequence set forth in SEQ ID NO:55; and a CDR 3 comprising the sequence set forth in SEQ ID NO:56.
[0027] In some embodiments, the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:58; a CDR 2 comprising the sequence set forth in SEQ ID NO:59; and a CDR 3 comprising the sequence set forth in SEQ ID NO:60.
[0028] In some embodiments, the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:62; a CDR 2 comprising the sequence set forth in SEQ ID NO:63; and a CDR 3 comprising the sequence set forth in SEQ ID NO:64.
[0029] In some embodiments, the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:66; a CDR 2 comprising the sequence set forth in SEQ ID NO:67; and a CDR 3 comprising the sequence set forth in SEQ ID NO:68.
[0030] In some embodiments, the VHH comprises an amino acid sequence having about 90% identity or more to SEQ ID NO: 1, 5, 9, 13, 17, 21, 25, 29, 33, 37, 41, 45, 49, 53, 57, 61 or 65.
[0031] In some embodiments, the VHH comprises the VHH comprises an amino acid sequence having about 90% identity or more to SEQ ID NO: 1, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:2; a CDR 2 comprising the sequence set forth in SEQ ID NO:3; and a CDR 3 comprising the sequence set forth in SEQ ID NON.
[0032] In some embodiments, the VHH comprises an amino acid sequence having about 90% identity or more to SEQ ID NO:5, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:6; a CDR 2 comprising the sequence set forth in SEQ ID NO:7; and a CDR 3 comprising the sequence set forth in SEQ ID NO:8.
[0033] In some embodiments, the VHH comprises an amino acid sequence having about 90% identity or more to SEQ ID NO: 10, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO: 10; a CDR 2 comprising the sequence set forth in SEQ ID NO: 11; and a CDR 3 comprising the sequence set forth in SEQ ID NO: 12.
[0034] In some embodiments, the VHH comprises an amino acid sequence having about 90% identity or more to SEQ ID NO: 13, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO: 14; a CDR 2 comprising the sequence set forth in SEQ ID NO: 15; and a CDR 3 comprising the sequence set forth in SEQ ID NO: 16.
[0035] In some embodiments, the VHH comprises an amino acid sequence having about 90% identity or more to SEQ ID NO: 17, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO: 18; a CDR 2 comprising the sequence set forth in SEQ ID NO: 19; and a CDR 3 comprising the sequence set forth in SEQ ID NO:20.
[0036] In some embodiments, the VHH comprises an amino acid sequence having about 90% identity or more to SEQ ID NO:21, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:22; a CDR 2 comprising the sequence set forth in SEQ ID NO:23; and a CDR 3 comprising the sequence set forth in SEQ ID NO:24.
[0037] In some embodiments, the VHH comprises an amino acid sequence having about 90% identity or more to SEQ ID NO:25, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:26; a CDR 2 comprising the sequence set forth in SEQ ID NO:27; and a CDR 3 comprising the sequence set forth in SEQ ID NO:28.
[0038] In some embodiments, the VHH comprises an amino acid sequence having about 90% identity or more to SEQ ID NO:30, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:30; a CDR 2 comprising the sequence set forth in SEQ ID NO:31; and a CDR 3 comprising the sequence set forth in SEQ ID NO:32. In some embodiments, the VHH comprises an amino acid sequence having about 90% identity or more to SEQ ID NO:33, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:34; a CDR 2 comprising the sequence set forth in SEQ ID NO:35; and a CDR 3 comprising the sequence set forth in SEQ ID NO:36.
[0039] In some embodiments, the VHH comprises an amino acid sequence having about 90% identity or more to SEQ ID NO:37, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:38; a CDR 2 comprising the sequence set forth in SEQ ID NO:39; and a CDR 3 comprising the sequence set forth in SEQ ID NO:40.
[0040] In some embodiments, the VHH comprises an amino acid sequence having about 90% identity or more to SEQ ID NO:41, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:42; a CDR 2 comprising the sequence set forth in SEQ ID NO:43; and a CDR 3 comprising the sequence set forth in SEQ ID NO:44.
[0041] In some embodiments, the VHH comprises an amino acid sequence having about 90% identity or more to SEQ ID NO:45, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:46; a CDR 2 comprising the sequence set forth in SEQ ID NO:47; and a CDR 3 comprising the sequence set forth in SEQ ID NO:48.
[0042] In some embodiments, the VHH comprises an amino acid sequence having about 90% identity or more to SEQ ID NO:49, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:50; a CDR 2 comprising the sequence set forth in SEQ ID NO:51; and a CDR 3 comprising the sequence set forth in SEQ ID NO:52.
[0043] In some embodiments, the VHH comprises an amino acid sequence having about 90% identity or more to SEQ ID NO:53, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:54; a CDR 2 comprising the sequence set forth in SEQ ID NO 55; and a CDR 3 comprising the sequence set forth in SEQ ID NO:56.
[0044] In some embodiments, the VHH comprises an amino acid sequence having about 90% identity or more to SEQ ID NO:57, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:58; a CDR 2 comprising the sequence set forth in SEQ ID NO:59; and a CDR 3 comprising the sequence set forth in SEQ ID NO:60.
[0045] In some embodiments, the VHH comprises an amino acid sequence having about 90% identity or more to SEQ ID NO:61, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:62; a CDR 2 comprising the sequence set forth in SEQ ID NO:63; and a CDR 3 comprising the sequence set forth in SEQ ID NO:64.
[0046] In some embodiments, the VHH comprises an amino acid sequence having about 90% identity or more to SEQ ID NO:65, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:66; a CDR 2 comprising the sequence set forth in SEQ ID NO:67; and a CDR 3 comprising the sequence set forth in SEQ ID NO:68.
[0047] In some embodiments, the VHH comprises an amino acid sequence set forth in SEQ ID NO: 1, 5, 9, 13, 17, 21, 25, 29, 33, 37, 41, 45, 49, 53, 57, 61 or 65.
[0048] In some embodiments, the antigen binding polypeptide is a heavy chain antibody or a single-domain antibody (nanobody).
[0049] In some embodiments, the VHH is a camelid VHH.
[0050] In some embodiments, the VHH is humanized.
[0051] In some embodiments, the antigen binding polypeptide binds to an extracellular portion of cadherin 17 (CDH17).
[0052] In some embodiments, the antigen binding polypeptide binds to at least one selected from ECI domain, EC2 domain, EC3 domain, EC4 domain, EC5 domain, EC6 domain, and EC7 domain of CDH17.
[0053] Conjugate
[0054] In some embodiments, the present invention is directed to a conjugate.
[0055] In some embodiments, the conjugate comprises the antigen binding polypeptide herein; and a drug, a toxin, or a radioisotope, conjugated to the antigen binding polypeptide.
[0056] In some embodiments, the conjugate comprises at least one selected from the group consisting of maytansinoid (DM1), SSTR2 -binding octreotide, paclitaxel, auristatin, MMAE, MMAF, dauxrubicin, duocarmycin A, 5-fluoruracil, methotrexate, tutbulin polymerization inhibitors, ravtansine (DM4), Ricin A, 90Y, 177Lu, and 11 Un conjugated to the antigen binding polypeptide.
[0057] In some embodiments, the conjugate is an antibody-drug-conjugate (ADC).
[0058] Chimeric antigen receptor
[0059] In some aspects, the present invention is directed to a chimeric antigen receptor (CAR). In some embodiments, the CAR comprises an antigen binding domain comprising the antigen binding polypeptide herein; a transmembrane domain; and an intracellular signaling domain.
[0060] In some embodiments, the CAR further comprises a hinge domain.
[0061] Nucleic acid
[0062] In some aspects, the present invention is directed to a nucleic acid.
[0063] In some embodiments, the nucleic acid encodes the CAR herein.
[0064] In some embodiments, the nucleic acid is part of an expression vector.
[0065] CAR-T cell
[0066] In some aspects, the present invention is directed to a CAR-T cell.
[0067] In some embodiments, the CAR-T cell comprises the CAR or the nucleic acid herein.
[0068] Method of treating a disease or disorder
[0069] In some aspects, the present invention is directed to a method of treating a disease or disorder caused by or involving CDH17-positive cells in a subject in need thereof.
[0070] In some embodiments, the method comprises administering to the subject an effective amount of the antigen binding polypeptide herein, an effective amount of the conjugate herein, or an effective amount of the CAR-T cell herein.
[0071] In some embodiments, the disease or disorder is a CDH 17-positive cancer.
[0072] In some embodiments, the CDH 17-positive cancer is a CDH 17-positive gastrointestinal cancer (GIC) selected from the group consisting of a CDH 17-positive neuroendocrine tumor (NET), a CDH 17-positive gastric cancer (GC), a CDH 17-positive pancreatic cancer (PC), and a CDH 17-positive colorectal cancers (CRC).
[0073] In some embodiments, the CDH 17-positive cancer is a CDH 17-positive mucinous ovarian cancer.
[0074] In some embodiments, the CDH 17-positive cancer is a CDH 17-positive pancreatic acinar cell carcinoma.
[0075] In some embodiments, the CDH 17-positive cancer is a CDH 17-positive cervical adenocarcinoma. In some embodiments, the CDH 17-positive cancer is a CDH 17-positive bilio-pancreatic adenocarcinoma.
[0076] In some embodiments, the CDH 17-positive cancer is a CDH 17-positive pulmonary adenocarcinoma.
[0077] In some embodiments, the subject is a mammal.
[0078] In some embodiments, the subject is a human.
[0079] BRIEF DESCRIPTION OF THE DRAWINGS
[0080] The following detailed description of exemplary embodiments will be better understood when read in conjunction with the appended drawings. For the purpose of illustrating, nonlimiting embodiments are shown in the drawings. It should be understood, however, that the instant specification is not limited to the precise arrangements and instrumentalities of the embodiments shown in the drawings.
[0081] Figs. 1A-1B: Isolation of 16 anti-CDH17 variable heavy domains of heavy chain antibodies (VHHs) from CDH17 immunized phage libraries, in accordance with some embodiments. Fig. 1A: The flow chat of CDH17-specific VHH nanobody screening. Fig. IB: Flow cytometry analysis of the isolated VHHs binding to NB4 cells expressing either vector or CDH 17.
[0082] Figs. 2A-2D: Identification of the domains of CDH17 that binds to the isolated novel VHHs, in accordance with some embodiments. Figs. 2A-2C: 293T cells were transfected with CDH17 wild type or truncation mutants, followed by flow cytometry analysis with isolated novel VHH proteins and secondary anti-HA-APC antibody. Fig. 2D: Summary of each VHH binding domains of CDH17.
[0083] Figs. 3A-3C: Generation of novel VHH re-directed CAR T cells, in accordance with some embodiments. Fig. 3 A: Schematic diagram of VHH-28BBz CAR structure, including signal peptide (SP), IgG4 mutant (IgG4m) hinge, CD28 transmembrane domain (TM), CD28, 4- 1BB, and CD3(^. Figs. 3B-3C: The expression of CARs in primary human T cells were detected by flow cytometry with either anti -VHH or CDH 17 protein.
[0084] Fig. 4 demonstrates that the novel anti-CDH17 VHH-CAR T cells was able to achieve potent killing effect on BON cells. In vitro cytotoxicity of new anti-CDH17 VHH-CARTs on BON tumor cells, using LDH release assay 20 h after co-culture. Data are presented as the mean ± s.d. (n = 3).
[0085] Figs. 5A-5E demonstrate that the novel anti-CDH17 VHH-CAR T cells was able to eliminated BON tumors in vivo without cause significant changes in the body weight of the treated animals, in accordance with some embodiments. Figs. 5A-5D: Each anti-CDH17 VHH- CAR T cells were collected and infused into mice with BON tumors 5 days after virus transduction. Tumor volume was detected twice a week. Data are presented as mean ± s.d. (n=2 per group). Fig. 5E: Apart from VHH166 (data not shown), the anti-CDH17 VHH-CAR T cells did not cause significant changes in the body weight of the treated mice.
[0086] Figs. 6A-6C demonstrate that VHH115-CAR T cells eliminated colorectal cancer (HT29) tumors in vivo, in accordance with some embodiments. Fig. 6A: HT29 cells were transduced with lentivirus expressing CDH17, followed by sorting of the CDH17 positive cells. Flow cytometry analysis of VHH1 binding to control or sorted CDH17-expressing HT29 cells. Figs. 6B-6C: Control or CDH17 expressing HT29 cells were inoculated to each side of the flank of NSG mice, and the mice were treated with UTD, VHH1 or VHH115 CAR T cells by tail vein injection. Tumor volume was detected twice a week. Data are presented as mean ± s.d. (n=5 per group).
[0087] Figs. 7A-7B: Amino acid sequences of sixteen (16) anti-CDH17 VHH nanobodies identified in the screening, in accordance with some embodiments. The sequences shown in Fig. 7 are also set forth in SEQ ID NOs: 1, 5, 9, 13, 17, 21, 25, 29, 33, 37, 41, 45, 49, 53, 57, 61 and 65, described herein.
[0088] Figs. 8A-8B: Initial characterization of binding affinities (as assayed according to the mean fluorescence intensities or MFI) of various VHHs binding to BON cells via flow assay, in accordance with some embodiments.
[0089] Fig. 9: Initial characterization of binding affinities (as assayed according to the mean fluorescence intensities or MFI) of various VHHCARs binding to exogenous CDH17 protein with his tag via flow assay, in accordance with some embodiments.
[0090] Fig. 10 demonstrates that some non-limiting examples of the CDH17CAR T cells herein eradicated colorectal cancer (Caco2) tumor xenografts in vivo, in accordance with some embodiments. Fig. 11 : The construction of several non-limiting examples of the chimeric antigen receptors (CARs), in accordance with some embodiments.
[0091] Fig. 12 illustrates a proposed mechanism of the selective killing of the CDH17CAR T cells herein against CDH17-expressing tumor cells while sparing CDH 17-positive normal cells such as the cells of the intestine epithelium (IE), in accordance with some embodiments.
[0092] Figs. 13A-13C illustrate certain aspects of the evaluation of BON tumor xenografts with CAR-Ts against CDH17, in accordance with some embodiments. Fig. 13A: Schematic of timelines in mice tumor formation and CART injections. Figs. 13B: Tumor volume post CAR-T injections. Injections were done using the VHH 150 (n=8 tumors, 4 mice), VHH 115 (n=6 tumors, 3 mice), VHH1 (n=2 tumors, 1 mouse) and VHH95 (n=2 tumors, 1 mouse) CAR T cells. Fig. 13C: Body weight changes in the indicated mice post CAR-T injections.
[0093] Figs. 14A-14B illustrate certain aspects of the evaluation of the antitumor efficacy of CDH17-targeting CAR-T cells against HT29-HCDH17 xenografts in NSG mice, in accordance with some embodiments. Fig. 14A: Schematic of the experimental design. NSG mice were subcutaneously engrafted with HT29-HCDH17 tumor cells (1 x 107cells per flank) and subsequently treated via intravenous injection with either untransduced T cells (UTD) or CDH17-specific CAR-T cells (VHH1 or VHH214). Fig. 14B: Tumor growth curves showing volume progression over time in mice treated with UTD or CAR-T cells (n = 6 tumors per group)
[0094] DETAILED DESCRIPTION
[0095] The following disclosure provides many different embodiments, or examples, for implementing different features of the provided subject matter. Specific examples of components and arrangements are described below to simplify the present disclosure. These are, of course, merely examples and are not intended to be limiting. For example, the formation of a first feature over or on a second feature in the description that follows may include embodiments in which the first and second features are formed in direct contact, and may also include embodiments in which additional features may be formed between the first and second features, such that the first and second features may not be in direct contact. In addition, the present disclosure may repeat reference numerals and / or letters in the various examples. This repetition is for the purpose of simplicity and clarity and does not in itself dictate a relationship between the various embodiments and / or configurations discussed.
[0096] It was discovered that cadherin 17 (CDH17) is a potential target for treating various gastrointestinal cancers (GICs). Specifically, many GICs, including neuroendocrine tumors (NETs), gastric cancer (GC), pancreatic cancer (PC), and colorectal cancers (CRC), frequently express high levels of CDH17 on the cell surface.
[0097] In the study described herein (“the present study”), sixteen (16) CDH17-specific VHHs (Variable Heavy domain of Heavy chain) were obtained by immunizing llamas and then isolating CDH17 positive clones from phage libraries displaying VHHs from the llama peripheral blood mononuclear cells (PBMCs). The VHHs were characterized, and used to construct chimeric antigen receptors (CARs) and CAR-T cells.
[0098] Notably, it was discovered that targeting CDH17 (with e.g. the CDH17-specific CAR T cells herein) was effective in treating CDH 17-positive cancers without significant affecting normal cells, including CDH 17-positive normal cells.
[0099] Accordingly, in some aspects, the present invention is directed to an antigen binding polypeptide that specifically binds to CDH17, as well as conjugates comprising the antigen binding polypeptide.
[0100] In some aspects, the present invention is directed to a chimeric antigen receptor (CAR) that specifically recognizes CDH17, as well as nucleotides encoding the CAR.
[0101] In some aspects, the present invention is directed to a CAR-T cell that specifically recognizes CDH17, and / or specifically killing CDH 17-positive cancer cells.
[0102] In some aspects, the present invention is directed to a method of treating a disease caused by or involves CDH17 positive cells, such as CDH 17-positive cancers.
[0103] Definitions
[0104] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although any methods and materials similar or equivalent to those described herein can be used in the practice for testing of the present invention, the preferred materials and methods are described herein. In describing and claiming the present invention, the following terminology will be used. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.
[0105] The articles “a” and “an” are used herein to refer to one or to more than one (z.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element.
[0106] “About” as used herein when referring to a measurable value such as an amount, a temporal duration, and the like, is meant to encompass variations of ±20%, ±10%, ±5%, ±1%, or ±0.1% from the specified value, as such variations are appropriate to perform the disclosed methods.
[0107] The term “antibody,” as used herein, refers to an immunoglobulin molecule which specifically binds with an antigen. Antibodies can be intact immunoglobulins derived from natural sources or from recombinant sources and can be immunoreactive portions of intact immunoglobulins. Antibodies are typically tetramers of immunoglobulin molecules. The antibodies in the present invention may exist in a variety of forms including, but not limit to, heavy-chain antibodies and single-domain antibodies (sdAbs) (e.g., nanobodies), as well as humanized antibodies (Harlow et al., 1999, In: Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY; Harlow et al., 1989, In: Antibodies: A Laboratory Manual, Cold Spring Harbor, New York; Houston et al., 1988, Proc. Natl. Acad. Sci. USA 85:5879-5883; Bird et al., 1988, Science 242:423-426).
[0108] An “antibody heavy chain,” as used herein, refers to the larger of the two types of polypeptide chains present in all antibody molecules in their naturally occurring conformations. Some species, such as those in the Camelidae family, produce antibodies that include only the heavy chain (heavy-chain antibody).
[0109] An “antibody light chain,” as used herein, refers to the smaller of the two types of polypeptide chains present in all antibody molecules in their naturally occurring conformations, a and 0 light chains refer to the two major antibody light chain isotypes.
[0110] As used herein, the term “autologous” is meant to refer to any material derived from the same individual to which it is later to be re-introduced into the individual.
[0111] “Allogeneic” refers to any material derived from a different animal of the same species.
[0112] The term “chimeric antigen receptor” or “CAR,” as used herein, refers to an artificial T cell receptor that is engineered to be expressed on an immune effector cell and specifically bind an antigen. CARs may be used as a therapy with adoptive cell transfer. T cells are removed from a patient and modified so that they express the receptors specific to a particular form of antigen. In some embodiments, the CAR has specificity to a selected target, for example a tumor antigen. CARs may also comprise an intracellular activation domain, a transmembrane domain and an extracellular domain comprising an antigen binding region.
[0113] “Co-stimulatory ligand,” as the term is used herein, includes a molecule on an antigen presenting cell (e.g., an aAPC, dendritic cell, B cell, and the like) that specifically binds a cognate co-stimulatory molecule on a T cell, thereby providing a signal which, in addition to the primary signal provided by, for instance, binding of a TCR / CD3 complex with an MHC molecule loaded with peptide, mediates a T cell response, including, but not limited to, proliferation, activation, differentiation, and the like. A co-stimulatory ligand can include, but is not limited to, CD7, B7-1 (CD80), B7-2 (CD86), PD-L1, PD-L2, 4-1BBL, OX40L, inducible costimulatory ligand (ICOS-L), intercellular adhesion molecule (ICAM), CD30L, CD40, CD70, CD83, HLA-G, MICA, MICB, HVEM, lymphotoxin beta receptor, 3 / TR6, ILT3, ILT4, HVEM, an agonist or antibody that binds Toll ligand receptor and a ligand that specifically binds with B7-H3. A co-stimulatory ligand also encompasses, inter alia, an antibody that specifically binds with a co-stimulatory molecule present on a T cell, such as, but not limited to, CD27, CD28, 4- 1BB, 0X40, CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, and a ligand that specifically binds with CD83.
[0114] A “co-stimulatory molecule” refers to the cognate binding partner on a T cell that specifically binds with a co-stimulatory ligand, thereby mediating a co-stimulatory response by the T cell, such as, but not limited to, proliferation. Co-stimulatory molecules include, but are not limited to an MHC class I molecule, BTLA and a Toll ligand receptor.
[0115] A “co-stimulatory signal”, as used herein, refers to a signal, which in combination with a primary signal, such as TCR / CD3 ligation, leads to T cell proliferation and / or upregulation or downregulation of key molecules.
[0116] A “disease” is a state of health of an animal wherein the animal cannot maintain homeostasis, and wherein if the disease is not ameliorated then the animal’s health continues to deteriorate. In contrast, a “disorder” in an animal is a state of health in which the animal is able to maintain homeostasis, but in which the animal’s state of health is less favorable than it would be in the absence of the disorder. Left untreated, a disorder does not necessarily cause a further decrease in the animal’s state of health.
[0117] “Effective amount” or “therapeutically effective amount” are used interchangeably herein, and refer to an amount of a compound, formulation, material, or composition, as described herein effective to achieve a particular biological result or provides a therapeutic or prophylactic benefit. Such results may include, but are not limited to an amount that when administered to a mammal, causes a detectable level of immune suppression or tolerance compared to the immune response detected in the absence of the composition of the invention. The immune response can be readily assessed by a plethora of art-recognized methods. The skilled artisan would understand that the amount of the composition administered herein varies and can be readily determined based on a number of factors such as the disease or condition being treated, the age and health and physical condition of the mammal being treated, the severity of the disease, the particular compound being administered, and the like.
[0118] “Encoding” refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (z.e., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom. Thus, a gene encodes a protein if transcription and translation of mRNA corresponding to that gene produces the protein in a cell or other biological system. Both the coding strand, the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings, and the non-coding strand, used as the template for transcription of a gene or cDNA, can be referred to as encoding the protein or other product of that gene or cDNA.
[0119] As used herein “endogenous” refers to any material from or produced inside an organism, cell, tissue or system.
[0120] The term “epitope” as used herein is defined as a small chemical molecule on an antigen that can elicit an immune response, inducing B and / or T cell responses. An antigen can have one or more epitopes. Most antigens have many epitopes; i.e., they are multivalent. In general, an epitope is roughly about 10 amino acids and / or sugars in size. Preferably, the epitope is about 4- 18 amino acids, more preferably about 5-16 amino acids, and even more most preferably 6-14 amino acids, more preferably about 7-12, and most preferably about 8-10 amino acids. One skilled in the art understands that generally the overall three-dimensional structure, rather than the specific linear sequence of the molecule, is the main criterion of antigenic specificity and therefore distinguishes one epitope from another. Based on the present disclosure, a peptide of the present invention can be an epitope.
[0121] As used herein, the term “exogenous” refers to any material introduced from or produced outside an organism, cell, tissue or system.
[0122] The term “expand” as used herein refers to increasing in number, as in an increase in the number of T cells. In one embodiment, the T cells that are expanded ex vivo increase in number relative to the number originally present in the culture. In another embodiment, the T cells that are expanded ex vivo increase in number relative to other cell types in the culture. The term "ex vivo " as used herein, refers to cells that have been removed from a living organism, (e.g., a human) and propagated outside the organism (e.g., in a culture dish, test tube, or bioreactor).
[0123] The term “expression” as used herein is defined as the transcription and / or translation of a particular nucleotide sequence driven by its promoter.
[0124] “Expression vector” refers to a vector comprising a recombinant polynucleotide comprising expression control sequences operatively linked to a nucleotide sequence to be expressed. An expression vector comprises sufficient cis-acting elements for expression; other elements for expression can be supplied by the host cell or in an in vitro expression system. Expression vectors include all those known in the art, such as cosmids, plasmids (e.g., naked or contained in liposomes) and viruses e.g., Sendai viruses, lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) that incorporate the recombinant polynucleotide.
[0125] “Identity” as used herein refers to the subunit sequence identity between two polymeric molecules particularly between two amino acid molecules, such as, between two polypeptide molecules. When two amino acid sequences have the same residues at the same positions; e.g., if a position in each of two polypeptide molecules is occupied by an arginine, then they are identical at that position. The identity or extent to which two amino acid sequences have the same residues at the same positions in an alignment is often expressed as a percentage. The identity between two amino acid sequences is a direct function of the number of matching or identical positions; e.g., if half (e.g., five positions in a polymer ten amino acids in length) of the positions in two sequences are identical, the two sequences are 50% identical; if 90% of the positions (e.g., 9 of 10), are matched or identical, the two amino acids sequences are 90% identical.
[0126] The term “immunoglobulin” or “Ig,” as used herein is defined as a class of proteins, which function as antibodies. Antibodies expressed by B cells are sometimes referred to as the BCR (B cell receptor) or antigen receptor. The five members included in this class of proteins are IgA, IgG, IgM, IgD, and IgE. IgA is the primary antibody that is present in body secretions, such as saliva, tears, breast milk, gastrointestinal secretions and mucus secretions of the respiratory and genitourinary tracts. IgG is the most common circulating antibody. IgM is the main immunoglobulin produced in the primary immune response in most subjects. It is the most efficient immunoglobulin in agglutination, complement fixation, and other antibody responses, and is important in defense against bacteria and viruses. IgD is the immunoglobulin that has no known antibody function, but may serve as an antigen receptor. IgE is the immunoglobulin that mediates immediate hypersensitivity by causing release of mediators from mast cells and basophils upon exposure to allergen.
[0127] The term “immune response” as used herein is defined as a cellular response to an antigen that occurs when lymphocytes identify antigenic molecules as foreign and induce the formation of antibodies and / or activate lymphocytes to remove the antigen.
[0128] The term “immunostimulatory” is used herein to refer to increasing overall immune response.
[0129] The term “immunosuppressive” is used herein to refer to reducing overall immune response.
[0130] “Isolated” means altered or removed from the natural state. For example, a nucleic acid or a peptide naturally present in a living animal is not “isolated,” but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its natural state is “isolated.” An isolated nucleic acid or protein can exist in substantially purified form, or can exist in a non-native environment such as, for example, a host cell.
[0131] A “lentivirus” as used herein refers to a genus of the Retroviridae family. Lentiviruses are unique among the retroviruses in being able to infect non-dividing cells; they can deliver a significant amount of genetic information into the DNA of the host cell, so they are one of the most efficient methods of a gene delivery vector. HIV, SIV, and FIV are all examples of lentiviruses. Vectors derived from lentiviruses offer the means to achieve significant levels of gene transfer in vivo.
[0132] The term “limited toxicity” as used herein, refers to the peptides, polynucleotides, cells and / or antibodies of the invention manifesting a lack of substantially negative biological effects, anti-tumor effects, or substantially negative physiological symptoms toward a healthy cell, nontumor cell, non-diseased cell, non-target cell or population of such cells either in vitro or in vivo.
[0133] By the term “modified” as used herein, is meant a changed state or structure of a molecule or cell of the invention. Molecules may be modified in many ways, including chemically, structurally, and functionally. Cells may be modified through the introduction of nucleic acids.
[0134] By the term “modulating,” as used herein, is meant mediating a detectable increase or decrease in the level of a response in a subject compared with the level of a response in the subject in the absence of a treatment or compound, and / or compared with the level of a response in an otherwise identical but untreated subject. The term encompasses perturbing and / or affecting a native signal or response thereby mediating a beneficial therapeutic response in a subject, preferably, a human.
[0135] In the context of the present invention, the following abbreviations for the commonly occurring nucleic acid bases are used. “A” refers to adenosine, “C” refers to cytosine, “G” refers to guanosine, “T” refers to thymidine, and “U” refers to uridine.
[0136] Unless otherwise specified, a “nucleotide sequence encoding an amino acid sequence” includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. The phrase nucleotide sequence that encodes a protein or an RNA may also include introns to the extent that the nucleotide sequence encoding the protein may in some version contain an intron(s).
[0137] “Parenteral” administration of an immunogenic composition includes, e.g, subcutaneous (s.c.), intravenous (i.v.), intramuscular (i.m.), or intrastemal injection, or infusion techniques.
[0138] The term “polynucleotide” as used herein is defined as a chain of nucleotides. Furthermore, nucleic acids are polymers of nucleotides. Thus, nucleic acids and polynucleotides as used herein are interchangeable. One skilled in the art has the general knowledge that nucleic acids are polynucleotides, which can be hydrolyzed into the monomeric “nucleotides.” The monomeric nucleotides can be hydrolyzed into nucleosides. As used herein polynucleotides include, but are not limited to, all nucleic acid sequences which are obtained by any means available in the art, including, without limitation, recombinant means, i.e., the cloning of nucleic acid sequences from a recombinant library or a cell genome, using ordinary cloning technology and PCR™, and the like, and by synthetic means.
[0139] As used herein, the terms “peptide,” “polypeptide,” and “protein” are used interchangeably, and refer to a compound comprised of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids that can comprise a protein’s or peptide’s sequence. Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds. As used herein, the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types. “Polypeptides” include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, among others. The polypeptides include natural peptides, recombinant peptides, synthetic peptides, or a combination thereof.
[0140] By the term “specifically binds,” as used herein with respect to an antibody, is meant an antibody which recognizes a specific antigen, but does not substantially recognize or bind other molecules in a sample. For example, an antibody that specifically binds to an antigen from one species may also bind to that antigen from one or more species. But, such cross-species reactivity does not itself alter the classification of an antibody as specific. In another example, an antibody that specifically binds to an antigen may also bind to different allelic forms of the antigen. However, such cross reactivity does not itself alter the classification of an antibody as specific. In some instances, the terms “specific binding” or “specifically binding,” can be used in reference to the interaction of an antibody, a protein, or a peptide with a second chemical species, to mean that the interaction is dependent upon the presence of a particular structure (e.g., an antigenic determinant or epitope) on the chemical species; for example, an antibody recognizes and binds to a specific protein structure rather than to proteins generally. If an antibody is specific for epitope “A”, the presence of a molecule containing epitope A (or free, unlabeled A), in a reaction containing labeled “A” and the antibody, will reduce the amount of labeled A bound to the antibody.
[0141] By the term “stimulation,” is meant a primary response induced by binding of a stimulatory molecule (e.g., a TCR / CD3 complex) with its cognate ligand thereby mediating a signal transduction event, such as, but not limited to, signal transduction via the TCR / CD3 complex. Stimulation can mediate altered expression of certain molecules, such as downregulation of TGF-beta, and / or reorganization of cytoskeletal structures, and the like.
[0142] A “stimulatory molecule,” as the term is used herein, means a molecule on a T cell that specifically binds with a cognate stimulatory ligand present on an antigen presenting cell.
[0143] A “stimulatory ligand,” as used herein, means a ligand that when present on an antigen presenting cell (e.g., an aAPC, a dendritic cell, a B-cell, and the like) can specifically bind with a cognate binding partner (referred to herein as a “stimulatory molecule”) on a T cell, thereby mediating a primary response by the T cell, including, but not limited to, activation, initiation of an immune response, proliferation, and the like. Stimulatory ligands are well-known in the art and encompass, inter alia, an MHC Class I molecule loaded with a peptide, an anti-CD3 antibody, a superagonist anti-CD28 antibody, and a superagonist anti-CD2 antibody.
[0144] The term “subject” is intended to include living organisms in which an immune response can be elicited (e.g., mammals). A “subject” or “patient,” as used therein, may be a human or non-human mammal. Non-human mammals include, for example, livestock and pets, such as ovine, bovine, porcine, canine, feline and murine mammals. Preferably, the subject is human.
[0145] As used herein, a “substantially purified” cell is a cell that is essentially free of other cell types. A substantially purified cell also refers to a cell which has been separated from other cell types with which it is normally associated in its naturally occurring state. In some instances, a population of substantially purified cells refers to a homogenous population of cells. In other instances, this term refers simply to cell that have been separated from the cells with which they are naturally associated in their natural state. In some embodiments, the cells are cultured in vitro. In other embodiments, the cells are not cultured in vitro.
[0146] A “target site” or “target sequence” refers to a genomic nucleic acid sequence that defines a portion of a nucleic acid to which a binding molecule may specifically bind under conditions sufficient for binding to occur. As used herein, the term “T cell receptor” or “TCR” refers to a complex of membrane proteins that participate in the activation of T cells in response to the presentation of antigen. The TCR is responsible for recognizing antigens bound to major histocompatibility complex molecules. TCR is composed of a heterodimer of an alpha (a) and beta (p) chain, although in some cells the TCR consists of gamma and delta (y / 8) chains. TCRs may exist in alpha / beta and gamma / delta forms, which are structurally similar but have distinct anatomical locations and functions. Each chain is composed of two extracellular domains, a variable and constant domain. In some embodiments, the TCR may be modified on any cell comprising a TCR, including, for example, a helper T cell, a cytotoxic T cell, a memoiy T cell, regulator,' T cell, natural killer T cell, and gamma delta T cell.
[0147] The term “therapeutic” as used herein means a treatment and / or prophylaxis. A therapeutic effect is obtained by suppression, remission, or eradication of a disease state.
[0148] “Transplant” refers to a biocompatible lattice or a donor tissue, organ or cell, to be transplanted. An example of a transplant may include but is not limited to skin cells or tissue, bone marrow, and solid organs such as heart, pancreas, kidney, lung and liver. A transplant can also refer to any material that is to be administered to a host. For example, a transplant can refer to a nucleic acid or a protein.
[0149] The term “transfected” or “transformed” or “transduced” as used herein refers to a process by which exogenous nucleic acid is transferred or introduced into the host cell. A “transfected” or “transformed” or “transduced” cell is one which has been transfected, transformed or transduced with exogenous nucleic acid. The cell includes the primary subject cell and its progeny.
[0150] To “treat” a disease as the term is used herein, means to reduce the frequency or severity of at least one sign or symptom of a disease or disorder experienced by a subject.
[0151] A “vector” is a composition of matter which comprises an isolated nucleic acid and which can be used to deliver the isolated nucleic acid to the interior of a cell. Numerous vectors are known in the art including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses. Thus, the term “vector” includes an autonomously replicating plasmid or a virus. The term should also be construed to include non-plasmid and non-viral compounds which facilitate transfer of nucleic acid into cells, such as, for example, polylysine compounds, liposomes, and the like. Examples of viral vectors include, but are not limited to, Sendai viral vectors, adenoviral vectors, adeno-associated virus vectors, retroviral vectors, lentiviral vectors, and the like.
[0152] “Xenogeneic” refers to any material derived from an animal of a different species.
[0153] Ranges: throughout this disclosure, various aspects of the invention can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.
[0154] Antigen Binding Polypeptide and Conjugate Comprising the Same
[0155] In some aspects, the instant specification is directed to an antigen binding polypeptide.
[0156] In some embodiments, the antigen binding polypeptide binds to cadherin 17 (CDH17), such as the extracellular domain thereof.
[0157] In some embodiments, the antigen binding polypeptide comprises a variable domain of a heavy-chain antibody (VHH). In some embodiments, the VHH is derived from a Camelidae subject. In some embodiments, the VHH is humanized.
[0158] In some embodiments, the VHH comprises:
[0159] (1) a CDR 1 comprising the sequence set forth in SEQ ID NO:2; a CDR 2 comprising the sequence set forth in SEQ ID NO:3; and a CDR 3 comprising the sequence set forth in SEQ ID NO:4;
[0160] (2) a CDR 1 comprising the sequence set forth in SEQ ID NO:6; a CDR 2 comprising the sequence set forth in SEQ ID NO: 7; and a CDR 3 comprising the sequence set forth in SEQ ID NO: 8;
[0161] (3) a CDR 1 comprising the sequence set forth in SEQ ID NOTO; a CDR 2 comprising the sequence set forth in SEQ ID NO: 11; and a CDR 3 comprising the sequence set forth in SEQ ID NO: 12; (4) a CDR 1 comprising the sequence set forth in SEQ ID NO:14; a CDR 2 comprising the sequence set forth in SEQ ID NO: 15; and a CDR 3 comprising the sequence set forth in SEQ ID NO: 16;
[0162] (5) a CDR 1 comprising the sequence set forth in SEQ ID NO: 18; a CDR 2 comprising the sequence set forth in SEQ ID NO: 19; and a CDR 3 comprising the sequence set forth in SEQ ID NO:20;
[0163] (6) a CDR 1 comprising the sequence set forth in SEQ ID NO:22; a CDR 2 comprising the sequence set forth in SEQ ID NO:23; and a CDR 3 comprising the sequence set forth in SEQ ID NO:24;
[0164] (7) a CDR 1 comprising the sequence set forth in SEQ ID NO:26; a CDR 2 comprising the sequence set forth in SEQ ID NO:27; and a CDR 3 comprising the sequence set forth in SEQ ID NO:28;
[0165] (8) a CDR 1 comprising the sequence set forth in SEQ ID NO:30; a CDR 2 comprising the sequence set forth in SEQ ID NO:31; and a CDR 3 comprising the sequence set forth in SEQ ID NO:32;
[0166] (9) a CDR 1 comprising the sequence set forth in SEQ ID NO:34; a CDR 2 comprising the sequence set forth in SEQ ID NO:35; and a CDR 3 comprising the sequence set forth in SEQ ID NO: 36;
[0167] (10) a CDR 1 comprising the sequence set forth in SEQ ID NO:38; a CDR 2 comprising the sequence set forth in SEQ ID NO:39; and a CDR 3 comprising the sequence set forth in SEQ ID NO:40;
[0168] (11) a CDR 1 comprising the sequence set forth in SEQ ID NO:42; a CDR 2 comprising the sequence set forth in SEQ ID NO:43; and a CDR 3 comprising the sequence set forth in SEQ ID NO:44;
[0169] (12) a CDR 1 comprising the sequence set forth in SEQ ID NO:46; a CDR 2 comprising the sequence set forth in SEQ ID NO:47; and a CDR 3 comprising the sequence set forth in SEQ ID NO:48;
[0170] (13) a CDR 1 comprising the sequence set forth in SEQ ID NO:50; a CDR 2 comprising the sequence set forth in SEQ ID NO:51; and a CDR 3 comprising the sequence set forth in SEQ ID NO: 52; (14) a CDR 1 comprising the sequence set forth in SEQ ID NO:54; a CDR 2 comprising the sequence set forth in SEQ ID NO:55; and a CDR 3 comprising the sequence set forth in SEQ ID NO:56;
[0171] (15) a CDR 1 comprising the sequence set forth in SEQ ID NO:58; a CDR 2 comprising the sequence set forth in SEQ ID NO:59; and a CDR 3 comprising the sequence set forth in SEQ ID NO: 60;
[0172] (16) a CDR 1 comprising the sequence set forth in SEQ ID NO:62; a CDR 2 comprising the sequence set forth in SEQ ID NO:63; and a CDR 3 comprising the sequence set forth in SEQ ID NO: 64;
[0173] (17) a CDR 1 comprising the sequence set forth in SEQ ID NO:66; a CDR 2 comprising the sequence set forth in SEQ ID NO:67; and a CDR 3 comprising the sequence set forth in SEQ ID NO: 68.
