Tetracyclic compound, preparation method therefor, and pharmaceutical use thereof

Abstract

The present invention relates to a tetracyclic compound, a preparation method therefor, and a pharmaceutical use thereof. Specifically, the present invention relates to a tetracyclic compound as shown in general formula (I), a preparation method therefor, a pharmaceutical composition containing the tetracyclic compound, and a use of the tetracyclic compound as a therapeutic agent, especially a use as a BCL6 inhibitor or a degradation agent and a use in preparation of drugs for treating and / or preventing BCL6 mediated or dependent diseases or conditions. The groups in general formula (I) are as defined in the description.

Description

Tetracyclic compounds, their preparation methods and their pharmaceutical applications Technical Field

[0001] This disclosure pertains to the pharmaceutical field and relates to a tetracyclic compound of general formula (I), a method for its preparation, a pharmaceutical composition containing the tetracyclic compound, and its use as a therapeutic agent, particularly as a BCL6 inhibitor or degrader, and in the preparation of medicaments for the treatment and / or prevention of BCL6-mediated or dependent diseases or conditions. Background Technology

[0002] BCL6 (B-cell lymphoma 6) is a member of the BTB / POZ zinc finger family, containing an N-terminal BTB / POZ domain and a C-terminal zinc finger structure. As a transcription factor for T follicular helper (Tfh) cells, BCL6 is essential for germinal center formation and antibody affinity maturation in naive B cells. Initially identified as an oncogene in diffuse large B-cell lymphomas (DIBCLs), BCL6 is associated with many types of diseases, including B-cell acute lymphoblastic leukemia, chronic myeloid leukemia, breast cancer, and non-small cell lung cancer (NSCLC). The N-terminal BTB / POZ domain binds to and recruits co-inhibitors such as SMRT, NCOR1, and BCOR, forming type I and type II histone deacetylase complexes, while the C-terminal zinc finger binds to specific DNA recognition sequences. By binding to target gene sequences and forming complexes, BCL6 can reduce the expression of target gene RNA, including some key tumor suppressor factors. Overexpression of BCL6 leads to ectopic inhibition of cyclins and DNA repair checkpoint proteins, resulting in uncontrolled cell proliferation and tumorigenesis, a phenomenon commonly seen in malignancies such as non-Hodgkin's lymphoma (NHL). Germinal center reactions (GCs) in some diseases lead to increased production of disease-related autoantibodies, suggesting that inhibiting or degrading BCL6 has potential therapeutic applications. The structural characterization of the co-crystal structure of the BCL6 TB / POZ domain and its co-inhibitor indicates that binding occurs at a side groove formed at the interface between the BCL6 BB / POZ homodimers. Therefore, research is being conducted on specific ligands binding to this groove site, and the discovery of this groove-affinity ligand makes BCL6 a potential drug target.

[0003] Protein degradation is a highly regulated and essential process for maintaining cellular homeostasis. The selective recognition and removal of damaged, misfolded, or redundant proteins is achieved via the ubiquitin-proteasome pathway (UPP). UPP is central to regulating almost all cellular processes. Protein ubiquitination is accomplished by E3 ubiquitin ligases, which bind to proteins and add ubiquitin molecules to them, thereby enabling the proteasome to degrade the ubiquitinated protein. One promising therapy uses chimeric proteolysis, commonly known as PROTACs, to remove unwanted proteins through protein degradation. PROTACs are ligand-directed degraders that bind an E3 ligase to the target protein to be degraded. These bivalent molecules typically consist of an E3 ligase ligand that is linked via a linker portion to a small molecule bound to the target protein. PROTACs position the E3 ligase at the appropriate distance and orientation to the target protein, allowing the latter to ubiquitinate. The ubiquitinated target protein is then recognized by the proteasome and subsequently degraded. In summary, PROTAC chimeric molecules can be used to link ligands targeting the substrate-binding pocket of the BCL6 BTB domain and E3 ligands together via linkers, thereby achieving the goal of degrading BCL6. Summary of the Invention

[0004] The purpose of this disclosure is to provide a compound of general formula (I) or a pharmaceutically acceptable salt thereof.

[0005] in:

[0006] Cy is an arbitrary ring controlled by one or more R. 8 The replacement of the four rings;

[0007] It can be a double bond or a single bond;

[0008] X is N or CR 9 ;

[0009] R 9 Selected from hydrogen atom, halogen, hydroxyl, alkyl, hydroxyalkyl, haloalkyl and cyano;

[0010] L c Selected from key, -(CR) a R b ) a -、-O-、-S-、-NR c -、-C(O)-、-C(O)NR c -and-NR c C(O)-;

[0011] L is -(L) A ) n -;

[0012] n is an integer from 0 to 20;

[0013] Each L A They may be the same or different, and each is independently selected from O and S(O). v NR c C(O), C(O)NR c NR c C(O), C(O)O, OC(O), alkylene, alkenyl, ynyl, cycloalkyl, heterocyclic, aryl, and heteroaryl; wherein each of the alkylene, alkenyl, ynyl, cycloalkyl, heterocyclic, aryl, and heteroaryl groups is independently and optionally selected by one or more R L replace;

[0014] R 1 Selected from hydrogen atom, alkyl, haloalkyl, hydroxyalkyl, alkoxy, haloalkoxy, alkoxyalkyl, -alkylene-NR 17 R 18 alkyl, cycloalkylalkyl, heterocyclic, aryl, and heteroaryl; each of the alkyl, alkylene, alkoxy, alkoxyalkyl, cycloalkyl, cycloalkylalkyl, heterocyclic, aryl, and heteroaryl groups is independently and optionally composed of one or more R 1a replace;

[0015] X 1 For N or CR 2a ;

[0016] X 2 For N or CR 2b ;

[0017] X 3 For N or CR 2c ;

[0018] R 2a R 2b R 2c and R 3a They may be the same or different, and each is independently selected from hydrogen atom, halogen, alkyl, haloalkyl, hydroxyalkyl, alkoxy, haloalkoxy, cyano, hydroxyl, -NR 17 R 18 cycloalkyl and heterocyclic groups;

[0019] R 3 For -A 1 -(CR 4a R 4b ) t -A 2 Or -CH = CH-A 2 ;

[0020] R 4a and R 4bThey may be the same or different, and each is independently selected from hydrogen, halogen, alkyl, haloalkyl, hydroxyalkyl, alkoxy, haloalkoxy, cyano, and hydroxyl; or R 4a and R 4b Together with the attached carbon atom, it forms a cycloalkyl or heterocyclic group, each of which is independently and optionally influenced by one or more R groups. 4c replace;

[0021] t is 1, 2, 3, 4, or 5;

[0022] A 1 Selected from NR Y O and S;

[0023] R Y Selected from hydrogen atoms, alkyl, haloalkyl, hydroxyalkyl, cycloalkyl, and cycloalkylalkyl;

[0024] A 2 Selected from -C(O)NR 4 R 5 -C(O)R 6 -C(O)OR 6 -S(O) 1-2 R 6 -P(O)-R 6 R 6 and -C(=NH)NH2;

[0025] R 4 and R 5 The same or different, and each independently selected from hydrogen atoms, alkyl, alkenyl, alkynyl, haloalkyl, hydroxyalkyl, alkoxy, haloalkoxy, cycloalkyl, heterocyclic, aryl, and heteroaryl, wherein the alkyl, alkoxy, alkenyl, alkynyl, cycloalkyl, heterocyclic, aryl, and heteroaryl are each independently optionally selected by one or more R 5a Replace; or, R 4 and R 5 Together with the attached nitrogen atom, it forms an optional structure with one or more R atoms. 5a Substituted heterocyclic groups;

[0026] R 6 The same or different, and each independently selected from hydrogen atoms, alkyl, alkenyl, alkynyl, haloalkyl, hydroxyalkyl, cycloalkyl, heterocyclic, aryl, and heteroaryl, wherein each alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclic, aryl, and heteroaryl is independently optionally selected by one or more R 6a replace;

[0027] X a For N or CR 7a ;

[0028] X b For N or CR7b ;

[0029] X c For N or CR 7c ;

[0030] R 7 R 7a R 7b and R 7c The same or different, and each independently selected from hydrogen atom, halogen, alkyl, alkenyl, alkynyl, cyano, haloalkyl, hydroxyalkyl, alkoxy, alkoxyalkyl, haloalkoxy, cycloalkyl, heterocyclic, aryl, heteroaryl, -OR 16 -NR 17 R 18 ,-alkylene-NR 17 R 18 -C(O)R 16 -C(O)OR 16 -C(O)NR 17 R 18 and -S(O) v R 16 ;

[0031] Each R 8 R L R 1a R 4c R 5a and R 6a They may be the same or different, and each is independently selected from halogen, alkyl, alkenyl, alkynyl, haloalkyl, hydroxyalkyl, alkoxy, haloalkoxy, alkoxyalkyl, -alkylene-NR 17 R 18 , cyano, amino, hydroxy, nitro, -OR 16 -NR 17 R 18 -C(O)R 16 -C(O)OR 16 -C(O)NR 17 R 18 -OC(O)NR 17 R 18 -OC(O)R 16 -OC(O)OR 16 -NR 19 C(O)R 16 -NR 19 C(O)OR 16 -C(=NR) 20 )NR 17 R 18 -S(O) v R 16 -S(O)v NR 17 R 18 -NR 19 S(O) v R 16 -NR 19 S(O) v NR 17 R 18 =O, =S, =CR 21 R 22 alkyl, heterocyclic, aryl, and heteroaryl; wherein each of the alkyl, alkylene, alkenyl, alkoxy, alkoxyalkyl, cycloalkyl, heterocyclic, aryl, and heteroaryl groups is independently and optionally composed of one or more R 0 replace;

[0032] R 16 R 17 and R 18 The same or different, and each independently selected from hydrogen atoms, alkyl, alkenyl, ynyl, cycloalkyl, heterocyclic, aryl, and heteroaryl; wherein the alkyl, alkenyl, ynyl, cycloalkyl, heterocyclic, aryl, and heteroaryl are each independently optionally selected by one or more R atoms. 0 Replace; or R 17 and R 18 Together with the connected nitrogen atom, they form an optional structure with one or more R atoms. 0 Substituted heterocyclic groups;

[0033] R 19 They may be the same or different, and each is independently selected from hydrogen atoms, alkyl groups, and cycloalkyl groups;

[0034] R 20 They may be the same or different, and each is independently selected from hydrogen atoms, alkyl, alkoxy, hydroxyl and cycloalkyl;

[0035] R 21 and R 22 They may be the same or different, and each is independently selected from hydrogen atoms, halogens, alkyl groups, haloalkyl groups, hydroxyalkyl groups, and cycloalkyl groups; or, R 21 and R 22 Together with the carbon atoms attached to it, they form cycloalkyl groups;

[0036] R 0They may be the same or different, and each is independently selected from =O, =S, =CH2, =CHF, =CF2, halogen, hydroxyl, alkenyl, alkynyl, cyano, nitro, amino, -NHalkyl, -N(alkyl)2, -C(O)Oalkyl, -C(O)OH, -C(O)NH2, -C(O)NH(alkyl), -C(O)N(alkyl)2, -C(O)halogen, -C(O)alkyl, alkyl, haloalkyl, hydroxyalkyl, alkoxy, haloalkoxy, alkoxyalkyl, aminoalkyl, -S(alkyl), cycloalkyl, cycloalkylalkyl, cycloalkyloxy, heterocyclic, heterocyclic alkyl, heterocyclic oxy, aryl, arylalkyl, aryloxy, heteroaryl, heteroarylalkyl and heteroaryloxy;

[0037] R a and R b They may be the same or different, and each is independently selected from hydrogen, halogen, alkyl, haloalkyl, alkoxy, hydroxyalkyl, cyano and hydroxyl;

[0038] R c Selected from hydrogen atoms, alkyl, haloalkyl, hydroxyalkyl, cycloalkyl, and cycloalkylalkyl;

[0039] a can be 0, 1, 2, 3, 4, or 5;

[0040] v can be 0, 1, or 2.

[0041] In some embodiments of this disclosure, the compound represented by general formula (I) or a pharmaceutically acceptable salt thereof is a compound represented by general formula (I-1) or a pharmaceutically acceptable salt thereof.

[0042] in:

[0043] Cy, L, X a X b X c X 1 X 2 X 3 R 1 R 3 R 3a and R 7 As defined in general formula (I).

[0044] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts of general formulas (I), (I-1), (I-2), (I-3), and (II) are not compounds disclosed in WO2023232133A1 or CN117229263A.

[0045] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts of general formulas (I), (I-1), (I-2), (I-3), and (II) are not the following compounds:

[0046] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), or pharmaceutically acceptable salts thereof, wherein X 1 For CR 2a ;X 2 For CR 2b ;X 3 For CR 2c Or, X 1 For N; X 2 For CR 2b ;X 3 For CR 2c Or, X 1 For CR 2a ;X 2 For N; X 3 For CR 2c Or, X 1 For CR 2a ;X 2 For CR 2b ;X 3 For N; R 2a R 2b and R 2c As defined in general formula (I); in some implementations, X 1 For CR 2a ;X 2 For CR 2b ;X 3 For CR 2c ;R 2a R 2b and R 2c As defined in general formula (I); in some implementations, X 1 For CH; X 2 For CH; X 3 For N or CH; in some implementations, X 1 For CH; X 2 For CH; X 3 For CH.

[0047] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), or pharmaceutically acceptable salts thereof, wherein for X 3 R 1 R 2a R2b R 4 and R 5 As defined in general formula (I); in some implementations, for R 1 R 2a R 2b R 2c R 4 and R 5 As defined in general formula (I).

[0048] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), or pharmaceutically acceptable salts thereof, wherein X 1 For N; in some implementations, X 1 For N or CH; in some implementations, X 1 For CR 2a ;R 2a As defined in general formula (I); in some implementations, X 1 For CH.

[0049] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), or pharmaceutically acceptable salts thereof, wherein X 2 For N; in some implementations, X 2 For N or CH; in some implementations, X 2 For CR 2b ;R 2b As defined in general formula (I); in some implementations, X 2 For CH.

[0050] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), or pharmaceutically acceptable salts thereof, wherein X 3 For N; in some implementations, X 3 For N or CH; in some implementations, X 3 For CR 2c ;R 2c As defined in general formula (I); in some implementations, X 3 For CH.

[0051] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), or pharmaceutically acceptable salts thereof, wherein R 3a Selected from hydrogen atoms, halogens and C 1-6 Alkyl; in some embodiments, R 3a It is a hydrogen atom.

[0052] In some embodiments of this disclosure, the compound represented by general formula (I), general formula (I-1), or a pharmaceutically acceptable salt thereof, wherein t is 1 or 2; in some embodiments, t is 1.

[0053] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), or pharmaceutically acceptable salts thereof, wherein R 3 For -A 1 -CR 4a R 4b -A 2 A 1 A 2 R 4a and R 4b As defined in general formula (I); in some implementations, R 3 for R 4 and R 5 As defined in general formula (I); in some implementations, R 3 for R 4 and R 5 Whether the atoms are the same or different, and each is independently selected from hydrogen atoms, C atoms 1-6 Alkyl and 3- to 6-membered cycloalkyl; in some embodiments, R 3 for R 4 and R 5 They may be the same or different, and each is independently a hydrogen atom or a carbon atom. 1-6 Alkyl; in some embodiments, R 3 Selected from In some implementation schemes, R 3 for In some implementation schemes, R 3 for

[0054] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), or pharmaceutically acceptable salts thereof, wherein R Y It is a hydrogen atom or a carbon atom. 1-6 Alkyl; in some embodiments, R Y It is a hydrogen atom.

[0055] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), or pharmaceutically acceptable salts thereof, wherein A 1 It is O.

