Combinatorial dense probes for identifying subsets of microorganism species in clinical samples.

Abstract

The present invention provides method for detecting and classifying a microorganism in a biological sample by a nucleic acid amplification reaction, using broad-taxonomic-range amplification primers and at least two nucleic acid detection probes that detect amplicons of distinct selections of a defined group of microorganism species that is to be detected, and wherein the combination of signals from said detection probes partitions the group of microorganism species into subsets whereby each microorganism species is in one and only one subset, and wherein the microorganism species is classified as a member of the subset.

Description

[0001] P137210PC00 Title: Combinatorial dense probes for identifying subsets of microorganism species in clinical samples. FIELD OF THE INVENTION The present invention is in the field of microbial diagnostics, in particular directed to high-throughput screening of clinical samples, such as urine and blood samples, for the presence of specific microorganisms and identification of microorganisms present in clinical samples. The invention relates to methods of rapid microbial detection and identification based on DNA analysis of PCR amplified DNA or RNA sequences, such as Internal Transcribed Spacer (ITS) regions in rRNA genes. In particular, the invention relates to a method for detecting and classifying a microorganism present in a biological sample by a nucleic acid amplification reaction using oligonucleotide probes for analysis of the amplification product. Further, a selection of probes and kits of parts comprising the probes for performing the method of the invention are provided. BACKGROUND OF THE INVENTION In clinical settings, bacterial infection in body fluids is typically diagnosed by classic culture techniques including biochemical and metabolic profiling. These techniques are insufficiently sensitive and require at least 24 to 48 hours to identify the bacterial species involved. More advanced molecular techniques are readily available for the identification of the cause of infection, and information on the appropriate antibiotic therapy may also be obtained based on the presence of resistance markers. Molecular techniques for bacterial detection and identification generally involve various Nucleic Acid Amplification Techniques (NAAT), optionally in combination with next-generation sequencing (NGS) and comparison of the obtained sequences to a database of known bacterial sequences. In blood testing, the presence of large amounts of human DNA affects both sensitivity and specificity of these tests, and PCR amplification and subsequent detection of pathogen-specific DNA, such as bacterial 16S rDNA, is needed to overcome this problem. To enable detection of pathogens at a high level of specificity, such as at the genus or species level, this target specificity must be addressed in the assay, either pre- or post-amplification. In a conventional PCR detection assay, use can be made of one or more sets of species-specific PCR amplification primers, preferably in a multiplex format to allow parallel detection of multiple pathogens. Alternatively, PCR amplification of bacterial sequences may be performed using a set of broad- taxonomic-range PCR primers followed by post-amplification detection of species-specific sequences in the amplicon, such as by NGS. Currently, there are several commercial culture-independent diagnostic platforms available for use in clinical practice that are based on PCR and NGS technology. However, these molecular diagnostics methods generally demonstrate either increased sensitivity at the expense of specificity, or acceptable specificity with moderate sensitivity. Improvement may be expected from technological advances in PCR and NGS machinery, but these may not be affordable for most clinical laboratories. There is, therefore, still a need to improve culture-independent diagnostic methods. It is generally recognized that quantitative PCR (qPCR), as widely applied and standardized in high-throughput analysis, is suitable for routine screening of clinical samples, but that the degree of multiplexing needed for species-specific detection of most clinically relevant pathogens is hampered by the limited analysis capacity of any PCR instrument. In addressing the analysis capacity of qPCR without loss of specificity, WO2013116780 and WO2020010137 propose to measure multiple analytes per PCR color channel using a combinatorial scheme whereby individual analytes are detected at distinct end-point fluorescence intensities or ranges thereof, for instance, by using different probe concentrations for different analytes. These methods do not require further post-amplification analysis steps, but rely solely on species-specific primer and / or probe hybridizations during or after PCR amplification. The multitude of primer / probe sets needed for species-specific detection of most clinically relevant pathogens, however, still hampers broad application of this method, especially in daily practice, as the limited number of color channels in a PCR machine restricts the number of simultaneous detections, and because high loads of oligonucleotides in a reaction mixture have an adverse effect on the assay. WO2021112673 describes a qPCR amplification method wherein PCR primers against conserved bacterial genomic regions are used to generate a broad-taxonomic-range amplicon of a microbial rRNA internal transcribed spacer (ITS) region, and wherein information of the species identity is derived from the high-resolution melting curve profile and the fragment length of the amplicon. The need for amplicon length determination, which is a post-amplification analysis, is due to the similarity between melting curves of different bacterial species, even in the case of ribosomal DNA ITS amplicons, in combination with inter-assay variability in the melting curve profile for a single species due to biological variation and equipment noise. This inherent analytical and biological variation may result in an overlap of the observed high-resolution melting curves of the amplicons obtained from different species and may lead to misidentification. Although resulting in accurate identification of the bacterial species in many cases, that is, for many different pathogenic species, the post-amplification amplicon length analysis capacity cannot keep pace with qPCR amplicon generation, limiting high-throughput application in clinical settings. In fact, each post- amplification analysis step adds complexity, time, and costs to the process. Moreover, each post-amplification analysis step adds logistical demands and harbors the problem of contaminating the assay-environment with amplicons. At present, there still exists a need for a high-throughput assay for detection of microorganisms in clinical samples by PCR, with as few downstream analysis steps as possible, and which allows for accurate identification of many hundreds of different species in a single assay, preferably in less than 4 hours. Especially there is a need to provide a high- throughput assay for detection of microorganisms from a comprehensive list of candidate microorganisms wherein the assay comprises the least number of reagents as possible (such as primers, probes, etc.) in order to minimize the risk of disturbances, non-specific reactions and background noise in the assay. SUMMARY OF THE INVENTION The present inventors have now realized that downstream analysis of the amplification product after nucleic acid amplification (such as by PCR or qPCR) is the bottleneck in high-throughput screening of clinical samples for (infectious) microbes. In order to address this problem, the solution is not in preventing the need for downstream processing and analysis altogether, but rather in collecting more information from a single amplification product. It was determined by the present inventors that increasing the level of informative data that is obtained from a single amplification reaction (e.g. from a single-well or from a closed-tube PCR assay), will lower the downstream analysis capacity requirement by a factor of 10 or more. A lower downstream analysis capacity requirement brings high-throughput analysis of hundreds or thousands of clinical samples within reach of all laboratories with a standard PCR inventory. The present inventors have realized that a combination of detection probes that target various sequences in an amplicon can be used for detection of specific microorganism, and that such a combination of probes can be designed in a manner that results in an increase in the informative data from a single amplification reaction. The complex design of the combination of detection probes facilitates a multiplexed detection analysis of microorganism species in clinical samples. Surprisingly, the present inventors have discovered that, rather than using species-specific detection probes, a combination of multiple probes can be designed in such a way that each of the probes detects multiple known species from a group that is to be detected, wherein the detection signals of the probes together form a combinatorial partition of distinct sets and wherein each microorganism species from the group is present in one and only one of the sets. The inventors named this design a combinatorial dense probes design. The use of combinatorial dense probes allows for the detection and identification of a high number of (pathogenic) microorganisms in a biological sample, either at species level or in groups, by the use of a single nucleic acid amplification reaction and the use of a relatively low number of distinct detection probes. A high number of distinct detection probes, which is required when using only species-specific probes (i.e., probes that detect only one microorganism species), may often negatively impact an amplification reaction, such as a polymerase chain reaction (PCR), due to probe interferences, increased background noise, unspecific reactions, etc., hampering accurate identification and detection. The present invention provides in a first aspect a method for detecting and classifying a microorganism present in a biological sample by a nucleic acid amplification reaction, said method comprising the steps of: a) providing a biological sample that has been obtained and which is suspected of comprising a microorganism, and optionally isolating nucleic acids from said biological sample; b) defining a group of N microorganism species the presence of at least one of which is to be determined in said biological sample wherein N is greater than two; c) providing a reaction container comprising a nucleic acid amplification reaction mixture comprising: (i) an aliquot of said biological sample or nucleic acids isolated therefrom; (ii) at least one pair of broad-taxonomic-range amplification primers for amplifying a variable and / or hypervariable region in a conserved microbial gene from the, optionally isolated, nucleic acids in said sample and for generating an amplicon, preferably wherein said amplicon differs between each of said N microorganism species, (iii) at least two nucleic acid detection probes, -wherein each of said detection probes detects the amplicon of asubgroup selection of at least two microorganism species selected from said group of N microorganism species, -wherein said at least two detection probes comprise a detectablelabel for generating a detection signal when the probe target sequence is present in the amplicon, and wherein the detection signals of said at least two detection probes are individually detectable and together provide a combination of at least two different detection signals based on the presence or absence of the probe target sequence in the amplicon, -wherein said combination of said at least two different detectionsignals partitions said group of N microorganism species into M subsets wherein each microorganism species of said group of N microorganism species is in one and only one of these M subsets, d) performing a nucleic acid amplification reaction on the mixture of step c) for generating an amplicon, e) allowing said probes to detect their respective target sequence in said amplicon, and recording the detection signal of each of said detection probes, f) classifying a microorganism present in said biological sample on the basis of the subset-specific combination of detection signals of said detection probes recorded in step e), wherein said microorganism species is classified as a member of one distinct subset within the M subsets. In a preferred embodiment of a method of the invention, steps d) and e) are carried out in the same single closed reaction container. In another preferred embodiment of a method of the invention, the reaction mixture comprises a DNA intercalating dye, and step e) further comprises recording the signal of the DNA intercalating dye and establishing the presence or absence of an amplicon based on a recorded signal of the DNA intercalating dye, and wherein the presence or absence of an amplicon establishes the presence or absence of a microorganism in said biological sample, preferably wherein the signal of the DNA intercalating dye is different from the detection signal of said detection probes. In another preferred embodiment of a method of the invention, said variable and / or hypervariable region in a conserved microbial gene comprises at least a part of an rDNA internal transcribed spacer (ITS) region, preferably at least a part of the 16S-23S rDNA-ITS, more preferably the complete 16S-23S rDNA-ITS region. In another preferred embodiment of a method of the invention, said at least two detection probes each comprise a targeting sequence the nucleic acid sequence of which comprises at least 50%, preferably at least 80%, more preferably at least 90%, still more preferably at least 95% sequence identity to a target sequence in the amplicon or the reverse complement thereof, and wherein the targeting sequences of said at least two detection probes is identified by: a) providing a database comprising nucleic acid sequences of said amplicon predicted to be generated in step e) annotated to each microorganism species in the group of N microorganism species; b) having a computer program select target sequences for each of said at least two detection probes in said predicted amplicon sequences of the group of N microorganism species, wherein said target sequences have a length of about 15-40, preferably from about 20-30 consecutive bases, and wherein said target sequence is present in a subgroup selection of at least two microorganism species selected from said group of N microorganism species, and wherein said target sequence is not present in any other microorganism species from said group of N microorganism species, to thereby provide nucleic acid targets for the detection probes in the amplicon. The subgroup selection of at least two microorganism species selected from said group of N microorganism species is based on the presence in their amplicon of one or more common targets for one or more combinatorial dense probes as detection probes as defined herein, preferably wherein the one or more combinatorial detection probes that define a first subgroup selection comprise detectable labels of which the detection signals are detectable in a first single color channel, and wherein the one or more combinatorial detection probes that define a second subgroup selection comprise detectable labels of which the detection signals are detectable in a second single color channel. The combination of detection signals of the combinatorial detection probes in the first and second single color channel define a subset partitioning of the group of N microorganism species. In preferred embodiments of aspects of the invention, the subset as defined by the combination of said at least two different detection signals is comprised of multiple microorganism species of which the high resolution melting curves (hrMCs) of their respective amplicons have distinguishable profiles. In another preferred embodiment of a method of the invention, step d) and e) are performed on a PCR instrument comprising distinct color channels for detecting distinct detection signals from said at least two detection probes and wherein the detection probes in said reaction mixture generate between 2 and X distinct detection signals, wherein X is the number of distinct color channels of the PCR instrument. In another preferred embodiment of a method of the invention, the detection probes comprise degenerate probes. Alternatively, two or more detection probes that have similar or identical detectable labels (e.g. that are detected in the same color channel of the PCR instrument) together target said distinct selection of microorganism species from said group of N microorganism species. In another preferred embodiment of a method of the invention, the biological sample is selected from whole blood, serum, synovial fluid, plasma, urine, and cerebrospinal fluid / liquor. In another preferred embodiment of a method of the invention, the nucleic acid amplification reaction is a polymerase chain reaction (PCR), preferably a quantitative polymerase chain reaction (qPCR). In another aspect, the present invention provides a kit of parts comprising at least two nucleic acid detection probes, wherein each of said detection probes detects the amplicon of a distinct selection of at least two microorganism species from a group of at least three microorganism species the presence of at least one of which group is to be determined in a biological sample, wherein said amplicon is obtainable by performing a nucleic acid amplification reaction on an aliquot of said biological sample or nucleic acids isolated therefrom using at least one pair of broad-taxonomic-range amplification primers for amplifying a variable and / or hypervariable region in a conserved microbial gene from the, optionally isolated, nucleic acids in said sample and for generating an amplicon, preferably wherein said amplicon comprises the 16S-23S rDNA-ITS, wherein said at least two detection probes comprise a detectable label for generating a detection signal when the probe target sequence is present in the amplicon, and wherein the detection signals of said at least two detection probes are individually detectable and together provide a combination of at least two different detection signals based on the presence or absence of the probe target sequence in the amplicon, wherein said combination of said at least two different detection signals partitions said group of at least three microorganism species into distinct subsets wherein each microorganism species of said group of at least three microorganism species is in one and only one of these distinct subsets, and wherein the total number of detection probes is smaller than the number of distinct subsets. In preferred embodiments of aspects of this invention, the detection probes are hydrolysis probes. In other preferred embodiments in aspects of this invention, the detection probes comprise a fluorophore label detectable by at least one color channels of a PCR or qPCR instrument. In preferred embodiments of aspects of this invention, the at least two detection probes comprise 3 detection probes for detecting the presence or absence of 8, preferably 7, distinct (subsets of) microorganism species in said biological sample. In other preferred embodiments of aspects of this invention, the at least two detection probes comprise 4 detection probes for detecting the presence or absence of 16, preferably 15, distinct (subsets of) microorganism species in said biological sample. In other preferred embodiments of aspects of this invention, the at least two detection probes comprise 5 detection probes for detecting the presence or absence of 32, preferably 31, distinct (subsets of) microorganism species in said biological sample. In other preferred embodiments of aspects of this invention, the at least two detection probes