[0174] In some embodiments, the VHH comprises an amino acid sequence having about 80% identity or more, about 85% identity or more, about 90% identity or more, about 95% identity or more, about 96% identity or more, about 97% identity or more, about 98% identity or more, about 99% identity or more, or 100% identity to SEQ ID NO: 1, 5, 9, 13, 17, 21, 25, 29, 33, 37, 41, 45, 49, 53, 57, 61 or 65.
[0175] In some embodiments, the VHH comprises an amino acid sequence having about 90% identity or more, about 85% identity or more, about 90% identity or more, about 95% identity or more, about 96% identity or more, about 97% identity or more, about 98% identity or more, about 99% identity or more, or 100% identity to SEQ ID NO:1; and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:2; a CDR 2 comprising the sequence set forth in SEQ ID NO:3; and a CDR 3 comprising the sequence set forth in SEQ ID NO:4;
[0176] In some embodiments, the VHH comprises an amino acid sequence having about 90% identity or more, about 85% identity or more, about 90% identity or more, about 95% identity or more, about 96% identity or more, about 97% identity or more, about 98% identity or more, about 99% identity or more, or 100% identity to SEQ ID NO:5, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:6; a CDR 2 comprising the sequence set forth in SEQ ID NO:7; and a CDR 3 comprising the sequence set forth in SEQ ID NO:8.
[0177] In some embodiments, the VHH comprises an amino acid sequence having about 90% identity or more, about 85% or more, about 90% identity or more, about 95% identity or more, about 96% identity or more, about 97% identity or more, about 98% identity or more, about 99% identity or more, or 100% identity to SEQ ID NO: 10, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO: 10; a CDR 2 comprising the sequence set forth in SEQ ID NO: 11; and a CDR 3 comprising the sequence set forth in SEQ ID NO: 12.
[0178] In some embodiments, the VHH comprises an amino acid sequence having about 90% identity or more, about 85% identity or more, about 90% identity or more, about 95% identity or more, about 96% identity or more, about 97% identity or more, about 98% identity or more, about 99% identity or more, or 100% identity to SEQ ID NO: 13, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO: 14; a CDR 2 comprising the sequence set forth in SEQ ID NO: 15; and a CDR 3 comprising the sequence set forth in SEQ ID NO: 16.
[0179] In some embodiments, the VHH comprises an amino acid sequence having about 90% identity or more, about 85% identity or more, about 90% identity or more, about 95% identity or more, about 96% identity or more, about 97% identity or more, about 98% identity or more, about 99% identity or more, or 100% identity to SEQ ID NO: 17, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO: 18; a CDR 2 comprising the sequence set forth in SEQ ID NO: 19; and a CDR 3 comprising the sequence set forth in SEQ ID NO:20.
[0180] In some embodiments, the VHH comprises an amino acid sequence having about 90% identity or more, about 85% identity or more, about 90% identity or more, about 95% identity or more, about 96% identity or more, about 97% identity or more, about 98% identity or more, about 99% identity or more, or 100% identity to SEQ ID NO:21, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:22; a CDR 2 comprising the sequence set forth in SEQ ID NO:23; and a CDR 3 comprising the sequence set forth in SEQ ID NO:24.
[0181] In some embodiments, the VHH comprises an amino acid sequence having about 90% identity or more, about 85% identity or more, about 90% identity or more, about 95% identity or more, about 96% identity or more, about 97% identity or more, about 98% identity or more, about 99% identity or more, or 100% identity to SEQ ID NO:25, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:26; a CDR 2 comprising the sequence set forth in SEQ ID NO:27; and a CDR 3 comprising the sequence set forth in SEQ ID NO:28.
[0182] In some embodiments, the VHH comprises an amino acid sequence having about 90% identity or more, about 85% identity or more, about 90% identity or more, about 95% identity or more, about 96% identity or more, about 97% identity or more, about 98% identity or more, about 99% identity or more, or 100% identity to SEQ ID NO:30, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:30; a CDR 2 comprising the sequence set forth in SEQ ID NO:31; and a CDR 3 comprising the sequence set forth in SEQ ID NO:32.
[0183] In some embodiments, the VHH comprises an amino acid sequence having about 90% identity or more, about 85% identity or more, about 90% identity or more, about 95% identity or more, about 96% identity or more, about 97% identity or more, about 98% identity or more, about 99% identity or more, or 100% identity to SEQ ID NO:33, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:34; a CDR 2 comprising the sequence set forth in SEQ ID NO:35; and a CDR 3 comprising the sequence set forth in SEQ ID NO:36.
[0184] In some embodiments, the VHH comprises an amino acid sequence having about 90% identity or more, about 85% identity or more, about 90% identity or more, about 95% identity or more, about 96% identity or more, about 97% identity or more, about 98% identity or more, about 99% identity or more, or 100% identity to SEQ ID NO:37, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:38; a CDR 2 comprising the sequence set forth in SEQ ID NO:39; and a CDR 3 comprising the sequence set forth in SEQ ID NO:40.
[0185] In some embodiments, the VHH comprises an amino acid sequence having about 90% identity or more, about 85% identity or more, about 90% identity or more, about 95% identity or more, about 96% identity or more, about 97% identity or more, about 98% identity or more, about 99% identity or more, or 100% identity to SEQ ID NO:41, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:42; a CDR 2 comprising the sequence set forth in SEQ ID NO:43; and a CDR 3 comprising the sequence set forth in SEQ ID NO:44.
[0186] In some embodiments, the VHH comprises an amino acid sequence having about 90% identity or more, about 85% identity or more, about 90% identity or more, about 95% identity or more, about 96% identity or more, about 97% identity or more, about 98% identity or more, about 99% identity or more, or 10% identity to SEQ ID NO:45, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:46; a CDR 2 comprising the sequence set forth in SEQ ID NO:47; and a CDR 3 comprising the sequence set forth in SEQ ID NO:48.
[0187] In some embodiments, the VHH comprises an amino acid sequence having about 90% identity or more, about 85% identity or more, about 90% identity or more, about 95% identity or more, about 96% identity or more, about 97% identity or more, about 98% identity or more, about 99% identity or more, or 100% identity to SEQ ID NO:49, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:50; a CDR 2 comprising the sequence set forth in SEQ ID NO:51; and a CDR 3 comprising the sequence set forth in SEQ ID NO:52.
[0188] In some embodiments, the VHH comprises an amino acid sequence having about 90% identity or more, about 85% identity or more, about 90% identity or more, about 95% identity or more, about 96% identity or more, about 97% identity or more, about 98% identity or more, about 99% identity or more, or 100% identity to SEQ ID NO:53, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:54; a CDR 2 comprising the sequence set forth in SEQ ID NO:55; and a CDR 3 comprising the sequence set forth in SEQ ID NO:56.
[0189] In some embodiments, the VHH comprises an amino acid sequence having about 90% identity or more, about 85% identity or more, about 90% identity or more, about 95% identity or more, about 96% identity or more, about 97% identity or more, about 98% identity or more, about 99% identity or more, or 100% identity to SEQ ID NO:57, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:58; a CDR 2 comprising the sequence set forth in SEQ ID NO:59; and a CDR 3 comprising the sequence set forth in SEQ ID NO:60.
[0190] In some embodiments, the VHH comprises an amino acid sequence having about 90% identity or more, about 85% identity or more, about 90% identity or more, about 95% identity or more, about 96% identity or more, about 97% identity or more, about 98% identity or more, about 99% identity or more, or 100% identity to SEQ ID NO:61, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:62; a CDR 2 comprising the sequence set forth in SEQ ID NO:63; and a CDR 3 comprising the sequence set forth in SEQ ID NO:64.
[0191] In some embodiments, the VHH comprises an amino acid sequence having about 90% identity or more, about 85% identity or more, about 90% identity or more, about 95% identity or more, about 96% identity or more, about 97% identity or more, about 98% identity or more, about 99% identity or more, or 100% identity to SEQ ID NO:65, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:66; a CDR 2 comprising the sequence set forth in SEQ ID NO:67; and a CDR 3 comprising the sequence set forth in SEQ ID NO:68.
[0192]
[0193] In some embodiments, the antigen binding polypeptide is an antibody molecule, such as a heavy-chain antibody, a single-domain antibody (sdAb) (also referred to as a nanobody), or the VHH (i.e., the antigen binding polypeptide consists one of the VHHs described herein).
[0194] In some embodiments, the VHH is derived from a camelid heavy-chain antibody. In some embodiments, the VHH is humanized. However, in addition, due to the relatively high homology of camelid VHHs to human VH4, humanization of camelid VHHs is not needed according to some embodiments herein. That said, humanizing VHHs is described in, for example, Conrath et al. (J Mol Biol. 2005 Jul l;350(l): 112-25), Vincke et al. (J Biol Chem. 2009 Jan 30;284(5):3273-3284), Soler et al. (Biomolecules. 2021 Jan 26; 11(2): 163), Rossotti et al. (FEBSJ. 2022 Jul;289(14):4304-4327), Belanger et al. (Protein Eng Des Sei. 2021 Feb 15:34:gzab012), and Kim et al. (Adv Drug Deliv Rev . 2023 Apr:195:l 14726). The entireties of these references are hereby incorporated herein by reference.
[0195] In some embodiments, the antigen binding polypeptide herein or the VHH thereof binds to the extracellular portion of CDH17.
[0196] In some embodiments, the antigen binding polypeptide or VHH herein binds to the ECI domain of CDH17. In some embodiments, the antigen binding polypeptide herein or the VHH thereof binds to the EC2 domain of CDH17. In some embodiments, the antigen binding polypeptide herein or the VHH thereof binds to the EC3 domain of CDH17. In some embodiments, the antigen binding polypeptide herein or the VHH thereof binds to the EC4 domain of CDH17. In some embodiments, the antigen binding polypeptide herein or the VHH thereof binds to the EC5 domain of CDH17. In some embodiments, the antigen binding polypeptide herein or the VHH thereof binds to the EC6 domain of CDH17. In some embodiments, the antigen binding polypeptide herein or the VHH thereof binds to the EC7 domain of CDH17. In some embodiments, the antigen binding polypeptide or VHH herein binds to more than one domain or region between two adjacent domains (e.g., EC1-2, EC3-4, EC-4-5, etc.) In some aspects, the present invention is directed to a conjugate comprising the antigen binding polypeptide.
[0197] In some embodiments, the conjugate comprises a drug, a toxin, a radioisotope, or combinations thereof attached to the antigen binding polypeptide.
[0198] In some embodiments, the conjugate is an antibody drug conjugate (ADCs). In some embodiments, the ADC comprises an antibody, which comprises one or more of the VHHs herein, linked / conjugated to a drug (e.g. a cancer cell-killing drug), a toxin, or a radioisotope
[0199] In some embodiments, the antigen binding polypeptide herein is linked / conjugated to any drug or cancer targeting agent known to one of skill in the art, including but not limited to maytansinoid (DM1), or SSTR2 -binding octreotide, or toxin, including but not limited to paclitaxel, auristatin (MMAE and MMAF), dauxrubicin, duocarmycin A, 5-fluoruracil, methotrexate, tubulin polymerization inhibitors, ravtansine (DM4), Ricin A. The polypeptide herein may also be linked to radioactive isotopes, including but not limited to 90Y and 177Lu, 11 Un, and such ADC can also be used for imaging applications (e.g. imaging cancer cells).
[0200] Chimeric Antigen Receptor (CAR) and Nucleic Acid Encoding the Same
[0201] In some aspects, the present invention is directed to a chimeric antigen receptor (CAR).
[0202] In some embodiments, the CAR comprises an antigen binding domain targeting CDH17, a transmembrane domain, and an intracellular signaling domain.
[0203] In some embodiments, the CAR further comprises a hinge domain.
[0204] Antigen Binding Domain
[0205] In some embodiments, the antigen binding domain is the same as or similar to the antigen binding polypeptide or VHH described elsewhere herein, such as in the “Antigen Binding Polypeptide and Conjugate Comprising the Same” section.
[0206] Transmembrane Domain and Hinge Domain
[0207] With respect to the transmembrane domain, the CAR is designed to comprise a transmembrane domain that connects the antigen binding domain of the CAR to the intracellular domain. In one embodiment, the transmembrane domain is naturally associated with one or more of the domains in the CAR. In some instances, the transmembrane domain can be selected or modified by amino acid substitution to avoid binding of such domains to the transmembrane domains of the same or different surface membrane proteins to minimize interactions with other members of the receptor complex.
[0208] The transmembrane domain may be derived either from a natural or from a synthetic source. Where the source is natural, the domain may be derived from any membrane-bound or transmembrane protein. Transmembrane regions of particular use in this invention may be derived from (i.e. comprise at least the transmembrane region(s) of) the alpha, beta or zeta chain of the T-cell receptor, CD28, ICOS, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154, Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, and TLR9.
[0209] The transmembrane domains described herein be combined with any of the antigen binding domains described herein, any of the intracellular domains or cytoplasmic domains described herein, or any of the other domains described herein that may be included in the CAR.
[0210] In some instances, a variety of hinges can be employed as well including but not limited to the Ig (immunoglobulin) hinge, and the CD8 hinge. The transmembrane domain may be combined with any hinge domain and / or may comprise one or more transmembrane domains described herein. In one embodiment, the transmembrane domain comprises a CD8 transmembrane domain. In another embodiment, the transmembrane domain comprises a CD8 hinge domain and a CD8 transmembrane domain. In certain embodiments, the hinge domain is selected from the group consisting of a CD8 hinge, an IgG3s hinge, and an IgG4 or analog hinge.
[0211] In one embodiment, the transmembrane domain may be synthetic, in which case it will comprise predominantly hydrophobic residues such as leucine and valine. Preferably a triplet of phenylalanine, tryptophan and valine will be found at each end of a synthetic transmembrane domain.
[0212] Between the extracellular domain and the transmembrane domain of the CAR, or between the intracellular domain and the transmembrane domain of the CAR, there may be incorporated a spacer domain. As used herein, the term “spacer domain” generally means any oligo- or polypeptide that functions to link the transmembrane domain to, either the extracellular domain or, the cytoplasmic domain in the polypeptide chain. A spacer domain may comprise up to 300 amino acids, preferably 10 to 100 amino acids and most preferably 25 to 50 amino acids. Intracellular Signaling Domain
[0213] The intracellular signaling domain or otherwise the cytoplasmic domain of the CAR is responsible for activation of the cell in which the CAR is expressed. Examples of an intracellular domain for use in the invention include, but are not limited to, the cytoplasmic portion of a surface receptor, co-stimulatory molecule, and any molecule that acts in concert to initiate signal transduction in the T cell, as well as any derivative or variant of these elements and any synthetic sequence that has the same functional capability.
[0214] The intracellular signaling domain of the chimeric membrane protein is responsible for activation of at least one of effector functions of the T cell. While usually the entire intracellular signaling domain can be employed, in many cases it is not necessary to use the entire chain. To the extent that a truncated portion of the intracellular signaling domain is used, such truncated portion may be used in place of the intact chain as long as it transduces the effector function signal. The intracellular signaling domain includes any truncated portion of the intracellular signaling domain sufficient to transduce the effector function signal.
[0215] In one embodiment, the intracellular signaling domain of the CAR includes any portion of one or more co-stimulatory molecules, such as at least one signaling domain from CD3, CD8, CD27, CD28, ICOS, 4-IBB, PD-1, any derivative or variant thereof, any synthetic sequence thereof that has the same functional capability, and any combination thereof.
[0216] Examples of the intracellular signaling domain include a fragment or domain from one or more molecules or receptors including, but are not limited to, TCR, CD3 zeta, CD3 gamma, CD3 delta, CD3 epsilon, CD86, common FcR gamma, FcR beta (Fc Epsilon Rib), CD79a, CD79b, Fcgamma Rlla, DAP10, DAP 12, T cell receptor (TCR), CD8, CD27, CD28, 4-IBB (CD137), 0X9, 0X40, CD30, CD40, PD-1, ICOS, a KIR family protein, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, a ligand that specifically binds with CD83, CDS, ICAM-1, GITR, BAFFR, HVEM (LIGHTR), SLAMF7, NKp80 (KLRF1), CD127, CD 160, CD 19, CD4, CD8alpha, CD8beta, IL2R beta, IL2R gamma, IL7R alpha, ITGA4, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD1 Id, ITGAE, CD 103, ITGAL, CD 11 a, LFA-1, ITGAM, CD lib, ITGAX, CD 11c, ITGB1, CD29, ITGB2, CD 18, LFA- 1, ITGB7, TNFR2, TRANCE / RANKL, DNAM1 (CD226), SLAMF4 (CD244, 2B4), CD84, CD 96 (Tactile), CEACAM1, CRT AM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), CD69, SLAMF6 (NTB-A, Lyl08), SLAM (SLAMF1, CD 150, IPO-3), BLAME (SLAMF8), SELPLG (CD 162), LTBR, LAT, GADS, SLP-76, PAG / Cbp, NKp44, NKp30, NKp46, NKG2D, Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, other co-stimulatory molecules described herein, any derivative, variant, or fragment thereof, any synthetic sequence of a co-stimulatory molecule that has the same functional capability, and any combination thereof.
[0217] In certain embodiments, the intracellular signaling domain of the CAR comprises 4- IBB and CD3 zeta.
[0218] The intracellular signaling domains described herein can be combined with any of the antigen binding domains described herein, any of the transmembrane domains described herein, or any of the other domains described herein that may be included in the CAR.
[0219] In certain embodiments, the CAR comprises a signal peptide, an IgG4 mutant (IgG4m) hinge region, a CD28 transmembrane domain (TM), a CD28 intracellular domain, a 4-1BB intracellular domain and CD3zeta intracellular domain.
[0220] In some aspects, the present invention is directed to a nucleic acid encoding the CAR. In some embodiments, the nucleic acid is a DNA molecule. In some embodiments, the nucleic acid is an RNA molecule.
[0221] In some embodiments, the nucleic acid is or is part of a vector, such as an expression vector. Vectors suitable for using as or containing the nucleic acid herein is described elsewhere herein, such as in the “Vectors” section.
[0222] CAR-T Cell
[0223] In some aspects, the present invention is directed to a CAR-T cell.
[0224] In some embodiments, the CAR-T cell express a chimeric antigen receptor, which is the same as or similar to those described elsewhere herein, such as in the “Chimeric Antigen Receptor (CAR) and Nucleotide Encoding the Same” section.
[0225] In some embodiments, the CAR T cell is obtained by introducing the nucleic acid encoding the CAR described elsewhere herein into a T cell, such as by a method described in the “Introduction of Nucleic Acids” section herein.
[0226] Method of Treating Disease or Disorder In some aspects, the present invention is directed to a method of treating a disease or disorder caused by or involves CDH 17-positive cells in a subject in need thereof.
[0227] In some embodiments, the method comprises administering to the subject an effective amount of the antigen binding protein herein, an effective amount of the conjugate herein, or the CAR-T cell herein.
[0228] In some embodiments, the disease or disorder comprises a cancer. In some embodiments, the cancer is a CDH 17-positive cancer.
[0229] The expression of CDH17 in cancers is not strictly associated with the cancer types. As such, the present invention is not limited to one or several cancer types.
[0230] CDH17 is upregulated in some types of cancers, such as gastric cancers, colorectal cancers, and gastrointestinal (GI) neuroendocrine tumors. However, a cancer does not need to involve the upregulation of CDH17 to be targetable by the antigen binding polypeptides, the conjugates, and / or the CAR-T cells. For example, the malignant transformations (the process by which cells acquire the properties of cancer) of CDH17-expressing normal cells expose the CDH17 molecule, which are otherwise packed between cellular tight junctions and largely inaccessible. As such, the malignant transformation of a normal CDH17-expressing cell would render the CDH17 proteins accessible to the polypeptides, conjugates, and / or CAR-T cells herein, even if the level of CDH17 is unchanged or reduced in during the transformation.
[0231] For these reasons, as long as cancer cells express CDH17, such cancer cells are expected to be targetable by the antigen binding proteins, conjugates, and / or CAR-T cells herein. Nonlimiting examples of CDH17-positive cancers include gastrointestinal cancers (GICs) such as neuroendocrine tumors (NETs), gastric cancer (GC), pancreatic cancer (PC), and colorectal cancers (CRC); mucinous ovarian cancer; pancreatic acinar cell carcinoma; cervical adenocarcinoma; bilio-pancreatic adenocarcinomas; pulmonary adenocarcinomas; and the like.
[0232] In some embodiments, the composition, administration, formulation, dosing, and delivery of the antigen binding polypeptide and / or the conjugate herein is described elsewhere herein, such as in the “Pharmaceutical compositions” section, the “Administration / Dosage / Formulations” section, and the “Dosing” section, the “Delivery” section.
[0233] In some embodiments, the CAR-T cells herein are administered to the subject. The method of treatment involving CAR-T cells is described below: In some embodiments, the VHHs described herein are used for specifically delivering compounds to CDH17-expressing cells, such as the GI system. For example, the VHHs described herein can be conjugated with drug molecules to form antibody-drug-conjugates (ADCs) for specifically delivering the drug into CDH17-positive cells. The VHHs described herein can also be conjugated with nanoparticles to form nanoparticle-antibody conjugates for delivering nanoparticles (which can in turn package drug molecules, for example) into CDH17- positive cells. Since autoimmune diseases such as inflammation bowel diseases (IBD), gastric ulcers, as well as some other diseases involves CDH 17-positive cells, the VHHs described herein are useful in treating these diseases, as well.
[0234] Treatment involving CAR-T cells
[0235] The CAR T cells described herein, may be included in a composition for immunotherapy. The composition may include a pharmaceutical composition and further include a pharmaceutically acceptable carrier. A therapeutically effective amount of the pharmaceutical composition comprising the modified T cells may be administered.
[0236] In one aspect, the invention includes a method for adoptive cell transfer therapy comprising administering to a subject in need thereof a modified T cell of the present invention. In another aspect, the invention includes a method of treating a disease or condition in a subject comprising administering to a subject in need thereof a population of modified T cells. In certain embodiments, the disease to be treated is cancer.
[0237] Methods for administration of immune cells for adoptive cell therapy are known and may be used in connection with the provided methods and compositions. For example, adoptive T cell therapy methods are described, e.g., in US Patent Application Publication No. 2003 / 0170238 to Gruenberg et al; US Patent No. 4,690,915 to Rosenberg; Rosenberg (2011) Nat Rev Clin Oncol. 8(10):577-85). See, e.g., Themeli et al. (2013) Nat Biotechnol. 31(10): 928-933; Tsukahara et al. (2013) Biochem Biophys Res Commun 438(1): 84-9; Davila et al. (2013) PLoS ONE 8(4): e61338. In some embodiments, the cell therapy, e.g., adoptive T cell therapy is carried out by autologous transfer, in which the cells are isolated and / or otherwise prepared from the subject who is to receive the cell therapy, or from a sample derived from such a subject. Thus, in some aspects, the cells are derived from a subject, e.g., patient, in need of a treatment and the cells, following isolation and processing are administered to the same subject. In some embodiments, the cell therapy, e.g., adoptive T cell therapy, is carried out by allogeneic transfer, in which the cells are isolated and / or otherwise prepared from a subject other than a subject who is to receive or who ultimately receives the cell therapy, e.g., a first subject. In such embodiments, the cells then are administered to a different subject, e.g., a second subject, of the same species. In some embodiments, the first and second subjects are genetically identical. In some embodiments, the first and second subjects are genetically similar. In some embodiments, the second subject expresses the same HLA class or supertype as the first subject.
[0238] In some embodiments, the subject has been treated with a therapeutic agent targeting the disease or condition, e.g. the tumor, prior to administration of the cells or composition containing the cells. In some aspects, the subject is refractory or non-responsive to the other therapeutic agent. In some embodiments, the subject has persistent or relapsed disease, e.g., following treatment with another therapeutic intervention, including chemotherapy, radiation, and / or hematopoietic stem cell transplantation (HSCT), e.g., allogenic HSCT. In some embodiments, the administration effectively treats the subject despite the subject having become resistant to another therapy.
[0239] In some embodiments, the subject is responsive to the other therapeutic agent, and treatment with the therapeutic agent reduces disease burden. In some aspects, the subject is initially responsive to the therapeutic agent, but exhibits a relapse of the disease or condition over time. In some embodiments, the subject has not relapsed. In some such embodiments, the subject is determined to be at risk for relapse, such as at a high risk of relapse, and thus the cells are administered prophylactically, e.g., to reduce the likelihood of or prevent relapse. In some aspects, the subject has not received prior treatment with another therapeutic agent.
[0240] The modified immune cells of the present invention can be administered to an animal, preferably a mammal, even more preferably a human, to treat a cancer. In addition, the cells of the present invention can be used for the treatment of any condition related to a cancer, especially a cell-mediated immune response against a tumor cell(s), where it is desirable to treat or alleviate the disease. The types of cancers to be treated with the modified cells or pharmaceutical compositions of the invention include, acute myeoloid leukemia, chronic myeloid leukemia, pancreatic neuroenodocrine tumor (PNETs), gastrointestinal NETs, and lung and prostate cancer NETs, carcinoma, blastoma, and sarcoma, and certain leukemia or lymphoid malignancies, benign and malignant tumors, and malignancies e.g., sarcomas, carcinomas, and melanomas. Other exemplary cancers include but are not limited breast cancer, prostate cancer, ovarian cancer, cervical cancer, skin cancer, pancreatic cancer, colorectal cancer, renal cancer, liver cancer, brain cancer, lymphoma, leukemia, lung cancer, thyroid cancer, and the like. The cancers may be non-solid tumors (such as hematological tumors) or solid tumors. Adult tumors / cancers and pediatric tumors / cancers are also included. In one embodiment, the cancer is a solid tumor or a hematological tumor. In one embodiment, the cancer is a carcinoma. In one embodiment, the cancer is a sarcoma. In one embodiment, the cancer is a leukemia. In one embodiment the cancer is a solid tumor. In one embodiment, the cancer is ovarian cancer. In one embodiment, the cancer is endometrial cancer.
[0241] Solid tumors are abnormal masses of tissue that usually do not contain cysts or liquid areas. Solid tumors can be benign or malignant. Different types of solid tumors are named for the type of cells that form them (such as sarcomas, carcinomas, and lymphomas). Examples of solid tumors, such as sarcomas and carcinomas, include fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteosarcoma, and other sarcomas, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, lymphoid malignancy, pancreatic cancer, breast cancer, lung cancers, ovarian cancer, prostate cancer, hepatocellular carcinoma, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, medullary thyroid carcinoma, papillary thyroid carcinoma, pheochromocytomas sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, Wilms' tumor, cervical cancer, testicular tumor, seminoma, bladder carcinoma, melanoma, and CNS tumors (such as a glioma (such as brainstem glioma and mixed gliomas), glioblastoma (also known as glioblastoma multiforme) astrocytoma, CNS lymphoma, germinoma, medulloblastoma, Schwannoma craniopharyogioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, menangioma, neuroblastoma, retinoblastoma and brain metastases).
[0242] Carcinomas that can be amenable to therapy by a method disclosed herein include, but are not limited to, esophageal carcinoma, hepatocellular carcinoma, basal cell carcinoma (a form of skin cancer), squamous cell carcinoma (various tissues), bladder carcinoma, including transitional cell carcinoma (a malignant neoplasm of the bladder), bronchogenic carcinoma, colon carcinoma, colorectal carcinoma, gastric carcinoma, lung carcinoma, including small cell carcinoma and non-small cell carcinoma of the lung, adrenocortical carcinoma, thyroid carcinoma, pancreatic carcinoma, breast carcinoma, ovarian carcinoma, prostate carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinoma, cystadenocarcinoma, medullary carcinoma, renal cell carcinoma, ductal carcinoma in situ or bile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilm's tumor, cervical carcinoma, uterine carcinoma, testicular carcinoma, osteogenic carcinoma, epithelial carcinoma, and nasopharyngeal carcinoma, ovarian cancer, endometrial cancer, uterine sarcoma, cervical carcinoma, breast cancer, lung cancer, prostate cancer, ocular melanoma, and any MISIIR-expressing tumor.
[0243] Sarcomas that can be amenable to therapy by a method disclosed herein include, but are not limited to, fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, chordoma, osteogenic sarcoma, osteosarcoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's sarcoma, leiomyosarcoma, rhabdomyosarcoma, and other soft tissue sarcomas.
[0244] In certain exemplary embodiments, the modified immune cells of the invention are used to treat a myeloma, or a condition related to myeloma. Examples of myeloma or conditions related thereto include, without limitation, light chain myeloma, non-secretory myeloma, monoclonal gamopathy of undertermined significance (MGUS), plasmacytoma (e.g., solitary, multiple solitary, extramedullary plasmacytoma), amyloidosis, and multiple myeloma. In one embodiment, a method of the present disclosure is used to treat multiple myeloma. In one embodiment, a method of the present disclosure is used to treat refractory myeloma. In one embodiment, a method of the present disclosure is used to treat relapsed myeloma.
[0245] In certain exemplary embodiments, the modified immune cells of the invention are used to treat a melanoma, or a condition related to melanoma. Examples of melanoma or conditions related thereto include, without limitation, superficial spreading melanoma, nodular melanoma, lentigo maligna melanoma, acral lentiginous melanoma, amelanotic melanoma, or melanoma of the skin (e.g., cutaneous, eye, vulva, vagina, rectum melanoma). In one embodiment, a method of the present disclosure is used to treat cutaneous melanoma. In one embodiment, a method of the present disclosure is used to treat refractory melanoma. In one embodiment, a method of the present disclosure is used to treat relapsed melanoma. In yet other exemplary embodiments, the modified immune cells of the invention are used to treat a sarcoma, or a condition related to sarcoma. Examples of sarcoma or conditions related thereto include, without limitation, angiosarcoma, chondrosarcoma, Ewing’s sarcoma, fibrosarcoma, gastrointestinal stromal tumor, leiomyosarcoma, liposarcoma, malignant peripheral nerve sheath tumor, osteosarcoma, pleomorphic sarcoma, rhabdomyosarcoma, and synovial sarcoma. In one embodiment, a method of the present disclosure is used to treat synovial sarcoma. In one embodiment, a method of the present disclosure is used to treat liposarcoma such as myxoid / round cell liposarcoma, differentiated / dedifferentiated liposarcoma, and pleomorphic liposarcoma. In one embodiment, a method of the present disclosure is used to treat myxoid / round cell liposarcoma. In one embodiment, a method of the present disclosure is used to treat a refractory sarcoma. In one embodiment, a method of the present disclosure is used to treat a relapsed sarcoma.
[0246] The cells of the invention to be administered may be autologous, with respect to the subject undergoing therapy.
[0247] The administration of the cells of the invention may be carried out in any convenient manner known to those of skill in the art. The cells of the present invention may be administered to a subject by aerosol inhalation, injection, ingestion, transfusion, implantation or transplantation. The compositions described herein may be administered to a patient transarterially, subcutaneously, intradermally, intratumorally, intranodally, intramedullary, intramuscularly, by intravenous (i.v.) injection, or intraperitoneally. In other instances, the cells of the invention are injected directly into a site of inflammation in the subject, a local disease site in the subject, alymph node, an organ, a tumor, and the like.
[0248] In some embodiments, the cells are administered at a desired dosage, which in some aspects includes a desired dose or number of cells or cell type(s) and / or a desired ratio of cell types. Thus, the dosage of cells in some embodiments is based on a total number of cells (or number per kg body weight) and a desired ratio of the individual populations or sub-types, such as the CD4+ to CD8+ ratio. In some embodiments, the dosage of cells is based on a desired total number (or number per kg of body weight) of cells in the individual populations or of individual cell types. In some embodiments, the dosage is based on a combination of such features, such as a desired number of total cells, desired ratio, and desired total number of cells in the individual populations. In some embodiments, the populations or sub-types of cells, such as CD8+and CD4+T cells, are administered at or within a tolerated difference of a desired dose of total cells, such as a desired dose of T cells. In some aspects, the desired dose is a desired number of cells or a desired number of cells per unit of body weight of the subject to whom the cells are administered, e.g, cells / kg. In some aspects, the desired dose is at or above a minimum number of cells or minimum number of cells per unit of body weight. In some aspects, among the total cells, administered at the desired dose, the individual populations or sub-types are present at or near a desired output ratio (such as CD4+to CD8+ratio), e.g., within a certain tolerated difference or error of such a ratio.
[0249] In some embodiments, the cells are administered at or within a tolerated difference of a desired dose of one or more of the individual populations or sub-types of cells, such as a desired dose of CD4+ cells and / or a desired dose of CD8+ cells. In some aspects, the desired dose is a desired number of cells of the sub-type or population, or a desired number of such cells per unit of body weight of the subject to whom the cells are administered, e.g., cells / kg. In some aspects, the desired dose is at or above a minimum number of cells of the population or subtype, or minimum number of cells of the population or sub-type per unit of body weight. Thus, in some embodiments, the dosage is based on a desired fixed dose of total cells and a desired ratio, and / or based on a desired fixed dose of one or more, e.g., each, of the individual sub-types or subpopulations. Thus, in some embodiments, the dosage is based on a desired fixed or minimum dose of T cells and a desired ratio of CD4+to CD8+cells, and / or is based on a desired fixed or minimum dose of CD4+and / or CD8+cells.
[0250] In certain embodiments, the cells, or individual populations of sub-types of cells, are administered to the subject at a range of about one million to about 100 billion cells, such as, e g., 1 million to about 50 billion cells (e.g., about 5 million cells, about 25 million cells, about 500 million cells, about 1 billion cells, about 5 billion cells, about 20 billion cells, about 30 billion cells, about 40 billion cells, or a range defined by any two of the foregoing values), such as about 10 million to about 100 billion cells (e.g., about 20 million cells, about 30 million cells, about 40 million cells, about 60 million cells, about 70 million cells, about 80 million cells, about 90 million cells, about 10 billion cells, about 25 billion cells, about 50 billion cells, about 75 billion cells, about 90 billion cells, or a range defined by any two of the foregoing values), and in some cases about 100 million cells to about 50 billion cells (e.g., about 120 million cells, about 250 million cells, about 350 million cells, about 450 million cells, about 650 million cells, about 800 million cells, about 900 million cells, about 3 billion cells, about 30 billion cells, about 45 billion cells) or any value in between these ranges.
[0251] In some embodiments, the dose of total cells and / or dose of individual sub-populations of cells is within a range of between at or about IxlO5cells / kg to about IxlO11cells / kg 104and at or about 1011cells / kilograms (kg) body weight, such as between 105and 106cells I kg body weight, for example, at or about 1 x 105cells / kg, 1.5 x 105cells / kg, 2 x 105cells / kg, or 1 x 106cells / kg body weight. For example, in some embodiments, the cells are administered at, or within a certain range of error of, between at or about 104and at or about 109T cells / kilograms (kg) body weight, such as between 105and 106T cells I kg body weight, for example, at or about 1 x 105T cells / kg, 1.5 x 105T cells / kg, 2 x 105T cells / kg, or 1 x 106T cells / kg body weight. In other exemplary embodiments, a suitable dosage range of modified cells for use in a method of the present disclosure includes, without limitation, from about IxlO5cells / kg to about IxlO6cells / kg, from about IxlO6cells / kg to about IxlO7cells / kg, from about IxlO7cells / kg about IxlO8cells / kg, from about IxlO8cells / kg about IxlO9cells / kg, from about IxlO9cells / kg about IxlO10cells / kg, from about IxlO10cells / kg about IxlO11cells / kg. In an exemplary embodiment, a suitable dosage for use in a method of the present disclosure is about IxlO8cells / kg. In an exemplary embodiment, a suitable dosage for use in a method of the present disclosure is about IxlO7cells / kg. In other embodiments, a suitable dosage is from about IxlO7total cells to about 5xl07total cells. In some embodiments, a suitable dosage is from about IxlO8total cells to about 5xl08total cells. In some embodiments, a suitable dosage is from about 1.4xl07total cells to about l.lxlO9total cells. In an exemplary embodiment, a suitable dosage for use in a method of the present disclosure is about 7x109total cells.
[0252] In some embodiments, the cells are administered at or within a certain range of error of between at or about 104and at or about 109CD4+and / or CD8+cells / kilograms (kg) body weight, such as between 105and 106CD4+and / or CD8+cells I kg body weight, for example, at or about 1 x 105CD4+and / or CD8+cells / kg, 1.5 x 105CD4+and / or CD8+cells / kg, 2 x 105CD4+and / or CD8+cells / kg, or 1 x 106CD4+and / or CD8+cells / kg body weight. In some embodiments, the cells are administered at or within a certain range of error of, greater than, and / or at least about 1 x 106, about 2.5 x 106, about 5 x 106, about 7.5 x 106, or about 9 x 106CD4+cells, and / or at least about 1 x 106, about 2.5 x 106, about 5 x 106, about 7.5 x 106, or about 9 x 106CD8+ cells, and / or at least about 1 x 106, about 2.5 x 106, about 5 x 106, about 7.5 x 106, or about 9 x 106T cells. In some embodiments, the cells are administered at or within a certain range of error of between about 108and 1012or between about IO10and 1011T cells, between about 108and 1012or between about IO10and 1011CD4 cells, and / or between about 108and 1012or between about 1010and 1011CD8+cells.