[0056] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), or pharmaceutically acceptable salts thereof, wherein A 2-C(O)NR 4 R 5 ;R 4 and R 5 As defined in general formula (I); in some implementations, A 2 Selected from -C(O)NH2, -C(O)NH(CH3) and -C(O)N(CH3)2; in some embodiments, A 2 It is -C(O)NH(CH3) or -C(O)NH (cyclopropyl); in some embodiments, A 2 It is -C(O)NH(CH3).

[0057] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), or pharmaceutically acceptable salts thereof, wherein R 4a and R 4b They may be the same or different, and each is independently a hydrogen atom or a carbon atom. 1-6 Alkyl; in some embodiments, R 4a and R 4b They may be the same or different, and each is independently a hydrogen atom or a methyl group; in some embodiments, R 4a and R 4b It is a hydrogen atom.

[0058] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), or pharmaceutically acceptable salts thereof, wherein X a For N; in some implementations, X a For CR 7a ;R 7a As defined in general formula (I); in some implementations, X a For N or CH; in some implementations, X a For CH.

[0059] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), or pharmaceutically acceptable salts thereof, wherein X b For N; in some implementations, X b For CR 7b ;R 7b As defined in general formula (I); in some implementations, X b For N or CH; in some implementations, X b For CH.

[0060] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), or pharmaceutically acceptable salts thereof, wherein X c For N; in some implementations, X c For CR 7c ;R7c As defined in general formula (I); in some implementations, X c For N or CH; in some implementations, X c For CH.

[0061] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), or pharmaceutically acceptable salts thereof, wherein X a For N; X b For N or CR 7b ;X c For CR 7c ;R 7b and R 7c As defined in general formula (I); in some implementations, X a For N; X b For N or CH; X c For CH; in some implementations, X a For N; X b For N; X c For CH.

[0062] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), or pharmaceutically acceptable salts thereof, wherein R 7a R 7b and R 7c They may be the same or different, and each is independently selected from hydrogen atoms, halogens, and carbon atoms. 1-6 Alkyl; in some embodiments, R 7a R 7b and R 7c They may be the same or different, and each is independently a hydrogen atom or a halogen; in some embodiments, R 7a R 7b and R 7c They may be the same or different, and each is independently a hydrogen atom or F; in some implementations, R 7a R 7b and R 7c For hydrogen atoms; in some implementations, R 7a For hydrogen atoms; in some implementations, R 7b For hydrogen atoms; in some implementations, R 7c It is a hydrogen atom.

[0063] In some embodiments of this disclosure, the compound represented by general formula (I), general formula (I-1), or a pharmaceutically acceptable salt thereof, wherein n is 1, 2, 3, 4, 5, 6, or 7; in some embodiments, n is 1, 2, 3, 4, 5, or 6; in some embodiments, n is 1, 2, 3, 4, or 5; in some embodiments, n is 2, 3, 4, or 5; in some embodiments, n is 2 or 3; in some embodiments, n is 3; and in some embodiments, n is 2.

[0064] In some embodiments of this disclosure, n is 0, that is, L is a key.

[0065] In some embodiments of this disclosure, the compounds represented by general formulas (I), (I-1), and (I-2) or their pharmaceutically acceptable salts, wherein each L A They may be the same or different, and each is independently selected from O, S, NH, C(O), C 1-6 Alkylene, C 2-6 alkenyl, C 2-6 Alkyne group, 3- to 12-membered cycloalkyl group and 3- to 12-membered heterocyclic group, wherein the C 1-6 The alkylene group, the 3- to 12-membered cycloalkyl group, and the 3- to 12-membered heterocyclic group are each independently and optionally influenced by one or more R groups. L Replace, R L As defined in general formula (I); in some implementations, each L A They may be the same or different, and each is independently selected from O, NH, C(O), C 1-6 Alkylene, 4- to 8-membered cycloalkyl, and 4- to 8-membered heterocyclic groups, each of which is independently optionally surrounded by one or more R groups. L Replace, R L As defined in general formula (I); in some implementations, each L A They are the same or different, and each is independently selected from O, C(O), C 1-6 Alkylene, 4- to 8-membered cycloalkyl, and 4- to 8-membered heterocyclic groups; in some embodiments, each L A Same or different, and each independently selected from O and C 1-6 Alkylene, 4- to 8-membered cycloalkyl, and 4- to 8-membered heterocyclic groups; in some embodiments, each L A They may be the same or different, and each is independently selected from O, 4 to 8-membered cycloalkyl and 4 to 8-membered heterocyclic groups; in some embodiments, each L A They may be the same or different, and each is independently selected from O, 4 to 6-membered cycloalkyl and 4 to 6-membered heterocyclic groups; in some embodiments, each L A The same or different, and each independently is C. 1-6 Alkylene or 4- to 6-membered heterocyclic groups.

[0066] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), and general formula (I-2), or their pharmaceutically acceptable salts, wherein L is -(L A ) n -, where n is 1, 2, 3, 4, or 5, and each L A They may be the same or different, and each is independently selected from O, NH, C(O), C 1-6 Alkylene, 4- to 8-membered cycloalkyl, and 4- to 8-membered heterocyclic groups, each of which is independently optionally surrounded by one or more R groups. L Replace, R L As defined in general formula (I); in some implementations, L is -(L A ) n -, where n is 1, 2, 3, 4, or 5, and each L A They may be the same or different, and each is independently selected from O, NH, C(O), C 1-6 Alkylene, 4- to 8-membered cycloalkyl, and 4- to 8-membered heterocyclic groups, each of which is independently optionally surrounded by one or more R groups. L Replace, R L They may be the same or different, and each is independently selected from halogens, C 1-6 Alkyl, C 1-6 Halogenated alkyl groups, hydroxyl groups, and =O;

[0067] In some implementations, L is -L A2 -L A1 -L A3 -;L A2 and L A3 They may be the same or different, and each independently is a 4- to 8-membered cycloalkyl group and a 4- to 8-membered heterocyclic group; each of the 4- to 8-membered cycloalkyl group and the 4- to 8-membered heterocyclic group is independently optionally converted by one or more R L Replace; R L and L A1 As defined in general formula (II);

[0068] In some implementations, L is Z 3 Z 4 b3, b4, R L x2, L A1 and L A2 As defined in general formula (I-3);

[0069] In some implementations, L is Z1, Z 2 Z 3 Z 4 b1, b2, b3, b4, R Lx1, x2 and L A1 As defined in general formula (II);

[0070] In some implementation schemes, L is selected from

[0071] In some implementation schemes, L is selected from

[0072] In some implementation schemes, L is selected from In some implementation schemes, L is selected from In some implementation schemes, L is selected from *End and R 7 The rings are connected; in some implementations, L is selected from... *End and R 7 The rings are connected; in some implementations, L is selected from... In some implementation schemes, L is selected from In some implementation schemes, L is selected from In some implementation schemes, L is selected from In some implementation schemes, L is selected from *End and R 7 The rings are connected; in some implementations, L is selected from... *End and R 7 The rings are connected; in some implementations, L is... In some implementations, L is In some implementations, L is *End and R 7 The rings they belong to are connected.

[0073] In some embodiments of this disclosure, the compounds represented by general formulas (I), (I-1), (I-2), and (I-3), or their pharmaceutically acceptable salts, wherein L A2 Selected from bonds, 4- to 8-membered cycloalkyl groups and 4- to 8-membered heterocyclic groups, each of which is independently optionally converted by one or more R groups. LReplace, R L As defined in general formula (I); in some implementations, L A2 The alkyl group is a 4- to 8-membered cycloalkyl group, wherein the 4- to 8-membered cycloalkyl group is optionally bonded by one or more R groups. L Replace, R L As defined in general formula (I); in some implementations, L A2 For key; in some implementations, L A2 It is a 4- to 8-membered cycloalkyl group, wherein the 4- to 8-membered cycloalkyl group is optionally surrounded by one or more R L Replace, R L As defined in general formula (I); in some implementations, L A2 It is a 4- to 6-membered cycloalkyl or a 4- to 6-membered heterocyclic group, wherein each of the 4- to 6-membered cycloalkyl and the 4- to 6-membered heterocyclic group is independently optionally converted by one or more R L Replace, R L As defined in general formula (I); in some implementations, L A2 The group is selected from cyclobutyl, azircyclobutyl, cyclopentyl, pyrrolidinyl, piperidinyl, piperazinyl, and cycloheptyl, and each of the above groups is independently optionally surrounded by one or more R. L Replace, R L As defined in general formula (I); in some implementations, L A2 Selected from cyclobutane, aziridine, and piperazine; in some embodiments, L A2 It is a 4- to 6-membered cycloalkyl group; in some embodiments, L A2 Selected from cyclobutyl and cyclopentyl; in some embodiments, L A2 For bond or cyclobutyl; in some embodiments, L A2 It is cyclobutane; in some embodiments, L A2 for Z 1 Z 2 b1, b2, R L And x1 as defined in general formula (II); in some implementations, L A2 Selected from Furthermore, each of the above groups is independently and optionally converted by one or more R groups. L Replace, R L As defined in general formula (I); in some implementations, L A2 Selected from key, In some implementations, L A2 For key or In some implementations, L A2 for

[0074] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), and general formula (I-2), or their pharmaceutically acceptable salts, wherein L A3 It is a 4- to 8-membered heterocyclic group, wherein the 4- to 8-membered heterocyclic group is optionally surrounded by one or more R L Replace, R L As defined in general formula (I); in some implementations, L A3 For optional use by one or more R L The substituted 6-membered heterocyclic group, R L As defined in general formula (I); in some implementations, L A3 The group is selected from cyclobutyl, azircyclobutyl, cyclopentyl, pyrrolidinyl, piperidinyl, piperazinyl, and cycloheptyl, and each of the above groups is independently optionally surrounded by one or more R. L Replace, R L As defined in general formula (I); in some implementations, L A3 It is piperidinyl or piperazine; in some embodiments, L A3 It is piperidinyl; in some embodiments, L A3 for Z 3 Z 4 b3, b4, R L And x2 as defined in general formula (II); L A3 Selected from Furthermore, each of the above groups is independently and optionally converted by one or more R groups. L Replace, R L As defined in general formula (I); in some implementations, L A3 for Furthermore, each of the above groups is independently and optionally converted by one or more R groups. L Replace, R L As defined in general formula (I);

[0075] In some implementations, L A3 Selected from

[0076] *End and R 7 The rings are connected; in some implementations, L A3 for In some implementations, L A3 for *End and R 7 The rings they belong to are connected.

[0077] In some embodiments of this disclosure, the compound represented by general formula (I) or a pharmaceutically acceptable salt thereof, wherein X is N; in some embodiments, X is CR 9 ;R 9 As defined in general formula (I); in some implementations, X is CH or N; in some implementations, X is CH.

[0078] In some embodiments of this disclosure, the compound represented by general formula (I) or a pharmaceutically acceptable salt thereof, wherein It is a single key; in some implementations, It is a double bond.

[0079] In some embodiments of this disclosure, the compound represented by general formula (I) or a pharmaceutically acceptable salt thereof, wherein X is CH; It can be a double bond or a single bond; in some implementations, X is CH; X is a single bond; in some implementations, X is N; It is a single key.

[0080] In some embodiments of this disclosure, the compound represented by general formula (I) or a pharmaceutically acceptable salt thereof, wherein L c Selected from bonds, NH and NHC(O); in some embodiments, L c For key.

[0081] In some embodiments of this disclosure, the compound represented by general formula (I) or general formula (I-1), or a pharmaceutically acceptable salt thereof, is a compound represented by general formula (I-2) or a pharmaceutically acceptable salt thereof.

[0082] in:

[0083] Cy, L, R 1 R 2a R 2b R 2c R 4 R 5 and R 7 As defined in general formula (I).

[0084] In some embodiments of this disclosure, the compound represented by general formula (I), general formula (I-1), or general formula (I-2), or a pharmaceutically acceptable salt thereof, is a compound represented by general formula (I-3) or a pharmaceutically acceptable salt thereof.

[0085] in:

[0086] Z 3 For N or CR Z3 ;

[0087] Z 4 For N or CR Z4 ;

[0088] R Z3 and R Z4 They may be the same or different, and each is independently selected from hydrogen atoms, halogens, alkyl groups, hydroxyalkyl groups, haloalkyl groups, hydroxyl groups, cyano groups, alkoxy groups, alkoxyalkyl groups, cycloalkyl groups, and cycloalkylalkyl groups;

[0089] b3 and b4 are each independently 0, 1, 2, 3 or 4;

[0090] x2 is 0, 1, 2, 3 or 4;

[0091] L A1 Selected from bonds, O, C(O), S(O) v NR c and (CR) 10b R 10c ) b ;

[0092] L A2 Selected from alkyl, cycloalkyl, and heterocyclic groups, each of which is independently and optionally converted by one or more R groups. L replace;

[0093] b can be 0, 1, 2, 3, or 4;

[0094] R 10b and R 10c The same or different, and each independently selected from hydrogen atom, halogen, alkyl, hydroxyalkyl, haloalkyl, hydroxyl, cyano, alkoxy, alkoxyalkyl, cycloalkyl, and cycloalkylalkyl; or R 10b and R 10c Together with the attached carbon atom, it forms a cycloalkyl or heterocyclic group;

[0095] Cy, R 1 R 2a R 2b R 2c R 4 R 5 R 7 R L and R c As defined in general formula (I).

[0096] In some embodiments of this disclosure, the compounds represented by general formulas (I), (I-1), (I-2), and (I-3), or their pharmaceutically acceptable salts, are compounds represented by general formula (II) or their pharmaceutically acceptable salts.

[0097] in:

[0098] Z 1 For N or CR Z1 ;

[0099] Z 2 For N or CR Z2 ;

[0100] Z 3 For N or CR Z3 ;

[0101] Z 4 For N or CR Z4 ;

[0102] R Z1 R Z2 R Z3 and R Z4 They may be the same or different, and each is independently selected from hydrogen atoms, halogens, alkyl groups, hydroxyalkyl groups, haloalkyl groups, hydroxyl groups, cyano groups, alkoxy groups, alkoxyalkyl groups, cycloalkyl groups, and cycloalkylalkyl groups;

[0103] b1, b2, b3 and b4 are each independently 0, 1, 2, 3 or 4;

[0104] x1 and x2 are each independently 0, 1, 2, 3 or 4;

[0105] L A1 Selected from bonds, O, C(O), S(O) v NR c and (CR) 10b R 10c ) b ;

[0106] b can be 0, 1, 2, 3, or 4;

[0107] R 10b and R 10c The same or different, and each independently selected from hydrogen atom, halogen, alkyl, hydroxyalkyl, haloalkyl, hydroxyl, cyano, alkoxy, alkoxyalkyl, cycloalkyl, and cycloalkylalkyl; or R 10b and R 10c Together with the attached carbon atom, it forms a cycloalkyl or heterocyclic group;

[0108] Cy, R 1 R 2a R 2b R 2c R 4 R 5 R 7 R L R c And v is as defined in general formula (I).

[0109] In some embodiments of this disclosure, the compound represented by general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II) or a pharmaceutically acceptable salt thereof, wherein the cyclic Cy is optionally surrounded by one or more R 8 The replacement of the 16-20 yuan Fourth Ring Road; R 8 As defined in general formula (I); in some implementations, the ring Cy is optionally controlled by one or more R 8 The replacement of the 17-yuan Fourth Ring Road; R 8 As defined in general formula (I).