comprise 3, 4, 5, or more detection probes for detecting the presence or absence of respectively 8, 16 or 32 or 2^xdistinct microorganism species or groups of microorganism species in said biological sample wherein x is the number of distinct color channels in the instrument used for detecting the probe detection signals. In other preferred embodiments of aspects of this invention, the total number of detection probes needed for detecting and classifying each microorganism species from said group of N microorganism species is divided over multiple separate reaction containers, that may be analysed in parallel, such that in each separate reaction container the number of distinct detection signals obtained from the detectable labels of the detection probes is no more than x, preferably x-1, wherein x is the number of distinct color channels in the instrument used for detecting the probe detection signals. In a preferred embodiment of a kit of part of the present invention, said kit of parts further comprises a pair of broad-taxonomic- range amplification primers for amplifying a variable and / or hypervariable region in a conserved microbial gene from a microorganism species as defined herein. The present invention provides improved methods for detecting and / or identifying a high number of (pathogenic) microorganisms. Further, the present invention provides a single closed-tube amplification and detection system for detecting and / or identifying a high number of pathogenic microorganisms in a biological sample by a single nucleic acid amplification reaction. DESCRIPTION OF DRAWINGS Figure 1 shows an example of the method of the present invention using two dense detection probes having two different detectable labels which results in three distinct subsets of microorganism-species. High- resolution melting curve (hrMC) clash matrix of the 14 microorganism species having the color coding according to the defined subsets. Figure 2 shows an example of the method of the present invention using four dense detection probes having three different detectable labels which results in five distinct subsets selected from 14 microorganism species. High-resolution melting curve (hrMC) clash matrix of the 14 microorganism species having the color coding according to the defined subsets. Figure 3 shows an exemplary partitioning matrix for three color channels resulting in 8 possible subsets wherein the microorganism species may be partitioned. Figure 4 shows an embodiment of the use of combinatorial dense probes in accordance with aspects of this invention wherein a group of 50 individual microorganism species are partitioned into 7 distinct subsets using 6 probes, wherein probes 1 and 2 both have (a detectable label providing a detection signal having) a first color (e.g. red), probes 3 and 4 have a second color (e.g. green), and probes 5 and 6 have a third color (e.g. blue). “0” indicates no signal or “off”, “1”indicates positive signal. The permutation all channels off was not used in this example. Figure 5 provides the mathematical description of the method of the present invention. DETAILED DESCRIPTION OF THE INVENTION The present invention provides a method for detecting and classifying a microorganism present in a biological sample by a nucleic acid amplification reaction, said method comprising the steps of a) providing a biological sample that has been obtained and which is suspected of comprising a microorganism, and optionally isolating nucleic acids from said biological sample; b) defining a group of N microorganism species, the presence of at least one of which is to be determined in said biological sample, wherein N is greater than two; c) providing a reaction container comprising a nucleic acid amplification reaction mixture comprising: (i) an aliquot of said biological sample or nucleic acids isolated therefrom; (ii) at least one pair of broad-taxonomic-range amplification primers for amplifying a variable and / or hypervariable region in a conserved microbial gene from the, optionally isolated, nucleic acids in said sample and for generating an amplicon, preferably wherein said amplicon differs between each of said N microorganism species, and (iii) at least two nucleic acid detection probes, wherein each of said detection probes detects the amplicon of a subgroup selection comprising at least two microorganism species selected from said group of N microorganism species, wherein said at least two detection probes comprise a detectable label for generating a detection signal when the probe target sequence is present in the amplicon, and wherein the detection signals of said at least two detection probes are individually detectable and together provide a combination of at least two different detection signals based on the presence or absence of the probe target sequence in the amplicon, wherein said combination of said at least two different detection signals partitions said group of N microorganism species into M subsets wherein each microorganism species of said group of N microorganism species is in one and only one of these M subsets, d) performing a nucleic acid amplification reaction on the mixture of step c) for generating an amplicon, e) allowing said probes to detect their respective target sequence in said amplicon, and recording the detection signal of each of said detection probes, and f) classifying a microorganism present in said biological sample on the basis of the subset-specific combination of detection signals of said detection probes recorded in step e), wherein said microorganism species is classified as a member of one distinct subset within the M subsets. In aspects of the invention, the total number of detection probes is preferably smaller than M, the number of subsets. Steps c) and d) are preferably carried out in the same single closed reaction container. The subgroups selection of microorganisms species from the group of N microorganism species, the provision of the at least two detection probes for these subgroup selections, and the detection capacity of the detection instrument to detect different detection signals from these probes, ensures that each unique combination of detection signals identifies the presence of one and only one subset of the M subsets. Depending on the number of sensors or color channels in a detection instrument, which constraints the number of detection signals, the maximum number of subsets in a partition in accordance with the present combinatorial dense probe design is 2^x, wherein x is the number of color channels. Hence, in a method of the invention the group of N microorganism species is divided into subgroup selections such that each microorganism species from the group of N microorganism species is detected by at least one detection probe. These detection probes preferably target multiple species, but may also target single species. At least two detection probes detect at least two species. The number of individual species that can then be partitioned into distinct subsets, defined on the basis of their combined detection signals for the individual combinatorial dense probes, is 2^x. If the group of N microorganism species is larger than M (2^x), and species identification to the species level is required, additional probes and additional color channels are needed. If the maximum number of color channels is already used, additional color channels can be readily made available by performing a parallel amplification reaction with the additional probes, in order to allow for the partitioning of the original group of N microorganism species into more subsets. Each subset may comprise 0, 1 or multiple species, for species-level identification each subset should contain 1 species, such that the minimum number of probes for detecting, e.g., 45 species at species level is 6 probes, which can easily be divided over 2 parallel reactions. Preferably, the subset wherein all probes are “off” (no target detected) is not used. Further, the invention provides a selection of combinatorial detection probes which are subgroup-specific and may be used in a method of the invention, as well as a kit of parts comprising a selection of at least two combinatorial detection probes in accordance with the invention. The kit of parts may further comprise at least one pair of broad-taxonomic-range amplification primers for amplifying a variable and / or hypervariable region in a conserved microbial gene from the, optionally isolated, nucleic acids in said sample and for generating an amplicon. In the following, the features of the invention will be described in more detail. It should be understood that embodiments may be combined in any manner and in any number to create additional embodiments. The variously described examples and embodiments should not be construed to limit the invention to only the explicitly described embodiments. This description should be understood to support and encompass embodiments which combine the explicitly described embodiments with any number of the disclosed features. Furthermore, any permutations and combinations of all described features in this application should be considered disclosed by the description of the present application unless the context indicates otherwise. Throughout this specification and the claims, unless the context requires otherwise, the word "comprise", and variations such as "comprises" and "comprising", will be understood to imply the inclusion of a stated member, integer or step or group of members, integers or steps but not the exclusion of any other member, integer or step or group of members, integers or steps. The terms "a" and "an" and "the" and similar reference used in the context of describing the invention (especially in the context of the claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by the context. Recitation of ranges of values herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each individual value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., "such as", “for example”, and “may”), provided herein is intended merely to better illustrate the invention and does not pose a limitation on the scope of the invention otherwise claimed. No language in the specification should be construed as indicating any non-claimed element essential to the practice of the invention. All documents cited or referenced herein (“herein cited documents”), and all documents cited or referenced in herein cited documents, together with any manufacturer's instructions, descriptions, product specifications, and product sheets for any products mentioned herein or in any document incorporated by reference herein, are hereby incorporated herein by reference, and may be employed in the practice of the invention. More specifically, all referenced documents are incorporated by reference to the same extent as if each individual document was specifically and individually indicated to be incorporated by reference. For the purpose of clarity and a concise description, features are described herein as part of the same or separate embodiments, however, it will be appreciated that the disclosure includes embodiments having combinations of all or some of the features described. Definitions The term “nucleic acid sequence”, or “nucleotide sequence”, which terms can be used interchangeably herein, refers to the base sequence of a DNA or RNA molecule in single or double stranded form, such as a DNA sequence encoding an ITS region of the ribosomal RNA gene. The term “nucleic acid sequence” is for example also used to refer to a DNA or RNA molecule. An "isolated nucleic acid sequence" refers to a nucleic acid molecule which is no longer in the natural environment from which it was isolated. The term inter alia refers to a nucleic acid molecule that has been separated from at least about 50%, 75%, 90%, or more of proteins, lipids, carbohydrates, or other materials with which it is naturally associated, e.g. in a microbial host cell. The term “microbial”, as used herein, refers to an element as originating from a microorganism, or microbe, which generally refers to an organism that is microscopic, which means too small to be seen by the unaided human eye. Microorganisms in the context of this invention include archaea, bacteria, viruses, protozoa, and fungi. Preferably, a microorganism is a (opportunistic) pathogenic microorganism capable of causing disease, preferably selected from pathogenic bacteria, viruses, protozoa, or fungi, most preferably pathogenic bacteria or fungi. The term “rDNA internal transcribed spacer (ITS) region” or its equivalent “ITS region of the ribosomal RNA gene”, in short referred to as the “internal transcribed spacer (ITS) region”, as used herein, refers to the spacer DNA situated between the small-subunit ribosomal RNA (rDNA) and large-subunit rDNA genes in the chromosome or the corresponding transcribed region in the polycistronic rDNA precursor transcript of the microorganism. In bacteria and archaea, the rrn operons contain the coding sequences for the 16S rRNA gene, the 23S rRNA gene, and the 5S rRNA gene and may be found in 1–15 copies per genome. The typical gene configuration of a bacterial rRNA operon is 16S-23S-5S rRNA, wherein subunit genes are separated by internal transcribed spacer regions that show a high degree of variability in both sequence and size at the genus and species level. The highly polymorphic nature of these spacer sequences may be analyzed by PCR, using conserved sequences from the adjacent S genes as primers. This method is known as internal transcribed spacer-PCR (ITS- PCR). In preferred embodiments of this invention, the hypervariable region in a conserved microbial gene is the 16S–23S ITS region in bacteria, or the combined ITS1 and ITS2 in eukaryotes (wherein ITS1 is the spacer between the 18S and 5.8S rDNA genes and ITS2 is the spacer between the 5.8S and 28S rDNA genes). Tens of thousands of full-length fungal ITS sequences associated with a Latin binominal are available in GenBank. The 18S nuclear ribosomal small subunit rDNA gene (SSU) is commonly used in phylogenetics of eukaryotic microorganisms such as fungi, and although its homolog (16S) is often used as a species diagnostic for bacteria, it has fewer hypervariable domains in fungi. The 28S nuclear ribosomal large subunit rDNA gene (LSU) sometimes discriminates species on its own. In fungi, the internal transcribed spacer (ITS) region has the highest probability for successful identification of a broad-taxonomic-range of fungi. The nuclear rDNA cistron has been used for fungal diagnostics and phylogenetics for more than 20 years. Although in some preferred embodiments of this invention, the full length ITS of fungi may advantageously be used for eukaryotic microorganisms, use may also be made of either ITS1 or ITS2 in alternative embodiments. In one alternative preferred embodiment of aspects of this invention the internal transcribed spacer (ITS) region is ITS2. The term “fungus”, as used herein, refers to eukaryotic organisms including yeasts, molds, and fleshy fungi (mushrooms). Yeasts are microscopic, unicellular fungi; molds are multinucleated, filamentous fungi (such as mildews, rusts, and common household molds); the fleshy fungi include mushrooms and puffballs. Fungal infections, or mycosis, are diseases caused by pathogenic fungi (yeast or mold). Hence, in preferred embodiments of this invention, fungus refers to yeast or mold. The term “fungus”, as referred to herein, may include species of Aphanoascus, Absidia, Acremonium, Adiaspiromyces, Akanthomyces, Alternaria, Apophysomyces, Arthrobotrys, Arthroderma, Aspergillus, Basidiobolus, Batrachochytrium, Beauveria, Bipolaris, Blastomyces, Candida, Chrysosporium, Cladophialophora, Cladosporium, Clavispora, Clonostachys, Coccidioides, Colletotrichum, Conidiobolus, Coniothyrium, Cryphonectria, Cryptococcus, Cunninghamella, Curvularia, Cutaneotrichosporon, Cyphellophora, Dichotomophthora, Dissitimurus, Emergomyces, Epicoccum, Epidermophyton, Eremothecium, Exophiala, Falciformispora, Fomitopsis, Fonsecaea, Fusarium, Ganoderma, Geotrichum, Gymnoascus, Histoplasma, Ilyonectria, Keratinomyces, Lacazia, Lasiodiplodia, Lecanicillium, Lichtheimia, Lomentospora, Lophophyton, Madurella, Magnusiomyces, Malassezia, Medicopsis, Metarhizium, Microascus, Microsporum, Mortierella, Mucor, Mycocentrospora, Nannizzia, Neocosmospora, Neocucurbitaria, Neoscytalidium, Neotestudina, Nigrograna, Nigrospora, Ochroconis, Ophiostoma, Ovulinia, Paecilomyces, Paracoccidioides, Paraconiothyrium, Peronosclerospora, Phaeoacremonium, Phellinus, Phialemonium, Phialophora, Phoma, Pichia, Pleurostoma, Pneumocystis, Pseudochaetosphaeronema, Pseudogymnoascus, Pyrenophora, Pythium, Quambalaria, Redaellia, Rhinocladiella, Rhinosporidium, Rhizomucor, Rhizopus, Saksenaea, Sarocladium, Scedosporium, Schizophyllum, Sclerophtora, Scopulariopsis, Sporothrix, Stagonosporopsis, Stenella, Syncephalastrum, Talaromyces, Trematosphaeria, Trichoderma, Trichomonascus, Trichophyton, Trichosporon, Tritirachium, Verruconis, and Verticillium spp., as well as teleomorphs and anamorphs thereof. The term “domain”, as used herein, refers to a taxonomic rank, as well as a taxonomic unit, a taxon, in that rank, comprising the domains Bacteria (Eubacteria), Archaea (Archaebacteria), and Eukarya (Eukaryota). The term “Kingdom”, as used herein, refers to a taxonomic rank, including all taxonomic units or taxa in that rank, selected from the kingdoms Bacteria, Archaea, Protozoa, Chromista, Plantae, Fungi, and Animalia. The term “phylum”, as used herein, refers to a taxonomic rank, including all taxonomic units or taxa in that rank, that is below the taxonomic level of the kingdom and domain. The domain or kingdom Bacteria comprises about 40 bacterial phyla that have been validly published according to the Bacteriological Code (Euzéby JP, Parte AC. "Names of phyla". List of Prokaryotic names with Standing in Nomenclature (LPSN), retrieved 3 April 2022). Important phyla of (opportunistic) pathogenic bacteria include Firmicutes, Fusobacterium, Deferribacteres, Spirochaetes, Cyanobacteria, Acidobacteria, Nitrospina, Nitrospirae, Caldithrix, Haloanaerobiales, Verrrucomicrobia, Chlamydiae, Planctomycetes, Gemmimonas, Fibrobacteres, Chlorobi, Bacteroidetes, Proteobacteria (Pseudomonadota), Thermotogae, Corprothermobacter, Synergites, Thermodesulfobacteria, Desulfurobacterium, Aquificae, Deinococcus-Thermus, Chloroflexi, Tenericutes and Actinobacteria. These phyla are known to the person skilled in the art and have been described, inter alia, in Schloss 2004 (Microb. Mol. Biol. Rev.6 (4): 686-691), or in the Bergey manual of systematics of archaea and bacteria (2015, John Wiley & Sons, Inc., Online ISBN: 9781118960608). The term “class”, as used herein, refers to a taxonomic rank, including all taxonomic units comprised therein as a higher order grouping, that is below the level of the phylum. The phylum Proteobacteria, for instance, comprises the classes Acidithiobacillia, Alphaproteobacteria, Betaproteobacteria, Gammaproteobacteria, Hydrogenophilalia, and Zetaproteobacteria. The term “order”, as used herein, refers to a taxonomic rank, including all taxonomic units comprised therein as a higher order grouping, that is below the level of the class. The class Gammaproteobacteria, for instance, inter alia comprises the orders Enterobacterales, Legionellales, Pseudomonadales, and Vibrionales. The term “family”, as used herein, refers to a taxonomic rank, including all taxonomic units comprised therein as a higher order grouping, that is below the level of the order. The order Enterobacterales, for instance, inter alia comprises the families Enterobacteriaceae, Erwiniaceae, Morganellaceae, and Yersiniaceae. The term “genus”, as used herein, refers to a taxonomic rank, including all taxonomic units comprised therein as a higher order grouping, that is below the level of family. The family Enterobacteriaceae, for instance, inter alia comprises the genera Enterobacter, Escherichia, Citrobacter, Klebsiella, Salmonella and Shigella. The