[0253] In some embodiments, the cells are administered at or within a tolerated range of a desired output ratio of multiple cell populations or sub-types, such as CD4+ and CD8+ cells or sub-types. In some aspects, the desired ratio can be a specific ratio or can be a range of ratios, for example, in some embodiments, the desired ratio (e.g., ratio of CD4+to CD8+cells) is between at or about 5: 1 and at or about 5: 1 (or greater than about 1 :5 and less than about 5: 1), or between at or about 1:3 and at or about 3 : 1 (or greater than about 1 :3 and less than about 3: 1), such as between at or about 2: 1 and at or about 1:5 (or greater than about 1 :5 and less than about 2: 1, such as at or about 5: 1, 4.5: 1, 4: 1, 3.5: 1, 3: 1, 2.5: 1, 2: 1, 1.9: 1, 1.8: 1, 1.7: 1, 1.6: 1, 1.5: 1, 1.4: 1, 1.3: 1, 1.2: 1, 1.1 : 1, 1 : 1, 1: 1.1, 1 : 1.2, 1 : 1.3, 1 : 1.4, 1: 1.5, 1 : 1.6, 1 : 1.7, 1 : 1.8, 1: 1.9: 1:2, 1 :2.5, 1 :3, 1 :3.5, 1 :4, 1 :4.5, or 1:5. In some aspects, the tolerated difference is within about 1%, about 2%, about 3%, about 4% about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50% of the desired ratio, including any value in between these ranges.
[0254] In some embodiments, a dose of modified cells is administered to a subject in need thereof, in a single dose or multiple doses. In some embodiments, a dose of modified cells is administered in multiple doses, e.g., once a week or every 7 days, once every 2 weeks or every 14 days, once every 3 weeks or every 21 days, once every 4 weeks or every 28 days. In an exemplary embodiment, a single dose of modified cells is administered to a subject in need thereof. In an exemplary embodiment, a single dose of modified cells is administered to a subject in need thereof by rapid intravenous infusion.
[0255] For the prevention or treatment of disease, the appropriate dosage may depend on the type of disease to be treated, the type of cells or recombinant receptors, the severity and course of the disease, whether the cells are administered for preventive or therapeutic purposes, previous therapy, the subject's clinical history and response to the cells, and the discretion of the attending physician. The compositions and cells are in some embodiments suitably administered to the subject at one time or over a series of treatments. In some embodiments, the cells are administered as part of a combination treatment, such as simultaneously with or sequentially with, in any order, another therapeutic intervention, such as an antibody or engineered cell or receptor or agent, such as a cytotoxic or therapeutic agent. The cells in some embodiments are co-administered with one or more additional therapeutic agents or in connection with another therapeutic intervention, either simultaneously or sequentially in any order. In some contexts, the cells are co-administered with another therapy sufficiently close in time such that the cell populations enhance the effect of one or more additional therapeutic agents, or vice versa. In some embodiments, the cells are administered prior to the one or more additional therapeutic agents. In some embodiments, the cells are administered after the one or more additional therapeutic agents. In some embodiments, the one or more additional agents include a cytokine, such as IL-2, for example, to enhance persistence. In some embodiments, the methods comprise administration of a chemotherapeutic agent.
[0256] In certain embodiments, the modified cells of the invention (e.g., a modified cell comprising a CAR) may be administered to a subject in combination with an immune checkpoint antibody (e.g., an anti-PDl, anti-CTLA-4, or anti-PDLl antibody). For example, the modified cell may be administered in combination with an antibody or antibody fragment targeting, for example, PD-1 (programmed death 1 protein). Examples of anti-PD-1 antibodies include, but are not limited to, pembrolizumab (KEYTRUDA®, formerly lambrolizumab, also known as MK- 3475), and nivolumab (BMS-936558, MDX-1106, ONO-4538, OPDIVA®) or an antigenbinding fragment thereof. In certain embodiments, the modified cell may be administered in combination with an anti-PD-Ll antibody or antigen-binding fragment thereof Examples of anti-PD-Ll antibodies include, but are not limited to, BMS-936559, MPDL3280A (TECENTRIQ®, Atezolizumab), and MEDI4736 (Durvalumab, Imfinzi). In certain embodiments, the modified cell may be administered in combination with an anti-CTLA-4 antibody or antigen-binding fragment thereof. An example of an anti- CTLA-4 antibody includes, but is not limited to, Ipilimumab (trade name Yervoy). Other types of immune checkpoint modulators may also be used including, but not limited to, small molecules, siRNA, miRNA, and CRISPR systems. Immune checkpoint modulators may be administered before, after, or concurrently with the modified cell comprising the CAR. In certain embodiments, combination treatment comprising an immune checkpoint modulator may increase the therapeutic efficacy of a therapy comprising a modified cell of the present invention. Following administration of the cells, the biological activity of the engineered cell populations in some embodiments is measured, e.g., by any of a number of known methods. Parameters to assess include specific binding of an engineered or natural T cell or other immune cell to antigen, in vivo, e.g., by imaging, or ex vivo, e.g., by ELISA or flow cytometry. In certain embodiments, the ability of the engineered cells to destroy target cells can be measured using any suitable method known in the art, such as cytotoxicity assays described in, for example, Kochenderfer et al., J. Immunotherapy, 32(7): 689-702 (2009), and Herman et al. J. Immunological Methods, 285(1): 25-40 (2004). In certain embodiments, the biological activity of the cells is measured by assaying expression and / or secretion of one or more cytokines, such as CD 107a, IFNy, IL-2, and TNF. In some aspects the biological activity is measured by assessing clinical outcome, such as reduction in tumor burden or load.
[0257] In certain embodiments, the subject is provided a secondary treatment. Secondary treatments include but are not limited to chemotherapy, radiation, surgery, and medications.
[0258] In some embodiments, the subject can be administered a conditioning therapy prior to CAR T cell therapy. In some embodiments, the conditioning therapy comprises administering an effective amount of cyclophosphamide to the subject. In some embodiments, the conditioning therapy comprises administering an effective amount of fludarabine to the subject. In preferred embodiments, the conditioning therapy comprises administering an effective amount of a combination of cyclophosphamide and fludarabine to the subject. Administration of a conditioning therapy prior to CAR T cell therapy may increase the efficacy of the CAR T cell therapy. Methods of conditioning patients for T cell therapy are described in U.S. Patent No. 9,855,298, which is incorporated herein by reference in its entirety.
[0259] In some embodiments, a specific dosage regimen of the present disclosure includes a lymphodepletion step prior to the administration of the modified T cells. In an exemplary embodiment, the lymphodepletion step includes administration of cyclophosphamide and / or fludarabine.
[0260] In some embodiments, the lymphodepletion step includes administration of cyclophosphamide at a dose of between about 200 mg / m2 / day and about 2000 mg / m2 / day (e.g., 200 mg / m2 / day, 300 mg / m2 / day, or 500 mg / m2 / day). In an exemplary embodiment, the dose of cyclophosphamide is about 300 mg / m2 / day. In some embodiments, the lymphodepletion step includes administration of fludarabine at a dose of between about 20 mg / m2 / day and about 900 mg / m2 / day (e.g., 20 mg / m2 / day, 25 mg / m2 / day, 30 mg / m2 / day, or 60 mg / m2 / day). In an exemplary embodiment, the dose of fludarabine is about 30 mg / m2 / day.
[0261] In some embodiment, the lymphodepletion step includes administration of cyclophosphamide at a dose of between about 200 mg / m2 / day and about 2000 mg / m2 / day (e.g., 200 mg / m2 / day, 300 mg / m2 / day, or 500 mg / m2 / day), and fludarabine at a dose of between about 20 mg / m2 / day and about 900 mg / m2 / day (e.g., 20 mg / m2 / day, 25 mg / m2 / day, 30 mg / m2 / day, or 60 mg / m2 / day). In an exemplary embodiment, the lymphodepletion step includes administration of cyclophosphamide at a dose of about 300 mg / m2 / day, and fludarabine at a dose of about 30 mg / m2 / day.
[0262] In an exemplary embodiment, the dosing of cyclophosphamide is 300 mg / m2 / day over three days, and the dosing of fludarabine is 30 mg / m2 / day over three days.
[0263] Dosing of lymphodepletion chemotherapy may be scheduled on Days -6 to -4 (with a -1 day window, i.e., dosing on Days -7 to -5) relative to T cell (e.g., CAR-T, TCR-T, a modified T cell, etc.) infusion on Day 0.
[0264] In an exemplary embodiment, for a subject having cancer, the subject receives lymphodepleting chemotherapy including 300 mg / m2of cyclophosphamide by intravenous infusion 3 days prior to administration of the modified T cells. In an exemplary embodiment, for a subject having cancer, the subject receives lymphodepleting chemotherapy including 300 mg / m2of cyclophosphamide by intravenous infusion for 3 days prior to administration of the modified T cells.
[0265] In an exemplary embodiment, for a subject having cancer, the subject receives lymphodepleting chemotherapy including fludarabine at a dose of between about 20 mg / m2 / day and about 900 mg / m2 / day (e.g., 20 mg / m2 / day, 25 mg / m2 / day, 30 mg / m2 / day, or 60 mg / m2 / day). In an exemplary embodiment, for a subject having cancer, the subject receives lymphodepleting chemotherapy including fludarabine at a dose of 30 mg / m2for 3 days.
[0266] In an exemplary embodiment, for a subject having cancer, the subject receives lymphodepleting chemotherapy including cyclophosphamide at a dose of between about 200 mg / m2 / day and about 2000 mg / m2 / day (e.g., 200 mg / m2 / day, 300 mg / m2 / day, or 500 mg / m2 / day), and fludarabine at a dose of between about 20 mg / m2 / day and about 900 mg / m2 / day (e.g., 20 mg / m2 / day, 25 mg / m2 / day, 30 mg / m2 / day, or 60 mg / m2 / day). In an exemplary embodiment, for a subject having cancer, the subject receives lymphodepleting chemotherapy including cyclophosphamide at a dose of about 300 mg / m2 / day, and fludarabine at a dose of 30 mg / m2for 3 days.
[0267] Cells of the invention can be administered in dosages and routes and at times to be determined in appropriate pre-clinical and clinical experimentation and trials. Cell compositions may be administered multiple times at dosages within these ranges. Administration of the cells of the invention may be combined with other methods useful to treat the desired disease or condition as determined by those of skill in the art.
[0268] It is known in the art that one of the adverse effects following infusion of CAR T cells is the onset of immune activation, known as cytokine release syndrome (CRS). CRS is immune activation resulting in elevated inflammatory cytokines. CRS is a known on-target toxicity, development of which likely correlates with efficacy. Clinical and laboratory measures range from mild CRS (constitutional symptoms and / or grade-2 organ toxicity) to severe CRS (sCRS; grade >3 organ toxicity, aggressive clinical intervention, and / or potentially life threatening). Clinical features include: high fever, malaise, fatigue, myalgia, nausea, anorexia, tachycardia / hypotension, capillary leak, cardiac dysfunction, renal impairment, hepatic failure, and disseminated intravascular coagulation. Dramatic elevations of cytokines including interferon-gamma, granulocyte macrophage colony-stimulating factor, IL- 10, and IL-6 have been shown following CAR T-cell infusion. One CRS signature is elevation of cytokines including IL-6 (severe elevation), IFN-gamma, TNF-alpha (moderate), and IL-2 (mild). Elevations in clinically available markers of inflammation including ferritin and C-reactive protein (CRP) have also been observed to correlate with the CRS syndrome. The presence of CRS generally correlates with expansion and progressive immune activation of adoptively transferred cells. It has been demonstrated that the degree of CRS severity is dictated by disease burden at the time of infusion as patients with high tumor burden experience a more sCRS.
[0269] Accordingly, the invention provides for, following the diagnosis of CRS, appropriate CRS management strategies to mitigate the physiological symptoms of uncontrolled inflammation without dampening the antitumor efficacy of the engineered cells (e.g., CAR T cells). CRS management strategies are known in the art. For example, systemic corticosteroids may be administered to rapidly reverse symptoms of sCRS (e.g., grade 3 CRS) without compromising initial antitumor response. In some embodiments, an anti-IL-6R antibody may be administered. An example of an anti-IL-6R antibody is the Food and Drug Administration-approved monoclonal antibody tocilizumab, also known as atlizumab (marketed as Actemra, or RoActemra). Tocilizumab is a humanized monoclonal antibody against the interleukin-6 receptor (IL-6R). Administration of tocilizumab has demonstrated near-immediate reversal of CRS.
[0270] CRS is generally managed based on the severity of the observed syndrome and interventions are tailored as such. CRS management decisions may be based upon clinical signs and symptoms and response to interventions, not solely on laboratory values alone.
[0271] Mild to moderate cases generally are treated with symptom management with fluid therapy, non-steroidal anti-inflammatory drug (NSAID) and antihistamines as needed for adequate symptom relief. More severe cases include patients with any degree of hemodynamic instability; with any hemodynamic instability, the administration of tocilizumab is recommended. The first-line management of CRS may be tocilizumab, in some embodiments, at the labeled dose of 8 mg / kg IV over 60 minutes (not to exceed 800 mg / dose); tocilizumab can be repeated Q8 hours. If suboptimal response to the first dose of tocilizumab, additional doses of tocilizumab may be considered. Tocilizumab can be administered alone or in combination with corticosteroid therapy. Patients with continued or progressive CRS symptoms, inadequate clinical improvement in 12-18 hours or poor response to tocilizumab, may be treated with high- dose corticosteroid therapy, generally hydrocortisone 100 mg IV or methylprednisolone 1-2 mg / kg. In patients with more severe hemodynamic instability or more severe respiratory symptoms, patients may be administered high-dose corticosteroid therapy early in the course of the CRS. CRS management guidance may be based on published standards (Lee et al. (2019) Biol Blood Marrow Transplant, doi.org / 10.1016 / j.bbmt.2018.12.758; Neelapu et al. (2018) Nat Rev Clin Oncology, 15:47; Teachey et al. (2016) Cancer Discov, 6(6): 664-679).
[0272] Features consistent with Macrophage Activation Syndrome (MAS) or Hemophagocytic lymphohistiocytosis (HLH) have been observed in patients treated with CAR-T therapy (Henter, 2007), coincident with clinical manifestations of the CRS. MAS appears to be a reaction to immune activation that occurs from the CRS, and should therefore be considered a manifestation of CRS. MAS is similar to HLH (also a reaction to immune stimulation). The clinical syndrome of MAS is characterized by high grade non-remitting fever, cytopenias affecting at least two of three lineages, and hepatosplenomegaly. It is associated with high serum ferritin, soluble interleukin-2 receptor, and triglycerides, and a decrease of circulating natural killer (NK) activity.
[0273] In one aspect, the invention includes a method of treating cancer in a subject in need thereof, comprising administering to the subject any one of the modified immune or precursor cells disclosed herein. Yet another aspect of the invention includes a method of treating cancer in a subject in need thereof, comprising administering to the subject a modified immune or precursor cell generated by any one of the methods disclosed herein.
[0274] In one aspect, the invention includes a method for treating cancer in a subject in need thereof, the method comprising administering to the subject a modified cell comprising a CAR, wherein the CAR comprises a nanobody retrieved by the sequential tumor-related antibody and antigen retrieving (STAR) method, a transmembrane domain, and an intracellular signaling domain.
[0275] In another aspect, the invention provides a method for treating cancer in a subject in need thereof, the method comprising administering to the subject a modified cell comprising a CAR, wherein the CAR comprises a CD13-specific nanobody, a transmembrane domain, and an intracellular signaling domain.
[0276] A method for treating cancer in a subject in need thereof, the method comprising administering to the subject a modified cell comprising a CAR, wherein the CAR comprises a CDH17-specific nanobody, a transmembrane domain, and an intracellular signaling domain.
[0277] In certain embodiments, the T cell is a human cell. In certain embodiments, the T cell is autologous.
[0278] Vectors
[0279] A vector may be used to introduce the CAR into a T cell as described elsewhere herein. In certain aspects, the invention includes vectors comprising nucleic acid sequences encoding a CAR. The vector can comprise a plasmid vector, viral vector, retrotransposon (e.g. piggyback, sleeping beauty), site directed insertion vector (e.g. CRISPR, Zn finger nucleases, TALEN), suicide expression vector, lentiviral vector, RNA vector, or other known vectors in the art.
[0280] The production of any of the molecules described herein can be verified by sequencing. Expression of the full-length proteins may be verified using immunoblot, immunohistochemistry, flow cytometry or other technology well known and available in the art. The present invention also provides a vector in which DNA of the present invention is inserted. Vectors, including those derived from retroviruses such as lentivirus, are suitable tools to achieve long-term gene transfer since they allow long-term, stable integration of a transgene and its propagation in daughter cells. Lentiviral vectors have the added advantage over vectors derived from onco-retroviruses, such as murine leukemia viruses, in that they can transduce nonproliferating cells, such as hepatocytes. They also have the added advantage of resulting in low immunogenicity in the subject into which they are introduced.
[0281] The expression of natural or synthetic nucleic acids is typically achieved by operably linking a nucleic acid or portions thereof to a promoter, and incorporating the construct into an expression vector. The vector is one generally capable of replication in a mammalian cell, and / or also capable of integration into the cellular genome of the mammal. Typical vectors contain transcription and translation terminators, initiation sequences, and promoters useful for regulation of the expression of the desired nucleic acid sequence.
[0282] The nucleic acid can be cloned into any number of different types of vectors. For example, the nucleic acid can be cloned into a vector including, but not limited to a plasmid, a phagemid, a phage derivative, an animal virus, and a cosmid. Vectors of particular interest include expression vectors, replication vectors, probe generation vectors, and sequencing vectors.
[0283] The expression vector may be provided to a cell in the form of a viral vector. Viral vector technology is well known in the art and is described, for example, in Sambrook et al., 2012, MOLECULAR CLONING: A LABORATORY MANUAL, volumes 1 -4, Cold Spring Harbor Press, NY), and in other virology and molecular biology manuals. Viruses, which are useful as vectors include, but are not limited to, retroviruses, adenoviruses, adeno- associated viruses, herpes viruses, and lentiviruses. In general, a suitable vector contains an origin of replication functional in at least one organism, a promoter sequence, convenient restriction endonuclease sites, and one or more selectable markers, (e.g., WO 01 / 96584; WO 01 / 29058; and U.S. Pat. No. 6,326,193).
[0284] Additional promoter elements, e.g., enhancers, regulate the frequency of transcriptional initiation. Typically, these are located in the region 30-110 bp upstream of the start site, although a number of promoters have recently been shown to contain functional elements downstream of the start site as well. The spacing between promoter elements frequently is flexible, so that promoter function is preserved when elements are inverted or moved relative to one another. In the thymidine kinase (tk) promoter, the spacing between promoter elements can be increased to 50 bp apart before activity begins to decline. Depending on the promoter, it appears that individual elements can function either cooperatively or independently to activate transcription.
[0285] An example of a promoter is the immediate early cytomegalovirus (CMV) promoter sequence. This promoter sequence is a strong constitutive promoter sequence capable of driving high levels of expression of any polynucleotide sequence operatively linked thereto. However, other constitutive promoter sequences may also be used, including, but not limited to the simian virus 40 (SV40) early promoter, mouse mammary tumor virus (MMTV), human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, MoMuLV promoter, an avian leukemia virus promoter, an Epstein-Barr virus immediate early promoter, a Rous sarcoma virus promoter, the EF-1 alpha promoter, as well as human gene promoters such as, but not limited to, the actin promoter, the myosin promoter, the hemoglobin promoter, and the creatine kinase promoter. Further, the invention should not be limited to the use of constitutive promoters. Inducible promoters are also contemplated as part of the invention. The use of an inducible promoter provides a molecular switch capable of turning on expression of the polynucleotide sequence which it is operatively linked when such expression is desired, or turning off the expression when expression is not desired. Examples of inducible promoters include, but are not limited to a metallothionine promoter, a glucocorticoid promoter, a progesterone promoter, and a tetracycline promoter.
[0286] In order to assess expression of a polypeptide or portions thereof, the expression vector to be introduced into a cell can also contain either a selectable marker gene or a reporter gene or both to facilitate identification and selection of expressing cells from the population of cells sought to be transfected or infected through viral vectors. In other aspects, the selectable marker may be carried on a separate piece of DNA and used in a co- transfection procedure. Both selectable markers and reporter genes may be flanked with appropriate regulatory sequences to enable expression in the host cells. Useful selectable markers include, for example, antibioticresistance genes, such as neo and the like.
[0287] Reporter genes are used for identifying potentially transfected cells and for evaluating the functionality of regulatory sequences. In general, a reporter gene is a gene that is not present in or expressed by the recipient organism or tissue and that encodes a polypeptide whose expression is manifested by some easily detectable property, e.g., enzymatic activity. Expression of the reporter gene is assessed at a suitable time after the DNA has been introduced into the recipient cells. Suitable reporter genes may include genes encoding luciferase, beta-galactosidase, chloramphenicol acetyl transferase, secreted alkaline phosphatase, or the green fluorescent protein gene (e.g., Ui-Tei et al., 2000 FEBS Letters 479: 79-82). Suitable expression systems are well known and may be prepared using known techniques or obtained commercially. In general, the construct with the minimal 5' flanking region showing the highest level of expression of reporter gene is identified as the promoter. Such promoter regions may be linked to a reporter gene and used to evaluate agents for the ability to modulate promoter- driven transcription.
[0288] Introduction of Nucleic Acids
[0289] Methods of introducing nucleic acids into a cell include physical, biological and chemical methods. Physical methods for introducing a polynucleotide, such as DNA or RNA, into a host cell include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like. A polynucleotide can be introduced into target cells using commercially available methods which include electroporation (Amaxa Nucleofector-II (Amaxa Biosystems, Cologne, Germany)), (ECM 830 (BTX) (Harvard Instruments, Boston, Mass.) or the Gene Pulser II (BioRad, Denver, Colo.), Multiporator (Eppendort, Hamburg Germany). A polynucleotide can also be introduced into cells using cationic liposome mediated transfection using lipofection, using polymer encapsulation, using peptide mediated transfection, or using biolistic particle delivery systems such as “gene guns” (see, for example, Nishikawa, et al. Hum Gene Ther., 12(8):861-70 (2001).
[0290] Biological methods for introducing a polynucleotide of interest into a host cell include the use of DNA and RNA vectors. Viral vectors, and especially retroviral vectors, have become the most widely used method for inserting genes into mammalian, e.g., human cells. Other viral vectors can be derived from lentivirus, poxviruses, herpes simplex virus I, adenoviruses and adeno-associated viruses, and the like. See, for example, U.S. Pat. Nos. 5,350,674 and 5,585,362.
[0291] Chemical means for introducing a polynucleotide into a host cell include colloidal dispersion systems, such as macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. An exemplary colloidal system for use as a delivery vehicle in vitro and in vivo is a liposome (e.g., an artificial membrane vesicle). Lipids suitable for use can be obtained from commercial sources. For example, dimyristyl phosphatidylcholine (“DMPC”) can be obtained from Sigma, St. Louis, MO; dicetyl phosphate (“DCP”) can be obtained from K & K Laboratories (Plainview, NY); cholesterol (“Choi”) can be obtained from Calbiochem-Behring; dimyristyl phosphatidylglycerol (“DMPG”) and other lipids may be obtained from Avanti Polar Lipids, Inc. (Birmingham, AL). Stock solutions of lipids in chloroform or chloroform / methanol can be stored at about -20°C. Chloroform is used as the only solvent since it is more readily evaporated than methanol. “Liposome” is a generic term encompassing a variety of single and multilamellar lipid vehicles formed by the generation of enclosed lipid bilayers or aggregates. Liposomes can be characterized as having vesicular structures with a phospholipid bilayer membrane and an inner aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo self-rearrangement before the formation of closed structures and entrap water and dissolved solutes between the lipid bilayers (Ghosh et al., 1991 Glycobiology 5: 505-10). However, compositions that have different structures in solution than the normal vesicular structure are also encompassed. For example, the lipids may assume a micellar structure or merely exist as nonuniform aggregates of lipid molecules. Also contemplated are lipofectamine- nucleic acid complexes.
[0292] Regardless of the method used to introduce exogenous nucleic acids into a host cell or otherwise expose a cell to the inhibitor of the present invention, in order to confirm the presence of the nucleic acids in the host cell, a variety of assays may be performed. Such assays include, for example, “molecular biological” assays well known to those of skill in the art, such as Southern and Northern blotting, RT-PCR and PCR; “biochemical” assays, such as detecting the presence or absence of a particular peptide, e.g., by immunological means (ELISAs and Western blots) or by assays described herein to identify agents falling within the scope of the invention.
[0293] Moreover, the nucleic acids may be introduced by any means, such as transducing the expanded T cells, transfecting the expanded T cells, and electroporating the expanded T cells. One nucleic acid may be introduced by one method and another nucleic acid may be introduced into the T cell by a different method.
[0294] Sources of T Cells Prior to expansion, a source of T cells is obtained from a subject. Non-limiting examples of subjects include humans, dogs, cats, mice, rats, and transgenic species thereof. Preferably, the subject is a human. T cells can be obtained from a number of sources, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, spleen tissue, umbilical cord, and tumors. In certain embodiments, any number of T cell lines available in the art, may be used. In certain embodiments, T cells can be obtained from a unit of blood collected from a subject using any number of techniques known to the skilled artisan, such as Ficoll separation. In one embodiment, cells from the circulating blood of an individual are obtained by apheresis or leukapheresis. The apheresis product typically contains lymphocytes, including T cells, monocytes, granulocytes, B cells, other nucleated white blood cells, red blood cells, and platelets. The cells collected by apheresis may be washed to remove the plasma fraction and to place the cells in an appropriate buffer or media, such as phosphate buffered saline (PBS) or wash solution lacks calcium and may lack magnesium or may lack many if not all divalent cations, for subsequent processing steps. After washing, the cells may be resuspended in a variety of biocompatible buffers, such as, for example, Ca-free, Mg-free PBS. Alternatively, the undesirable components of the apheresis sample may be removed and the cells directly resuspended in culture media.
[0295] In another embodiment, T cells are isolated from peripheral blood by lysing the red blood cells and depleting the monocytes, for example, by centrifugation through a PERCOLL™ gradient. Alternatively, T cells can be isolated from umbilical cord. In any event, a specific subpopulation of T cells can be further isolated by positive or negative selection techniques.
[0296] The cord blood mononuclear cells so isolated can be depleted of cells expressing certain antigens, including, but not limited to, CD34, CD8, CD14, CD19 and CD56. Depletion of these cells can be accomplished using an isolated antibody, a biological sample comprising an antibody, such as ascites, an antibody bound to a physical support, and a cell bound antibody.
[0297] Enrichment of a T cell population by negative selection can be accomplished using a combination of antibodies directed to surface markers unique to the negatively selected cells. A preferred method is cell sorting and / or selection via negative magnetic immunoadherence or flow cytometry that uses a cocktail of monoclonal antibodies directed to cell surface markers present on the cells negatively selected. For example, to enrich for CD4+ cells by negative selection, a monoclonal antibody cocktail typically includes antibodies to CD14, CD20, CDl lb, CD16, HLA-DR, and CD8.
[0298] For isolation of a desired population of cells by positive or negative selection, the concentration of cells and surface (e.g., particles such as beads) can be varied. In certain embodiments, it may be desirable to significantly decrease the volume in which beads and cells are mixed together (i.e., increase the concentration of cells), to ensure maximum contact of cells and beads. For example, in one embodiment, a concentration of 2 billion cells / ml is used. In one embodiment, a concentration of 1 billion cells / ml is used. In a further embodiment, greater than 100 million cells / ml is used. In a further embodiment, a concentration of cells of 10, 15, 20, 25, 30, 35, 40, 45, or 50 million cells / ml is used. In yet another embodiment, a concentration of cells from 75, 80, 85, 90, 95, or 100 million cells / ml is used. In further embodiments, concentrations of 125 or 150 million cells / ml can be used. Using high concentrations can result in increased cell yield, cell activation, and cell expansion.
[0299] T cells can also be frozen after the washing step, which does not require the monocyteremoval step. While not wishing to be bound by theory, the freeze and subsequent thaw step provides a more uniform product by removing granulocytes and to some extent monocytes in the cell population. After the washing step that removes plasma and platelets, the cells may be suspended in a freezing solution. While many freezing solutions and parameters are known in the art and will be useful in this context, in a non-limiting example, one method involves using PBS containing 20% DMSO and 8% human serum albumin, or other suitable cell freezing media. The cells are then frozen to -80°C at a rate of 1° per minute and stored in the vapor phase of a liquid nitrogen storage tank. Other methods of controlled freezing may be used as well as uncontrolled freezing immediately at -20°C or in liquid nitrogen.
[0300] In one embodiment, the population of T cells is comprised within cells such as peripheral blood mononuclear cells, cord blood cells, a purified population of T cells, and a T cell line. In another embodiment, peripheral blood mononuclear cells comprise the population of T cells. In yet another embodiment, purified T cells comprise the population of T cells.
[0301] In certain embodiments, T regulatory cells (Tregs) can be isolated from a sample. The sample can include, but is not limited to, umbilical cord blood or peripheral blood. In certain embodiments, the Tregs are isolated by flow-cytometry sorting. The sample can be enriched for Tregs prior to isolation by any means known in the art. The isolated Tregs can be cryopreserved, and / or expanded prior to use. Methods for isolating Tregs are described in U.S. Patent Numbers: 7,754,482, 8,722,400, and 9,555, 105, and U.S. Patent Application No. 13 / 639,927, contents of which are incorporated herein in their entirety.
[0302] Expansion of T Cells
[0303] As demonstrated by the data disclosed herein, expanding the T cells by the methods disclosed herein can be multiplied by about 10 fold, 20 fold, 30 fold, 40 fold, 50 fold, 60 fold, 70 fold, 80 fold, 90 fold, 100 fold, 200 fold, 300 fold, 400 fold, 500 fold, 600 fold, 700 fold, 800 fold, 900 fold, 1000 fold, 2000 fold, 3000 fold, 4000 fold, 5000 fold, 6000 fold, 7000 fold, 8000 fold, 9000 fold, 10,000 fold, 100,000 fold, 1,000,000 fold, 10,000,000 fold, or greater, and any and all whole or partial integers therebetween. In one embodiment, the T cells expand in the range of about 20 fold to about 50 fold.
[0304] Following culturing, the T cells can be incubated in cell medium in a culture apparatus for a period of time or until the cells reach confluency or high cell density for optimal passage before passing the cells to another culture apparatus. The culturing apparatus can be of any culture apparatus commonly used for culturing cells in vitro. Preferably, the level of confluence is 70% or greater before passing the cells to another culture apparatus. More preferably, the level of confluence is 90% or greater. A period of time can be any time suitable for the culture of cells in vitro. The T cell medium may be replaced during the culture of the T cells at any time. Preferably, the T cell medium is replaced about every 2 to 3 days. The T cells are then harvested from the culture apparatus whereupon the T cells can be used immediately or cryopreserved to be stored for use at a later time. In one embodiment, the invention includes cryopreserving the expanded T cells. The cryopreserved T cells are thawed prior to introducing nucleic acids into the T cell.
[0305] In another embodiment, the method comprises isolating T cells and expanding the T cells. In another embodiment, the invention further comprises cryopreserving the T cells prior to expansion. In yet another embodiment, the cryopreserved T cells are thawed for electroporation with the RNA encoding the chimeric membrane protein.
[0306] Another procedure for ex vivo expansion cells is described in U.S. Pat. No. 5,199,942 (incorporated herein by reference). Expansion, such as described in U.S. Pat. No. 5,199,942 can be an alternative or in addition to other methods of expansion described herein. Briefly, ex vivo culture and expansion of T cells comprises the addition to the cellular growth factors, such as those described in U.S. Pat. No. 5,199,942, or other factors, such as flt3-L, IL-1, IL-3 and c-kit ligand. In one embodiment, expanding the T cells comprises culturing the T cells with a factor selected from the group consisting of flt3-L, IL-1, IL-3 and c-kit ligand.
[0307] The culturing step as described herein (contact with agents as described herein or after electroporation) can be very short, for example less than 24 hours such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 hours. The culturing step as described further herein (contact with agents as described herein) can be longer, for example 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or more days.
[0308] Various terms are used to describe cells in culture. Cell culture refers generally to cells taken from a living organism and grown under controlled condition. A primary cell culture is a culture of cells, tissues or organs taken directly from an organism and before the first subculture. Cells are expanded in culture when they are placed in a growth medium under conditions that facilitate cell growth and / or division, resulting in a larger population of the cells. When cells are expanded in culture, the rate of cell proliferation is typically measured by the amount of time required for the cells to double in number, otherwise known as the doubling time.
[0309] Each round of subculturing is referred to as a passage. When cells are subcultured, they are referred to as having been passaged. A specific population of cells, or a cell line, is sometimes referred to or characterized by the number of times it has been passaged. For example, a cultured cell population that has been passaged ten times may be referred to as a PIO culture. The primary culture, i.e., the first culture following the isolation of cells from tissue, is designated P0. Following the first subculture, the cells are described as a secondary culture (Pl or passage 1). After the second subculture, the cells become a tertiary culture (P2 or passage 2), and so on. It will be understood by those of skill in the art that there may be many population doublings during the period of passaging; therefore the number of population doublings of a culture is greater than the passage number. The expansion of cells (i.e., the number of population doublings) during the period between passaging depends on many factors, including but is not limited to the seeding density, substrate, medium, and time between passaging.
[0310] In one embodiment, the cells may be cultured for several hours (about 3 hours) to about 14 days or any hourly integer value in between. Conditions appropriate for T cell culture include an appropriate media (e.g., Minimal Essential Media or RPMI Media 1640 or, X-vivo 15, (Lonza)) that may contain factors necessary for proliferation and viability, including serum (e.g., fetal bovine or human serum), interleukin-2 (IL-2), insulin, IFN-gamma, IL-4, IL-7, GM-CSF, IL-10, IL-12, IL-15, TGF-beta, and TNF-a. or any other additives for the growth of cells known to the skilled artisan. Other additives for the growth of cells include, but are not limited to, surfactant, plasmanate, and reducing agents such as N-acetyl-cysteine and 2-mercaptoethanol. Media can include RPMI 1640, AIM-V, DMEM, MEM, a-MEM, F-12, X-Vivo 15, and X-Vivo 20, Optimizer, with added amino acids, sodium pyruvate, and vitamins, either serum-free or supplemented with an appropriate amount of serum (or plasma) or a defined set of hormones, and / or an amount of cytokine(s) sufficient for the growth and expansion of T cells. Antibiotics, e.g., penicillin and streptomycin, are included only in experimental cultures, not in cultures of cells that are to be infused into a subject. The target cells are maintained under conditions necessary to support growth, for example, an appropriate temperature (e.g., 37° C) and atmosphere (e.g., air plus 5% CO2).
[0311] The medium used to culture the T cells may include an agent that can co-stimulate the T cells. For example, an agent that can stimulate CD3 is an antibody to CD3, and an agent that can stimulate CD28 is an antibody to CD28. This is because, as demonstrated by the data disclosed herein, a cell isolated by the methods disclosed herein can be expanded approximately 10 fold, 20 fold, 30 fold, 40 fold, 50 fold, 60 fold, 70 fold, 80 fold, 90 fold, 100 fold, 200 fold, 300 fold, 400 fold, 500 fold, 600 fold, 700 fold, 800 fold, 900 fold, 1000 fold, 2000 fold, 3000 fold, 4000 fold, 5000 fold, 6000 fold, 7000 fold, 8000 fold, 9000 fold, 10,000 fold, 100,000 fold, 1,000,000 fold, 10,000,000 fold, or greater. In one embodiment, the T cells expand in the range of about 20 fold to about 50 fold, or more by culturing the electroporated population. In one embodiment, human T regulatory cells are expanded via anti-CD3 antibody coated KT64.86 artificial antigen presenting cells (aAPCs). Methods for expanding and activating T cells can be found in U.S. Patent Numbers: 7,754,482, 8,722,400, and 9,555, 105, contents of which are incorporated herein in their entirety.
[0312] In one embodiment, the method of expanding the T cells can further comprise isolating the expanded T cells for further applications. In another embodiment, the method of expanding can further comprise a subsequent electroporation of the expanded T cells followed by culturing. The subsequent electroporation may include introducing a nucleic acid encoding an agent, such as a transducing the expanded T cells, transfecting the expanded T cells, or electroporating the expanded T cells with a nucleic acid, into the expanded population of T cells, wherein the agent further stimulates the T cell. The agent may stimulate the T cells, such as by stimulating further expansion, effector function, or another T cell function.
[0313] Pharmaceutical compositions
[0314] Pharmaceutical compositions of the present invention may comprise the antigen binding proteins or the modified T cell as described herein, in combination with one or more pharmaceutically or physiologically acceptable carriers, diluents or excipients. Such compositions may comprise buffers such as neutral buffered saline, phosphate buffered saline and the like; carbohydrates such as glucose, mannose, sucrose or dextrans, mannitol; proteins; polypeptides or amino acids such as glycine; antioxidants; chelating agents such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and preservatives. Compositions of the present invention are preferably formulated for intravenous administration.
[0315] Pharmaceutical compositions of the present invention may be administered in a manner appropriate to the disease to be treated (or prevented). The quantity and frequency of administration will be determined by such factors as the condition of the patient, and the type and severity of the patient’s disease, although appropriate dosages may be determined by clinical trials.
[0316] The cells of the invention to be administered may be autologous, allogeneic or xenogeneic with respect to the subject undergoing therapy.
[0317] Cells or polypeptides of the invention can be administered in dosages and routes and at times to be determined in appropriate pre-clinical and clinical experimentation and trials. Cell compositions may be administered multiple times at dosages within these ranges. Administration of the cells or polypeptides of the invention may be combined with other methods useful to treat the desired disease or condition as determined by those of skill in the art.