[0110] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II), or pharmaceutically acceptable salts thereof, wherein the cyclic Cy is selected from... With L or Z 1 Connected;

[0111] In equation (X-1) or equation (X-2), U 1 C and R A Together with the attached atoms, they form a cycloalkyl or heterocyclic group, each of which is independently and optionally influenced by one or more R atoms. 8 Replace; U 3 For N or CR 8c ;U 4 For N or CR 8d Or, U 3 C and R A Together with their respective attached atoms, they form a cycloalkyl or heterocyclic group, each of which is independently and optionally influenced by one or more R atoms. 8 Replace; U 1 For N or CR 8a U 4 For N or CR 8d ;

[0112] In equation (X-3), U 2 C and R A Together with their respective attached atoms, they form a cycloalkyl or heterocyclic group, each of which is independently and optionally influenced by one or more R atoms. 8 Replace; U 3 For N or CR 8c U 4 For N or CR 8d ;

[0113] Y is selected from CR 12 R 13 O, S, NR 14and C(O); R 11 and R 14 They may be the same or different, and each is independently selected from hydrogen atoms, alkyl, haloalkyl, hydroxyalkyl, cycloalkyl, and cycloalkylalkyl; R 12 and R 13 They may be the same or different, and each is independently selected from hydrogen atoms, halogens, alkyl groups, haloalkyl groups, and hydroxyalkyl groups; or, R 12 and R 13 Together with the adjacent carbon atom, they form cycloalkyl groups;

[0114] R 8a R 8c and R 8d They may be the same or different, and each is independently a hydrogen atom or R. 8 ; y is 0, 1, 2, 3 or 4; ring A is selected from cycloalkyl, heterocyclic, aryl and heteroaryl; R 8 As defined in general formula (I).

[0115] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II), or pharmaceutically acceptable salts thereof, wherein the cyclic Cy is selected from... With L or Z 1 Connected; U 1 For N or CR 8a U 3 For N or CR 8c U 4 For N or CR 8d A 1 For N or CR A1 A 2 For N or CR A2 ;R A1 and R A2 The same or different, and each independently selected from hydrogen atoms, halogens, alkyl groups, hydroxyalkyl groups, haloalkyl groups, hydroxyl groups, cyano groups, alkoxy groups, alkoxyalkyl groups, cycloalkyl groups, and cycloalkylalkyl groups; R 8a R 8c and R 8d They may be the same or different, and each is independently a hydrogen atom or R. 8 Y is selected from CR 12 R 13 O, S, NR 14 and C(O); M is selected from bond, O, S, C(O), C(O)O, OC(O), NR m C(O)NR m and NR m C(O); R m R 11 and R14 They may be the same or different, and each is independently selected from hydrogen atoms, alkyl, haloalkyl, hydroxyalkyl, cycloalkyl, and cycloalkylalkyl; R 12 and R 13 They may be the same or different, and each is independently selected from hydrogen atoms, halogens, alkyl groups, haloalkyl groups, and hydroxyalkyl groups; or, R 12 and R 13 Together with the adjacent carbon atom, it forms a cycloalkyl group; m1 and m2 are each independently 0, 1, 2, 3, or 4; a1 and a2 are each independently 0, 1, 2, 3, or 4; k is 0, 1, 2, 3, 4, 5, or 6; R 8 As defined in general formula (I).

[0116] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II), or pharmaceutically acceptable salts thereof, wherein the cyclic Cy is selected from... End with L or Z 1 Connected; A 1 For N or CR A1 A 2 For N or CR A2 ;R A1 and R A2 The same or different, and each independently selected from hydrogen atoms, halogens, alkyl groups, hydroxyalkyl groups, haloalkyl groups, hydroxyl groups, cyano groups, alkoxy groups, alkoxyalkyl groups, cycloalkyl groups, and cycloalkylalkyl groups; R 8a R 8b R 8c and R 8d They may be the same or different, and each is independently a hydrogen atom or R. 8 Y is selected from CR 12 R 13 O, S, NR 14 and C(O); M and M 1 Each is independently selected from bond, O, S, C(O), C(O)O, OC(O), NR m C(O)NR m and NR m C(O); R m R 11 and R 14 They may be the same or different, and each is independently selected from hydrogen atoms, alkyl, haloalkyl, hydroxyalkyl, cycloalkyl, and cycloalkylalkyl; R 12 and R 13 They may be the same or different, and each is independently selected from hydrogen atoms, halogens, alkyl groups, haloalkyl groups, and hydroxyalkyl groups; or, R 12 and R 13Together with the adjacent carbon atom, it forms a cycloalkyl group; m1 and m2 are each independently 0, 1, 2, 3, or 4; m3 and m4 are each independently 0, 1, 2, 3, or 4; R 8 As defined in general formula (I).

[0117] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II), or pharmaceutically acceptable salts thereof, wherein the cyclic Cy is selected from... End with L or Z 1 Connected; A 1 For N or CR A1 A 2 For N or CR A2 ;R A1 and R A2 The same or different, and each independently selected from hydrogen atoms, halogens, alkyl groups, hydroxyalkyl groups, haloalkyl groups, hydroxyl groups, cyano groups, alkoxy groups, alkoxyalkyl groups, cycloalkyl groups, and cycloalkylalkyl groups; R 8a R 8b R 8c and R 8d They may be the same or different, and each is independently a hydrogen atom or R. 8 Y is selected from CR 12 R 13 O, S, NR 14 and C(O); M and M 1 Each is independently selected from bond, O, S, C(O), C(O)O, OC(O), NR m C(O)NR m and NR m C(O); R m R 11 and R 14 They may be the same or different, and each is independently selected from hydrogen atoms, alkyl, haloalkyl, hydroxyalkyl, cycloalkyl, and cycloalkylalkyl; R 12 and R 13 They may be the same or different, and each is independently selected from hydrogen atoms, halogens, alkyl groups, haloalkyl groups, and hydroxyalkyl groups; or, R 12 and R 13 Together with the adjacent carbon atom, it forms a cycloalkyl group; m1 and m2 are each independently 0, 1, 2, 3, or 4; m3 and m4 are each independently 0, 1, 2, 3, or 4; R 8 As defined in general formula (I).

[0118] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II), or pharmaceutically acceptable salts thereof, wherein the cyclic Cy is selected from... In some implementations, the Cy ring is In some implementations, the Cy ring is In some implementations, the Cy ring is In the above implementation schemes, End with L or Z 1 Connected; A 1 For N or CR A1 A 2 For N or CR A2 ;R A1 and R A2 The same or different, and each independently selected from hydrogen atoms, halogens, alkyl groups, hydroxyalkyl groups, haloalkyl groups, hydroxyl groups, cyano groups, alkoxy groups, alkoxyalkyl groups, cycloalkyl groups, and cycloalkylalkyl groups; R 8a R 8c and R 8d They may be the same or different, and each is independently a hydrogen atom or R. 8 Y is selected from CR 12 R 13 O, S, NR 14 and C(O); M is selected from bond, O, S, C(O), C(O)O, OC(O), NR m C(O)NR m and NR m C(O); R m R 11 and R 14 They may be the same or different, and each is independently selected from hydrogen atoms, alkyl, haloalkyl, hydroxyalkyl, cycloalkyl, and cycloalkylalkyl; R 12 and R 13 They may be the same or different, and each is independently selected from hydrogen atoms, halogens, alkyl groups, haloalkyl groups, and hydroxyalkyl groups; or, R 12 and R 13 Together with the adjacent carbon atom, it forms a cycloalkyl group; m1 and m2 are each independently 0, 1, 2, 3, or 4; R 8 As defined in general formula (I);

[0119] In some implementations, the Cy ring is selected from... In some implementations, the Cy ring is In some implementations, the Cy ring is In the above implementation schemes, End with L or Z 1 Connected.

[0120] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II), or pharmaceutically acceptable salts thereof, wherein the cyclic Cy is selected from... End with L or Z 1 Connected.

[0121] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II), or pharmaceutically acceptable salts thereof, wherein the cyclic Cy is selected from... End with L or Z 1 Connected.

[0122] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II), or pharmaceutically acceptable salts thereof, wherein the cyclic Cy is selected from...

[0123] In some implementations, the Cy ring is selected from... End with L or Z 1 Connected.

[0124] In some embodiments of this disclosure, the compounds of general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II), or pharmaceutically acceptable salts thereof, wherein the cyclic Cy is A 1 For N or CR A1 A 2 For N or CR A2 ;R A1 and R A2 The same or different, and each independently selected from hydrogen atoms, halogens, alkyl groups, hydroxyalkyl groups, haloalkyl groups, hydroxyl groups, cyano groups, alkoxy groups, alkoxyalkyl groups, cycloalkyl groups, and cycloalkylalkyl groups; R 8b R 8c and R 8d They may be the same or different, and each is independently a hydrogen atom or R. 8 M 1Selected from bond, O, S, C(O), C(O)O, OC(O), NR m C(O)NR m and NR m C(O); R m Selected from hydrogen atoms, alkyl, haloalkyl, hydroxyalkyl, cycloalkyl, and cycloalkylalkyl; m3 and m4 are each independently 0, 1, 2, 3, or 4; R 8 As defined in general formula (I); in some implementations, the ring Cy is selected from... End with L or Z 1 Connected.

[0125] In some embodiments disclosed herein, the cyclone Cy is selected from End with L or Z 1 Connected; U 1 For N or CR 8a U 2 For N or CR 8b U 3 For N or CR 8c U 4 For N or CR 8d A 1 For N or CR A1 A 2 For N or CR A2 ;R A1 and R A2 The same or different, and each independently selected from hydrogen atoms, halogens, alkyl groups, hydroxyalkyl groups, haloalkyl groups, hydroxyl groups, cyano groups, alkoxy groups, alkoxyalkyl groups, cycloalkyl groups, and cycloalkylalkyl groups; R 8a R 8b R 8c and R 8d They may be the same or different, and each is independently a hydrogen atom or R. 8 Y is selected from CR 12 R 13 O, S, NR 14 and C(O); M is selected from bond, O, S, C(O), C(O)O, OC(O), NR m C(O)NR m and NR m C(O); R m R 11 and R 14 They may be the same or different, and each is independently selected from hydrogen atoms, alkyl, haloalkyl, hydroxyalkyl, cycloalkyl, and cycloalkylalkyl; R 12 and R 13 They may be the same or different, and each is independently selected from hydrogen atoms, halogens, alkyl groups, haloalkyl groups, and hydroxyalkyl groups; or, R12 and R 13 Together with the adjacent carbon atom, it forms a cycloalkyl group; m1 and m2 are each independently 0, 1, 2, 3, or 4; a1 and a2 are each independently 0, 1, 2, 3, or 4; R 8 As defined in general formula (I);

[0126] In some implementations, the Cy ring is selected from... End with L or Z 1 Connected; among which: A 1 For N or CR A1 A 2 For N or CR A2 ;R A1 and R A2 The same or different, and each independently selected from hydrogen atoms, halogens, alkyl groups, hydroxyalkyl groups, haloalkyl groups, hydroxyl groups, cyano groups, alkoxy groups, alkoxyalkyl groups, cycloalkyl groups, and cycloalkylalkyl groups; R 8a R 8b R 8c and R 8d They may be the same or different, and each is independently a hydrogen atom or R. 8 Y is selected from CR 12 R 13 O, S, NR 14 and C(O); M and M 1 Each is independently selected from bond, O, S, C(O), C(O)O, OC(O), NR m C(O)NR m and NR m C(O); R m R 11 and R 14 They may be the same or different, and each is independently selected from hydrogen atoms, alkyl, haloalkyl, hydroxyalkyl, cycloalkyl, and cycloalkylalkyl; R 12 and R 13 They may be the same or different, and each is independently selected from hydrogen atoms, halogens, alkyl groups, haloalkyl groups, and hydroxyalkyl groups; or, R 12 and R 13 Together with the adjacent carbon atom, it forms a cycloalkyl group; m1 and m2 are each independently 0, 1, 2, 3, or 4; m3 and m4 are each independently 0, 1, 2, 3, or 4; R 8 As defined in general formula (I).

[0127] In some embodiments disclosed herein, the cyclone Cy is selected from End with L or Z 1 Connected.

[0128] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II), or pharmaceutically acceptable salts thereof, wherein ring A is a 4- to 8-membered cycloalkyl or a 4- to 8-membered heterocyclic group; in some embodiments, ring A is a 6-membered cycloalkyl or a 6-membered heterocyclic group; in some embodiments, ring A is a 4- to 8-membered heterocyclic group; in some embodiments, ring A is a 5- or 6-membered heterocyclic group; in some embodiments, ring A is a 6-membered heterocyclic group; in some embodiments, ring A is piperidinyl or piperazineyl.

[0129] In some embodiments of this disclosure, the compound or pharmaceutically acceptable salt thereof represented by general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II) is used, wherein k is 0, 1 or 2; in some embodiments, k is 0.

[0130] In some embodiments of this disclosure, the compound or pharmaceutically acceptable salt thereof represented by general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II) is used, wherein y is 0, 1 or 2; in some embodiments, y is 0.

[0131] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts represented by general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II) are wherein a1 and a2 are each independently 0 or 1; in some embodiments, a1 and a2 are 1.

[0132] In some embodiments of this disclosure, the compounds of general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II), or pharmaceutically acceptable salts thereof, wherein U 1 For CR 8a ;R 8a For hydrogen atoms or R 8 ;R 8 As defined in general formula (I); in some implementations, U 1 For CH or CF; in some implementations, U 1 For CH; in some implementations, U 1 For CF; in some implementations, U 1 Let N be the number of elements in the array.

[0133] In some embodiments of this disclosure, the compounds of general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II), or pharmaceutically acceptable salts thereof, wherein U 2 For CR8b ;R 8b For hydrogen atoms or R 8 ;R 8 As defined in general formula (I); in some implementations, U 2 For CH or CF; in some implementations, U 2 For CH; in some implementations, U 2 For CF; in some implementations, U 2 Let N be the number of elements in the array.

[0134] In some embodiments of this disclosure, the compounds of general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II), or pharmaceutically acceptable salts thereof, wherein U 3 For CR 8c ;R 8c For hydrogen atoms or R 8 ;R 8 As defined in general formula (I); in some implementations, U 3 For CH or CF; in some implementations, U 3 For CH; in some implementations, U 3 For CF; in some implementations, U 3 Let N be the number of elements in the array.

[0135] In some embodiments of this disclosure, the compounds of general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II), or pharmaceutically acceptable salts thereof, wherein U 4 For CR 8d ;R 8d For hydrogen atoms or R 8 ;R 8 As defined in general formula (I); in some implementations, U 4 For CH or CF; in some implementations, U 4 For CH; in some implementations, U 4 For CF; in some implementations, U 4 Let N be the number of elements in the array.

[0136] In some embodiments of this disclosure, the compound represented by general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II) or a pharmaceutically acceptable salt thereof, wherein Y is CH2 or C(O); in some embodiments, Y is C(O); in some embodiments, Y is CH2.

[0137] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II), or pharmaceutically acceptable salts thereof, wherein R 11 It is a hydrogen atom or a carbon atom. 1-6 Alkyl; in some embodiments, R 11 C 1-6 Alkyl; in some embodiments, R 11 It is a methyl group.

[0138] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II), or pharmaceutically acceptable salts thereof, wherein R 12 and R 13 They may be the same or different, and each is independently selected from hydrogen atoms, halogens, and carbon atoms. 1-6 Alkyl; in some embodiments, R 12 and R 13 It is a hydrogen atom.

[0139] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II), or pharmaceutically acceptable salts thereof, wherein R 14 It is a hydrogen atom or a carbon atom. 1-6 Alkyl; in some embodiments, R 14 It is a hydrogen atom.

[0140] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts of general formulas (I), (I-1), (I-2), (I-3), or (II) are wherein A 1 For N or CH; in some implementations, A 1 For N; in some implementations, A 1 For CH.

