A novel genomic safe harbor site in the ACTB locus
The ACTB locus is used for site-specific integration of recombinant gene expression cassettes to achieve stable and high expression levels, addressing the challenges of random integration in recombinant mammalian cell lines by reducing clonal variability and genomic instability.
Patent Information
- Application Number
- PCT/EP2025/070213
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-07-15
- Filing Date
- 2025-07-15
- Publication Date
- 2026-01-22
AI Technical Summary
Current methods for generating recombinant mammalian cell lines for biopharmaceutical production are time-consuming and expensive due to random integration of transgenes, leading to variable expression profiles and genomic instability, which complicates screening and regulatory characterization.
Utilizing a novel genomic safe harbor site downstream of the beta-actin (ACTB) gene locus for site-specific integration of recombinant gene expression cassettes, ensuring stable and high expression levels of proteins by integrating between the stop codon of ACTB and the start of the next gene's 5' UTR, preferably between 600bp and 3000bp downstream.
The ACTB locus provides stable and high expression of transgenes, reducing clonal variability and genomic instability, thereby streamlining the selection process and ensuring regulatory stability for biopharmaceutical production.
Smart Images

Figure EP2025070213_22012026_PF_FP_ABST
Abstract
Description
[0001] A Novel Genomic Safe Harbor Site in the ACTB Locus
[0002] Field of the invention
[0003] The present invention relates to methods for protein production using a novel genomic integration site in the beta Actin gene locus, methods of stable cell line production, cell lines and uses thereof.
[0004] Background of the invention
[0005] The demand and use of an increasing variety of biopharmaceuticals, such as antibodies, viral vectors or gene therapy approaches, continues to grow and therefore requires the constant improvement of recombinant mammalian production cell lines [1], Such cell lines need to exhibit a variety of characteristics like favorable growth, expression and stability, which makes their generation time-consuming and expensive [2- 4] . Currently, these cell lines are often generated by transfecting production cells with a plasmid encoding the desired transgene under control of a strong promoter. The transfected DNA integrates into the cellular DNA of the host cell through cellular repair mechanisms, and cell clones with stable expression are isolated by using selection markers. This process is largely random, resulting in a broad range of clonal cells with different properties, of which a majority exhibit undesirable characteristics [5-7],
[0006] An important reason for the highly divergent expression profiles of individual cell clones seems to be the varying number of insertion events at different genomic loci. During integration, chromosomal rearrangements and mutations can lead to genomic instability and the silencing or dysregulation of endogenous genes, which can influence other cellular characteristics [8-10], The expression level of the transgene cassette itself is usually influenced by surrounding chromosomal elements near the integration site, such as the proximity of endogenous promoters, enhancers or silencers, the presence of DNA elements such as insulators, S / MARs (scaffold / matrix attachment region) elements or ubiquitous chromatin opening elements [11, 12], This inherent clonal variability not only complicates the screening process to identify strong production cell clones, but also creates greater challenges in terms of regulatory characterization and understanding the biology of mammalian cell lines for targeted optimization [13, 14],
[0007] An alternative strategy involves employing precisely defined landing sites, which can be reused by different methods. Usually this approach leads to production clones with a single copy integration and predictable expression characteristics. Consequently, it streamlines the selection process of suitable clones in terms of productivity as well as the requisite regulatory stability [15, 16],
[0008] Employing endonucleases such as zinc-finger nucleases or the clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated protein 9 (Cas9) system, double-strand breaks can be induced at a specific target site. This approach enhances targeted integration of a transgene into the host cell genome facilitating the exploration and characterization of potential landing sites [17-19], Well-defined landing sites are also known as genomic safe harbors (GSHs) [20, 21],
[0009] Definition and selection of such GSHs is not trivial due to potential interference of the expression of the transgene and cellular functions. Indeed, some groups prefer GSH locations within particular genes, whereas other rather use extragenic regions [22-24], The currently most often targeted GSHs include the human ROSA26 locus on chromosome 3
[0025] , as well as the CCR5 locus also located on chromosome 3
[0026] or the adeno-associated virus integration site 1 (AAVS1) on chromosome 19
[0027] , No stringent robust data on transgene expression in commonly used mammalian cells during biopharmaceutical production or comprehensive studies on the general safety of these sites are available
[0028] ,
[0010] Regarding the expression level of these loci, studies have been performed mainly in cells such as CD34+ progenitor cells or human embryonic stem cells (ESCs) by integrating reporter genes such as the one coding for green fluorescent protein (GFP)
[0030] , A more recent study shows the comparison of the three GSHs by the expression of GFP in HEK293 cell line, in which large differences in expression levels between these GSHs have been observed
[0031] ,
[0011] None of the three loci meets the criteria being located in extragenic regions of the human genome. Integration into the AAVS1 locus destroys the gene phosphatase 1 regulatory subunit 12C (PPP1R12C), whose function has not yet been clearly identified. Integration into the CCR5 locus, which contains several genes, some of which are cancer-related, may lead to dysregulation of surrounding genes. Also with the directed integration into the human ROSA26 locus, an altered regulation of nearby genes cannot be excluded [22, 29, 30],
[0012] Hence, there is a need for the identification and diligent characterization of suitable GSHs in appropriate cell lines to support modern biopharmaceutical drug development. Crucially, the GSH must provide robust expression without interfering with expression or regulation of other genes or any other cellular functions.
[0013] Objectives and Summary of the Invention
[0014] The present work addresses this issue by providing methods and host cells using a novel site-specific integration (SSI) site downstream of the beta-actin (ACTB) gene locus as a GSH for recombinant protein expression.
[0015] The inventors compared cells expressing a gene of interest integrated at the SSI described herein with previously produced cell lines derived from a random integration screen stably expressing the same gene. Surprisingly, the host cells expressing a gene of interest from the SSI described herein performed better than even the highest-expressing cells derived from random integration screens.
[0016] Hence, in a first aspect, the invention provides a method for producing a protein of interest in an isolated host cell, the method comprising
[0017] (i) providing an isolated host cell comprising an endogenous beta Actin (ACTB) gene locus; (ii) integrating a recombinant gene expression cassette downstream of the stop codon of the ACTB gene, wherein the recombinant gene expression cassette comprises a nucleic acid sequence encoding at least one protein of interest; and
[0018] (iii) culturing the isolated host cell under conditions allowing expression of the protein of interest.
[0019] In one embodiment, the recombinant gene expression cassette is integrated between the stop codon of ACTB and the start of the 5’ UTR of the next gene located downstream of ACTB.
[0020] In another embodiment, the recombinant gene expression cassette is integrated between the end of the 3’ UTR of ACTB and the start of the 5’ UTR of the next gene located downstream of ACTB.
[0021] In one embodiment, the recombinant gene expression cassette is integrated at least 600bp downstream of the stop codon of ACTB gene.
[0022] Preferably, the recombinant gene expression cassette is integrated between 600bp and 6000bp downstream of the stop codon of ACTB gene. More preferably, the recombinant gene expression cassette is integrated between 600bp and 3000bp downstream of the stop codon of ACTB gene.
[0023] In one particular embodiment, the recombinant gene expression cassette is integrated at about 2000bp downstream of the stop codon of ACTB gene.
[0024] In one embodiment the recombinant gene expression cassette is integrated at or near a nucleic acid sequence at least 80% identical to SEQ ID NO: 1 or a nucleic acid sequence at least 80% identical to SEQ ID NO: 2, optionally wherein the recombinant gene expression cassette is integrated between a nucleic acid sequence at least 80% identical to SEQ ID NO: 1 or a nucleic acid sequence at least 80% identical to SEQ ID NO: 2.
[0025] In one embodiment, the method described herein further comprises a step of: (iv) harvesting the protein of interest from the isolated host cell and / or supernatant.
[0026] The skilled person is aware of methods suitable for harvesting proteins from the isolated host cell and / or supernatant, i.e. cell cultures. Such methods include, for example, chromatography methods (gel-filtration chromatography, ion-exchange chromatography, hydrophobic interaction chromatography, affinity chromatography, liquid chromatography), or purification using protein tags such as strep-tag or his-tag and immunoprecipitation.
[0027] In one embodiment, the recombinant gene expression cassette further comprises a nucleic acid sequence encoding a regulatory sequence operatively linked to the nucleic acid sequence encoding the at least one protein of interest.
[0028] In one embodiment, the regulatory sequence is a promoter, preferably tissue non-specific promoter. In one embodiment, the tissue non-specific promoter is selected from the group consisting of CMV, SV40, PGK, EFla, UbC, CAG, TRE (tet response element), and Tet- promoter.
[0029] In one embodiment, the protein of interest is stably expressed over at least 5 passages.
[0030] In one embodiment, the protein of interest is stably expressed over at least 2 host cell generations.
[0031] In one embodiment, the protein of interest comprises one or more of a selection marker, a detectable protein, an antibody, a peptide antigen, an enzyme, a hormone, a growth factor, a receptor, a fusion protein a therapeutic protein or other biologically active protein.
[0032] In one particular embodiment, the protein of interest is a therapeutic protein.
[0033] The integration of the recombinant gene expression cassette can be achieved by any gene editing method known to the skilled person. In one embodiment, the recombinant gene expression cassette is integrated using an integration technique that comprises inducing double strand breaks at the target site. Preferably, the recombinant gene expression cassette is integrated using a CRISPR-based technique. In one embodiment, the recombinant gene expression cassette is integrated using CRISPR / Cas9.
[0034] In one embodiment, step (ii) of the method further comprises selecting an isolated host cell with a single site specific integration of the recombinant gene expression cassette, preferably wherein the isolated host cell does not have additional integration of the recombinant gene expression cassette.
[0035] In one embodiment, the recombinant gene expression cassette further comprises a selection marker.
[0036] In one embodiment, the recombinant gene expression cassette further comprises at least two recombinase recognition sites.
[0037] In one embodiment, the isolated host cell is an isolated human host cell. In one embodiment, the isolated host cell is selected from the group consisting of CAP®, CHO, HeLa, iPSC, K562, HEK293, HT-1080, BHK and Vero, preferably wherein the isolated host cell is a CAP® cell.
[0038] In a second aspect, the invention also provides a method of producing a stable host cell line with a site specific integration, comprising
[0039] (i) providing an isolated host cell comprising an endogenous beta Actin (ACTB) gene locus;
[0040] (ii) integrating a recombinant gene expression cassette between 600 bp and 3000 bp downstream of the stop codon of the ACTB gene; and
[0041] (iii) culturing the isolated host cell under conditions allowing the selection of an isolated host cell with the correct site specific integration; and
[0042] (iv) expanding the selected isolated host cell into a stable host cell line. In a third aspect, the invention provides an isolated site-specific integration host cell comprising an endogenous beta Actin (ACTB) gene locus, wherein the isolated site-specific integration host is produced by the any of the methods described herein.
[0043] In a fourth aspect, the invention also provides an isolated site-specific integration host cell comprising an endogenous beta Actin (ACTB) gene locus, wherein a recombinant gene expression cassette is integrated between 600 bp and 3000 bp downstream of the stop codon of the ACTB gene.
[0044] In one embodiment, the host cell line is a human host cell line. In one embodiment, the host cell line is selected from the group consisting of CAP®, CHO, HeLa, iPSC, K562, HEK293, HT-1080, BHK and Vero, preferably the host cell line is CAP® cell line.
[0045] In a fifth aspect, the invention also relates to the use of the isolated host cell described above for the production of a protein of interest.
[0046] In a sixth aspect, the invention also relates to the use of an integration site between the end of the 3’ UTR of the ACTB gene and the start of the 5’ UTR of the next gene located downstream of the ACTB gene of an isolated host cell for the production of a protein of interest.
[0047] In one embodiment, the integration site is between 600 bp and 3000 bp downstream of the stop codon of the endogenous ACTB gene of an isolated host cell.
[0048] Figure Legends
[0049] Figure 1: Strategies to identify genomic loci enabling high and stable transgene expression.
[0050] A: Strategy for targeting a region downstream the ACTB locus. The targeting vector carries an eGFP-T2A-NeoR expression cassette under control of the CMV promoter. The expression cassette is flanked by two ACTB homology arms (5’ arm and 3’ arm) and two identical sgRNA recognition sites (black triangles) enabling in vivo linearization of the targeting vector. Specific DSBs (double strand breaks) in the genomic and vector DNA were induced by co-transfection of a Cas9 / sgRNA carrying helper plasmid (not shown). The 2.8 kb expression cassette was inserted 3’ of the ACTB locus via CRISPR / Cas9 mediated DSB and homology directed repair (HDR). B: Random integration strategy to generate reference loci with strong single copy expression. Targeting vectors contained a CAG (or alternatively CMV) promoter and an eGFP-T2A-NeoR expression cassette flanked by F3 / FRT sites and two equal sgRNA recognition sites (red triangles) for in vivo linearization of the plasmid. Cellular repair mechanisms were exploited to integrate the 4.1 kb expression cassette following electroporation induced random DSBs. Schemes are not drawn to scale. CMV: Cytomegalovirus promoter, CAG: CMV early enhancer / chicken / 3 -Actin promoter, eGFP: enhanced green fluorescent protein, T2A: self-cleaving peptide, NeoR: neomycin resistance, PKG-pA: poly A from protein kinase G, F3 / FRT: flippase recognition target sites.