[0318] It can generally be stated that a pharmaceutical composition comprising the modified T cells described herein may be administered at a dosage of 104to 109cells / kg body weight, in some instances 105to 106cells / kg body weight, including all integer values within those ranges. T cell compositions may also be administered multiple times at these dosages. The cells can be administered by using infusion techniques that are commonly known in immunotherapy (see, e.g., Rosenberg et al., New Eng. J. of Med. 319:1676, 1988). The optimal dosage and treatment regime for a particular patient can readily be determined by one skilled in the art of medicine by monitoring the patient for signs of disease and adjusting the treatment accordingly.
[0319] The administration of the antigen binding polypeptide or the modified T cells of the invention may be carried out in any convenient manner known to those of skill in the art. The polypeptides or cells of the present invention may be administered to a subject by aerosol inhalation, injection, ingestion, transfusion, implantation or transplantation. The compositions described herein may be administered to a patient transarterially, subcutaneously, intradermally, intratum orally, intranodally, intramedullary, intramuscularly, by intravenous (z.v.) injection, or intraperitoneally. In other instances, the cells of the invention are injected directly into a site of disease in the subject, a local disease site in the subject, a lymph node, an organ, a tumor, and the like.
[0320] It should be understood that the method and compositions that would be useful in the present invention are not limited to the particular formulations set forth in the examples. The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the polypeptides and / or the cells, expansion and culture methods, and therapeutic methods of the invention, and are not intended to limit the scope of what the inventors regard as their invention.
[0321] The practice of the present invention employs, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are well within the purview of the skilled artisan. Such techniques are explained fully in the literature, such as, “Molecular Cloning: A Laboratory Manual”, fourth edition (Sambrook, 2012); “Oligonucleotide Synthesis” (Gait, 1984); “Culture of Animal Cells” (Freshney, 2010); “Methods in Enzymology” “Handbook of Experimental Immunology” (Weir, 1997); “Gene Transfer Vectors for Mammalian Cells” (Miller and Calos, 1987); “Short Protocols in Molecular Biology” (Ausubel, 2002); “Current Protocols in Immunology” (Coligan, 2002). These techniques are applicable to the production of the polynucleotides and polypeptides of the invention, and, as such, may be considered in making and practicing the invention. Particularly useful techniques for particular embodiments will be discussed in the sections that follow.
[0322] Administration / Dosage / Formulations The regimen of administration may affect what constitutes an effective amount. The therapeutic formulations contemplated within the disclosure may be administered to the subject either prior to or after the onset of a disease and / or disorder contemplated herein. Further, several divided dosages, as well as staggered dosages may be administered daily or sequentially, or the dose may be continuously infused, or may be a bolus injection. Further, the dosages of the therapeutic formulations contemplated within the disclosure may be proportionally increased or decreased as indicated by the exigencies of the therapeutic or prophylactic situation.
[0323] Administration of the compositions contemplated within the disclosure to a patient, preferably a mammal, more preferably a human, may be carried out using known procedures, at dosages and for periods of time effective to treat a disease and / or disorder contemplated herein in the patient. An effective amount of the therapeutic compound necessary to achieve a therapeutic effect may vary according to factors such as the state of the disease or disorder in the patient; the age, sex, and weight of the patient; and the ability of the therapeutic compound contemplated within the disclosure to treat a disease and / or disorder contemplated herein in the patient. Dosage regimens may be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation. A non-limiting example of an effective dose range for a therapeutic compound contemplated within the disclosure is from about 1 and 5,000 mg / kg of body weight / per day. One of ordinary skill in the art would be able to study the relevant factors and make the determination regarding the effective amount of the therapeutic compound without undue experimentation.
[0324] Actual dosage levels of the active ingredients in the pharmaceutical compositions contemplated within the disclosure may be varied so as to obtain an amount of the active ingredient that is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient.
[0325] In particular, the selected dosage level depends upon a variety of factors including the activity of the particular compound employed, the time of administration, the rate of excretion of the compound, the duration of the treatment, other drugs, compounds or materials used in combination with the compound, the age, sex, weight, condition, general health and prior medical history of the patient being treated, and like factors well, known in the medical arts. A medical doctor, e.g., physician or veterinarian, having ordinary skill in the art may readily determine and prescribe the effective amount of the pharmaceutical composition required. For example, the physician or veterinarian could start doses of the compounds contemplated within the disclosure employed in the pharmaceutical composition at levels lower than that required in order to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved.
[0326] In particular embodiments, it is especially advantageous to formulate the compound in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the patients to be treated; each unit containing a predetermined quantity of therapeutic compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical vehicle. The dosage unit forms contemplated within the disclosure are dictated by and directly dependent on (a) the unique characteristics of the therapeutic compound and the particular therapeutic effect to be achieved, and (b) the limitations inherent in the art of compounding / formulating such a therapeutic compound for the treatment of a disease and / or disorder contemplated herein.
[0327] In certain embodiments, the compositions of the disclosure are formulated using one or more pharmaceutically acceptable excipients or carriers. In certain embodiments, the pharmaceutical compositions of the disclosure comprise a therapeutically effective amount of a compound of the disclosure and a pharmaceutically acceptable carrier.
[0328] The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity may be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms may be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it is preferable to include isotonic agents, for example, sugars, sodium chloride, or polyalcohols such as mannitol and sorbitol, in the composition. Prolonged absorption of the injectable compositions may be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate or gelatin. In certain embodiments, the compositions of the disclosure are administered to the patient in dosages that range from one to five times per day or more. In another embodiment, the compositions of the disclosure are administered to the patient in range of dosages that include, but are not limited to, once every day, every two, days, every three days to once a week, and once every two weeks. It is readily apparent to one skilled in the art that the frequency of administration of the various combination compositions of the disclosure varies from individual to individual depending on many factors including, but not limited to, age, disease or disorder to be treated, gender, overall health, and other factors. Thus, the disclosure should not be construed to be limited to any particular dosage regime and the precise dosage and composition to be administered to any patient is determined by the attending physical taking all other factors about the patient into account.
[0329] Compounds of the disclosure for administration may be in the range of from about 1 pg to about 10,000 mg, about 20 pg to about 9,500 mg, about 40 pg to about 9,000 mg, about 75 pg to about 8,500 mg, about 150 pg to about 7,500 mg, about 200 pg to about 7,000 mg, about 3050 pg to about 6,000 mg, about 500 pg to about 5,000 mg, about 750 pg to about 4,000 mg, about 1 mg to about 3,000 mg, about 10 mg to about 2,500 mg, about 20 mg to about 2,000 mg, about 25 mg to about 1,500 mg, about 30 mg to about 1,000 mg, about 40 mg to about 900 mg, about 50 mg to about 800 mg, about 60 mg to about 750 mg, about 70 mg to about 600 mg, about 80 mg to about 500 mg, and any and all whole or partial increments therebetween.
[0330] In some embodiments, the dose of a compound of the disclosure is from about 1 mg and about 2,500 mg. In some embodiments, a dose of a compound of the disclosure used in compositions described herein is less than about 10,000 mg, or less than about 8,000 mg, or less than about 6,000 mg, or less than about 5,000 mg, or less than about 3,000 mg, or less than about 2,000 mg, or less than about 1,000 mg, or less than about 500 mg, or less than about 200 mg, or less than about 50 mg. Similarly, in some embodiments, a dose of a second compound as described herein is less than about 1,000 mg, or less than about 800 mg, or less than about 600 mg, or less than about 500 mg, or less than about 400 mg, or less than about 300 mg, or less than about 200 mg, or less than about 100 mg, or less than about 50 mg, or less than about 40 mg, or less than about 30 mg, or less than about 25 mg, or less than about 20 mg, or less than about 15 mg, or less than about 10 mg, or less than about 5 mg, or less than about 2 mg, or less than about 1 mg, or less than about 0.5 mg, and any and all whole or partial increments thereof. In certain embodiments, the present disclosure is directed to a packaged pharmaceutical composition comprising a container holding a therapeutically effective amount of a compound of the disclosure, alone or in combination with a second pharmaceutical agent; and instructions for using the compound to treat, prevent, or reduce one or more symptoms of the disease or disorder in a patient.
[0331] Formulations may be employed in admixtures with conventional excipients, z.e., pharmaceutically acceptable organic or inorganic carrier substances suitable for intracranially, intrathecal, oral, parenteral, nasal, intravenous, subcutaneous, enteral, or any other suitable mode of administration, known to the art. The pharmaceutical preparations may be sterilized and if desired mixed with auxiliary agents, e.g. , lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure buffers, coloring, flavoring and / or aromatic substances and the like. They may also be combined where desired with other active agents, e.g., other analgesic agents.
[0332] Routes of administration of any of the compositions of the disclosure include oral, nasal, rectal, intravaginal, parenteral, buccal, sublingual or topical. The compounds for use in the disclosure may be formulated for administration by any suitable route, such as for oral or parenteral, for example, transdermal, transmucosal e.g., sublingual, lingual, (trans)buccal, (trans)urethral, vaginal (e.g., trans- and perivaginally), (intra)nasal and (trans)rectal), intravesical, intrapulmonary, intraduodenal, intragastrical, intrathecal, subcutaneous, intramuscular, intradermal, intra-arterial, intravenous, intrabronchial, inhalation, and topical administration.
[0333] Suitable compositions and dosage forms include, for example, tablets, capsules, caplets, pills, gel caps, troches, dispersions, suspensions, solutions, syrups, granules, beads, transdermal patches, gels, powders, pellets, magmas, lozenges, creams, pastes, plasters, lotions, discs, suppositories, liquid sprays for nasal or oral administration, dry powder or aerosolized formulations for inhalation, compositions and formulations for intravesical administration and the like. It should be understood that the formulations and compositions that would be useful in the present disclosure are not limited to the particular formulations and compositions that are described herein. Oral Administration
[0334] For oral application, particularly suitable are tablets, dragees, liquids, drops, suppositories, or capsules, caplets and gelcaps. The compositions intended for oral use may be prepared according to any method known in the art and such compositions may contain one or more agents selected from the group consisting of inert, non-toxic pharmaceutically excipients that are suitable for the manufacture of tablets. Such excipients include, for example an inert diluent such as lactose; granulating and disintegrating agents such as cornstarch; binding agents such as starch; and lubricating agents such as magnesium stearate. The tablets may be uncoated or they may be coated by known techniques for elegance or to delay the release of the active ingredients. Formulations for oral use may also be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert diluent.
[0335] For oral administration, the compounds of the disclosure may be in the form of tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents (e.g, polyvinylpyrrolidone, hydroxypropylcellulose or hydroxypropylmethylcellulose); fillers (e.g., cornstarch, lactose, microcrystalline cellulose or calcium phosphate); lubricants (e.g., magnesium stearate, talc, or silica); disintegrates (e.g., sodium starch glycollate); or wetting agents (e.g., sodium lauryl sulphate). If desired, the tablets may be coated using suitable methods and coating materials such as OPADRY™ film coating systems available from Colorcon, West Point, Pa. (e.g., OPADRY™ OY Type, OYC Type, Organic Enteric OY-P Type, Aqueous Enteric OY-A Type, OY-PM Type and OPADRY™ White, 32K18400). Liquid preparation for oral administration may be in the form of solutions, syrups or suspensions. The liquid preparations may be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (e.g., sorbitol syrup, methyl cellulose or hydrogenated edible fats); emulsifying agent (e.g., lecithin or acacia); non-aqueous vehicles (e.g., almond oil, oily esters or ethyl alcohol); and preservatives (e.g., methyl or propyl p-hydroxy benzoates or sorbic acid).
[0336] The present disclosure also includes a multi-layer tablet comprising a layer providing for the delayed release of one or more compounds of the disclosure, and a further layer providing for the immediate release of another medication. Using a wax / pH-sensitive polymer mix, a gastric insoluble composition may be obtained in which the active ingredient is entrapped, ensuring its delayed release. Parenteral Administration
[0337] For parenteral administration, the compounds of the disclosure may be formulated for injection or infusion, for example, intravenous, intramuscular or subcutaneous injection or infusion, or for administration in a bolus dose and / or continuous infusion. Suspensions, solutions or emulsions in an oily or aqueous vehicle, optionally containing other formulatory agents such as suspending, stabilizing and / or dispersing agents may be used.
[0338] Additional Administration Forms
[0339] Additional dosage forms of this disclosure include dosage forms as described in U.S.
[0340] Patents Nos. 6,340,475; 6,488,962; 6,451,808; 5,972,389; 5,582,837; and 5,007,790. Additional dosage forms of this disclosure also include dosage forms as described in U.S. Patent Applications Nos. 20030147952; 20030104062; 20030104053; 20030044466; 20030039688; and 20020051820. Additional dosage forms of this disclosure also include dosage forms as described in PCT Applications Nos. WO 03 / 35041; WO 03 / 35040; WO 03 / 35029; WO 03 / 35177; WO 03 / 35039; WO 02 / 96404; WO 02 / 32416; WO 01 / 97783; WO 01 / 56544; WO 01 / 32217; WO 98 / 55107; WO 98 / 11879; WO 97 / 47285; WO 93 / 18755; and WO 90 / 11757.
[0341] Controlled Release Formulations and Drug Delivery Systems
[0342] In certain embodiments, the formulations of the present disclosure may be, but are not limited to, short-term, rapid-offset, as well as controlled, for example, sustained release, delayed release and pulsatile release formulations.
[0343] The term sustained release is used in its conventional sense to refer to a drug formulation that provides for gradual release of a drug over an extended period of time, and that may, although not necessarily, result in substantially constant blood levels of a drug over an extended time period. The period of time may be as long as a month or more and should be a release which is longer that the same amount of agent administered in bolus form.
[0344] For sustained release, the compounds may be formulated with a suitable polymer or hydrophobic material which provides sustained release properties to the compounds. As such, the compounds for use the method of the disclosure may be administered in the form of microparticles, for example, by injection or in the form of wafers or discs by implantation. In certain embodiments of the disclosure, the compounds of the disclosure are administered to a patient, alone or in combination with another pharmaceutical agent, using a sustained release formulation.
[0345] The term delayed release is used herein in its conventional sense to refer to a drug formulation that provides for an initial release of the drug after some delay following drug administration and that mat, although not necessarily, includes a delay of from about 10 minutes up to about 12 hours.
[0346] The term pulsatile release is used herein in its conventional sense to refer to a drug formulation that provides release of the drug in such a way as to produce pulsed plasma profiles of the drug after drug administration.
[0347] The term immediate release is used in its conventional sense to refer to a drug formulation that provides for release of the drug immediately after drug administration.
[0348] As used herein, short-term refers to any period of time up to and including about 8 hours, about 7 hours, about 6 hours, about 5 hours, about 4 hours, about 3 hours, about 2 hours, about 1 hour, about 40 minutes, about 20 minutes, or about 10 minutes and any or all whole or partial increments thereof after drug administration after drug administration.
[0349] As used herein, rapid-offset refers to any period of time up to and including about 8 hours, about 7 hours, about 6 hours, about 5 hours, about 4 hours, about 3 hours, about 2 hours, about 1 hour, about 40 minutes, about 20 minutes, or about 10 minutes, and any and all whole or partial increments thereof after drug administration.
[0350] Dosing
[0351] The therapeutically effective amount or dose of a compound of the present disclosure depends on the age, sex and weight of the patient, the current medical condition of the patient and the progression of the disease / disorder in the patient being treated. The skilled artisan is able to determine appropriate dosages depending on these and other factors.
[0352] A suitable dose of a compound of the present disclosure may be in the range of from about 0.01 mg to about 5,000 mg per day, such as from about 0.1 mg to about 1,000 mg, for example, from about 1 mg to about 500 mg, such as about 5 mg to about 250 mg per day. The dose may be administered in a single dosage or in multiple dosages, for example from 1 to 4 or more times per day. When multiple dosages are used, the amount of each dosage may be the same or different. For example, a dose of 1 mg per day may be administered as two 0.5 mg doses, with about a 12-hour interval between doses.
[0353] It is understood that the amount of compound dosed per day may be administered, in nonlimiting examples, every day, every other day, every 2 days, every 3 days, every 4 days, or every 5 days. For example, with every other day administration, a 5 mg per day dose may be initiated on Monday with a first subsequent 5 mg per day dose administered on Wednesday, a second subsequent 5 mg per day dose administered on Friday, and so on.
[0354] In the case wherein the patient's status does improve, upon the doctor's discretion the administration of the modulator of the disclosure is optionally given continuously; alternatively, the dose of drug being administered is temporarily reduced or temporarily suspended for a certain length of time (z.e., a "drug holiday"). The length of the drug holiday optionally varies between 2 days and 1 year, including by way of example only, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 10 days, 12 days, 15 days, 20 days, 28 days, 35 days, 50 days, 70 days, 100 days, 120 days, 150 days, 180 days, 200 days, 250 days, 280 days, 300 days, 320 days, 350 days, or 365 days. The dose reduction during a drug holiday includes from 10%-l 00%, including, by way of example only, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%.
[0355] Once improvement of the patient's conditions has occurred, a maintenance dose is administered if necessary. Subsequently, the dosage or the frequency of administration, or both, is reduced, as a function of the patient's condition, to a level at which the improved disease is retained. In certain embodiments, patients require intermittent treatment on a long-term basis upon any recurrence of symptoms and / or infection.
[0356] The compounds for use in the method of the disclosure may be formulated in unit dosage form. The term "unit dosage form" refers to physically discrete units suitable as unitary dosage for patients undergoing treatment, with each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect, optionally in association with a suitable pharmaceutical carrier. The unit dosage form may be for a single daily dose or one of multiple daily doses (e.g, about 1 to 4 or more times per day). When multiple daily doses are used, the unit dosage form may be the same or different for each dose.
[0357] Toxicity and therapeutic efficacy of such therapeutic regimens are optionally determined in cell cultures or experimental animals, including, but not limited to, the determination of the LDso (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between the toxic and therapeutic effects is the therapeutic index, which is expressed as the ratio between LD50 and ED50. Capsid assembly modulators exhibiting high therapeutic indices are preferred. The data obtained from cell culture assays and animal studies are optionally used in formulating a range of dosage for use in human. The dosage of such capsid assembly modulators lies preferably within a range of circulating concentrations that include the ED50 with minimal toxicity. The dosage optionally varies within this range depending upon the dosage form employed and the route of administration utilized.
[0358] Those skilled in the art recognizes, or is able to ascertain using no more than routine experimentation, numerous equivalents to the specific procedures, embodiments, claims, and examples described herein. Such equivalents were considered to be within the scope of this disclosure and covered by the claims appended hereto. For example, it should be understood, that modifications in assay and / or reaction conditions, with art-recognized alternatives and using no more than routine experimentation, are within the scope of the present application.
[0359] It is to be understood that wherever values and ranges are provided herein, all values and ranges encompassed by these values and ranges, are meant to be encompassed within the scope of the present disclosure. Moreover, all values that fall within these ranges, as well as the upper or lower limits of a range of values, are also contemplated by the present application.
[0360] Delivery
[0361] In certain embodiments, the compound contemplated herein (including but not limited to nucleic acids) can be more efficiently delivered to the cell nucleus by coupling the compound with the monoclonal anti-DNA antibody 3E10, which penetrates living cells and localizes in the nucleus without causing any apparent harm to the cell (Hansen JE, et al., Intranuclear protein transduction through a nucleoside salvage pathway. I Biol Chem 2007;282:20790-3; see also WO 2020 / 047353 and WO 2021 / 042060, all of which are incorporated herein in their entireties by reference). 3E10 and its single-chain variable fragment (3E10 scFv) have been developed as an intracellular delivery system for macromolecules. After localizing in the cell nucleus, 3E10 scFv is largely degraded within 4 hours, thus further minimizing any potential toxicity.
[0362] In certain embodiments, the compounds contemplated herein (including but not limited to nucleic acids) can be more efficiently delivered to the central nervous system using certain lipid nanoparticle formulations known in the art, such as but not limited to those described in Cullis, P. R. et al., Molecular Therapy Vol. 25 No 7 July 2017. See also US20150165039 and WO 2014 / 008334, all of which are incorporated herein in their entireties by reference.
[0363] In certain embodiments, the compounds contemplated herein can be more efficiently delivered to tissue by coupling with certain protein fragments, called “pHLIP” (pH (Low) Insertion Peptide), which allow for the cargo to accumulate in acidic environments within the body. In certain embodiments, a polypeptide with a predominantly hydrophobic sequence long enough to span a membrane lipid bilayer as a transmembrane helix (TM) and comprising one or more dissociable groups inserts across a membrane spontaneously in a pH-dependent fashion placing one terminus inside cell. The polypeptide conjugated with various functional moi eties delivers and accumulates them at cell membrane with low extracellular pH. The functional moiety conjugated with polypeptide terminus placed inside cell are translocated through the cell membrane in cytosol. The peptide and its variants or non-peptide analogs can be used to deliver therapeutic, prophylactic, diagnostic, imaging, gene regulation, cell regulation, or immunologic agents to or inside of cells in vitro or in vivo in tissue at low extracellular pH. See also US20080233107, WO2012 / 021790, US20120039990, US20120142042, US20150051153, US20150086617, and US20150191508, all of which are incorporated herein in their entireties by reference.
[0364] Examples
[0365] The instant specification further describes in detail by reference to the following experimental examples. These examples are provided for purposes of illustration only, and are not intended to be limiting unless so specified. Thus, the instant specification should in no way be construed as being limited to the following examples, but rather, should be construed to encompass any and all variations which become evident as a result of the teaching provided herein.
[0366] Example 1: Screening and Characterization of anti-CDH17 VHH Nanobodies
[0367] The present study sought to screen anti-CDH17 VHH (Variable Heavy domain of Heavy chain) nanobodies via phage display and develop more choices of VHHs and potent VHH-CAR T cells targeting CDH17. Referring to Fig. 1 A, to achieve these goals, the present study immunized two llamas with purified CDH17 protein, and collected peripheral blood mononuclear cells (PBMCs), which include B cells, from these two llamas. RNAs were extracted from the PBMCs and used as templates to synthesize cDNAs.
[0368] From the cDNAs, the variable regions of heavy chain of the immunoglobulin heavy chain genes (VHH) were amplified with PCR, ligated to the phage display vector, and transformed into competent cells, yielding two VHH phage display libraries, each had >109independent phage clones.
[0369] To screen VHHs that specifically binding to cell surface CDH17 from the phage library, the present study incubated the freshly prepared and concentrated VHH phage, which express antigen binding VHH, as a pill fusion protein on their surface, with CDH17-overexpressing NB4 cells. Then, the complex was washed with flow-cytometry buffer, and the bound VHH phage was eluted from the cells. The eluted phage was amplified, and then counter-selected with CDH17 negative NB4 cells, followed by one more round selection with CDH17-NB4 cells.
[0370] After two round panning, over 200 single clones were picked from the phage output, and analyzed with flow cytometry for their binding to CDH17-NB4 cells, with anti -phage secondary antibody.
[0371] In multiple rounds of screening, accumulatively, seventeen (17) unique VHHs that specifically bound CDH17-NB4 cells, but not CDH17 negative NB4 cells, were identified (Fig. IB). The VHHs are referred to herein as JF93, JF95, JF96, JF98, JF99, JF 111, JF115, JF118, JF 150, JF162, JF165, JF 166, JF 177, JF197, JF206, JF214, JF243 respectively. The sequence of each of the VHHs was determined and confirmed to contain the conserved VHH sequence (Figs. 7A-7B).
[0372] The extracellular portion of CDH17 has seven extracellular (EC) domains, ECI to EC7. As such, the present study sought to determine the specific domain(s) of CDH17 to which each of the sixteen anti-CDH17 VHHs binds.
[0373] To achieve this, 293T cells were transfected with various CDH17 mutants having deletions in each of the EC domains (AEC1, AEC2, etc.), followed by flow cytometry analysis with each VHH. Referring to Figs. 2A-2D, it was determined that JF93 binds to EC3 and EC4; JF95 binds to EC3; JF96 binds to EC3 and EC4; JF98 binds to EC3; JF99 binds to EC3 and EC4; JF111 binds to ECI; JF115 binds to EC4 and EC5; JF118 binds to ECI; JF 150 binds to EC 3 and EC4; JF162 binds to EC3 and EC4; JF165 binds to EC4 and EC5; JF166 binds to EC2 and EC3; JF 1 'll binds to EC2 and EC3; JF197 binds to EC3; JF206 binds to EC5 and EC6; JF214 binds to EC6, and JF243 binds to EC7.
[0374] Example 2: Construction of CAR Receptors
[0375] To investigate whether the isolated VHHs are capable of driving CAR-T cells to kill CDH17-expressing tumors, multiple chimeric antigen receptors (CARs) were constructed, which were in turn used to make CAR-T cells.
[0376] Referring to Fig. 3A, several of the VHH cDNAs were cloned to the lentivirus vector to construct lentivirus packaging plasmids that express CARs, which include, from N-terminus to C-terminus: the VHHs as the antigen-binding domains; an IgG4m hinge; a CD28 transmembrane domain; CD28 and 4- IBB co-stimulatory domains; and a CD3zeta domain.
[0377] The sequences of the VHH-28BBz CAR plasmids are listed in the Table below: CTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGAT
[0378] CAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATAC
[0379] CAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTA
[0380] GCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGG
[0381] CGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCG
[0382] CAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACG
[0383] ACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTC
[0384] CCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAG
[0385] AGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGG
[0386] GTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGA
[0387] GCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGG
[0388] CCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATT
[0389] ACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCG
[0390] AGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCG
[0391] CGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGC
[0392] GGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAG
[0393] GCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACA
[0394] ATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCGCGCAATTAACCCT
[0395] CACTAAAGGGAACAAAAGCTGGAGCTGCAAGCTTAATGTAGTCTTATGCAATACT
[0396] CTTGTAGTCTTGCAACATGGTAACGATGAGTTAGCAACATGCCTTACAAGGAGAG
[0397] AAAAAGCACCGTGCATGCCGATTGGTGGAAGTAAGGTGGTACGATCGTGCCTTAT
[0398] TAGGAAGGCAACAGACGGGTCTGACATGGATTGGACGAACCACTGAATTGCCGCA
[0399] TTGCAGAGATATTGTATTTAAGTGCCTAGCTCGATACATAAACGGGTCTCTCTGGT
[0400] TAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAA
[0401] GCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTG
[0402] ACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGC
[0403] AGTGGCGCCCGAACAGGGACTTGAAAGCGAAAGGGAAACCAGAGGAGCTCTCTC
[0404] GACGCAGGACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGAC
[0405] TGGTGAGTACGCCAAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAGATGGGT
[0406] GCGAGAGCGTCAGTATTAAGCGGGGGAGAATTAGATCGCGATGGGAAAAAATTC
[0407] GGTTAAGGCCAGGGGGAAAGAAAAAATATAAATTAAAACATATAGTATGGGCAA GCAGGGAGCTAGAACGATTCGCAGTTAATCCTGGCCTGTTAGAAACATCAGAAGG
[0408] CTGTAGACAAATACTGGGACAGCTACAACCATCCCTTCAGACAGGATCAGAAGAA
[0409] CTTAGATCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGGATAGA
[0410] GATAAAAGACACCAAGGAAGCTTTAGACAAGATAGAGGAAGAGCAAAACAAAAG
[0411] TAAGACCACCGCACAGCAAGCGGCCGCTGATCTTCAGACCTGGAGGAGGAGATAT
[0412] GAGGGACAATTGGAGAAGTGAATTATATAAATATAAAGTAGTAAAAATTGAACC
[0413] ATTAGGAGTAGCACCCACCAAGGCAAAGAGAAGAGTGGTGCAGAGAGAAAAAAG
[0414] AGCAGTGGGAATAGGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACT
[0415] ATGGGCGCAGCGTCAATGACGCTGACGGTACAGGCCAGACAATTATTGTCTGGTA
[0416] TAGTGCAGCAGCAGAACAATTTGCTGAGGGCTATTGAGGCGCAACAGCATCTGTT
[0417] GCAACTCACAGTCTGGGGCATCAAGCAGCTCCAGGCAAGAATCCTGGCTGTGGAA
[0418] AGATACCTAAAGGATCAACAGCTCCTGGGGATTTGGGGTTGCTCTGGAAAACTCA
[0419] TTTGCACCACTGCTGTGCCTTGGAATGCTAGTTGGAGTAATAAATCTCTGGAACAG
[0420] ATTTGGAATCACACGACCTGGATGGAGTGGGACAGAGAAATTAACAATTACACAA
[0421] GCTTAATACACTCCTTAATTGAAGAATCGCAAAACCAGCAAGAAAAGAATGAACA
[0422] AGAATTATTGGAATTAGATAAATGGGCAAGTTTGTGGAATTGGTTTAACATAACA
[0423] AATTGGCTGTGGTATATAAAATTATTCATAATGATAGTAGGAGGCTTGGTAGGTTT
[0424] AAGAATAGTTTTTGCTGTACTTTCTATAGTGAATAGAGTTAGGCAGGGATATTCAC
[0425] CATTATCGTTTCAGACCCACCTCCCAACCCCGAGGGGACCCGACAGGCCCGAAGG
[0426] AATAGAAGAAGAAGGTGGAGAGAGAGACAGAGACAGATCCATTCGATTAGTGAA
[0427] CGGATCTCGACGGTATCGATTAGACTGTAGCCCAGGAATATGGCAGCTAGATTGT
[0428] ACACATTTAGAAGGAAAAGTTATCTTGGTAGCAGTTCATGTAGCCAGTGGATATA
[0429] TAGAAGCAGAAGTAATTCCAGCAGAGACAGGGCAAGAAACAGCATACTTCCTCTT
[0430] AAAATTAGCAGGAAGATGGCCAGTAAAAACAGTACATACAGACAATGGCAGCAA
[0431] TTTCACCAGTACTACAGTTAAGGCCGCCTGTTGGTGGGCGGGGATCAAGCAGGAA
[0432] TTTGGCATTCCCTACAATCCCCAAAGTCAAGGAGTAATAGAATCTATGAATAAAG
[0433] AATTAAAGAAAATTATAGGACAGGTAAGAGATCAGGCTGAACATCTTAAGACAG
[0434] CAGTACAAATGGCAGTATTCATCCACAATTTTAAAAGAAAAGGGGGGATTGGGGG
[0435] GTACAGTGCAGGGGAAAGAATAGTAGACATAATAGCAACAGACATACAAACTAA
[0436] AGAATTACAAAAACAAATTACAAAAATTCAAAATTTTCGGGTTTATTACAGGGAC
[0437] AGCAGAGATCCAGTTTGGCTGCATACGCGTCGTGAGGCTCCGGTGCCCGTCAGTG GGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAA
[0438] TTGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTG
[0439] TACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAG
[0440] TCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTAAGTGCC
[0441] GTGTGTGGTTCCCGCGGGCCTGGCCTCTTTACGGGTTATGGCCCTTGCGTGCCTTG
[0442] AATTACTTCCACCTGGCTGCAGTACGTGATTCTTGATCCCGAGCTTCGGGTTGGAA
[0443] GTGGGTGGGAGAGTTCGAGGCCTTGCGCTTAAGGAGCCCCTTCGCCTCGTGCTTG
[0444] AGTTGAGGCCTGGCCTGGGCGCTGGGGCCGCCGCGTGCGAATCTGGTGGCACCTT
[0445] CGCGCCTGTCTCGCTGCTTTCGATAAGTCTCTAGCCATTTAAAATTTTTGATGACCT
[0446] GCTGCGACGCTTTTTTTCTGGCAAGATAGTCTTGTAAATGCGGGCCAAGATCTGCA
[0447] CACTGGTATTTCGGTTTTTGGGGCCGCGGGCGGCGACGGGGCCCGTGCGTCCCAG
[0448] CGCACATGTTCGGCGAGGCGGGGCCTGCGAGCGCGGCCACCGAGAATCGGACGG
[0449] GGGTAGTCTCAAGCTGGCCGGCCTGCTCTGGTGCCTGGCCTCGCGCCGCCGTGTAT
[0450] CGCCCCGCCCTGGGCGGCAAGGCTGGCCCGGTCGGCACCAGTTGCGTGAGCGGAA
[0451] AGATGGCCGCTTCCCGGCCCTGCTGCAGGGAGCTCAAAATGGAGGACGCGGCGCT
[0452] CGGGAGAGCGGGCGGGTGAGTCACCCACACAAAGGAAAAGGGCCTTTCCGTCCTC
[0453] AGCCGTCGCTTCATGTGACTCCACTGAGTACCGGGCGCCGTCCAGGCACCTCGATT
[0454] AGTTCTCGTGCTTTTGGAGTACGTCGTCTTTAGGTTGGGGGGAGGGGTTTTATGCG
[0455] ATGGAGTTTCCCCACACTGAGTGGGTGGAGACTGAAGTTAGGCCAGCTTGGCACT
[0456] TGATGTAATTCTCCTTGGAATTTGCCCTTTTTGAGTTTGGATCTTGGTTCATTCTCA
[0457] AGCCTCAGACAGTGGTTCAAAGTTTTTTTCTTCCATTTCAGGTGTCGTGAGCTAGC
[0458] TCTAGAATGGCCTTACCAGTGACCGCCTTGCTCCTGCCGCTGGCCTTGCTGCTCCA
[0459] CGCCGCCAGGCCGGGATCCCAGGTGCAGCTGCAGGAGTCTGGAGGAGGATTG
[0460] GTGCAGGCTGGGGGCTCTCTGAGACTCTCCTGTGCAGCCTCTGGATTCACTT
[0461] TGGACCGTTATTCCATTGGCTGGTTCCGCCAGGCCCCAGGGAAGGAGCGCGA
[0462] CGGGGTCTCATGTATTAGTGCTAGTGATGGTAGATACTATTCAGACTCCGTG
[0463] AGGGGCCGATTCACCATCTCCAGAGACAATGCCAAGAACACGGTATATCTGC
[0464] AAATGAACGGCCTGAAACCTGAGGACACGGCCGTTTATTACTGTGCGACCAC
[0465] GATATGTCAGAGGTCTATAGCGGATATGACGGGAAACTACTGGGGCCAGGG
[0466] GACCCAGGTCACCGTCTCCTCAGCGGCCGCCACTAGTTCCGGAGAGAGCAAGT
[0467] ACGGCCCTCCCTGCCCCCCTTGCCCTGATATCTTTTGGGTGCTGGTGGTGGTTGGT GGAGTCCTGGCTTGCTATAGCTTGCTAGTAACAGTGGCCTTTATTATTTTCTGGGT
[0468] GAGGAGTAAGAGGAGCAGGCTCCTGCACAGTGACTACATGAACATGACTCCCCGC
[0469] CGCCCCGGGCCCACCCGCAAGCATTACCAGCCCTATGCCCCACCACGCGACTTCG
[0470] CAGCCTATCGCTCCGCTAGCAAACGGGGCAGAAAGAAACTCCTGTATATATTCAA
[0471] ACAACCATTTATGAGACCAGTACAAACTACTCAAGAGGAAGATGGCTGTAGCTGC
[0472] CGATTTCCAGAAGAAGAAGAAGGAGGATGTGAACTGAGAGTGAAGTTCAGCAGG
[0473] AGCGCAGACGCCCCCGCGTACAAGCAGGGCCAGAACCAGCTCTATAACGAGCTC
[0474] AATCTAGGACGAAGAGAGGAGTACGATGTTTTGGACAAGAGACGTGGCCGGGAC
[0475] CCTGAGATGGGGGGAAAGCCGAGAAGGAAGAACCCTCAGGAAGGCCTGTACAAT
[0476] GAACTGCAGAAAGATAAGATGGCGGAGGCCTACAGTGAGATTGGGATGAAAGGC
[0477] GAGCGCCGGAGGGGCAAGGGGCACGATGGCCTTTACCAGGGTCTCAGTACAGCC
[0478] ACCAAGGACACCTACGACGCCCTTCACATGCAGGCCCTGCCCCCTCGCTAAGTCG
[0479] ACAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTAT
[0480] GTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATT
[0481] GCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTT
[0482] ATGAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTGCT
[0483] GACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTCCGGGAC
[0484] TTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCC
[0485] GCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGG
[0486] GAAGCTGACGTCCTTTCCTTGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCG
[0487] GGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGC
[0488] GGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAG
[0489] TCGGATCTCCCTTTGGGCCGCCTCCCCGCCTGGAATTCGAGCTCGGTACCTTTAAG
[0490] ACCAATGACTTACAAGGCAGCTGTAGATCTTAGCCACTTTTTAAAAGAAAAGGGG
[0491] GGACTGGAAGGGCTAATTCACTCCCAACGAAGACAAGATCTGCTTTTTGCTTGTAC
[0492] TGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGA
[0493] ACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCC
[0494] CGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTG
[0495] GAAAATCTCTAGCAGTAGTAGTTCATGTCATCTTATTATTCAGTATTTATAACTTG
[0496] CAAAGAAATGAATATCAGAGAGTGAGAGGAACTTGTTTATTGCAGCTTATAATGG
[0497] TTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGC AACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAAT
[0498] TAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCT
[0499] TCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCG
[0500] GTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTAC
[0501] ACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATA
[0502] GGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACT
[0503] TTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTT
[0504] TTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCA
[0505] GACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAAT
[0506] CTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGAT
[0507] CAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATAC
[0508] CAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTA
[0509] GCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGG
[0510] CGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCG
[0511] CAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACG
[0512] ACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTC
[0513] CCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAG
[0514] AGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGG
[0515] GTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGA
[0516] GCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGG
[0517] CCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATT
[0518] ACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCG
[0519] AGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCG
[0520] CGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGC
[0521] GGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAG
[0522] GCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACA
[0523] ATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCGCGCAATTAACCCT
[0524] CACTAAAGGGAACAAAAGCTGGAGCTGCAAGCTTAATGTAGTCTTATGCAATACT
[0525] CTTGTAGTCTTGCAACATGGTAACGATGAGTTAGCAACATGCCTTACAAGGAGAG
[0526] AAAAAGCACCGTGCATGCCGATTGGTGGAAGTAAGGTGGTACGATCGTGCCTTAT
[0527] TAGGAAGGCAACAGACGGGTCTGACATGGATTGGACGAACCACTGAATTGCCGCA TTGCAGAGATATTGTATTTAAGTGCCTAGCTCGATACATAAACGGGTCTCTCTGGT
[0528] TAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAA
[0529] GCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTG
[0530] ACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGC
[0531] AGTGGCGCCCGAACAGGGACTTGAAAGCGAAAGGGAAACCAGAGGAGCTCTCTC
[0532] GACGCAGGACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGAC
[0533] TGGTGAGTACGCCAAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAGATGGGT
[0534] GCGAGAGCGTCAGTATTAAGCGGGGGAGAATTAGATCGCGATGGGAAAAAATTC
[0535] GGTTAAGGCCAGGGGGAAAGAAAAAATATAAATTAAAACATATAGTATGGGCAA
[0536] GCAGGGAGCTAGAACGATTCGCAGTTAATCCTGGCCTGTTAGAAACATCAGAAGG
[0537] CTGTAGACAAATACTGGGACAGCTACAACCATCCCTTCAGACAGGATCAGAAGAA
[0538] CTTAGATCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGGATAGA
[0539] GATAAAAGACACCAAGGAAGCTTTAGACAAGATAGAGGAAGAGCAAAACAAAAG
[0540] TAAGACCACCGCACAGCAAGCGGCCGCTGATCTTCAGACCTGGAGGAGGAGATAT
[0541] GAGGGACAATTGGAGAAGTGAATTATATAAATATAAAGTAGTAAAAATTGAACC
[0542] ATTAGGAGTAGCACCCACCAAGGCAAAGAGAAGAGTGGTGCAGAGAGAAAAAAG
[0543] AGCAGTGGGAATAGGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACT
[0544] ATGGGCGCAGCGTCAATGACGCTGACGGTACAGGCCAGACAATTATTGTCTGGTA
[0545] TAGTGCAGCAGCAGAACAATTTGCTGAGGGCTATTGAGGCGCAACAGCATCTGTT
[0546] GCAACTCACAGTCTGGGGCATCAAGCAGCTCCAGGCAAGAATCCTGGCTGTGGAA
[0547] AGATACCTAAAGGATCAACAGCTCCTGGGGATTTGGGGTTGCTCTGGAAAACTCA
[0548] TTTGCACCACTGCTGTGCCTTGGAATGCTAGTTGGAGTAATAAATCTCTGGAACAG
[0549] ATTTGGAATCACACGACCTGGATGGAGTGGGACAGAGAAATTAACAATTACACAA
[0550] GCTTAATACACTCCTTAATTGAAGAATCGCAAAACCAGCAAGAAAAGAATGAACA
[0551] AGAATTATTGGAATTAGATAAATGGGCAAGTTTGTGGAATTGGTTTAACATAACA
[0552] AATTGGCTGTGGTATATAAAATTATTCATAATGATAGTAGGAGGCTTGGTAGGTTT
[0553] AAGAATAGTTTTTGCTGTACTTTCTATAGTGAATAGAGTTAGGCAGGGATATTCAC
[0554] CATTATCGTTTCAGACCCACCTCCCAACCCCGAGGGGACCCGACAGGCCCGAAGG
[0555] AATAGAAGAAGAAGGTGGAGAGAGAGACAGAGACAGATCCATTCGATTAGTGAA
[0556] CGGATCTCGACGGTATCGATTAGACTGTAGCCCAGGAATATGGCAGCTAGATTGT
[0557] ACACATTTAGAAGGAAAAGTTATCTTGGTAGCAGTTCATGTAGCCAGTGGATATA TAGAAGCAGAAGTAATTCCAGCAGAGACAGGGCAAGAAACAGCATACTTCCTCTT
[0558] AAAATTAGCAGGAAGATGGCCAGTAAAAACAGTACATACAGACAATGGCAGCAA
[0559] TTTCACCAGTACTACAGTTAAGGCCGCCTGTTGGTGGGCGGGGATCAAGCAGGAA
[0560] TTTGGCATTCCCTACAATCCCCAAAGTCAAGGAGTAATAGAATCTATGAATAAAG
[0561] AATTAAAGAAAATTATAGGACAGGTAAGAGATCAGGCTGAACATCTTAAGACAG
[0562] CAGTACAAATGGCAGTATTCATCCACAATTTTAAAAGAAAAGGGGGGATTGGGGG
[0563] GTACAGTGCAGGGGAAAGAATAGTAGACATAATAGCAACAGACATACAAACTAA
[0564] AGAATTACAAAAACAAATTACAAAAATTCAAAATTTTCGGGTTTATTACAGGGAC
[0565] AGCAGAGATCCAGTTTGGCTGCATACGCGTCGTGAGGCTCCGGTGCCCGTCAGTG
[0566] GGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAA
[0567] TTGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTG
[0568] TACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAG
[0569] TCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTAAGTGCC
[0570] GTGTGTGGTTCCCGCGGGCCTGGCCTCTTTACGGGTTATGGCCCTTGCGTGCCTTG
[0571] AATTACTTCCACCTGGCTGCAGTACGTGATTCTTGATCCCGAGCTTCGGGTTGGAA
[0572] GTGGGTGGGAGAGTTCGAGGCCTTGCGCTTAAGGAGCCCCTTCGCCTCGTGCTTG
[0573] AGTTGAGGCCTGGCCTGGGCGCTGGGGCCGCCGCGTGCGAATCTGGTGGCACCTT
[0574] CGCGCCTGTCTCGCTGCTTTCGATAAGTCTCTAGCCATTTAAAATTTTTGATGACCT
[0575] GCTGCGACGCTTTTTTTCTGGCAAGATAGTCTTGTAAATGCGGGCCAAGATCTGCA
[0576] CACTGGTATTTCGGTTTTTGGGGCCGCGGGCGGCGACGGGGCCCGTGCGTCCCAG
[0577] CGCACATGTTCGGCGAGGCGGGGCCTGCGAGCGCGGCCACCGAGAATCGGACGG
[0578] GGGTAGTCTCAAGCTGGCCGGCCTGCTCTGGTGCCTGGCCTCGCGCCGCCGTGTAT
[0579] CGCCCCGCCCTGGGCGGCAAGGCTGGCCCGGTCGGCACCAGTTGCGTGAGCGGAA
[0580] AGATGGCCGCTTCCCGGCCCTGCTGCAGGGAGCTCAAAATGGAGGACGCGGCGCT
[0581] CGGGAGAGCGGGCGGGTGAGTCACCCACACAAAGGAAAAGGGCCTTTCCGTCCTC
[0582] AGCCGTCGCTTCATGTGACTCCACTGAGTACCGGGCGCCGTCCAGGCACCTCGATT
[0583] AGTTCTCGTGCTTTTGGAGTACGTCGTCTTTAGGTTGGGGGGAGGGGTTTTATGCG
[0584] ATGGAGTTTCCCCACACTGAGTGGGTGGAGACTGAAGTTAGGCCAGCTTGGCACT
[0585] TGATGTAATTCTCCTTGGAATTTGCCCTTTTTGAGTTTGGATCTTGGTTCATTCTCA
[0586] AGCCTCAGACAGTGGTTCAAAGTTTTTTTCTTCCATTTCAGGTGTCGTGAGCTAGC
[0587] TCTAGAATGGCCTTACCAGTGACCGCCTTGCTCCTGCCGCTGGCCTTGCTGCTCCA CGCCGCCAGGCCGGGATCCCAGGTGCAGCTGCAGGAGTCTGGAGGAGGATTG
[0588] GTGCAGGCTGGGGGCTCTCTGAGACTCTCCTGTACAGTTTCTGGAGGCACCT
[0589] TCAGTAGATATGCCATGGGCTGGTTCCGCCAGGCTCCAGGAAAGGAGCGTGA
[0590] GTTTGTTGCAGCTATTGCATGGAGTACACATAACACAAATTATGCCGACTCC
[0591] GTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACACGGTGTATC
[0592] TGCAAATGAACAGCCTGAAACCTGAGGACACGGCCGTTTATTACTGTGCGGC
[0593] AGATACACAATATGATAGTGTAACATATGACTACTGGGGCCAGGGGACCCAG
[0594] GTCACCGTCTCCTCAGCGGCCGCCACTAGTTCCGGAGAGAGCAAGTACGGCCC
[0595] TCCCTGCCCCCCTTGCCCTGATATCTTTTGGGTGCTGGTGGTGGTTGGTGGAGTCCT
[0596] GGCTTGCTATAGCTTGCTAGTAACAGTGGCCTTTATTATTTTCTGGGTGAGGAGTA
[0597] AGAGGAGCAGGCTCCTGCACAGTGACTACATGAACATGACTCCCCGCCGCCCCGG
[0598] GCCCACCCGCAAGCATTACCAGCCCTATGCCCCACCACGCGACTTCGCAGCCTAT
[0599] CGCTCCGCTAGCAAACGGGGCAGAAAGAAACTCCTGTATATATTCAAACAACCAT
[0600] TTATGAGACCAGTACAAACTACTCAAGAGGAAGATGGCTGTAGCTGCCGATTTCC
[0601] AGAAGAAGAAGAAGGAGGATGTGAACTGAGAGTGAAGTTCAGCAGGAGCGCAGA
[0602] CGCCCCCGCGTACAAGCAGGGCCAGAACCAGCTCTATAACGAGCTCAATCTAGGA
[0603] CGAAGAGAGGAGTACGATGTTTTGGACAAGAGACGTGGCCGGGACCCTGAGATG
[0604] GGGGGAAAGCCGAGAAGGAAGAACCCTCAGGAAGGCCTGTACAATGAACTGCAG
[0605] AAAGATAAGATGGCGGAGGCCTACAGTGAGATTGGGATGAAAGGCGAGCGCCGG
[0606] AGGGGCAAGGGGCACGATGGCCTTTACCAGGGTCTCAGTACAGCCACCAAGGAC
[0607] ACCTACGACGCCCTTCACATGCAGGCCCTGCCCCCTCGCTAAGTCGACAATCAAC
[0608] CTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCT
[0609] TTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGT
[0610] ATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAG
[0611] TTGTGGCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTGCTGACGCAAC
[0612] CCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTCCGGGACTTTCGCTT
[0613] TCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGG
[0614] ACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAGCTGA
[0615] CGTCCTTTCCTTGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCT
[0616] TCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTG
[0617] CCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTC CCTTTGGGCCGCCTCCCCGCCTGGAATTCGAGCTCGGTACCTTTAAGACCAATGAC
[0618] TTACAAGGCAGCTGTAGATCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGAA
[0619] GGGCTAATTCACTCCCAACGAAGACAAGATCTGCTTTTTGCTTGTACTGGGTCTCT
[0620] CTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTG
[0621] CTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTT
[0622] GTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCT
[0623] CTAGCAGTAGTAGTTCATGTCATCTTATTATTCAGTATTTATAACTTGCAAAGAAA
[0624] TGAATATCAGAGAGTGAGAGGAACTTGTTTATTGCAGCTTATAATGGTTACAAAT
[0625] AAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGT
[0626] TGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGCTCTAGCTATCCCGC
[0627] CCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTA
[0628] TTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGG
[0629] AGGCTTTTTTGGAGGCCTAGCTAGGGACGTACCCAATTCGCCCTATAGTGAGTCGT
[0630] ATTACGCGCGCTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGC
[0631] GTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAG
[0632] CGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAA
[0633] TGGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCA
[0634] GCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTT
[0635] CCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCT
[0636] TTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGG
[0637] TGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGT
[0638] TGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAAC
[0639] CCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGG
[0640] TTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAA
[0641] CGCTTACAATTTAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTT
[0642] TATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAA
[0643] ATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCG
[0644] CCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGC
[0645] TGGTGAAAGTAAAAGATGCTGAAGATCAGTTGG (SEQ ID NO:70)
[0646] Italic. Restriction enzyme cutting sites used for inserting VHH;
[0647] Bold: Inserted VHH sequence VHH98-28BBz pTRPE-CAR vector (VHH: JF98)
[0648] GTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGA
[0649] GAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGC
[0650] TATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCG
[0651] CCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAA
[0652] AAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAA
[0653] CCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACC
[0654] GAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTT
[0655] GATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGAC
[0656] ACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCG
[0657] AACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGA
[0658] TAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTG
[0659] CTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACT
[0660] GGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGT
[0661] CAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCA
[0662] CTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGAT
[0663] TGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTG
[0664] ATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCA
[0665] GACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGT
[0666] AATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTG
[0667] CCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAG
[0668] CGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTC
[0669] AAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGT
[0670] GGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGA
[0671] TAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACAC
[0672] AGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGA
[0673] GCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCC
[0674] GGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGG
[0675] AAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGC
[0676] GTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAG
[0677] CAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTT CTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGT
[0678] GAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGA
[0679] GCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTT
[0680] GGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGG
[0681] CAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAG
[0682] GCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATA
[0683] ACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCGCGCAATT
[0684] AACCCTCACTAAAGGGAACAAAAGCTGGAGCTGCAAGCTTAATGTAGTCTTA
[0685] TGCAATACTCTTGTAGTCTTGCAACATGGTAACGATGAGTTAGCAACATGCC
[0686] TTACAAGGAGAGAAAAAGCACCGTGCATGCCGATTGGTGGAAGTAAGGTGG
[0687] TACGATCGTGCCTTATTAGGAAGGCAACAGACGGGTCTGACATGGATTGGAC
[0688] GAACCACTGAATTGCCGCATTGCAGAGATATTGTATTTAAGTGCCTAGCTCG
[0689] ATACATAAACGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCT
[0690] GGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGC
[0691] TTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTC
[0692] AGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTGGCGCCCGAACAGGGA
[0693] CTTGAAAGCGAAAGGGAAACCAGAGGAGCTCTCTCGACGCAGGACTCGGCT
[0694] TGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCC
[0695] AAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAGATGGGTGCGAGAGCGT
[0696] CAGTATTAAGCGGGGGAGAATTAGATCGCGATGGGAAAAAATTCGGTTAAG
[0697] GCCAGGGGGAAAGAAAAAATATAAATTAAAACATATAGTATGGGCAAGCAG
[0698] GGAGCTAGAACGATTCGCAGTTAATCCTGGCCTGTTAGAAACATCAGAAGGC
[0699] TGTAGACAAATACTGGGACAGCTACAACCATCCCTTCAGACAGGATCAGAAG
[0700] AACTTAGATCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAG
[0701] GATAGAGATAAAAGACACCAAGGAAGCTTTAGACAAGATAGAGGAAGAGCA
[0702] AAACAAAAGTAAGACCACCGCACAGCAAGCGGCCGCTGATCTTCAGACCTG
[0703] GAGGAGGAGATATGAGGGACAATTGGAGAAGTGAATTATATAAATATAAAG
[0704] TAGTAAAAATTGAACCATTAGGAGTAGCACCCACCAAGGCAAAGAGAAGAG
[0705] TGGTGCAGAGAGAAAAAAGAGCAGTGGGAATAGGAGCTTTGTTCCTTGGGTT
[0706] CTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCGTCAATGACGCTGACGGT
[0707] ACAGGCCAGACAATTATTGTCTGGTATAGTGCAGCAGCAGAACAATTTGCTG AGGGCTATTGAGGCGCAACAGCATCTGTTGCAACTCACAGTCTGGGGCATCA
[0708] AGCAGCTCCAGGCAAGAATCCTGGCTGTGGAAAGATACCTAAAGGATCAAC
[0709] AGCTCCTGGGGATTTGGGGTTGCTCTGGAAAACTCATTTGCACCACTGCTGTG
[0710] CCTTGGAATGCTAGTTGGAGTAATAAATCTCTGGAACAGATTTGGAATCACA
[0711] CGACCTGGATGGAGTGGGACAGAGAAATTAACAATTACACAAGCTTAATAC
[0712] ACTCCTTAATTGAAGAATCGCAAAACCAGCAAGAAAAGAATGAACAAGAAT
[0713] TATTGGAATTAGATAAATGGGCAAGTTTGTGGAATTGGTTTAACATAACAAA
[0714] TTGGCTGTGGTATATAAAATTATTCATAATGATAGTAGGAGGCTTGGTAGGT
[0715] TTAAGAATAGTTTTTGCTGTACTTTCTATAGTGAATAGAGTTAGGCAGGGATA
[0716] TTCACCATTATCGTTTCAGACCCACCTCCCAACCCCGAGGGGACCCGACAGG
[0717] CCCGAAGGAATAGAAGAAGAAGGTGGAGAGAGAGACAGAGACAGATCCATT
[0718] CGATTAGTGAACGGATCTCGACGGTATCGATTAGACTGTAGCCCAGGAATAT
[0719] GGCAGCTAGATTGTACACATTTAGAAGGAAAAGTTATCTTGGTAGCAGTTCA
[0720] TGTAGCCAGTGGATATATAGAAGCAGAAGTAATTCCAGCAGAGACAGGGCA
[0721] AGAAACAGCATACTTCCTCTTAAAATTAGCAGGAAGATGGCCAGTAAAAACA
[0722] GTACATACAGACAATGGCAGCAATTTCACCAGTACTACAGTTAAGGCCGCCT
[0723] GTTGGTGGGCGGGGATCAAGCAGGAATTTGGCATTCCCTACAATCCCCAAAG
[0724] TCAAGGAGTAATAGAATCTATGAATAAAGAATTAAAGAAAATTATAGGACA
[0725] GGTAAGAGATCAGGCTGAACATCTTAAGACAGCAGTACAAATGGCAGTATTC
[0726] ATCCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAA
[0727] AGAATAGTAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAA
[0728] CAAATTACAAAAATTCAAAATTTTCGGGTTTATTACAGGGACAGCAGAGATC
[0729] CAGTTTGGCTGCATACGCGTCGTGAGGCTCCGGTGCCCGTCAGTGGGCAGAG
[0730] CGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGA
[0731] ACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTG
[0732] TACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAG
[0733] TAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGT
[0734] AAGTGCCGTGTGTGGTTCCCGCGGGCCTGGCCTCTTTACGGGTTATGGCCCTT
[0735] GCGTGCCTTGAATTACTTCCACCTGGCTGCAGTACGTGATTCTTGATCCCGAG
[0736] CTTCGGGTTGGAAGTGGGTGGGAGAGTTCGAGGCCTTGCGCTTAAGGAGCCC
[0737] CTTCGCCTCGTGCTTGAGTTGAGGCCTGGCCTGGGCGCTGGGGCCGCCGCGT GCGAATCTGGTGGCACCTTCGCGCCTGTCTCGCTGCTTTCGATAAGTCTCTAG
[0738] CCATTTAAAATTTTTGATGACCTGCTGCGACGCTTTTTTTCTGGCAAGATAGT
[0739] CTTGTAAATGCGGGCCAAGATCTGCACACTGGTATTTCGGTTTTTGGGGCCGC
[0740] GGGCGGCGACGGGGCCCGTGCGTCCCAGCGCACATGTTCGGCGAGGCGGGG
[0741] CCTGCGAGCGCGGCCACCGAGAATCGGACGGGGGTAGTCTCAAGCTGGCCG
[0742] GCCTGCTCTGGTGCCTGGCCTCGCGCCGCCGTGTATCGCCCCGCCCTGGGCG
[0743] GCAAGGCTGGCCCGGTCGGCACCAGTTGCGTGAGCGGAAAGATGGCCGCTTC
[0744] CCGGCCCTGCTGCAGGGAGCTCAAAATGGAGGACGCGGCGCTCGGGAGAGC
[0745] GGGCGGGTGAGTCACCCACACAAAGGAAAAGGGCCTTTCCGTCCTCAGCCGT
[0746] CGCTTCATGTGACTCCACTGAGTACCGGGCGCCGTCCAGGCACCTCGATTAG
[0747] TTCTCGTGCTTTTGGAGTACGTCGTCTTTAGGTTGGGGGGAGGGGTTTTATGC
[0748] GATGGAGTTTCCCCACACTGAGTGGGTGGAGACTGAAGTTAGGCCAGCTTGG
[0749] CACTTGATGTAATTCTCCTTGGAATTTGCCCTTTTTGAGTTTGGATCTTGGTTC
[0750] ATTCTCAAGCCTCAGACAGTGGTTCAAAGTTTTTTTCTTCCATTTCAGGTGTC
[0751] GTGAGCTAGCTCTAGAATGGCCTTACCAGTGACCGCCTTGCTCCTGCCGCTG
[0752] GCCTTGCTGCTCCACGCCGCCAGGCCGGGATCCCAGGTGCAGCTGCAGGAG
[0753] TCTGGGGGAGGCTTGGTGCAGGCTGGGGGGTCTCTGAGACTCTCCTGTG
[0754] CAGTCTCTAGAAGCGACTTCAGTATCCGTGCCGGCGCCTGGTACCGCCA
[0755] GGCTCCAGGGAAGCAGCGCGACCTGGTCGCACGCATTACTACTGATGGT
[0756] AGGATAAACTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCACAGG
[0757] ACAAGGACAACACTACACTGTATCTGCAAATGAACAGCCTGAAAACTGA
[0758] CGACACGGCCGTCTATTACTGTAATGCAGACTTACGGCGACGTTACGAG
[0759] TACATGACTATGTGGGGCCAGGGGACCCAGGTCACCGTCTCCTCAGCGG
[0760] CCGCCACTAGTTCCGGAGAGAGCAAGTACGGCCCTCCCTGCCCCCCTTGCCC
[0761] TGATATCTTTTGGGTGCTGGTGGTGGTTGGTGGAGTCCTGGCTTGCTATAGCT
[0762] TGCTAGTAACAGTGGCCTTTATTATTTTCTGGGTGAGGAGTAAGAGGAGCAG
[0763] GCTCCTGCACAGTGACTACATGAACATGACTCCCCGCCGCCCCGGGCCCACC
[0764] CGCAAGCATTACCAGCCCTATGCCCCACCACGCGACTTCGCAGCCTATCGCT
[0765] CCGCTAGCAAACGGGGCAGAAAGAAACTCCTGTATATATTCAAACAACCATT
[0766] TATGAGACCAGTACAAACTACTCAAGAGGAAGATGGCTGTAGCTGCCGATTT
[0767] CCAGAAGAAGAAGAAGGAGGATGTGAACTGAGAGTGAAGTTCAGCAGGAGC GCAGACGCCCCCGCGTACAAGCAGGGCCAGAACCAGCTCTATAACGAGCTC
[0768] AATCTAGGACGAAGAGAGGAGTACGATGTTTTGGACAAGAGACGTGGCCGG
[0769] GACCCTGAGATGGGGGGAAAGCCGAGAAGGAAGAACCCTCAGGAAGGCCTG
[0770] TACAATGAACTGCAGAAAGATAAGATGGCGGAGGCCTACAGTGAGATTGGG
[0771] ATGAAAGGCGAGCGCCGGAGGGGCAAGGGGCACGATGGCCTTTACCAGGGT
[0772] CTCAGTACAGCCACCAAGGACACCTACGACGCCCTTCACATGCAGGCCCTGC
[0773] CCCCTCGCTAAGTCGACAATCAACCTCTGGATTACAAAATTTGTGAAAGATT
[0774] GACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTT
[0775] TAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCT
[0776] TGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGG
[0777] CAACGTGGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGG
[0778] GCATTGCCACCACCTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCT
[0779] ATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGG
[0780] CTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAGCTGACGTC
[0781] CTTTCCTTGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCT
[0782] TCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTG
[0783] CTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCG
[0784] GATCTCCCTTTGGGCCGCCTCCCCGCCTGGAATTCGAGCTCGGTACCTTTAAG
[0785] ACCAATGACTTACAAGGCAGCTGTAGATCTTAGCCACTTTTTAAAAGAAAAG
[0786] GGGGGACTGGAAGGGCTAATTCACTCCCAACGAAGACAAGATCTGCTTTTTG
[0787] CTTGTACTGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGC
[0788] TAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTC
[0789] AAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAG
[0790] ACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTAGTAGTTCATGTCATCTTA
[0791] TTATTCAGTATTTATAACTTGCAAAGAAATGAATATCAGAGAGTGAGAGGAA
[0792] CTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATT
[0793] TCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTC
[0794] ATCAATGTATCTTATCATGTCTGGCTCTAGCTATCCCGCCCCTAACTCCGCCC
[0795] AGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGA
[0796] GGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTT
[0797] TTTGGAGGCCTAGCTAGGGACGTACCCAATTCGCCCTATAGTGAGTCGTATT
[0798] CTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACT
[0799] GGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGT
[0800] CAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCA
[0801] CTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGAT
[0802] TGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTG
[0803] ATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCA
[0804] GACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGT
[0805] AATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTG
[0806] CCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAG
[0807] CGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTC
[0808] AAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGT
[0809] GGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGA
[0810] TAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACAC
[0811] AGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGA
[0812] GCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCC
[0813] GGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGG
[0814] AAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGC
[0815] GTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAG
[0816] CAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTT
[0817] CTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGT
[0818] GAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGA
[0819] GCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTT
[0820] GGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGG
[0821] CAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAG
[0822] GCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATA
[0823] ACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCGCGCAATT
[0824] AACCCTCACTAAAGGGAACAAAAGCTGGAGCTGCAAGCTTAATGTAGTCTTA
[0825] TGCAATACTCTTGTAGTCTTGCAACATGGTAACGATGAGTTAGCAACATGCC
[0826] TTACAAGGAGAGAAAAAGCACCGTGCATGCCGATTGGTGGAAGTAAGGTGG
[0827] TACGATCGTGCCTTATTAGGAAGGCAACAGACGGGTCTGACATGGATTGGAC
[0828] GAACCACTGAATTGCCGCATTGCAGAGATATTGTATTTAAGTGCCTAGCTCG ATACATAAACGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCT
[0829] GGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGC
[0830] TTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTC
[0831] AGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTGGCGCCCGAACAGGGA
[0832] CTTGAAAGCGAAAGGGAAACCAGAGGAGCTCTCTCGACGCAGGACTCGGCT
[0833] TGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCC
[0834] AAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAGATGGGTGCGAGAGCGT
[0835] CAGTATTAAGCGGGGGAGAATTAGATCGCGATGGGAAAAAATTCGGTTAAG
[0836] GCCAGGGGGAAAGAAAAAATATAAATTAAAACATATAGTATGGGCAAGCAG
[0837] GGAGCTAGAACGATTCGCAGTTAATCCTGGCCTGTTAGAAACATCAGAAGGC
[0838] TGTAGACAAATACTGGGACAGCTACAACCATCCCTTCAGACAGGATCAGAAG
[0839] AACTTAGATCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAG
[0840] GATAGAGATAAAAGACACCAAGGAAGCTTTAGACAAGATAGAGGAAGAGCA
[0841] AAACAAAAGTAAGACCACCGCACAGCAAGCGGCCGCTGATCTTCAGACCTG
[0842] GAGGAGGAGATATGAGGGACAATTGGAGAAGTGAATTATATAAATATAAAG
[0843] TAGTAAAAATTGAACCATTAGGAGTAGCACCCACCAAGGCAAAGAGAAGAG
[0844] TGGTGCAGAGAGAAAAAAGAGCAGTGGGAATAGGAGCTTTGTTCCTTGGGTT
[0845] CTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCGTCAATGACGCTGACGGT
[0846] ACAGGCCAGACAATTATTGTCTGGTATAGTGCAGCAGCAGAACAATTTGCTG
[0847] AGGGCTATTGAGGCGCAACAGCATCTGTTGCAACTCACAGTCTGGGGCATCA
[0848] AGCAGCTCCAGGCAAGAATCCTGGCTGTGGAAAGATACCTAAAGGATCAAC
[0849] AGCTCCTGGGGATTTGGGGTTGCTCTGGAAAACTCATTTGCACCACTGCTGTG
[0850] CCTTGGAATGCTAGTTGGAGTAATAAATCTCTGGAACAGATTTGGAATCACA
[0851] CGACCTGGATGGAGTGGGACAGAGAAATTAACAATTACACAAGCTTAATAC
[0852] ACTCCTTAATTGAAGAATCGCAAAACCAGCAAGAAAAGAATGAACAAGAAT
[0853] TATTGGAATTAGATAAATGGGCAAGTTTGTGGAATTGGTTTAACATAACAAA
[0854] TTGGCTGTGGTATATAAAATTATTCATAATGATAGTAGGAGGCTTGGTAGGT
[0855] TTAAGAATAGTTTTTGCTGTACTTTCTATAGTGAATAGAGTTAGGCAGGGATA
[0856] TTCACCATTATCGTTTCAGACCCACCTCCCAACCCCGAGGGGACCCGACAGG
[0857] CCCGAAGGAATAGAAGAAGAAGGTGGAGAGAGAGACAGAGACAGATCCATT
[0858] CGATTAGTGAACGGATCTCGACGGTATCGATTAGACTGTAGCCCAGGAATAT GGCAGCTAGATTGTACACATTTAGAAGGAAAAGTTATCTTGGTAGCAGTTCA
[0859] TGTAGCCAGTGGATATATAGAAGCAGAAGTAATTCCAGCAGAGACAGGGCA
[0860] AGAAACAGCATACTTCCTCTTAAAATTAGCAGGAAGATGGCCAGTAAAAACA
[0861] GTACATACAGACAATGGCAGCAATTTCACCAGTACTACAGTTAAGGCCGCCT
[0862] GTTGGTGGGCGGGGATCAAGCAGGAATTTGGCATTCCCTACAATCCCCAAAG
[0863] TCAAGGAGTAATAGAATCTATGAATAAAGAATTAAAGAAAATTATAGGACA
[0864] GGTAAGAGATCAGGCTGAACATCTTAAGACAGCAGTACAAATGGCAGTATTC
[0865] ATCCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAA
[0866] AGAATAGTAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAA
[0867] CAAATTACAAAAATTCAAAATTTTCGGGTTTATTACAGGGACAGCAGAGATC
[0868] CAGTTTGGCTGCATACGCGTCGTGAGGCTCCGGTGCCCGTCAGTGGGCAGAG
[0869] CGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGA
[0870] ACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTG
[0871] TACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAG
[0872] TAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGT
[0873] AAGTGCCGTGTGTGGTTCCCGCGGGCCTGGCCTCTTTACGGGTTATGGCCCTT
[0874] GCGTGCCTTGAATTACTTCCACCTGGCTGCAGTACGTGATTCTTGATCCCGAG
[0875] CTTCGGGTTGGAAGTGGGTGGGAGAGTTCGAGGCCTTGCGCTTAAGGAGCCC
[0876] CTTCGCCTCGTGCTTGAGTTGAGGCCTGGCCTGGGCGCTGGGGCCGCCGCGT
[0877] GCGAATCTGGTGGCACCTTCGCGCCTGTCTCGCTGCTTTCGATAAGTCTCTAG
[0878] CCATTTAAAATTTTTGATGACCTGCTGCGACGCTTTTTTTCTGGCAAGATAGT
[0879] CTTGTAAATGCGGGCCAAGATCTGCACACTGGTATTTCGGTTTTTGGGGCCGC
[0880] GGGCGGCGACGGGGCCCGTGCGTCCCAGCGCACATGTTCGGCGAGGCGGGG
[0881] CCTGCGAGCGCGGCCACCGAGAATCGGACGGGGGTAGTCTCAAGCTGGCCG
[0882] GCCTGCTCTGGTGCCTGGCCTCGCGCCGCCGTGTATCGCCCCGCCCTGGGCG
[0883] GCAAGGCTGGCCCGGTCGGCACCAGTTGCGTGAGCGGAAAGATGGCCGCTTC
[0884] CCGGCCCTGCTGCAGGGAGCTCAAAATGGAGGACGCGGCGCTCGGGAGAGC
[0885] GGGCGGGTGAGTCACCCACACAAAGGAAAAGGGCCTTTCCGTCCTCAGCCGT
[0886] CGCTTCATGTGACTCCACTGAGTACCGGGCGCCGTCCAGGCACCTCGATTAG
[0887] TTCTCGTGCTTTTGGAGTACGTCGTCTTTAGGTTGGGGGGAGGGGTTTTATGC
[0888] GATGGAGTTTCCCCACACTGAGTGGGTGGAGACTGAAGTTAGGCCAGCTTGG CACTTGATGTAATTCTCCTTGGAATTTGCCCTTTTTGAGTTTGGATCTTGGTTC
[0889] ATTCTCAAGCCTCAGACAGTGGTTCAAAGTTTTTTTCTTCCATTTCAGGTGTC
[0890] GTGAGCTAGCTCTAGAATGGCCTTACCAGTGACCGCCTTGCTCCTGCCGCTG
[0891] GCCTTGCTGCTCCACGCCGCCAGGCCGGGATCCCAGGTGCAGCTGCAGGAG
[0892] TCTGGAGGAGGATTGGTGCAGGCTGGGGGCTCTCTGAGACTCTCCTGTG
[0893] CAGCCTCTGGACGCACCTTCAGTGAACGCACCTTCAGTGACTATGTTGT
[0894] GGGCTGGTTCCGCCAGGCCCCAGGGAAGGATCGTGAATTTGTTTCACTT
[0895] ATTTCAAGGGGTGGTGGGGTAATGTATGCGGACTCCGTGAAGGGCCGAT
[0896] TCACCATCTCAAGAGACAATGCTAAGAACACGTGGTACCTGCAAATGAA
[0897] CAGCCTGAAACCCGAGGACACGGCCGTTTATTACTGTGCAGCAGATCTC
[0898] CTGGGCACCTATGATCAACCTACTGATTATGGGTACTGGGGCCAGGGGA
[0899] CCCAGGTCACCGTCTCCTCAGCGGCCGCCACTAGTTCCGGAGAGAGCAAG
[0900] TACGGCCCTCCCTGCCCCCCTTGCCCTGATATCTTTTGGGTGCTGGTGGTGGT
[0901] TGGTGGAGTCCTGGCTTGCTATAGCTTGCTAGTAACAGTGGCCTTTATTATTT
[0902] TCTGGGTGAGGAGTAAGAGGAGCAGGCTCCTGCACAGTGACTACATGAACAT
[0903] GACTCCCCGCCGCCCCGGGCCCACCCGCAAGCATTACCAGCCCTATGCCCCA
