Sepsis-related disease biomarker HLA-DQA and use thereof
By using HLA-DQA as a biomarker, the challenge of early diagnosis of sepsis has been solved, enabling early intervention before organ dysfunction and improving the survival rate of sepsis patients.
Patent Information
- Application Number
- PCT/CN2025/109249
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-07-19
- Filing Date
- 2025-07-18
- Publication Date
- 2026-01-22
AI Technical Summary
The lack of sepsis-specific molecular markers in current technologies makes it difficult to make early diagnosis and intervention before organ dysfunction occurs, and delayed treatment significantly reduces patient survival rates.
Using HLA-DQA or its active fragments as biomarkers, the detection of HLA-DQA levels in samples can be used for early diagnosis, risk assessment, immune status assessment, prognosis prediction, and treatment selection for sepsis-related diseases.
HLA-DQA has high diagnostic efficacy, capable of differentiating between infected and non-infected patients when the SOFA score is below 2, providing early diagnosis and prediction, improving the timeliness of treatment, and reducing the risk of patient death.
Smart Images

Figure PCTCN2025109249-FTAPPB-I100001 
Figure PCTCN2025109249-FTAPPB-I100002 
Figure PCTCN2025109249-FTAPPB-I100003
Abstract
Description
HLA-DQA, a biomarker for sepsis-related diseases, and its applications
[0001] Cross-references to related applications
[0002] This application claims the benefit of Chinese patent application CN202410977759.9, filed on July 19, 2024; the entire contents of which are incorporated herein by reference. Technical Field
[0003] This invention belongs to the field of molecular diagnostics, specifically relating to the use of HLA-DQA as a biomarker for sepsis-related diseases in the preparation of products for early diagnosis, risk assessment, immune status assessment, prognosis prediction and / or treatment selection of sepsis-related diseases. Background Technology
[0004] Currently, sepsis diagnosis primarily relies on clinical indicators, with the diagnostic criterion being "infection + SOFA ≥ 2". The SOFA score, or Sequential Organ Failure Assessment, is a scoring system that assesses the severity and prognosis of critically ill patients based on clinical blood biochemistry tests and clinical indicators; a higher score indicates a more severe condition. Currently, procalcitonin (PCT) is used clinically to assist in sepsis diagnosis. However, elevated PCT only indicates infection, offering good differentiation between infected and non-infected patients, but it is difficult to distinguish between common infections and sepsis. In summary, due to the lack of sepsis-specific molecular markers, clinicians struggle to make early diagnoses and screenings before organ dysfunction (SOFA ≥ 2) occurs. Early intervention is a universal principle in sepsis treatment and management. For every hour that treatment is delayed, the patient's survival rate decreases by approximately 7.6% (Ferrer, R., et al. Effectiveness of treatments for severe sepsis: a prospective, multicenter, observational study. American Journal of Respiratory and Critical Care Medicine 180, 861-866 (2009).; Kumar, A., et al. Duration of hypotension before initiation of effective antimicrobial therapy is the critical determinant of survival in human septic shock. Critical Care Medicine 34, 1589-1596 (2006).). If a new molecular biomarker for sepsis can be found, allowing for early warning and diagnosis of sepsis before organ dysfunction occurs, the window for intervention can be extended, enabling patients to receive more timely treatment. Summary of the Invention
[0005] The purpose of this invention is to provide biomarkers for sepsis-related diseases and their use in the preparation of products for early diagnosis, risk assessment, immune status assessment, prognosis prediction and / or treatment selection of subjects with sepsis-related diseases.
[0006] Another object of the present invention is to provide products and systems for early diagnosis, risk assessment, immune status assessment, prognosis prediction and / or treatment selection of sepsis-related diseases.
[0007] To solve the above-mentioned technical problems and achieve the above-mentioned objectives, the present invention provides the following technical solution:
[0008] In a first aspect, the present invention provides the use of HLA-DQA or its active fragments or functional fragments as biomarkers in the preparation of products for early diagnosis, risk assessment, immune status assessment, prognosis prediction and / or treatment selection of sepsis-related diseases.