[0051] Figure 2: Selection of eGFP single cell clones based on expression strength and gene copy number.
[0052] A: Distribution of the expression level of analyzed single cell CAPAGTB-eGFP+clones measured by flow cytometry. A total of 57 single cell clones were examined and grouped according to expression level. B: Distribution of expression level of analyzed single cell CAPRar GAG’eGFP+clones measured by flow cytometry. Overall, 55 single cell clones were analyzed and grouped according to expression level. C: Gene copy analysis of high expressing CAPAGTB-eGFP+and CAPRan’GAG’eGFP+single cell clones using ddPCR. Data are mean ± SEM, n = 3. Rfu: relative expression unit.
[0053] Figure 3: Stability test of selected cell lines with single copy insertions and strong transgene expression.
[0054] Cell line ACTB B8 (targeted integration) and cell lines 2C, 2D, 2E & 10F (single copy random integrations), were cultured in shake flasks continuously for 9 weeks with and without the selection antibiotic G418. To analyze the stability of the expression level, samples were taken at different numbers of passages as indicated for each cultivation and the eGFP expression level was determined by flow cytometry. Passages are shown in increasing order for each cell line, from left to right: Passage 2 (P2) , P4, P6, P8, PIO, P12, P14, P16, P18. Data are mean ± SEM, n = 3. Rfu: relative expression unit.
[0055] Figure 4: Generation of CUN stable cell lines by reusing the ACTB locus.
[0056] A: Schematic outline of the genomic region after homologous recombination of the CIIN (Cl esterase inhibitor) expression construct into the ACTB locus. Scheme is not drawn to scale. CMV: Cytomegalovirus promoter, T2A: self-cleaving peptide, PuroR: puromycin resistance, SV40-pA: poly A from Simian-Virus 40.
[0057] B: Western blot analysis showing actin beta (band at 45 kDa) and GAPDH (Glyceraldehyde 3-phosphate dehydrogenase, 37 kDa) expression in CAP WT and CAPACTBC1IN+C6 cells.
[0058] Figure 5: Generation of CUN stable cell lines by recombinase-mediated cassette exchange in cell lines derived from random transgenesis.
[0059] A: Schematic representation of RMCE (recombinase-mediated cassette exchange) in selected clones derived from random transgenesis. Co-transfection of the targeting vector pCl I N_FI p with the Flp expression plasmid pCAG_FLPo leads to the exchange of the eGFP reporter construct by the CIIN expression cassette in the pre-tagged clones. CMV: Cytomegalovirus promoter, T2A: self-cleaving peptide, PuroR: puromycin resistance, SV40- pA: poly A from Simian-Virus 40, CAG: CMV early enhancer / chicken ft -Actin promoter, eGFP: enhanced green fluorescent protein, CIIN: Cl esterase inhibitor, NeoR: neomycin resistance, PKG-pA: poly A from protein kinase G, F3 / FRT: flippase recognition target sites. B: Characterization of the CAPRandom’CAG’GFP+cell line 2E after RMCE. eGFP expression levels were measured by flow cytometry over the duration of the selection process (34, 40 & 69 days post transfection). C: PCR analysis to confirm the correct cassette exchange in the SCCs CAPRMCE-C1IN+ 2EB7 and 2EB9. Both clones show the expected 449 bp PCR fragment indicating successful RMCE, which is absent in CAP WT and RandomGFP+ cells that served as negative controls. Figure 6: Transgene copy number and productivity of CIIN recombinant cell lines.
[0060] A: Copy number analysis of selected CII N producer clones derived from the present work (ACTBC1IN+and RMCEC1IN+) and high CIIN producing reference clones (CSPChlgh). Data are mean ± SEM, n=3. B: Comparison of absolute CIIN expression of all cell lines analyzed in A. All samples were generated by contiguous shake flask experiments over a time period of three weeks. Data are mean ± SEM, n = 3. Statistical analysis between both CSPChlghand all ACTB / RMCEcllN+shows *** p< 0.001, except CSPChigh2B10 - ACTBC1IN+C6 * <0.1. Statistical analysis between ACTBC1IN+C6 and RMCEC1IN+2EB7 shows *** p< 0.001. C: Relative CII N expression shown as a dependency of the detected gene copy number. Data are mean ± SEM, n = 3. Statistical analysis between both CSPChighand all ACTB / RMCEcllN+as well as ACTBC1IN+C6 and RMCEC1IN+2EB7 shows *** p< 0.001.
[0061] DETAILED DESCRIPTION OF THE INVENTION
[0062] Definitions
[0063] Before the invention is described in detail with respect to some of its preferred embodiments, the following general definitions are provided.
[0064] The present invention will be described with respect to particular embodiments and with reference to certain figures but the invention is not limited thereto but only by the claims.
[0065] Where the term “comprising” is used in the present description and claims, it does not exclude other elements. For the purposes of the present invention, the term “consisting of” is considered to be a preferred embodiment of the term “comprising of”. If hereinafter a group is defined to comprise at least a certain number of embodiments, this is also to be understood to disclose a group which preferably consists only of these embodiments.
[0066] For the purposes of the present invention, the term “obtained” is considered to be a preferred embodiment of the term “obtainable”. If hereinafter e.g. a compound is defined to be obtainable from a specific source, this is also to be understood to disclose a compound which is obtained from this source.
[0067] Where an indefinite or definite article is used when referring to a singular noun, e.g. “a”, “an” or “the”, this includes a plural of that noun unless something else is specifically stated. The terms “about” or “approximately” in the context of the present invention denote an interval of accuracy that the person skilled in the art will understand to still ensure the technical effect of the feature in question. The term typically indicates deviation from the indicated numerical value of ± 10%, and preferably of ± 5%.
[0068] Technical terms are used by their common sense. If a specific meaning is conveyed to certain terms, definitions of terms will be given in the following in the context of which the terms are used.
[0069] As used herein, “producing a protein of interest” refers to expression of a protein of interest in a host cell culture, wherein the protein is either recovered from lysed cells or from the supernatant of the culture, or both. The nucleic acid used to express the protein may be introduced into the cell by any method, including transfection, transduction, infection, lipofection or genetic engineering.
[0070] "Gene expression" or "expression" refers to the process of gene transcription, translation, and post-translational modification.
[0071] An "isolated" polynucleotide or polypeptide is a polynucleotide or polypeptide which is substantially separated from other contaminants that naturally accompany it, e.g., protein, lipids, and other polynucleotide sequences. The term embraces polynucleotide sequences which have been removed or purified from their naturally-occurring environment or clone library, and include recombinant or cloned DNA isolates and chemically synthesized analogues or analogues biologically synthesized by heterologous systems.
[0072] The terms “upstream” or “downstream” used relative to a gene or gene locus within a genome refer to the surrounding sequences. The term “upstream” refers to the DNA sequence that is before the 5’ UTR and / or before the start codon of the gene. The term “downstream” refers to the DNA sequence that is after the stop codon and / or after the 3’ UTR of a gene. These terms are used in relation to the gene regardless of if the gene is in forward or reverse orientation within the DNA or chromosome.
[0073] The term “UTR” or “untranslated region” refers to a part of the transcribed sequence of a gene that is not translated into protein. The UTR regions are in one or more of the first and last exons of a gene and form part of the mRNA and cDNA. The 5’ UTR region is found on the 5’ end of the coding region and usually includes part of exon 1, or in some cases, all of exon 1 and part of further adjacent exons. The 5’ UTR region starts at the start of the transcript and ends where translation of the protein begins, i.e. adjacent to the start codon. The 3’ UTR region is found on the 3’ end of the coding region and usually includes part of the last exon, or in some cases, all of the last exons and part of the adjacent exon. The 3’ UTR region starts where translation of the protein ends, i.e. right after the stop codon, and ends at the end of the transcript.
[0074] "Host cell", “host cells”, "cell lines," "cell cultures," "packaging cell line" and other such terms, used interchangeably herein, denote higher eukaryotic cells, e.g., mammalian cells, such human cells, useful in the present invention. These cells can be used as recipients for recombinant vectors, viruses or other transfer polynucleotides, and include the progeny of the original cell that was transduced. It is understood that the progeny of a single cell may not necessarily be completely identical (in morphology or in genomic complement) to the original parent cell.
[0075] A "plasmid" or "expression vector" as used herein is an expression construct used for cloning and gene expression, comprising a region which encodes a polypeptide or RNA of interest. A "plasmid" is a type of vector, which refers to a circular double stranded DNA loop into which additional DNA segments can be ligated. In the present specification, “plasmid”, "plasmid vector" and "expression vector" can be used interchangeably as the plasmid is the most commonly used form of vector. The term "expression vector" means a vector capable of directing expression of a particular nucleotide sequence in an appropriate host cell.
[0076] A “gene expression cassette” as described herein refers to a combination of control elements and a gene or genes to which they are operably linked for expression. Commonly, a gene expression cassette comprises regulatory elements operably linked to a nucleic acid of interest, and optionally a termination signal and / or other regulatory elements.
[0077] A “recombinant” polynucleotide or amino acid sequence as used interchangeably herein can refer to a nucleotide or an amino acid sequence that is the product of various combinations of cloning, restriction and / or ligation steps, and other procedures that result in a construct that is distinct from a polynucleotide or amino acid sequence found in nature. A recombinant polynucleotide might also be combined in si / ico an produced by nucleic acid synthesis. As used herein, the term “recombinant gene expression cassette” refers to a gene expression cassette that is not found in nature, but comprises elements from different sources or organisms, which may be naturally occurring or synthetic.
[0078] As used herein, the term “endogenous” when referring to a gene or gene locus means a gene that originates within the cell or organism and has not been introduced.
[0079] Conversely, the term “exogenous” refers to any entity that is or has been introduced into an organism or a cell. For example, an “exogenous nucleic acid” is a nucleic acid that is derived from outside an organism or cell. In some embodiments, an exogenous nucleic acid in a mammalian cell has been introduced through a cell membrane (e.g., by the hand of man). In some embodiments, an exogenous nucleic acid may be or comprise a nucleotide sequence that exists in the native genome in a non-native context (e.g., at a different location and / or under the control of non-natural expression element(s)). In some embodiments, an exogenous nucleic acid may be or comprise a nucleotide sequence that did not previously exist in the genome of the organism or cell (e.g., from a different organism). Exogenous nucleic acids include exogenous genes. An “exogenous gene” is a nucleic acid or sequence thereof that has been introduced into an organism or a cell (e.g., by transformation / transfection) that codes for the expression of an RNA and / or protein, and is also referred to herein as a “transgene.”
[0080] As used herein, the term “gene” or “genes” refers to a DNA sequence in a chromosome that codes for a gene product (e.g., an RNA product, e.g., a polypeptide product). In some embodiments, a gene includes coding sequence (i.e., sequence that encodes a particular product). In some embodiments, a gene includes non-coding sequence. In some particular embodiments, a gene may include both coding (e.g., exonic) and non-coding (e.g., intronic) sequence. In some embodiments, a gene may include one or more regulatory sequences (e.g., promoters, enhancers, etc.) and / or intron sequences that, for example, may control or impact one or more aspects of gene expression (e.g., cell-type-specific expression, inducible expression, etc.). As used herein, the term “gene” generally refers to a portion of a nucleic acid that encodes a polypeptide or fragment thereof; the term may optionally encompass regulatory sequences, as will be clear from context to those of ordinary skill in the art. This definition is not intended to exclude application of the term “gene” to non-protein-coding expression units but rather to clarify that, in most cases, the term as used in this document refers to a polypeptide-coding nucleic acid. In some embodiments, a gene may encode a polypeptide, but that polypeptide may not be functional, e.g., a gene variant may encode a polypeptide that does not function in the same way, or at all, relative to the wild-type gene.
[0081] The gene of interest includes any gene or DNA sequence of natural or synthetic origin. A non-limiting list of genes that may be used in the method of the present invention is selected from the group of genes consisting of recombinases, reporter genes, receptors, signaling molecules, transcription factors, pharmaceutically active proteins and peptides, drug target candidates, disease causing gene products and toxins, and mutations and combinations thereof. In particular, the term “therapeutic protein” refers to pharmaceutically active proteins and peptides, drug target candidates, or genes intended to replace defective or abnormally expressed genes. The term “mutation” is understood to mean any changes introduced into the DNA sequence of a reference gene. As used herein, the term “genome” refers to the total genetic information carried by an individual organism or cell, represented by the complete nucleic acid sequences of its chromosomes.
[0082] The term “regulatory element” as used herein refers to a non-coding DNA region that is capable of initiating, increasing, reducing or otherwise influencing the transcription of a gene. Regulatory elements include, for example, enhancers or promoters.
[0083] The terms “operative linkage” and “operatively linked” (or “operably linked”) are used interchangeably with reference to a juxtaposition of two or more components (such as sequence elements), in which the components are arranged such that both components function normally and allow the possibility that at least one of the components can mediate a function that is exerted upon at least one of the other components. By way of illustration, a transcriptional regulatory sequence, such as a promoter, is operatively linked to a coding sequence if the transcriptional regulatory sequence controls the level of transcription of the coding sequence in response to the presence or absence of one or more transcriptional regulatory factors. A transcriptional regulatory sequence is generally operatively linked in cis with a coding sequence, but need not be directly adjacent to it. For example, an enhancer is a transcriptional regulatory sequence that is operatively linked to a coding sequence, even though they are not contiguous.
