Cosmetic composition for improving skin tone and whitening skin containing DNA extracted from rice bran

Abstract

The present invention relates to a cosmetic composition for improving skin tone and whitening skin, the cosmetic composition containing DNA extracted from rice bran. In the present invention, DNA extracted from rice bran is produced using only eco-friendly substances such as inorganic salts and ascorbic acid without using any harmful substances such as chloroform or phenol, and thus the DNA can be extracted and purified to a high purity to provide excellent skin tone improvements such as skin regeneration, oxidation inhibition, skin whitening, skin barrier strengthening, and skin tone-up.

Description

Cosmetic composition for improving skin tone and whitening containing DNA extracted from rice bran

[0001] The present invention relates to a cosmetic composition for improving skin tone and whitening containing DNA extracted from rice bran.

[0002]

[0003] DNA is a polymer composed of phosphates, bases (adenine, thymine, guanine, and cytosine), and deoxyribose, which are double-bonded in a helical pattern based on complementary base structures. It contains genetic information. DNA activates adenosine receptors in cell membranes, and is therefore used for skin regeneration, scar and wound healing, and arthritis treatment.

[0004] Polydeoxyribonucleotide (PDRN), recently used as a key material in cosmeceuticals and bio-cosmetics, is manufactured from DNA extracted from salmon semen and contains deoxyribonucleotide polymers of 50 to 2,000 base pairs. PDRN is mainly used for the treatment of wounds caused by skin grafts and tissue repair, but it is also used for some tissue regeneration or inflammation treatment for which there is no suitable treatment, depending on the medical professional's judgment. It is known to be used for the treatment of a wide range of disorders such as diabetic foot ulcers, scars, vascular insufficiency, and female pattern hair loss. It is also known to stimulate the A2 receptor, a skin regeneration signaling pathway, to promote the secretion of various growth factors, induce capillary formation by VEGF (vascular endothelial growth factor), improve blood circulation, have anti-inflammatory effects, and prevent capillary leakage. PDRN is an animal-derived raw material extracted from salmon semen, and its effectiveness has been proven. However, it is not suitable for vegan products that do not contain animal ingredients or cruelty-free cosmetics that are not tested on animals. Furthermore, in the case of animal DNA such as salmon, it is obtained by removing the cell membrane made of phospholipids using chemical methods (organic solvents such as chloroform and phenol), so new improvements are needed in the extraction method. Meanwhile, research is underway on methods to obtain DNA from natural products such as plants and seaweed to replace animal-derived raw materials. However, plants and seaweed contain a lot of chlorophyll, pectin, cellulose, and other impurities because they photosynthesize. Therefore, it is important to develop technology that can efficiently remove impurities during the process of extracting high-purity DNA and enable commercialization.

[0005] Rice bran is the finest inner bran produced when rice is milled. In pure Korean, it is called rice bran. Brown rice, which has been harvested and the husk removed, is called brown rice. Brown rice is slightly yellowish in color. The fine powder separated from brown rice during the milling process, which involves grinding the rice again to make white rice, is called rice bran / rice bran. Structurally, it surrounds the outer layer of white rice, accounting for approximately 8% of brown rice. Brown rice, from which only the husk is removed, consists of the bran layer, including the pericarp, seed coat, and aleurone layer, starting from the outside; the germ, which occupies a small portion of the base of the grain; and the endosperm, which makes up the majority of the remainder. This endosperm is primarily filled with starch particles and is the edible part of white rice. The weight ratio of the bran layer to the whole grain of brown rice is 5–8%, the germ 2–5%, and the endosperm 90–93%. Therefore, when brown rice is polished in a rice mill, white rice with 92% of the brown rice content is produced. Brown rice is rich in fat, protein, vitamin B1, and vitamin B2.

[0006]

[0007] [Prior Art Literature]

[0008] [Patent Document]

[0009] Republic of Korea Patent No. 10-2524599 (Title of the invention: Liposomal composition containing vegan PDRN, effective for elasticity, nutrition, and regeneration; Applicant: DermaLoop Co., Ltd.; Registration date: October 21, 2022)

[0010] Republic of Korea Patent No. 10-2249241 (Title of the invention: Polydeoxyribonucleotide derived from seaweed with angiogenesis and cell regeneration effects and method for extracting polynucleotides, Applicant: Han Ji-seong, Registration date: November 20, 2020)

[0011] Korean Patent No. 10-2237543 (Title of the invention: Method for producing DNA derived from aloe plants, and anti-aging and anti-inflammatory composition containing DNA derived from aloe plants as an active ingredient, Applicant: Moachem Co., Ltd., Registration date: February 22, 2019)

[0012]

[0013] The purpose of the present invention is to provide a cosmetic composition for improving skin tone and whitening containing DNA extracted from rice bran.

[0014] More specifically, the purpose of the present invention is to provide a cosmetic composition for improving skin, including skin regeneration, anti-oxidation, skin whitening, DEJ enhancement, moisturizing, and skin tone-up effects, using DNA extracted from rice bran as an active ingredient.

[0015]

[0016] The present invention relates to a cosmetic composition for improving skin tone and whitening containing PDRN (polydeoxyribonucleotide) extracted from rice bran.

[0017] The above PDRN may comprise a polynucleotide sequence of sequence number 1 or sequence number 2.

[0018] The above PDRN is characterized by having melanin production inhibition and secretion effects.

[0019] The above PDRN may have the effect of inhibiting the expression of the PAR-2 ​​(protease activated receptor-2) gene, which is a factor related to melanosome movement.

[0020] The above PDRN is preferably characterized by having an effect of inhibiting MTNR1 (melatonin receptor 1A) protein expression.

[0021] The above PDRN is characterized by its ability to activate the biorhythm of skin cells during sleep, thereby restoring damaged skin cells. Preferably, it is characterized by its ability to suppress Bmal-1 gene expression.