[0009] In some embodiments, early diagnosis, risk assessment, immune status assessment, prognostic prediction, and / or treatment selection for sepsis-related diseases of the subject includes: measuring HLA-DQA levels in samples from the subject and comparing the HLA-DQA levels in the samples with reference values to perform early diagnosis, risk assessment, immune status assessment, prognostic prediction, and / or treatment selection for the subject.
[0010] In a second aspect, the present invention provides a product for early diagnosis, risk assessment, immune status assessment, prognosis prediction and / or treatment selection of sepsis-related diseases in subjects, characterized in that the product comprises reagents, kits and / or detection devices for detecting HLA-DQA levels in samples from subjects.
[0011] In some embodiments, the sepsis-related disease includes sepsis, severe sepsis, or septic shock; the early stage of the sepsis-related disease is SOFA < 2; and / or, the subject is diagnosed with or suspected of having an infection.
[0012] In some embodiments, the HLA-DQA is selected from at least one of the HLA-DQA gene, HLA-DQA mRNA, cDNA of HLA-DQA mRNA, or HLA-DQA protein.
[0013] In some embodiments, the sample is derived from the subject's bodily fluids, cells, tissues, metabolites, and / or excretions.
[0014] In some preferred embodiments, the sample is derived from the subject's bodily fluids, which are selected from at least one of blood, plasma, extracellular fluid, tissue fluid, lymph, or cerebrospinal fluid.
[0015] In some preferred embodiments, the sample is derived from the subject's blood, preferably peripheral blood.
[0016] In some embodiments, the kit includes:
[0017] (i) Reagents for detecting an effective amount of HLA-DQA in the target sample;
[0018] (ii) Optionally, at least one substance selected from the group consisting of: containers or packaging, additives, solutions, buffer solutions, negative controls, positive controls or instructions.
[0019] In some embodiments, the reagent comprises at least one of the following: primers, probes, antibodies, biochips, or small molecule compounds for the specific detection of HLA-DQA.
[0020] In some embodiments, the reagent is directly or indirectly labeled with a detectable tag selected from at least one of the following: a radioactive isotope, a fluorescent group, a chemiluminescent moiety, an enzyme, an enzyme substrate, an enzyme cofactor, an enzyme inhibitor, a dye, a metal ion, or a ligand.
[0021] In some embodiments, the kit includes at least one of the following: Western blot kit, enzyme-linked immunosorbent assay kit, radioimmunoassay kit, radioimmunodiffusion kit, two-dimensional biphasic immunodiffusion kit, rocket immunoelectrophoresis kit, immunohistochemical staining kit, immunoprecipitation assay kit, complement fixation assay kit, fluorescence-activated cell sorting kit, aptamer chip kit, microarray kit, protein chip kit, qPCR kit, or flow cytometry kit.
[0022] In some embodiments, the detection device is selected from at least one of the following:
[0023] Detection equipment used for real-time quantitative reverse transcription PCR, biochip detection, DNA blotting, RNA blotting, in situ hybridization, immunofluorescence, or immunohistochemistry.
[0024] Thirdly, the present invention provides a system for early diagnosis, risk assessment, immune status assessment, prognosis prediction, and / or treatment selection of sepsis-related diseases, characterized in that the system comprises:
[0025] (1) A first device for collecting and / or receiving HLA-DQA level data in a sample of an object;
[0026] (2) A second device for analyzing the data to perform early diagnosis, risk assessment, immune status assessment, prognosis prediction and / or treatment selection for the subject of sepsis-related diseases.
[0027] In some embodiments, the first device includes the product described in the second aspect;
[0028] In some implementations, the analysis includes comparing the HLA-DQA level in the sample with a reference value.
[0029] Fourthly, the present invention provides a method for early diagnosis, risk assessment, immune status assessment, prognosis prediction, and / or treatment selection of sepsis-related diseases, the method comprising:
[0030] 1) Collect and / or process samples of the subject to bring the HLA-DQA level to a detectable level;
[0031] 2) Detect the HLA-DQA level of the object using any of the aforementioned products or systems;
[0032] 3) Compare the subject's HLA-DQA level with a reference value to enable early diagnosis, risk assessment, immune status assessment, prognosis prediction, and / or treatment selection.