term “species”, as used herein, refers to a taxonomic rank, including all taxonomic units comprised therein as a higher order grouping, that is below the level of the genus. The family Klebsiella, for instance, inter alia comprises the species K. aerogenes, K. oxytoca, and K. pneumoniae. The term “subspecies”, as used herein, refers to a taxonomic rank, including all taxonomic units comprised therein as a higher order grouping, that is below the level of the species. The term “strain”, as used herein, refers to the lowest taxonomic rank, that is below the level of the species. The term “strain” includes reference to an “isolate” or a group of isolates exhibiting characteristics that set it apart from other isolates belonging to the same species. The term “polymerase chain reaction (PCR)”, as used herein refers to the well-known in vitro technique to make numerous copies of a specific segment of target DNA from a template DNA - i.e., the DNA that contains the target region to be copied. During the reaction a mixture containing the target DNA, primers, dNTPs, and a heat-stable DNA polymerase is heated to 90-95°C to denature the strands of the target DNA. The solution is cooled to a temperature that allows the primers (single-stranded DNA molecules of about 18 to 30 nucleotides long) to anneal to their complementary sequence on the target DNA and provide the 3'-OH required for DNA synthesis. Subsequently, the DNA polymerase synthesizes a new DNA strand complementary to the target by extending the primer, usually at a temperature of about 72°C. The thermal cycling scheme of denaturing / primer annealing / primer extension is repeated numerous times with the DNA synthesized during the previous cycles serving as a template for each subsequent cycle. The result is a doubling of the target DNA present with each cycle, and exponential accumulation of target DNA sequences over the course of 20-40 cycles. A heating block with an automatic thermal cycler is used for precise temperature control. The method of the invention for example comprises qPCR amplification (also known as real- time PCR), wherein typically the amplification of a targeted DNA molecule is monitored during the PCR (i.e., in real time), using non-specific fluorescent dyes that intercalate with any double-stranded DNA (e.g. SYBR® Green or EvaGreen®), or sequence-specific DNA probes consisting of oligonucleotides that are labelled with a fluorescent reporter for the detection of PCR products in real-time. As used herein, the term "primer" refers to an oligonucleotide, which is capable of acting as a point of initiation of nucleic acid sequence synthesis when placed under conditions in which synthesis of a primer extension product which is complementary to a target nucleic acid strand is induced, i.e., in the presence of different nucleotide triphosphates and a polymerase in an appropriate buffer ("buffer" includes pH, ionic strength, cofactors etc.) and at a suitable temperature. One or more of the nucleotides of the primer can be modified for instance by addition of a methyl group, a biotin or digoxigenin moiety, a fluorescent tag or by using radioactive nucleotides. A primer sequence need not reflect the exact sequence of the template. For example, a non-complementary nucleotide fragment may be attached to the 5' end of the primer, with the remainder of the primer sequence being substantially complementary to the strand. The term primer as used herein includes all forms of primers that may be synthesized including peptide nucleic acid primers, locked nucleic acid primers, phosphorothioate modified primers, labeled primers, and the like. The term "forward primer" as used herein means a primer that anneals to the anti-sense strand of double- stranded DNA (dsDNA). A "reverse primer" anneals to the sense-strand of dsDNA. As used herein, the term "primer pair" refers to a forward and reverse primer pair (i.e., a left and right primer pair) that can be used together to amplify a given region of a nucleic acid of interest. As used herein, the term "probe" refers to an oligonucleotide that interacts with a target nucleic acid via hybridization. A probe is for example fully complementary to a target nucleic acid sequence or partially complementary. The level of complementarity will depend on many factors based, in general, on the function of the probe. Probes are for example labeled or unlabeled, or modified in any of a number of ways well known in the art. A probe will specifically hybridize to its target nucleic acid. Probes are for example DNA, RNA or a RNA / DNA hybrid. Probes are for example oligonucleotides, peptide nucleic acid (PNA), locked nucleic acid (LNA), oligomer of cyclic heterocycles, or conjugates of nucleic acid. Probes comprise for example modified nucleobases, modified sugar moieties, and modified internucleotide linkages. Probes are typically at least about 10, 15, 20, 25, 30, 35, 40, 50, 60, 75, 100 nucleotides or more in length. The term “hydrolysis probe”, as used herein, refers to an oligonucleotide labeled with one or more fluorescent reporters at or near the 5' end and one or more quenchers of fluorescence at or near the 3' end (or vice versa) or at other positions in the oligonucleotide. Hydrolysis probes are also known as Taqman™ probes. The background fluorescence of probe is prevented by the presence of the quencher in close proximity. During the annealing step in PCR, both probe and primers anneal to the DNA target. Once Taq polymerase reaches the probe in the extension step, its 5' to 3' exonuclease activity degrades the probe, breaking the reporter-quencher proximity and thus allowing the emission of fluorescence. The amount of nucleic acid present during each amplification cycle is based on the level of the fluorescence signal, while increase in fluorescent signal is directly proportional to the quantity of exponentially accumulating amplicons produced during amplification. Suitable fluorescent reporters (with emission maxima) for use in aspects of this invention are, for instance, 6-FAM (6- carboxyfluorescein, 520nm), TET (tetrachlorofluorescein, 539nm), YAK (Yakima Yellow®, 549nm), VIC (CAS # 1414265-81-8, 554), SUN (Integrated DNA Technologies, 554nm), HEX (hexachlorofluorescein, 555nm), JOE (5'- dichloro-dimethoxy-fluorescein, 548nm), which may be used in combination with quenchers such as TAMRA (tetramethylrhodamine), Black Hole Quencher 1 (BHQ®-1) or Iowa Black FQ (single-quenched) or ZEN-Iowa Black FQ (double-quenched); alternatively, or in addition, suitable fluorescent reporters (with emission maxima) for use in aspects of this invention are, for instance, Cy3®(564nm), ATTO ™ 550 (575nm), TAMRA (583), ATTO 565 (591nm), PET®(595nm), ROX (carboxy-X-rhodamine, 608nm), Texas Red®-X (617nm), JUN® (617nm), ATTO 633 (657nm), LIZ®(655nm), Cy5®(668nm), and ATTO 647 (669nm), which may be used in combination with quenchers such as Black Hole Quencher-2 (BHQ-2), Iowa Black RQ (single-quenched), or TAO–Iowa Black RQ (double-quenched). All these fluorophores and quenchers are commercially available. The term “color channel” as used herein generally refers to the output response band of an optical color scanner, such as that employed in commercial real-time PCR machines. Such instruments have three or more discrete channels with photodiodes for detecting fluorescence emitted from the fluorophores in the amplification reaction mixture. In order to separate different fluorescence wavelengths, narrow band filters and dichromatic mirrors are used to allow fluorescence with the required wavelength to reach the corresponding sensor of the channel. If other instruments than PCR machines are used, the term “color channel” refers to the detection signal-specific sensor(s) in that instrument. The term “detection probe” refers to a probe used in the method of the present invention comprising a targeting sequence for targeting an complementary nucleotide sequence in an amplicon and further comprising a detectable label for generating a detection signal. In aspects of this invention, a detection probe may target a single amplicon, which is defined by a unique nucleotide sequence, and which will often be species-specific. However, in aspects of this invention at least two detection probes are used that target multiple amplicons, each having a different and unique nucleotide sequence, but each comprising the target sequence of the detection probe, wherein said multiple amplicons are generated through amplification of variable or hypervariable regions in a conserved microbial gene from multiple microorganism species using a single set of broad- taxonomic-range amplification primers. The multiple amplicons targeted by the at least two detection probes in aspects of this invention detect the amplicon of a distinct selection of microorganism species from the group of N microorganism species, wherein each distinct selection comprises at least two microorganism species. The group of microorganism species within each selection may or may not overlap between the group of microorganism species of other distinct selections. The terms “combinatorial detection probe” and “detection probe” are used interchangeably herein, unless the context indicates a more general interpretation. Aspects of the present invention comprise the use of at least two combinatorial detection probes. The at least two combinatorial detection probes each comprise a detection signal, wherein the at least two detection probes comprise at least two different detection signals. Each of the at least two combinatorial detection probes comprises a targeting sequence which contributes to the partitioning of the " microorganism species where all detection probes and their comprised detection signals together define a unique partition of the " microorganism species. Hence, the combination of all probes according to the present invention defines the partition of microorganism species. The targeting sequence for example provides specific binding / hybridization of the detection probe with an amplicon. The targeting sequence for example provides specific binding / hybridization of the detection probe with more than one amplicon, such as at least two amplicons. The term “partitioning”, refers to the way of dividing a set into distinct, non-overlapping subsets such that every element of the original set is included in exactly one of these subsets. These subsets are collectively exhaustive, meaning every element from the original set is included in one of the subsets, and mutually exclusive, meaning each element from the original set appears in only one subset. The term “partition” refers to the resulting collection of subsets from the partitioning process. An amplification primer or detection probe is typically at least 10, 15, 20, 30, 40 or 50 nucleotides in length. In some embodiments, primers are preferably between about 15 to about 40 nucleotides in length, and most preferably between about 20 to about 35 nucleotides in length. An optimal length for a particular primer application may be readily determined in the manner described in PCR Technology, Principles and Application for DNA Amplification, Henry A. Erlich (ed.), 1st ed.1989, Palgrave Macmillan, London.The term “molecular beacon”, as used herein, refers to a dye-labeled oligonucleotide (25–40 nt) that forms a hairpin structure with a stem and a loop. The 5' and 3' ends of the probe have complementary sequences of 5–6 nucleotides that form the stem structure. The loop portion of the hairpin is designed to specifically hybridize to a 15–30 nucleotide section of the amplicon, which section equals the molecular beacon’s target sequence. A fluorescent reporter molecule is attached to the 5' end of the molecular beacon, and a quencher is attached to the 3' end or in close proximity of those positions. Formation of the hairpin brings the reporter and quencher together, so no fluorescence is emitted. During the annealing step of the amplification reaction, the loop portion of the molecular beacon binds to its target sequence, causing the stem to denature. The reporter and quencher are thus separated, quenching is abolished, and the reporter fluorescence is detectable. Because fluorescence is emitted from the probe only when it is bound to the target, the amount of fluorescence detected is proportional to the amount of target in the reaction. Unlike hydrolysis assays, molecular beacons are displaced but not destroyed during amplification due to the use of a DNA polymerase lacking 5' exonuclease activity. Reporter and quencher pairs can be as described for hydrolysis probes. The term “degenerate”, as used herein for primers and probes refer to mixtures of similar oligonucleotide sequences that incorporate variations at specific positions to account for the degeneracy of the genetic code. The term “template”, as used herein, refers to the nucleic acid from which an amplicon is generated in a nucleic acid amplification reaction. The template comprises primer binding sites for hybridization of amplification primers. The term “isolating”, as used herein in the context of isolating nucleic acid sequences from a biological sample, refers to an in vitro process wherein nucleic acids, preferably DNA or RNA, are extracted from a sample of interest. The process may generally involve, but is not limited to, lysis of a (cells in) biological sample using a guanidine-detergent lysing solution that permits selective precipitation of genomic DNA from a (cell) lysate, and precipitation of the DNA from the lysate with ethanol. Following an ethanol wash, precipitated DNA may be solubilized in either water or 8 mM NaOH and used as template in a PCR reaction. Genomic DNA samples analysis with diagnostic purpose may be obtained by using generally known techniques for DNA isolation. The total genomic DNA may be purified by using, for instance, a combination of physical and chemical methods. Very suitably commercially available systems for DNA isolation may be used, such as the NucliSENS® easyMAG® nucleic acid extraction system (bioMérieux, Marcy l'Etoile, France) or the MagNA Pure 96 System (Roche Diagnostics GmbH, Mannheim, Germany). RNA isolation and purification procedures preferably take place in the presence of RNase inhibitory agents, such as guanidine salts, sodium dodecylsulfate (SDS), or phenol-based compounds that are designed to lower the risk of RNA degradation in a sample. Suitably, use may be made of organic extraction methods for RNA preparation, comprising homogenization of the sample in a phenol- containing solution followed by centrifugation. During centrifugation, the sample separates into three phases: a lower organic phase, a middle phase that contains denatured proteins and gDNA, and an upper aqueous phase that contains RNA. The upper aqueous phase is recovered and RNA is collected by alcohol precipitation and rehydration. Very suitably commercially available systems for RNA isolation may be used, such as the Tempus™ Spin RNA Isolation Kit (Thermo Fisher Scientific Inc.). Prior to PCR, the RNA is preferably reverse transcribed into cDNA using a reverse transcriptase enzyme. The term “PCR mixture”, as used herein, refers to the small volume of biochemical reactants in aqueous liquid for performing the PCR reaction, preferably comprising the (genomic) template DNA comprising the target DNA sequence(s), a set of at least two oligonucleotide primers that hybridize to opposite strands of the target DNA sequence(s) and flank the region to be amplified, a thermo-stable DNA polymerase, the four deoxyribonucleoside triphosphates (dNTPs), and Mg2+ ions. The term “amplification primers”, as used herein, refers to the oligonucleotide primers that hybridize to opposite strands of the target DNA sequence(s) and flank the region to be amplified. The terms “amplification product”, and “amplicon”, as used interchangeably herein, refer to a nucleic acid fragment that is the product of a nucleic acid amplification or replication event, such as for instance formed in the polymerase chain reaction (PCR). The term “PCR amplicon”, as used herein, refers to the PCR product or amplified target DNA. The term “broad-taxonomic-range amplification”, as used herein refers to the amplification of at least one variable or hypervariable region in a conserved microbial gene to produce homologous amplicons across different broad groupings or taxa of microorganisms, i.e. to produce homologous amplicons from the genomic DNA or RNA transcripts thereof of essentially all species within a taxonomic rank selected from order, class, phylum or kingdom. For example, broad-taxonomic-range amplification refers to amplification of at least one rDNA or rDNA ITS region from genomic DNA to produce homologous amplicons from genomic DNA of essentially all species within a taxonomic rank selected from phylum or kingdom. Essentially all in this context refers to at least 80%, 85%, 90%, 95%, or 99% of the species within the taxa of said taxonomic rank. Preferably, ribosomal DNA-targeted primer pairs are pairs of broad- taxonomic-range primers directed to conserved regions in the rDNA gene that flank variable or hypervariable (e.g. ITS) regions in said gene or genetic region. As indicated above, also RNA transcripts from a variable or hypervariable region in a conserved microbial gene may be used as a template for broad-taxonomic-range amplification in aspects of this invention. The term “broad-taxonomic-range” as used herein, refers to a collection of microorganisms at a higher order taxonomic ranking, such as at the rank of class, phylum, or kingdom, which collection includes essentially all lower taxonomic ranked groupings comprised therein, such as species genus, family, and order. For instance, in the context of a primer, the term “broad-taxonomic-range” refers to a primer that may be used to amplify a gene of interest across essentially all species genera, or families of microorganisms within a phylum, or kingdom. A broad-taxonomic-range primer thus has a high level (e.g. at least 70%, 80%, 90%, 95%, or 98%, or 99%) of coverage, i.e., the proportion of sequences within a given sequence set that is matched. The term "specific" as used herein in reference to a primer pair or probe means that the primer pair generates no amplicons from, and that the probe does not bind to, any targets other than the target of interest. This is, inter alia, deemed to be the case when the nucleotide sequence of the primer(s) or probe has a high level of sequence identity with a portion of the nucleic acid to be amplified when the primer and the target nucleic acid are aligned. An amplification primer or hybridization probe that is specific for a nucleic acid is one that, under stringent hybridization conditions, hybridizes to the target of interest and not to nucleic acids which are not of interest. Higher levels of sequence identity between the primer and the target are preferred and include at least 75%, at least 80%, at least 85%, at least 90%, at least 85-95% and more preferably at least 95% sequence identity. Sequence identity is based on the percentage of identical bases over the entire length of the comparison window when target and primer or probe are aligned, or, preferably, over the entire length of the primer or probe. Sequence identity can be determined using a commercially available computer program with a default setting that employs algorithms well known in the art. A non-specific PCR amplicon may result from primers that are not “specific”, as used herein, and is a potential by-product in PCR, consisting of amplified DNA that is not target DNA, usually resulting from a specific annealing (hybridization) of the primer molecules to other nucleic acid sequences in the template DNA, such as human DNA or non-target microbial DNA. A non-specific PCR amplicon results in a hrMC that is different from the PCR amplicon generated from a target microbial DNA sequence. As used herein, a primer pair is “taxon-specific” when it generates an amplicon from genomic DNA of a group of microorganisms of interest, e.g. whose presence or absence is to be confirmed or whose hrMC ambiguity is to be resolved, while it does not generate an amplicon from a group of microorganisms of a higher taxonomic ranking that comprises microorganisms that do not belong to the (lower ranking) taxon of microorganisms of interest. As used herein, a probe is “taxon-specific” when it binds to and is able to specifically detect an amplicon generated from genomic DNA or RNA transcribed therefrom of a group of microorganisms of interest, e.g. whose presence or absence is to be confirmed or whose hrMC ambiguity is to be resolved, while it does not bind to an amplicon generated from a group of microorganisms of a higher taxonomic ranking that comprises microorganisms that do not belong to the (lower ranking) taxon of microorganisms of interest. The term “taxon-specific” therefore generally indicates specificity of the primers and / or probes to a taxon of a lower ranking than the taxon or group of taxa covered by the broad-taxonomic- range primers as defined herein. The term “high-resolution melting curve (hrMC) analysis”, as used herein, refers to a post-PCR analysis method used to identify variations in nucleic acid sequences. The method is based on detecting small differences in PCR melting (dissociation) curves. The temperature-dependent dissociation between two DNA-strands can be measured using a DNA- intercalating fluorophore such as SYBR green, EvaGreen or a "saturation dye" (a dye that does not inhibit PCR even if used at concentrations that give maximum fluorescence (saturation)) like LCGreen® I, LCGreen Plus or Cyto9, in conjunction with real-time PCR instrumentation that has precise temperature ramp control and advanced (fluorescence) data capture capabilities. Data are analyzed and manipulated using software designed specifically for hrMC analysis. For hrMC analysis, software is often included in the qPCR equipment, but can also be obtained from third parties. High- resolution melting curves are generated by ramping through a temperature gradient with a high level of accuracy (e.g.0.1 °C or less), and measuring5+( -(7(- 0) ;603(4&( / &( 0) % / , / 5(3&%-%5, / * '9( %5 (%&+ 45(1# $+( .