[0022] The above PDRN has antioxidant properties and has the ability to scavenge ROS (reactive oxygen species).

[0023] The above PDRN has skin regeneration properties by strengthening the basement membrane between the epidermis and dermis. It is particularly effective in increasing the expression of Laminin 5 or collagen type XVII (COL-XVII). It also enhances the expression of OCDN (Occludin), thereby improving the skin barrier.

[0024] Hereinafter, the present invention will be described in detail.

[0025] The rice-derived PDRN of the present invention can be prepared by the following method. Preferably,

[0026] (Step 1) A step of mixing rice bran with a buffer solution containing Tris(hydroxymethyl)aminomethane hydrochloride, potassium phosphate, ethylenediaminetetraacetic acid, sodium chloride, sodium acetate, ascorbic acid, sodium hydroxide, and sodium dodecyl sulfate, heating the solution to soften the plant cells of the rice bran, elute DNA, and cooling the solution;

[0027] (Step 2) Step to remove impurities and other proteins;

[0028] (Step 3) Step of immersing the solid content generated by adding alcohol;

[0029] (Step 4) A step of obtaining a solid containing immersed DNA; and,

[0030] (Step 5) A step of dissolving and purifying the obtained DNA solid may be included.

[0031] As each raw material of the buffer solution of the first step above,

[0032] It contains 5.0 to 500.0 mM Tris(hydroxymethyl)aminomethane hydrochloride, 5.0 to 500.0 mM potassium phosphate, 5.0 to 500.0 mM ethylenediaminetetraacetic acid, 0.1 to 5.0 M sodium chloride, 0.1 to 5.0 M sodium acetate, 5.0 to 500.0 mM ascorbic acid, 10.0 to 500.0 mM sodium hydroxide, and may contain 0.1 to 1.0 wt% of sodium dodecyl sulfate.

[0033] The buffer solution in the first step above serves to reduce damage during the extraction process of rice DNA.

[0034] Additionally, the alcohol used in all steps of the present invention may be a C1 to C4 alcohol, and preferably may be selected from the group consisting of methanol, ethanol, propanol, isopropanol, butanol, and isobutanol. Additionally, the alcohol may be a mixed solution of 10 to 90 (v / v)% with water, if necessary.

[0035] Through the heating step of the first step, the plant cells of the rice bran are softened, and DNA is extracted from the cells. The heating step can be performed at 20 to 70°C for 0.5 to 48 hours.

[0036] The impurities of the second step above may be various cell walls, cytoplasm, proteins, fibers, etc. that make up the rice bran tissue.

[0037] The second step may involve adjusting the acidity of the protein to its isoelectric point using organic acids such as acetic acid, hydrochloric acid, citric acid, and lactic acid to precipitate the protein impurities, and then removing the impurities through centrifugation or pressure filtration. Preferably, this step may also involve removing substances exhibiting viscosity through diatomaceous earth filtration.

[0038] When adding alcohol in the third step above, it is recommended to slowly add the cooled alcohol at a rate of 0.1 to 10 mL / sec to ensure that the alcohol and the sample containing DNA are well mixed, and it is recommended to maintain the immersion state for 1 to 72 hours.

[0039] In the DNA purification step of the above 3rd to 5th steps, when the solid is immersed, the sediment is separated through centrifugation and pressure filtration to obtain only the solid, the obtained DNA-containing solid is dissolved in purified water or an ionic buffer solution, centrifuged again, the solid is additionally recovered, and the solid is repeatedly redissolved to further increase the purity of the DNA. This process can be continuously repeated.

[0040] The present invention also relates to a cosmetic composition containing rice-derived DNA (PDRN) prepared by the above method.

[0041] The rice-derived DNA of the present invention includes a gene sequence of sequence number 1 and includes DNA having a molecular weight of 75 to 500 bp and about 48.5 to 325 kDa.

[0042] The DNA extracted in the present invention is yellow or light brown in color, has no specific odor, and has a pH of 5.0 to 7.5.

[0043] When treated with 10 μg / ml of rice bran-derived PDRN of the present invention, melanin secretion or production in skin cells is suppressed by about 40-55%, and restored to the level of the untreated group of melanin production stimulants. In addition, the amount of ROS production is reduced by 20-45% due to the PDRN of 1-10 μg / ml, and when treated with 10 μg / ml of rice bran-derived PDRN, the amount of ROS production is reduced by 30-50%. When treated with 10 μg / ml of rice bran-derived PDRN, the wound healing effect or cell regeneration effect increases by 1.5-1.7 times.

[0044] PAR-2 ​​(protease activated receptor-2) gene expression is suppressed by 20-40% when treated with 5-10 ㎍ / ml of rice bran-derived PDRN, and by 30-40% when treated with 10 ㎍ / ml of PDRN. MTNR1 (melatonin receptor 1A) protein expression increases by approximately 1.9-2.4 times in old skin when treated with 5-10 ㎍ / ml, returning it to the level of young skin. Bmal-1 gene expression increases by 1.7-3.0 times in UVB-damaged skin when treated with 1-10 ㎍ / ml of rice bran-derived PDRN, and by 2.2-3.0 times when treated with 10 ㎍ / ml.

[0045] The expression of laminin 5 increases by more than 1.5 times when treated with 1 ㎍ / ml of rice bran-derived PDRN, and by more than 2.8 times when treated with 5 ㎍ / ml, and by 2.3 to 2.8 times when treated with 1 to 5 ㎍ / ml of collagen type XVII (COL-XVII).

[0046] When cells damaged by UVB are treated with 1 to 10 μg / ml of rice-derived PDRN, the protein expression of OCDN (Occludin) increases by 1.4 to 1.9 times, and when treated with 5 to 10 μg / ml, the expression increases by 1.7 to 1.9 times.