[0084] As used herein, the term “promoter”, generally refers to a regulatory region of DNA capable of initiating, directing and mediating the transcription of a nucleic acid sequence. Promoters may additionally comprise recognition sequences, such as upstream or downstream promoter or enhancer elements, which may influence the transcription rate.
[0085] “Tissue non-specific promoters” are also called “constitutive” or “ubiquitous” promoters, meaning that they are always active, independent from the cell type or tissue or developmental timing. It is however conceivable that they are specifically engineered to be repressed in an experimental setting. Furthermore, their strength of expression is not necessarily equal in all cell types, and it is conceivable that in some cases exhibit less or no expression in a specific minority of cell types.
[0086] As used herein, the term “stably expressed” means that expression levels of a gene do not change considerably over time or between passages or generations of a host cell culture. It means for example that the locus of gene integration is not silenced over time and that the locus is not rearranged in a way that interferes with gene expression or changes gene expression levels.
[0087] As used herein the term “passages” or “passaging” refers to the procedure of harvesting cells from a culture, transferring the cells to one or more culture vessels with fresh growth medium, and using those cells to start new cultures. It is also referred to as subculturing or splitting cells. Passaging is usually done when cells have grown to exceed the capacity of the medium to support further growth, i.e. when there is no further room for expansion. Cells are usually passaged just before they reach confluency, while they are in a log growth phase.
[0088] As used herein, the term “generation” or “generation time” refers to the time it takes for a cell population to double in numbers. The generation time is equivalent to the average length of the cell cycle.
[0089] The term “recombination target site” or “recombinase recognition site” refers to pairs of defined sequences that a suitable for site-specific recombination, wherein genetic recombination occurs between segments of DNA with specific sequences with the help of a recombinase. During this process, DNA strand exchange occurs between two doublestranded DNA molecules. Examples are the FLP-FRT system, Cre-Lox system and attP / AttB system. The recombinase recognition sites are preferably mutually incompatible, in order to enable directional and specific recombination.
[0090] As used here, the term “guide sequence” refers to a nucleic acid sequence corresponding to that of a guide RNA for nuclease-mediated editing (e.g., with an RNA-guided nuclease). The terms “guide RNA” and “gRNA” and “single guide RNA” or “sgRNA” refer to any nucleic acid that promotes the specific association (or “targeting”) of an RNA-guided nuclease such as Cas9 or Cpfl to a target sequence such as a genomic or episomal sequence in a cell. gRNAs can be unimolecular (comprising a single RNA molecule, and referred to alternatively as sgRNA), or modular (comprising more than one, and typically two, separate RNA molecules, such as a crRNA and a tracrRNA, which are usually associated with one another, for instance by duplexing). Guide RNAs, whether unimolecular or modular, include a “guide sequence” that is fully or partially complementary to a sequence within a target, such as a DNA sequence in the genome of a cell where editing is desired. Guide sequences are referred to by various names in the literature, including without limitation “targeting domain”, “complementarity regions” (e.g., WO 2016 / 073990 by Cotta-Ramusino et al.), “spacers” (e.g., Briner et al., Molecular Cell 56(2), 333-339, October 23, 2014) and generically as “crRNAs” (e.g., Jiang et al. Nat BiotechnoL 2013 Mar; 31(3): 233-239). Irrespective of the names they are given, guide sequences are typically about 10 to 30 nucleotides in length. In some embodiments, a guide sequence is 15 to 25 nucleotides in length. In certain embodiments, a guide sequence is 16 to 24 nucleotides in length (for instance, 16, 17, 18, 19, 20, 21, 22, 23 or 24 nucleotides in length). In some embodiments, a guide sequence is at or near the 5’ terminus of a gRNA (e.g., with Cas9 or a nuclease derived or obtained therefrom). In some embodiments, a guide sequence is at or near the 3’ terminus of a gRNA (e.g., with Cpfl or a nuclease derived or obtained therefrom).
[0091] As used herein, the term “RNA-guided nuclease” refers to a polypeptide that binds to a particular target nucleotide sequence in a sequence-specific manner and is directed to the target nucleotide sequence by a guide RNA molecule that is complexed with the polypeptide and hybridizes with the target sequence. Although an RNA-guided nuclease can be capable of cleaving the target sequence upon binding, the term RNA-guided nuclease also encompasses nuclease-dead RNA-guided nucleases that are capable of binding to, but not cleaving, a target sequence. Cleavage of a target sequence by an RNA-guided nuclease can result in a single- or double -stranded break. RNA-guided nucleases only capable of cleaving a single strand of a double-stranded nucleic acid molecule are referred to herein as nickases. In some embodiments, an RNA-guided nuclease is or is derived from Cas9, Cas Z, Cpfl, and / or Fokl.
[0092] “Recombination” refers to a process of exchange of genetic information between two polynucleotides. For the purposes of this disclosure, “homologous recombination (HR)” refers to the specialized form of such exchange that takes place, for example, during repair of double-strand breaks in cells. Homologous recombination is a type of genetic recombination in which genetic information is exchanged between two similar or identical molecules of double-stranded or single-stranded nucleic acids. Homologous recombination is widely used by cells to accurately repair harmful DNA breaks that occur on both strands of DNA, known as double-strand breaks (DSB), in a process called homologous recombinational repair (HRR).
[0093] This process requires nucleotide sequence homology, uses a “donor” molecule to template repair of a “target” molecule (i.e., the one that experienced the double-strand break), and is variously known as “non-crossover gene conversion” or “short tract gene conversion,” because it leads to the transfer of genetic information from the donor to the target. Without wishing to be bound by any particular theory, such transfer can involve mismatch correction of heteroduplex DNA that forms between the broken target and the donor, and / or “synthesis-dependent strand annealing,” in which the donor is used to resynthesize genetic information that will become part of the target, and / or related processes. In this context, “homologous” sequences are nucleic acid sequences that are identical or so similar that they can form double strands.
[0094] “Cleavage” refers to the breakage of the covalent backbone of a DNA molecule. Cleavage can be initiated by a variety of methods including, but not limited to, enzymatic or chemical hydrolysis of a phosphodiester bond. Both single-stranded cleavage and double-stranded cleavage are possible, and double-stranded cleavage can occur as a result of two distinct single-stranded cleavage events. DNA cleavage can result in the production of either blunt ends or staggered ends. In certain embodiments, fusion polypeptides are used for targeted double-stranded DNA cleavage.
[0095] As used herein, the terms “transformation” or “transfection” refer to any process by which exogenous DNA is introduced into a host cell (e.g. a mammalian host cell). Transformation may occur under natural or artificial conditions using various methods well known in the art. Transformation may rely on any known method for the insertion of foreign nucleic acid sequences into a prokaryotic or eukaryotic host cell. In some embodiments, a particular transformation methodology is selected based on the host cell being transformed and may include, but is not limited to, viral infection or transduction, electroporation, lipofection. In some embodiments, a "transformed" cell is stably transformed in that the inserted DNA is capable of replication either as an autonomously replicating plasmid or as part of the host chromosome. In some embodiments, a transformed cell transiently expresses introduced nucleic acid for limited periods of time.
[0096] In the context of the present invention, the term "host cell", hereinafter also called "recipient cell", refers to a cell harboring an exogenous nucleotide sequence, preferably stably integrated, in its genome. In the context of the present invention, the term "cell" preferably means cell of a cell line. Preferably, the term "cell line" refers to established immortalized cell lines.
[0097] Integration Site
[0098] Genomic safe harbour (GSH) sites can accommodate the integration of new genetic material in a manner that ensures that the inserted genetic elements function predictably and do not cause alterations to the host genome, i.e. alterations in endogenous gene expression and / or gene regulation. The present work provides for the first time methods and host cells using a novel site-specific integration (SSI) site downstream of the beta-actin (ACTB) gene locus as a GSH for recombinant protein expression. The methods and host cells of the invention are especially suitable for the production of high titers of genes of interest such as commercial or therapeutic proteins. The invention provides a method for producing a protein of interest in an isolated host cell, the method comprising
[0099] (i) providing an isolated host cell comprising an endogenous beta Actin (ACTB) gene locus;
[0100] (ii) integrating a recombinant gene expression cassette downstream of the stop codon of the ACTB gene, wherein the recombinant gene expression cassette comprises a nucleic acid sequence encoding at least one protein of interest; and
[0101] (iii) culturing the isolated host cell under conditions allowing expression of the protein of interest.
[0102] The integration site should be located between the stop codon of ACTB and the 5’ UTR of the next gene downstream from ACTB. Exemplarily, in the human genome, ACTB is located on chromosome 7 reverse strand. The 3’ UTR of ACTB comprises 599 bp and the start of the next gene, in human FBXL18 (F-Box And Leucine Rich Repeat Protein 18), is 13938 bp downstream of the stop codon of ACTB (Ensembl Human Genome Browser version 111, Human Genome assembly GRCh38.pl4). To ensure that expression of surrounding genes is not perturbed, the integration site should not be within an UTR or a protein coding sequence. Hence, in this example, the integration site should be at least 600 bp downstream of the stop codon of the ACTB gene and at most 13938 bp downstream of the stop codon of the ACTB gene. This rationale can be applied to any host cell line.
[0103] The inventors were able to show that the integration of a recombinant gene expression cassette downstream of ACTB provides stable expression and high expression levels of a transgene. Preferably, the integration site is located closer to the ACTB gene than to the next gene. Hence, in one embodiment, the integration site is between 600bp and 6000bp downstream of the stop codon of ACTB gene. In another embodiment, the integration site is between lOOObp and 6000bp downstream of the stop codon of ACTB gene. In one embodiment, the integration site is not in the 3’ UTR of ACTB.
[0104] In one embodiment, the recombinant gene expression cassette is integrated between 600 and 2000 bp, between 1000 and 2000 bp, or between 1500 and 2000 bp downstream of the stop codon of ACTB gene. In one particular embodiment, the recombinant gene expression cassette is integrated about 2000bp downstream of the stop codon of ACTB gene.
[0105] In another embodiment, the recombinant gene expression cassette is integrated between 1800 and 6000 bp, between 1800 and 5000 bp, between 1800 and 4000 bp, between 1800 and 3000 bp, or between 1800 and 2000bp downstream of the stop codon of ACTB gene.
[0106] In some cases, base pairs are deleted during the integration of the recombinant gene expression cassette. In one embodiment, at least 3 base pairs are deleted during integration of the recombinant gene expression cassette. In one embodiment, at least 6 base pairs, at least 9 base pairs, at least 12 base pairs, at least 15 base pairs, at least 18 base pairs, at least 21 base pairs, or at least 24 base pairs are deleted during integration of the recombinant gene expression cassette.
[0107] The integration site may be between the two homologous regions. Before integration of the recombinant gene expression cassette, the upstream homologous sequence may start at 1413 bp downstream of the ACTB stop codon (5’ end of the upstream homologous sequence) and the downstream homologous sequence may end at 2475 bp downstream of the ACTB stop codon (3’ end of the downstream homologous sequence). Hence, in one embodiment, the recombinant gene expression cassette is integrated between about 1413 bp and about 2475 bp downstream of the stop codon of ACTB gene.
[0108] In one embodiment, the recombinant gene expression cassette is integrated at about 1934bp downstream of the stop codon of ACTB gene.
[0109] In one embodiment, the recombinant gene expression cassette is integrated between about 1934bp and about 1958bp downstream of the stop codon of ACTB gene. In another embodiment, the recombinant gene expression cassette is integrated at least 600 bp, at least 800 bp, at least 1000 bp, at least 1500 bp, at least 2000 bp, at least 2500 bp, at least 3000 bp, at least 3500 bp, at least 4000 bp, at least 4500 bp, at least 5000 bp downstream of the stop codon of ACTB gene.
[0110] In another embodiment, the recombinant gene expression cassette is integrated at least 600 bp, at least 800 bp, at least 1000 bp, at least 1500 bp, at least 2000 bp, at least 2500 bp, at least 3000 bp, at least 3500 bp, at least 4000 bp, at least 4500 bp, or at least 5000 bp and at most 6000 bp downstream of the stop codon of ACTB gene.
[0111] In another embodiment, the recombinant gene expression cassette is integrated between 600 bp and 10000 bp, between 600 bp and 8000 bp, between 600 bp and 6000 bp, between 600 bp and 4000 bp, between 600 bp and 3000 bp, or between 600 bp and 2000 bp downstream of the stop codon of ACTB gene.
[0112] In another embodiment, the recombinant gene expression cassette is integrated between 1000 bp and 10000 bp, between 1000 bp and 8000 bp, between 1000 bp and 6000 bp, between 1000 bp and 4000 bp, between 1000 bp and 3000 bp, or between 1000 bp and 2000 bp downstream of the stop codon of ACTB gene.
[0113] The recombinant gene expression cassette may be integrated into the genome of the host cell using homologous recombination. To this end, nucleic acid sequences that are homologous to nucleic acid sequences at the target site may be used in the construct comprising the recombinant gene expression cassette. The homologous sequence may comprise any nucleic acid sequence of at least 50 contiguous nucleic acids from the nucleic acid sequences set forth in SEQ ID NO: 1 or SEQ ID NO: 2.