(-5, / *temperature of a DNA molecule is determined by nucleic acid sequence and length, and differences in these nucleotide sequences between samples3(46-5 , / .(-5, / * 130:-(4 5+%5 %3( 6 / ,26( 50 % 1%35,&6-%3 41(&,(4" (7( / 8+( / amplicons are generated using universal primers. Details of the hrMC analysis procedure are well known to those skilled in the art and are for instance described in Reed et al., 2007, Pharmacogenomics 8:597–608; US7,297,484; US7,387,887; US7,524,632; US20090117553 and US20100041044, which contents are incorporated herein by reference. The term “high-resolution melting curve (hrMC)”, as used herein, refers to the dissociation curve describing the temperature-dependent dissociation between two DNA-strands, preferably as measured using a DNA-intercalating fluorophore. The high-resolution melting curve may refer to the graph of the negative first derivative of the melting curve which makes it easier to pin-point the temperature of dissociation (defined as 50% dissociation), by virtue of the peaks thus formed. The term “to distinguish”, as used herein, refers to the ability to observe dissimilarity between diagnostic data, as output of an analytical measurement, for different species of microorganisms, wherein the observable dissimilarity allows for discrimination between the species. “to distinguish” follows from the analysis that the data is more likely derived from one species than from another species of microorganism, and allows for the positive identification of a microorganism in a sample as belonging to a distinct species, such as identifying a microorganism as Citrobacter braakii, rather than as Citrobacter freundii, Citrobacter werkmanii, Citrobacter youngae, or Enterobacter asburiae. For instances, the hrMC of a rDNA ITS amplicon may be sufficient to arrive at an unambiguous species identification. In practice, the identification of unknown microorganisms may, for instance, occur through pattern matching, of the hrMC obtained with a library containing the characteristic hrMC information of various species in the form of, for instance, profiles, peaks, or spectra or derivatives thereof. The library information is preferably generated by several measurements of known bacterial species and strains under slightly different conditions, and then extracting the specific hrMC information. Additionally the library information can be generated or supplemented in- silico with predicted melting curves from known DNA sequences. As an average, the library may contain about 20 profiles, peak patterns or spectra per species. Software may be used to automatically generate the profile, peak pattern or spectrum of an unknown microorganism and to compare it to the database. A matching score, or similarity measure, based on profile correlation or pattern matching may be generated and used for ranking of the results. The highest similarity would result in the identification of the unknown microorganism. It is possible to add statistical confidence levels to the identification in aspects of this invention, based on the similarity or dissimilarity of the hrMC obtained to hrMCs in the library or database used for identification. However, if the unknown profile correlates with two or more profiles in the library, the hrMC information of the unknown microorganism is insufficient to distinguish between microorganisms and cannot lead to unambiguous identification of the unknown microorganism. The term “cannot be distinguished” in the sense that microorganisms cannot be distinguished based on hrMC information, refers to the situation that at least two hrMCs in the library exhibit a high degree of similarity between them. In practice, this means that the profiles of those at least two hrMCs in the library may overlap, be similar or even be identical. The term “negative control reaction”, as used herein, refers to a post- PCR mixture comprising no PCR amplicon(s) as a result of the deliberate absence of target nucleic acid sequences or template DNA in the pre-PCR mixture. The term "quantification cycle" or "Cq" as used herein includes reference to a measurement taken in a real time PCR assay or qPCR assay, whereby a positive reaction is detected by accumulation of a signal, such as a fluorescent signal. The Cq (quantification cycle) can be defined as the number of cycles required for the signal to cross the threshold (i.e. exceeds background level). Cq levels are inversely proportional to the amount of target nucleic acid in the sample (i.e. the lower the Cq level the greater the amount of target nucleic acid in the sample). The term "biological sample", as used herein, includes reference to a sample from a human or animal subject, in particular, the term refers to a clinical sample obtained from a human patient. In preferred embodiments, a sample is a tissue or bodily fluid collected from a subject. Sample sources include, but are not limited to, mucus, sputum (processed or unprocessed), bronchial alveolar lavage (BAL), bronchial wash (BW), synovial fluid, blood, bodily fluids, skin or skin lesions, cerebrospinal fluid (CSF), urine, plasma, serum, or tissue (e.g., biopsy material). Preferred sample sources include plasma, serum, whole blood, urine and cerebrospinal fluid. The term "subject", as used herein is intended to refer to any individual or patient on a biological sample of which a method as described herein is performed. Generally the subject is human, although as will be appreciated by those in the art, the subject may be an animal. Thus other animals, including mammals and birds are included within the definition of subject. Detailed description of preferred embodiments Samples and optional nucleic acid extraction A method of the present invention comprises as a first step the provision of a biological sample suspected of comprising a microorganism and optionally isolating nucleic acids from said biological sample. The biological sample is for example provided in the form of a dry or moist swab, a needle aspirate, such as a biopsy, a sample of blood such as drawn from a vein of a subject, or a plasma sample, a lumbar puncture to obtain CSF, or a urine sample aspirated from the bladder or a lung aspirate obtained by catheter or a joint aspirate, or a pus aspirate or tissue biopsy. Samples may also suitably be obtained by lavage or by a midstream clean-catch method such as in the case of urine. A biological sample is suspected of comprising a microorganism if the subject from which the sample is obtained or taken suffers from symptoms that are potentially caused by a microbial infection, such as a bacterial infection in the case of sepsis. The sample is for example used directly in a method of the invention, meaning that an aliquot of the sample is mixed into the nucleic acid amplification mixture, optionally wherein the microorganism is first concentrated from the sample, for instance by centrifugation. Nucleic acids are for example isolated from said biological sample. Alternatively, nucleic acids are for example not isolated from said biological sample. Nucleic acid isolation may increase PCR amplification efficiency by removing PCR inhibitors present in the biological sample. Moreover, nucleic acid isolation may increase PCR amplification efficiency by concentrating the low quantities of microbial DNA present in many biological samples, such as blood. In order to successfully extract nucleic acids, the sample is for example, as indicated above, first subjected to (staged) centrifugation in order to concentrate the microbial cells, or selectively remove human cells of the subject or patient, such as blood cells or leucocytes. Another option is to first selectively lyse human cells containing DNA, after which all free DNA is degraded or after which bacteria are spun down by centrifugation and supernatant is removed. In a next step, bacteria are lysed (optionally after concentrating them by a centrifugation or a filtering step) and their DNA is isolated, leading to a selective isolation of bacterial DNA over host (human) DNA. This is for blood samples a most preferred embodiment. When using centrifugation in urine samples, crystal formation is preferably avoided, such as by using Tris-EDTA dissolution of urine crystals. Nucleic acids are for example then isolated from the sample or from the concentrated microbial sample obtained therefrom, by either extraction of total nucleic acids (TNA), DNA or RNA following a cell-lysis step. Preferably, total nucleic acid (DNA plus RNA) is extracted from the cell lysate. Use is for example made of classical two-step DNA isolation from cell lysates using guanidine thiocyanate and isobutyl alcohol. For example, use is made of standardized commercially available TNA extraction systems, which are usually based on guanidine hydrochloride-based cell lysis and nucleic acid extraction and for example further rely on the capture of lysed- cell- released TNA by magnetic silica particles, followed by the purification of the TNA by several washing steps, the release from the silica by heating, and the removal of the silica, to thereby provide a purified sample of isolated nucleic acids comprising microbial genomic DNA present in said biological sample. Broad-taxonomic-range amplification of variable or hypervariable regions in a conserved microbial gene In a method of the invention, a nucleic acid amplification reaction is performed using an aliquot of the biological sample or nucleic acids isolated therefrom. In methods of this invention, the amplification reaction may be a reaction for amplifying RNA or DNA, and is preferably a reaction for amplifying a variable or hypervariable region or a fragment thereof in a conserved microbial gene or in an RNA transcript thereof. Preferably, the conserved microbial gene is selected from a ribosomal RNA (rRNA) gene, a ribosomal protein gene (e.g., RPSA, RPS2 or RPL6), a DNA gyrase (subunit A) (GyrA) gene, a DNA gyrase (subunit B) (GyrB) gene, a RecA protein gene, an ATPase subunit gene (e.g., atpB, atpD), an RNA polymerase subunit gene (e.g., rpoB, rpoC), an Elongation factor thermal unstable Tu (EF-Tu) gene, an Elongation factor G (EF-G) gene, a Protein translocase subunitSecY (secY) gene, and a beta-tubulin (tubB) gene. Preferably, the amplifiedvariable or hypervariable region comprises, or is a fragment of, an rDNA ITS region, such as a 16S-23S rDNA ITS region, a 23S-5S rDNA ITS region, an 18S-5.8S rDNA ITS region, a 5.8-26S / 28S rDNA ITS region or an 18S- 5.8S-26S / 28S rDNA ITS region (including both ITS1 and ITS2 of eukaryotic microorganism species). More preferably, the amplicon comprises a 16S-23S rDNA ITS region or an 18S-5.8S-26S / 28S rDNA ITS region, or a fragment thereof. The amplification reaction is preferably performed by PCR. Nucleic acid amplification is performed in a reaction container. Such a container comprises a nucleic acid amplification reaction mixture comprising microbial DNA or RNA template, amplification primers, polymerase enzyme, deoxynucleoside triphosphates (dNTPs) mixture, fluorescence dye, a reaction buffer, optionally including magnesium ion (Mg2+) co-factor, for example said buffer supports activity of the polymerase enzyme. The reaction container comprising the complete reaction mixture is then closed, to form a closed container or closed-tube assay system. The reaction mixture in aspects of this invention comprises at least two detection probes for detecting amplicons generated during the amplification reaction as described herein. Amplification primers The amplification reaction requires the presence of amplification primers in the reaction mixture. The amplification primers in aspects of this invention comprise at least one pair of broad-taxonomic-range amplification primers for amplifying a variable or hypervariable region in a conserved microbial gene, for example selected from a microbial ribosomal DNA (rDNA) gene and a microbial rDNA internal transcribed spacer (ITS) region, from the, optionally isolated, nucleic acids in said sample and for generating an amplicon. A broad-taxonomic-range amplification primer for example suitably comprises a primer sequence that corresponds to a conserved region of the microbial genome, allowing for amplification of DNA from a wide range of microbial species. In bacteria, these primers are for example suitably designed to target highly conserved regions in the 16S rDNA gene and / or in the 23S rDNA gene, which genes are present in most bacteria within the rrn operon and exhibit sufficient sequence conservation to serve as a target for such primers. Broad-taxonomic-range primers for example include degenerate primers, meaning that the primer comprises alternative bases at one or more positions to increase the number of matches within a given sequence set of microbial rDNA sequences. While a higher degeneracy facilitates higher coverage, it also can lead to unspecific amplification. Therefore, degenerate primer design is a trade-off between specificity and coverage (sensitivity). Computer programs for optimal design of broad- taxonomic-range primers, such as DegePrime, are well known to one of skill in the art (e.g. Hugerth et al., 2014. Appl. Environ. Microbiol.80(16): 5116 – 5123), which programs finds a degenerate oligomer of as high coverage as possible for each position of a multiple sequence alignment, and outputs its coverage among taxonomic divisions. Aligned bacterial 16S rDNA gene sequences may be downloaded from RDP, v.9 (Cole et al., Nucleic Acids Res. 37:D141–D145). With respect to broad-taxonomic-range primers for identification of bacteria, primers for example include 27F (5'- AGAGTTTGATCMTGGCTCAG-3'), 341F (5’-CCTACGGGNGGCWGCAG-3’); 341’F (5’-CCTAHGGGRBGCAGCAG-3’); 515F (5’- GTGYCAGCCGCCGCGGTAA-3’); 515’F (5’-GTGBCAGCMGCCGCGGTAA- 3’), 805R (5’-GACTACHVGGGTATCTAATCC-3’), and 1492R (5'- TACGGYTACCTTGTTACGACT-3'), wherein N is (A / G / C / T); W is (A / T); H is A / C / T; R is (A / G); B is (C / G / T); Y is (C / T); M is (A / C); V is (A / C / G). Such primers are sometimes referred to as universal primers. In order to amplify the 16S–23S rDNA ITS region of bacterial rDNA, one of skill will understand that the complementary strand of said primer annealing sites of the above broad-taxonomic-range 16S rDNA primers are for example also be used as a target for a forward or reversed primer, in order to arrive at a primer set for DNA amplification of said ITS region. Preferred bacterial broad range amplification primers include SEQ ID NOs: 14 and 15. With respect to broad-taxonomic-range primers for identification of bacteria, in addition to the above universal primers, suitable primers for example also include phylum-specific primers as disclosed herein. Exemplary, and preferred, primer sets for amplifying a 16S–23S rDNA ITS region from genomic DNA of one or more of the bacterial phyla Firmicutes, Bacteroidetes or Proteobacteria are provided as SEQ ID NOs:1- 13 in Table 1. An exemplary, and preferred, primer set for universally amplifying a 16S–23S rDNA ITS region from genomic DNA of bacteria is provided as SEQ ID NOs:14-15 in Table 1. Primers for phyla Firmicutes and Bacteroides SEQ Primer name Type Sequence (5'-3') ID No FirISf Forward CTGGATCACCTCCTTTCTAWG 1 BacISf Forward CTGGAACACCTCCTTTCTGGA 2 DUISr1 Reverse AGGCATCCACCGTGCGCCCT 3 DUISr2 Reverse AGGCATTCACCRTGCGCCCT 4 DUISr3 Reverse AGGCATCCRCCATGCGCCCT 5 Primers for phylum Proteobacteria SEQ Primer name Type Sequence (5'-3') ID No ProtISf Forward CCGCCCGTCACACCATGG 6 DPISr1 Reverse AATCTCGGTTGATTTCTTTTCCT 7 DPISr2 Reverse AATCTCGGTTGATTTCTTCTCCT 8 DPISr3 Reverse AATCTCTTTTGATTTCTTTTCCTCG 9 DPISr4 Reverse AATCTCATTTGATGTCTTTTCCTCG 10 DPISr5 Reverse AATCTCTTTTGATTTCTTTTCCTTCG 11 DPISr6 Reverse AATCTCTCTTGATTTCTTTTCCTTCG 12 DPISr7 Reverse AATCTCAATTGATTTCTTTTCCTAAGG 13 Universal bacterial primers SEQ Primer name Type Sequence (5'-3') ID No ITS1FD Forward CGGTGAATACGTTCCCGGIIIIIGTACAC 14 ITS2RD Reverse CGTCCTTCDTCGVCTBIIIIIGCCARG 15 Table 1: Exemplary primer sequences for amplification. It is within the routine capabilities of the skilled person to design further primer sets that allow for broad-taxonomic-range amplification of microbial DNA, such as fungal or bacterial DNA. Broad taxonomic grouping of fungi for example include the species of the Ascomycota division including, but not limited to, Aspergillus spp., Blastomyces spp., Candida spp., Coccidioides spp., Epidermophyton spp. Histoplasma spp., Microsporum spp., Paracoccidioides spp., Pneumocystis spp., Sporothrix spp., Trichoderma spp. and Trichophyton spp.; the Basidiomycota division including, but not limited to, Cryptococcus spp., Malassezia spp. and Trichosporon spp.; and the Mucoromycota division including, but not limited to, Rhizopus spp., Mucor spp., Rhizomucor spp., Syncephalastrum spp., Apophysomyces spp., Lichtheimia spp., Cunninghamella spp. and Saksenaea spp.. With respect to broad-taxonomic- range primer pairs employed for identification of fungi, a broad taxonomic- range primer set consisting of ITS1F (5’-TCCGTAGGTGAACCTGCGG- 3’) / ITS4R (5’-TCCTCCGCTTATTGATATGC-3’) is for example used to amplify the ITS region of fungal rDNA flanked by these conserved sequences as primer annealing sites for DNA amplification. These primers amplify a ~600-base pair (bp) DNA fragment of the ITS region of fungi (White et al., 1990, pp.315–322. In: Innis, Gelfand, Sninsky & White, eds. PCR protocols a guide to methods and applications. Academic Press, San Diego, CA.). Other suitable broad taxonomic-range fungal ITS region primers for example include (sequence provided in 5’-3’ orientation) ITS2 (5’- GCTGCGTTCTTCATCGATGC-3’), ITS3 (5’-GCATCGATGAAGAACGCAGC- 3’) and ITS5 (5’-GGAAGTAAAAGTCGTAACAAGG-3’) (White et al., 1990. supra.); ITS1-F (5’-CTTGGTCATTTAGAGGAAGTAA-3’), ITS4-B (5’- CAGGAGACTTGTACACGGTCCAG-3’) (Gardes & Bruns, 1993, Mol. Ecol.2: 113–118), 5.8S (5’-CGCTGCGTTCTTCATCG-3’), 5.8SR (5’- TCGATGAAGAACGCAGCG), SR6R (5’-AAGWAAAAGTCGTAACAAGG-3’), wherein W=G,T (Vilgalys & Hester, 1990, J. Bacteriol.172: 4238–4246; Gizard et al., 2014. Ecology and Evolution 4(7): 1140–1157). Polymerase enzymes The amplification reaction requires the presence in the reaction mixture of polymerase enzymes for de novo DNA synthesis using the genomic DNA or cDNA of RNA transcripts thereof as a template. Polymerase enzymes catalyze the synthesis of DNA or RNA polymers whose sequence is complementary to the original template. Preferably, the reaction mixture contains a DNA polymerase. The reaction mixture for example further comprises reverse transcriptase, helicase, recombinase, restriction endonuclease, and or RNA polymerase enzymes. One of skill in the art will be aware of the various polymerase and DNA modifying enzymes required in various nucleic acid amplification procedures that are for example suitably used in aspects of this invention, such as for instance isothermal amplification technologies. In aspects of this invention, use is preferably made of PCR, more preferably qPCR, wherein the reaction mixture contains a Taq DNA polymerase. Detection probes In preferred embodiments of aspects of the present invention detection probes are so-called “dense probes”, which are detection probes that detect multiple species. Aspects of the present invention in preferred embodiments, include the presence or use of at least two of such dense probes. The dense probes preferably comprise different detectable labels, that is, each of the at least two dense preferably comprises a different detectable label. However, with as dictated by instrument constraints, the number of detectable labels will be limited. For instance, the number of detectable labels may be limited to 3, 4, 5, or 6. However, a dense probe may also comprise a detectable label that is detectably the same as that comprised in another of the at least two dense probes. In aspects of this invention, it is preferred that each of the at least two dense detection probes comprises a targeting sequence that detects the amplicon of a selection of at least two species selected from the N microorganism species where N is greater than two and the number of microorganism species in the selection is smaller than N. Hence, the targeting sequence of each dense detection probe according to the present invention detects a specific selection of multiple microorganism species from the N microorganism species. The targeting sequence of each dense detection probe provides for specific detection of a target sequence within the amplicon that the selection of microorganism species have in common. This allows a single dense probe to detect multiple species which is a key aspect of the present invention, as it increases the amount of information that can be retrieved from a single probe and thereby allows for improved detection of microorganisms. The targeting sequence of the detection probes of the invention are selected to detect an amplicon having a target sequence of 10-50, preferably 15-40, more preferably 18-30 consecutive bases that is present in the species-specific variable and / or hypervariable region of a conserved microbial gene of all species contained in a distinct group selected from the N microorganism species. The targeting sequence of the detection probes according to the present invention facilitate specific binding to or hybridization with its target sequence which is contained in the amplicon. The targeting sequence facilitates binding / hybridization of the detection probe to / with an amplicon of a microorganism species, wherein the amplicon comprises an amplified fragment from a variable of hypervariable region of a conserved microbial gene, preferably selected from a ribosomal RNA (rRNA) gene, a ribosomal protein gene (e.g., RPSA, RPS2 or RPL6), a DNA gyrase (subunit A) (GyrA) gene, a DNA gyrase (subunit B) (GyrB) gene, a RecA protein gene, an ATPase subunit gene (e.g., atpB, atpD), an RNA polymerase subunit gene (e.g., rpoB, rpoC), an Elongation factor thermal unstable Tu (EF-Tu) gene, an Elongation factor G (EF-G) gene, a Proteintranslocase subunit SecY (secY) gene, and a beta-tubulin (tubB) gene.Preferably, the amplified variable or hypervariable region comprises, or is a fragment of, an rDNA ITS region, such as a 16S-23S rDNA ITS region, a 23S-5S rDNA ITS region, an 18S-5.8S rDNA ITS region, a 5.8-26S / 28S rDNA ITS region or an 18S-5.8S-26S / 28S rDNA ITS region (including both ITS1 and ITS2 of eukaryotic microorganism species). More preferably, the amplicon comprises a 16S-23S rDNA ITS region or an 18S-5.8S-26S / 28S rDNA ITS region, or a fragment thereof. The targeting sequence of a detection probe according to the present invention may suitably comprise from 5 – 50, 10 – 45, 15 – 40, 20 – 35, or 25 – 30 consecutive nucleotide bases. The targeting sequence of a detection probe according to the present invention may suitably comprise 10-50, preferably 15-40, more preferably 18-30 consecutive nucleotide bases. The targeting sequence of a detection probe according to the present invention may suitably be 100% complementary to its target sequence. The targeting sequence of a detection probe according to the present invention is preferably at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 92% at least 93% at least 94, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% complementary to its target sequence. The term “complementary” herein indicates the percentage of sequence identity over the length of the target sequence in the amplicon or the reverse complement thereof, The targeting sequence of the detection probe according to the present invention may suitably comprise nucleotide modifications. One or more nucleotides of the targeting sequence may for instance be modified in order to increase stability of the detection probe. One or more nucleotides of the targeting sequence may for instance be modified in order to increase the strength of binding or hybridization to the target sequence of an amplicon. Suitable nucleotide modifications of the detection probes may for instance comprise phosphorylation, 3’or 5’end amino modification, and inclusion of spacers, fluorophores, quenchers, modified bases, and phosphorothioate bonds. The detection probe may suitably be a degenerate probe. A degenerate probe may comprise one or more degenerate bases, in order to facilitate simultaneous detection of amplicons having one or more base differences in the target sequence. Preferably the detection probes do not contain more than 2, 3, 4, 5, 6, 7, 8, 9 or 10 degenerate nucleotide bases. Aspects of the present invention in preferred embodiments, may suitably include the presence or use of at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least eleven, at least twelve, at least thirteen, at least fourteen or at least fifteen, or more, detection probes each comprising a detectable label. For example, the invention may comprise the use of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 75, 80, 85, 90, 95 or 100 detection probes. A detection probe according to the present invention is at least about 10, 15, 20, 25, 30, 35, 40, 50, 60, 75, 100 nucleotides or more in length. The detection probes may comprise modified nucleotides within the targeting sequence and / or within regions flanking the targeting sequence. The detectable label of the detection probe is preferably a fluorescent label. A fluorescent label for example allows its detection following or during the period that the nucleic acid amplification reaction is being performed in the closed reaction tube. Thereto, the fluorescent label is preferably detectable in the closed-tube and preferably by the amplification equipment, such as in a specific (color) channel of the (q)PCR instrument. The fluorescent label used as detectable label is for example selected from the group of 6-FAM (520nm), TET (539nm), YAK (Yakima Yellow®, 549nm), VIC (554), SUN (554nm), HEX (555nm), JOE (555nm) in combination with quenchers TAMRA, Black Hole Quencher 1 (BHQ®-1) or Iowa Black FQ (single-quenched) or ZEN-Iowa Black FQ (double-quenched); fluorescent reporters Cy®3 (564nm), ATTO ™ 550 (575nm), TAMRA (583), ATTO 565 (591nm), PET® (595nm), ROX (608nm), Texas Red®-X (617nm), JUN® (617nm), ATTO 633 (657nm), LIZ® (655nm), Cy5 (668nm), and ATTO 647 (669nm) in combination with quenchers Black Hole Quencher-2 (BHQ-2), Iowa Black RQ (single-quenched), or TAO–Iowa Black RQ (double- quenched). The detection probe in aspects of this invention may be a hydrolysis probe or a molecular beacon. The detection probe according to the invention is for example a hydrolysis probe. An example of a hydrolysis probe is a TaqMan-probe. The TaqMan probe principle relies on the 5´–3´ exonuclease activity of Taq polymerase to cleave a dual-labeled probe during hybridization to the complementary target sequence and fluorophore-based detection. As in other quantitative PCR methods, the resulting fluorescence signal permits quantitative measurements of the accumulation of the amplicon during PCR. The detection probes may, in embodiments, comprise two or more detectable labels. The two or more detectable labels on one detection probe may be the same or different, and are preferably different. Decorating a detection probe according to the present invention for example improves signal intensity and / or detection accuracy. A selection of microorganism species selected from the N microorganism species that is detectable by at least one of the at least two detection probes may consist of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or more microorganism species. Selections from the group of N microorganism species The at least two detection probes according to the present invention define distinct selections of multiple microorganism species selected from the group of N microorganism species. A selection from N microorganism species is based on the presence of a common target sequence within the amplicon obtained from these microorganism species and which can be detected by a selection-specific detection probe. In aspects of this invention, the selection of microorganism species may be completely independent from the taxonomic position or relationship between the different microorganism species that constitute the selection. For instance, the selection of microorganism species does not need to comprise microorganisms species that belong to the same genus, family of order. They may belong to completely different genera or families. For example, a first selection of multiple microorganism species selected from the group of N microorganism species which is detected by a first detection probe may consist of Enterococcus faecalis, Enterococcus faecium, Listeria monocytogenes, Staphylococcus aureus, Staphylococcus epidermidis, Stenotrophomonas maltophilia, Streptococcus constellatus, Streptococcus dysgalactiae, and Streptococcus mitis. For example, a further selection of multiple microorganism species selected from the group of N microorganism species which is detected by a further detection probe may consist of Neisseria meningitidis, and Pseudomonas aeruginosa. For example, a further selection of multiple microorganism species selected from the group of N microorganism species which is detected by a further detection probe may consist of Enterococcus faecium, Streptococcus constellatus and Streptococcus dysgalactiae. For example, a further selection of multiple microorganism species selected from the group of N microorganism species which is detected by a further detection probe may consist of Staphylococcus aureus and Streptococcus dysgalactiae. Selecting a targeting sequences of a detection probe In aspects of the present invention, a selection of multiple microorganism species selected from the group of N microorganism species which is detected by a detection probe requires the definition of the target sequence for said probe. Selection of target sequences may, for example, comprise the provision of a database comprising the nucleotide sequence of species-specific variable and / or hypervariable regions of a conserved microbial gene, which sequences are annotated to the microorganisms species from which the sequence was obtained. The database is suitably a public database comprising species-specific variable and / or hypervariable regions of a conserved microbial gene with species annotation. Suitable data may be extracted from public databases, such as GenBank. A database Selecting target sequences may further comprise generating one or more sequence alignment of species-specific variable and / or hypervariable regions of a conserved microbial gene of all N microorganism species whose presence is to be detected. Further, selecting target sequences for example comprises selecting at least a first target sequence which is exclusively present in a first group of microorganism species and absent in microorganism species not belonging to said first group, in order to provide a target for a first detection probe, and selecting at least a second target sequence which is exclusively present in at least a second group of microorganism species and absent in microorganism species not belonging to said second group , in order to provide a target for a second detection probe. The at least first group and at least second group have at least one microorganism species not in common. For example, the at least first group and at least second group have at least one microorganism species in common. The target sequence may suitably be a sequence of 15 – 25 consecutive nucleotide bases. Selecting target sequences for the detection probes is for example performed manually or using a computer program. For example, a computer program may be used to detect a region of consecutive bases that is present in the amplicon of a multitude of microorganism species, and that is not present in other microorganism species in the group of the N microorganism species. If needed, degenerate bases can be introduced into the targeting sequence of the detection probe to create degenerate probes which facilitate simultaneous detection of multiple microorganisms species that have the target sequence in their amplicon, and excludes detection of other microorganism species that do not contain the target sequence in their amplicon. For example, the computer program may provide a sequence alignment of species-specific variable and / or hypervariable regions of a conserved microbial gene of all N microorganism species which should be detected by a single detection probe. In essence, at least one target sequence of consecutive nucleotide bases is selected that is present in the variable and / or hypervariable region of a conserved microbial gene of multiple species selected from the group of N microorganism species and which target sequence is not present in other species of the group of N microorganism species, in order to provide a target sequence for a first detection probe. Performing PCR in a method of the invention In a method of the invention, a step of amplifying DNA is for example performed by the polymerase chain reaction (PCR), although other methods of DNA amplification may also be used, such as polymerase chain reaction (PCR, Mullis et al., 1986, Cold Spring Harb Symp Quant Biol 51, 263-273), ligation-mediated amplification (LAR, Wu & Wallace, 1989, Genomics 4, 560–569), Nucleic Acid Sequence Based Amplification (NASBA, Guatelli, et al., 1990, Proc. Natl. Acad. Sci. U.S.A.87, 1874–1878), Strand Displacement Amplification (SDA, Walker et al., 1992, Nucleic Acids Res.20, 1691–1696), Loop-Mediated Isothermal Amplification (LAMP, Notomi et al., 2000, Nucleic Acids Res.28 (12): 63e–63), Ligase Chain Reaction (LCR, Wu et al., 2001, J. Clin. Microbiol.39, 2794–2798) and, helicase-dependent amplification (HDA, Vincent et al., 2004, EMBO Rep.5(8): 795–800), Rolling Circle Amplification (RCA, Larsson et al., 2004, Nat. Meth.1, 227–232), Recombinase Polymerase Amplification (RPA, Piepenburg et al., 2006, PloS Biol.4 (7), e204), all these methods are well known to one of skill in the art (for an overview see Monis & Giglio, 2006, Infection, Genetics and Evolution 6, 2–12 and Wang et al., 2023, Biosensors 13, 160). Preferably, PCR is a qPCR or real-time PCR (Higuchi et al., 1992, Biotechnology (NY) 10, 413– 417; Heid et al., 1996 , Genome Res.6, 986–994; Edwards, et al., 2004, In: Real-time PCR, An Essential Guide. Horizon Bioscience, Wymondham, p. 346.). The present invention relates, inter alia, to methods involving a broad-taxonomic-range amplification or universal amplification of at least one variable or hypervariable region in a conserved microbial gene, preferably selected from a microbial ribosomal DNA (rDNA) gene and a microbial rDNA internal transcribed spacer (ITS) region, from microbial genomic DNA in a sample. The skilled person is well aware of methods and means for setting up such a DNA amplification reaction, such as a PCR reaction. In one preferred embodiment, a method of the invention is for detecting or identifying a bacterium or bacterial DNA in a sample. Recording the detection signal of at least two detection probes The present invention comprises a step of recording the detection signals of the at least two detection probes, such as a fluorophore labels, which are comprised in the reaction mixture. Fluorophore labels may readily be detected by recording emission spectra in distinct color channels of a PCR or qPCR instrument. The detection probe of the present invention is preferably fluorescently labeled to allow its detection following or during the performance of the nucleic acid amplification reaction in the closed reaction tube. Thereto, the fluorescent label is preferably detectable in the closed-tube and preferably by the amplification equipment, such as in a specific (color) channel of the (q)PCR instrument. For example, for recording the respective detection signals of two detection probes each having a different fluorophore label as detection signal, two distinct color channels of a PCR or qPCR are used. For example, for recording the respective detection signals of three detection probes each having a different fluorophore label as detection signal three distinct color channels of a PCR or qPCR are used. For example, for recording the respective detection signals of four detection probes each having a different fluorophore label as detectable label four distinct color channels of a PCR or qPCR are used. For example, for recording the respective detection signal of each subsequent detection probe having another fluorophore label as detection signal a subsequent distinct color channel of a PCR or qPCR is used. The number of distinct color channels of a PCR or qPCR which are required for recording detection signals is dependent on the number of different fluorophore labels used in the method of the invention. Accordingly, if for example three detection probes are used, all having different fluorophore labels as detection signals, three distinct color channels are required for recording. If for example three detection probes are used wherein two detection probes have the same fluorophore label as detection signals, two distinct color channels are required for recording. The skilled person is well aware how to record distinct signals of detectable labels in distinct color channels of a (q)PCR instrument. For example, recording the respective detection signals of the at least two detection probes comprises recording the presence of one detection signal of one detection probe in one color channel and the absence of another detection signal of another detection probe in another color channel. Recording the respective detection signals of the at least two detection probes having different detectable labels may comprise recording the presence or absence of a first detection signal of a first detection probe in a first color channel and the presence or absence of a second detection signal of a second detection probe in a second color channel. The presence or absence of the detection