[0904] CCACGCGACTTCGCAGCCTATCGCTCCGCTAGCAAACGGGGCAGAAAGAAAC
[0905] TCCTGTATATATTCAAACAACCATTTATGAGACCAGTACAAACTACTCAAGA
[0906] GGAAGATGGCTGTAGCTGCCGATTTCCAGAAGAAGAAGAAGGAGGATGTGA
[0907] ACTGAGAGTGAAGTTCAGCAGGAGCGCAGACGCCCCCGCGTACAAGCAGGG
[0908] CCAGAACCAGCTCTATAACGAGCTCAATCTAGGACGAAGAGAGGAGTACGA
[0909] TGTTTTGGACAAGAGACGTGGCCGGGACCCTGAGATGGGGGGAAAGCCGAG
[0910] AAGGAAGAACCCTCAGGAAGGCCTGTACAATGAACTGCAGAAAGATAAGAT
[0911] GGCGGAGGCCTACAGTGAGATTGGGATGAAAGGCGAGCGCCGGAGGGGCAA
[0912] GGGGCACGATGGCCTTTACCAGGGTCTCAGTACAGCCACCAAGGACACCTAC
[0913] GACGCCCTTCACATGCAGGCCCTGCCCCCTCGCTAAGTCGACAATCAACCTC
[0914] TGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCT
[0915] TTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCC
[0916] CGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTAT
[0917] GAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTG
[0918] CTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTCC GGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTG
[0919] CCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTG
[0920] GTGTTGTCGGGGAAGCTGACGTCCTTTCCTTGGCTGCTCGCCTGTGTTGCCAC
[0921] CTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAG
[0922] CGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTT
[0923] CGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGCCTGG
[0924] AATTCGAGCTCGGTACCTTTAAGACCAATGACTTACAAGGCAGCTGTAGATC
[0925] TTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGAAGGGCTAATTCACTCCCA
[0926] ACGAAGACAAGATCTGCTTTTTGCTTGTACTGGGTCTCTCTGGTTAGACCAGA
[0927] TCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCA
[0928] ATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACT
[0929] CTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAG
[0930] CAGTAGTAGTTCATGTCATCTTATTATTCAGTATTTATAACTTGCAAAGAAAT
[0931] GAATATCAGAGAGTGAGAGGAACTTGTTTATTGCAGCTTATAATGGTTACAA
[0932] ATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATT
[0933] CTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGCTCTAG
[0934] CTATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGA
[0935] CTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATT
[0936] CCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGCTAGGGACGTACCCAAT
[0937] TCGCCCTATAGTGAGTCGTATTACGCGCGCTCACTGGCCGTCGTTTTACAACG
[0938] TCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACAT
[0939] CCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTT
[0940] CCCAACAGTTGCGCAGCCTGAATGGCGAATGGGACGCGCCCTGTAGCGGCGC
[0941] ATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCC
[0942] AGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTC
[0943] GCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATT
[0944] TAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCA
[0945] CGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTC
[0946] CACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTA
[0947] TCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGT
[0948] TAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATT GGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGA
[0949] TAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACAC
[0950] AGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGA
[0951] GCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCC
[0952] GGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGG
[0953] AAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGC
[0954] GTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAG
[0955] CAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTT
[0956] CTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGT
[0957] GAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGA
[0958] GCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTT
[0959] GGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGG
[0960] CAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAG
[0961] GCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATA
[0962] ACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCGCGCAATT
[0963] AACCCTCACTAAAGGGAACAAAAGCTGGAGCTGCAAGCTTAATGTAGTCTTA
[0964] TGCAATACTCTTGTAGTCTTGCAACATGGTAACGATGAGTTAGCAACATGCC
[0965] TTACAAGGAGAGAAAAAGCACCGTGCATGCCGATTGGTGGAAGTAAGGTGG
[0966] TACGATCGTGCCTTATTAGGAAGGCAACAGACGGGTCTGACATGGATTGGAC
[0967] GAACCACTGAATTGCCGCATTGCAGAGATATTGTATTTAAGTGCCTAGCTCG
[0968] ATACATAAACGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCT
[0969] GGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGC
[0970] TTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTC
[0971] AGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTGGCGCCCGAACAGGGA
[0972] CTTGAAAGCGAAAGGGAAACCAGAGGAGCTCTCTCGACGCAGGACTCGGCT
[0973] TGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCC
[0974] AAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAGATGGGTGCGAGAGCGT
[0975] CAGTATTAAGCGGGGGAGAATTAGATCGCGATGGGAAAAAATTCGGTTAAG
[0976] GCCAGGGGGAAAGAAAAAATATAAATTAAAACATATAGTATGGGCAAGCAG
[0977] GGAGCTAGAACGATTCGCAGTTAATCCTGGCCTGTTAGAAACATCAGAAGGC
[0978] TGTAGACAAATACTGGGACAGCTACAACCATCCCTTCAGACAGGATCAGAAG AACTTAGATCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAG
[0979] GATAGAGATAAAAGACACCAAGGAAGCTTTAGACAAGATAGAGGAAGAGCA
[0980] AAACAAAAGTAAGACCACCGCACAGCAAGCGGCCGCTGATCTTCAGACCTG
[0981] GAGGAGGAGATATGAGGGACAATTGGAGAAGTGAATTATATAAATATAAAG
[0982] TAGTAAAAATTGAACCATTAGGAGTAGCACCCACCAAGGCAAAGAGAAGAG
[0983] TGGTGCAGAGAGAAAAAAGAGCAGTGGGAATAGGAGCTTTGTTCCTTGGGTT
[0984] CTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCGTCAATGACGCTGACGGT
[0985] ACAGGCCAGACAATTATTGTCTGGTATAGTGCAGCAGCAGAACAATTTGCTG
[0986] AGGGCTATTGAGGCGCAACAGCATCTGTTGCAACTCACAGTCTGGGGCATCA
[0987] AGCAGCTCCAGGCAAGAATCCTGGCTGTGGAAAGATACCTAAAGGATCAAC
[0988] AGCTCCTGGGGATTTGGGGTTGCTCTGGAAAACTCATTTGCACCACTGCTGTG
[0989] CCTTGGAATGCTAGTTGGAGTAATAAATCTCTGGAACAGATTTGGAATCACA
[0990] CGACCTGGATGGAGTGGGACAGAGAAATTAACAATTACACAAGCTTAATAC
[0991] ACTCCTTAATTGAAGAATCGCAAAACCAGCAAGAAAAGAATGAACAAGAAT
[0992] TATTGGAATTAGATAAATGGGCAAGTTTGTGGAATTGGTTTAACATAACAAA
[0993] TTGGCTGTGGTATATAAAATTATTCATAATGATAGTAGGAGGCTTGGTAGGT
[0994] TTAAGAATAGTTTTTGCTGTACTTTCTATAGTGAATAGAGTTAGGCAGGGATA
[0995] TTCACCATTATCGTTTCAGACCCACCTCCCAACCCCGAGGGGACCCGACAGG
[0996] CCCGAAGGAATAGAAGAAGAAGGTGGAGAGAGAGACAGAGACAGATCCATT
[0997] CGATTAGTGAACGGATCTCGACGGTATCGATTAGACTGTAGCCCAGGAATAT
[0998] GGCAGCTAGATTGTACACATTTAGAAGGAAAAGTTATCTTGGTAGCAGTTCA
[0999] TGTAGCCAGTGGATATATAGAAGCAGAAGTAATTCCAGCAGAGACAGGGCA
[1000] AGAAACAGCATACTTCCTCTTAAAATTAGCAGGAAGATGGCCAGTAAAAACA
[1001] GTACATACAGACAATGGCAGCAATTTCACCAGTACTACAGTTAAGGCCGCCT
[1002] GTTGGTGGGCGGGGATCAAGCAGGAATTTGGCATTCCCTACAATCCCCAAAG
[1003] TCAAGGAGTAATAGAATCTATGAATAAAGAATTAAAGAAAATTATAGGACA
[1004] GGTAAGAGATCAGGCTGAACATCTTAAGACAGCAGTACAAATGGCAGTATTC
[1005] ATCCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAA
[1006] AGAATAGTAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAA
[1007] CAAATTACAAAAATTCAAAATTTTCGGGTTTATTACAGGGACAGCAGAGATC
[1008] CAGTTTGGCTGCATACGCGTCGTGAGGCTCCGGTGCCCGTCAGTGGGCAGAG CGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGA
[1009] ACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTG
[1010] TACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAG
[1011] TAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGT
[1012] AAGTGCCGTGTGTGGTTCCCGCGGGCCTGGCCTCTTTACGGGTTATGGCCCTT
[1013] GCGTGCCTTGAATTACTTCCACCTGGCTGCAGTACGTGATTCTTGATCCCGAG
[1014] CTTCGGGTTGGAAGTGGGTGGGAGAGTTCGAGGCCTTGCGCTTAAGGAGCCC
[1015] CTTCGCCTCGTGCTTGAGTTGAGGCCTGGCCTGGGCGCTGGGGCCGCCGCGT
[1016] GCGAATCTGGTGGCACCTTCGCGCCTGTCTCGCTGCTTTCGATAAGTCTCTAG
[1017] CCATTTAAAATTTTTGATGACCTGCTGCGACGCTTTTTTTCTGGCAAGATAGT
[1018] CTTGTAAATGCGGGCCAAGATCTGCACACTGGTATTTCGGTTTTTGGGGCCGC
[1019] GGGCGGCGACGGGGCCCGTGCGTCCCAGCGCACATGTTCGGCGAGGCGGGG
[1020] CCTGCGAGCGCGGCCACCGAGAATCGGACGGGGGTAGTCTCAAGCTGGCCG
[1021] GCCTGCTCTGGTGCCTGGCCTCGCGCCGCCGTGTATCGCCCCGCCCTGGGCG
[1022] GCAAGGCTGGCCCGGTCGGCACCAGTTGCGTGAGCGGAAAGATGGCCGCTTC
[1023] CCGGCCCTGCTGCAGGGAGCTCAAAATGGAGGACGCGGCGCTCGGGAGAGC
[1024] GGGCGGGTGAGTCACCCACACAAAGGAAAAGGGCCTTTCCGTCCTCAGCCGT
[1025] CGCTTCATGTGACTCCACTGAGTACCGGGCGCCGTCCAGGCACCTCGATTAG
[1026] TTCTCGTGCTTTTGGAGTACGTCGTCTTTAGGTTGGGGGGAGGGGTTTTATGC
[1027] GATGGAGTTTCCCCACACTGAGTGGGTGGAGACTGAAGTTAGGCCAGCTTGG
[1028] CACTTGATGTAATTCTCCTTGGAATTTGCCCTTTTTGAGTTTGGATCTTGGTTC
[1029] ATTCTCAAGCCTCAGACAGTGGTTCAAAGTTTTTTTCTTCCATTTCAGGTGTC
[1030] GTGAGCTAGCTCTAGAATGGCCTTACCAGTGACCGCCTTGCTCCTGCCGCTG
[1031] GCCTTGCTGCTCCACGCCGCCAGGCCGGGATCCCAGGTGCAGCTGCAGGAG
[1032] TCTGGGGGAGGCTTGGTGCAGCCTGGGGGTTCTCTGAGACTCTCCTGTG
[1033] CAGCCTCTGGATTCACTTTGGATGATTATACCATAGGCTGGTTCCGCCAG
[1034] GCCCCAGGAAAGGAGCGCGAGGGGGTCTCATGGTTTAATAGTGGCGATG
[1035] GTAGTACATACTATGCAGACTCCGTGAAGGGCCGATTCACCGCCTCCAG
[1036] AGACAACGCCAAGAACACGCTGTATCTTCAAATGAACGGCCTGAAACCT
[1037] GAGGACACGGCCGATTATTACTGTGCAGCAGTTGAGTCTCGGCAACTAC
[1038] GGATTAGGGAAGACGAGGACCTACTGATTCCGATGCTGTATGACTACTG GGGCCAGGGGACCCAGGTCACCGTCTCCTCAGCGGCCGCCACTAGTTCC
[1039] GGAGAGAGCAAGTACGGCCCTCCCTGCCCCCCTTGCCCTGATATCTTTTGGGT
[1040] GCTGGTGGTGGTTGGTGGAGTCCTGGCTTGCTATAGCTTGCTAGTAACAGTG
[1041] GCCTTTATTATTTTCTGGGTGAGGAGTAAGAGGAGCAGGCTCCTGCACAGTG
[1042] ACTACATGAACATGACTCCCCGCCGCCCCGGGCCCACCCGCAAGCATTACCA
[1043] GCCCTATGCCCCACCACGCGACTTCGCAGCCTATCGCTCCGCTAGCAAACGG
[1044] GGCAGAAAGAAACTCCTGTATATATTCAAACAACCATTTATGAGACCAGTAC
[1045] AAACTACTCAAGAGGAAGATGGCTGTAGCTGCCGATTTCCAGAAGAAGAAG
[1046] AAGGAGGATGTGAACTGAGAGTGAAGTTCAGCAGGAGCGCAGACGCCCCCG
[1047] CGTACAAGCAGGGCCAGAACCAGCTCTATAACGAGCTCAATCTAGGACGAA
[1048] GAGAGGAGTACGATGTTTTGGACAAGAGACGTGGCCGGGACCCTGAGATGG
[1049] GGGGAAAGCCGAGAAGGAAGAACCCTCAGGAAGGCCTGTACAATGAACTGC
[1050] AGAAAGATAAGATGGCGGAGGCCTACAGTGAGATTGGGATGAAAGGCGAGC
[1051] GCCGGAGGGGCAAGGGGCACGATGGCCTTTACCAGGGTCTCAGTACAGCCA
[1052] CCAAGGACACCTACGACGCCCTTCACATGCAGGCCCTGCCCCCTCGCTAAGT
[1053] CGACAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTT
[1054] AACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTA
[1055] TCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTG
[1056] GTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGCGTGG
[1057] TGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACC
[1058] TGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGA
[1059] ACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGC
[1060] ACTGACAATTCCGTGGTGTTGTCGGGGAAGCTGACGTCCTTTCCTTGGCTGCT
[1061] CGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTT
[1062] CGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGG
[1063] CCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGC
[1064] CGCCTCCCCGCCTGGAATTCGAGCTCGGTACCTTTAAGACCAATGACTTACA
[1065] AGGCAGCTGTAGATCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGAAG
[1066] GGCTAATTCACTCCCAACGAAGACAAGATCTGCTTTTTGCTTGTACTGGGTCT
[1067] CTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACC
[1068] CACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCC TATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCG
[1069] CCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAA
[1070] AAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAA
[1071] CCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACC
[1072] GAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTT
[1073] GATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGAC
[1074] ACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCG
[1075] AACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGA
[1076] TAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTG
[1077] CTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACT
[1078] GGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGT
[1079] CAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCA
[1080] CTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGAT
[1081] TGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTG
[1082] ATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCA
[1083] GACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGT
[1084] AATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTG
[1085] CCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAG
[1086] CGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTC
[1087] AAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGT
[1088] GGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGA
[1089] TAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACAC
[1090] AGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGA
[1091] GCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCC
[1092] GGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGG
[1093] AAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGC
[1094] GTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAG
[1095] CAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTT
[1096] CTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGT
[1097] GAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGA
[1098] GCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTT GGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGG
[1099] CAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAG
[1100] GCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATA
[1101] ACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCGCGCAATT
[1102] AACCCTCACTAAAGGGAACAAAAGCTGGAGCTGCAAGCTTAATGTAGTCTTA
[1103] TGCAATACTCTTGTAGTCTTGCAACATGGTAACGATGAGTTAGCAACATGCC
[1104] TTACAAGGAGAGAAAAAGCACCGTGCATGCCGATTGGTGGAAGTAAGGTGG
[1105] TACGATCGTGCCTTATTAGGAAGGCAACAGACGGGTCTGACATGGATTGGAC
[1106] GAACCACTGAATTGCCGCATTGCAGAGATATTGTATTTAAGTGCCTAGCTCG
[1107] ATACATAAACGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCT
[1108] GGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGC
[1109] TTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTC
[1110] AGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTGGCGCCCGAACAGGGA
[1111] CTTGAAAGCGAAAGGGAAACCAGAGGAGCTCTCTCGACGCAGGACTCGGCT
[1112] TGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCC
[1113] AAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAGATGGGTGCGAGAGCGT
[1114] CAGTATTAAGCGGGGGAGAATTAGATCGCGATGGGAAAAAATTCGGTTAAG
[1115] GCCAGGGGGAAAGAAAAAATATAAATTAAAACATATAGTATGGGCAAGCAG
[1116] GGAGCTAGAACGATTCGCAGTTAATCCTGGCCTGTTAGAAACATCAGAAGGC
[1117] TGTAGACAAATACTGGGACAGCTACAACCATCCCTTCAGACAGGATCAGAAG
[1118] AACTTAGATCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAG
[1119] GATAGAGATAAAAGACACCAAGGAAGCTTTAGACAAGATAGAGGAAGAGCA
[1120] AAACAAAAGTAAGACCACCGCACAGCAAGCGGCCGCTGATCTTCAGACCTG
[1121] GAGGAGGAGATATGAGGGACAATTGGAGAAGTGAATTATATAAATATAAAG
[1122] TAGTAAAAATTGAACCATTAGGAGTAGCACCCACCAAGGCAAAGAGAAGAG
[1123] TGGTGCAGAGAGAAAAAAGAGCAGTGGGAATAGGAGCTTTGTTCCTTGGGTT
[1124] CTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCGTCAATGACGCTGACGGT
[1125] ACAGGCCAGACAATTATTGTCTGGTATAGTGCAGCAGCAGAACAATTTGCTG
[1126] AGGGCTATTGAGGCGCAACAGCATCTGTTGCAACTCACAGTCTGGGGCATCA
[1127] AGCAGCTCCAGGCAAGAATCCTGGCTGTGGAAAGATACCTAAAGGATCAAC
[1128] AGCTCCTGGGGATTTGGGGTTGCTCTGGAAAACTCATTTGCACCACTGCTGTG CCTTGGAATGCTAGTTGGAGTAATAAATCTCTGGAACAGATTTGGAATCACA
[1129] CGACCTGGATGGAGTGGGACAGAGAAATTAACAATTACACAAGCTTAATAC
[1130] ACTCCTTAATTGAAGAATCGCAAAACCAGCAAGAAAAGAATGAACAAGAAT
[1131] TATTGGAATTAGATAAATGGGCAAGTTTGTGGAATTGGTTTAACATAACAAA
[1132] TTGGCTGTGGTATATAAAATTATTCATAATGATAGTAGGAGGCTTGGTAGGT
[1133] TTAAGAATAGTTTTTGCTGTACTTTCTATAGTGAATAGAGTTAGGCAGGGATA
[1134] TTCACCATTATCGTTTCAGACCCACCTCCCAACCCCGAGGGGACCCGACAGG
[1135] CCCGAAGGAATAGAAGAAGAAGGTGGAGAGAGAGACAGAGACAGATCCATT
[1136] CGATTAGTGAACGGATCTCGACGGTATCGATTAGACTGTAGCCCAGGAATAT
[1137] GGCAGCTAGATTGTACACATTTAGAAGGAAAAGTTATCTTGGTAGCAGTTCA
[1138] TGTAGCCAGTGGATATATAGAAGCAGAAGTAATTCCAGCAGAGACAGGGCA
[1139] AGAAACAGCATACTTCCTCTTAAAATTAGCAGGAAGATGGCCAGTAAAAACA
[1140] GTACATACAGACAATGGCAGCAATTTCACCAGTACTACAGTTAAGGCCGCCT
[1141] GTTGGTGGGCGGGGATCAAGCAGGAATTTGGCATTCCCTACAATCCCCAAAG
[1142] TCAAGGAGTAATAGAATCTATGAATAAAGAATTAAAGAAAATTATAGGACA
[1143] GGTAAGAGATCAGGCTGAACATCTTAAGACAGCAGTACAAATGGCAGTATTC
[1144] ATCCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAA
[1145] AGAATAGTAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAA
[1146] CAAATTACAAAAATTCAAAATTTTCGGGTTTATTACAGGGACAGCAGAGATC
[1147] CAGTTTGGCTGCATACGCGTCGTGAGGCTCCGGTGCCCGTCAGTGGGCAGAG
[1148] CGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGA
[1149] ACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTG
[1150] TACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAG
[1151] TAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGT
[1152] AAGTGCCGTGTGTGGTTCCCGCGGGCCTGGCCTCTTTACGGGTTATGGCCCTT
[1153] GCGTGCCTTGAATTACTTCCACCTGGCTGCAGTACGTGATTCTTGATCCCGAG
[1154] CTTCGGGTTGGAAGTGGGTGGGAGAGTTCGAGGCCTTGCGCTTAAGGAGCCC
[1155] CTTCGCCTCGTGCTTGAGTTGAGGCCTGGCCTGGGCGCTGGGGCCGCCGCGT
[1156] GCGAATCTGGTGGCACCTTCGCGCCTGTCTCGCTGCTTTCGATAAGTCTCTAG
[1157] CCATTTAAAATTTTTGATGACCTGCTGCGACGCTTTTTTTCTGGCAAGATAGT
[1158] CTTGTAAATGCGGGCCAAGATCTGCACACTGGTATTTCGGTTTTTGGGGCCGC GGGCGGCGACGGGGCCCGTGCGTCCCAGCGCACATGTTCGGCGAGGCGGGG
[1159] CCTGCGAGCGCGGCCACCGAGAATCGGACGGGGGTAGTCTCAAGCTGGCCG
[1160] GCCTGCTCTGGTGCCTGGCCTCGCGCCGCCGTGTATCGCCCCGCCCTGGGCG
[1161] GCAAGGCTGGCCCGGTCGGCACCAGTTGCGTGAGCGGAAAGATGGCCGCTTC
[1162] CCGGCCCTGCTGCAGGGAGCTCAAAATGGAGGACGCGGCGCTCGGGAGAGC
[1163] GGGCGGGTGAGTCACCCACACAAAGGAAAAGGGCCTTTCCGTCCTCAGCCGT
[1164] CGCTTCATGTGACTCCACTGAGTACCGGGCGCCGTCCAGGCACCTCGATTAG
[1165] TTCTCGTGCTTTTGGAGTACGTCGTCTTTAGGTTGGGGGGAGGGGTTTTATGC
[1166] GATGGAGTTTCCCCACACTGAGTGGGTGGAGACTGAAGTTAGGCCAGCTTGG
[1167] CACTTGATGTAATTCTCCTTGGAATTTGCCCTTTTTGAGTTTGGATCTTGGTTC
[1168] ATTCTCAAGCCTCAGACAGTGGTTCAAAGTTTTTTTCTTCCATTTCAGGTGTC
[1169] GTGAGCTAGCTCTAGAATGGCCTTACCAGTGACCGCCTTGCTCCTGCCGCTG
[1170] GCCTTGCTGCTCCACGCCGCCAGGCCGGGATCCCAGGTGCAGCTGCAGGAG
[1171] TCTGGGGGAGGATTGGTGCAGTCTGGGGGCTCTCTGAGACTCTCCTGTG
[1172] CAGCCTCTGGAGGCACCATTAGTAGATATGGCATGGGCTGGTTCCGCCA
[1173] GGCTCCAGGAAAGGAGCGTGTCTTTGTAGCAGATATTGCATGGAGTACT
[1174] CAGAACACAAACTATGCCGACTCCGTGAAGGGCCGATTCGCTATCTCCA
[1175] GAGACAACGCCAAGAACATGGTGTATCTGCAAATGAACAGTCTGAAACC
[1176] TGAGGACACGGCCGTTTATTACTGTGCAGCAGATACACAATATGATAGT
[1177] GTGGCGTATGACCTTTGGGGCCAGGGGACCCAGGTCACCGTCTCCTCAG
[1178] CGGCCGCCACTAGTICCGGAGAGAGCAAGTACGGCCCTCCCTGCCCCCCTT
[1179] GCCCTGATATCTTTTGGGTGCTGGTGGTGGTTGGTGGAGTCCTGGCTTGCTAT
[1180] AGCTTGCTAGTAACAGTGGCCTTTATTATTTTCTGGGTGAGGAGTAAGAGGA
[1181] GCAGGCTCCTGCACAGTGACTACATGAACATGACTCCCCGCCGCCCCGGGCC
[1182] CACCCGCAAGCATTACCAGCCCTATGCCCCACCACGCGACTTCGCAGCCTAT
[1183] CGCTCCGCTAGCAAACGGGGCAGAAAGAAACTCCTGTATATATTCAAACAAC
[1184] CATTTATGAGACCAGTACAAACTACTCAAGAGGAAGATGGCTGTAGCTGCCG
[1185] ATTTCCAGAAGAAGAAGAAGGAGGATGTGAACTGAGAGTGAAGTTCAGCAG
[1186] GAGCGCAGACGCCCCCGCGTACAAGCAGGGCCAGAACCAGCTCTATAACGA
[1187] GCTCAATCTAGGACGAAGAGAGGAGTACGATGTTTTGGACAAGAGACGTGG
[1188] CCGGGACCCTGAGATGGGGGGAAAGCCGAGAAGGAAGAACCCTCAGGAAGG CCTGTACAATGAACTGCAGAAAGATAAGATGGCGGAGGCCTACAGTGAGAT
[1189] TGGGATGAAAGGCGAGCGCCGGAGGGGCAAGGGGCACGATGGCCTTTACCA
[1190] GGGTCTCAGTACAGCCACCAAGGACACCTACGACGCCCTTCACATGCAGGCC
[1191] CTGCCCCCTCGCTAAGTCGACAATCAACCTCTGGATTACAAAATTTGTGAAA
[1192] GATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCT
[1193] GCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCC
[1194] TCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGT
[1195] CAGGCAACGTGGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGT
[1196] TGGGGCATTGCCACCACCTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCT
[1197] CCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACA
[1198] GGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAGCTGA
[1199] CGTCCTTTCCTTGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACG
[1200] TCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGG
[1201] CCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGA
[1202] GTCGGATCTCCCTTTGGGCCGCCTCCCCGCCTGGAATTCGAGCTCGGTACCTT
[1203] TAAGACCAATGACTTACAAGGCAGCTGTAGATCTTAGCCACTTTTTAAAAGA
[1204] AAAGGGGGGACTGGAAGGGCTAATTCACTCCCAACGAAGACAAGATCTGCT
[1205] TTTTGCTTGTACTGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCT
[1206] CTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGT
[1207] GCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCC
[1208] TCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTAGTAGTTCATGTCAT
[1209] CTTATTATTCAGTATTTATAACTTGCAAAGAAATGAATATCAGAGAGTGAGA
[1210] GGAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCAC
[1211] AAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCA
[1212] AACTCATCAATGTATCTTATCATGTCTGGCTCTAGCTATCCCGCCCCTAACTC
[1213] CGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATG
[1214] CAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGG
[1215] CTTTTTTGGAGGCCTAGCTAGGGACGTACCCAATTCGCCCTATAGTGAGTCGT
[1216] ATTACGCGCGCTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCC
[1217] TGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGC
[1218] GTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCT CTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGAT
[1219] TGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTG
[1220] ATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCA
[1221] GACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGT
[1222] AATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTG
[1223] CCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAG
[1224] CGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTC
[1225] AAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGT
[1226] GGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGA
[1227] TAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACAC
[1228] AGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGA
[1229] GCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCC
[1230] GGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGG
[1231] AAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGC
[1232] GTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAG
[1233] CAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTT
[1234] CTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGT
[1235] GAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGA
[1236] GCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTT
[1237] GGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGG
[1238] CAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAG
[1239] GCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATA
[1240] ACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCGCGCAATT
[1241] AACCCTCACTAAAGGGAACAAAAGCTGGAGCTGCAAGCTTAATGTAGTCTTA
[1242] TGCAATACTCTTGTAGTCTTGCAACATGGTAACGATGAGTTAGCAACATGCC
[1243] TTACAAGGAGAGAAAAAGCACCGTGCATGCCGATTGGTGGAAGTAAGGTGG
[1244] TACGATCGTGCCTTATTAGGAAGGCAACAGACGGGTCTGACATGGATTGGAC
[1245] GAACCACTGAATTGCCGCATTGCAGAGATATTGTATTTAAGTGCCTAGCTCG
[1246] ATACATAAACGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCT
[1247] GGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGC
[1248] TTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTC AGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTGGCGCCCGAACAGGGA
[1249] CTTGAAAGCGAAAGGGAAACCAGAGGAGCTCTCTCGACGCAGGACTCGGCT
[1250] TGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCC
[1251] AAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAGATGGGTGCGAGAGCGT
[1252] CAGTATTAAGCGGGGGAGAATTAGATCGCGATGGGAAAAAATTCGGTTAAG
[1253] GCCAGGGGGAAAGAAAAAATATAAATTAAAACATATAGTATGGGCAAGCAG
[1254] GGAGCTAGAACGATTCGCAGTTAATCCTGGCCTGTTAGAAACATCAGAAGGC
[1255] TGTAGACAAATACTGGGACAGCTACAACCATCCCTTCAGACAGGATCAGAAG
[1256] AACTTAGATCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAG
[1257] GATAGAGATAAAAGACACCAAGGAAGCTTTAGACAAGATAGAGGAAGAGCA
[1258] AAACAAAAGTAAGACCACCGCACAGCAAGCGGCCGCTGATCTTCAGACCTG
[1259] GAGGAGGAGATATGAGGGACAATTGGAGAAGTGAATTATATAAATATAAAG
[1260] TAGTAAAAATTGAACCATTAGGAGTAGCACCCACCAAGGCAAAGAGAAGAG
[1261] TGGTGCAGAGAGAAAAAAGAGCAGTGGGAATAGGAGCTTTGTTCCTTGGGTT
[1262] CTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCGTCAATGACGCTGACGGT
[1263] ACAGGCCAGACAATTATTGTCTGGTATAGTGCAGCAGCAGAACAATTTGCTG
[1264] AGGGCTATTGAGGCGCAACAGCATCTGTTGCAACTCACAGTCTGGGGCATCA
[1265] AGCAGCTCCAGGCAAGAATCCTGGCTGTGGAAAGATACCTAAAGGATCAAC
[1266] AGCTCCTGGGGATTTGGGGTTGCTCTGGAAAACTCATTTGCACCACTGCTGTG
[1267] CCTTGGAATGCTAGTTGGAGTAATAAATCTCTGGAACAGATTTGGAATCACA
[1268] CGACCTGGATGGAGTGGGACAGAGAAATTAACAATTACACAAGCTTAATAC
[1269] ACTCCTTAATTGAAGAATCGCAAAACCAGCAAGAAAAGAATGAACAAGAAT
[1270] TATTGGAATTAGATAAATGGGCAAGTTTGTGGAATTGGTTTAACATAACAAA
[1271] TTGGCTGTGGTATATAAAATTATTCATAATGATAGTAGGAGGCTTGGTAGGT
[1272] TTAAGAATAGTTTTTGCTGTACTTTCTATAGTGAATAGAGTTAGGCAGGGATA
[1273] TTCACCATTATCGTTTCAGACCCACCTCCCAACCCCGAGGGGACCCGACAGG
[1274] CCCGAAGGAATAGAAGAAGAAGGTGGAGAGAGAGACAGAGACAGATCCATT
[1275] CGATTAGTGAACGGATCTCGACGGTATCGATTAGACTGTAGCCCAGGAATAT
[1276] GGCAGCTAGATTGTACACATTTAGAAGGAAAAGTTATCTTGGTAGCAGTTCA
[1277] TGTAGCCAGTGGATATATAGAAGCAGAAGTAATTCCAGCAGAGACAGGGCA
[1278] AGAAACAGCATACTTCCTCTTAAAATTAGCAGGAAGATGGCCAGTAAAAACA GTACATACAGACAATGGCAGCAATTTCACCAGTACTACAGTTAAGGCCGCCT
[1279] GTTGGTGGGCGGGGATCAAGCAGGAATTTGGCATTCCCTACAATCCCCAAAG
[1280] TCAAGGAGTAATAGAATCTATGAATAAAGAATTAAAGAAAATTATAGGACA
[1281] GGTAAGAGATCAGGCTGAACATCTTAAGACAGCAGTACAAATGGCAGTATTC
[1282] ATCCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAA
[1283] AGAATAGTAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAA
[1284] CAAATTACAAAAATTCAAAATTTTCGGGTTTATTACAGGGACAGCAGAGATC
[1285] CAGTTTGGCTGCATACGCGTCGTGAGGCTCCGGTGCCCGTCAGTGGGCAGAG
[1286] CGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGA
[1287] ACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTG
[1288] TACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAG
[1289] TAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGT
[1290] AAGTGCCGTGTGTGGTTCCCGCGGGCCTGGCCTCTTTACGGGTTATGGCCCTT
[1291] GCGTGCCTTGAATTACTTCCACCTGGCTGCAGTACGTGATTCTTGATCCCGAG
[1292] CTTCGGGTTGGAAGTGGGTGGGAGAGTTCGAGGCCTTGCGCTTAAGGAGCCC
[1293] CTTCGCCTCGTGCTTGAGTTGAGGCCTGGCCTGGGCGCTGGGGCCGCCGCGT
[1294] GCGAATCTGGTGGCACCTTCGCGCCTGTCTCGCTGCTTTCGATAAGTCTCTAG
[1295] CCATTTAAAATTTTTGATGACCTGCTGCGACGCTTTTTTTCTGGCAAGATAGT
[1296] CTTGTAAATGCGGGCCAAGATCTGCACACTGGTATTTCGGTTTTTGGGGCCGC
[1297] GGGCGGCGACGGGGCCCGTGCGTCCCAGCGCACATGTTCGGCGAGGCGGGG
[1298] CCTGCGAGCGCGGCCACCGAGAATCGGACGGGGGTAGTCTCAAGCTGGCCG
[1299] GCCTGCTCTGGTGCCTGGCCTCGCGCCGCCGTGTATCGCCCCGCCCTGGGCG
[1300] GCAAGGCTGGCCCGGTCGGCACCAGTTGCGTGAGCGGAAAGATGGCCGCTTC
[1301] CCGGCCCTGCTGCAGGGAGCTCAAAATGGAGGACGCGGCGCTCGGGAGAGC
[1302] GGGCGGGTGAGTCACCCACACAAAGGAAAAGGGCCTTTCCGTCCTCAGCCGT
[1303] CGCTTCATGTGACTCCACTGAGTACCGGGCGCCGTCCAGGCACCTCGATTAG
[1304] TTCTCGTGCTTTTGGAGTACGTCGTCTTTAGGTTGGGGGGAGGGGTTTTATGC
[1305] GATGGAGTTTCCCCACACTGAGTGGGTGGAGACTGAAGTTAGGCCAGCTTGG
[1306] CACTTGATGTAATTCTCCTTGGAATTTGCCCTTTTTGAGTTTGGATCTTGGTTC
[1307] ATTCTCAAGCCTCAGACAGTGGTTCAAAGTTTTTTTCTTCCATTTCAGGTGTC
[1308] GTGAGCTAGCTCTAGAATGGCCTTACCAGTGACCGCCTTGCTCCTGCCGCTG
[1309] I l l GCCTTGCTGCTCCACGCCGCCAGGCCGGGATCCCAGGTGCAGCTGCAGGAG
[1310] TCTGGAGGAGGATTGGTGCAGCCTGGGGGCTCTCTGAGACTCTCCTGTG
[1311] CAGCCTCTGGACGCACCTTCAGTAGCTATCGCATGGGCTGGTTCCGCCA
[1312] GGCTCCAGGGAGGGAGCGTGAGTTTGTAGCCTCGATTAGCGGGAGTGGT
[1313] TTGGACAAATACCTTGCGGAGTCCGTGAGGGGCCGGTTCGCCATCTCCA
[1314] GAGACAACGCCAAGAACATGCTGTATTTACAAATGGATATCCTGAAACC
[1315] TGAGGACACGGCCATTTATTACTGTGCAGCAGATGTCGCCATTGGTTAT
[1316] GCGTACCACGACATGAGGAGGTCTACGTTTGACCAGTGGGGCCAGGGGA
[1317] CCCAGGTCACCGTCTCCTCAGCGGCCGCCACTAGTTCCGGAGAGAGCAAG
[1318] TACGGCCCTCCCTGCCCCCCTTGCCCTGATATCTTTTGGGTGCTGGTGGTGGT
[1319] TGGTGGAGTCCTGGCTTGCTATAGCTTGCTAGTAACAGTGGCCTTTATTATTT
[1320] TCTGGGTGAGGAGTAAGAGGAGCAGGCTCCTGCACAGTGACTACATGAACAT
[1321] GACTCCCCGCCGCCCCGGGCCCACCCGCAAGCATTACCAGCCCTATGCCCCA
[1322] CCACGCGACTTCGCAGCCTATCGCTCCGCTAGCAAACGGGGCAGAAAGAAAC
[1323] TCCTGTATATATTCAAACAACCATTTATGAGACCAGTACAAACTACTCAAGA
[1324] GGAAGATGGCTGTAGCTGCCGATTTCCAGAAGAAGAAGAAGGAGGATGTGA
[1325] ACTGAGAGTGAAGTTCAGCAGGAGCGCAGACGCCCCCGCGTACAAGCAGGG
[1326] CCAGAACCAGCTCTATAACGAGCTCAATCTAGGACGAAGAGAGGAGTACGA
[1327] TGTTTTGGACAAGAGACGTGGCCGGGACCCTGAGATGGGGGGAAAGCCGAG
[1328] AAGGAAGAACCCTCAGGAAGGCCTGTACAATGAACTGCAGAAAGATAAGAT
[1329] GGCGGAGGCCTACAGTGAGATTGGGATGAAAGGCGAGCGCCGGAGGGGCAA
[1330] GGGGCACGATGGCCTTTACCAGGGTCTCAGTACAGCCACCAAGGACACCTAC
[1331] GACGCCCTTCACATGCAGGCCCTGCCCCCTCGCTAAGTCGACAATCAACCTC
[1332] TGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCT
[1333] TTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCC
[1334] CGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTAT
[1335] GAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTG
[1336] CTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTCC
[1337] GGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTG
[1338] CCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTG
[1339] GTGTTGTCGGGGAAGCTGACGTCCTTTCCTTGGCTGCTCGCCTGTGTTGCCAC CTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAG
[1340] CGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTT
[1341] CGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGCCTGG
[1342] AATTCGAGCTCGGTACCTTTAAGACCAATGACTTACAAGGCAGCTGTAGATC
[1343] TTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGAAGGGCTAATTCACTCCCA
[1344] ACGAAGACAAGATCTGCTTTTTGCTTGTACTGGGTCTCTCTGGTTAGACCAGA
[1345] TCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCA
[1346] ATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACT
[1347] CTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAG
[1348] CAGTAGTAGTTCATGTCATCTTATTATTCAGTATTTATAACTTGCAAAGAAAT
[1349] GAATATCAGAGAGTGAGAGGAACTTGTTTATTGCAGCTTATAATGGTTACAA
[1350] ATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATT
[1351] CTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGCTCTAG
[1352] CTATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGA
[1353] CTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATT
[1354] CCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGCTAGGGACGTACCCAAT
[1355] TCGCCCTATAGTGAGTCGTATTACGCGCGCTCACTGGCCGTCGTTTTACAACG
[1356] TCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACAT
[1357] CCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTT
[1358] CCCAACAGTTGCGCAGCCTGAATGGCGAATGGGACGCGCCCTGTAGCGGCGC
[1359] ATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCC
[1360] AGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTC
[1361] GCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATT
[1362] TAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCA
[1363] CGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTC
[1364] CACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTA
[1365] TCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGT
[1366] TAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATT
[1367] AACGCTTACAATTTAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTA
[1368] TTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAA
[1369] CCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAAC GCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCC
[1370] GGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGG
[1371] AAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGC
[1372] GTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAG
[1373] CAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTT
[1374] CTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGT
[1375] GAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGA
[1376] GCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTT
[1377] GGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGG
[1378] CAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAG
[1379] GCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATA
[1380] ACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCGCGCAATT
[1381] AACCCTCACTAAAGGGAACAAAAGCTGGAGCTGCAAGCTTAATGTAGTCTTA
[1382] TGCAATACTCTTGTAGTCTTGCAACATGGTAACGATGAGTTAGCAACATGCC
[1383] TTACAAGGAGAGAAAAAGCACCGTGCATGCCGATTGGTGGAAGTAAGGTGG
[1384] TACGATCGTGCCTTATTAGGAAGGCAACAGACGGGTCTGACATGGATTGGAC
[1385] GAACCACTGAATTGCCGCATTGCAGAGATATTGTATTTAAGTGCCTAGCTCG
[1386] ATACATAAACGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCT
[1387] GGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGC
[1388] TTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTC
[1389] AGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTGGCGCCCGAACAGGGA
[1390] CTTGAAAGCGAAAGGGAAACCAGAGGAGCTCTCTCGACGCAGGACTCGGCT
[1391] TGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCC
[1392] AAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAGATGGGTGCGAGAGCGT
[1393] CAGTATTAAGCGGGGGAGAATTAGATCGCGATGGGAAAAAATTCGGTTAAG
[1394] GCCAGGGGGAAAGAAAAAATATAAATTAAAACATATAGTATGGGCAAGCAG
[1395] GGAGCTAGAACGATTCGCAGTTAATCCTGGCCTGTTAGAAACATCAGAAGGC
[1396] TGTAGACAAATACTGGGACAGCTACAACCATCCCTTCAGACAGGATCAGAAG
[1397] AACTTAGATCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAG
[1398] GATAGAGATAAAAGACACCAAGGAAGCTTTAGACAAGATAGAGGAAGAGCA
[1399] AAACAAAAGTAAGACCACCGCACAGCAAGCGGCCGCTGATCTTCAGACCTG GAGGAGGAGATATGAGGGACAATTGGAGAAGTGAATTATATAAATATAAAG
[1400] TAGTAAAAATTGAACCATTAGGAGTAGCACCCACCAAGGCAAAGAGAAGAG
[1401] TGGTGCAGAGAGAAAAAAGAGCAGTGGGAATAGGAGCTTTGTTCCTTGGGTT
[1402] CTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCGTCAATGACGCTGACGGT
[1403] ACAGGCCAGACAATTATTGTCTGGTATAGTGCAGCAGCAGAACAATTTGCTG
[1404] AGGGCTATTGAGGCGCAACAGCATCTGTTGCAACTCACAGTCTGGGGCATCA
[1405] AGCAGCTCCAGGCAAGAATCCTGGCTGTGGAAAGATACCTAAAGGATCAAC
[1406] AGCTCCTGGGGATTTGGGGTTGCTCTGGAAAACTCATTTGCACCACTGCTGTG
[1407] CCTTGGAATGCTAGTTGGAGTAATAAATCTCTGGAACAGATTTGGAATCACA