[0114] In one embodiment the recombinant gene expression cassette is integrated at or near a nucleic acid sequence at least 80% identical to SEQ ID NO: 1 or a nucleic acid sequence at least 80% identical to SEQ ID NO: 2. In one embodiment the recombinant gene expression cassette is integrated at or near a nucleic acid sequence at least 85% identical to SEQ ID NO: 1 or a nucleic acid sequence at least 85% identical to SEQ ID NO: 2. In one embodiment the recombinant gene expression cassette is integrated at or near a nucleic acid sequence at least 90% identical to SEQ ID NO: 1 or a nucleic acid sequence at least 90% identical to SEQ ID NO: 2. In one embodiment the recombinant gene expression cassette is integrated at or near a nucleic acid sequence at least 95% identical to SEQ ID NO: 1 or a nucleic acid sequence at least 95% identical to SEQ ID NO: 2. In one embodiment the recombinant gene expression cassette is integrated at or near a nucleic acid sequence at least 98% identical to SEQ ID NO: 1 or a nucleic acid sequence at least 98% identical to SEQ ID NO: 2. In one embodiment the recombinant gene expression cassette is integrated at or near a nucleic acid sequence identical to SEQ ID NO: 1 or a nucleic acid sequence identical to SEQ ID NO: 2.
[0115] In one embodiment the recombinant gene expression cassette is integrated between a nucleic acid sequence at least 80% identical to SEQ ID NO: 1 or a nucleic acid sequence at least 80% identical to SEQ ID NO: 2. In one embodiment the recombinant gene expression cassette is integrated between a nucleic acid sequence at least 85% identical to SEQ ID NO: 1 or a nucleic acid sequence at least 85% identical to SEQ ID NO: 2. In one embodiment the recombinant gene expression cassette is integrated between a nucleic acid sequence at least 90% identical to SEQ ID NO: 1 or a nucleic acid sequence at least 90% identical to SEQ ID NO: 2. In one embodiment the recombinant gene expression cassette is integrated between a nucleic acid sequence at least 95% identical to SEQ ID NO: 1 or a nucleic acid sequence at least 95% identical to SEQ ID NO: 2. In one embodiment the recombinant gene expression cassette is integrated between a nucleic acid sequence at least 98% identical to SEQ ID NO: 1 or a nucleic acid sequence at least 98% identical to SEQ ID NO: 2. In one embodiment the recombinant gene expression cassette is integrated between a nucleic acid sequence identical to SEQ ID NO: 1 or a nucleic acid sequence identical to SEQ ID NO: 2.
[0116] Hence, one embodiment, the method for producing a protein of interest in an isolated host cell comprises the steps of: (i) providing an isolated host cell comprising an endogenous beta Actin (ACTB) gene locus;
[0117] (ii) integrating a recombinant gene expression cassette between 600bp and 6000bp downstream of the stop codon of ACTB gene e, wherein the recombinant gene expression cassette comprises a nucleic acid sequence encoding at least one protein of interest;
[0118] (iii) culturing the isolated host cell under conditions allowing expression of the protein of interest; and optionally
[0119] (iv) harvesting the protein of interest from the isolated host cell and / or supernatant.
[0120] In another embodiment, the method for producing a protein of interest in an isolated host cell comprises the steps of:
[0121] (i) providing an isolated host cell comprising an endogenous beta Actin (ACTB) gene locus;
[0122] (ii) integrating a recombinant gene expression cassette between 600bp and 3000bp downstream of the stop codon of ACTB gene e, wherein the recombinant gene expression cassette comprises a nucleic acid sequence encoding at least one protein of interest;
[0123] (iii) culturing the isolated host cell under conditions allowing expression of the protein of interest; and optionally
[0124] (iv) harvesting the protein of interest from the isolated host cell and / or supernatant.
[0125] Hence, one embodiment, the method for producing a protein of interest in an isolated host cell comprises the steps of:
[0126] (i) providing an isolated host cell comprising an endogenous beta Actin (ACTB) gene locus; (ii) integrating a recombinant gene expression cassette between lOOObp and 6000bp downstream of the stop codon of ACTB gene e, wherein the recombinant gene expression cassette comprises a nucleic acid sequence encoding at least one protein of interest;
[0127] (iii) culturing the isolated host cell under conditions allowing expression of the protein of interest; and optionally
[0128] (iv) harvesting the protein of interest from the isolated host cell and / or supernatant.
[0129] In another embodiment, the method for producing a protein of interest in an isolated host cell comprises the steps of:
[0130] (i) providing an isolated host cell comprising an endogenous beta Actin (ACTB) gene locus;
[0131] (ii) integrating a recombinant gene expression cassette between lOOObp and 3000bp downstream of the stop codon of ACTB gene e, wherein the recombinant gene expression cassette comprises a nucleic acid sequence encoding at least one protein of interest;
[0132] (iii) culturing the isolated host cell under conditions allowing expression of the protein of interest; and optionally
[0133] (iv) harvesting the protein of interest from the isolated host cell and / or supernatant.
[0134] Regulatory Element
[0135] In one embodiment, the recombinant gene expression cassette further comprises a nucleic acid sequence encoding a regulatory sequence operatively linked to the nucleic acid sequence encoding the at least one protein of interest.
[0136] Hence, one embodiment, the method for producing a protein of interest in an isolated host cell comprises the steps of: (i) providing an isolated host cell comprising an endogenous beta Actin (ACTB) gene locus;
[0137] (ii) integrating a recombinant gene expression cassette between 600bp and 6000bp downstream of the stop codon of the ACTB gene, wherein the recombinant gene expression cassette comprises a nucleic acid sequence encoding at least one protein of interest and a nucleic acid sequence encoding a regulatory sequence operatively linked to the nucleic acid sequence encoding the at least one protein of interest; and
[0138] (iii) culturing the isolated host cell under conditions allowing expression of the protein of interest; and optionally
[0139] (iv) harvesting the protein of interest from the isolated host cell and / or supernatant.
[0140] In one embodiment, the regulatory sequence is a promoter, preferably a tissue non-specific promoter.
[0141] In one embodiment, the method for producing a protein of interest in an isolated host cell comprises the steps of:
[0142] (i) providing an isolated host cell comprising an endogenous beta Actin (ACTB) gene locus;
[0143] (ii) integrating a recombinant gene expression cassette between lOOObp and 6000bp downstream of the stop codon of the ACTB gene, wherein the recombinant gene expression cassette comprises a nucleic acid sequence encoding at least one protein of interest and a nucleic acid sequence encoding a regulatory sequence operatively linked to the nucleic acid sequence encoding the at least one protein of interest; and
[0144] (iii) culturing the isolated host cell under conditions allowing expression of the protein of interest; and optionally
[0145] (iv) harvesting the protein of interest from the isolated host cell and / or supernatant. In one embodiment, the regulatory sequence is a promoter, preferably a tissue non-specific promoter.
[0146] A tissue non-specific promoter is a constitutively active promoter. Tissue non-specific promoters are usually derived from the regulatory regions of constitutively active genes, so- called housekeeping genes. Examples of tissue non-specific promoters include CAG (CMV early enhancer / chicken ft -Actin), CBA (chicken ft -Actin), CMV (Cytomegalovirus promoter), HBA (human ft -Actin), UBC (Ubiquitin C promoter), EFl a (elongation factor 1 a promoter), PGK (phosphoglycerate kinase promoter), SV40 (simian virus 40 promoter), TRE (tetracycline operator response element) and TET (tetracycline-inducible promoter). Hence, in one embodiment, the regulatory sequence is a promoter, preferably selected from the group consisting of CAG, CBA, CMV, HBA, UBC, EFl a , PGK, SV40, TRE and TET.
[0147] Hence, one embodiment, the method for producing a protein of interest in an isolated host cell comprises the steps of:
[0148] (i) providing an isolated host cell comprising an endogenous beta Actin (ACTB) gene locus;
[0149] (ii) integrating a recombinant gene expression cassette between 600bp and 6000bp downstream of the stop codon of the ACTB gene, wherein the recombinant gene expression cassette comprises a nucleic acid sequence encoding at least one protein of interest and a nucleic acid sequence encoding a tissue non-specific promoter operatively linked to the nucleic acid sequence encoding the at least one protein of interest; and
[0150] (iii) culturing the isolated host cell under conditions allowing expression of the protein of interest; and optionally
[0151] (iv) harvesting the protein of interest from the isolated host cell and / or supernatant. Hence, one embodiment, the method for producing a protein of interest in an isolated host cell comprises the steps of:
[0152] (i) providing an isolated host cell comprising an endogenous beta Actin (ACTB) gene locus;
[0153] (ii) integrating a recombinant gene expression cassette between 600bp and 6000bp downstream of the stop codon of the ACTB gene, wherein the recombinant gene expression cassette comprises a nucleic acid sequence encoding at least one protein of interest and a nucleic acid sequence encoding a promoter selected from the group consisting of CAG, CBA, CMV, HBA, UBC, EFl a , PGK, SV40, TRE and TET operatively linked to the nucleic acid sequence encoding the at least one protein of interest; and
[0154] (iii) culturing the isolated host cell under conditions allowing expression of the protein of interest; and optionally
[0155] (iv) harvesting the protein of interest from the isolated host cell and / or supernatant.
[0156] In one embodiment, the method for producing a protein of interest in an isolated host cell comprises the steps of:
[0157] (i) providing an isolated host cell comprising an endogenous beta Actin (ACTB) gene locus;
[0158] (ii) integrating a recombinant gene expression cassette between lOOObp and 6000bp downstream of the stop codon of the ACTB gene, wherein the recombinant gene expression cassette comprises a nucleic acid sequence encoding at least one protein of interest and a nucleic acid sequence encoding a tissue non-specific promoter operatively linked to the nucleic acid sequence encoding the at least one protein of interest; and (iii) culturing the isolated host cell under conditions allowing expression of the protein of interest; and optionally
[0159] (iv) harvesting the protein of interest from the isolated host cell and / or supernatant.
[0160] Hence, one embodiment, the method for producing a protein of interest in an isolated host cell comprises the steps of:
[0161] (i) providing an isolated host cell comprising an endogenous beta Actin (ACTB) gene locus;
[0162] (ii) integrating a recombinant gene expression cassette between lOOObp and 6000bp downstream of the stop codon of the ACTB gene, wherein the recombinant gene expression cassette comprises a nucleic acid sequence encoding at least one protein of interest and a nucleic acid sequence encoding a promoter selected from the group consisting of CAG, CBA, CMV, HBA, UBC, EFl a , PGK, SV40, TRE and TET operatively linked to the nucleic acid sequence encoding the at least one protein of interest; and
[0163] (iii) culturing the isolated host cell under conditions allowing expression of the protein of interest; and optionally
[0164] (iv) harvesting the protein of interest from the isolated host cell and / or supernatant.
[0165] Protein Expression
[0166] In one embodiment, the protein of interest is stably expressed over at least 2 passages. In another embodiment, the protein of interest is stably expressed over at least 5, at least 10, at least 15, at at least 20, at least 25, at least 30, at least 40, or at least 50 passages.
[0167] In one embodiment, the protein of interest is stably expressed over at least 2 host cell generations. In another embodiment, the protein of interest is stably expressed over at least 2, at least 4, at least 6, at least 8, at least 10, at least 15, at least 20, at least 30, at least 40, or at least 50 host cell generations.
[0168] In one embodiment, the protein of interest comprises one or more of a selection marker, a detectable protein, an antibody, a peptide antigen, an enzyme, a hormone, a growth factor, a receptor, a fusion protein, a therapeutic protein or other biologically active protein.
[0169] In one particular embodiment, the protein of interest is a therapeutic protein.
[0170] The integration of the recombinant gene expression cassette can be achieved by any gene editing method known to the skilled person. In one embodiment, the recombinant gene expression cassette is integrated using an integration technique that comprises inducing double strand breaks at the target site. In one embodiment, the integration uses an integration technique selected from the group consisting of Zinc Finger Nucleases (ZFNs), Transcription activator-like effector nucleases (TALENs), or CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats).
[0171] Preferably, the recombinant gene expression cassette is integrated using a CRISPR-based technique. In one embodiment, the recombinant gene expression cassette is integrated using CRISPR / Cas9.
[0172] In one embodiment, step (ii) of the method further comprises selecting an isolated host cell with a single site specific integration of the recombinant gene expression cassette, preferably wherein the isolated host cell does not have additional integration of the recombinant gene expression cassette.
[0173] In one embodiment, the recombinant gene expression cassette further comprises a selection marker. A selection marker may be an antibiotic resistance gene, an enzyme or a fluorescent protein. The selection marker may be an antibiotic resistance gene such as hygromycin, neomycine, puromycine or zeocin, an enzyme such as [3-galactosidase or luciferase, or a fluorescent protein such as GFP, RFP, YFP, CFP, mCherry, dsRed, or other derivatives thereof. In one embodiment, the recombinant gene expression cassette further comprises at least two recombinase recognition sites .
[0174] In one embodiment, the at least two recombinase recognition sites are from the FLP-FRT system, Cre-Lox system or attP / AttB system. In one embodiment, the at least two recombinase recognition sites are mutually incompatible. In one embodiment, the at least two recombinase recognition sites are selected from the group consisting of F3, FRT, F5, FRT, attB, attP, loxP , Iox2272, loxP66, oxP71, loxP and loxP511. In one embodiment, the recombinase recognition sites are mutually incompatible pairs selected from the group consisting of F3 / FRT, F5 / FRT, attB / attP, loxP / lox2272, loxP66 / loxP71, and loxP / loxP511.