[0141] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts of general formulas (I), (I-1), (I-2), (I-3), or (II) are wherein A 2 For N or CH; in some implementations, A 2 For N; in some implementations, A 2 For CH.

[0142] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts of general formulas (I), (I-1), (I-2), (I-3), or (II) are wherein A 1 For N; A 2 Let N be the number of elements in the array.

[0143] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II), or pharmaceutically acceptable salts thereof, wherein R A1 It is a hydrogen atom or a halogen; in some implementations, R A1 It is a hydrogen atom.

[0144] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II), or pharmaceutically acceptable salts thereof, wherein R A2 It is a hydrogen atom or a halogen; in some implementations, R A2 It is a hydrogen atom.

[0145] In some embodiments of this disclosure, the compound represented by general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II) or a pharmaceutically acceptable salt thereof, wherein M is O.

[0146] In some embodiments of this disclosure, the compounds of general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II), or pharmaceutically acceptable salts thereof, wherein M 1 For key or O; in some implementations, M 1 For key.

[0147] In some embodiments of this disclosure, the compound or pharmaceutically acceptable salt of the general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II) is used, wherein m1 is 0 or 1; in some embodiments, m1 is 0; in some embodiments, m1 is 1.

[0148] In some embodiments of this disclosure, the compound or pharmaceutically acceptable salt of the general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II) is used, wherein m2 is 0 or 1; in some embodiments, m2 is 1.

[0149] In some embodiments of this disclosure, the compound or pharmaceutically acceptable salt thereof represented by general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II) is used, wherein m1 is 0 or 1; m2 is 1; in some embodiments, m1 is 0; m2 is 1; in some embodiments, m1 is 1; m2 is 1.

[0150] In some embodiments of this disclosure, the compound or pharmaceutically acceptable salt of the general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II) is used, wherein m3 is 0, 1 or 2; in some embodiments, m3 is 0; in some embodiments, m3 is 1; and in some embodiments, m3 is 2.

[0151] In some embodiments of this disclosure, the compound or pharmaceutically acceptable salt thereof represented by general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II) is wherein m4 is 0, 1 or 2; in some embodiments, m4 is 0; in some embodiments, m4 is 1; in some embodiments, m4 is 2.

[0152] In some embodiments of this disclosure, the compound or pharmaceutically acceptable salt thereof represented by general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II) is wherein m3 is 0, 1 or 2; m4 is 0, 1 or 2; in some embodiments, m3 is 0; m4 is 2; in some embodiments, m3 is 2; m4 is 0; in some embodiments, m3 is 1; m4 is 1.

[0153] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II), or their pharmaceutically acceptable salts, wherein each R 8 They may be the same or different, and each is independently selected from oxo groups, halogens, and C. 1-6 Alkyl, C 1-6 Halogenated alkyl groups and C 1-6 Alkoxy; in some embodiments, each R 8 They may be the same or different, and each is independently selected from halogens, C 1-6 Alkyl, C 1-6 Halogenated alkyl groups and C 1-6 Alkoxy; in some embodiments, each R 8 They may be the same or different, and each is independently an oxo group or a halogen; in some embodiments, each R... 8 The same or different, and each independently is C. 1-6 Alkyl or halogen; in some embodiments, R 8 C 1-6 Alkyl; in some embodiments, R 8 For methyl; in some embodiments, R 8 For oxygen groups; in some embodiments, each R 8 They may be the same or different, and each is independently an oxo group, a methyl group, and an F group.

[0154] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II), or pharmaceutically acceptable salts thereof, wherein R 8a R 8c and R 8d They may be the same or different, and each is independently selected from hydrogen atoms, halogens, and carbon atoms. 1-6 Alkyl, C 1-6 Halogenated alkyl groups and C 1-6 Alkoxy; in some embodiments, R 8a R 8c and R 8d They may be the same or different, and each is independently selected from hydrogen atoms, halogens, and carbon atoms. 1-6 Alkyl; in some embodiments, R 8a R 8c and R 8d They may be the same or different, and each is independently a hydrogen atom or a halogen; in some embodiments, R 8a R 8c and R 8d They may be the same or different, and each is independently a hydrogen atom or F; in some implementations, R 8a R 8c and R 8d It is a hydrogen atom;

[0155] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II), or pharmaceutically acceptable salts thereof, wherein R 8a It is a hydrogen atom or a halogen; in some implementations, R 8a For hydrogen atoms or F; in some implementations, R 8a For hydrogen atoms; in some implementations, R 8a It is F.

[0156] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II), or pharmaceutically acceptable salts thereof, wherein R 8b Selected from hydrogen atoms, halogens, C 1-6 Alkyl, C 1-6 Halogenated alkyl groups and C 1-6 Alkoxy; in some embodiments, R 8b Selected from hydrogen atoms, halogens and C 1-6 Alkyl; in some embodiments, R 8b It is a hydrogen atom or a halogen; in some implementations, R 8b For hydrogen atoms or F; in some implementations, R 8b For hydrogen atoms; in some implementations, R8b It is F.

[0157] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II), or pharmaceutically acceptable salts thereof, wherein R 8c It is a hydrogen atom or a halogen; in some implementations, R 8c For hydrogen atoms or F; in some implementations, R 8c For hydrogen atoms; in some implementations, R 8c It is F.

[0158] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II), or pharmaceutically acceptable salts thereof, wherein R 8d It is a hydrogen atom or a halogen; in some implementations, R 8d For hydrogen atoms or F; in some implementations, R 8d For hydrogen atoms; in some implementations, R 8d It is F.

[0159] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II), or pharmaceutically acceptable salts thereof, wherein R m It is a hydrogen atom or a carbon atom. 1-6 Alkyl; in some embodiments, R m It is a hydrogen atom.

[0160] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II), or pharmaceutically acceptable salts thereof, wherein R 1 Selected from hydrogen atoms, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy C 1-6 Alkyl, 3- to 6-membered cycloalkyl and 3- to 6-membered cycloalkyl C 1-6 Alkyl; in some embodiments, R 1 C 1-6 Alkyl or 3- to 6-membered cycloalkyl; in some embodiments, R 1 C 1-6 Alkyl; in some embodiments, R 1 Selected from methyl, isopropyl, and cyclopropyl; in some embodiments, R 1 Selected from methyl, ethyl, and isopropyl; in some embodiments, R 1 It is methyl or isopropyl; in some embodiments, R 1It is cyclopropyl.

[0161] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II), or pharmaceutically acceptable salts thereof, wherein R 2a R 2b and R 2c They may be the same or different, and each is independently selected from hydrogen atoms, halogens, and carbon atoms. 1-6 Alkyl; in some embodiments, R 2a R 2b and R 2c For hydrogen atoms; in some implementations, R 2a For hydrogen atoms; in some implementations, R 2b For hydrogen atoms; in some implementations, R 2c It is a hydrogen atom.

[0162] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II), or pharmaceutically acceptable salts thereof, wherein R 4 and R 5 Whether the atoms are the same or different, and each is independently selected from hydrogen atoms, C atoms 1-6 Alkyl and 3- to 6-membered cycloalkyl; in some embodiments, R 4 and R 5 They may be the same or different, and each is independently a hydrogen atom or a carbon atom. 1-6 Alkyl; in some embodiments, R 4 and R 5 They may be the same or different, and each independently consists of a hydrogen atom, a methyl group, and a cyclopropyl group; in some embodiments, R 4 and R 5 They may be the same or different, and each independently consists of a hydrogen atom, a methyl group, and an ethyl group; in some embodiments, R 4 For hydrogen atoms, R 5 C 1-6 Alkyl or 3- to 6-membered cycloalkyl; in some embodiments, R 4 For hydrogen atoms, R 5 C 1-6 Alkyl; in some embodiments, R 4 For hydrogen atoms, R 5 It is methyl or cyclopropyl; in some embodiments, R 4 For hydrogen atoms, R 5 For methyl; in some embodiments, R 4 For hydrogen atoms, R 5 It is cyclopropyl; in some embodiments, R 4 For hydrogen atoms, R 5For hydrogen atoms; in some implementations, R 4 For methyl, R 5 It is a methyl group.

[0163] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II), or pharmaceutically acceptable salts thereof, wherein R 7 Selected from hydrogen atoms, halogens, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, cyano, and ethynyl; in some embodiments, R 7 For halogen; in some implementations, R 7 For F or Cl; in some implementations, R 7 It is Cl.

[0164] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts of general formulas (I), (I-1), (I-2), (I-3), or (II) are wherein Z 1 For N or CH; in some implementations, Z 1 CH; in some implementations, Z 1 Let N be the number of elements in the array.

[0165] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts of general formulas (I), (I-1), (I-2), (I-3), or (II) are wherein Z 2 For N or CH; in some implementations, Z 2 CH; in some implementations, Z 2 Let N be the number of elements in the array.

[0166] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts of general formulas (I), (I-1), (I-2), (I-3), or (II) are wherein Z 3 For N or CH; in some implementations, Z 3 CH; in some implementations, Z 3 Let N be the number of elements in the array.

[0167] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts of general formulas (I), (I-1), (I-2), (I-3), or (II) are wherein Z 4 For N or CH; in some implementations, Z 4 For N; in some implementations, Z 4 For CH.

[0168] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II), or pharmaceutically acceptable salts thereof, wherein R Z1 R Z2 R Z3 and R Z4 They may be the same or different, and each is independently selected from hydrogen atoms, halogens, and carbon atoms. 1-6 Alkane; in some implementations, R Z1 R Z2 R Z3 and R Z4 For hydrogen atoms; in some implementations, R Z1 For hydrogen atoms; in some implementations, R Z2 For hydrogen atoms; in some implementations, R Z3 For hydrogen atoms; in some implementations, R Z4 It is a hydrogen atom.

[0169] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts of general formulas (I), (I-1), (I-2), (I-3), or (II) are wherein Z 1 For N or CH; Z 2 For N or CH; Z 3 For N or CH; Z 4 For N or CH; in some implementations, Z 1 CH; Z 2 CH; Z 3 CH; Z 4 Let N be the number of elements in the array.

[0170] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts of the general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II) are wherein b1, b2, b3 and b4 are each independently 0 or 1; in some embodiments, b1 and b2 are each independently 0 or 1; in some embodiments, b1 is 0; b2 is 0 or 1; in some embodiments, b3 and b4 are each independently 0 or 1; in some embodiments, b1 and b2 are 0; in some embodiments, b1 is 0; b2 is 1; in some embodiments, b3 and b4 are 1; in some embodiments, b1 is 0; b2 is 0 or 1; b3 and b4 are 1; in some embodiments, b1 and b2 are 0; b3 and b4 are 1.

[0171] In some embodiments of this disclosure, the compound or pharmaceutically acceptable salt of the general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II) is used, wherein x1 is 0 or 1; in some embodiments, x1 is 0.

[0172] In some embodiments of this disclosure, the compound or pharmaceutically acceptable salt of the general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II) is used, wherein x2 is 0 or 1; in some embodiments, x2 is 0.

[0173] In some embodiments of this disclosure, the compound or pharmaceutically acceptable salt thereof represented by general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II) is used, wherein x1 and x2 are 0.

[0174] In some embodiments of this disclosure, the compound or pharmaceutically acceptable salt of the general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II), wherein L A1 Selected from O, CH2, CH2CH2, CH(CH3) and C(CH3)2; in some embodiments, L A1 For O or CH2; in some implementations, L A1 For O; in some implementations, L A1 It is CH2.

[0175] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts of general formulas (I), (I-1), (I-2), (I-3), or (II) are wherein Z 1 For N or CH; Z 2 For N or CH; Z 3 For N or CH; Z 4 It is N or CH; and / or b1, b2, b3 and b4 are each independently 0 or 1; and / or x1 and x2 are 0; and / or L A1 It can be O or CH2.

[0176] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II), or pharmaceutically acceptable salts thereof, wherein R L They may be the same or different, and each is independently selected from halogens, C 1-6 Alkyl, C 1-6 Halogenated alkyl, hydroxyl, =O, C 1-6 Alkoxy and C 1-6 Hydroxyalkyl; in some embodiments, R L They may be the same or different, and each is independently selected from halogens, C1-6 Alkyl, C 1-6 Halogenated alkyl, hydroxyl, and =O; in some embodiments, R L They may be the same or different, and each is independently selected from halogens, C 1-6 Alkyl and hydroxyl; in some embodiments, R L The same or different, and each independently is C. 1-6 Alkyl or hydroxyl.

[0177] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts of general formulas (I), (I-1), (I-2), (I-3), or (II) are wherein... for In some implementation schemes, for In some implementation schemes, for

[0178] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II), or pharmaceutically acceptable salts thereof, wherein R 6 C 1-6 Alkyl; in some embodiments, R 6 It is a methyl group.

[0179] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II), or pharmaceutically acceptable salts thereof, wherein R 16 It is a hydrogen atom or a carbon atom. 1-6 Alkyl; in some embodiments, R 16 C 1-6 alkyl.

[0180] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II), or pharmaceutically acceptable salts thereof, wherein R 17 and R 18 They may be the same or different, and each is independently a hydrogen atom or a carbon atom. 1-6 alkyl.

[0181] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II), or pharmaceutically acceptable salts thereof, wherein R 19 It is a hydrogen atom.

[0182] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II), or pharmaceutically acceptable salts thereof, wherein R 20 Selected from hydrogen atoms, C 1-6 Alkyl, C 1-6 Alkyl and hydroxyl; in some embodiments, R 20 It is a hydrogen atom or a carbon atom. 1-6 Alkyl; in some embodiments, R 20 It is a hydrogen atom.

[0183] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II), or pharmaceutically acceptable salts thereof, wherein R 21 and R 22 They may be the same or different, and each is independently selected from hydrogen atoms, halogens, and carbon atoms. 1-6 Alkyl; in some embodiments, R 21 and R 22 They may be the same or different, and each is independently a hydrogen atom or a halogen; in some embodiments, R 21 and R 22 It is F.

[0184] In some embodiments of this disclosure, the compound or pharmaceutically acceptable salt of the general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II) is used, wherein v is 0; in some embodiments, v is 1; and in some embodiments, v is 2.

[0185] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II), or pharmaceutically acceptable salts thereof, wherein R 1a R 4c R 5a and R 6a They may be the same or different, and each is independently selected from halogens, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy and C 1-6 Haloalkoxy; in some embodiments, R 1a R 4c R 5a and R 6a They may be the same or different, and each is independently selected from halogens, C 1-6 Alkyl and C 1-6 Halogenated alkyl groups.

[0186] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II), or pharmaceutically acceptable salts thereof, wherein R a and R b They may be the same or different, and each is independently selected from hydrogen atoms, halogens, and carbon atoms. 1-6 Alkyl; in some embodiments, R a and R b It is a hydrogen atom.

[0187] In some embodiments of this disclosure, the compound or pharmaceutically acceptable salt of the general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II) is used, wherein a is 1 or 2; in some embodiments, a is 1.

[0188] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II), or pharmaceutically acceptable salts thereof, wherein R c It is a hydrogen atom or a carbon atom. 1-6 Alkyl; in some embodiments, R c It is a hydrogen atom.

[0189] In some embodiments of this disclosure, the compounds represented by general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II), or pharmaceutically acceptable salts thereof, wherein R 10b and R 10c They may be the same or different, and each is independently selected from hydrogen atoms, halogens, and carbon atoms. 1-6 Alkyl; in some embodiments, R 10b and R 10c It is a hydrogen atom.

[0190] In some embodiments of this disclosure, the compound or pharmaceutically acceptable salt of the general formula (I), general formula (I-1), general formula (I-2), general formula (I-3) or general formula (II) is used, wherein b is 1 or 2; in some embodiments, b is 1.