[0033] In some implementations, the early stage of sepsis-related disease is SOFA < 2.
[0034] In some implementations, the subject is diagnosed with or suspected of being infected.
[0035] In some implementations, the sepsis-related disease includes sepsis, severe sepsis, or septic shock.
[0036] In some implementations, the sample is derived from the subject's bodily fluids, cells, tissues, metabolites, and / or excretions.
[0037] In some preferred embodiments, the sample is derived from the subject's bodily fluids and is selected from at least one of the following:
[0038] Blood, plasma, extracellular fluid, tissue fluid, lymph, or cerebrospinal fluid.
[0039] In some preferred embodiments, the sample is derived from the subject's blood, preferably peripheral blood.
[0040] In some embodiments, the HLA-DQA level includes the HLA-DQA mRNA molecular level, the HLA-DQA mRNA cDNA molecular level, and / or the HLA-DQA protein molecular level.
[0041] This invention utilizes various sequencing analysis methods, blood sample testing from clinically infected patients, and follow-up on the clinical outcomes of these patients to identify significant expression changes in two HLA-DQA molecules in the early stages of sepsis. This allows for the differentiation between infected and non-infected patients, as well as between those with common infections and those who ultimately progress to sepsis. It holds promise as an immunomarker for the early diagnosis, immune status assessment, and prognosis of sepsis. HLA-DQA exhibits superior diagnostic efficacy; ROC analysis shows an AUC value of 0.8988 for differentiating between common infections and sepsis, exceeding the diagnostic efficacy of the commonly used clinical marker PCT. Therefore, the sepsis biomarker provided by this invention is of great significance for the early clinical diagnosis of sepsis and also has promising applications in the in vitro diagnostic reagent industry. Attached Figure Description
[0042] Figure 1 shows the levels of HLA-DQA mRNA in peripheral blood immune cells of healthy volunteers (normal control), patients with common infections, and patients with sepsis detected by digital PCR.
[0043] Figure 2 shows the ROC curve analysis results of HLA-DQA mRNA levels in the ordinary infection group and the sepsis group.
[0044] Figure 3 shows the ROC curve analysis results of HLA-DQA expression and clinical outcome information of 176 sepsis patients in the sequencing dataset E-MTAB-7581 of the Biostudies database.
[0045] Figure 4 shows the Kaplan-Meier survival curve analysis results of HLA-DQA expression and clinical outcome information of 479 sepsis patients in the GEO database sequencing dataset GSE65682.
[0046] Figure 5 shows the expression of HLA-DQA protein in peripheral blood immune cells of mice in the control and sepsis groups by flow cytometry analysis. Detailed Implementation
[0047] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly used in the field to which this invention pertains. For the purposes of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural forms, and vice versa.
[0048] Unless the context clearly indicates otherwise, the terms “a” and “an” as used herein include plural references. For example, reference to “a cell” includes multiple such cells and equivalents known to those skilled in the art, etc.
[0049] As used herein, the term "about" indicates a range of ±20% of the following value. In some embodiments, the term "about" indicates a range of ±10% of the following value. In some embodiments, the term "about" indicates a range of ±5% of the following value.
[0050] The numerical ranges used in this article should be understood as including all numbers within that range. For example, the range 1 to 20 should be understood to include any number, combination of numbers, or subrange from the following group: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.
[0051] As used herein, the terms “comprises” or “comprising” mean “including, but not limited to”. This term is intended to be open-ended to specify the presence of any of the stated features, elements, integers, steps, or components, but does not exclude the presence or addition of one or more other features, elements, integers, steps, components, or groups thereof. Therefore, the term “comprising” includes the more restrictive terms “consisting of” and “substantially consisting of”.
[0052] As used herein, the terms “optional,” “any,” “arbitrary,” or “any one” mean that the event or situation described below may, but does not have to, occur, including the circumstances in which the event or situation may or may not occur.
[0053] As used herein, the term “and / or” should be understood to mean any one of the options or any combination of two or more of the options.