[0047] The rice bran used in the present invention is a fine powder separated from brown rice during the process of polishing it into white rice. Brown rice is made by separating only the husk from the rice plant (Oryza sativa).

[0048] Meanwhile, the present invention is only to select rice bran as a high-quality raw material that is easy to extract PDRN from rice or rice, and thus, the present invention may also relate to any composition containing DNA (PDRN) extracted from any tissue of rice (Oryza sativa) or wild rice Oryza rufipogon, other various Oryza genus or hybrids thereof. This includes rice whole plant, sprout, stem, root, or anything obtained therefrom, husk, rice husk, grains without removing the husk, brown rice with the husk removed, semi-polished rice such as 7-minute rice, 5-minute rice, and 3-minute rice from which the outer hull of brown rice, i.e. the part corresponding to the bran, is not completely removed, white rice with some germ, etc. remaining, or any variety of rice derived from rice (Oryza sativa) can be used as a raw material for extracting PDRN in the present invention. The above Oryza genus plant may be, for example, a cultivated species such as Oryza glaberrima, or a wild species such as Oryza nivara, Oryza longistaminata, Oryza barthii, Oryza meridionalis, Oryza officinalis, Oryza granulata, Oryza latifolia, Oryza punctata, Oryza eichingeri, or Oryza meyeriana. The above wild species of rice may be used for cultivar improvement of Oryza sativa.

[0049] In addition, the DNA-containing composition of the present invention can be provided as a cosmetic composition, and the cosmetic composition can be prepared in any formulation commonly manufactured in the art, and can be provided in the form of an essence, a lotion, an emulsion, a pack, a hand cream, a foot cream, a lip balm, a lipstick, an eye shadow, an eyeliner, an eyebrow pencil, a blusher, a highlighter, a general toner, a skin, a cream, a serum, a cosmetic soap, a softening toner, a medicated toner, a body cleanser, a cleansing foam, a cleansing lotion, a gel, a cleansing oil, a cleansing cream, a shampoo, a rinse, a hair treatment, a hair lotion, a cleansing tissue, and a cleansing water.

[0050] More specifically, when the formulation of the cosmetic composition of the present invention is a paste, cream or gel, animal fiber, plant fiber, wax, paraffin, starch, tragacanth, cellulose derivatives, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide may be used as a carrier component. When the formulation of the cosmetic composition of the present invention is a powder or spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component, and particularly in the case of a spray, a propellant such as chlorofluorohydrocarbon, propane-butane or dimethyl ether may be additionally included. When the formulation of the cosmetic composition of the present invention is a solution or emulsion, a solvent, solvating agent or emulsifying agent is used as a carrier component, and examples thereof include water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butyl glycol oil, glycerol aliphatic ester, polyethylene glycol or fatty acid ester of sorbitan. When the formulation of the cosmetic composition of the present invention is a suspension, a liquid diluent such as water, ethanol or propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar or tragacanth, and the like can be used as a carrier component. When the formulation of the cosmetic composition of the present invention is a surfactant-containing cleansing, aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, acethionate, imidazolinium derivative, methyl taurate, sarcosinate, fatty acid amide ether sulfate, alkylamidobetaine, fatty alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, linolenic derivative, or ethoxylated glycerol fatty acid ester may be used as a carrier component.The cosmetic composition of the present invention may additionally contain excipients including fluorescent substances, fungicides, hydrotropism inducers, moisturizers, fragrances, fragrance carriers, proteins, solubilizers, sugar derivatives, sunscreens, vitamins, plant extracts, etc. The amounts of the above components may be selected according to the formulation or intended use within a range that does not impair the inherent effects of the cosmetic composition. The amount of the above components may be, for example, 0.1 to 10 wt%, preferably 0.1 to 6 wt%, based on the total weight of the composition, but is not limited thereto.

[0051]

[0052] The present invention relates to a cosmetic composition for improving skin tone and whitening containing DNA extracted from rice bran. The DNA extracted from rice bran in the present invention does not contain any harmful substances such as chloroform or phenol, and instead uses only environmentally friendly substances such as inorganic salts and ascorbic acid. Therefore, the DNA can be extracted and purified with high purity, and this provides excellent skin tone improvement effects such as skin regeneration, antioxidant activity, skin whitening, skin barrier strengthening, and skin tone enhancement.

[0053]

[0054] Figure 1a shows the electrophoresis results of rice PDRN.

[0055] Figure 1b shows the results of Metagenome Amplicon Sequencing of rice PDRN.

[0056] Figure 2 shows the cytotoxicity results of rice bran PDRN against CCD-1064-Sk (Human Dermal Fibroblast, ATCC, CRL-2076, neonate), HaCaT (Keratinocyte, Human immortalized keratinocytes), A431 (Keratinocyte, ATCC, CRL-1555), and B16-F1 (ATCC, CRL-6323).

[0057] Figure 3 shows the whitening efficacy of brown rice PDRN, and shows the results of confirming the melanin production rate per unit cell (intracellular melanin) and the melanin secretion rate per unit cell (extracellular melanin) in B16-F1 (ATCC, CRL-6323) cells, and the cytotoxicity results under the same cell conditions.

[0058] Figure 4 shows the results showing the radical scavenging ability as an antioxidant effect of brown rice PDRN.

[0059] Figure 5 shows the results of confirming the cell regeneration efficacy of rice PDRN through a wound healing assay.

[0060] Figure 6 shows the results of confirming the skin tone-up, regenerative effect, and overnight skin repair effect of brown rice PDRN through PAR-2 ​​mRNA expression, MTNR1 protein expression, and Bmal-1 mRNA expression.

[0061] Figure 7 shows the results of confirming the basement membrane strengthening effect of rice PDRN through protein expression of laminin 5 and collagen type XVII.