[0191] In some embodiments of this disclosure, the compounds or pharmaceutically acceptable salts of general formulas (I), (I-1), (I-2), (I-3), or (II) are used, wherein b is 0, i.e., L A1 For key.

[0192] In some embodiments of this disclosure, the compound represented by general formula (I) or a pharmaceutically acceptable salt thereof, wherein For single bonds; X is CH; L c For key; X a For N; Xb For N or CH; X c For CH; R 1 C 1-6 Alkyl; X 1 For CH; X 2 For CH; X 3 For CH; R 3 Selected from R 3a For hydrogen atoms; R 7 It is a halogen; the cyclic Cy is selected from The terminal is connected to L; R 8a R 8c and R 8d They may be the same or different, and each is independently a hydrogen atom or a halogen; R 11 Methyl; A 1 For N or CH; A 2 For N or CH; for M, O; for m1, 0 or 1; for m2, 1; for Y, CH2 or C(O); for L, -(L A ) n -; n is 1, 2, 3, 4 or 5; each L A They may be the same or different, and each is independently selected from O, NH, C(O), C 1-6 Alkylene, 4- to 8-membered cycloalkyl, and 4- to 8-membered heterocyclic groups; each of the 4- to 8-membered cycloalkyl and 4- to 8-membered heterocyclic groups is independently optionally coupled with one or more R L Replace; R L They may be the same or different, and each is independently selected from halogens, C 1-6 Alkyl, C 1-6 Halogenated alkyl groups, hydroxyl groups, and =O.

[0193] In some embodiments of this disclosure, the compound represented by general formula (I) or a pharmaceutically acceptable salt thereof, wherein For single bonds; X is CH; L c For key; X a For N; X b For N; X c For CH; R 1 C 1-6 Alkyl; X 1 For CH; X 2 For CH; X 3 For CH; R 3 Selected from R 3a For hydrogen atoms; R 7 It is a halogen; the cyclic Cy is selected from... The terminal is connected to L; R 8a R8c and R 8d They may be the same or different, and each is independently a hydrogen atom or a halogen; A 1 For N or CH; A 2 For N or CH; for M, O; for m1, 0 or 1; for m2, 1; for Y, CH2 or C(O); for L, selected from... *End and R 7 The rings they belong to are connected.

[0194] In some embodiments of this disclosure, the compound represented by general formula (I) or a pharmaceutically acceptable salt thereof, wherein For single bonds; X is CH; L c For key; X a For N; X b For N; X c For CH; R 1 C 1-6 Alkyl; X 1 For CH; X 2 For CH; X 3 For CH; R 3 for R 3a For hydrogen atoms; R 7 It is a halogen; L is selected from *End and R 7 The rings are connected; the ring Cy is Terminal is connected to L; M is O; m1 is 0 or 1; m2 is 1; Y is CH2 or C(O); A 2 For N or CH; R 8c For hydrogen atoms or F; R 8d It can be a hydrogen atom or F.

[0195] In some embodiments of this disclosure, the compound represented by general formula (I-2) or a pharmaceutically acceptable salt thereof, wherein the cyclic Cy is selected from... Connected to L; L is selected from *End and R 7 The rings are connected; R 7 It is a halogen; R 2a R 2b and R 2c For hydrogen atoms; R 4 and R 5 Whether the atoms are the same or different, and each is independently selected from hydrogen atoms, C atoms 1-6 Alkyl and 3- to 6-membered cycloalkyl; R 1 C 1-6 Alkyl or 3- to 6-membered cycloalkyl.

[0196] In some embodiments of this disclosure, the compound represented by general formula (II) or a pharmaceutically acceptable salt thereof, wherein Z 1 For N or CH; Z 2 For N or CH; Z 3 For N or CH; Z 4 For N or CH; b1, b2, b3, and b4 are each independently 0 or 1; x1 and x2 are 0; L A1 For O or CH2; R 1 C 1-6 Alkyl; R 4 and R 5 They may be the same or different, and each is independently a hydrogen atom or a carbon atom. 1-6 Alkyl; R 2a R 2b and R 2c For hydrogen atoms; R 7 It is a halogen; the cyclic Cy is selected from... End and Z 1 Connected; R 8a R 8c and R 8d They may be the same or different, and each is independently a hydrogen atom or a halogen; R 11 Methyl; A 1 For N or CH; A 2 For N or CH; for M, O; for m1, 0 or 1; for m2, 1; for Y, CH2 or C(O).

[0197] In some embodiments of this disclosure, the compound represented by general formula (II) or a pharmaceutically acceptable salt thereof, wherein Z 1 For N or CH; Z 2 For N or CH; Z 3 For N or CH; Z 4 For N or CH; b1 and b2 are each independently 0 or 1; b3 and b4 are 1; x1 and x2 are 0; L A1 For O; R 1 C 1-6 Alkyl; R 4 and R 5 They may be the same or different, and each is independently a hydrogen atom or a carbon atom. 1-6 Alkyl; R 2a R 2b and R 2c For hydrogen atoms; R 7 It is a halogen; the cyclic Cy is selected from... With end Z 1 Connected; R 8a R 8c and R 8dThey may be the same or different, and each is independently a hydrogen atom or F; A 1 For N or CH; A 2 For N or CH; for M, O; for m1, 0; for m2, 1; for Y, CH2.

[0198] In some embodiments of this disclosure, the compound represented by general formula (II) or a pharmaceutically acceptable salt thereof, wherein Z 1 For N or CH; Z 2 For N or CH; Z 3 For N or CH; Z 4 For N or CH; b1 and b2 are each independently 0 or 1; b3 and b4 are 1; x1 and x2 are 0; L A1 For O; R 1 C 1-6 Alkyl; R 4 For hydrogen atoms; R 5 C 1-6 Alkyl; R 2a R 2b and R 2c For hydrogen atoms; R 7 It is a halogen; the cyclic Cy is End and Z 1 Connected; R 8c For hydrogen atoms; R 8d A is a hydrogen atom; 2 N is N; M is O; m1 is 0; m2 is 1; Y is CH2 or C(O).

[0199] In some embodiments of this disclosure, the compound represented by general formula (I-2) or a pharmaceutically acceptable salt thereof, wherein R 1 C 1-6 Alkyl or 3- to 6-membered cycloalkyl; R 4 and R 5 Whether the atoms are the same or different, and each is independently selected from hydrogen atoms, C atoms 1-6 Alkyl and 3- to 6-membered cycloalkyl; R 2a R 2b and R 2c For hydrogen atoms; R 7 It is a halogen; L is -(L A ) n -; n is 1, 2, 3, 4 or 5; each L A Same or different, and each independently selected from O and C 1-6 Alkylene, 4- to 8-membered cycloalkyl, and 4- to 8-membered heterocyclic groups; cycloCy is selected from... The terminal is connected to L; R 8a R 8c and R 8dThey may be the same or different, and each is independently a hydrogen atom or a halogen; R 11 Methyl; A 1 For N or CH; A 2 For N or CH; for M, O; for m1, 0 or 1; for m2, 1; for Y, CH2 or C(O);

[0200] In some embodiments of this disclosure, the compound represented by general formula (II) or a pharmaceutically acceptable salt thereof, wherein Z 1 For N or CH; Z 2 For N or CH; Z 3 For N or CH; Z 4 For N or CH; b1 and b2 are each independently 0 or 1; b3 and b4 are 1; x1 and x2 are 0; L A1 For O; R 1 C 1-6 Alkyl; R 4 For hydrogen atoms; R 5 C 1-6 Alkyl; R 2a R 2b and R 2c For hydrogen atoms; R 7 It is a halogen; the cyclic Cy is End and Z 1 Connected.

[0201] In some embodiments of this disclosure, the compound represented by general formula (I-1) or a pharmaceutically acceptable salt thereof, wherein R 1 Selected from methyl, isopropyl, and cyclopropyl; X 1 For CH; X 2 For CH; X 3 For N or CH; R 3a For hydrogen atoms; R 3 for R 7 Halogen; X a For N; X b For N or CH; X c CH; L is selected from *End and R 7 The rings are connected; the ring Cy is Connected to L.

[0202] In some embodiments of this disclosure, the compound represented by general formula (I-1) or a pharmaceutically acceptable salt thereof, wherein R 1 Selected from methyl, isopropyl, and cyclopropyl; X 1 For CH; X 2 For CH; X 3 For N or CH; R 3aFor hydrogen atoms; R 3 for R 7 Halogen; X a For N; X b For N or CH; X c CH; L is selected from *End and R 7 The rings are connected; the Cy ring is selected from... Connected to L.

[0203] In some embodiments of this disclosure, the compound represented by general formula (I-1) or a pharmaceutically acceptable salt thereof, wherein R 1 Methyl or isopropyl; X 1 For CH; X 2 For CH; X 3 For N or CH; R 3a For hydrogen atoms; R 3 for R 7 Halogen; X a For N; X b For N; X c CH; L is selected from End and R 7 The rings are connected; the Cy ring is selected from... Connected to L.

[0204] Table A lists typical compounds disclosed herein, including but not limited to:

[0205] This disclosure provides a compound of general formula (I-3a) or a salt thereof.

[0206] in:

[0207] R w1 It is a hydrogen atom or an amino protecting group;

[0208] Cy and Z rings 3 b3, b4, R L x2, L A1 and L A2 As defined in general formula (I-3).

[0209] This disclosure provides a compound of general formula (I-3A) or a salt thereof.

[0210] in:

[0211] Cy and Z rings 3 b3, b4, R L x2, L A1 and L A2 As defined in general formula (I-3).

[0212] This disclosure provides a compound of general formula (IIa) or a salt thereof.

[0213] in:

[0214] R w1 It is a hydrogen atom or an amino protecting group;

[0215] Cy and Z rings 1 Z 2 Z 3 b1, b2, b3, b4, R L x1, x2 and L A1 As defined in general formula (II). Furthermore, this disclosure provides a compound of general formula (IIA) or a salt thereof.

[0216] in:

[0217] Cy and Z rings 1 Z 2 Z 3 b1, b2, b3, b4, R L x1, x2 and L A1 As defined in general formula (II).

[0218] In some embodiments of this disclosure, the compound or salt thereof represented by general formula (I-3a) or general formula (IIa), wherein R w1 For hydrogen atoms; in some implementations, R w1 It is an amino protecting group; in some embodiments, R w1 For Boc; in some implementations, R w1 It is a hydrogen atom or Boc.

[0219] In some embodiments of this disclosure, the compounds or salts of general formulas (I-3a), (I-3A), (IIa), or (IIA) are described, wherein L A1 It can be O or CH2.

[0220] Table B lists typical intermediate compounds disclosed herein, including but not limited to:

[0221] Another aspect of this disclosure relates to a method for preparing a compound of general formula (I-3) or a pharmaceutically acceptable salt thereof, comprising:

[0222] The compound of general formula (I-3A) or its salt undergoes a nucleophilic substitution reaction with the compound of general formula (IIB) or its salt to give the compound of general formula (I-3) or its pharmaceutically usable salt.

[0223] in:

[0224] Z 4 Let N be the number of people in the group.

[0225] R LP For leaving groups; in some embodiments, R LP For halogens, in some implementations, R LP For F;

[0226] Cy and Z rings 3 b3, b4, R L x2, L A1 L A2 R 1 R 2a R 2bR 2c R 4 R 5 and R 7 As defined in general formula (I-3).

[0227] Another aspect of this disclosure relates to a method for preparing a compound of general formula (II) or a pharmaceutically acceptable salt thereof, comprising:

[0228] The compound of general formula (IIA) or its salt undergoes a nucleophilic substitution reaction with the compound of general formula (IIB) or its salt to give the compound of general formula (II) or its pharmaceutically usable salt.

[0229] in:

[0230] Z 4 Let N be the number of people in the group.

[0231] R LP For leaving groups; in some embodiments, R LP For halogens, in some implementations, R LP For F;

[0232] Cy and Z rings 1 Z 2 Z 3 b1, b2, b3, b4, R L x1, x2, L A1 R 1 R 2a R 2b R 2c R 4 R 5 and R 7 As defined in general formula (II).

[0233] In some embodiments of this disclosure, the preparation method of the compound of general formula (II) or general formula (I-3) or its pharmaceutically acceptable salt thereof, wherein the nucleophilic substitution reaction is carried out under basic conditions.

[0234] In some embodiments of this disclosure, the preparation method of the compound represented by general formula (II) or general formula (I-3) or its pharmaceutically acceptable salt, wherein the reagent providing the alkaline conditions includes organic and inorganic bases, wherein the organic bases include, but are not limited to, triethylamine, N,N-diisopropylethylamine, n-butyllithium, diisopropylaminolithium, potassium acetate, sodium tert-butoxide, potassium tert-butoxide, tetrabutylammonium fluoride, tetrahydrofuran solution of tetrabutylammonium fluoride, or 1,8-diazabicycloundec-7-ene, and wherein the inorganic bases include, but are not limited to, sodium hydride, potassium phosphate, sodium carbonate, sodium acetate, potassium acetate, potassium carbonate, cesium carbonate, sodium hydroxide, lithium hydroxide, cesium fluoride, and potassium hydroxide; in some embodiments, the reagent providing the alkaline conditions is N,N-diisopropylethylamine.

[0235] In some embodiments of this disclosure, the preparation method of the compound of general formula (II) or general formula (I-3) or its pharmaceutically acceptable salt thereof, wherein the nucleophilic substitution reaction is carried out in a solvent, including but not limited to: ethylene glycol dimethyl ether, acetic acid, methanol, ethanol, acetonitrile, n-butanol, toluene, tetrahydrofuran, dichloromethane, petroleum ether, ethyl acetate, n-hexane, dimethyl sulfoxide, 1,4-dioxane, water, N,N-dimethylformamide, N,N-dimethylacetamide, and mixtures thereof.

[0236] Another aspect of this disclosure relates to a pharmaceutical composition comprising a compound of the above-described general formulas (I), (I-1), (I-2), (I-3), (II) or Table A, or a pharmaceutically acceptable salt thereof, and one or more pharmaceutically acceptable carriers, diluents, or excipients.

[0237] This disclosure further relates to the use of compounds of general formula (I), general formula (I-1), general formula (I-2), general formula (I-3), general formula (II) or Table A, or pharmaceutically acceptable salts thereof, or pharmaceutical compositions comprising them, in the preparation of a medicament for inhibiting or degrading BCL6.

[0238] This disclosure further relates to the use of compounds of general formula (I), general formula (I-1), general formula (I-2), general formula (I-3), general formula (II) or Table A, or pharmaceutically acceptable salts thereof, or pharmaceutical compositions comprising thereof, in the preparation of a medicament for regulating the ubiquitination and degradation of BCL6 protein in a subject.

[0239] This disclosure further relates to the use of compounds of general formula (I), general formula (I-1), general formula (I-2), general formula (I-3), general formula (II) or Table A, or pharmaceutically acceptable salts thereof, or pharmaceutical compositions comprising them, in the preparation of medicaments for the treatment and / or prevention of diseases or conditions mediated or dependent on BCL6.

[0240] This disclosure further relates to the use of compounds of general formula (I), general formula (I-1), general formula (I-2), general formula (I-3), general formula (II) or Table A, or pharmaceutically acceptable salts thereof, or pharmaceutical compositions comprising them, in the preparation of medicaments for the treatment and / or prevention of tumors or autoimmune diseases.

[0241] This disclosure also relates to a method for regulating the ubiquitination and degradation of BCL6 protein in a subject, comprising administering to a desired patient a compound of the above general formula (I), general formula (I-1), general formula (I-2), general formula (I-3), general formula (II) or Table A, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising the above.

[0242] This disclosure also relates to a method for inhibiting or degrading BCL6 in a subject, comprising administering to a desired patient a compound of the above general formula (I), general formula (I-1), general formula (I-2), general formula (I-3), general formula (II) or Table A, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising the above.