[0054] As used herein, the terms “first” and “second” are used for descriptive purposes only to distinguish different descriptive objects, and should not be construed as indicating or implying relative importance or implicitly specifying the number of technical features indicated, nor should they be construed as indicating order or connection.
[0055] As used herein, the term "sepsis-related disease" refers to a class of diseases characterized by life-threatening organ dysfunction caused by a dysregulated host response to infection, including, but not limited to, sepsis, septic shock, and severe sepsis. In some preferred embodiments, the sepsis-related disease is sepsis. For a specific definition and diagnostic criteria for sepsis, please refer to Singer M, Deutschman CS, Seymour CW, et al. The Third International Consensus Definitions for Sepsis and Septic Shock (Sepsis-3). JAMA. 2016; 315(8):801-810. doi:10.1001 / jama.2016.0287.
[0056] As used herein, the term "subject" refers to an animal, preferably a mammal, and more typically a human. Subjects investigated by the methods of the present invention are preferably subjects with suspected infection. As used herein, "with suspected infection" means a subject exhibiting clinical parameters, signs, and / or symptoms of infection. Therefore, subjects according to the present invention are generally those with or suspected of having an infection, and more typically those presenting in the emergency department.
[0057] As used herein, the term "infection" refers to a pathological process caused by the invasion of a pathogenic or potential pathogen, organism, and / or microorganism into normal sterile tissues or fluids, and preferably involves infections of bacteria, viruses, fungi, and / or parasites. Therefore, an infection can be a bacterial infection, a viral infection, and / or a fungal infection. An infection can be local or systemic. For the purposes of this invention, a viral infection can be considered a microbial infection.
[0058] As used herein, unless otherwise stated or clearly determined, the term "HLA-DQA" may include the HLA-DQA gene, HLA-DQA mRNA, HLA-DQA mRNA cDNA, and / or HLA-DQA protein. HLA-DQA belongs to the HLA class II α-chain family of molecules. It binds to the β-chain encoded by the HLA-DQB gene to form the HLA-DQ heterodimer, which is responsible for presenting exogenous antigens to helper T cells, thereby activating the immune response. The HLA-DQA gene is expressed in various tissues, particularly in the lungs and lymphoid tissues.
[0059] As used in this disclosure, the term "HLA-DQA" belongs to the HLA class II α-chain family. It binds to the β-chain encoded by the HLA-DQB gene to form the HLA-DQ heterodimer. This dimer is responsible for presenting exogenous antigens to helper T cells, thereby activating the immune response. The HLA-DQA gene is expressed in a variety of tissues, particularly in the lungs and lymphoid tissues.
[0060] As used herein, the term "reference value" refers to a standard value used for comparison with the level (content or activity) of a biomarker in a sample, which can be calculated based on the average level of the biomarker determined in samples isolated from multiple healthy individuals or individuals with sepsis. Reference values are typically given as a range. Therefore, the terms "reference value" and "range of reference values" as used herein are defined to have the same meaning.
[0061] Reference values can be negative reference values established from healthy individuals or those with ordinary infections. For example, a decrease in HLA-DQA levels relative to a negative reference value usually indicates the presence of sepsis-related disease, a risk of progression to sepsis-related disease, a risk of immunosuppression, or a risk of poor prognosis. Reference values can also be positive reference values established from patients with sepsis, or a series of positive reference values established from patients with sepsis at different stages of progression. HLA-DQA levels equivalent to a positive reference value usually indicate the corresponding degree of sepsis progression, immune status, or prognosis.
[0062] As used herein, the term “reduction” can refer to a reduction of 5%, 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more in the level of a detected biomarker (e.g., expression or activity) compared to a reference value.