[1408] CGACCTGGATGGAGTGGGACAGAGAAATTAACAATTACACAAGCTTAATAC
[1409] ACTCCTTAATTGAAGAATCGCAAAACCAGCAAGAAAAGAATGAACAAGAAT
[1410] TATTGGAATTAGATAAATGGGCAAGTTTGTGGAATTGGTTTAACATAACAAA
[1411] TTGGCTGTGGTATATAAAATTATTCATAATGATAGTAGGAGGCTTGGTAGGT
[1412] TTAAGAATAGTTTTTGCTGTACTTTCTATAGTGAATAGAGTTAGGCAGGGATA
[1413] TTCACCATTATCGTTTCAGACCCACCTCCCAACCCCGAGGGGACCCGACAGG
[1414] CCCGAAGGAATAGAAGAAGAAGGTGGAGAGAGAGACAGAGACAGATCCATT
[1415] CGATTAGTGAACGGATCTCGACGGTATCGATTAGACTGTAGCCCAGGAATAT
[1416] GGCAGCTAGATTGTACACATTTAGAAGGAAAAGTTATCTTGGTAGCAGTTCA
[1417] TGTAGCCAGTGGATATATAGAAGCAGAAGTAATTCCAGCAGAGACAGGGCA
[1418] AGAAACAGCATACTTCCTCTTAAAATTAGCAGGAAGATGGCCAGTAAAAACA
[1419] GTACATACAGACAATGGCAGCAATTTCACCAGTACTACAGTTAAGGCCGCCT
[1420] GTTGGTGGGCGGGGATCAAGCAGGAATTTGGCATTCCCTACAATCCCCAAAG
[1421] TCAAGGAGTAATAGAATCTATGAATAAAGAATTAAAGAAAATTATAGGACA
[1422] GGTAAGAGATCAGGCTGAACATCTTAAGACAGCAGTACAAATGGCAGTATTC
[1423] ATCCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAA
[1424] AGAATAGTAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAA
[1425] CAAATTACAAAAATTCAAAATTTTCGGGTTTATTACAGGGACAGCAGAGATC
[1426] CAGTTTGGCTGCATACGCGTCGTGAGGCTCCGGTGCCCGTCAGTGGGCAGAG
[1427] CGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGA
[1428] ACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTG
[1429] TACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAG TAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGT
[1430] AAGTGCCGTGTGTGGTTCCCGCGGGCCTGGCCTCTTTACGGGTTATGGCCCTT
[1431] GCGTGCCTTGAATTACTTCCACCTGGCTGCAGTACGTGATTCTTGATCCCGAG
[1432] CTTCGGGTTGGAAGTGGGTGGGAGAGTTCGAGGCCTTGCGCTTAAGGAGCCC
[1433] CTTCGCCTCGTGCTTGAGTTGAGGCCTGGCCTGGGCGCTGGGGCCGCCGCGT
[1434] GCGAATCTGGTGGCACCTTCGCGCCTGTCTCGCTGCTTTCGATAAGTCTCTAG
[1435] CCATTTAAAATTTTTGATGACCTGCTGCGACGCTTTTTTTCTGGCAAGATAGT
[1436] CTTGTAAATGCGGGCCAAGATCTGCACACTGGTATTTCGGTTTTTGGGGCCGC
[1437] GGGCGGCGACGGGGCCCGTGCGTCCCAGCGCACATGTTCGGCGAGGCGGGG
[1438] CCTGCGAGCGCGGCCACCGAGAATCGGACGGGGGTAGTCTCAAGCTGGCCG
[1439] GCCTGCTCTGGTGCCTGGCCTCGCGCCGCCGTGTATCGCCCCGCCCTGGGCG
[1440] GCAAGGCTGGCCCGGTCGGCACCAGTTGCGTGAGCGGAAAGATGGCCGCTTC
[1441] CCGGCCCTGCTGCAGGGAGCTCAAAATGGAGGACGCGGCGCTCGGGAGAGC
[1442] GGGCGGGTGAGTCACCCACACAAAGGAAAAGGGCCTTTCCGTCCTCAGCCGT
[1443] CGCTTCATGTGACTCCACTGAGTACCGGGCGCCGTCCAGGCACCTCGATTAG
[1444] TTCTCGTGCTTTTGGAGTACGTCGTCTTTAGGTTGGGGGGAGGGGTTTTATGC
[1445] GATGGAGTTTCCCCACACTGAGTGGGTGGAGACTGAAGTTAGGCCAGCTTGG
[1446] CACTTGATGTAATTCTCCTTGGAATTTGCCCTTTTTGAGTTTGGATCTTGGTTC
[1447] ATTCTCAAGCCTCAGACAGTGGTTCAAAGTTTTTTTCTTCCATTTCAGGTGTC
[1448] GTGAGCTAGCTCTAGAATGGCCTTACCAGTGACCGCCTTGCTCCTGCCGCTG
[1449] GCCTTGCTGCTCCACGCCGCCAGGCCGGGATCCCAGGTGCAGCTGCAGGAG
[1450] TCTGGGGGAGGATTGGTGCAGGCTGGGGGCTCTTTGAGACTCTCCTGTG
[1451] CAGCCTCTGGAAGCATGTTCGGCACATATGCCGTGGGCTGGTTCCGCCA
[1452] GGCTCCAGGGAAGGAGCGAGAGTTTGTAGCAGCGCTTGCCTGGATTGAT
[1453] GGTAACACAAACTATGCAGACTCCGTGAAGGGTCGATTCACCGTCTCCA
[1454] GAGGCAACGCCAAGAACACGGTGTATCTGCAAATGGACAGCCTGAAACC
[1455] TGAGGACACGGCCGTTTATTACTGTGCAGCAGATCGGATAGGGCGTTAC
[1456] GTACTGGCTACTACTACAGACAAGTATGACTTCTGGGGCCAGGGGACCC
[1457] AGGTCACCGTCTCCTCAGCGGCCGCCACTAGTTCCGGAGAGAGCAAGTAC
[1458] GGCCCTCCCTGCCCCCCTTGCCCTGATATCTTTTGGGTGCTGGTGGTGGTTGG
[1459] TGGAGTCCTGGCTTGCTATAGCTTGCTAGTAACAGTGGCCTTTATTATTTTCT GGGTGAGGAGTAAGAGGAGCAGGCTCCTGCACAGTGACTACATGAACATGA
[1460] CTCCCCGCCGCCCCGGGCCCACCCGCAAGCATTACCAGCCCTATGCCCCACC
[1461] ACGCGACTTCGCAGCCTATCGCTCCGCTAGCAAACGGGGCAGAAAGAAACTC
[1462] CTGTATATATTCAAACAACCATTTATGAGACCAGTACAAACTACTCAAGAGG
[1463] AAGATGGCTGTAGCTGCCGATTTCCAGAAGAAGAAGAAGGAGGATGTGAAC
[1464] TGAGAGTGAAGTTCAGCAGGAGCGCAGACGCCCCCGCGTACAAGCAGGGCC
[1465] AGAACCAGCTCTATAACGAGCTCAATCTAGGACGAAGAGAGGAGTACGATG
[1466] TTTTGGACAAGAGACGTGGCCGGGACCCTGAGATGGGGGGAAAGCCGAGAA
[1467] GGAAGAACCCTCAGGAAGGCCTGTACAATGAACTGCAGAAAGATAAGATGG
[1468] CGGAGGCCTACAGTGAGATTGGGATGAAAGGCGAGCGCCGGAGGGGCAAGG
[1469] GGCACGATGGCCTTTACCAGGGTCTCAGTACAGCCACCAAGGACACCTACGA
[1470] CGCCCTTCACATGCAGGCCCTGCCCCCTCGCTAAGTCGACAATCAACCTCTG
[1471] GATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTT
[1472] TACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCC
[1473] GTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATG
[1474] AGGAGTTGTGGCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTGC
[1475] TGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTCCG
[1476] GGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGC
[1477] CTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGG
[1478] TGTTGTCGGGGAAGCTGACGTCCTTTCCTTGGCTGCTCGCCTGTGTTGCCACC
[1479] TGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGC
[1480] GGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTC
[1481] GCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGCCTGGA
[1482] ATTCGAGCTCGGTACCTTTAAGACCAATGACTTACAAGGCAGCTGTAGATCT
[1483] TAGCCACTTTTTAAAAGAAAAGGGGGGACTGGAAGGGCTAATTCACTCCCAA
[1484] CGAAGACAAGATCTGCTTTTTGCTTGTACTGGGTCTCTCTGGTTAGACCAGAT
[1485] CTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAA
[1486] TAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTC
[1487] TGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGC
[1488] AGTAGTAGTTCATGTCATCTTATTATTCAGTATTTATAACTTGCAAAGAAATG
[1489] AATATCAGAGAGTGAGAGGAACTTGTTTATTGCAGCTTATAATGGTTACAAA CCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACC
[1490] GAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTT
[1491] GATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGAC
[1492] ACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCG
[1493] AACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGA
[1494] TAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTG
[1495] CTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACT
[1496] GGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGT
[1497] CAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCA
[1498] CTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGAT
[1499] TGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTG
[1500] ATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCA
[1501] GACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGT
[1502] AATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTG
[1503] CCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAG
[1504] CGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTC
[1505] AAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGT
[1506] GGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGA
[1507] TAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACAC
[1508] AGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGA
[1509] GCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCC
[1510] GGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGG
[1511] AAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGC
[1512] GTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAG
[1513] CAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTT
[1514] CTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGT
[1515] GAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGA
[1516] GCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTT
[1517] GGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGG
[1518] CAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAG
[1519] GCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATA ACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCGCGCAATT
[1520] AACCCTCACTAAAGGGAACAAAAGCTGGAGCTGCAAGCTTAATGTAGTCTTA
[1521] TGCAATACTCTTGTAGTCTTGCAACATGGTAACGATGAGTTAGCAACATGCC
[1522] TTACAAGGAGAGAAAAAGCACCGTGCATGCCGATTGGTGGAAGTAAGGTGG
[1523] TACGATCGTGCCTTATTAGGAAGGCAACAGACGGGTCTGACATGGATTGGAC
[1524] GAACCACTGAATTGCCGCATTGCAGAGATATTGTATTTAAGTGCCTAGCTCG
[1525] ATACATAAACGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCT
[1526] GGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGC
[1527] TTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTC
[1528] AGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTGGCGCCCGAACAGGGA
[1529] CTTGAAAGCGAAAGGGAAACCAGAGGAGCTCTCTCGACGCAGGACTCGGCT
[1530] TGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCC
[1531] AAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAGATGGGTGCGAGAGCGT
[1532] CAGTATTAAGCGGGGGAGAATTAGATCGCGATGGGAAAAAATTCGGTTAAG
[1533] GCCAGGGGGAAAGAAAAAATATAAATTAAAACATATAGTATGGGCAAGCAG
[1534] GGAGCTAGAACGATTCGCAGTTAATCCTGGCCTGTTAGAAACATCAGAAGGC
[1535] TGTAGACAAATACTGGGACAGCTACAACCATCCCTTCAGACAGGATCAGAAG
[1536] AACTTAGATCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAG
[1537] GATAGAGATAAAAGACACCAAGGAAGCTTTAGACAAGATAGAGGAAGAGCA
[1538] AAACAAAAGTAAGACCACCGCACAGCAAGCGGCCGCTGATCTTCAGACCTG
[1539] GAGGAGGAGATATGAGGGACAATTGGAGAAGTGAATTATATAAATATAAAG
[1540] TAGTAAAAATTGAACCATTAGGAGTAGCACCCACCAAGGCAAAGAGAAGAG
[1541] TGGTGCAGAGAGAAAAAAGAGCAGTGGGAATAGGAGCTTTGTTCCTTGGGTT
[1542] CTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCGTCAATGACGCTGACGGT
[1543] ACAGGCCAGACAATTATTGTCTGGTATAGTGCAGCAGCAGAACAATTTGCTG
[1544] AGGGCTATTGAGGCGCAACAGCATCTGTTGCAACTCACAGTCTGGGGCATCA
[1545] AGCAGCTCCAGGCAAGAATCCTGGCTGTGGAAAGATACCTAAAGGATCAAC
[1546] AGCTCCTGGGGATTTGGGGTTGCTCTGGAAAACTCATTTGCACCACTGCTGTG
[1547] CCTTGGAATGCTAGTTGGAGTAATAAATCTCTGGAACAGATTTGGAATCACA
[1548] CGACCTGGATGGAGTGGGACAGAGAAATTAACAATTACACAAGCTTAATAC
[1549] ACTCCTTAATTGAAGAATCGCAAAACCAGCAAGAAAAGAATGAACAAGAAT TATTGGAATTAGATAAATGGGCAAGTTTGTGGAATTGGTTTAACATAACAAA
[1550] TTGGCTGTGGTATATAAAATTATTCATAATGATAGTAGGAGGCTTGGTAGGT
[1551] TTAAGAATAGTTTTTGCTGTACTTTCTATAGTGAATAGAGTTAGGCAGGGATA
[1552] TTCACCATTATCGTTTCAGACCCACCTCCCAACCCCGAGGGGACCCGACAGG
[1553] CCCGAAGGAATAGAAGAAGAAGGTGGAGAGAGAGACAGAGACAGATCCATT
[1554] CGATTAGTGAACGGATCTCGACGGTATCGATTAGACTGTAGCCCAGGAATAT
[1555] GGCAGCTAGATTGTACACATTTAGAAGGAAAAGTTATCTTGGTAGCAGTTCA
[1556] TGTAGCCAGTGGATATATAGAAGCAGAAGTAATTCCAGCAGAGACAGGGCA
[1557] AGAAACAGCATACTTCCTCTTAAAATTAGCAGGAAGATGGCCAGTAAAAACA
[1558] GTACATACAGACAATGGCAGCAATTTCACCAGTACTACAGTTAAGGCCGCCT
[1559] GTTGGTGGGCGGGGATCAAGCAGGAATTTGGCATTCCCTACAATCCCCAAAG
[1560] TCAAGGAGTAATAGAATCTATGAATAAAGAATTAAAGAAAATTATAGGACA
[1561] GGTAAGAGATCAGGCTGAACATCTTAAGACAGCAGTACAAATGGCAGTATTC
[1562] ATCCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAA
[1563] AGAATAGTAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAA
[1564] CAAATTACAAAAATTCAAAATTTTCGGGTTTATTACAGGGACAGCAGAGATC
[1565] CAGTTTGGCTGCATACGCGTCGTGAGGCTCCGGTGCCCGTCAGTGGGCAGAG
[1566] CGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGA
[1567] ACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTG
[1568] TACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAG
[1569] TAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGT
[1570] AAGTGCCGTGTGTGGTTCCCGCGGGCCTGGCCTCTTTACGGGTTATGGCCCTT
[1571] GCGTGCCTTGAATTACTTCCACCTGGCTGCAGTACGTGATTCTTGATCCCGAG
[1572] CTTCGGGTTGGAAGTGGGTGGGAGAGTTCGAGGCCTTGCGCTTAAGGAGCCC
[1573] CTTCGCCTCGTGCTTGAGTTGAGGCCTGGCCTGGGCGCTGGGGCCGCCGCGT
[1574] GCGAATCTGGTGGCACCTTCGCGCCTGTCTCGCTGCTTTCGATAAGTCTCTAG
[1575] CCATTTAAAATTTTTGATGACCTGCTGCGACGCTTTTTTTCTGGCAAGATAGT
[1576] CTTGTAAATGCGGGCCAAGATCTGCACACTGGTATTTCGGTTTTTGGGGCCGC
[1577] GGGCGGCGACGGGGCCCGTGCGTCCCAGCGCACATGTTCGGCGAGGCGGGG
[1578] CCTGCGAGCGCGGCCACCGAGAATCGGACGGGGGTAGTCTCAAGCTGGCCG
[1579] GCCTGCTCTGGTGCCTGGCCTCGCGCCGCCGTGTATCGCCCCGCCCTGGGCG GCAAGGCTGGCCCGGTCGGCACCAGTTGCGTGAGCGGAAAGATGGCCGCTTC
[1580] CCGGCCCTGCTGCAGGGAGCTCAAAATGGAGGACGCGGCGCTCGGGAGAGC
[1581] GGGCGGGTGAGTCACCCACACAAAGGAAAAGGGCCTTTCCGTCCTCAGCCGT
[1582] CGCTTCATGTGACTCCACTGAGTACCGGGCGCCGTCCAGGCACCTCGATTAG
[1583] TTCTCGTGCTTTTGGAGTACGTCGTCTTTAGGTTGGGGGGAGGGGTTTTATGC
[1584] GATGGAGTTTCCCCACACTGAGTGGGTGGAGACTGAAGTTAGGCCAGCTTGG
[1585] CACTTGATGTAATTCTCCTTGGAATTTGCCCTTTTTGAGTTTGGATCTTGGTTC
[1586] ATTCTCAAGCCTCAGACAGTGGTTCAAAGTTTTTTTCTTCCATTTCAGGTGTC
[1587] GTGAGCTAGCTCTAGAATGGCCTTACCAGTGACCGCCTTGCTCCTGCCGCTG
[1588] GCCTTGCTGCTCCACGCCGCCAGGCCGGGATCCCAGATGCAGCTGCAGGAG
[1589] TCTGGAGGAGGATTGGTGCAGGCTGGGGACTCTCTGAGACTCTCCTGTG
[1590] CAGGCTCTGGAGGCACCTTCAGTAGGTATGTCATGGGCTGGTTCCGCCA
[1591] GGCTCCAGGGAAGGAGCGTGAGTTTGTATCAGCTATTAGCTTGAGTACC
[1592] GGCCGCACATACTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCA
[1593] GAGACCGCGCCGAGAACACAGTGACTCTGCAAATGAACAGCCTGAAACC
[1594] TGAGGACACGGCCGTTTATTACTGCGCAGCAGCGAGAGGGCCAAATCCT
[1595] GACGGGAAAGTGGACCTCTGGGGCCAGGGGACCCAGGTCACCGTCTCCT
[1596] CAGCGGCCGCCACTAGTTCCGGAGAGAGCAAGTACGGCCCTCCCTGCCCCC
[1597] CTTGCCCTGATATCTTTTGGGTGCTGGTGGTGGTTGGTGGAGTCCTGGCTTGC
[1598] TATAGCTTGCTAGTAACAGTGGCCTTTATTATTTTCTGGGTGAGGAGTAAGAG
[1599] GAGCAGGCTCCTGCACAGTGACTACATGAACATGACTCCCCGCCGCCCCGGG
[1600] CCCACCCGCAAGCATTACCAGCCCTATGCCCCACCACGCGACTTCGCAGCCT
[1601] ATCGCTCCGCTAGCAAACGGGGCAGAAAGAAACTCCTGTATATATTCAAACA
[1602] ACCATTTATGAGACCAGTACAAACTACTCAAGAGGAAGATGGCTGTAGCTGC
[1603] CGATTTCCAGAAGAAGAAGAAGGAGGATGTGAACTGAGAGTGAAGTTCAGC
[1604] AGGAGCGCAGACGCCCCCGCGTACAAGCAGGGCCAGAACCAGCTCTATAAC
[1605] GAGCTCAATCTAGGACGAAGAGAGGAGTACGATGTTTTGGACAAGAGACGT
[1606] GGCCGGGACCCTGAGATGGGGGGAAAGCCGAGAAGGAAGAACCCTCAGGAA
[1607] GGCCTGTACAATGAACTGCAGAAAGATAAGATGGCGGAGGCCTACAGTGAG
[1608] ATTGGGATGAAAGGCGAGCGCCGGAGGGGCAAGGGGCACGATGGCCTTTAC
[1609] CAGGGTCTCAGTACAGCCACCAAGGACACCTACGACGCCCTTCACATGCAGG CCCTGCCCCCTCGCTAAGTCGACAATCAACCTCTGGATTACAAAATTTGTGA
[1610] AAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACG
[1611] CTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCT
[1612] CCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTT
[1613] GTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTG
[1614] GTTGGGGCATTGCCACCACCTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCC
[1615] CTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGAC
[1616] AGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAGCTG
[1617] ACGTCCTTTCCTTGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGAC
[1618] GTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCG
[1619] GCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACG
[1620] AGTCGGATCTCCCTTTGGGCCGCCTCCCCGCCTGGAATTCGAGCTCGGTACCT
[1621] TTAAGACCAATGACTTACAAGGCAGCTGTAGATCTTAGCCACTTTTTAAAAG
[1622] AAAAGGGGGGACTGGAAGGGCTAATTCACTCCCAACGAAGACAAGATCTGC
[1623] TTTTTGCTTGTACTGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTC
[1624] TCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAG
[1625] TGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCC
[1626] CTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTAGTAGTTCATGTCA
[1627] TCTTATTATTCAGTATTTATAACTTGCAAAGAAATGAATATCAGAGAGTGAG
[1628] AGGAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCA
[1629] CAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCC
[1630] AAACTCATCAATGTATCTTATCATGTCTGGCTCTAGCTATCCCGCCCCTAACT
[1631] CCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTAT
[1632] GCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAG
[1633] GCTTTTTTGGAGGCCTAGCTAGGGACGTACCCAATTCGCCCTATAGTGAGTC
[1634] GTATTACGCGCGCTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAAC
[1635] CCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTG
[1636] GCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGC
[1637] CTGAATGGCGAATGGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGT
[1638] GTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCG
[1639] CTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTC GACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGT
[1640] AATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTG
[1641] CCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAG
[1642] CGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTC
[1643] AAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGT
[1644] GGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGA
[1645] TAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACAC
[1646] AGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGA
[1647] GCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCC
[1648] GGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGG
[1649] AAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGC
[1650] GTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAG
[1651] CAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTT
[1652] CTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGT
[1653] GAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGA
[1654] GCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTT
[1655] GGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGG
[1656] CAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAG
[1657] GCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATA
[1658] ACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCGCGCAATT
[1659] AACCCTCACTAAAGGGAACAAAAGCTGGAGCTGCAAGCTTAATGTAGTCTTA
[1660] TGCAATACTCTTGTAGTCTTGCAACATGGTAACGATGAGTTAGCAACATGCC
[1661] TTACAAGGAGAGAAAAAGCACCGTGCATGCCGATTGGTGGAAGTAAGGTGG
[1662] TACGATCGTGCCTTATTAGGAAGGCAACAGACGGGTCTGACATGGATTGGAC
[1663] GAACCACTGAATTGCCGCATTGCAGAGATATTGTATTTAAGTGCCTAGCTCG
[1664] ATACATAAACGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCT
[1665] GGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGC
[1666] TTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTC
[1667] AGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTGGCGCCCGAACAGGGA
[1668] CTTGAAAGCGAAAGGGAAACCAGAGGAGCTCTCTCGACGCAGGACTCGGCT
[1669] TGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCC AAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAGATGGGTGCGAGAGCGT
[1670] CAGTATTAAGCGGGGGAGAATTAGATCGCGATGGGAAAAAATTCGGTTAAG
[1671] GCCAGGGGGAAAGAAAAAATATAAATTAAAACATATAGTATGGGCAAGCAG
[1672] GGAGCTAGAACGATTCGCAGTTAATCCTGGCCTGTTAGAAACATCAGAAGGC
[1673] TGTAGACAAATACTGGGACAGCTACAACCATCCCTTCAGACAGGATCAGAAG
[1674] AACTTAGATCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAG
[1675] GATAGAGATAAAAGACACCAAGGAAGCTTTAGACAAGATAGAGGAAGAGCA
[1676] AAACAAAAGTAAGACCACCGCACAGCAAGCGGCCGCTGATCTTCAGACCTG
[1677] GAGGAGGAGATATGAGGGACAATTGGAGAAGTGAATTATATAAATATAAAG
[1678] TAGTAAAAATTGAACCATTAGGAGTAGCACCCACCAAGGCAAAGAGAAGAG
[1679] TGGTGCAGAGAGAAAAAAGAGCAGTGGGAATAGGAGCTTTGTTCCTTGGGTT
[1680] CTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCGTCAATGACGCTGACGGT
[1681] ACAGGCCAGACAATTATTGTCTGGTATAGTGCAGCAGCAGAACAATTTGCTG
[1682] AGGGCTATTGAGGCGCAACAGCATCTGTTGCAACTCACAGTCTGGGGCATCA
[1683] AGCAGCTCCAGGCAAGAATCCTGGCTGTGGAAAGATACCTAAAGGATCAAC
[1684] AGCTCCTGGGGATTTGGGGTTGCTCTGGAAAACTCATTTGCACCACTGCTGTG
[1685] CCTTGGAATGCTAGTTGGAGTAATAAATCTCTGGAACAGATTTGGAATCACA
[1686] CGACCTGGATGGAGTGGGACAGAGAAATTAACAATTACACAAGCTTAATAC
[1687] ACTCCTTAATTGAAGAATCGCAAAACCAGCAAGAAAAGAATGAACAAGAAT
[1688] TATTGGAATTAGATAAATGGGCAAGTTTGTGGAATTGGTTTAACATAACAAA
[1689] TTGGCTGTGGTATATAAAATTATTCATAATGATAGTAGGAGGCTTGGTAGGT
[1690] TTAAGAATAGTTTTTGCTGTACTTTCTATAGTGAATAGAGTTAGGCAGGGATA
[1691] TTCACCATTATCGTTTCAGACCCACCTCCCAACCCCGAGGGGACCCGACAGG
[1692] CCCGAAGGAATAGAAGAAGAAGGTGGAGAGAGAGACAGAGACAGATCCATT
[1693] CGATTAGTGAACGGATCTCGACGGTATCGATTAGACTGTAGCCCAGGAATAT
[1694] GGCAGCTAGATTGTACACATTTAGAAGGAAAAGTTATCTTGGTAGCAGTTCA
[1695] TGTAGCCAGTGGATATATAGAAGCAGAAGTAATTCCAGCAGAGACAGGGCA
[1696] AGAAACAGCATACTTCCTCTTAAAATTAGCAGGAAGATGGCCAGTAAAAACA
[1697] GTACATACAGACAATGGCAGCAATTTCACCAGTACTACAGTTAAGGCCGCCT
[1698] GTTGGTGGGCGGGGATCAAGCAGGAATTTGGCATTCCCTACAATCCCCAAAG
[1699] TCAAGGAGTAATAGAATCTATGAATAAAGAATTAAAGAAAATTATAGGACA GGTAAGAGATCAGGCTGAACATCTTAAGACAGCAGTACAAATGGCAGTATTC
[1700] ATCCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAA
[1701] AGAATAGTAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAA
[1702] CAAATTACAAAAATTCAAAATTTTCGGGTTTATTACAGGGACAGCAGAGATC
[1703] CAGTTTGGCTGCATACGCGTCGTGAGGCTCCGGTGCCCGTCAGTGGGCAGAG
[1704] CGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGA
[1705] ACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTG
[1706] TACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAG
[1707] TAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGT
[1708] AAGTGCCGTGTGTGGTTCCCGCGGGCCTGGCCTCTTTACGGGTTATGGCCCTT
[1709] GCGTGCCTTGAATTACTTCCACCTGGCTGCAGTACGTGATTCTTGATCCCGAG
[1710] CTTCGGGTTGGAAGTGGGTGGGAGAGTTCGAGGCCTTGCGCTTAAGGAGCCC
[1711] CTTCGCCTCGTGCTTGAGTTGAGGCCTGGCCTGGGCGCTGGGGCCGCCGCGT
[1712] GCGAATCTGGTGGCACCTTCGCGCCTGTCTCGCTGCTTTCGATAAGTCTCTAG
[1713] CCATTTAAAATTTTTGATGACCTGCTGCGACGCTTTTTTTCTGGCAAGATAGT
[1714] CTTGTAAATGCGGGCCAAGATCTGCACACTGGTATTTCGGTTTTTGGGGCCGC
[1715] GGGCGGCGACGGGGCCCGTGCGTCCCAGCGCACATGTTCGGCGAGGCGGGG
[1716] CCTGCGAGCGCGGCCACCGAGAATCGGACGGGGGTAGTCTCAAGCTGGCCG
[1717] GCCTGCTCTGGTGCCTGGCCTCGCGCCGCCGTGTATCGCCCCGCCCTGGGCG
[1718] GCAAGGCTGGCCCGGTCGGCACCAGTTGCGTGAGCGGAAAGATGGCCGCTTC
[1719] CCGGCCCTGCTGCAGGGAGCTCAAAATGGAGGACGCGGCGCTCGGGAGAGC
[1720] GGGCGGGTGAGTCACCCACACAAAGGAAAAGGGCCTTTCCGTCCTCAGCCGT
[1721] CGCTTCATGTGACTCCACTGAGTACCGGGCGCCGTCCAGGCACCTCGATTAG
[1722] TTCTCGTGCTTTTGGAGTACGTCGTCTTTAGGTTGGGGGGAGGGGTTTTATGC
[1723] GATGGAGTTTCCCCACACTGAGTGGGTGGAGACTGAAGTTAGGCCAGCTTGG
[1724] CACTTGATGTAATTCTCCTTGGAATTTGCCCTTTTTGAGTTTGGATCTTGGTTC
[1725] ATTCTCAAGCCTCAGACAGTGGTTCAAAGTTTTTTTCTTCCATTTCAGGTGTC
[1726] GTGAGCTAGCTCTAGAATGGCCTTACCAGTGACCGCCTTGCTCCTGCCGCTG
[1727] GCCTTGCTGCTCCACGCCGCCAGGCCGGGATCCCAGGTGCAGCTGCAGGAG
[1728] TCTGGGGGAGGATTGGTGCAGGCTGGGGGCTCTCTGAGACTCTCCTGTG
[1729] TAGCCTCTGGAGACACCTTCGGTAACTTGAACGCGGCCTGGTTCCGCCA GCCTCCGGGGAAGGAGCGTGAGGTTGTTGCACGTATTACGTGGACGTCG
[1730] TGGACGGACTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCCGAG
[1731] ACAACGCCAAGAAGACAGTGTATCTGCAAATGAACAGCCTGAAACCTGA
[1732] AGACACGGCCGTTTACACCTGTGCACTGGGGTCGATAAATGACTCATAT
[1733] AGGACTTGGGGCCAGGGGACCCAGGTCACCGTCTCCTCAGCGGCCGCCA
[1734] CTAGTTCCGGAGAGAGCAAGTACGGCCCTCCCTGCCCCCCTTGCCCTGATAT
[1735] CTTTTGGGTGCTGGTGGTGGTTGGTGGAGTCCTGGCTTGCTATAGCTTGCTAG
[1736] TAACAGTGGCCTTTATTATTTTCTGGGTGAGGAGTAAGAGGAGCAGGCTCCT
[1737] GCACAGTGACTACATGAACATGACTCCCCGCCGCCCCGGGCCCACCCGCAAG
[1738] CATTACCAGCCCTATGCCCCACCACGCGACTTCGCAGCCTATCGCTCCGCTAG
[1739] CAAACGGGGCAGAAAGAAACTCCTGTATATATTCAAACAACCATTTATGAGA
[1740] CCAGTACAAACTACTCAAGAGGAAGATGGCTGTAGCTGCCGATTTCCAGAAG
[1741] AAGAAGAAGGAGGATGTGAACTGAGAGTGAAGTTCAGCAGGAGCGCAGACG
[1742] CCCCCGCGTACAAGCAGGGCCAGAACCAGCTCTATAACGAGCTCAATCTAGG
[1743] ACGAAGAGAGGAGTACGATGTTTTGGACAAGAGACGTGGCCGGGACCCTGA
[1744] GATGGGGGGAAAGCCGAGAAGGAAGAACCCTCAGGAAGGCCTGTACAATGA
[1745] ACTGCAGAAAGATAAGATGGCGGAGGCCTACAGTGAGATTGGGATGAAAGG
[1746] CGAGCGCCGGAGGGGCAAGGGGCACGATGGCCTTTACCAGGGTCTCAGTAC
[1747] AGCCACCAAGGACACCTACGACGCCCTTCACATGCAGGCCCTGCCCCCTCGC
[1748] TAAGTCGACAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTA
[1749] TTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTT
[1750] TGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAAT
[1751] CCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGC
[1752] GTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCA
[1753] CCACCTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACG
[1754] GCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGT
[1755] TGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAGCTGACGTCCTTTCCTTGG
[1756] CTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGT
[1757] CCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTC
[1758] TGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCTT
[1759] TGGGCCGCCTCCCCGCCTGGAATTCGAGCTCGGTACCTTTAAGACCAATGAC TTACAAGGCAGCTGTAGATCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTG
[1760] GAAGGGCTAATTCACTCCCAACGAAGACAAGATCTGCTTTTTGCTTGTACTG
[1761] GGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGG
[1762] GAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTG
[1763] TGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTA
[1764] GTCAGTGTGGAAAATCTCTAGCAGTAGTAGTTCATGTCATCTTATTATTCAGT
[1765] ATTTATAACTTGCAAAGAAATGAATATCAGAGAGTGAGAGGAACTTGTTTAT
[1766] TGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAAT
[1767] AAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGT
[1768] ATCTTATCATGTCTGGCTCTAGCTATCCCGCCCCTAACTCCGCCCAGTTCCGC
[1769] CCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGG
[1770] CCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGG
[1771] CCTAGCTAGGGACGTACCCAATTCGCCCTATAGTGAGTCGTATTACGCGCGC
[1772] TCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCC
[1773] AACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGA
[1774] AGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAA
[1775] TGGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGC
[1776] GCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTC
[1777] TTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCG
[1778] GGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAA
[1779] AACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGT
[1780] TTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCC
[1781] AAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGG
[1782] ATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATT
[1783] TAACGCGAATTTTAACAAAATATTAACGCTTACAATTTAGGTGGCACTTTTCG
[1784] GGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATA
[1785] TGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAA
[1786] AAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTG
[1787] CGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAA
[1788] GATGCTGAAGATCAGTTGG (SEQ ID NO:78)
[1789] Italic. Restriction enzyme cutting sites used for inserting VHH; CAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTT
[1790] CTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGT
[1791] GAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGA
[1792] GCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTT
[1793] GGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGG
[1794] CAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAG
[1795] GCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATA
[1796] ACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCGCGCAATT
[1797] AACCCTCACTAAAGGGAACAAAAGCTGGAGCTGCAAGCTTAATGTAGTCTTA
[1798] TGCAATACTCTTGTAGTCTTGCAACATGGTAACGATGAGTTAGCAACATGCC
[1799] TTACAAGGAGAGAAAAAGCACCGTGCATGCCGATTGGTGGAAGTAAGGTGG
[1800] TACGATCGTGCCTTATTAGGAAGGCAACAGACGGGTCTGACATGGATTGGAC
[1801] GAACCACTGAATTGCCGCATTGCAGAGATATTGTATTTAAGTGCCTAGCTCG
[1802] ATACATAAACGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCT
[1803] GGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGC
[1804] TTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTC
[1805] AGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTGGCGCCCGAACAGGGA
[1806] CTTGAAAGCGAAAGGGAAACCAGAGGAGCTCTCTCGACGCAGGACTCGGCT
[1807] TGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCC
[1808] AAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAGATGGGTGCGAGAGCGT
[1809] CAGTATTAAGCGGGGGAGAATTAGATCGCGATGGGAAAAAATTCGGTTAAG
[1810] GCCAGGGGGAAAGAAAAAATATAAATTAAAACATATAGTATGGGCAAGCAG
[1811] GGAGCTAGAACGATTCGCAGTTAATCCTGGCCTGTTAGAAACATCAGAAGGC
[1812] TGTAGACAAATACTGGGACAGCTACAACCATCCCTTCAGACAGGATCAGAAG
[1813] AACTTAGATCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAG
[1814] GATAGAGATAAAAGACACCAAGGAAGCTTTAGACAAGATAGAGGAAGAGCA
[1815] AAACAAAAGTAAGACCACCGCACAGCAAGCGGCCGCTGATCTTCAGACCTG
[1816] GAGGAGGAGATATGAGGGACAATTGGAGAAGTGAATTATATAAATATAAAG
[1817] TAGTAAAAATTGAACCATTAGGAGTAGCACCCACCAAGGCAAAGAGAAGAG
[1818] TGGTGCAGAGAGAAAAAAGAGCAGTGGGAATAGGAGCTTTGTTCCTTGGGTT
[1819] CTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCGTCAATGACGCTGACGGT ACAGGCCAGACAATTATTGTCTGGTATAGTGCAGCAGCAGAACAATTTGCTG
[1820] AGGGCTATTGAGGCGCAACAGCATCTGTTGCAACTCACAGTCTGGGGCATCA
[1821] AGCAGCTCCAGGCAAGAATCCTGGCTGTGGAAAGATACCTAAAGGATCAAC
[1822] AGCTCCTGGGGATTTGGGGTTGCTCTGGAAAACTCATTTGCACCACTGCTGTG
[1823] CCTTGGAATGCTAGTTGGAGTAATAAATCTCTGGAACAGATTTGGAATCACA
[1824] CGACCTGGATGGAGTGGGACAGAGAAATTAACAATTACACAAGCTTAATAC
[1825] ACTCCTTAATTGAAGAATCGCAAAACCAGCAAGAAAAGAATGAACAAGAAT
[1826] TATTGGAATTAGATAAATGGGCAAGTTTGTGGAATTGGTTTAACATAACAAA
[1827] TTGGCTGTGGTATATAAAATTATTCATAATGATAGTAGGAGGCTTGGTAGGT
[1828] TTAAGAATAGTTTTTGCTGTACTTTCTATAGTGAATAGAGTTAGGCAGGGATA
[1829] TTCACCATTATCGTTTCAGACCCACCTCCCAACCCCGAGGGGACCCGACAGG
[1830] CCCGAAGGAATAGAAGAAGAAGGTGGAGAGAGAGACAGAGACAGATCCATT
[1831] CGATTAGTGAACGGATCTCGACGGTATCGATTAGACTGTAGCCCAGGAATAT
[1832] GGCAGCTAGATTGTACACATTTAGAAGGAAAAGTTATCTTGGTAGCAGTTCA
[1833] TGTAGCCAGTGGATATATAGAAGCAGAAGTAATTCCAGCAGAGACAGGGCA
[1834] AGAAACAGCATACTTCCTCTTAAAATTAGCAGGAAGATGGCCAGTAAAAACA
[1835] GTACATACAGACAATGGCAGCAATTTCACCAGTACTACAGTTAAGGCCGCCT
[1836] GTTGGTGGGCGGGGATCAAGCAGGAATTTGGCATTCCCTACAATCCCCAAAG
[1837] TCAAGGAGTAATAGAATCTATGAATAAAGAATTAAAGAAAATTATAGGACA
[1838] GGTAAGAGATCAGGCTGAACATCTTAAGACAGCAGTACAAATGGCAGTATTC
[1839] ATCCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAA
[1840] AGAATAGTAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAA
[1841] CAAATTACAAAAATTCAAAATTTTCGGGTTTATTACAGGGACAGCAGAGATC
[1842] CAGTTTGGCTGCATACGCGTCGTGAGGCTCCGGTGCCCGTCAGTGGGCAGAG
[1843] CGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGA
[1844] ACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTG
[1845] TACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAG
[1846] TAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGT
[1847] AAGTGCCGTGTGTGGTTCCCGCGGGCCTGGCCTCTTTACGGGTTATGGCCCTT
[1848] GCGTGCCTTGAATTACTTCCACCTGGCTGCAGTACGTGATTCTTGATCCCGAG
[1849] CTTCGGGTTGGAAGTGGGTGGGAGAGTTCGAGGCCTTGCGCTTAAGGAGCCC CTTCGCCTCGTGCTTGAGTTGAGGCCTGGCCTGGGCGCTGGGGCCGCCGCGT
[1850] GCGAATCTGGTGGCACCTTCGCGCCTGTCTCGCTGCTTTCGATAAGTCTCTAG
[1851] CCATTTAAAATTTTTGATGACCTGCTGCGACGCTTTTTTTCTGGCAAGATAGT
[1852] CTTGTAAATGCGGGCCAAGATCTGCACACTGGTATTTCGGTTTTTGGGGCCGC
[1853] GGGCGGCGACGGGGCCCGTGCGTCCCAGCGCACATGTTCGGCGAGGCGGGG
[1854] CCTGCGAGCGCGGCCACCGAGAATCGGACGGGGGTAGTCTCAAGCTGGCCG
[1855] GCCTGCTCTGGTGCCTGGCCTCGCGCCGCCGTGTATCGCCCCGCCCTGGGCG
[1856] GCAAGGCTGGCCCGGTCGGCACCAGTTGCGTGAGCGGAAAGATGGCCGCTTC
[1857] CCGGCCCTGCTGCAGGGAGCTCAAAATGGAGGACGCGGCGCTCGGGAGAGC
[1858] GGGCGGGTGAGTCACCCACACAAAGGAAAAGGGCCTTTCCGTCCTCAGCCGT
[1859] CGCTTCATGTGACTCCACTGAGTACCGGGCGCCGTCCAGGCACCTCGATTAG
[1860] TTCTCGTGCTTTTGGAGTACGTCGTCTTTAGGTTGGGGGGAGGGGTTTTATGC
[1861] GATGGAGTTTCCCCACACTGAGTGGGTGGAGACTGAAGTTAGGCCAGCTTGG
[1862] CACTTGATGTAATTCTCCTTGGAATTTGCCCTTTTTGAGTTTGGATCTTGGTTC
[1863] ATTCTCAAGCCTCAGACAGTGGTTCAAAGTTTTTTTCTTCCATTTCAGGTGTC
[1864] GTGAGCTAGCTCTAGAATGGCCTTACCAGTGACCGCCTTGCTCCTGCCGCTG
[1865] GCCTTGCTGCTCCACGCCGCCAGGCCGGGATCCCAGGTGCAGCTGCAGGAG
[1866] TCTGGGGGAGGCTTGGTGCAGGCTGGGGGGTCTCTGAGACTCTCCTGTC
[1867] GAGCCTCTGGAATAATCTTCAGTTCCACGACCATGGACTGGTACCGCCA
[1868] GGCTCCAGGGAAGCAGCGCGAGTTGGTCGCAGGTGCTTCACCTACTGGT
[1869] GCCACAAACTATTTAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAG
[1870] ACAACGCCCAGAACACGGTGTATTTGCAAATGAACAACCTGAAACCTGA
[1871] GGACACAGCCGTCTATTCGTGTCATGCAGATCTACTGTACGCCTCGAAT
[1872] GACTACTGGGGCCAGGGGACCCAGGTCACCGTCTCCTCAGCGGCCGCCA
[1873] CTAGTTCCGGAGAGAGCAAGTACGGCCCTCCCTGCCCCCCTTGCCCTGATAT
[1874] CTTTTGGGTGCTGGTGGTGGTTGGTGGAGTCCTGGCTTGCTATAGCTTGCTAG
[1875] TAACAGTGGCCTTTATTATTTTCTGGGTGAGGAGTAAGAGGAGCAGGCTCCT
[1876] GCACAGTGACTACATGAACATGACTCCCCGCCGCCCCGGGCCCACCCGCAAG
[1877] CATTACCAGCCCTATGCCCCACCACGCGACTTCGCAGCCTATCGCTCCGCTAG
[1878] CAAACGGGGCAGAAAGAAACTCCTGTATATATTCAAACAACCATTTATGAGA
[1879] CCAGTACAAACTACTCAAGAGGAAGATGGCTGTAGCTGCCGATTTCCAGAAG AAGAAGAAGGAGGATGTGAACTGAGAGTGAAGTTCAGCAGGAGCGCAGACG
[1880] CCCCCGCGTACAAGCAGGGCCAGAACCAGCTCTATAACGAGCTCAATCTAGG
[1881] ACGAAGAGAGGAGTACGATGTTTTGGACAAGAGACGTGGCCGGGACCCTGA
[1882] GATGGGGGGAAAGCCGAGAAGGAAGAACCCTCAGGAAGGCCTGTACAATGA
[1883] ACTGCAGAAAGATAAGATGGCGGAGGCCTACAGTGAGATTGGGATGAAAGG
[1884] CGAGCGCCGGAGGGGCAAGGGGCACGATGGCCTTTACCAGGGTCTCAGTAC
[1885] AGCCACCAAGGACACCTACGACGCCCTTCACATGCAGGCCCTGCCCCCTCGC
[1886] TAAGTCGACAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTA
[1887] TTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTT
[1888] TGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAAT
[1889] CCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGC
[1890] GTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCA
[1891] CCACCTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACG
[1892] GCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGT
[1893] TGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAGCTGACGTCCTTTCCTTGG
[1894] CTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGT
[1895] CCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTC
[1896] TGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCTT
[1897] TGGGCCGCCTCCCCGCCTGGAATTCGAGCTCGGTACCTTTAAGACCAATGAC
[1898] TTACAAGGCAGCTGTAGATCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTG
[1899] GAAGGGCTAATTCACTCCCAACGAAGACAAGATCTGCTTTTTGCTTGTACTG
[1900] GGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGG
[1901] GAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTG
[1902] TGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTA
[1903] GTCAGTGTGGAAAATCTCTAGCAGTAGTAGTTCATGTCATCTTATTATTCAGT
[1904] ATTTATAACTTGCAAAGAAATGAATATCAGAGAGTGAGAGGAACTTGTTTAT
[1905] TGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAAT
[1906] AAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGT
[1907] ATCTTATCATGTCTGGCTCTAGCTATCCCGCCCCTAACTCCGCCCAGTTCCGC
[1908] CCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGG
[1909] CCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGG
[1910] Example 3: Making CAR-T Cells Expressing CDH17-Specific CARs
[1911] Lentiviruses expressing the VHH-CARs were obtained using the constructed lentivirus packaging plasmids described in Example 2 above. The lentiviruses were used to infect human primary T cells to produce CAR-T cells expressing the CAR receptors of Example 2.