[0243] This disclosure also relates to a method of treating and / or preventing diseases or conditions mediated or dependent on BCL6, comprising administering to a desired patient a compound of the above general formula (I), general formula (I-1), general formula (I-2), general formula (I-3), general formula (II) or Table A, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising the above.

[0244] This disclosure also relates to a method of treating and / or preventing tumors or autoimmune diseases, comprising administering to a desired patient a compound of the above general formula (I), general formula (I-1), general formula (I-2), general formula (I-3), general formula (II) or Table A, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising the above.

[0245] This disclosure further relates to a compound of the above general formula (I), general formula (I-1), general formula (I-2), general formula (I-3), general formula (II) or Table A, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising the above, which is used as a medicine.

[0246] This disclosure further relates to a compound of the above general formula (I), general formula (I-1), general formula (I-2), general formula (I-3), general formula (II) or Table A, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising the above, which is used as a drug for regulating the ubiquitination and degradation of BCL6 protein in a subject.

[0247] This disclosure further relates to a compound of the above general formula (I), general formula (I-1), general formula (I-2), general formula (I-3), general formula (II) or Table A, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising the above, which is used as a medicament for treating and / or preventing diseases or conditions mediated or dependent on BCL6.

[0248] This disclosure further relates to compounds of the above general formulas (I), (I-1), (I-2), (I-3), (II) or Table A, or pharmaceutically acceptable salts thereof, or pharmaceutical compositions comprising thereof, for regulating BCL6 protein ubiquitination and degradation in a subject.

[0249] This disclosure further relates to compounds of the above general formulas (I), (I-1), (I-2), (I-3), (II) or Table A, or pharmaceutically acceptable salts thereof, or pharmaceutical compositions comprising thereof, for use in inhibiting or degrading BCL6 in a subject.

[0250] This disclosure further relates to compounds of the above general formulas (I), (I-1), (I-2), (I-3), (II) or Table A, or pharmaceutically acceptable salts thereof, or pharmaceutical compositions comprising them, for the treatment and / or prevention of diseases or conditions mediated or dependent on BCL6.

[0251] This disclosure further relates to compounds of the above general formulas (I), (I-1), (I-2), (I-3), (II) or Table A, or pharmaceutically acceptable salts thereof, or pharmaceutical compositions comprising them, for the treatment and / or prevention of tumors or autoimmune diseases.

[0252] In some embodiments, the diseases or conditions mediated or dependent on BCL6 described in this disclosure are tumors or autoimmune diseases; in some embodiments, the diseases or conditions mediated or dependent on BCL6 described in this disclosure are tumors; in some embodiments, the diseases or conditions mediated or dependent on BCL6 described in the disclosure are selected from lymphoma, leukemia, breast cancer, and lung cancer; in some embodiments, the diseases or conditions mediated or dependent on BCL6 described in the disclosure are lymphoma or leukemia; in some embodiments, the diseases or conditions mediated or dependent on BCL6 described in the disclosure are lymphoma.

[0253] In some embodiments, the tumors described in this disclosure are selected from lymphoma, leukemia, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, hepatocellular carcinoma, renal cell carcinoma, bladder cancer, colorectal cancer, breast cancer, cervical cancer, colon cancer, esophageal cancer, kidney cancer, liver cancer, lung cancer, head and neck cancer, ovarian cancer, pancreatic cancer, prostate cancer, gastric cancer, melanoma, sarcoma, Ewing sarcoma, angiosarcoma, Kaposi's sarcoma, liposarcoma, sarcoma, and peripheral neuroepithelial tumor. Neuroepithelial tumor, synovial sarcoma, glioma, astrocytoma, glioblastoma, neuroblastoma, ganglioglioma, medulloblastoma, pineal cell carcinoma, meningioma, meningeal sarcoma, neurofibroma and schwannoma, prostate cancer, endometrial cancer, testicular cancer, thyroid cancer, astrocytoma, carcinosarcoma, Hodgkin's disease, nephroblastoma and teratoma; in some embodiments, the tumors described in this disclosure are selected from leukemia, lymphoma, breast cancer and lung cancer; in some embodiments, the tumors described in this disclosure are leukemia or lymphoma; in some embodiments, the tumors described in this disclosure are lymphoma; in some embodiments, the tumors described in this disclosure are B-cell non-Hodgkin's lymphoma.

[0254] In some embodiments, the autoimmune diseases described in this disclosure are selected from systemic lupus erythematosus (SLE), ankylosing spondylitis, Chagas disease, chronic obstructive pulmonary disease, dermatomyositis, type 1 diabetes mellitus, endometriosis, Goodpasture's syndrome, Graves' disease, Guillain-Barré syndrome (GBS), Hashimoto's disease, hidradenitis suppurativa, and Kawasaki disease. Diseases, IgA nephropathy, idiopathic thrombocytopenic purpura, interstitial cystitis (IC), mixed connective tissue disease (MCTD), morphine scleroderma, multiple sclerosis, chronic spontaneous urticaria (CSU), neuromuscular rigidity, psoriasis, psoriatic arthritis, psoriasis, polymyositis, primary biliary cirrhosis, relapsing polychondritis, rheumatoid arthritis, sarcoidosis, scleroderma, Sjögren's syndrome, stiffness syndrome, ulcerative colitis, vasculitis, vitiligo, and Wegener's granulomatosis. Atosis), atopic dermatitis, asthma, insulin-dependent diabetes mellitus, Hashimoto's thyroiditis, pernicious anemia, myasthenia gravis, pemphigus vulgaris, and Crohn's disease; in some embodiments, the autoimmune diseases described in this disclosure are selected from systemic lupus erythematosus (SLE), rheumatoid arthritis, scleroderma, and Guillain-Barré syndrome (GBS); in some embodiments, the autoimmune diseases described in this disclosure are selected from atopic dermatitis, asthma, insulin-dependent diabetes mellitus, Hashimoto's thyroiditis, pernicious anemia, myasthenia gravis, pemphigus vulgaris, and Crohn's disease.

[0255] In some implementations, the tumor described in this disclosure is cancer.

[0256] In some embodiments, the tumors described in this disclosure are hematologic malignancies.

[0257] In some implementations, the lung cancer described in this disclosure is non-small cell lung cancer (NSCLC).

[0258] In some embodiments, the lymphomas described in this disclosure are selected from non-Hodgkin lymphoma (NHL), diffuse large B-cell lymphoma (DLBCL), Burkitt lymphoma, T-cell lymphoblastic lymphoma (T-LL), peripheral T-cell lymphoma, lymphoblastic lymphoma, pre-B lymphoma, B-cell lymphoma, B-cell ALL, follicular lymphoma (FL), marginal zone lymphoma (MZL), mantle cell lymphoma (MCL), small lymphocytic lymphoma (SLL), angioimmunoblastic T-cell lymphoma (AITL), large B-cell lymphoma (LBCL), B-cell non-Hodgkin lymphoma, intravascular large B-cell lymphoma, and Waldenström macroglobulinemia (WM).

[0259] In some embodiments, the lymphoma described in this disclosure is a B-cell lymphoma.

[0260] In some embodiments, the lymphoma described in this disclosure is diffuse large B-cell lymphoma.

[0261] In some implementations, the lymphoma described in this disclosure is non-Hodgkin lymphoma (NHL).

[0262] In some implementations, the lymphoma described in this disclosure is relapsed / refractory non-Hodgkin lymphoma.

[0263] In some embodiments, the lymphoma described in this disclosure is B-cell non-Hodgkin lymphoma.

[0264] In some embodiments, the leukemia described in this disclosure is selected from T-cell acute lymphoblastic leukemia (T-ALL), adult T-cell leukemia, precursor B-cell acute lymphoblastic leukemia (Pre-B ALL), B-cell acute lymphoblastic leukemia, chronic myeloid leukemia, chronic lymphocytic leukemia (CLL), B-cell leukemia, and chronic myeloid leukemia.

[0265] The active compounds can be formulated into forms suitable for administration via any appropriate route. As a general guideline, the active compounds of this disclosure are, in some embodiments, expressed as unit doses or in a manner that allows the patient to self-administer a single dose. The unit dose of the disclosed compounds or compositions can be expressed as tablets, capsules, sachets, bottled liquids, powders, granules, lozenges, suppositories, regenerated powders, or liquid formulations. In some embodiments, the unit dose of the pharmaceutical composition is 0.001 mg to 1000 mg; in some embodiments, a suitable unit dose may be 0.1 to 1000 mg.

[0266] In addition to the active compound, the pharmaceutical compositions disclosed herein may contain one or more excipients selected from the following: fillers (diluents), binders, wetting agents, disintegrants, or excipients. Depending on the method of administration, the composition may contain 0.1 to 99% by weight of the active compound.

[0267] In some embodiments, the pharmaceutical composition contains 0.01-99.99% of the aforementioned compound or its pharmaceutically acceptable salt or isotopic substitution, based on the total weight of the composition. In some embodiments, the pharmaceutical composition contains 0.1-99.9% of the aforementioned compound or its pharmaceutically acceptable salt or isotopic substitution. In some embodiments, the pharmaceutical composition contains 0.5%-99.5% of the aforementioned compound or its pharmaceutically acceptable salt or isotopic substitution. In some embodiments, the pharmaceutical composition contains 1%-99% of the aforementioned compound or its pharmaceutically acceptable salt or isotopic substitution. In some embodiments, the pharmaceutical composition contains 2%-98% of the aforementioned compound or its pharmaceutically acceptable salt or isotopic substitution.

[0268] In some embodiments, the pharmaceutical composition contains 0.01% to 99.99% pharmaceutically acceptable excipients based on the total weight of the composition. In some embodiments, the pharmaceutical composition contains 0.1% to 99.9% pharmaceutically acceptable excipients. In some embodiments, the pharmaceutical composition contains 0.5% to 99.5% pharmaceutically acceptable excipients. In some embodiments, the pharmaceutical composition contains 1% to 99% pharmaceutically acceptable excipients. In some embodiments, the pharmaceutical composition contains 2% to 98% pharmaceutically acceptable excipients.

[0269] The pharmaceutically acceptable salts of the compounds described in this disclosure may be selected from inorganic or organic salts.

[0270] Pharmaceutical compositions containing active ingredients may be in forms suitable for oral administration, such as tablets, sugar lozenges, tablets, aqueous or oil suspensions, dispersible powders or granules, emulsions, hard or soft capsules, or syrups or elixirs. Oral compositions may be prepared according to any method known in the art for preparing pharmaceutical compositions, and such compositions may contain one or more ingredients selected from sweeteners, flavoring agents, coloring agents, and preservatives to provide an appealing and palatable pharmaceutical formulation.

[0271] Tablets contain an active ingredient and non-toxic, pharmaceutically acceptable excipients suitable for tablet preparation, used for mixing. These excipients may be inert excipients, granulating agents, disintegrants, binders, and lubricants. These tablets may be uncoated or coated using known techniques that mask the taste of the drug or delay disintegration and absorption in the gastrointestinal tract, thus providing sustained release over a longer period.

[0272] Oral formulations can also be provided using soft gelatin capsules in which the active ingredient is mixed with an inert solid diluent or in which the active ingredient is mixed with a water-soluble carrier or an oil solvent.

[0273] Aqueous suspensions contain active substances and excipients suitable for preparing aqueous suspensions for mixing. These excipients are suspending agents, dispersing agents, or wetting agents. Aqueous suspensions may also contain one or more preservatives, one or more coloring agents, one or more flavoring agents, and one or more sweeteners.

[0274] Oil suspensions are formulated by suspending the active ingredient in vegetable or mineral oil. Oil suspensions may contain thickeners. Sweeteners and flavoring agents mentioned above may be added to provide palatable formulations. These compositions may be preserved by adding antioxidants.

[0275] The pharmaceutical compositions disclosed herein may also be in the form of an oil-in-water emulsion. The oil phase may be vegetable oil, mineral oil, or a mixture thereof. Suitable emulsifiers may be naturally occurring phospholipids, and the emulsion may also contain sweeteners, flavoring agents, preservatives, and antioxidants. Such formulations may also contain modifiers, preservatives, colorants, and antioxidants.

[0276] The pharmaceutical compositions disclosed herein may be in the form of sterile injectable aqueous solutions. Acceptable solvents or media that can be used include water, Ringer's solution, and isotonic sodium chloride solution. The sterile injectable formulation may be a sterile injectable oil-in-water microemulsion in which the active ingredient is dissolved in the oil phase, which can be injected into the patient's bloodstream via local large-volume injection. Alternatively, the solution and microemulsion are preferably administered in a manner that maintains a constant circulating concentration of the compounds disclosed herein. To maintain such a constant concentration, a continuous intravenous delivery device may be used. An example of such a device is the Deltec CADD-PLUS™ 5400 intravenous infusion pump.

[0277] The pharmaceutical compositions disclosed herein may be in the form of sterile injectable aqueous or oil suspensions for intramuscular and subcutaneous administration. These suspensions may be formulated using suitable dispersants or wetting agents and suspending agents according to known techniques. The sterile injectable formulations may also be sterile injectable solutions or suspensions prepared in parenteral acceptable non-toxic diluents or solvents. Furthermore, sterile fixative oils can be conveniently used as solvents or suspension media. Any blended fixative oil may be used for this purpose. Additionally, fatty acids may also be used to prepare injectable formulations.

[0278] The disclosed compounds can be administered in suppository form for rectal administration. These pharmaceutical compositions can be prepared by mixing the drug with a suitable, non-irritating excipient that is solid at normal temperatures but liquid in the rectum, and thus dissolves in the rectum to release the drug.

[0279] As is well known to those skilled in the art, the dosage of a drug depends on a variety of factors, including but not limited to: the activity of the specific compound used, the patient's age, the patient's weight, the patient's health status, the patient's behavior, the patient's diet, the timing of administration, the route of administration, the rate of excretion, the combination of drugs, the severity of the disease, etc.; in addition, the optimal treatment mode, such as the treatment pattern, the daily dosage of the compound, or the type of medicinal salt can be validated based on conventional treatment protocols.

[0280] Terminology Explanation

[0281] Unless otherwise stated, the terms used in the specification and claims have the following meanings.

[0282] The term "alkyl" refers to a saturated, straight-chain or branched aliphatic hydrocarbon group having 1 to 20 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) carbon atoms (i.e., C2). 1-20 Alkyl group). In some embodiments, the alkyl group is an alkyl group having 1 to 12 carbon atoms (i.e., C12). 1-12 Alkyl groups, in some embodiments, having 1 to 6 carbon atoms (i.e., C14-C6 ... 1-6Alkyl groups). Non-limiting examples include: methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, sec-butyl, n-pentyl, 1,1-dimethylpropyl, 1,2-dimethylpropyl, 2,2-dimethylpropyl, 1-ethylpropyl, 2-methylbutyl, 3-methylbutyl, n-hexyl, 1-ethyl-2-methylpropyl, 1,1,2-trimethylpropyl, 1,1-dimethylbutyl, 1,2-dimethylbutyl, 2,2-dimethylbutyl, 1,3-dimethylbutyl, 2-ethylbutyl, 2-methylpentyl, 3-methylpentyl, 4-methylpentyl, 2,3-dimethylbutyl, n-heptyl, 2-methylhexyl, 3-methylhexyl, 4-methylhexyl, 5-methylhexyl, 2 3-Dimethylpentyl, 2,4-Dimethylpentyl, 2,2-Dimethylpentyl, 3,3-Dimethylpentyl, 2-Ethylpentyl, 3-Ethylpentyl, n-Octyl, 2,3-Dimethylhexyl, 2,4-Dimethylhexyl, 2,5-Dimethylhexyl, 2,2-Dimethylhexyl, 3,3-Dimethylhexyl, 4,4-Dimethylhexyl, 2-Ethylhexyl, 3-Ethylhexyl, 4-Ethylhexyl, 2-Methyl-2-Ethylpentyl, 2-Methyl-3-Ethylpentyl, n-Nonyl, 2-Methyl-2-Ethylhexyl, 2-Methyl-3-Ethylhexyl, 2,2-Diethylpentyl, n-Decyl, 3,3-Diethylhexyl, 2,2-Diethylhexyl, and their various branched isomers, etc. Alkyl groups can be substituted or unsubstituted, and when substituted, they can be substituted at any usable connection point. In some embodiments, the substituents are selected from one or more of the following: D atom, halogen, alkoxy, haloalkyl, haloalkoxy, cycloalkyloxy, heterocyclic oxy, hydroxy, hydroxyalkyl, cyano, amino, nitro, cycloalkyl, heterocyclic, aryl, and heteroaryl.