[0063] As used herein, the terms "reagent," "detection reagent," or "reagent for detecting HLA-DQA levels" are used interchangeably and refer to substances that are specifically targeted at HLA-DQA molecules and can be used to directly or indirectly detect the presence and / or content of HLA-DQA genes, mRNA, cDNA, and proteins. Based on the sequence of the HLA-DQA molecule, those skilled in the art can prepare reagents specifically targeting HLA-DQA molecules using conventional methods or obtain them commercially available. For example, detection reagents usable in this invention include, but are not limited to, antibodies (preferably monoclonal antibodies) with detection specificity for HLA-DQA molecules, probes, gene chips, PCR primers, gRNA, etc. Furthermore, for ease of detection, the detection reagents disclosed herein may also be labeled with detectable markers, including but not limited to, radioisotopes, fluorophores, chemiluminescent components, enzymes, enzyme substrates, enzyme cofactors, enzyme inhibitors, dyes, metal ions, ligands (e.g., biotin or haptens), etc. The detection reagents disclosed herein may exist in solution, immobilized on a carrier (such as a substrate or adsorbent), or in other manner conventional in the art, as long as such manner of existence is suitable for the detection of HLA-DQA in biological samples. For example, when the detection reagents of the present invention are nucleotide probes, they may exist in the form of a biochip (or "microarray").
[0064] As used herein, the terms "product" and "detection product" are used interchangeably, referring to substances, combinations of reagents, or devices used in conjunction with or in conjunction with HLA-DQA-specific substances. Depending on the requirements of the detection method used, appropriate HLA-DQA detection substances can be selected and formulated into products suitable for the detection method, such as kits. Those skilled in the art can adjust and modify the detection method and the reagents contained in the product according to actual conditions and needs. The products disclosed herein may also contain other reagents clinically used for early diagnosis, risk assessment, immune status assessment, prognostic prediction (or assessment, judgment), and / or treatment selection of sepsis-related diseases in subjects, to assist or validate the results obtained by detecting HLA-DQA. Those skilled in the art can make routine selections according to specific needs.
[0065] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. Unless otherwise specified in the embodiments, conditions are performed according to conventional conditions or the manufacturer's recommendations. All reagents or instruments without specified manufacturers are commercially available conventional products. To better illustrate this invention, numerous specific details are given in the following detailed embodiments. The specific embodiments described herein are for illustrative purposes only and are not intended to constitute any limitation on the invention. Furthermore, descriptions of well-known structures and techniques are omitted in the following description to avoid unnecessarily obscuring the concept of the invention. Such structures and techniques are also described in many publications, such as *Molecular Cloning: A Laboratory Manual (4th Edition)* (Cold Spring Harbor Laboratory Science Press), Ausubel, FM et al., *Current Protocols in Molecular Biology*, Greene Publishing Assoc., and Wiley-Interscience.
[0066] Example 1. Validation of the clinical diagnostic efficacy of HLA-DQA in differentiating between common infections and sepsis.
[0067] (1) Extraction of total RNA
[0068] Forty patients with common infections, 11 patients with sepsis, and 20 healthy controls were recruited from West China Hospital of Sichuan University. Peripheral blood was collected in K3EDTA anticoagulant tubes. The blood was lysed overnight (-80℃) or on ice for 30 minutes with an appropriate volume of Trizol under enzyme-free conditions. The lysed blood was thawed at room temperature, inverted to mix, and allowed to stand at room temperature for 10 minutes. One-fifth of the sample volume (approximately 200 μL) of chloroform was added, vortexed for 30 seconds, and allowed to stand for 5 minutes. A pink layer was observed at the bottom, and the top layer was colorless. The sample was centrifuged at 12000g for 20 minutes at 4℃. After centrifugation, the sample was clearly separated into three layers: a pinkish layer of contaminating proteins at the bottom, a middle layer of white DNA, and an uppermost colorless aqueous layer containing RNA. The RNA was carefully transferred to a new enzyme-free tube; an equal volume of isopropanol was added, and the mixture was transferred together to -20℃ to allow RNA precipitation (approximately 1-2 hours). After centrifugation at 12000g for 10 minutes at 4°C, a white, lumpy RNA precipitate was observed settling at the bottom of the tube. The supernatant was removed, and the RNA was resuspended in a prepared DEPC solution (ethanol:DEPC = 3:1). The mixture was then centrifuged at 12000g for 5 minutes at 4°C, repeated twice. After removing the supernatant, the RNA was air-dried in a fume hood until the precipitate became colorless and transparent. Then, 30 μL of enzyme-free water was added, and the mixture was thoroughly mixed. The RNA concentration was then measured using a Thermo Scientific Nanodrop.