signal of a first detection probe provides a specific indicator for the presence or absence of one or more microorganism species of the selection of microorganism species from the group of N microorganism species that comprise the target sequence of the first detection probe, while the presence or absence of the detection signal of a second detection probe provides a specific indicator for the presence or absence of one or more microorganism species of the selection of microorganism species from the group of N microorganism species that comprise the target sequence of the second detection probe. The combination of detection signals of the first and second detection probes then provides an indicator for the presence or absence of a subset from the N microorganism species as a subset-specific indicator. For example, a first subset-specific indicator may be obtained if no detection signal is recorded for either of the two detection probes. Alternatively, a second subset-specific indicator may be obtained if a detection signal is recorded for both of the two detection probes. Still further, a third subset-specific indicator may be obtained if a detection signal is recorded only for the first detection probe, and a fourth subset-specific indicator may be obtained if a detection signal is recorded only for the second detection probe. When using three different detection probes in accordance with the present invention, a total of eight subset- specific indicators may be obtained if distinct signals can be recorded for each probe. When using four different detection probes in accordance with the present invention, a total of 16 subset-specific indicators may be obtained if distinct signals can be recorded for each probe. Each of the above subset-specific indicators may indicate the presence of multiple or single species of microorganisms. hrMC measurements The present invention may very suitably comprise further characterization of the amplicons generated during the amplification reaction. For instance, a method of the invention may comprise characterization of the amplicon(s) by high resolution metling curve (hrMC) analyses. Nucleic acid characterization by hrMC analysis of amplicons is a powerful technique for identifying the microorganism species from which the amplicon originates when used in combination with a database comprising known hrMC data for known species of microorganisms. By measuring the fluorescence of a saturating intercalating dye as PCR- amplified DNA fragments are heated and disassociate, sequence-defined melting curves may be generated. hrMC analyses may, for example, be used in aspects of the present invention where a subset-specific indicator indicates the presence of at least two different microorganism species in a subset defined by the combined signal of at least two combinatorial detection probes as defined herein, and where the amplicon of these species is distinguishable by hrMC analysis. The benefit of such an embodiment is that no further detection probes are needed to determine the microorganism species identity from which the subset-specific detection signals originate. In a method of the present invention, an hrMC profile for the PCR amplicons is for example generated during the step of PCR amplification, or after the step of PCR amplification. As used herein, a "melting profile" refers to a profile generated by hrMC analysis. One of skill in the art is well aware how hrMC is to be performed. Ample guidance can be found, for instance in Reed et al.2007 Pharmacogenomics 8(6): 597-608 and Wittwer et al.2003 Clin Chem.49:853–860. High-resolution melting curve analysis may occur using PCR, qPCR (i.e. real-time PCR) or digital PCR. In digital PCR, each partition contains only a single sample template, which means that all amplicons for each partition originate from a single template. This homogeneity allows for easier interpretation of hrMC profiles and allows for direct comparison with other partitions. PCR in aspects of the invention is preferably qPCR. As indicated above, in a method of the present invention, an hrMC profile of a post-PCR sample may be generated for the purpose of identifying the microorganisms from which the amplicon originates in the instance that the subset as defined herein (i.e., the combination of detection signals obtained for the combinatorial detection probes) contains multiple microorganism species with unique hrMC signatures. The generated hrMC profile is compared to (predetermined) reference hrMC profiles of one or more corresponding amplicons of known (i.e., taxonomically identified) species of microbes. For example, the reference hrMC profiles of one or more corresponding amplicons of known species is comprised in a library or database of reference hrMC profiles. Such a library or database can, for instance, be established by (i) in vitro generating rDNA or rDNA ITS PCR amplicons of individual species of microbes, (ii) performing an hrMC analysis of said amplicons, and (iii) storing said reference hrMC profiles in a library or database of reference hrMC profiles, wherein the species identity is annotated to the hrMC profile. Alternatively, a database or library of reference hrMC profiles can be generated by in silico prediction of an hrMC profile of one or more rDNA or rDNA ITS PCR amplicons of individual species of microbes. From a clinical perspective, if a hrMC profile of an rDNA or rDNA ITS PCR amplicon in a PCR sample indicates that a microorganism of known species identity, such as a specific bacterial species, is present in said clinical sample, the clinician can already make an important first treatment decision: start administering a therapeutic amount of an anti-microbial agent for which the microbial species is known to be sensitive. In some instances, PCR followed by hrMC analysis of the PCR product can provide a definitive answer as to the species identity of the microorganism if there is a clear match with a reference hrMC profile in the database. A match herein indicates that the hrMC profile can be assigned to a specific microorganism species with higher level of certainty than to any other microorganism species in the database. PCR followed by hrMC analysis of the PCR product for example provide a definitive answer / identification of an individual microorganism if a subset selected from N microorganisms is detected based on the subset-specific indicator which comprises at least two microorganism species. Therefore, it is preferred in embodiments of the present invention that the combinatorial detection probes are selected or designed such that all microorganism species within at least one subset, preferably within all subsets, have distinguishable hrMC. The present invention is based on the realization that the detection / identification of individual microorganism species as based on the combinatorial detection probes of the present invention is for example only conclusive when a subset according to the present invention consist of only one microorganism species. The detection / identification of individual microorganism species, that are part of a particular subset, solely based on the detection probes of the present invention, is not possible if a detected subset consist of at least two individual microorganism species. hrMC analysis is for example used to resolve such ambiguity, and one of skill in the art will readily understand the benefit of designing the combinatorial dense probes in such a way that the individual microorganism species in that subset have distinguishable hrMCs. In order to discover (in advance) which species can potentially not be distinguished based on the hrMC analysis alone and thus should be allocated to different subsets selected from N microorganism species according to the invention, a large number of melting curves is for example generated, for instance from rDNA or rDNA ITS amplicons of species of interest (either in silico, using sequences from public databases, or in vitro using samples of known species of microorganisms). Per species, multiple strains are for example tested in order to identify the biological variation in the hrMC signature of the species. Moreover, per strain, preferably multiple melting curves are generated, either in the same run, between runs and on different instruments operated by different technicians, to estimate the impact of different sources of technical variation on resulting melting curves. Alternatively, artificial noise could be added to MCs to simulate various sources of variation. A classifier (such as in the form of a computer machine learning algorithm) is for example used to classify the various hrMCs and annotate or link them to bacterial species. Various classifiers are suitable for this purpose. With this approach, a similarity matrix can be generated that compares every hrMC to every other hrMC in the dataset. A “clash” is defined as the situation wherein the similarity of hrMCs from two different bacterial species is higher than a predefined threshold. In such instances, there is a realistic chance, given biological and technical noise that can occur, that the actual hrMC obtained from a clinical sample results in misidentification of the species. Although these species can be distinguished in most cases when run within the same experiment, strain variation and instrumental variation results in a situation where conclusive identification based on the hrMC is not sufficiently certain. A method of the present invention may further comprise the step of recording a hrMC profile of the generated amplicon for determining the presence of a polymicrobial infection in the sample. A polymicrobial infection in the sample is indicated when the hrMC profile does not agree or does not match with the expected hrMC profile of the microorganism species indicated by or associated with the signal of the detection probe(s). Kit of the present invention The present invention also refers to a kit of parts for performing the method of detecting a subset selected from N microorganism species. The kit of parts for example comprises a selection of at least two detection probes according to the invention. The kit for example comprises at least one pair of broad-taxonomic-range amplification primers for amplifying a variable and / or hypervariable region in a conserved microbial gene. The kit for example further comprises instructions. The kit for example comprises a polymerase enzyme to perform the amplification reaction. The kit for example also comprises a instrument, such as a PCR or qPCR instrument, reaction tubes, a reaction mixture, and / or a reaction buffer to perform the method of the present invention for detecting a subset selected from N microorganism species. The present invention allows for the reliable and accurate screening of a large number of clinical samples for the presence of a microbial infection, and allows species level identification of that microbial infection in a majority of the samples within less than 4 hours, preferably less than 3 hours, such as in about 2 hours, or most preferably less than 2 hours, such as in about 1 hour. The present invention reduces the need for post-PCR analysis, such as for instance determining the amplicon length, or sequencing of the amplicon. As a result, a method of the present invention allows the performance of screening of a large number of clinical samples in a high throughput format, using only a standard inventory of a clinical diagnostic laboratory. Such an inventory may comprise (i) a real-time PCR (qPCR) instrument, optionally capable of recording an amplicon melting curve, with at least 3, 4 or 5 color channels. The inventory may optionally further comprise (iii) a DNA sequencer capable of determining the nucleotide sequence of a DNA amplicon of about 200-1000 nucleotides, for 5- 50 samples per day. Mathematical description The mathematical description of the combinatorial dense probe design is provided in Figure 5. The method is described as follows. In figure 5, the set X represents the group of N microorganism species, the presence of at least one of which is to be determined in said biological sample, wherein N is greater than two (e.g., all the microorganism species the presence of which can be expected in the sample of interest). The probes are actual probes, and one or more probes attached to a color (i.e. the combination of the detection probe plus its detection signal) form a sensor. What the sensors do is partition the set of species into subsets. This term partition is used herein in its common mathematical sense. A partition is a collection of sets that together form the original set (in the present case, of species that could be in the sample) in such a way that each member of the original set ends up in one and only one of the subsets of the partition. This means that through this method each species ends up in a different set that can be identified, which is called a subset herein. There will be no overlap. Some of these subsets can be empty, but the subsets do not overlap, which means that a species cannot end up in two different subsets, or no subset at all. There is an important conceptual difference between the prior art probe design and the combinatorial dense probe design of the present invention. In the context of prior art probe design, a detection probe may have any detectable label and is designed to identify a specific group of species, such as a group of taxonomic species, while another probe with a different detectable label is designed to identify another specific group of species. The result is that there is no collective information from the combination of signals of such probes. In the combinatorial dense probe design, the individual probes or sensors (probes attached to a color) may individually be less meaningful, but the combined information of a multitude of such probes provides for a very powerful diagnostic tool. By consequence, the individual targets of a dense detection probe in the context of the present invention are not really important, and the targets for an individual probe can be quite “random”, what is important is that all the probes, assigned to all their colors, collectively make a design that creates the partitioning that has surprising diagnostic power. Hence, an individual probe (in the context of the selection of its targeting sequence) only has meaning in the entire design where together with all other probes and their colors assigned, it has the effect of creating the desired partition. If one probe in the design is changed, it may be necessary to change all other probes at the same time, to still make the partition work. The dense probe in the context of the present invention therefore may be addressed as a combinatorial probe, or a multiplexing probe to emphasize the design of the combined probes as a whole. The present invention therefore provides a method of detection using combinatorial probes which, through their targeting of specific sequences, facilitate an integrated effect of multiplexed detection signal analysis, enabling both rapid and reliable detection of microorganism subsets and / or even individual microorganisms at the species level. The advantage of using the combinatorial probes design in diagnostic methods may be understood more readily from the following. In attempting to identify or classify individual species in a set of species, the prior art detection methods provide species-specific probes for each species separately, and each probe has one unique label (color) and the number of species that can be detected in a single reaction is limited to the number of color channel. Thus, each color channel indicates the presence of one unique species, limiting the number of detectable species to the number of color channels. The method of the present invention, by contrast, starts with the definition of the set of species that need to be identified or classified, and then defining the diagnostic goal, which is to partition this set of species in a specific way to answer relevant diagnostic questions. The solution involves designing a set of probes and assigning colors such that they, through their combined outputs, create the required partition. A number of constraints may be defined for the required design: preferably, there is at least one probe that detects multiple species (density constraint); preferably, the number of probes is less than the number of species that are identified, either individually or as part of a set in the partition (density constraint); preferably, when working with 2 detection probes with two different labels, there are at least 3 non empty sets in the partition where at least one of the detection signals is active (combinatorial constraint); preferably, there are more non empty sets in the partition than there are detection signals (combinatorial constraint). In essence, the combinatorial probes approach yields more information per probe used than would be the case if only species specific probes were used. The information output of the process is increased and the throughput in screening samples is thereby enhanced. In addition, by allowing for “abstract” partitioning that does not resolve individual species but serves a broader diagnostic purpose, information that is not relevant for the diagnostic method does not have to be produced and hence the throughput is further enhanced. Thus, it is an advantage of the method of the present invention that the diagnostic method uses a lower number of distinct probes than would be needed by prior art methods using species- specific rather than combinatorial probes. It is a further advantage of the method of the present invention that the method allows for a much wider variety of diagnostic methods using partitions where partitions do not necessarily have to mean that its subsets are individual species, but possibly a group of species and that such subsets can have different diagnostic meaning such as, “dangerous”, “more tests needed”, “intervene by specific antibiotic treatment”, etc. The invention is illustrated in greater detail in the examples below. EXAMPLES Example 1: Use of two detection probes having different detectable labels Two groups of different species are identified which are detectable by two detection probes. Group 1, detectable by detection probe 1 comprising a red fluorophore as detection signal, consists of 11 individual microorganisms and Group 2, detectable by detection probe 2 comprising a green fluorophore as detection signal, consists of 8 individual microorganisms. Group 1 and 2 have 5 microorganisms in common and 8 microorganism not in common.6 microorganisms are exclusively present in Group 1 and 3 microorganisms are exclusively present in Group 2, see Table 2A and 2B. Species of Group (Detection probe of Group 1 having a red Table 2A: Exemplary detection probe for a 1stgroup of microorganism having a red detection signal. Table 2B: Exemplary detection probe for a 2ndgroup of microorganisms having a green detection signal. Using two color channels of a (q)PCR instrument, the two groups provide three distinct subsets of microorganisms based on the specific combination of detection signals: (1) only red, (2) only green, and (3) red and green, see Figure 1. Example 2: Using four detection probes providing three different detection signals In practice, it will not always be possible to find a single detection probe that is positive for a given selection of species and negative for a different selection. Hence, more than two probes may be needed. In our example finding a minimum probe set for three color channels yields the four detection probes according to Table 3: Detection Probe Detection Targeting sequence signal No.1 CCTTCCGATACGGCTACCTTGTTA (SEQ ID NO.30) Color 1 No.2 TTACCACGGWRTGMTTCATGACTGGG (SEQ ID NO.31) Color 1 No.3 GTTCGATCCCGCTAGGCTCCATTA (SEQ ID NO.32) Color 2 No.4 TTAGGAGCYAGCCGYCKAAGGTGGGA (SEQ ID NO.33) Color 3 Table 3: Four detection probes defining four distinct groups of microorganisms having three different detection signals