[1912] The cell surface expression of each VHH-CAR in the T cells were detected by flow cytometry with either anti-VHH or CDH17 protein. As shown in Figs. 3B-3C, all the VHH- CARs were confirmed to be present on the T cell surface as detected by anti-VHH antibody, although 96CAR and 165CAR were not detected by the antigen, CDH17 protein. Example 4: CAR-T Cells Expressing CDH17-Specific CARs Kill CDH17-Positive Tumor
[1913] Cells In Vitro
[1914] Referring to Fig. 4, using a lactate dehydrogenase (LDH) release assay, the present study confirmed the potent in vitro cytotoxicity of novel CDH17 VHH-CAR T cells herein in the killing of the BON cells, which are a CDH17-positive tumor cell line derived from a serotonin- producing neuroendocrine tumor of the pancreas.
[1915] Example 5: CAR-T Cells Expressing CDH17-Specific CARs Kill CDH17-Positive Tumor Cells In Vivo
[1916] To further evaluate the ability of the novel CDH17 VHH-CAR T cells herein in killing CD 17-positive tumor cells, BON cells were inoculated into NOD scid gamma mice (NSG mice), followed by intravenously injection of each CDH17 VHH-CAR T cells or UTD T cells.
[1917] Referring to Figs. 5A-5D, the present study found that the CDH17CAR T cells expressing VHH95, VHH 98, VHH 150 and VHH 214 CAR receptors potently killed BON tumor in mice, although CDH17CAR T cells expressing the VHH111, VHH197 and VHH206 CAR receptors failed to suppress the BON tumors, which suggests that the binders for making the CAR construct may be important for mediating the CAR T killing efficacy.
[1918] Notably, although CDH17 is expressed in normal cells, especially in the gastrointestinal tract, the vast majority of the CDH17 VHH-CAR T cells herein did not appear to affect the health of the mice treated with the CAR T cells. Referring to Fig. 5E, all the tested CDH17 VHH-CAR T cells did not substantially affect the body weight of the mice.
[1919] Referring to Fig. 12, without wishing to be bound by theory, it is hypothesized that in normal CDH17-expressing cells such as the intestine epithelial cells, the CDH17 is distributed on the spatially restricted lateral membranes and is less accessible to the CAR T cells. In contrast, in CDH 17-positive cancer cells like the neuroendocrine cancer cells, CDH17 is exposed and can therefore be attacked by the CDH17 VHH-CAR T cells.
[1920] To further compare the killing efficacy, the present study tested the CAR T cells with the colorectal cancer (CRC) cell line, HT29 cells, which has low cell surface CDH17 expression (Fig. 6A).
[1921] The present study ectopically expressed the CDH17 in HT29 cells and inoculated the control HT29 and CDH17-HT29 cells to the left and right frank of the same NSG mice, respectively (Figs. 6A-B). The mice were then treated with UTD, VHH1 or VHH115 CAR T cells.
[1922] As shown in Fig. 6C, the VHH115 CAR T cells potently killed the control HT29 tumors, even the tumor has low cell surface CDH17 expression. Furthermore, the VHH115 CAR T cells eradicated the CDH17-HT29 tumors without tumor relapse. This result suggests that both CAR T cell capacity and the expression level of the antigen on the cell surface contribute to the killing efficacy.
[1923] Example 6:
[1924] In the present study, sixteen (16) novel anti-CDH17 VHH nanobodies were isolated from CDH17 protein immunized llamas. The extracellular domain(s) of CDH17 to which each VHH binds was also determined. Each of the 16 VHHs was constructed into CAR vector to construct CAR receptors that specifically bind to CDH17. It was demonstrated that anti-CDH17 VHH CAR-T cells expressing the CAR receptors were able to potently killed the tumor cells both in vitro and in vivo. Furthermore, the administration of the anti-CDH17 VHH CAR-T cells did not appear to significantly affect the health of test animals, suggesting that the CAR-T cells do not attack normal CDH17-expressing cells.
[1925] Together, the present study demonstrates that the anti-CDH17 CAR T cells herein are potent for eliminating both neuroendocrine tumors and CRC tumors, and are likely suitable for treating human GI tumors expressing low CDH17 expression or with more repressive microenvironment. Moreover, the new anti-CDH17 VHHs are also valuable for treating other diseases that involve the overexpression of CDH17 and can be targeted by the antibodies such as VHHs.
[1926] Example 7: CAR-T Cells Expressing CDH17-Specific CARs Kill CDH17-Positive Reduced Tumor Volume in Additional Xenograft Models
[1927] Referring to Figs. 14A-14C, CAR-T cells herein (VHH 150, VHH 95, and VHH 115) were able to reduce the volumes of tumor xenografts as compared to controls in mice grafted with BON tumor cells. Referring to Fig. 14A, mice were subcutaneous injected with IQx 106BON cells at day - 14, and injected with CDH17 VHH-CAR T cells herein or control CAR T cells or control T cells at day 0 and day 7.
[1928] Referring to Fig. 14B, all the three tested CAR T cells herein were able to significantly reduce tumor volumes as compared to VHH1 CAR T cells or untransduced (UTD) T cells. Referring to Fig. 14C, the CAR T cells herein did not significantly changed the weight of the mice.
[1929] Referring to Figs. 15A-15B, another CAR T cell herein (VHH 214) was able to reduce the volumes of HT29-HCDH17 tumor xenografts in mice as compared to controls in tumor grafted mice.
[1930] Referring to Fig. 15A, NSG mice were injected with HT29-HCDH17 tumor cells (1 x 107cells per flank) at day -10 to form tumors, and injected with VHH 214 CAR T cells or UTD T cells at day 0 and day 7.
[1931] Referring to Fig. 15B, VHH 214 CAR T cells was able to significantly reduce tumor volumes as compared to untransduced (UTD) T cells.
[1932] Enumerated Embodiments
[1933] Embodiment 1 : An antigen binding polypeptide comprising a variable domain of a heavy-chain antibody (VHH), wherein the VHH comprises: i. a CDR 1 comprising the sequence set forth in SEQ ID NO:2; a CDR 2 comprising the sequence set forth in SEQ ID NO:3; and a CDR 3 comprising the sequence set forth in SEQ ID NO:4; ii. a CDR 1 comprising the sequence set forth in SEQ ID NO:6; a CDR 2 comprising the sequence set forth in SEQ ID NOV; and a CDR 3 comprising the sequence set forth in SEQ ID NO: 8; iii. a CDR 1 comprising the sequence set forth in SEQ ID NOVO; a CDR 2 comprising the sequence set forth in SEQ ID NO: 11; and a CDR 3 comprising the sequence set forth in SEQ ID NO: 12; iv. a CDR 1 comprising the sequence set forth in SEQ ID NO: 14; a CDR 2 comprising the sequence set forth in SEQ ID NO: 15; and a CDR 3 comprising the sequence set forth in SEQ ID NO: 16; v. a CDR 1 comprising the sequence set forth in SEQ ID NO: 18; a CDR 2 comprising the sequence set forth in SEQ ID NO: 19; and a CDR 3 comprising the sequence set forth in SEQ ID NO:20; vi. a CDR 1 comprising the sequence set forth in SEQ ID NO:22; a CDR 2 comprising the sequence set forth in SEQ ID NO:23; and a CDR 3 comprising the sequence set forth in SEQ ID NO:24; vii. a CDR 1 comprising the sequence set forth in SEQ ID NO:26; a CDR 2 comprising the sequence set forth in SEQ ID NO:27; and a CDR 3 comprising the sequence set forth in SEQ ID NO:28; viii. a CDR 1 comprising the sequence set forth in SEQ ID NO:30; a CDR 2 comprising the sequence set forth in SEQ ID NO:31; and a CDR 3 comprising the sequence set forth in SEQ ID NO: 32; ix. a CDR 1 comprising the sequence set forth in SEQ ID NO:34; a CDR 2 comprising the sequence set forth in SEQ ID NO:35; and a CDR 3 comprising the sequence set forth in SEQ ID NO:36; x. a CDR 1 comprising the sequence set forth in SEQ ID NO:38; a CDR 2 comprising the sequence set forth in SEQ ID NO:39; and a CDR 3 comprising the sequence set forth in SEQ ID NO:40; xi. a CDR 1 comprising the sequence set forth in SEQ ID NO:42; a CDR 2 comprising the sequence set forth in SEQ ID NO:43; and a CDR 3 comprising the sequence set forth in SEQ ID NO:44; xii. a CDR 1 comprising the sequence set forth in SEQ ID NO:46; a CDR 2 comprising the sequence set forth in SEQ ID NO:47; and a CDR 3 comprising the sequence set forth in SEQ ID NO:48; xiii. a CDR 1 comprising the sequence set forth in SEQ ID NO:50; a CDR 2 comprising the sequence set forth in SEQ ID NO:51; and a CDR 3 comprising the sequence set forth in SEQ ID NO: 52; xiv. a CDR 1 comprising the sequence set forth in SEQ ID NO:54; a CDR 2 comprising the sequence set forth in SEQ ID NO:55; and a CDR 3 comprising the sequence set forth in SEQ ID NO: 56; xv. a CDR 1 comprising the sequence set forth in SEQ ID NO:58; a CDR 2 comprising the sequence set forth in SEQ ID NO:59; and a CDR 3 comprising the sequence set forth in SEQ ID NO: 60; xvi. a CDR 1 comprising the sequence set forth in SEQ ID NO:62; a CDR 2 comprising the sequence set forth in SEQ ID NO:63; and a CDR 3 comprising the sequence set forth in SEQ ID NO: 64; or xvii. a CDR 1 comprising the sequence set forth in SEQ ID NO:66; a CDR 2 comprising the sequence set forth in SEQ ID NO:67; and a CDR 3 comprising the sequence set forth in SEQ ID NO:68.
[1934] Embodiment 2: An antigen binding polypeptide comprising a variable domain of a heavy-chain antibody (VHH), wherein the VHH comprises an amino acid sequence having about 90% identity or more to SEQ ID NO: 1, 5, 9, 13, 17, 21, 25, 29, 33, 37, 41, 45, 49, 53, 57, 61, or 65.
[1935] Embodiment 3: An antigen binding polypeptide comprising a variable domain of a heavy-chain antibody (VHH), wherein at least one of the following applies: i. the VHH comprises an amino acid sequence having about 90% identity or more to SEQ
[1936] ID NO: 1, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:2; a CDR 2 comprising the sequence set forth in SEQ ID NO:3; and a CDR 3 comprising the sequence set forth in SEQ ID NO:4; ii. the VHH comprises an amino acid sequence having about 90% identity or more to SEQ
[1937] ID NO:5, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO: 6; a CDR 2 comprising the sequence set forth in SEQ ID NO: 7; and a CDR 3 comprising the sequence set forth in SEQ ID NO:8; iii. the VHH comprises an amino acid sequence having about 90% identity or more to SEQ
[1938] ID NO: 10, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO: 10; a CDR 2 comprising the sequence set forth in SEQ ID NO: 11; and a CDR 3 comprising the sequence set forth in SEQ ID NO: 12; iv. the VHH comprises an amino acid sequence having about 90% identity or more to SEQ
[1939] ID NO: 13, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO: 14; a CDR 2 comprising the sequence set forth in SEQ ID NO: 15; and a CDR 3 comprising the sequence set forth in SEQ ID NO: 16; v. the VHH comprises an amino acid sequence having about 90% identity or more to SEQ
[1940] ID NO: 17, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO: 18; a CDR 2 comprising the sequence set forth in SEQ ID NO: 19; and a CDR 3 comprising the sequence set forth in SEQ ID NO:20; vi. the VHH comprises an amino acid sequence having about 90% identity or more to SEQ
[1941] ID NO:21, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:22; a CDR 2 comprising the sequence set forth in SEQ ID NO:23; and a CDR 3 comprising the sequence set forth in SEQ ID NO:24; vii. the VHH comprises an amino acid sequence having about 90% identity or more to SEQ
[1942] ID NO:25, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:26; a CDR 2 comprising the sequence set forth in SEQ ID NO:27; and a CDR 3 comprising the sequence set forth in SEQ ID NO:28; viii. the VHH comprises an amino acid sequence having about 90% identity or more to SEQ
[1943] ID NO:30, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:30; a CDR 2 comprising the sequence set forth in SEQ ID NO:31; and a CDR 3 comprising the sequence set forth in SEQ ID NO:32; ix. the VHH comprises an amino acid sequence having about 90% identity or more to SEQ
[1944] ID NO:33, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:34; a CDR 2 comprising the sequence set forth in SEQ ID NO:35; and a CDR 3 comprising the sequence set forth in SEQ ID NO:36; x. the VHH comprises an amino acid sequence having about 90% identity or more to SEQ
[1945] ID NO:37, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:38; a CDR 2 comprising the sequence set forth in SEQ ID NO:39; and a CDR 3 comprising the sequence set forth in SEQ ID NO:40; xi. the VHH comprises an amino acid sequence having about 90% identity or more to SEQ
[1946] ID NO:41, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:42; a CDR 2 comprising the sequence set forth in SEQ ID NO:43; and a CDR 3 comprising the sequence set forth in SEQ ID NO:44; xii. the VHH comprises an amino acid sequence having about 90% identity or more to SEQ
[1947] ID NO:45, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:46; a CDR 2 comprising the sequence set forth in SEQ ID NO:47; and a CDR 3 comprising the sequence set forth in SEQ ID NO:48; xiii. the VHH comprises an amino acid sequence having about 90% identity or more to SEQ
[1948] ID NO:49, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:50; a CDR 2 comprising the sequence set forth in SEQ ID NO:51; and a CDR 3 comprising the sequence set forth in SEQ ID NO:52; xiv. the VHH comprises an amino acid sequence having about 90% identity or more to SEQ
[1949] ID NO:53, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:54; a CDR 2 comprising the sequence set forth in SEQ ID NO:55; and a CDR 3 comprising the sequence set forth in SEQ ID NO:56; xv. the VHH comprises an amino acid sequence having about 90% identity or more to SEQ
[1950] ID NO:57, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:58; a CDR 2 comprising the sequence set forth in SEQ ID NO:59; and a CDR 3 comprising the sequence set forth in SEQ ID NO:60; xvi. the VHH comprises an amino acid sequence having about 90% identity or more to SEQ
[1951] ID NO:61, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:62; a CDR 2 comprising the sequence set forth in SEQ ID NO:63; and a CDR 3 comprising the sequence set forth in SEQ ID NO:64; or xvii. the VHH comprises an amino acid sequence having about 90% identity or more to SEQ
[1952] ID NO:65, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:66; a CDR 2 comprising the sequence set forth in SEQ ID NO:67; and a CDR 3 comprising the sequence set forth in SEQ ID NO:68.
[1953] Embodiment 4: The antigen binding polypeptide of any one of Embodiments 1-3, wherein the VHH comprises an amino acid sequence set forth in SEQ ID NO: 1, 5, 9, 13, 17, 21, 25, 29, 33, 37, 41, 45, 49, 53, 57, 61, or 65.
[1954] Embodiment 5: The antigen binding polypeptide of any one of Embodiments 1-4, wherein the antigen binding polypeptide is a heavy chain antibody or a single-domain antibody (nanobody).
[1955] Embodiment 6: The antigen binding polypeptide of any one of Embodiments 1-5, wherein the VHH is a camelid VHH. Embodiment 7: The antigen binding polypeptide of any one of Embodiments 1-6, wherein the VHH is humanized.
[1956] Embodiment 8: The antigen binding polypeptide of any one of Embodiments 1-7, which binds to an extracellular portion of cadherin 17 (CDH17).
[1957] Embodiment 9: The antigen binding polypeptide of any one of Embodiments 1-8, which binds to at least one selected from ECI domain, EC2 domain, EC3 domain, EC4 domain, EC5 domain, EC6 domain, and EC7 domain of CDH17.
[1958] Embodiment 10: A conjugate, comprising: the antigen binding polypeptide of any one of Embodiments 1-9; and a drug, a toxin, or a radioisotope, conjugated to the antigen binding polypeptide.
[1959] Embodiment 11 : The conjugate of Embodiment 10, which comprises at least one selected from the group consisting of maytansinoid (DM1), SSTR2 -binding octreotide, paclitaxel, auristatin, MMAE, MMAF, dauxrubicin, duocarmycin A, 5-fluoruracil, methotrexate, tutbulin polymerization inhibitors, ravtansine (DM4), Ricin A, 90Y, 177Lu, and 11 Un conjugated to the antigen binding polypeptide.
[1960] Embodiment 12: The conjugate of any one of Embodiments 10-11, which is an antibody- drug-conjugate (ADC).
[1961] Embodiment 13: A chimeric antigen receptor (CAR), comprising: an antigen binding domain comprising the antigen binding polypeptide of any one of Embodiments 1-9; a transmembrane domain; and an intracellular signaling domain.
[1962] Embodiment 14: The CAR of Embodiment 13, further comprising a hinge domain.
[1963] Embodiment 15: A nucleic acid encoding the CAR of Embodiments 13 or 14.
[1964] Embodiment 16: The nucleic acid of Embodiment 15, which is part of an expression vector.
[1965] Embodiment 17: A CAR-T cell comprising the CAR of Embodiment 13 or 14, or the nucleic acid of Embodiment 15 or 16.
[1966] Embodiment 18: A method of treating a disease or disorder caused by or involving CDH 17-positive cells in a subject in need thereof, the method comprising: administering to the subject an effective amount of the antigen binding polypeptide of any one of Embodiments 1-9, an effective amount of the conjugate of any one of Embodiments 10-12, or an effective amount of the CAR-T cell of Embodiment 17. Embodiment 19: The method of Embodiment 18, wherein the disease or disorder is a CDH 17-positive cancer.
[1967] Embodiment 20: The method of Embodiment 19, wherein the CDH 17-positive cancer is:
[1968] (a) a CDH 17-positive gastrointestinal cancer (GIC) selected from the group consisting of a CDH 17-positive neuroendocrine tumor (NET), a CDH17-positive gastric cancer (GC), a CDH 17-positive pancreatic cancer (PC), and a CDH17-positive colorectal cancers (CRC);
[1969] (b) a CDH 17-positive mucinous ovarian cancer;
[1970] (c) a CDH 17-positive pancreatic acinar cell carcinoma;
[1971] (d) a CDH 17-positive cervical adenocarcinoma;
[1972] (e) a CDH 17-positive bilio-pancreatic adenocarcinoma; or
[1973] (f) a CDH17-positive pulmonary adenocarcinoma.
[1974] Embodiment 21 : The method of Embodiment 19 or 20, wherein the subject is a mammal, optionally a human.
[1975] The foregoing outlines features of several embodiments so that those skilled in the art may better understand the aspects of the present disclosure. Those skilled in the art should appreciate that they may readily use the present disclosure as a basis for designing or modifying other processes and structures for carrying out the same purposes and / or achieving the same advantages of the embodiments introduced herein. Those skilled in the art should also realize that such equivalent constructions do not depart from the spirit and scope of the present disclosure, and that they may make various changes, substitutions, and alterations herein without departing from the spirit and scope of the present disclosure.
Claims
1. CLAIMSWhat is claimed is:
1. An antigen binding polypeptide comprising a variable domain of a heavy -chain antibody(VHH), wherein the VHH comprises: i. a CDR 1 comprising the sequence set forth in SEQ ID NO:2; a CDR 2 comprising the sequence set forth in SEQ ID NO:3; and a CDR 3 comprising the sequence set forth in SEQ ID NO:4; ii. a CDR 1 comprising the sequence set forth in SEQ ID NO:6; a CDR 2 comprising the sequence set forth in SEQ ID NO:7; and a CDR 3 comprising the sequence set forth in SEQ ID NO:8; iii. a CDR 1 comprising the sequence set forth in SEQ ID NO: 10; a CDR 2 comprising the sequence set forth in SEQ ID NO:11; and a CDR 3 comprising the sequence set forth in SEQ ID NO: 12; iv. a CDR 1 comprising the sequence set forth in SEQ ID NO: 14; a CDR 2 comprising the sequence set forth in SEQ ID NO: 15; and a CDR 3 comprising the sequence set forth in SEQ ID NO: 16; v. a CDR 1 comprising the sequence set forth in SEQ ID NO: 18; a CDR 2 comprising the sequence set forth in SEQ ID NO: 19; and a CDR 3 comprising the sequence set forth in SEQ ID NO:20; vi. a CDR 1 comprising the sequence set forth in SEQ ID NO:22; a CDR 2 comprising the sequence set forth in SEQ ID NO:23; and a CDR 3 comprising the sequence set forth in SEQ ID NO:24; vii. a CDR 1 comprising the sequence set forth in SEQ ID NO:26; a CDR 2 comprising the sequence set forth in SEQ ID NO:27; and a CDR 3 comprising the sequence set forth in SEQ ID NO:28; viii. a CDR 1 comprising the sequence set forth in SEQ ID NO:30; a CDR 2 comprising the sequence set forth in SEQ ID NO:31; and a CDR 3 comprising the sequence set forth in SEQ ID NO:32; ix. a CDR 1 comprising the sequence set forth in SEQ ID NO:34; a CDR 2 comprising the sequence set forth in SEQ ID NO:35; and a CDR 3 comprising the sequence set forth in SEQ ID NO:36;x. a CDR 1 comprising the sequence set forth in SEQ ID NO:38; a CDR 2 comprising the sequence set forth in SEQ ID NO:39; and a CDR 3 comprising the sequence set forth in SEQ ID NO:40; xi. a CDR 1 comprising the sequence set forth in SEQ ID NO:42; a CDR 2 comprising the sequence set forth in SEQ ID NO:43; and a CDR 3 comprising the sequence set forth in SEQ ID NO:44; xii. a CDR 1 comprising the sequence set forth in SEQ ID NO:46; a CDR 2 comprising the sequence set forth in SEQ ID NO:47; and a CDR 3 comprising the sequence set forth in SEQ ID NO:48; xiii. a CDR 1 comprising the sequence set forth in SEQ ID NO:50; a CDR 2 comprising the sequence set forth in SEQ ID NO:51; and a CDR 3 comprising the sequence set forth in SEQ ID NO:52; xiv. a CDR 1 comprising the sequence set forth in SEQ ID NO:54; a CDR 2 comprising the sequence set forth in SEQ ID NO:55; and a CDR 3 comprising the sequence set forth in SEQ ID NO:56; xv. a CDR 1 comprising the sequence set forth in SEQ ID NO:58; a CDR 2 comprising the sequence set forth in SEQ ID NO:59; and a CDR 3 comprising the sequence set forth in SEQ ID NO: 60; xvi. a CDR 1 comprising the sequence set forth in SEQ ID NO:62; a CDR 2 comprising the sequence set forth in SEQ ID NO:63; and a CDR 3 comprising the sequence set forth in SEQ ID NO: 64; or xvii. a CDR 1 comprising the sequence set forth in SEQ ID NO:66; a CDR 2 comprising the sequence set forth in SEQ ID NO:67; and a CDR 3 comprising the sequence set forth in SEQ ID NO:68.
2. An antigen binding polypeptide comprising a variable domain of a heavy -chain antibody (VHH), wherein the VHH comprises an amino acid sequence having about 90% identity or more to SEQ ID NO: 1, 5, 9, 13, 17, 21, 25, 29, 33, 37, 41, 45, 49, 53, 57, 61 or 65.
3. An antigen binding polypeptide comprising a variable domain of a heavy -chain antibody (VHH), wherein at least one of the following applies:i. the VHH comprises an amino acid sequence having about 90% identity or more to SEQ ID NO: 1, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:2; a CDR 2 comprising the sequence set forth in SEQ ID NON; and a CDR 3 comprising the sequence set forth in SEQ ID NON; ii. the VHH comprises an amino acid sequence having about 90% identity or more to SEQ ID NO:5, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:6; a CDR 2 comprising the sequence set forth in SEQ ID NO: 7; and a CDR 3 comprising the sequence set forth in SEQ ID NO:8; iii. the VHH comprises an amino acid sequence having about 90% identity or more to SEQ ID NO: 10, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO: 10; a CDR 2 comprising the sequence set forth in SEQ ID NO:11; and a CDR 3 comprising the sequence set forth in SEQ ID NO: 12; iv. the VHH comprises an amino acid sequence having about 90% identity or more to SEQ ID NO: 13, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO: 14; a CDR 2 comprising the sequence set forth in SEQ ID NO:15; and a CDR 3 comprising the sequence set forth in SEQ ID NO: 16; v. the VHH comprises an amino acid sequence having about 90% identity or more to SEQ ID NO: 17, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO: 18; a CDR 2 comprising the sequence set forth in SEQ ID NO:19; and a CDR 3 comprising the sequence set forth in SEQ ID NO:20; vi. the VHH comprises an amino acid sequence having about 90% identity or more to SEQ ID NO:21, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:22; a CDR 2 comprising the sequence set forth in SEQ ID NO:23; and a CDR 3 comprising the sequence set forth in SEQ ID NO:24; vii. the VHH comprises an amino acid sequence having about 90% identity or more to SEQ ID NO:25, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:26; a CDR 2 comprising the sequence set forth in SEQ ID NO:27; and a CDR 3 comprising the sequence set forth in SEQ ID NO:28; viii. the VHH comprises an amino acid sequence having about 90% identity or more to SEQ ID NO:30, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ IDNO:30; a CDR 2 comprising the sequence set forth in SEQ ID NO:31; and a CDR 3 comprising the sequence set forth in SEQ ID NO:32; ix. the VHH comprises an amino acid sequence having about 90% identity or more to SEQ ID NO:33, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:34; a CDR 2 comprising the sequence set forth in SEQ ID NO:35; and a CDR 3 comprising the sequence set forth in SEQ ID NO:36; x. the VHH comprises an amino acid sequence having about 90% identity or more to SEQ ID NO:37, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:38; a CDR 2 comprising the sequence set forth in SEQ ID NO:39; and a CDR 3 comprising the sequence set forth in SEQ ID NO:40; xi. the VHH comprises an amino acid sequence having about 90% identity or more to SEQ ID NO:41, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:42; a CDR 2 comprising the sequence set forth in SEQ ID NO:43; and a CDR 3 comprising the sequence set forth in SEQ ID NO:44; xii. the VHH comprises an amino acid sequence having about 90% identity or more to SEQ ID NO:45, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:46; a CDR 2 comprising the sequence set forth in SEQ ID NO:47; and a CDR 3 comprising the sequence set forth in SEQ ID NO:48; xiii. the VHH comprises an amino acid sequence having about 90% identity or more to SEQ ID NO:49, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:50; a CDR 2 comprising the sequence set forth in SEQ ID NO:51; and a CDR 3 comprising the sequence set forth in SEQ ID NO:52; xiv. the VHH comprises an amino acid sequence having about 90% identity or more to SEQ ID NO:53, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:54; a CDR 2 comprising the sequence set forth in SEQ ID NO:55; and a CDR 3 comprising the sequence set forth in SEQ ID NO:56; xv. the VHH comprises an amino acid sequence having about 90% identity or more to SEQ ID NO: 57, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:58; a CDR 2 comprising the sequence set forth in SEQ ID NO:59; and a CDR 3 comprising the sequence set forth in SEQ ID NO:60;xvi. the VHH comprises an amino acid sequence having about 90% identity or more to SEQ ID NO:61, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:62; a CDR 2 comprising the sequence set forth in SEQ ID NO:63; and a CDR 3 comprising the sequence set forth in SEQ ID NO:64; or xvii. the VHH comprises an amino acid sequence having about 90% identity or more to SEQ ID NO:65, and the VHH comprises a CDR 1 comprising the sequence set forth in SEQ ID NO:66; a CDR 2 comprising the sequence set forth in SEQ ID NO:67; and a CDR 3 comprising the sequence set forth in SEQ ID NO: 68.
4. The antigen binding polypeptide of any one of claims 1-3, wherein the VHH comprises an amino acid sequence set forth in SEQ ID NO: 1, 5, 9, 13, 17, 21, 25, 29, 33, 37, 41, 45, 49, 53, 57, 61 or 65.
5. The antigen binding polypeptide of any one of claims 1-4, wherein the antigen binding polypeptide is a heavy chain antibody or a single-domain antibody (nanobody).
6. The antigen binding polypeptide of any one of claims 1-5, wherein the VHH is a camelid VHH.
7. The antigen binding polypeptide of any one of claims 1-6, wherein the VHH is humanized.
8. The antigen binding polypeptide of any one of claims 1-7, which binds to an extracellular portion of cadherin 17 (CDH17).
9. The antigen binding polypeptide of any one of claims 1-8, which binds to at least one selected from ECI domain, EC2 domain, EC3 domain, EC4 domain, EC5 domain, EC6 domain, and EC7 domain of CDH17.
10. A conjugate, comprising: the antigen binding polypeptide of any one of claims 1-9; anda drug, a toxin, or a radioisotope, conjugated to the antigen binding polypeptide.
11. The conjugate of claim 10, which comprises at least one selected from the group consisting of maytansinoid (DM1), SSTR2 -binding octreotide, paclitaxel, auristatin, MMAE, MMAF, dauxrubicin, duocarmycin A, 5-fluoruracil, methotrexate, tutbulin polymerization inhibitors, ravtansine (DM4), Ricin A, 90Y, 177Lu, and 11 Un conjugated to the antigen binding polypeptide.
12. The conjugate of any one of claims 10-11, which is an antibody-drug-conjugate (ADC).
13. A chimeric antigen receptor (CAR), comprising: an antigen binding domain comprising the antigen binding polypeptide of any one of claims 1-9; a transmembrane domain; and an intracellular signaling domain.
14. The CAR of claim 13, further comprising a hinge domain.
15. A nucleic acid encoding the CAR of claims 13 or 14.
16. The nucleic acid of claim 15, which is part of an expression vector.
17. A CAR-T cell comprising the CAR of claim 13 or 14, or the nucleic acid of claim 15 or 16.
18. A method of treating a disease or disorder caused by or involving CDH 17-positive cells in a subject in need thereof, the method comprising: administering to the subject an effective amount of the antigen binding polypeptide of any one of claims 1-9, an effective amount of the conjugate of any one of claims 10-12, or an effective amount of the CAR-T cell of claim 17.
19. The method of claim 18, wherein the disease or disorder is a CDH 17-positive cancer.
20. The method of claim 19, wherein the CDH17-positive cancer is:(a) a CDH 17-positive gastrointestinal cancer (GIC) selected from the group consisting of a CDH 17-positive neuroendocrine tumor (NET), a CDH 17-positive gastric cancer (GC), a CDH 17-positive pancreatic cancer (PC), and a CDH 17-positive colorectal cancers (CRC);(b) a CDH 17-positive mucinous ovarian cancer;(c) a CDH 17-positive pancreatic acinar cell carcinoma;(d) a CDH 17-positive cervical adenocarcinoma;(e) a CDH 17-positive bilio-pancreatic adenocarcinoma; or(f) a CDH17-positive pulmonary adenocarcinoma.
21. The method of claim 19 or 20, wherein the subject is a mammal, optionally a human.
Citation Information
Patent Citations
Cadherin-17 specific antibodies and cytotoxic cells for cancer treatment
US20190046655A1
Car t-cells comprising an anti CD33, an anti CLL1 and at least one further car anti CD123 and / or FTL3
WO2020035676A1