[0069] (2) Reverse transcription
[0070] Genomic DNA removal: Add 1 μg of qualified RNA to the following reaction system, gently mix with a pipette, and then transfer the prepared reaction mixture to a metal bath and react at 42°C for 2 minutes.
[0071] Table 1. Genome Removal Reaction System
[0072] Remove the mixture from the metal bath after the above reaction is complete, and then prepare the mRNA reverse transcription reaction system according to the grouping in the table below. After completion, place the mixture in a PCR instrument for reverse transcription. The reverse transcription program is: 37°C, 15 minutes; 85°C, 2 minutes; 4°C incubation.
[0073] Table 2. Reverse transcription reaction system
[0074] (3) Digital PCR detection
[0075] After reverse transcription is complete, dilute the resulting cDNA to approximately 0.2 ng / μL RNA equivalent to prepare the ddPCR reaction system for the gene to be tested: 1 μL cDNA template, Bio-rad QX200... TM ddPCR TM 10 μL of enzyme premixed reaction solution and 0.8 μL of primers (0.4 μL each of forward and reverse primers) were added to a final volume of 20 μL with water. The DQA primer sequences were: HLA-DQA-F: CTACAACTCTACCGCTGCTA (SEQ ID NO:1); HLA-DQA-R: GACTGACTGCCCATTGCT (SEQ ID NO:2).
[0076] The absolute copy number of HLA-DQA mRNA was determined using a Bio-Rad QX200 ddPCR instrument, following its instructions. The QX200 ddPCR system primarily utilizes microfluidic technology to partition the sample into approximately 20,000 nanometer-sized droplets for each sample before detection.
[0077] The test results were displayed using a scatter bar chart. Differences between groups were compared using one-way ANOVA, and the Mann-Whitney u test was used to compare the common infection group and the sepsis group separately (p<0.0001). The results showed that compared with the normal control, HLA-DQA expression was significantly lower in patients with common infection and lowest in patients with sepsis (Figure 1). Receiver operating characteristic (ROC) curve analysis was performed on the HLA-DQA mRNA expression levels in the common infection group and the sepsis group. Sensitivity was plotted on the ordinate to represent the true positive rate, and 1-specificity on the x-axis to represent the false positive rate, to create the ROC curve. The area under the curve (AUC) reflects the diagnostic value of the test; the larger the area, the closer it is to 1.0, the better the diagnostic efficacy and the higher the accuracy; the closer it is to 0.5, the lower the diagnostic efficacy; when it equals 0.5, it has no diagnostic value. ROC analysis showed that the AUC of 0.8988 was between the common infection group and the sepsis group, indicating that HLA-DQA mRNA level has high diagnostic efficacy in differentiating between sepsis and common infection (Figure 2).
[0078] Example 2. Receiver operating curves and Kaplan-Meier survival curves to assess the predictive efficacy of HLA-DQA for the prognosis of sepsis patients.
[0079] This invention analyzes the sequencing dataset E-MTAB-7581 (https: / / www.ebi.ac.uk / biostudies / arrayexpress / studies?query=E-MTAB-7581) from the Biostudies database. This dataset contains data from 176 sepsis patients. HLA-DQA mRNA expression and clinical outcome information were collected, and ROC analysis was performed. The ROC curve was plotted by calculating the sensitivity, specificity, and false positive rate (1-specificity) for all cutoff points. Sensitivity was plotted on the ordinate (true positive rate) and 1-specificity on the abscissa (false positive rate), and the area under the curve (AUC) was calculated. The optimal cutoff point is often selected at the upper left corner of the ROC curve, as it corresponds to relatively optimal sensitivity and specificity. The ROC analysis results showed that the area under the curve (AUC) was 0.8, the sensitivity was 0.732, the specificity was 0.745, the optimal cutoff value was 6.936, and the accuracy was good, indicating clinical application value (Figure 3).