[0175] Host Cells
[0176] The invention also provides a method of producing a stable host cell line with a site specific integration, comprising
[0177] (i) providing an isolated host cell comprising an endogenous beta Actin (ACTB) gene locus;
[0178] (ii) integrating a recombinant gene expression cassette between 600 bp and 6000 bp downstream of the stop codon of the ACTB gene; and
[0179] (iii) culturing the isolated host cell under conditions allowing the selection of an isolated host cell with the correct site specific integration; and
[0180] (iv) expanding the selected isolated host cell into a stable host cell line.
[0181] In one embodiment, the method of producing a stable host cell line with a site specific integration, comprises
[0182] (i) providing an isolated host cell comprising an endogenous beta Actin (ACTB) gene locus; (ii) integrating a recombinant gene expression cassette between 1000 bp and 6000 bp downstream of the stop codon of the ACTB gene; and
[0183] (iii) culturing the isolated host cell under conditions allowing the selection of an isolated host cell with the correct site specific integration; and
[0184] (iv) expanding the selected isolated host cell into a stable host cell line.
[0185] In one embodiment, the host cell is a mammalian cell. In one embodiment, the host cell is a recombinant mammalian cell. In one embodiment, the host cell is a recombinant human cell. In one embodiment, the host cell is an isolated host cell.
[0186] Any suitable host cell known in the art can be engineered in the context of the present disclosure. In one embodiment, the host cell is a human cell. Representative host cell types include, but are not limited to, human embryonic kidney (HEK) cells (e.g., HEK 293 cells, HEK 293T cells, Expi293 cells), Chinese hamster ovary (CHO) cells, HeLa cells (e.g., HeLa S3 cells), PER.C6 cells, HKB1 1 cells, CAP® cells, Baby Hamster Kidney fibroblasts (BHK cells) (e.g., BHK-21 cells), mouse myeloma cells (e.g., Sp2 / 0 cells and NSC cells), green African monkey kidney cells (e.g., COS cells and Vero cells), A549 cells, rhesus fetal lung cells (e.g., FRhL-2 cells), and any derivatives thereof.
[0187] In some certain embodiments, the host cell is a CHO cells. CHO cells have different lineages, including CHO-K1, CHO-S, CHO-DG44, and CHO-DXB1 1. In some certain embodiments, the host cell is a HEK 293 cell. In some the host cell is a HEK 293 T cell. In some embodiments, the host cell is a HeLa cell.
[0188] In some embodiments, the host cell of the present disclosure is suitable for adherent cell culture. In some embodiments, the host cell is cultured in an adherent cell culture medium. In some embodiments, the host cell can be grown under serum-free conditions. In some embodiments, the host cell of the present disclosure is suitable for suspension cell culture. In some embodiments, the host cell suitable for suspension cell culture is a CHO cell (e.g, CH0-K1, CHO-S, CHO-DG44, and / or CHO-DXB11 cells), HEK 293 cell (e.g., 293 SF, 3F6, 293T), HeLa cell, and derivatives thereof. In some embodiments, the host cell can be cultured in suspension under serum-free conditions. In some embodiments, HEK293 cells have the ability to grow in suspension under serum-free conditions.
[0189] In some embodiments, the host cell is cultured in suspension cell culture. In some embodiments, the host cell for suspension cell culture as suitable for culturing in large quantities (e.g., > 1 L capacity, > 2 L capacity, > 3 L capacity, > 4 L capacity, > 5 L capacity, > 10 L capacity, > 20 L capacity, > 30 L capacity, > 40 L capacity, > 50 L capacity, > 60 L capacity, > 70 L capacity, > 80 L capacity, > 90 L capacity, > 100 L capacity, > 200 L capacity, > 300 L capacity, > 400 L capacity, or > 500 L capacity).
[0190] In some embodiments, the host cell of the present disclosure is suitable for manufacturing of biologies (e.g., viral vectors). In some embodiments, the host cell is suitable for use in industrial-scale manufacturing of a biologic product. In some embodiments, the host cell is suitable for use in a method of manufacture that conforms with local regulatory standards (e.g., FDA and / or EMA regulatory standards). In some embodiments, the host cell is suitable for manufacturing of biologies (e.g., viral vectors) using current good manufacturing practices (cGMP). In some embodiments, the host cell is suitable for manufacturing of biologies (e.g., viral vectors) using good manufacturing practices (GMP). In some embodiments, the host cell is suitable for manufacturing of biologies (e.g., viral vectors) using non-good manufacturing practices (non-GMP).
[0191] In one embodiment, the host cell line is a human host cell line. In a particular embodiment, the host cell line is selected from the group consisting of CAP®, CHO, HeLa, iPSC, K562, HEK293, HT-1080, BHK and Vero.
[0192] CAP® (CEVEC’s Amniocyte Production) is particularly suited for the methods and uses described herein. CAP® cells are an immortalised human amniocyte suspension cell line for industrial-scale production of polypeptides for gene therapy applications. CAP® cells can be grown in all formats and all sizes of bioreactors.
[0193] Hence, in a preferred embodiment, the host cell line is a CAP® cell line or a cell line derived from CAP®.
[0194] Hence, in one embodiment, the method for producing a protein of interest in an isolated CAP® cell comprises the steps of:
[0195] (i) providing an isolated CAP® cell comprising an endogenous beta Actin (ACTB) gene locus;
[0196] (ii) integrating a recombinant gene expression cassette between 600bp and 6000bp downstream of the stop codon of the ACTB gene, wherein the recombinant gene expression cassette comprises a nucleic acid sequence encoding at least one protein of; and
[0197] (iii) culturing the isolated host cell under conditions allowing expression of the protein of interest; and optionally
[0198] (iv) harvesting the protein of interest from the isolated CAP® cell and / or supernatant.
[0199] In another embodiment, the method for producing a protein of interest in an isolated CAP® cell comprises the steps of:
[0200] (i) providing an isolated CAP® cell comprising an endogenous beta Actin (ACTB) gene locus;
[0201] (ii) integrating a recombinant gene expression cassette between 600bp and 6000bp downstream of the stop codon of the ACTB gene, wherein the recombinant gene expression cassette comprises a nucleic acid sequence encoding at least one protein of interest and a nucleic acid sequence encoding a promoter selected from the group consisting of CAG, CBA, CMV, HBA, UBC, EFl a , PGK, SV40, TRE and TET operatively linked to the nucleic acid sequence encoding the at least one protein of interest; and (iii) culturing the isolated host cell under conditions allowing expression of the protein of interest; and optionally
[0202] (iv) harvesting the protein of interest from the isolated CAP® cell and / or supernatant.
[0203] In one embodiment, the method for producing a protein of interest in an isolated CAP® cell comprises the steps of:
[0204] (i) providing an isolated CAP® cell comprising an endogenous beta Actin (ACTB) gene locus;
[0205] (ii) integrating a recombinant gene expression cassette between 600 bp and 3000 bp downstream of the stop codon of the ACTB gene, wherein the recombinant gene expression cassette comprises a nucleic acid sequence encoding at least one protein of interest and a nucleic acid sequence encoding a promoter selected from the group consisting of CAG, CBA, CMV, HBA, UBC, EFl a , PGK, SV40, TRE and TET operatively linked to the nucleic acid sequence encoding the at least one protein of interest; and
[0206] (iii) culturing the isolated CAP® cell under conditions allowing expression of the protein of interest; and optionally
[0207] (iv) harvesting the protein of interest from the isolated CAP® cell and / or supernatant.
[0208] The invention also provides a method of producing a stable CAP® cell line with a site specific integration, comprising
[0209] (i) providing an isolated CAP® cell comprising an endogenous beta Actin (ACTB) gene locus;
[0210] (ii) integrating a recombinant gene expression cassette between 600 bp and 6000 bp downstream of the stop codon of the ACTB gene; and (iii) culturing the isolated CAP® cell under conditions allowing the selection of an isolated CAP® cell with the correct site specific integration; and
[0211] (iv) expanding the selected isolated CAP® into a stable CAP® cell line.
[0212] The invention also provides a method of producing a stable CAP® cell line with a site specific integration, comprising
[0213] (i) providing an isolated CAP® cell comprising an endogenous beta Actin (ACTB) gene locus;
[0214] (ii) integrating a recombinant gene expression cassette between 600 bp and 3000 bp downstream of the stop codon of the ACTB gene; and
[0215] (iii) culturing the isolated CAP® cell under conditions allowing the selection of an isolated CAP® cell with the correct site specific integration; and
[0216] (iv) expanding the selected isolated CAP® into a stable CAP® cell line.
[0217] In another embodiment, the method for producing a protein of interest in an isolated CAP® cell comprises the steps of:
[0218] (i) providing an isolated CAP® cell comprising an endogenous beta Actin (ACTB) gene locus;
[0219] (ii) integrating a recombinant gene expression cassette between lOOObp and 6000bp downstream of the stop codon of the ACTB gene, wherein the recombinant gene expression cassette comprises a nucleic acid sequence encoding at least one protein of interest and a nucleic acid sequence encoding a promoter selected from the group consisting of CAG, CBA, CMV, HBA, UBC, EFl a , PGK, SV40, TRE and TET operatively linked to the nucleic acid sequence encoding the at least one protein of interest; and (iii) culturing the isolated host cell under conditions allowing expression of the protein of interest; and optionally
[0220] (iv) harvesting the protein of interest from the isolated CAP® cell and / or supernatant.
[0221] In one embodiment, the method for producing a protein of interest in an isolated CAP® cell comprises the steps of:
[0222] (i) providing an isolated CAP® cell comprising an endogenous beta Actin (ACTB) gene locus;
[0223] (ii) integrating a recombinant gene expression cassette between 1000 bp and 3000 bp downstream of the stop codon of the ACTB gene, wherein the recombinant gene expression cassette comprises a nucleic acid sequence encoding at least one protein of interest and a nucleic acid sequence encoding a promoter selected from the group consisting of CAG, CBA, CMV, HBA, UBC, EFl a , PGK, SV40, TRE and TET operatively linked to the nucleic acid sequence encoding the at least one protein of interest; and
[0224] (iii) culturing the isolated CAP® cell under conditions allowing expression of the protein of interest; and optionally
[0225] (iv) harvesting the protein of interest from the isolated CAP® cell and / or supernatant.
[0226] The invention also provides a method of producing a stable CAP® cell line with a site specific integration, comprising
[0227] (i) providing an isolated CAP® cell comprising an endogenous beta Actin (ACTB) gene locus;
[0228] (ii) integrating a recombinant gene expression cassette between 1000 bp and 6000 bp downstream of the stop codon of the ACTB gene; and (iii) culturing the isolated CAP® cell under conditions allowing the selection of an isolated CAP® cell with the correct site specific integration; and
[0229] (iv) expanding the selected isolated CAP® into a stable CAP® cell line.
[0230] Further Embodiments
[0231] The invention is also described by the following items:
[0232] 1. A method for producing a protein of interest in an isolated host cell, the method comprising
[0233] (i) providing an isolated host cell comprising an endogenous beta Actin (ACTB) gene locus;
[0234] (ii) integrating a recombinant gene expression cassette downstream of the stop codon of the ACTB gene, wherein the recombinant gene expression cassette comprises a nucleic acid sequence encoding at least one protein of interest; and
[0235] (iii) culturing the isolated host cell under conditions allowing expression of the protein of interest.
[0236] 2. Method of item 1, wherein the recombinant gene expression cassette is integrated between the end of the 3’ UTR of ACTB and the start of the 5’ UTR of the next gene located downstream of ACTB.
[0237] 3. Method of any one of items 1 or 2, further comprising
[0238] (iv) harvesting the protein of interest from the isolated host cell and / or supernatant.
[0239] 4. Method of any one of the preceding items, wherein the recombinant gene expression cassette further comprises a nucleic acid sequence encoding a regulatory sequence operatively linked to the nucleic acid sequence encoding the at least one protein of interest.
[0240] 5. Method of any one of the preceding items, wherein the protein of interest is stably expressed over at least 5 passages.
[0241] 6. Method of any one of the preceding items, wherein the protein of interest is stably expressed over at least 2 host cell generations, optionally wherein a host cell generation comprises doubling of the host cells.
[0242] 7. Method of any one of the preceding items, wherein the protein of interest comprises one or more of a selection marker, a detectable protein, an antibody, a peptide antigen, an enzyme, a hormone, a growth factor, a receptor, a fusion protein a therapeutic protein or other biologically active protein.
[0243] 8. Method of any one of the preceding items, wherein the protein of interest is a therapeutic protein.
[0244] 9. Method of any one of the preceding items, wherein the recombinant gene expression cassette is integrated using an integration technique that comprises inducing double strand breaks at the target site.
[0245] 10. Method of any one of the preceding items, wherein the recombinant gene expression cassette is integrated at or near a nucleic acid sequence at least 80% identical to SEQ ID NO: 1 or a nucleic acid sequence at least 80% identical to SEQ ID NO: 2, optionally wherein the recombinant gene expression cassette is integrated between a nucleic acid sequence at least 80% identical to SEQ ID NO: 1 or a nucleic acid sequence at least 80% identical to SEQ ID NO: 2.