[0062] Figure 8 shows the results of confirming the skin barrier strengthening effect of brown rice PDRN through the protein expression of Occludin (OCDN).

[0063]

[0064] Hereinafter, preferred embodiments of the present invention will be described in detail. However, the present invention is not limited to the embodiments described herein and may be embodied in other forms. Rather, the contents introduced herein are provided to ensure thoroughness and completeness, and to sufficiently convey the spirit of the present invention to those skilled in the art.

[0065]

[0066] <Preparation of raw materials>

[0067] Salmon PDRN (DNA) was purchased commercially and was confirmed to have a typical size of approximately 500–1500 bp.

[0068] To obtain rice bran PDRN (DNA), rice bran was first mixed in a buffer solution containing 500 mM Tris(hydroxymethyl)aminomethane hydrochloride, 100 mM potassium phosphate, 170 mM ethylenediaminetetraacetic acid, 0.1 M sodium chloride, 0.1 M sodium acetate, 10 mM ascorbic acid, 100 mM sodium hydroxide, and 0.1 wt% sodium dodecyl sulfate. At this time, purified water for preparing the buffer solution was added in an amount 10 times the weight of the rice bran raw material. Afterwards, it was heated at 40℃ for 24 hours.

[0069] After extracting DNA while heating, it was quickly cooled to a temperature below 20℃, and when the rice bran tissue and DNA were separated, the separated tissue impurities were removed, and additionally, the solid precipitated was removed by centrifugation, thereby primarily removing impurities. In addition, after most of the impurities were removed, 99.9% ethanol was added to the remaining solution to adjust the ethanol concentration in the solution to 50 (v / v)% in order to precipitate the rice bran-derived DNA in the solution. Again, centrifugation was performed to discard the ethanol and obtain only the precipitate containing DNA. The obtained precipitate was dissolved in purified water, precipitated again with a 50 (v / v)% ethanol aqueous solution, centrifuged, and the process of rehydrating only the precipitate in purified water was repeated 2 to 4 times to remove the ethanol component in the precipitate, purify only the DNA component, and obtain only high-purity rice bran PDRN.

[0070]

[0071] <Example 1. Identification of Rice Bran PDRN and Metagenome Amplicon Sequencing>

[0072] The extracted rice bran PDRN was quantified by electrophoresing 10 μl of DNA at a concentration of 200 μg / ml on an acrylamide gel and measuring it with NanoDrop.

[0073] As a result, it was confirmed that PDRN was in good condition and had an average size of 100 to 300 bp and a molecular weight of 65 to 195 kDa, as shown in Fig. 1a.

[0074] Afterwards, using the obtained rice bran PDRN, we commissioned Macrogen Co., Ltd. to perform Metagenome Amplicon Sequencing. This test method is a community genome analysis method that can determine the species composition of a specific DNA sample. It is similar to the method of creating an amplicon library by amplifying specific regions of marker genes such as microbial 16S rRNA, ITS gene, or rbcL gene, and then analyzing the distribution and diversity through sequencing, but the scope of analysis is broader.

[0075] Library construction for sequence analysis was performed by amplifying rbcL2-rbcLa and ITS2F-ITS4R according to the Illumina 16S metagenomics sequencing library protocol. 5 ng (rbcL2-rbcLa) and 10 ng (ITS2F-ITS4R) of gDNA were added with a buffer solution for PCR amplification, followed by 1 mM dNTP mix and 500 nM F / R PCR primers.

[0076] The amplified product through PCR was purified using AMPure beads (Agencourt Bioscence, Beverly, MA.). After purification, 10 uL of the PCR product was PCR amplified using NexteraXT Indexed Primer to construct a final library containing an index. The final purified product was then qPCR quantified according to the qPCR quantification protocol guide (KAPA Library Quantification Kits for Illumina Sequencing Platforms), verified using TapeStation D1000 ScreenTape (Agilent Technologies, Waldbronn, Germany), and sequenced using the MiSeq platform (Illumina, San Diego, USA). As a result of the metagenome amplicon sequencing analysis, as shown in Fig. 1b, the rice bran PDRN obtained in the present invention was analyzed to be 99.9905% Oryza sativa at the genus level, and among them, it was confirmed to have the following genes of sequence numbers 1 and 2.

[0077] SequenceNo.1ctcagccggg ggttccgcc gagaagcag gggctgcagt agctgccgaa tcttctactggtacatggac aactgtttgg actgatggac ttaccagtct tgatcgttac aaaggccgatgctatcacat cgagcccgtt gttggggagg ataatcaata tatcgcttat gtagcttatccattagacct atttgaagag ggttctgtta ctaacatgtt tacttccatt gtggtaacgtattggtt caaagcccta cgcgctctac gtctggagga tctgcgaatt ccccctactttcaaaaac tttccaaggt ccgcctcatg gtatccaagt tgaaagggat aagttgaacaaatacggtcg tcctttattg ggatgtacta ttaaaccaaa attgggatta tctgcaaaaaattatggtag agcatgttat gaggtgtctaNo.2ctcagccggg ggttccgcc ggaagcag gggctgcagt agctgccgaa tcttctactggtacatggac aactgtttgg actgatggac ttaccagtct tgatcgttac aaaggacgatgctatcacat cgagcccgtt gttggggagg aaaatcaata tatcgcttat gtagcttatccattagacct atttgaagag ggttctgtta ctaacatgtt tacttcatt gtgggttaacgtatttggttt caaagcccta cgcgctctac gtctggagga tctgcgaatt ccccctacttattcaaaaac tttccaaggc ccgcctcatg gtatccaagt tgaaagggat aagttgaacaagttggtcg tcctttattg ggatgtacta ttaaacaaaa atggggatta tccgcgataaattatggtag agcatgttat gagtgtcta

[0078] In addition, salmon PDRN was confirmed to be 500-1500bp as per the purchase information.