[0283] The term "alkenyl" refers to an alkyl group in which the molecule contains at least one carbon-carbon double bond, wherein the alkyl group is defined as described above and has 2 to 12 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12) carbon atoms (i.e., C atoms). 2-12 Alkenyl group). In some embodiments, the alkenyl group has 2 to 6 carbon atoms (i.e., C16). 2-6 Alkenyl). Non-limiting examples include vinyl, propenyl, isopropenyl, butenyl, etc. Alkenyl groups can be substituted or unsubstituted, and when substituted, they can be substituted at any usable connection point; in some embodiments, the substituent is selected from one or more of the following: D atom, alkoxy, halogen, haloalkyl, haloalkoxy, cycloalkyloxy, heterocyclic oxy, hydroxy, hydroxyalkyl, cyano, amino, nitro, cycloalkyl, heterocyclic, aryl, and heteroaryl.

[0284] The term "alkynyl" refers to an alkyl group in a molecule that contains at least one carbon-carbon triple bond, wherein the alkyl group is defined as described above and has 2 to 12 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12) carbon atoms (i.e., C64, C74, C84, C9 ... 2-12 (Alynyl group). In some embodiments, the alkynyl group has 2 to 6 carbon atoms (i.e., C12). 2-6 (Alynyl). Non-limiting examples include: ethynyl, propynyl, butynyl, pentyynyl, hexynyl, etc. The alkynyl group can be substituted or unsubstituted, and when substituted, it can be substituted at any usable linker; in some embodiments, the substituent is selected from one or more of the following: D atom, alkoxy, halogen, haloalkyl, haloalkoxy, cycloalkyloxy, heterocyclic oxy, hydroxy, hydroxyalkyl, cyano, amino, nitro, cycloalkyl, heterocyclic, aryl, and heteroaryl.

[0285] The term "alkylene" refers to a divalent alkyl group, wherein the alkyl group, as defined above, has 1 to 20 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) carbon atoms (i.e., C2). 1-20 Alkylene). In some embodiments, the alkylene has 1 to 10 carbon atoms (i.e., C10). 1-10 Alkylenes), in some embodiments, alkylenes having 1 to 8 carbon atoms (i.e., C1646-C ... 1-8 Alkylenes), in some embodiments, are selected to have 2 to 7 carbon atoms (i.e., C164-C ... 2-7 Alkylene; in some embodiments, alkylene having 1, 2, or 3 carbon atoms (i.e., C14) 1-6 Alkylenes. Non-limiting examples include: -CH2-, -CH(CH3)-, -C(CH3)2-, -CH2CH2-, -CH(CH2CH3)-, -CH2CH(CH3)-, -CH2C(CH3)2-, -CH2CH2CH2-, -CH2CH2CH2CH2-, etc. Alkylenes can be substituted or unsubstituted, and when substituted, they can be substituted at any usable link. In some embodiments, the substituent is selected from one or more of the following: D atom, halogen, alkoxy, haloalkyl, haloalkoxy, cycloalkyloxy, heterocyclic oxy, hydroxy, hydroxyalkyl, cyano, amino, nitro, cycloalkyl, heterocyclic, aryl, and heteroaryl.

[0286] The term "bridged alkylene" refers to an alkylene ring formed by the connection of two non-adjacent atoms, as defined above. Non-limiting examples include: bridged ethylene (-CH2CH2-) and bridged methylene (-CH2-).

[0287] The term "alkoxy" refers to -O-(alkyl), where alkyl is defined as described above. Non-limiting examples include methoxy, ethoxy, propoxy, and butoxy, etc. Alkoxy groups can be substituted or unsubstituted, and when substituted, they can be substituted at any usable link. In some embodiments, the substituent is selected from one or more of the following: D atom, halogen, alkoxy, haloalkyl, haloalkoxy, cycloalkyloxy, heterocyclic oxy, hydroxy, hydroxyalkyl, cyano, amino, nitro, cycloalkyl, heterocyclic, aryl, and heteroaryl.

[0288] The term "cycloalkyl" refers to a saturated or partially unsaturated monocyclic all-carbon ring (i.e., monocyclic cycloalkyl) or polycyclic system (i.e., polycyclic cycloalkyl) having 3 to 20 (e.g., 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20) ring atoms (i.e., 3 to 20 membered cycloalkyl). In some embodiments, the cycloalkyl group is a cycloalkyl group having 3 to 12 ring atoms (i.e., a 3 to 12-membered cycloalkyl group) or a cycloalkyl group having 4 to 11 ring atoms (i.e., a 4 to 11-membered cycloalkyl group); in some embodiments, a cycloalkyl group having 3 to 8 ring atoms (i.e., a 3 to 8-membered cycloalkyl group); in some embodiments, a cycloalkyl group having 4 to 8 ring atoms (i.e., a 4 to 8-membered cycloalkyl group); in some embodiments, a cycloalkyl group having 4 to 6 ring atoms (i.e., a 4 to 6-membered cycloalkyl group); and in some embodiments, a cycloalkyl group having 3 to 6 ring atoms (i.e., a 3 to 6-membered cycloalkyl group).

[0289] Non-limiting examples of the monocyclic cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexyl, cyclohexenyl, cyclohexadienyl, cycloheptyl, cyclohepttrienyl, and cyclooctyl.

[0290] The polycyclic alkyl groups include: spirocyclic alkyl groups, fused cyclic alkyl groups, and bridged cyclic alkyl groups.

[0291] The term "spirocycloalkyl" refers to a polycyclic system in which rings share a single carbon atom (called a spiro atom), and the ring may contain one or more double bonds, or one or more heteroatoms selected from nitrogen, oxygen, and sulfur (the nitrogen may optionally be oxidized to form nitrogen oxides; the sulfur may optionally be oxidized to form sulfoxides or sulfones, but excluding -OO-, -OS-, or -SS-), provided that it contains at least one full carbon ring with a bonding point on that full carbon ring, having 5 to 20 (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) ring atoms (i.e., 5 to 20-membered spirocycloalkyl). In some embodiments, the spirocycloalkyl is a spirocycloalkyl having 6 to 14 ring atoms (i.e., 6 to 14-membered spirocycloalkyl), and in some embodiments, it is a spirocycloalkyl having 7 to 10 ring atoms (i.e., 7 to 10-membered spirocycloalkyl). The spirocyclic alkyl group includes monospirocyclic alkyl and polyspirocyclic alkyl (such as bispirocyclic alkyl, etc.). In some embodiments, it is a monospirocyclic alkyl or a bispirocyclic alkyl. In some embodiments, the spirocyclic alkyl group is a 3-membered / 4-membered, 3-membered / 5-membered, 3-membered / 6-membered, 4-membered / 4-membered, 4-membered / 5-membered, 4-membered / 6-membered, 5-membered / 3-membered, 5-membered / 4-membered, 5-membered / 5-membered, 5-membered / 6-membered, 5-membered / 7-membered, 6-membered / 3-membered, 6-membered / 4-membered, 6-membered / 5-membered, 6-membered / 6-membered, 6-membered / 7-membered, 7-membered / 5-membered, or 7-membered / 6-membered monospirocyclic alkyl group. Non-limiting examples include:

[0292] Its connection point can be anywhere;

[0293] wait.

[0294] The term "fused cycloalkyl" refers to a polycyclic system in which two adjacent carbon atoms are shared between rings. This system is a monocyclic cycloalkyl group fused with one or more monocyclic cycloalkyl groups, or a monocyclic cycloalkyl group fused with one or more heterocyclic, aryl, or heteroaryl groups, wherein the bonding point is on the monocyclic cycloalkyl group, which may contain one or more double bonds and has 5 to 20 (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) ring atoms (i.e., 5 to 20-membered fused cycloalkyl). In some embodiments, the fused cycloalkyl group is a fused cycloalkyl group having 6 to 14 ring atoms (i.e., 6 to 14-membered fused cycloalkyl), and in some embodiments, it is a fused cycloalkyl group having 7 to 10 ring atoms (i.e., 7 to 10-membered fused cycloalkyl). The fused cyclic alkyl group includes bicyclic fused cyclic alkyl groups and polycyclic fused cyclic alkyl groups (such as tricyclic fused cyclic alkyl groups, tetracyclic fused cyclic alkyl groups, etc.). In some embodiments, it is a bicyclic fused cyclic alkyl group or a tricyclic fused cyclic alkyl group. In some embodiments, it is a ternary / quadrivalent, ternary / quinary, ternary / six-membered, quadrivalent / quadrivalent, quadrivalent / five-membered, quadrivalent / six-membered, quadrivalent / quadrivalent, quadrivalent / six-membered, 5-member / tertiary, 5-member / quadrivalent, 5-member / five-membered, 5-member / six-membered, 5-member / seven-membered, 6-member / tertiary, 6-member / quadrivalent, 6-member / four-membered, 6-member / five-membered, 6-member / six-membered, 6-member / seven-membered, 7-member / five-membered, or 7-member / six-member bicyclic fused cyclic alkyl group. Non-limiting examples include:

[0295] Its connection point can be anywhere;

[0296] wait.

[0297] The term "bridged cycloalkyl" refers to a fully carbon polycyclic system in which two non-directly connected carbon atoms are shared between rings, and the ring may contain one or more double bonds and have 5 to 20 (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) carbon atoms (i.e., 5 to 20-membered bridged cycloalkyl). In some embodiments, the bridged cycloalkyl is a bridged cycloalkyl with 6 to 14 carbon atoms (i.e., 6 to 14-membered bridged cycloalkyl), and in some embodiments, it is a bridged cycloalkyl with 7 to 10 carbon atoms (i.e., 7 to 10-membered bridged cycloalkyl). The bridged cycloalkyl includes bicyclic bridged cycloalkyl and polycyclic bridged cycloalkyl (e.g., tricyclic bridged cycloalkyl, tetracyclic bridged cycloalkyl, etc.), and in some embodiments, it is a bicyclic bridged cycloalkyl or a tricyclic bridged cycloalkyl. Non-limiting examples include:

[0298] Its connection point can be anywhere.

[0299] The cycloalkyl group can be substituted or unsubstituted. When substituted, it can be substituted at any usable connection point. In some embodiments, the substituent is selected from one or more of the following: D atom, halogen, alkyl, alkoxy, haloalkyl, haloalkoxy, cycloalkyloxy, alkylthio, haloalkylthio, cycloalkylthio, heterocyclic thio, heterocyclic oxy, hydroxy, hydroxyalkyl, oxo, cyano, amino, nitro, cycloalkyl, heterocyclic, aryl, and heteroaryl.

[0300] The term "heterocyclic group" refers to a saturated or partially unsaturated monocyclic heterocycle (i.e., monocyclic heterocyclic group) or polycyclic heterocyclic system (i.e., polycyclic heterocyclic group) containing at least one (e.g., 1, 2, 3 or 4) heteroatoms selected from nitrogen, oxygen and sulfur (the nitrogen may optionally be oxidized, i.e., to form nitrogen oxides; the sulfur may optionally be oxidized, i.e., to form sulfoxides or sulfones, but excluding -OO-, -OS- or -SS-), and having 3 to 20 (e.g., 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20) ring atoms (i.e., 3 to 20 membered heterocyclic groups). In some embodiments, the heterocyclic group is a heterocyclic group having 3 to 12 ring atoms (i.e., a 3 to 12-membered heterocyclic group) or a heterocyclic group having 4 to 11 ring atoms (i.e., a 4 to 11-membered heterocyclic group); in some embodiments, a heterocyclic group having 3 to 8 ring atoms (i.e., a 3 to 8-membered heterocyclic group); in some embodiments, a heterocyclic group having 4 to 8 ring atoms (i.e., a 4 to 8-membered heterocyclic group); in some embodiments, a heterocyclic group having 4 to 6 ring atoms (i.e., a 4 to 6-membered heterocyclic group); in some embodiments, a heterocyclic group having 3 to 6 ring atoms (i.e., a 3 to 6-membered heterocyclic group); in some embodiments, a heterocyclic group having 5 to 7 ring atoms (i.e., a 5 to 7-membered heterocyclic group); in some embodiments, a heterocyclic group having 5 or 6 ring atoms (i.e., a 5 or 6-membered heterocyclic group); in some embodiments, a heterocyclic group having 6 ring atoms (i.e., a 6-membered heterocyclic group).

[0301] Non-limiting examples of the monocyclic heterocyclic group include: pyrrolidinyl, tetrahydropyranyl, 1,2,3,6-tetrahydropyridyl, piperidinyl, piperazinyl, morpholinyl, thiomorpholinyl, and homopiperazinyl, etc.

[0302] The polycyclic heterocyclic groups include spirocyclic heterocyclic groups, fused heterocyclic groups, and bridged heterocyclic groups.

[0303] The term "spiroheterocyclic group" refers to a polycyclic heterocyclic system in which rings share a single atom (called a spiro atom), which may contain one or more double bonds and at least one (e.g., 1, 2, 3, or 4) heteroatoms selected from nitrogen, oxygen, and sulfur (the nitrogen may optionally be oxidized to form nitrogen oxides; the sulfur may optionally be oxidized to form sulfoxides or sulfones, but excluding -OO-, -OS-, or -SS-), provided that at least one monocyclic heterocyclic group is present and the bonding point is on the monocyclic heterocyclic group, which has 5 to 20 (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) ring atoms (i.e., 5 to 20-membered spiroheterocyclic groups). In some embodiments, the spiroheterocyclic group is a spiroheterocyclic group having 6 to 14 ring atoms (i.e., a 6 to 14-membered spiroheterocyclic group), and in some embodiments, it is a spiroheterocyclic group having 7 to 11 ring atoms (i.e., a 7 to 11-membered spiroheterocyclic group). The spiroheterocyclic group includes monospirocyclic and polyspirocyclic groups (such as bispirocyclic groups). In some embodiments, it is a monospirocyclic or bispirocyclic group. In some embodiments, it is a 3-membered / 4-membered, 3-membered / 5-membered, 3-membered / 6-membered, 4-membered / 4-membered, 4-membered / 5-membered, 4-membered / 6-membered, 5-membered / 3-membered, 5-membered / 4-membered, 5-membered / 5-membered, 5-membered / 6-membered, 5-membered / 7-membered, 6-membered / 3-membered, 6-membered / 4-membered, 6-membered / 5-membered, 6-membered / 6-membered, 6-membered / 7-membered, 7-membered / 5-membered, or 7-membered / 6-membered monospirocyclic group. Non-limiting examples include:

[0304] wait.