[0246] 11. Method of any one of the preceding items, wherein step (ii) further comprises selecting an isolated host cell with a single site specific integration of the recombinant gene expression cassette, preferably wherein the isolated host cell does not have additional integration of the recombinant gene expression cassette.
[0247] 12. Method of any one of the preceding items, wherein the recombinant gene expression cassette further comprises a selection marker.
[0248] 13. Method of any one of the preceding items, wherein the recombinant gene expression cassette further comprises at least two recombinase recognition sites.
[0249] 14. Method of any one of the preceding items, wherein the isolated host cell is a human cell, or is selected from the group consisting of CAP®, CHO, HeLa, iPSC, K562, HEK293, HT- 1080, BHK and Vero, preferably wherein the isolated host cell is a CAP® cell.
[0250] 15. Method of producing a stable host cell line with a site specific integration, comprising
[0251] (i) providing an isolated host cell comprising an endogenous beta Actin (ACTB) gene locus;
[0252] (ii) integrating a recombinant gene expression cassette between 500 bp and 3000 bp downstream of the stop codon of the ACTB gene; and
[0253] (iii) culturing the isolated host cell under conditions allowing the selection of an isolated host cell with the correct site specific integration; and
[0254] (iv) expanding the selected isolated host cell into a stable host cell line.
[0255] 16. Method of item 15, wherein the recombinant gene expression cassette is integrated using CRISPR / Cas9.
[0256] 17. Method of any one of items 15 or 16, wherein the recombinant gene expression cassette is integrated between a nucleic acid sequence at least 80% identical to SEQ ID NO: 1 and a nucleic acid sequence at least 80% identical to SEQ ID NO: 2. 18. Method of any one of items 15 to 17, wherein step (ii) further comprises selecting an isolated host cell with a single site specific integration of the recombinant gene expression cassette, preferably wherein the isolated host cell does not have additional integration of the recombinant gene expression cassette.
[0257] 19. Method of any one of items 15 to 18, wherein the recombinant gene expression cassette further comprises a selection marker.
[0258] 20. Method of any one of items 15 to 19, wherein the recombinant gene expression cassette further comprises at least two recombinase recognition sites.
[0259] 21. Method of any one of items 15 to 20, wherein the host cell line a human host cell line, or is selected from the group consisting of CAP®, CHO, HeLa, iPSC, K562, HEK293, HT- 1080, BHK and Vero, preferably wherein the host cell line is CAP® cell line.
[0260] 22. Method of any one items 15 to 21, wherein the recombinant gene expression cassette further comprises at least two recombinase recognition sites.
[0261] 23. An isolated site-specific integration host cell comprising an endogenous beta Actin (ACTB) gene locus produced by the method provided in any one of items 1 to 22.
[0262] 24. An isolated site-specific integration host cell comprising an endogenous beta Actin (ACTB) gene locus, wherein a recombinant gene expression cassette is integrated between 1000 bp and 3000 bp downstream of the stop codon of the ACTB gene.
[0263] 25. Isolated site-specific integration host cell of any one of items 23 or 24, wherein the host cell line is a human cell line, or is selected from the group consisting of CAP®, CHO, HeLa, iPSC, K562, HEK293, HT-1080, BHK and Vero, preferably wherein the host cell line is CAP® cell line.
[0264] 26. Use of the isolated host cell of any one of items 23 to 25 for the production of a protein of interest. 27. Use of an integration site between the end of the 3’ UTR of the ACTB gene and the start of the 5’ UTR of the next gene located downstream of the ACTB gene of an isolated host cell for the production of a protein of interest.
[0265] 28. Method of any one of items 1 to 22, isolated site-specific integration host cell of any one of items 23 to 25, or use of any one of claims 26 or 27, wherein the integration site is between lOOObp to 6000bp downstream of the stop codon of the ACTB gene.
[0266] 29. Method of any one of items 1 to 22, isolated site-specific integration host cell of any one of items 23 to 25, or use of any one of claims 26 or 27, wherein the integration site is between lOOObp to 3000bp downstream of the stop codon of the ACTB gene.
[0267] 30. Method of any one of items 1 to 22, isolated site-specific integration host cell of any one of items 23 to 25, or use of any one of claims 26 or 27, wherein the integration site is around 2000bp downstream of the stop codon of the ACTB gene.
[0268] 31. Method of any one of items 1 to 22, isolated site-specific integration host cell of any one of items 23 to 25, or use of any one of claims 26 or 27, wherein the integration site is around 1934 bp downstream of the stop codon of the ACTB gene.
[0269] Examples
[0270] Materials and Methods
[0271] Plasmid design and construction
[0272] The vector for targeted integration into the ACTB locus (pHDR_ACTB_eGFP) contained an expression cassette consisting of a CMV promoter, eGFP-T2A-NeoR, and a PGK-pA element. This 2.8 kb expression cassette was flanked by two ~ 0.5 kb long sequences homologous to the region 0.8 kb to 2 kb downstream of the ACTB locus. The integration site was 1934 bp downstream of the ACTB stop codon. In this case, the insertion leads to the deletion of 24 bp. This means that the 5' end of the 3' homology arm is located at position 1958 bp 3' of the stop-codon.
[0273] The homologous sequences upstream of the integration site is depicted in SEQ ID NO: 1, the downstream homologous region is depicted in SEQ ID NO: 2. The integration site is between the two homologous regions. Before integration of the recombinant gene expression cassette, the upstream homologous sequence starts at 1413 bp downstream of the ACTB stop codon (5’ end of the upstream homologous sequence) and the downstream homologous sequence ends at 2475 bp downstream of the ACTB stop codon (3’ end of the downstream homologous sequence).
[0274] The complete expression cassette flanked by homoglous sequences is depicted in SEQ ID NO: 3 (for EGFP expression ) and SEQ ID NO: 4 (for CIIN expression). The entire integration cassette was flanked with two sgRNA recognition sites as described by
[0017] , The sequence of the sgRNA recognition site in the vector was the same as in the ACTB locus used for targeting. This allowed for Cas9-mediated in vivo excision of the integration cassette parallel to the genomic double-strand break. The same design of homology arms was used for the targeting vector for the Cl esterase inhibitor (CIIN) containing an expression cassette of a CMV promoter, SV40 intron element, CllN-T2A-PuroR and a SV40-pA (pHDR_ACTB_CHN). The cut point for double strand break induction was between G20 and G21 of SEQ ID NO: 5.
[0275] The vectors for random integration contained the fusion gene eGFP-T2A-NeoR under the control of a CMV or CAG promoter (pRAN_CMV_eGFP & pRAN_CAG_eGFP). To enable subsequent cassette exchange in unknown loci, the expression cassette was flanked by F3 / FRT sites. The complete random integration cassettes were flanked by two identical sgRNA recognition sites, which enabled in vivo linearization of the plasmid. For the recombinase-mediated cassette exchange (RMCE) an exchange vector (pCl I N_FI p) and an Flp recombinase-expressing vector (pCAG-FLPo) were used. The exchange vectors harbored a CllN-T2A-PuroR-SV40-pA expression cassette flanked by F3 / FRT sites. pCAG- FLPo was carrying the Flp recombinase gene under the control of a CAG promoter.
[0276] The Cas9 expression vector (pCAG_Cas9) contained Cas9 under the control of a CAG promoter as well as an Hl promoter and a sgRNA scaffold. sgRNA target sequences were selected using CHOPCHOP
[0034] , single stranded oligos were synthesized, annealed, and mixed with the expression vector backbone to generate sgRNA expression vectors.
[0277] All plasmids were extracted and purified for transfection using NucleoBond Xtra Midi EF (Macherey-Nagel) according to manufacturer’s instructions.
[0278] Cell culture, transfection, generation of stable cell lines
[0279] CAP® cells (CEVEC Pharmaceuticals GmbH) were grown in complete growth medium - protein expression medium (PEM, Gibco™) supplemented with 4 mM L-alanyl-L-glutamine (GlutaMAX™ Supplement, Gibco™) - and cultivated in 125-ml Erlenmeyer flasks (Corning) with a working volume of 15 ml at 37 ° C, 5% C02 at 120 rpm in a shacking incubator. Cells were passaged every 3-4 days. For stable integration of transgene cassettes cells were transfected with expression vectors encoding Cas9, sgRNA targeting the integration site and / or the donor plasmid for in vitro linearization and the donor plasmid.
[0280] For targeted integration into the ACTB locus cells were transfected using polyethylenimine (Polysciences) transfection protocol. 4.5 x 107cells were transfected with a total amount of 45 pg DNA in FreeStyle™ 293 medium (Gibco™) in 15 ml transfection volume and incubated at 37 ° C, 5% CO2 at 120 rpm in a shacking incubator. 5 hours post transfection, media exchange with complete growth medium was performed. Samples were incubated 96 hours in total after transfection before the selection process was started.
[0281] For random integration of transgene cassettes cells were transfected using Nucleofector Kit V (Lonza) according to manufacturer’s recommendations. 1 x 107cells were transfected with a total amount of 5 pg DNA. After transfection, cells were incubated in 12.5 ml complete growth medium at 37 ° C, 5% C02 at 120 rpm for 96 hours before selection process was started.
[0282] To generate stable cell pools, cells were seeded in the maximum culture volume with a starting concentration of 1 x 106cells / ml four days after transfection with the appropriate selection antibiotic added to the complete growth medium (G418 200 pg / ml; Carl Roth, 1 pg / ml Puromycin; AppliChem). During selection, medium was changed every 3-4 days. After two weeks of selection and establishment of stable growth of cell pools, the percentage of eGFP positive cells was measured using NucleoCounter® NC-3000 (Chemometec). For single cell isolation from stable cell pools a limiting dilution step in 96 well plates were applied. A calculated cell concentration for 0.5 cells per 200 pl well was used to ensure single cell separation. Generated colonies were checked after 7 days under the microscope. Only clones in wells with single round shaped colonies expressing eGFP were further grown and used for downstream analyses.
[0283] Shake culture analysis
[0284] For long-term stability analysis, single cell clones were cultivated in 125-ml Erlenmeyer flasks either with or without selection antibiotics in a working volume of 25 ml at 37 ° C, 5 % CO2 at 120 rpm in a shaking incubator. For each passage (every 3-4 days), the cells were seeded at a starting concentration of 1 x 106 cells / ml. For 9 weeks, every week after the second passage a sample from each single cell clone culture was taken and eGFP expression level was measured using the BD Accuri™ C6 Flow Cytometer (Becton Dickinson).
[0285] Target cassette exchange
[0286] For site-specific cassette exchange CAPGFP+cells were transfected using polyethylenimine as described before. A molecular ration of 1:1 for both Flp recombinase-expressing vector (pCAG-FLPo) and the donor plasmid (pCHN_Flp) was used. 5 hours post transfection medium was exchanged to complete growth medium and 96 h selection with 1 pg / ml Puromycin was started. The cells were passaged every 3 - 4 days and changes in eGFP expression were analyzed using the BD Accuri™ C6 Flow Cytometer (Becton Dickinson).
[0287] Genomic DNA extraction and PCR amplification
[0288] Isolation of genomic DNA was performed by using NucleoSpin® Tissue Mini Kit (Macherey- Nagel) according to the manufacturer’s protocol. For genomic DNA isolation, 5 x 106 CAP® cells were harvested and washed once with DPBS. Genomic DNA was eluted from the column with 5 mM Tris / HCI, pH 8.5 and stored at -20 ° C. DNA concentration was determined using the NanoPhotometer® N60 (Implen). All generated cell pools and clones were checked for either targeted integration downstream the ACTB locus or for randomly generated sites by PCR. For targeted integration into the ACTB locus, GOI specific primer sets were used. For the ACTBGFP+ integration, three primers were used. Two of them binding 5' and 3' outside of the homology region of the integration site. The third primer was binding within the eGFP of the targeting vector (primer set for eGFP expression cassette: ACTB_fw 5’ ACAGCTCTGGTTAGCTATGG 3’ (SEQ ID NO: 6), ACTB_rv 5’ CCTCTATACCCGCACTATCTGG 3’ (SEQ ID NO: 7) and eGFP.rv 5’ CAACATGGCGGTAATGTTGG 3’ (SEQ ID NO: 8)). For verification of the ACTBC1IN+integration, the same outside primers were used as for the verification of the eGFP integration cassette. Only the inside primer for the CIIN transgene cassette was changed (CllN_rv 5’ GTTATGTAACGACCTGCAGG 3’ (SEQ ID NO: 9)). The primer sets led to amplification of wt-alleles by the outside primers and amplification of targeted alleles by inside-out primers. To verify RMCE, a primer combination was used in which one primer was binding outside the F3 / FRT flanked vector region and a second primer was binding within the inserted CIIN gene (RMCE_fw 5’ AAAGCGGGCATGACTTCTGC 3’ (SEQ ID NO: 10), RMCE_rv 5’ CTGTCTTGCAAACTCTCTGG 3’ (SEQ ID NO: 11)). For all PCR reactions, Phusion™ Plus PCR Master Mix (Thermo Scientific) with a fixed annealing temperature of 60 ° C was used.