[0002] Individual microorganism which are detectable by at least one of the four detection probes are grouped according to Table 4: GroupDetection probe Microorganism speciesNo.1 No.1 Enterococcus faecalis, Enterococcus faecium, Listeria monocytogenes, Staphylococcus aureus, Staphylococcus epidermidis, Stenotrophomonas maltophilia, Streptococcus constellatus, Streptococcus dysgalactiae, and Streptococcus mitis No.2 No.2 Neisseria meningitidis, and Pseudomonas aeruginosa No.3 No.3 Enterococcus faecium, Streptococcus constellatus and Streptococcus dysgalactiae No.4 No.4 Staphylococcus aureus and Streptococcus dysgalactiae Table 4: Overview of the individual microorganism targeted by the four detection probes. The unique signal combination of the four detection probes results in five specific subsets having the color channel combination of 0 / 0 / 0; 1 / 0 / 0; 1 / 0 / 1; 1 / 1 / 0; and 1 / 1 / 1, see Table 5. Color 1 Color 2 Color 3 Subset Cutibacterium acnes 0 0 0 1 Enterococcus faecalis 1 0 0 2 Enterococcus faecium 1 1 0 4 Fusobacterium nucleatum 0 0 0 1 Listeria monocytogenes 1 0 0 2 Morganella morganii 0 0 0 1 Neisseria meningitidis 1 0 0 2 Pseudomonas aeruginosa 1 0 0 2 Staphylococcus aureus 1 0 1 3 Staphylococcus epidermidis 1 0 0 2 Stenotrophomonas maltophilia 1 0 0 2 Streptococcus constellatus 1 1 0 4 Streptococcus dysgalactiae 1 1 1 5 Streptococcus mitis 1 0 0 2 Table 5: Exemplary microorganism subset identification based on a unique detection signal combination. Figure 2 shows the resulting graph coloring of the clash matrix using four different detection probes (comprising four different targeting sequences) with three different detectable labels to provide detection signals for recording in three color channels. There are many ways to tune this method to use different channels of colors given preferences of how many probes need to be used, how dense or sparse they should be etc. Moreover, a combination of multicolor dense probes and hrMC of variable DNA regions can resolve bacteria to the species level for almost any selection of species with a minimal number of probes. This opens up the possibility to create almost any bacterial detection and identification assay in a single-well solution for a large number of species without the limitations of traditional multiplexing.