[0080] This invention analyzes the clinical prognostic information of 479 sepsis patients in the GEO database GSE65682 dataset (https: / / www.ncbi.nlm.nih.gov / geo / query / acc.cgi?acc=GSE65682). HLA-DQA mRNA expression and clinical outcome information were collected, and Kaplan-Meier survival curve analysis was performed. Kaplan-Meier survival curves are primarily used to analyze the impact of a single factor on survival, to estimate patient survival rates, and to plot survival curves. The survival curve is a continuous step-shaped curve plotted with survival time on the horizontal axis and survival rate on the vertical axis, illustrating the relationship between survival time and survival rate. In medicine, biology, and other fields, Kaplan-Meier survival curves are commonly used to assess disease prognosis and treatment effectiveness. Kaplan-Meier survival curves were used to analyze the prognostic value of HLA-DQA for sepsis patients in the GSE65682 dataset. The results showed that HLA-DQA expression was associated with the survival rate of sepsis patients (p = 0.0031) (Figure 4).
[0081] Example 3. Flow cytometry detection to verify differential HLA-DQA protein expression
[0082] (1) Construction of animal models
[0083] All wild-type C57 mice (SPF grade) used in this invention were purchased from Beijing Huafukang Biotechnology Co., Ltd., with an age range of 7-8 weeks and a weight range of 20g-25g. All purchased mice underwent a one-week acclimatization period at the Experimental Animal Center of the Frontier Medical Research Center, West China Hospital, Sichuan University. The rearing room was well-ventilated, with humidity at 50%-60%, and the room temperature controlled at approximately 26℃. Day and night cycles were alternated, each lasting 12 hours. Mice were fed standard feed and had free access to water. Experiments were conducted after the one-week acclimatization period.
[0084] Establishment of a severe infection (sepsis) model: 6-8 week old C57 mice were selected. Mice were anesthetized with sodium pentobarbital. The abdomen of the mice was prepared with a shaving tool. After disinfection with iodine, the mice were opened under aseptic conditions. A small incision was made 0.5 cm to the left of the midline of the abdomen. The cecum was separated with surgical forceps (curved forceps) and gently removed. Then, a ligation was made with sterile No. 4 suture 0.75 cm from the cecum end. Next, an 18-gauge needle was used to puncture the cecum once. The cecum was then put back into the abdominal cavity. The muscle layer and outer skin layer of the mice were sutured. After disinfection with iodine, the mice were put back into the breeding cage for observation.
[0085] The healthy sham surgery group served as a control: the preoperative procedure was the same as that of the sepsis model, except that the cecum was not ligated or punctured after the abdomen was opened and the cecum was gently placed back into the abdominal cavity. The muscle layer and outer skin layer of the mice were sutured, and the mice were disinfected with iodine and then placed back into the breeding cage for observation.
[0086] Immediately after modeling, all mice were subcutaneously injected with 800 μL of physiological saline for fluid rewarming, and 20 mg / kg of ciprofloxacin was injected intramuscularly into the inner thigh.
[0087] (2) Flow cytometry detection of HLA-DQA expression
[0088] (a) A sepsis model was established using the animal modeling method described above, with the sham-operated group serving as a healthy control.
[0089] (b) Collect 50 μL of peripheral blood from mice into a K3EDTA anticoagulant tube and mix by inverting.
[0090] (c) Add flow cytometry antibodies for all genes to be tested according to the instructions (generally 2.5 μL / test): CD45 (brand: BD Pharmaceuticals) TM HLA-DQA antibody (brand: ThermoFisher-Invitrogen, catalog number: AB_2552186).
[0091] (d) Add 450 μL of 1X FACs hemolysin to the counting tube and lyse the red blood cells at room temperature (20°C) in the dark for 15 minutes to fully lyse the red blood cells.
[0092] (e) For flow cytometry analysis, the sample does not need to be washed. Add Dapi to the sample 5 minutes before the flow cytometer analysis to stain for cell viability and death, and then it can be used on the instrument.
[0093] (f) Results Analysis
[0094] The FAC file from the flow cytometer was analyzed using Fiowjo 10.0, and the results are shown in Figure 5. Compared with the healthy control group, the HLA-DQA protein level in peripheral blood immune cells of the sepsis group was significantly reduced, suggesting that detecting the HLA-DQA protein level in peripheral blood immune cells can also be used for the diagnosis of sepsis.