[0289] Western Blotting Assay A western blot experiment was conducted to detect a potentially adverse impact on ACTB expression caused by gene targeting. For this purpose, CAPACTB-C1IN+and CAP WT cells were lysed using RIPA buffer (Santa Cruz Biotechnology) and the protein concentration was determined using Bradford assay (Carl Roth). Subsequently, the samples were denatured and separated by 10 % sodium dodecyl-sulphate polyacrylamide gel electrophoresis (SDS- PAGE). The separated proteins were transferred to a polyvinylidene difluoride (PVDF) membrane (Bio-Rad). Subsequently, the PVDF membrane was blocked with blocking buffer (5% non-fat milk in TBS-T) and incubated with anti-actin beta (Cell Signaling) and anti- GAPDH (Santa Cruz) antibodies. Next, the membrane was washed with TBS-T and incubated with H-conjugated anti-mouse IgG (Cell Signaling) diluted with 5 % non-fat milk. Fluorescence images were obtained using Bio-Rad ChemiDoc (Bio-Rad).
[0290] Copy number determination
[0291] To determine the copy number of the transgene cassettes in the obtained single cell clones, multiplex digital droplet PCR (ddPCR) was performed on genomic DNA samples using ddPCR Supermix for Probes (Bio-Rad) on a QX200 Droplet Digital PCR System (Bio-Rad) . I n a first step 1 pg genomic DNA was digested using FastDigest Dpnl (Thermo Scientific™) for 1 h at 37 ° C with subsequent heat inactivation for 15 min at 65 ° C. Reaction mixtures contained ddPCR Supermix for Probes, 100 nM forward and reverse primer, 25 nM probe, and 50 ng of digested genomic DNA. A PCR protocol with the following conditions was used: 95 ° C for 10 min, 40 cycles at 95 ° C for 30 s and 60 s at 60 ° C, 98 ° C for 10 min. The primer and probes were designed for the transgenes EGFP and CIIN (Supplementary Table 1). Each PCR experiment was performed in three replicates and included no template controls. The absolute copy number of the target genes in the studied clones was determined in comparison to a known reference gene for wild-type CAP cells (undisclosed internal reference gene with a known copy number of two).
[0292] C1 esterase inhibitor quantification ELISA
[0293] The CII N expression level of all clones was analyzed by sandwich enzyme immunosorbent assay (ELISA). Clones were cultivated like described before in complete growth medium supplemented with 1 pg / ml puromycin (AppliChem). Sample collection was started two weeks after the start of cultivation. Cells were passaged twice a week. After four days of cultivation, cell concentration was determined and 1 ml supernatant was harvested for analysis. The samples were diluted accordingly with dilution buffer and measured in three different dilutions with three replicates each. The prepared samples were transferred to a 96-well plate coated with the ClIN-specific primary antibody (Thermo Scientific). Complement Cl esterase inhibitor (Calbiochem) was used for standard. After incubation with the peroxidase (HRP) labelled goat anti-human CIIN antibody (Affinity Biological) the photometric measurement base on substrate conversion by the peroxidase was done.
[0294] Statistical analysis
[0295] Data are expressed as the mean ± standard error of the mean. Statistical significance was tested using an unpaired Student’s t-test. Significant levels are indicated as *p<0.05, **p<0.01, ***p<0.001.
[0296] Example 1: Identification of loci supporting high eGFP expression
[0297] For the identification of a genomic locus enabling strong and stable transgene expression, an eGFP reporter cassette was inserted into a selected region 800 bp downstream of the stop codon of the ACTB gene in CAP cells. For this purpose, a targeting vector (pHDR_ACTB_eGFP) containing the eGFP gene and a neomycin resistance gene (NeoR) under common control of the cytomegalovirus (CMV) promoter was generated (Fig. la). The expression cassette was flanked by two -500 bp long ACTB homology arms and two sgRNA recognition sequences for CRSIPR / Cas9-mediated in vivo linearization of the vector. The same sgRNA also induced a double strand break (DSB) at the targeted genomic site (Fig. la). After co-transfection of the vector with the Cas9 expressing vector pCAG_Cas9 into CAP wild-type (CAP WT) cells, eGFP positive cells were enriched by G418 selection.
[0298] For the identification of randomly targeted loci supporting high expression in CAP cells, cell clones generated by random integration of a reporter gene were screened. Therefore, the screening vector (pRAN_eGFP) was designed. This vector contained an eGFP-T2A-NeoR expression cassette flanked by F3 / FRT sites, which enabled subsequent recombinase- mediated cassette exchange (RMCE) (Fig. lb). Two sgRNA recognition sequences were included to allow for CRISPR / Cas9-mediated in vivo linearization of the plasmid.
[0299] Transfection of pRAN_eGFP into CAP cells by electroporation was supposed to induce random DSBs in the host cell genome, leading to integration of the screening cassette (Fig. lb). As described for the targeted integration approach, an enrichment strategy based on G418 selection was applied to isolate eGFP positive.
[0300] Example 2: Selection of high eGFP expressing CAP cell clones
[0301] Compared to targeted integration into the A TCB locus, a larger heterogeneity in the expression pattern of individual clones was expected for the random insertion, which was indeed the case (see below). In the latter case, clones with highest eGFP expression were of interest as these indicate loci that potentially enable a particularly strong transgene expression.
[0302] Single cell isolation was performed from CAP,cra’eGFPand CAPRan-CAG’eGFP+pools using limiting dilution. Isolated single cell clones (SCC) were subsequently analyzed for eGFP expression level by flow cytometry (Fig. 2a-b). These data substantiate the assumption that most ACTB targeted clones would show a uniform expression level, whereas the randomly integrated clones would show a broader distribution in eGFP expression. For the targeted ACTB integration, 57 clones were evaluated and grouped into different expression levels. Most of the analyzed clones (n = 33) showed an expression level of 1 x 106- 1.5 x 106rfu (relative fluorescence units). Since a homogenous expression pattern can be expected for correctly targeted cell clones, 23 clones from this group were analyzed for the desired integration downstream of the ACTB locus by PCR using target region specific primers. 13 of these clones showed the expected PCR fragment, including two clones that lacked the wild-type PCR band, presumably reflecting homozygous integrations. Six of the heterozygous clones were selected for further expansion. After culturing in shake flasks with selection pressure for several passages, clones were reassessed for correct insertion. Of the six reassessed clones, all 4 showed the desired insertion band, so finally the clone CAPlc’re’’eGFPB8 was arbitrarily selected. For single cell isolation of CAPRaridom’CAP’eGFP+clones, a total of 55 SCCs were examined and classified according to their expression level (Fig. 2b). Only the top expression clones (> 5 x 105rfu) were expanded for further investigation (n = 13). Of these, six were chosen after a final expansion phase, showing favorable growth characteristics and viability.
[0303] All generated clonal cell lines were subsequently analyzed for their transgene copy number (TON) using a ddPCR assay (Fig. 2c). This analysis suggested a single integration for cell line CAPAGTB’eGFP+B8, which based on the PCR results is located in the targeted locus. I n case of the random integration approach, all six surviving cell clones of the high expression group were examined. Four of the clones (20, 2D, 2E & 10F) appeared to have a single copy insertion, whereas double insertions were found in two of the clones (3E & 11G). Based on these data, only the clones with single copy integration were used for further analysis.
[0304] Example 3: Stability testing of selected cell clones
[0305] To be considered as a suitable safe harbor site for biopharmaceutical production, a locus must permit stable transgene expression across multiple cell passages. Therefore, the stability of eGFP expression in the preselected cell clones CAPAGTB’eGFP+B8 (targeted insertion) and 2C, 2D, 2E and 10F (random transgenesis) were investigated over a time period of 18 passages. Expression was examined in both the presence and absence of the selection antibiotic G418. Cell clones with constant eGFP expression over time and independent of the presence of G418 can be considered stable. The clone B8 carrying a targeted insertion into the / I TC’fi’gene locus showed a consistent ~3-fold higher mean fluorescence (~ 9 x 105- 1.2 x 106rfu) compared to the clones derived from random transgenesis (~3 x 105- 6 x 106rfu) in the stability test (Fig. 3). Though minor variabilities in mean fluorescence were observed, each clone maintained at similar expression level over multiple passages. I mportantly, none of the clones showed major differences in mean fluorescence in the absence or presence of G418. Furthermore, all clones exhibited favorable growth and viability characteristics over the entire cultivation period (Fig. S3).
[0306] Example 4: Targeted integration of a Cl esterase inhibitor expression cassette into the ^C7 ?gene locus
[0307] Given that a safe harbor site must sustain the expression of not just a reporter gene but also, for example, therapeutic proteins, we integrated an expression cassette for the Cl esterase inhibitor (CIIN) into the previously identified region of the ACTB locus. CIIN belongs to the serpin superfamily and its deficiency is associated with hereditary angioedema (HAE), a genetic disorder that is commonly treated by a CIIN enzyme replacement therapy
[0035] . For the reuse of the A TCB gene locus, a new vector (pHDR_ACTB_CHN) was cloned, carrying the previously used homologous arms and an expression cassette for the CIIN and a puromycin resistance (PuroR) under control of the CMV promoter. Successful homologous recombination into the ACTB locus results in the same constellation as previously described for the reporter construct, with the difference of exchanging eGFP for CIIN and NeoR for PuroR (Fig. 4a).
[0308] After transfection of the targeting vector, pool selection and single clone isolation, the resulting SCCs were analyzed for correct integration by PCR using specific primers that allowed discriminating between the wild-type and the targeted allele. 19 out of 40 PCR- analyzed clones were identified as correctly targeted, of which four were further expanded. One of these clones, CAPACTB-C1IN+C6, was arbitrarily selected for further analysis and reconfirmed to be heterozygous for the desired integration by PCR.
[0309] In order to assess a potential effect of transgene insertion into the downstream region of the ACTB locus on endogenous actin beta expression, the level of this protein was determined in CAPACTB-C1IN+and CAP WT cells by western blotting. No differences in actin beta expression was visible in the two cell lines (Fig. 4c). This is in agreement with the previous observation that the use of this locus had no negative impact on the growth behavior of the cells (see above). Example 5: Integration of a Cl esterase inhibitor transgene into random integration site by recombinase-mediated cassette exchange
[0310] To access the suitability of loci generated by random transgenesis for their utility in producing a therapeutically relevant protein, we performed an exchange of the F3 / FRT- flanked reporter construct with the CII N expression cassette by RMCE. For this purpose, the exchange vector pCll N_FI p was designed enabling the site-specific cassette exchange in presence of Flp recombinase (Fig. 5a), which was provided by co-transfection of a Flp expression plasmid. Since the exchange vector contained a PuroR gene, while the gene locus resulting from the random insertion carried a NeoR gene, clones with a successful RMCE could be selected and enriched via puromycin selection.
[0311] RMCE was performed with all single copy SCC clones generated by random transgenesis, i.e. CAPRandom’CAG’eGFP+2C, 2D, 2E & 10F. It was expected that the puromycin-resistant cells no longer show eGFP fluorescence after a certain cultivation time due to loss of the reporter cassette if RMCE was successful in all cells. Surprisingly, only one pool, CAPRMCE-G1IN+2p, showed an almost complete loss of eGFP expression during the selection process (Fig. 5b). After nine weeks of cultivation and selection with puromycin, -96.4 % of the cells were eGFP negative. Accordingly, the CAPRMCE’C1IN+2E pool was selected for isolation of SCCs.
[0312] SCCs with successful RMCE were identified by PCR using sequence specific primers yielding a 449 bp fragment in case of correct integration. Of 48 clones screened, 43 showed the expected PCR band, of which two clones, CAPRMCE’C1IN+2EB7 and 2EB9, were arbitrarily selected for expansion and shake flask cultivation and successful RMCE was reconfirmed by PCR (Fig. 5c).
[0313] Example 6: Confirmation of copy number and measurement of CIIN expression level in selected cell lines
[0314] I n order to assess and compare the suitability of the downstream region of the ACTB locus as safe harbor sites for robust protein production, it was important to ensure that the insertions of the CIIN expression cassettes were single copies. For comparison, two reference clones previously generated by traditional random transgenesis and selected for their high CII N expression level, CAP CSPChlgh-cllN+1D6 and 2B10, were included in this analysis. The copy numbers and integration sites of these clones were unknown beforehand. All selected clones from the present work, i.e. the clone CAPACTB-C1IN+C6 derived from targeted integration into the ACTB locus as well as the RMCE clone CAPRMCE-C1IN+2EB7, were confirmed to have a single copy insertion (Fig. 6a). In contrast, the two reference cell lines CSPChlgh-cllN+1D9 and 2B10 harbored 15 and 2 transgene copies, respectively.
[0315] In order to compare the specific productivity of the individual cell lines in relation to the CUN gene copy number, batch production was carried out with all clones in a 125 ml shake flasks under identical conditions. For this purpose, the cells were cultured under 1 pg / ml puromycin selection pressure for a total of five weeks. After two weeks of cultivation, sampling for CUN titer measurement was started. Samples were taken four days after cell passages over a period of three weeks and subsequently used for CIIN ELISA measurement (n = 3). The two CSPChlghclones showed the highest absolute productivity of 47 - 95 pg / ml CIIN, while this value was at ~38 pg / ml in the CAPACTB-C1IN+clones and reached ~9 pg / ml in the CAPRMCE-C1IN+cel l lines (Fig. 6b). I n contrast, when considering the absolute CII N product titer in relation to the transgene copy number, the CAPACTB-C1IN+clones showed the highest relative titers (~38 pg / ml * gene copy), compared to 6 or 20 pg / ml * gene copy in the CSPChlghreference cell lines 1D6 and BIO, respectively (Fig. 6c). The relative titer of the CAPRMCE-CHN+ce| | |jne2EB7 (~9 pg / ml * gene copy) was in between that of the two CSPChlghclones.