Claims

Claims 1. A method for detecting and classifying a microorganism present in a biological sample by a nucleic acid amplification reaction, said method comprising the steps of: a) providing a biological sample that has been obtained and which is suspected of comprising a microorganism, and optionally isolating nucleic acids from said biological sample; b) defining a group of N microorganism species, the presence of at least one of which is to be determined in said biological sample, wherein N is greater than two; c) providing a reaction container comprising a nucleic acid amplification reaction mixture comprising: (i) an aliquot of said biological sample or nucleic acids isolated therefrom; (ii) at least one pair of broad-taxonomic-range amplification primers for amplifying a variable and / or hypervariable region in a conserved microbial gene from the, optionally isolated, nucleic acids in said sample and for generating an amplicon, preferably wherein said amplicon differs between each of said N microorganism species, (iii) at least two nucleic acid detection probes, -wherein each of said detection probes detects the amplicon of asubgroup selection comprising at least two microorganism species selected from said group of N microorganism species, -wherein said at least two detection probes comprise a detectablelabel for generating a detection signal when the probe target sequence is present in the amplicon, and wherein the detection signals of said at least two detection probes are individually detectable and together provide a combination of at least two different detection signals based on the presence or absence of the probe target sequence in the amplicon,- wherein said combination of said at least two different detectionsignals partitions said group of N microorganism species into M subsets wherein each microorganism species of said group of N microorganism species is in one and only one of these M subsets, -wherein the total number of detection probes is smaller than M,d) performing a nucleic acid amplification reaction on the mixture of step c) for generating an amplicon, e) allowing said probes to detect their respective target sequence in said amplicon, and recording the detection signal of each of said detection probes, f) classifying a microorganism present in said biological sample on the basis of the subset-specific combination of detection signals of said detection probes recorded in step e), wherein said microorganism species is classified as a member of one distinct subset within the M subsets.

2. The method according to claim 1, wherein steps d) and e) are carried out in the same single closed reaction container.

3. The method according to claim 1 or 2, wherein the reaction mixture comprises a DNA intercalating dye, and step e) further comprises recording the signal of the DNA intercalating dye and establishing the presence or absence of an amplicon based on a recorded signal of the DNA intercalating dye, and wherein the presence or absence of an amplicon establishes the presence or absence of a microorganism in said biological sample, preferably wherein the signal of the DNA intercalating dye is different from the detection signal of said detection probes.

4. The method according to any one of claims 1-3, wherein said conserved microbial gene is selected from a ribosomal RNA (rRNA) gene, a ribosomal protein gene, a DNA gyrase (subunit A) (GyrA) gene, a DNA gyrase (subunit B) (GyrB) gene, a RecA protein gene, an ATPase subunitgene, an RNA polymerase subunit gene, an Elongation factor thermal unstable Tu (EF-Tu) gene, an Elongation factor G (EF-G) gene, a Proteintranslocase subunit SecY (secY) gene, and a beta-tubulin (tubB) gene,preferably wherein the amplicon comprises a 16S-23S rDNA ITS region or an 18S-5.8S-26S / 28S rDNA ITS region or a fragment thereof.

5. The method according to any one of the preceding claims, wherein said at least two detection probes each comprise a targeting sequence the nucleic acid sequence of which comprises at least 50%, preferably at least 80%, more preferably at least 90%, still more preferably at least 95% sequence identity to a target sequence in the amplicon or the reverse complement thereof, and wherein the targeting sequences of said at least two detection probes is identified by: a) providing a database comprising nucleic acid sequences of said amplicon predicted to be generated in step e) annotated to each microorganism species in the group of N microorganism species; b) having a computer program select target sequences for each of said at least two detection probes in said predicted amplicon sequences of the group of N microorganism species, wherein said target sequences have a length of about 15-40, preferably from about 20-30 consecutive bases, and wherein said target sequence is present in a subgroup selection of at least two microorganism species selected from said group of N microorganism species, and wherein said target sequence is not present in any other microorganism species from said group of N microorganism species, to thereby provide nucleic acid targets for the detection probes in the amplicon.

6. The method according to any one of the preceding claims, wherein said subset as defined by the combination of said at least two different detection signals is comprised of multiple microorganism species of which the high resolution melting curves (hrMCs) of their respective amplicons have distinguishable profiles.

7. The method according to any one of the preceding claims, wherein step d) and e) are performed on a PCR instrument comprising distinct color channels for detecting distinct detection signals from said at least two detection probes and wherein the detection probes in said reaction mixture generate between 2 and X distinct detection signals, wherein X is the number of distinct color channels of the PCR instrument.

8. The method according to any one of the preceding claims, wherein the detection probes comprise degenerate probes, or wherein two or more detection probes that have similar or identical detectable labels together target said subgroup selection of microorganism species selected from said group of N microorganism species.

9. The method according to any one of the preceding claims, wherein the biological sample is selected from whole blood, serum, synovial fluid, plasma, urine, and cerebrospinal fluid / liquor.

10. The method according to any one of the preceding claims, wherein the nucleic acid amplification reaction is a polymerase chain reaction (PCR), preferably a quantitative polymerase chain reaction (qPCR).

11. A kit of parts comprising at least two nucleic acid detection probes, wherein each of said detection probes detects the amplicon of a subgroup selection of at least two microorganism species selected from a group of at least three microorganism species the presence of at least one of which group is to be determined in a biological sample, wherein said amplicon is obtainable by performing a nucleic acid amplification reaction on an aliquot of said biological sample or nucleic acids isolated therefrom using at least one pair of broad-taxonomic-range amplification primers for amplifying a variable and / or hypervariable region in a conserved microbial gene from the, optionally isolated, nucleic acids in said sample and for generating anamplicon, preferably wherein said amplicon comprises the 16S-23S rDNA- ITS, wherein said at least two detection probes comprise a detectable label for generating a detection signal when the probe target sequence is present in the amplicon, and wherein the detection signals of said at least two detection probes are individually detectable and together provide a combination of at least two different detection signals based on the presence or absence of the probe target sequence in the amplicon, wherein said combination of said at least two different detection signals partitions said group of at least three microorganism species into distinct subsets wherein each microorganism species of said group of at least three microorganism species is in one and only one of these distinct subsets, and wherein the total number of detection probes is smaller than the number of distinct subsets.

12. Method according to any one of claims 1-10 or kit of part according to claim 11, wherein the detection probes are hydrolysis probes.

13. Method according to any one of claims 1-10 or kit of part according to claim 11, wherein the at least two detection probes comprise 3, 4, 5, or more detection probes for detecting the presence or absence of respectively 8, 16 or 32 or 2^xdistinct microorganism species or distinct groups of microorganism species in said biological sample, wherein x is the number of distinct color channels in the instrument used for detecting the probe detection signals.

14. Method according to any one of claims 1-10 or kit of part according to claim 11, wherein the total number of detection probes needed for detecting and classifying each microorganism species from said group of N microorganism is divided over multiple separate reaction containers, preferably wherein each reaction container comprises multiple detection probes that in combination have no more than x distinct detectable labels,wherein x is the number of distinct color channels in the instrument used for detecting the probe detection signals of said x distinct detectable labels.

15. Kit of parts according to any of claims 11-14, wherein said kit further comprises a pair of broad-taxonomic-range amplification primers for amplifying a variable and / or hypervariable region in a conserved microbial gene from a microorganism species.

Images