[0079] The information of rbcL2-rbcLa, ITS2F-ITS4R, a primer set for detecting the genetic information of the above sequence numbers 1 and 2, is shown in Table 2 below.

[0080] PrimerSequencerbcL2No.3tcgtcggcag cgtcagatgt gtataagaga cagcctacgg gnggcwgcagrbcLaNo.4gtctcgtggg ctcggagatg tgtataagag acaggactac hvgggtatct aatccITS2FNo.5tcgtcggcag cgtcagatgt gtataagaga cagatgcgat acttggtgtg aatITS4RNo.6gtctcgtggg ctcggagatg tgtataagag acagtcctcc gcttattgat atgc

[0081]

[0082] <Example 2. Confirmation of cytotoxicity>

[0083] Cytotoxicity tests were performed using the MTT assay on CCD-1064-Sk (Human Dermal Fibroblast, ATCC, CRL-2076, neonate), HaCaT (Keratinocyte, Human immortalized keratinocytes), A431 (Keratinocyte, ATCC, CRL-1555), and B16-F1 (ATCC, CRL-6323) cells treated with various concentrations of rice bran PDRN. The experimental method is as follows.

[0084] Cells were seeded in a 24-well plate and cultured for 24 hours. The medium of the cultured cells was replaced with a serum-free medium, and the samples were treated at various concentrations and cultured for 24 hours. After the culture was completed, the medium was replaced with a 10-fold dilution of a 2.5 mg / ml MTT solution and reacted. The supernatant was removed, and 1 ml of DMSO was added to dissolve the produced MTT-formazan crystals, and the absorbance was measured at 570 nm using an ELISA reader. The control group used here was DMSO (Dimethyl Sulfoxide) as a dissolution solvent. Cytotoxicity was expressed as a percentage of absorbance compared to the control group, and as shown in Tables 3 to 5 and Fig. 2, it was confirmed that the rice bran PDRN extracted in the present invention was a non-cytotoxic substance up to about 10 μg / ml.

[0085] Cell viability (%): Fibroblast - CCD-1064-SkSampleConc.Aver.Stdev.p-valuecontrol100.01.661.0000Rice bran PDRN (㎍ / ㎖)1105.72.730.08335117.75.680.026310135.26.040.0046

[0086] Cell viability (%): Keratinocyte - HaCaTSampleConc.Aver.Stdev.p-valuecontrol100.07.531.0000Rice bran PDRN (㎍ / ㎖)1103.43.870.52195106.45.470.298510104.35.030.4524

[0087] Cell viability (%): Keratinocyte - A431SampleConc.Aver.Stdev.p-valuecontrol100.03.971.0000Rice bran PDRN (㎍ / ㎖)199.95.640.98905101.36.480.776310101.36.790.782925106.26.120.21625094.35.760.2309

[0088]

[0089] <Example 3. Evaluation of whitening efficacy through inhibition of melanin production and secretion>

[0090] B16-F1 was inoculated into a 24-well plate and cultured for 24 hours, then replaced with fresh DMEM medium containing α-melanocyte stimulating hormone (α-MSH) and 10% FBS. After that, each rice bran PDRN sample was treated with various concentrations and cultured for 72 hours. After 72 hours, the medium was removed, the cells were washed with 1 ml of PBS (phosphate buffer, saline), treated with 0.2 ml of 1 N NaOH, and the cells were collected in a 1.5 ml tube and cultured at 60°C for 30 minutes. After that, the obtained cell lysate was vortexed and transferred to a 96-well plate, and the absorbance was measured at 450 nm. At this time, the melanin production rate was confirmed by measuring the amount of melanin inside the melanoma cells (intracellular melanin), and the melanin secretion rate was confirmed by measuring the amount of melanin secreted outside the melanoma cells (extracellular melanin).

[0091] The final concentration of α-MSH used in the experiment was 100 nM, the positive control group, Arbutin, was 100 μg / ml, and each rice bran PDRN was treated at different concentrations, as shown in Tables 6, 7, and Fig. 3.

[0092] In addition, cells were prepared under the same experimental conditions and the MTT assay was performed according to the method of Example 2 to confirm the cell status.

[0093] As a result, it was found that the melanin production and secretion inhibition effect of brown rice PDRN was very excellent, confirming its whitening effect.

[0094] Additionally, the results of the MTT assay show that the results are not due to cell death, as shown in Table 8 and Figure 4, but rather are from cells in a stable state.

[0095] Melanin production rate per unit cell (%) SampleConc.AverageStdev.p-valuecontrol56.722.910.0000α-MSH 100 nM100.001.461.0000α-MSH + Arbutin(㎍ / ㎖)5055.841.750.0000α-MSH + Rice bran PDRN (㎍ / ㎖)182.346.420.01572.573.991.950.0001567.140.810.00001056.502.090.0000

[0096] Melanin secretion rate per unit cell (%) SampleConc.AverageStdev.p-valuecontrol45.171.540.0000α-MSH 100 nM100.001.211.0000α-MSH + Arbutin(㎍ / ㎖)5071.422.760.0001α-MSH + Rice bran PDRN (㎍ / ㎖)183.770.960.00012.560.663.140.0000547.580.820.00001045.410.120.0000

[0097] Cell viability (%): B16-F1SampleConc.AverageStdev.p-valuecontrol102.183.390.3373α-MSH 100 nM100.000.731.0000α-MSH + Arbutin (㎍ / ㎖)50104.002.500.0564α-MSH + Rice bran PDRN(㎍ / ㎖)199.462.400.72662.5102.760.960.01675103.121.330.023810103.351.970.0506

[0098]

[0099] <Example 4. Confirmation of ROS (Reactive Oxygen Species) Scavenging Ability>

[0100] To evaluate the antioxidant efficacy of rice bran PDRN, the amount of ROS production was measured in HaCaT cells (human keratinocyte cells).