[0095] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, and is not intended to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions made by those skilled in the art to the technical solution of the present invention do not depart from the essence and scope of the technical solution of the present invention.
Claims
1. Use of HLA-DQA or an active fragment, a functional fragment thereof as a biomarker in the manufacture of a product for early diagnosis, risk assessment, immune status assessment, prognosis prediction and / or treatment regimen selection of a subject with a sepsis-related disease.
2. Use according to claim 1, characterized in that, The early diagnosis, risk assessment, immune status assessment, prognosis prediction and / or treatment regimen selection of the subject with a sepsis-related disease comprises: determining the level of HLA-DQA in a sample from the subject, comparing the level of HLA-DQA in the sample with a reference value, to make early diagnosis, risk assessment, immune status assessment, prognosis prediction and / or treatment regimen selection of the subject.
3. A product for early diagnosis, risk assessment, immune status assessment, prognosis prediction and / or treatment regimen selection of a sepsis-related disease in a subject, characterized in that, The product comprises reagents, kits and / or detection devices for detecting the level of HLA-DQA in a sample from a subject.
4. Use according to claim 1 or product according to claim 3, characterized in that, The sepsis-related disease comprises sepsis, severe sepsis or septic shock; the early stage of the sepsis-related disease is SOFA < 2; and / or the subject is confirmed to be infected or suspected to be infected.
5. Use according to claim 1 or product according to claim 3, characterized in that, The HLA-DQA is selected from at least one of HLA-DQA gene, HLA-DQA mRNA, cDNA of HLA-DQA mRNA or HLA-DQA protein.
6. The product of claim 3, wherein, The sample is from the body fluid, cells, tissues, metabolites and / or excreta of the subject; Preferably, the sample is from the body fluid of the subject, which is selected from at least one of blood, plasma, extracellular fluid, tissue fluid, lymph or cerebrospinal fluid; More preferably, the sample is from the blood of the subject; More preferably, the sample is from the peripheral blood of the subject.
7. The product according to any one of claims 3-6, characterized in that, The kit comprises: (i) a detection-effective amount of reagents for detecting HLA-DQA in a sample from a subject; (ii) optionally, at least one substance selected from the group consisting of containers or packages, adjuvants, solutions, buffers, negative controls, positive controls or instructions; And / or, the reagent comprises at least one of primers, probes, antibodies, biochips or small molecule compounds that specifically detect HLA-DQA; Preferably, the reagent is directly or indirectly labeled with a detectable label selected from at least one of radioisotopes, fluorescent groups, chemiluminescent moieties, enzymes, enzyme substrates, enzyme cofactors, enzyme inhibitors, dyes, metal ions or ligands.
8. The product of claim 7, wherein, The kit comprises at least one of Western blotting kit, enzyme-linked immunosorbent assay kit, radioimmunoassay kit, radioimmunodiffusion kit, two-dimensional double immunodiffusion kit, rocket immunoelectrophoresis kit, immunohistochemical staining kit, immunoprecipitation assay kit, complement fixation assay kit, fluorescence activated cell sorting kit, aptamer chip kit, microarray kit, protein chip kit, qPCR kit or flow cytometry analysis kit.
9. The product according to any one of claims 3-8, characterized in that, The detection device is selected from at least one of: A detection device for real-time quantitative reverse transcription PCR, biochip detection method, Southern blotting method, Northern blotting method, in situ hybridization method, immunofluorescence method or immunohistochemical method.
10. A system for early diagnosis, risk assessment, immune status assessment, prognosis prediction and / or treatment regimen selection of a sepsis-related disease in a subject, characterized in that, The system comprises: (1) a first device for collecting and / or receiving the level of HLA-DQA in a sample from a subject; (2) a second device for analyzing the data to perform early diagnosis, risk assessment, immune status assessment, prognosis prediction and / or treatment regimen selection of a sepsis-related disease for the subject; wherein the first device comprises the product of claims 3-9; and / or, the analysis comprises comparing the level of HLA-DQA in the sample with a reference value.