[0316] In summary, no clones with single integrations of the transgene cassette were identified in the present study that showed higher expression of the two tested proteins (eGFP & CII N) than the clones carrying a targeted integration into the ACTB gene locus.
[0317] References 1. Arora, P., Singh, V., & Kumar, A. (2023). Mammalian Cell Culture: An Edge to Biopharmaceutical Industry. In (P. L. Singh, V., Show, Ed.) Biomanufacturing for Sustainable Production of Biomolecules (pp. 297-313). Springer, Singapore.
[0318] 2. Pilbrough, W., Munro, T. P., & Gray, P. (2009). Intraclonal protein expression heterogeneity in recombinant CHO cells. PLoS ONE, 4(12).
[0319] 3. Zhang, L., Inniss, M. C., Han, S., et al. (2015). Recombinase-mediated cassette exchange (RMCE) for monoclonal antibody expression in the commercially relevant CHOK1SV cell line. Biotechnology Progress, 31(E), 1645-1656.
[0320] 4. Browne, S. M., & Al-Rubeai, M. (2007). Selection methods for high-producing mammalian cell lines. Trends in Biotechnology, 25(E), 425-432.
[0321] 5. Wurm, F. M. (2004). Production of recombinant protein therapeutics in cultivated mammalian cells. Nature Biotechnology, 22(11), 1393-1398.
[0322] 6. Wiirtele, H., Little, K. C. E., & Chartrand, P. (2003). Illegitimate DNA integration in mammalian cells. Gene Therapy, 10(2.1), 1791-1799.
[0323] 7. Barnett, R. S., Limoli, K. L., Huynh, T. B., et al. (1995). Antibody Production in Chinese Hamster Ovary Cells Using an Impaired Selectable Marker. In Antibody Expression and Engineering (pp. 3-27). American Chemical Society.
[0324] 8. Wurm, F. M., & Wurm, M. J. (2017). Cloning of CHO Cells, productivity and genetic stability-a discussion. Processes, 5(2).
[0325] 9. Vcelar, S., Melcher, M., Auer, N., et al. (2018). Changes in Chromosome Counts and Patterns in CHO Cell Lines upon Generation of Recombinant Cell Lines and Subcloning. Biotechnology Journal, 13(3), 1-9. 10. Muller, K., Heller, H., & Doerfier, W. (2001). Foreign DNA integration. Genome-wide perturbations of methylation and transcription in the recipient genomes. Journal of Biological Chemistry, 276(11), 14271-14278.
[0326] 11. Bode, J., Benham, C., Knopp, A., et al. (2000). Transcriptional augmentation: Modulation of gene expression by scaffold / matrix-attached regions (S / MAR elements). Critical Reviews in Eukaryotic Gene Expression, 10(1), 73-90.
[0327] 12. West, A. G., & Fraser, P. (2005). Remote control of gene transcription. Human Molecular Genetics, 74(SPEC. ISS. 1), 101-111.
[0328] 13. Ko, P., Misaghi, S., Hu, Z., et al. (2018). Probing the importance of clonality: Single cell subcloning of clonally derived CHO cell lines yields widely diverse clones differing in growth, productivity, and product quality. Biotechnology Progress, 34(3), 624-634.
[0329] 14. Frye, C., Deshpande, R., Estes, S., et al. (2016). Industry view on the relative importance of “clonality” of biopharmaceutical-producing cell lines. Bioiogicais, 44(E), 111- 122.
[0330] 15. Kameyama, Y ., Kawabe, Y ., Ito, A., et al. (2010). An accumulative site-specific gene integration system using Cre recombinase-mediated cassette exchange. Biotechnology and Bioengineering, 105(E), 1106-1114.
[0331] 16. Hauser, H. (2015). Cell Line Development. In (M. Al-Rubeai, Ed.) Animal Cell Culture (pp. 1-25). Cham: Springer International Publishing.
[0332] 17. Zhang, J. P., Li, X. L., Li, G. H., et al. (2017). Efficient precise knockin with a double cut HDR donor after CRISPR / Cas9-mediated double-stranded DNA cleavage. Genome Biology, 18(1), 1-18.
[0333] 18. Porteus, M. H., & Carroll, D. (2005). Gene targeting using zinc finger nucleases. Nature Biotechnology, 23(3), 967-973. 19. Moynahan, M. E., & Jasin, M. (2010). Mitotic homologous recombination maintains genomic stability and suppresses tumorigenesis. Nature Reviews Molecular Cell Biology, 77(3), 196-207.
[0334] 20. Baum, C., Kustikova, 0., Modlich, U., et al. (2006). Mutagenesis and Oncogenesis by Chromosomal Insertion of Gene Transfer Vectors, 77(3), 253-63.
[0335] 21. U. S. Food and Drug Administration. (2010). Guidance for Industry - Characterization and Qualification of Cell Substrates and Other Biological Materials Used in the Production of Viral Vaccines for Infectious Disease Indications.
[0336] 22. Sadelain, M., Papapetrou, E. P., & Bushman, F. D. (2012). Safe harbours for the integration of new DNA in the human genome. Nature Reviews Cancer, 12(1), 51-58.
[0337] 23. Papapetrou, E. P., & Schambach, A. (2016). Gene insertion into genomic safe harbors for human gene therapy. Molecular Therapy, 24(0), 678-684.
[0338] 24. Pellenz, S., Phelps, M., Tang, W., et al. (2019). New Human Chromosomal Sites with “Safe Harbor” Potential for Targeted Transgene Insertion. Human Gene Therapy, 30(1), 814- 828.
[0339] 25. Irion, S., Luche, H., Gadue, P., et al. (2007). Identification and targeting of the ROSA26 locus in human embryonic stem cells. Nature Biotechnology, 25(12), 1477-1482.
[0340] 26. Lombardo, A., Genovese, P., Beausejour, C. M., et al. (2007). Gene editing in human stem cells using zinc finger nucleases and integrase-defective lentiviral vector delivery. Nature Biotechnology, 25(11), 1298-1306.
[0341] 27. Smith, J. R., Maguire, S., Davis, L. A., et al. (2008). Robust , Persistent Transgene Expression in Human Embryonic Stem Cells Is Achieved with AAVSl-Targeted Integration. Stem Cells, 26(2), 496-504. 28. Papapetrou, E. P., Lee, G., Malani, N ., et al. (2011). Genomic safe harbors permit high ? -globin transgene expression in thalassemia induced pluripotent stem cells. Nat Biotech no / , 29(1), 73-78.
[0342] 29. Henckaerts, E., Dutheil, N., Zeltner, N., et al. (2009). Site-specific integration of adeno-associated virus involves partial duplication of the target locus. Proc Nat / Acad Sci U SA, 106(1 ), 7571-7576.
[0343] 30. Lombardo, A., Cesana, D., Genovese, P., et al. (2011). Site-specific integration and tailoring of cassette design for sustainable gene transfer. Nat Methods, <?(10), 861-869.
[0344] 31. Shin, S., Kim, S. H., Shin, S. W., et al. (2020). Comprehensive Analysis of Genomic Safe Harbors as Target Sites for Stable Expression of the Heterologous Gene in HEK293 Cells. ACS Synthetic Biology, 5>(6), 1263-1269.
[0345] 32. Xiong, Y ., Han, X., Zhang, J., et al. (2020). Identification of ACTB Gene as a Potential Safe Harbor Locus in Pig Genome. Molecular Biotechnology, 62(11-12), 589-597.
[0346] 33. Shiozawa, S., Kawai, K., Okada, Y ., et al. (2011). Gene targeting and subsequent sitespecific transgenesis at the -actin (ACTB) locus in common marmoset embryonic stem cells. Stem Cells and Development, 20(9), 1587-1599.
[0347] 34. Labun, K., Montague, T. G., Krause, M., et al. (2019). CHOPCHOP v3: expanding the CRISPR web toolbox beyond genome editing. Nucleic acids research, 47(\N1), W171-W174.
[0348] 35. Gower, R. G., Busse, P. J., Aygbren-Pursun, E., et al. (2011). Hereditary Angioedema Caused by Cl-Esterase Inhibitor Deficiency: A Literature-Based Analysis and Clinical Commentary on Prophylaxis Treatment Strategies. World Allergy Organization Journal, 4(2), S9-S21.
Claims
1. Claims1. A method for producing a protein of interest in an isolated host cell, the method comprising(i) providing an isolated host cell comprising an endogenous beta Actin (ACTB) gene locus;(ii) integrating a recombinant gene expression cassette downstream of the stop codon of the ACTB gene, wherein the recombinant gene expression cassette comprises a nucleic acid sequence encoding at least one protein of interest; and(iii) culturing the isolated host cell under conditions allowing expression of the protein of interest.
2. Method of claim 1, wherein the recombinant gene expression cassette is integrated between the end of the 3’ UTR of ACTB and the start of the 5’ UTR of the next gene located downstream of ACTB, preferably wherein the recombinant gene expression cassette is integrated at least 600bp downstream of the stop codon of the ACTB gene.
3. Method of any one of claims 1 or 2, wherein the recombinant gene expression cassette further comprises a nucleic acid sequence encoding a regulatory sequence operatively linked to the nucleic acid sequence encoding the at least one protein of interest, preferably wherein the regulatory sequence is selected from the group consisting of CAG, CBA, CMV, HBA, UBC, EFl a , PGK, SV40, TRE and TET.
4. Method of any one of the preceding claims, wherein the protein of interest is stably expressed over at least 2 host cell generations, wherein one host cell generation comprises doubling of the host cells.
5. Method of any one of the preceding claims, wherein the protein of interest comprises one or more of a selection marker, a detectable protein, an antibody, a peptideantigen, an enzyme, a hormone, a growth factor, a receptor, a fusion protein a therapeutic protein or other biologically active protein, preferably wherein the protein of interest is a therapeutic protein.
6. Method of producing a stable host cell line with a site specific integration, comprising(i) providing an isolated host cell comprising an endogenous beta Actin (ACTB) gene locus;(ii) integrating a recombinant gene expression cassette between the end of the 3’ UTR of ACTB and the start of the 5’ UTR of the next gene located downstream of ACTB; and(iii) culturing the isolated host cell under conditions allowing the selection of an isolated host cell with the correct site specific integration; and(iv) expanding the selected isolated host cell into a stable host cell line.
7. Method of any one of the preceding claims, wherein the recombinant gene expression cassette is integrated using an integration technique that comprises inducing double strand breaks at the target site.
8. Method of any one of the preceding claims, wherein the recombinant gene expression cassette is integrated at or near a nucleic acid sequence at least 80% identical to SEQ ID NO: 1 or a nucleic acid sequence at least 80% identical to SEQ ID NO: 2, optionally wherein the recombinant gene expression cassette is integrated between a nucleic acid sequence at least 80% identical to SEQ ID NO: 1 or a nucleic acid sequence at least 80% identical to SEQ ID NO: 2.
9. Method of any one of the preceding claims, wherein step (ii) further comprises selecting an isolated host cell with a single site specific integration of the recombinant gene expression cassette, preferably wherein the isolated host cell does not have additional integration of the recombinant gene expression cassette.
10. Method of any one of the preceding claims, wherein the recombinant gene expression cassette further comprises(i) a selection marker; and / or(ii) at least two recombinase recognition sites, preferably a pair of mutually in compatible recombinase recognition sites selected from the group consisting of F3 / FRT, F5 / FRT, attB / attP, loxP / lox2272, loxP66 / loxP71 and loxP / loxP511.
11. Method of any one of the preceding claims, wherein the isolated host cell is selected from the group consisting of CAP®, CHO, HeLa, iPSC, K562, HEK293, HT-1080, BHK and Vero, preferably wherein the isolated host cell is a CAP® cell.
12. An isolated site-specific integration host cell comprising an endogenous beta Actin (ACTB) gene locus produced by the method provided in any one of claims 1 to 12.
13. An isolated site-specific integration host cell comprising an endogenous beta Actin (ACTB) gene locus, wherein a recombinant gene expression cassette is integrated between the end of the 3’ UTR of ACTB and the start of the 5’ UTR of the next gene located downstream of ACTB, preferably wherein the recombinant gene expression cassette is integrated at least 600bp downstream of the stop codon of the ACTB gene.
14. Isolated site-specific integration host cell of any one of claims 12 or 13, wherein the host cell line is selected from the group consisting of CAP®, CHO, HeLa, iPSC, K562, HEK293, HT-1080, BHK and Vero, preferably wherein the isolated host cell is a CAP® cell.
15. Use of the isolated host cell of any one of claims 12 to 14 for the production of a protein of interest.
6. Use of an integration site between the end of the 3’ UTR of the ACTB gene and the start of the 5’ UTR of the next gene located downstream of the ACTB gene of an isolated host cell for the production of a protein of interest.
Citation Information
Patent Citations
Methods for improving crispr / CAS-mediated genome-editing
WO2016073990A2
Construction method for targeting vector capable of achieving targeted integration of exogenous genes to ACTB gene downstream and application thereof
CN110358792A
Compositions and methods related to reporter systems and large animal models for evaluating gene editing technology
US20210395838A1