[0101] For this purpose, HaCaT cells were seeded in a 24-well plate at 1.5x10 5 Cells were seeded at 1 / well and cultured for 24 hours. Each well was replaced with serum-free medium, and samples were treated at different concentrations and cultured for 24 hours. EGCG, known as a powerful antioxidant, was used as a control group. After culture, DCFDA (D6883, Sigma-Aldrich, Germany) was treated for dark reaction to stain for ROS, and 1 mM H2O2 was additionally treated for 30 minutes to induce ROS (reactive oxygen species) production. Fluorescence was measured at a wavelength of 485 / 535 (excitation / emission) nm after all sample treatments. The measurement results were calculated as the amount of ROS produced / cell viability x 100 (%) and are shown in Table 9 and Fig. 4.

[0102] ROS production (%)SampleConc.AverageStdev.p-valuecontrol47.152.690.0008H2O21 mM100.009.691.0000H2O2+ EGCG (㎍ / ㎖)161.473.270.0029H2O2+ Rice bran PDRN (㎍ / ㎖)167.161.960.0205569.057.880.01271065.386.910.0073

[0103] Referring to Table 9 and Figure 4, when ROS production was induced using H2O2 and then treated with rice PDRN, rice PDRN showed enhanced ROS inhibition ability, and was shown to inhibit ROS production in all treatment groups (1-10 ㎍ / ㎖).

[0104]

[0105] <Example 5. Wound healing efficacy - scratch assay>

[0106] Human dermal fibroblasts were cultured in a 24-well plate (corning) for 1 day (37°C, CO25%), scraped with a Scar™ Scratcher (SPL), and washed with HBSS (Hank's Balanced Salt Solution, Gibco). The medium was replaced with serum-free medium (IMDM; Iscove's Modified Dulbecco's Medium, Welgene), and the samples were treated at different concentrations and cultured in an incubator at 37°C, CO25% for 25 hours.

[0107] To represent the results of each cell photograph, the wound closure value was calculated using ImageJ and shown in Fig. 5a, and the cell photographs for each sample were taken with a microscope (Leica) immediately after scratching with a scratcher and after 25 hours of culture and shown in Table 10 and Fig. 5b.

[0108] Wound closure area (%)SampleConc.Averagecontrol compared to (%)Stdev.p-valuecontrol16.8100.00.531.0000FBS 0.1%33.3198.33.360.0011Rice bran PDRN(㎍ / ㎖)1027.8165.41.120.0001Salmon PDRN (㎍ / ㎖)1019.2114.20.570.0176

[0109] As shown in Table 10 and Fig. 5, the rice bran PDRN extracted in the present invention significantly increased cell regeneration effects by showing 27% (165.5% when converted to 100% of the control group) enhanced cell growth in the closed wound area at 10 ㎍ / ㎖ compared to the control. On the other hand, salmon PDRN showed a very minimal cell regeneration effect in comparison.

[0110]

[0111] <Example 6. Confirmation of PAR-2, MTNR1A, and Bmal-1 expression>

[0112] Example 6-1. Confirmation of PAR-2 ​​gene expression

[0113] PAR-2 ​​(protease activated receptor-2) is a gene involved in the recovery of damaged skin barrier and melanosome transport. When the barrier is damaged, the pH of the stratum corneum rises, which activates PAR-2.

[0114] HaCaT cells (Human keratinocyte cells), which are keratinocytes, were seeded in a 60 mm dish and cultured for 24 hours. After replacing with fresh medium, the samples were treated at various concentrations and cultured for 8 hours. After washing with PBS (phosphate buffered saline), the cultured cells were treated with QIAzol Lysis Reagent (QIAGEN) and RNA was extracted using the method provided by the manufacturer. The isolated RNA was analyzed using Qubit™ After quantification using a fluorometer with RNA BR Assay kit, cDNA was synthesized and real-time PCR was performed. cDNA synthesis was performed using the qPCRBIO cDNA Synthesis Kit and the experiment was performed according to the kit's instructions. Real-time PCR was performed using 2x qPCRBIO SyGreen Blue mix Lo-ROX to amplify the housekeeping genes β-Actin and PAR-2, and then quantitatively analyze the amplification products.

[0115] PrimerSenseAntisensePAR-25'- CCA CCT ATC ACT TCA GAT CAA CAA A -3'5'- TTC CTG TAG GCC AGT GTC AAA AT -3'β-actin5'-GGC ACC CAG CAC AAT GAA G-3'5'-CCG ATC CAC ACG GAG TAC TTG-3'

[0116] PAR-2 ​​mRNA expression level (%)SampleConc.AverageStdev.p-valuecontrol40.843.350.0000UVB 30 mJ / ㎠100.000.001.0000UVB + Niacinamide (㎍ / ㎖)10081.522.160.0001UVB + Rice bran PDRN (㎍ / ㎖)194.940.440.0000579.861.790.00001070.444.740.0004

[0117] As shown in Table 12 and Figure 6a, it was confirmed that brown rice PDRN has a skin tone-up effect by suppressing the expression of PAR-2 ​​mRNA, a melanosome transport-related factor that creates a dark and dull skin tone, in a concentration-dependent manner.

[0118]

[0119] Example 6-2. Confirmation of MTNR1A protein expression

[0120] The skin maintains cellular condition and health through appropriate repair in a 24-hour cycle. DNA repair, barrier permeability, cell proliferation, and skin penetration primarily occur at night, driven by the circadian rhythm. Furthermore, the natural secretion of melatonin is regulated by the circadian rhythm, creating the sleep cycle. Recently, it has been reported that melatonin directly regulates the circadian clock and declines with aging.

[0121] Melatonin acts through receptors, and melatonin receptors are involved in the production of vitamin D and are essential for melatonin's function (DNA repair) through p53. Recently, it has been reported that melatonin levels / melatonin receptors decrease with aging, increasing sensitivity to UV and oxidative stress, which can lead to skin damage.

[0122] Next, we confirmed the effect of brown rice PDRN on the protein expression level of MTNR1A (melatonin receptor 1A).

[0123] For this purpose, human dermal fibroblasts derived from newborns (ATCC CRL-2076, CCD-1064 Sk) and 46-year-old adult (ATCC, CRL-2106, CCD-1090Sk) fibroblasts were used as young / young cells and senescent cells in the experiment in a 6-well plate (corning).

[0124] The senescent cells and young cells were cultured in 6-well plates, respectively, and then replaced with serum-free medium. The samples were treated and further cultured in a 37°C, 5% CO2 incubator for 48 hours. The cells were scraped with a cell scraper, and proteins were extracted using RIPA (thermos) buffer. The extracted intracellular proteins were quantified, subjected to SDS-PAGE, and transferred to a membrane. After blocking with skim milk and washing with TBST, the primary antibody [melatonin receptor antibody (abcam)] was incubated overnight at 4°C. After washing with TBST, the secondary antibody (BIO-RAD) was treated, and ECL solution was treated, and the bands were confirmed using Chemi doc. The results are shown in Table 13 and Figures 6b to 6c. Each sample treatment group was subjected to the conditions in Table 13, and 1 μM melatonin (MEL) was treated as a positive control.

[0125] cellSampleMTNR1 protein expression level (%)Conc.AverageStdev.p-valueYoung cell194.24.000.0023Old cellRice bran PDRN(㎍ / ㎖)0100.00.001.00001137.531.480.13095192.30.820.000010206.428.030.0278Melatonin (μM)1133.32.180.0864

[0126] Referring to Table 13 and Figures 6b and 6c, rice bran PDRN appears to increase MTNR1A expression, which is reduced in aged cells, and this level is restored to the level of young / infant cells. This demonstrates that rice bran PDRN improves sleep cycles by activating reduced melatonin (MEL), and influences skin repair and skin tone-up effects.

[0127]

[0128] Example 6-3. Confirmation of Bmal-1 (Brain and Muscle Arnt-Like / Arntl) Gene Expression - Related to Sleep Beauty-Circadian Clock (Night-Repair)

[0129] The skin's light-dark cycle, a 24-hour cycle, is driven by core clock genes that are expressed differently during daytime and nighttime. This process, known as the skin's circadian rhythm, not only maintains skin homeostasis but also restores overall skin functions, including skin repair, hydration, proliferation, and barrier function. Bmal-1, a transcription factor and core component of the skin's circadian rhythm (core day-night rhythm mechanism), is primarily expressed at night and serves as a crucial link connecting intracellular metabolic activity. Bmal-1 deficiency and alteration are associated with increased reactive oxygen species, decreased cell lifespan, weakened skin barrier, premature aging, and decreased lifespan. It has been reported that UVB damage specifically reduces gene expression. Studies have shown that Bmal-1 also influences cell proliferation and melatonin secretion in the skin, suggesting that it may influence skin cell homeostasis and sleep.

[0130] In this study, based on previous studies, a reduced expression pattern of Bmal-1, one of the core clock genes, was observed due to skin cycle altered by UVB, and in the present invention, the efficacy of activating skin biorhythm can be confirmed by confirming the gene expression level due to treatment with rice bran PDRN.

[0131] Human keratinocyte cells were seeded in a 6-well plate and cultured for 24 hours. After replacing with fresh medium, the samples were treated at different concentrations and cultured for 24 hours. After UVB irradiation, the cells were cultured in an incubator at 37°C and 5% CO2, washed with PBS (phosphate buffered saline), and RNA was extracted from the cultured cells using the method provided by the manufacturer by treating them with QIAzol Lysis Reagent (QIAGEN). The isolated RNA was extracted using Qubit™ After quantification using a fluorometer with RNA BR Assay kit, cDNA was synthesized and real-time PCR was performed. cDNA synthesis was performed using the qPCRBIO cDNA Synthesis Kit and the experiment was performed according to the kit's instructions. Real-time PCR was performed using 2x qPCRBIO SyGreen Blue mix Lo-ROX to amplify the housekeeping genes β-Actin and Bmal-1, and then quantitatively analyzed the amplification products. The results are shown in Table 15 and Fig. 6d. Retinoic acid was used as a positive control.

[0132] PrimerSenseAntisenseBmal-15'- TGT GGG CGC TCA CTG TGT -3'5'- TTC TGC CTG ATC CTG TCA TCT CT -3'β-actin5'-GGC ACC CAG CAC AAT GAA G-3'5'-CCG ATC CAC ACG GAG TAC TTG-3'

[0133] Bmal-1 mRNA expression level (%)SampleConc.AverageStdev.p-valueUntreated skin728.168.440.0000UVB 30 mJ / ㎠100.00.001.0000UVB + Retionic acid (μM)0.5150.57.110.0003UVB + Rice bran PDRN (㎍ / ㎖)1192.13.390.00005188.617.110.000910254.632.750.0012

[0134] As shown in Table 15 and Figure 6d, Bmal-1 gene expression was found to increase due to rice bran PDRN treatment. This confirms the efficacy of UVB irradiation-induced biorhythm imbalance to improve Bmal-1 gene expression that has been reduced.

[0135] That is, the results of Examples 6-2 and 6-3 show that brown rice PDRN increases the expression of Bmal-1, which is activated at night, and activates the melatonin receptor and melatonin level, which are down-regulated in aged skin, thereby improving the circadian sleep cycle and providing overnight skin repair effects, making it a raw material that can help restore the skin overnight.

[0136]

[0137] <Example 8. Confirmation of the skin regeneration efficacy of rice bran PDRN>

[0138] Laminin 5 is produced exclusively by keratinocytes and plays a crucial role in firmly holding the epidermis and dermis together, providing stability to the skin's basement membrane. Furthermore, producing laminin 5 in damaged skin strengthens communication between the epidermis and dermis, promoting regeneration of the damaged area. Note: Recently, laminin 5 has been renamed laminin 332.

[0139] Collagen type XVII (COL-XVII) is important for the attachment of keratinocytes to the basement membrane (BM) and plays a role in holding the epidermal-dermal space by combining with collagen type IV. When the expression of collagen type XVII decreases, epidermolysis bullosa appears.

[0140] Accordingly, A431 (keratinocyte) cells were prepared under the same conditions as Example 7, but before treating with rice PDRN, 50 mJ / cm of UVB 2 was investigated. After that, the cells were treated with rice PDRN, and 25 hours later, the expression of Laminin 5 and collagen type XVII (COL-XVII) proteins, which are factors related to skin regeneration, was confirmed through Western blot.

[0141] The results are shown in Table 16, Table 17 and Figure 7.

[0142] Laminin 5 protein expression (%)SampleConc.Aver.Stdev.p-valueControl343.627.170.0005UVB 50 mJ / ㎠ 100.06.031.0000UVB + Rice bran PDRN (㎍ / ㎖)1183.019.430.00515310.821.280.0004UVB + Salmon PDRN (㎍ / ㎖)152.10.380.00185106.412.290.4765UVB + Vitamin C (㎍ / ㎖)75152.60.550.0014

[0143] Laminin 5 protein expression (%)SampleConc.Aver.Stdev.p-valueControl343.627.170.0005UVB 50 mJ / ㎠ 100.06.031.0000UVB + Rice bran PDRN (㎍ / ㎖)1183.019.430.00515310.821.280.0004UVB + Salmon PDRN (㎍ / ㎖)152.10.380.00185106.412.290.4765UVB + Vitamin C (㎍ / ㎖)75152.60.550.0014

[0144] Western blot result bands and their numerical results showed that the expression of Laminin 5 and Collagen type XVII (COL-XVII) proteins was significantly reduced in cells damaged by UVB treatment, but it was confirmed that most of them were restored to normal levels or expressed higher when treated with rice bran PDRN. In particular, the difference in the expression of Laminin 5 was very significant when treated with rice bran PDRN compared to salmon PDRN.

[0145]

[0146] <Example 9. Confirmation of the skin barrier improvement effect of rice bran PDRN>

[0147] OCDN (Occludin) is a TJ (tight junction) protein present in the epidermal layer and plays a key role in maintaining skin barrier function as a TJ (tight junction) barrier. Therefore, using rice bran PDRN, we directly confirmed the protein expression level of OCDN (Occludin) within cells.

[0148] To this end, normal human keratinocyte cells were fixed with a 4% paraformaldehyde solution, permeablized with a 0.2% Triton X-100 solution, and then immunostained sequentially with anti-OCDN antibody and secondary fluorescent antibody. Images were acquired using a fluorescence microscope, and each result value was expressed numerically.

[0149] Occludin protein expression (%)SampleConc.Aver.Stdev.p-valueControl224.41.520.0000Damaged skin100.01.711.0000UVB + Rice bran PDRN (㎍ / ㎖)1152.74.800.00015181.12.850.000010181.32.650.0000

[0150] As a result, when examining Table 18 and Figure 8, it can be confirmed that when treated with brown PDRN, the expression of OCDN protein in skin damaged by UVB treatment is restored to a normal level.

Claims

1. A cosmetic composition for improving skin tone and whitening, characterized by containing PDRN (polydeoxyribonucleotide) extracted from rice bran.

2. In paragraph 1, The above PDRN is a cosmetic composition for improving skin tone and whitening, characterized by having melanin production inhibition and secretion effects.

3. In paragraph 1, The above PDRN is a cosmetic composition for improving skin tone and whitening, characterized in that it has the effect of inhibiting the expression of the PAR-2 ​​(protease activated receptor-2) gene, which is a factor related to melanosome movement.

4. In paragraph 1, The above PDRN is a cosmetic composition for improving skin tone and whitening, characterized in that it has the effect of restoring aged skin to a young skin state.

5. In paragraph 1, The above PDRN is a cosmetic composition for improving skin tone and whitening, characterized in that it has an effect of inhibiting the expression of MTNR1 (melatonin receptor 1A) protein.

6. In paragraph 1, A cosmetic composition for improving skin tone and whitening, characterized in that the above PDRN has the effect of activating the biorhythm of skin cells during sleep and restoring damaged skin cells.

7. In paragraph 1, The above PDRN is a cosmetic composition for improving skin tone and whitening, characterized in that it has the effect of inhibiting Bmal-1 gene expression.

8. In paragraph 1, The above PDRN is a cosmetic composition for improving skin tone and whitening, characterized by having antioxidant properties and ROS (reactive oxygen species) scavenging ability.

9. In paragraph 1, The above PDRN is a cosmetic composition for improving skin tone and whitening, characterized by having a skin regeneration effect due to strengthening of the basement membrane between the epidermis and the dermis.

10. In paragraph 1, The above PDRN is a cosmetic composition for improving skin tone and whitening, characterized in that it has the effect of increasing protein expression of Laminin 5.

11. In paragraph 1, The above PDRN is a cosmetic composition for improving skin tone and whitening, characterized in that it has the effect of increasing protein expression of collagen type XVII (COL-XVII).

12. In paragraph 1, The above PDRN is a cosmetic composition for improving skin tone and whitening, characterized in that it has a skin barrier improvement effect.

13. In paragraph 1, The above PDRN is a cosmetic composition for improving skin tone and whitening, characterized in that it has the effect of increasing the protein expression of OCDN (Occludin).

Images