[0305] The term "fused heterocyclic group" refers to a polycyclic heterocyclic system in which two adjacent atoms are shared between rings. The ring may contain one or more double bonds and at least one (e.g., 1, 2, 3, or 4) heteroatoms selected from nitrogen, oxygen, and sulfur (the nitrogen may optionally be oxidized to form nitrogen oxides; the sulfur may optionally be oxidized to form sulfoxides or sulfones, but excluding -OO-, -OS-, or -SS-). It is a monocyclic heterocyclic group fused with one or more monocyclic heterocyclic groups, or a monocyclic heterocyclic group fused with one or more cycloalkyl, aryl, or heteroaryl groups, wherein the bonding point is on the monocyclic heterocyclic group and has 5 to 20 (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) ring atoms (i.e., 5 to 20 membered fused heterocyclic groups). In some embodiments, the fused heterocyclic group is a fused heterocyclic group having 6 to 14 ring atoms (i.e., a 6 to 14-membered fused heterocyclic group); in some embodiments, it is a fused heterocyclic group having 7 to 11 ring atoms (i.e., a 7 to 11-membered fused heterocyclic group); and in some embodiments, it is a fused heterocyclic group having 9 ring atoms (i.e., a 9-membered fused heterocyclic group). The fused heterocyclic group includes bicyclic and polycyclic fused heterocyclic groups (such as tricyclic fused heterocyclic groups, tetracyclic fused heterocyclic groups, etc.). In some embodiments, it is a bicyclic or tricyclic fused heterocyclic group. In some embodiments, it is a 3-membered / 4-membered, 3-membered / 5-membered, 3-membered / 6-membered, 4-membered / 4-membered, 4-membered / 5-membered, 4-membered / 6-membered, 5-membered / 3-membered, 5-membered / 4-membered, 5-membered / 5-membered, 5-membered / 6-membered, 5-membered / 7-membered, 6-membered / 3-membered, 6-membered / 4-membered, 6-membered / 5-membered, 6-membered / 6-membered, 6-membered / 7-membered, 7-membered / 5-membered, or 7-membered / 6-membered bicyclic fused heterocyclic group. Non-limiting examples include:

[0306] wait.

[0307] The term "bridged heterocyclic group" refers to a polycyclic heterocyclic system in which two non-directly bonded atoms are shared between the rings. The rings may contain one or more double bonds, and the system contains at least one (e.g., 1, 2, 3, or 4) heteroatoms selected from nitrogen, oxygen, and sulfur (the nitrogen may optionally be oxidized to form nitrogen oxides; the sulfur may optionally be oxidized to form sulfoxides or sulfones, but excluding -OO-, -OS-, or -SS-). The system has 5 to 20 (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) ring atoms (i.e., a 5- to 20-membered bridged heterocyclic group). In some embodiments, the bridged heterocyclic group has 6 to 14 ring atoms (i.e., a 6- to 14-membered bridged heterocyclic group), and in some embodiments, it has 7 to 10 ring atoms (i.e., a 7- to 10-membered bridged heterocyclic group). Based on the number of constituent rings, heterocyclic groups can be classified into bicyclic bridged heterocyclic groups and multicyclic bridged heterocyclic groups (such as tricyclic bridged heterocyclic groups, tetracyclic bridged heterocyclic groups, etc.). In some embodiments, they are bicyclic bridged heterocyclic groups or tricyclic bridged heterocyclic groups. Non-limiting examples include:

[0308] wait.

[0309] The heterocyclic group can be substituted or unsubstituted. When substituted, it can be substituted at any usable connection point. In some embodiments, the substituent is selected from one or more of the following: D atom, halogen, alkyl, alkoxy, haloalkyl, haloalkoxy, cycloalkyloxy, heterocyclic oxy, alkylthio, haloalkylthio, cycloalkylthio, heterocyclic thio, hydroxy, hydroxyalkyl, oxo, cyano, amino, nitro, cycloalkyl, heterocyclic, aryl, and heteroaryl.

[0310] The term "aryl" refers to a monocyclic all-carbon aromatic ring (i.e., monocyclic aryl) or a polycyclic aromatic ring system (i.e., polycyclic aryl) having a conjugated π-electron system, having 6 to 14 (e.g., 6, 7, 8, 9, 10, 11, 12, 13, or 14) ring atoms (i.e., 6 to 14-membered aryl). In some embodiments, the aryl group has 6 to 10 ring atoms (i.e., 6 to 10-membered aryl). The monocyclic aryl group is, for example, phenyl. Non-limiting examples of the polycyclic aryl group include naphthyl, anthraceneyl, phenanthrene, etc. The polycyclic aryl group further includes fusion of the phenyl group with one or more heterocyclic groups or cycloalkyl groups, or fusion of the naphthyl group with one or more heterocyclic groups or cycloalkyl groups, wherein the bonding point is on the phenyl or naphthyl group, and in this case, the number of ring atoms continues to represent the number of ring atoms in the polycyclic aromatic ring system, non-limiting examples including:

[0311] wait.

[0312] The aryl group can be substituted or unsubstituted. When substituted, it can be substituted at any usable connection point. In some embodiments, the substituent is selected from one or more of the following: D atom, halogen, alkyl, alkoxy, haloalkyl, haloalkoxy, cycloalkyloxy, heterocyclic oxy, hydroxyl, alkylthio, haloalkylthio, cycloalkylthio, heterocyclic thio, hydroxyalkyl, oxo, cyano, amino, nitro, cycloalkyl, heterocyclic, aryl, and heteroaryl.

[0313] The term "heteroaryl" refers to a monocyclic heteroaryl ring (i.e., monocyclic heteroaryl) or a polycyclic heteroaryl ring system (i.e., polycyclic heteroaryl) having a conjugated π-electron system, containing at least one (e.g., 1, 2, 3, or 4) heteroatoms selected from nitrogen, oxygen, and sulfur (the nitrogen may optionally be oxidized, i.e., to form nitrogen oxides; the sulfur may optionally be oxidized, i.e., to form sulfoxides or sulfones, but excluding -OO-, -OS-, or -SS-), having 5 to 14 (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14) ring atoms (i.e., 5 to 14-membered heteroaryl). In some embodiments, the heteroaryl has 5 to 10 ring atoms (i.e., 5 to 10-membered heteroaryl), and in some embodiments, it has 5 or 6 ring atoms (i.e., 5 or 6-membered heteroaryl).

[0314] Non-limiting examples of the aforementioned monocyclic heteroaryl groups include: furanyl, thiopheneyl, thiazolyl, isothiazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiadiazolyl, imidazolyl, pyrazolyl, triazolyl, tetrazolyl, furazonyl, pyrroleyl, N-alkylpyrroleyl, pyridyl, pyrimidinyl, pyridoneyl, N-alkylpyridone (e.g.) (etc.), pyrazinyl, pyridazinyl, etc.

[0315] Non-limiting examples of the polycyclic heteroaryl groups include: indolyl, indazole, quinolinyl, isoquinolinyl, quinoxalinyl, phthalazinyl, benzimidazolyl, benzothiophene, quinazolinyl, benzothiazolyl, carbazole, etc. The polycyclic heteroaryl groups also include monocyclic heteroaryl groups fused with one or more aryl groups, wherein the connecting point is on the aromatic ring, and in this case, the number of ring atoms continues to represent the number of ring atoms in the polycyclic heteroaryl ring system. The polycyclic heteroaryl groups also include monocyclic heteroaryl groups fused with one or more cycloalkyl or heterocyclic groups, wherein the connecting point is on the monocyclic heteroaryl ring, and in this case, the number of ring atoms continues to represent the number of ring atoms in the polycyclic heteroaryl ring system. Non-limiting examples include: wait.

[0316] The heteroaryl group can be substituted or unsubstituted. When substituted, it can be substituted at any usable connection point. In some embodiments, the substituent is selected from one or more of the following: D atom, halogen, alkyl, alkoxy, haloalkyl, haloalkoxy, cycloalkyloxy, heterocyclic oxy, hydroxyl, alkylthio, haloalkylthio, cycloalkylthio, heterocyclic thio, hydroxyalkyl, cyano, amino, nitro, cycloalkyl, heterocyclic, aryl, and heteroaryl.

[0317] The term "tetracyclic" refers to a polycyclic ring system having four rings containing 0 to 5 heteroatoms selected from nitrogen, oxygen, and sulfur (the nitrogen may optionally be oxidized to form nitrogen oxides; the sulfur may optionally be oxidized to form sulfoxides or sulfones, but excluding -OO-, -OS-, or -SS-), having 15 to 24 (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25) ring atoms (i.e., a 15 to 24-membered tetracyclic ring). Each monocyclic ring in the tetracyclic ring is independently selected from saturated rings, partially unsaturated rings, and aromatic rings, and the monocyclic rings may be joined together in a fused, bridged, or helical manner; in some embodiments, the tetracyclic ring is a 16 to 20-membered tetracyclic ring; in some embodiments, the tetracyclic ring is a 17-membered tetracyclic ring; non-limiting examples of "tetracyclic" include, but are not limited to:

[0318] The aforementioned cycloalkyl, heterocyclic, aryl, and heteroaryl groups include residues derived from removing one hydrogen atom from a parent ring atom, or residues derived from removing two hydrogen atoms from the same ring atom or two different ring atoms of the parent ring, i.e., "cycloalkylene", "heterocyclicene", "arylene", and "heteroarylene". Non-limiting examples include: wait.

[0319] The term "cycloalkylalkyl" refers to an alkyl group that is substituted by one or more cycloalkyl groups, wherein the cycloalkyl and alkyl groups are as defined above.

[0320] The term "heterocyclic alkyl" refers to an alkyl group that is substituted by one or more heterocyclic groups, wherein the heterocyclic group and the alkyl group are as defined above.

[0321] The term "arylalkyl" refers to an alkyl group that is substituted with one or more aryl groups, wherein the aryl and alkyl groups are as defined above.

[0322] The term "heteroarylalkyl" refers to an alkyl group that is substituted by one or more heteroaryl groups, wherein the heteroaryl and alkyl groups are as defined above.

[0323] The term "cycloalkyloxy" refers to -O-cycloalkyl, where the cycloalkyl is as defined above.

[0324] The term "heterocyclic oxygen group" refers to an -O-heterocyclic group, wherein the heterocyclic group is as defined above.

[0325] The term "aryloxy group" refers to -O-aryl, where the aryl group is as defined above.

[0326] The term "heteroaryloxy" refers to -O-heteroaryl, where the heteroaryl is as defined above.

[0327] The term "aminoalkyl" refers to an alkyl group that is substituted with one or more amino groups, wherein the alkyl group is as defined above.

[0328] The term "alkoxyalkyl" refers to an alkyl group that is substituted with one or more alkoxy groups, wherein the alkoxy groups and alkyl groups are as defined above.

[0329] The term "halogenated alkyl" refers to an alkyl group that has been substituted with one or more halogens, wherein the alkyl group is as defined above.

[0330] The term "haloalkoxy" refers to an alkoxy group that is substituted by one or more halogens, wherein the alkoxy group is as defined above.

[0331] The term "hydroxyalkyl" refers to an alkyl group that is replaced by one or more hydroxyl groups, wherein the alkyl group is as defined above.

[0332] The term "halogen" refers to fluorine, chlorine, bromine, or iodine.

[0333] The term "hydroxyl group" refers to -OH.

[0334] The term "thiol" refers to -SH.

[0335] The term "amino" refers to -NH2.

[0336] The term "cyano" refers to -CN.

[0337] The term "nitro" refers to -NO2.

[0338] The term "oxo" or "oxo group" refers to "=O".

[0339] The term "carbonyl" refers to C=O.

[0340] The term "alkylthio" refers to -S-alkyl, where the alkyl group is as defined above.

[0341] The term "haloalkylthio" refers to an alkylthio group that is replaced by one or more halogens, wherein the alkylthio group is as defined above.

[0342] The term "cycloalkylthio" refers to -S-cycloalkyl, where the cycloalkyl group is as defined above.

[0343] The term "heterocyclic thio" refers to a -S-heterocyclic group, where the heterocyclic group is as defined above.

[0344] “TBS” refers to tert-butyldimethylsilyl substituent.

[0345] “Boc” refers to the tert-butyloxycarbonyl substituent.

[0346] “SEM” refers to (trimethylsilyl)ethoxymethyl substituent.

[0347] The term "amino protecting group" refers to a group that is easily removed from the amino group, introduced onto the amino group to ensure that the amino group remains unchanged during reactions at other sites of the molecule. Non-limiting examples include: (trimethylsilyl)ethoxymethyl, tetrahydropyranyl, tert-butoxycarbonyl (Boc), benzyloxycarbonyl (Cbz), methoxycarbonyl (Fmoc), allyloxycarbonyl (Alloc), trimethylsilylethoxycarbonyl (Teoc), methoxycarbonyl, ethoxycarbonyl, phthaloyl (Pht), p-toluenesulfonyl (Tos), trifluoroacetyl (Tfa), triphenylmethyl (Trt), 2,4-dimethoxybenzyl (DMB), acetyl, benzyl, allyl, p-methoxybenzyl, (trimethylsilyl)ethoxymethyl (SEM), etc.

[0348] A "leaving group," or simply a group, is an atom or functional group that breaks off from a larger molecule in a chemical reaction. It's a term used in nucleophilic substitution and elimination reactions. In a nucleophilic substitution reaction, the reactant attacked by the nucleophile is called the substrate, and the atom or group of atoms that breaks off with a pair of electrons from the substrate molecule is called the leaving group. Groups that readily accept electrons and have a strong ability to accept negative charges are desirable leaving groups. The smaller the pKa of the conjugate acid of the leaving group, the easier it is for the leaving group to break off from other molecules. This is because a smaller pKa means the leaving group doesn't need to bond with other atoms and has a stronger tendency to exist as an anion (or an electrically neutral leaving group). Common leaving groups include, but are not limited to, halogens, -OTs, or -OH.

[0349] The compounds disclosed herein can exist in specific stereoisomer forms. The term "stereoisomer" refers to isomers with the same structure but different spatial arrangements of atoms. These include cis and trans (or Z and E) isomers, (-)- and (+)- isomers, (R)- and (S)- enantiomers, diastereomers, (D)- and (L)- isomers, tautomers, blocked isomers, conformational isomers, and mixtures thereof (such as racemic mixtures and mixtures of diastereomers). Substituents in the compounds disclosed herein may contain additional asymmetric atoms. All such stereoisomers and mixtures thereof are included within the scope of this disclosure. Optically active (-)- and (+)- isomers, (R)- and (S)- enantiomers, and (D)- and (L)- isomers can be prepared by chiral synthesis, chiral reagents, or other conventional techniques. This disclosure discloses an isomer of a compound, which can be prepared by asymmetric synthesis or with chiral auxiliaries, or, when the molecule contains a basic functional group (such as an amino group) or an acidic functional group (such as a carboxyl group), by forming a salt of the diastereomer with a suitable optically active acid or base, followed by diastereomer resolution using conventional methods known in the art to obtain the pure isomer. Furthermore, the separation of enantiomers and diastereomers is typically performed by chromatography.

[0350] In the chemical structure of the compounds described in this disclosure, the bonds... This indicates that the configuration is not specified; that is, if chiral isomers exist in the chemical structure, the bond... It can be Or simultaneously include Two configurations. For all carbon-carbon double bonds, even if only one configuration is named, both the Z-type and E-type are included.

[0351] The compounds disclosed herein may exist in various tautomer forms, and all such forms are included within the scope of this disclosure. The terms "tautomer" or "tautomer form" refer to a structural isomer that exists in equilibrium and readily transforms from one isomer to another. This includes all possible tautomers, i.e., existing as a single isomer or as a mixture of said tautomers in any proportion. Non-limiting examples include: keto-enols, imine-enamines, lactam-lactamimides, etc. Examples of lactam-lactamimide equilibrium are shown below:

[0352] When referring to the pyrazolyl group, it should be understood to include any one or a mixture of two tautomers of the following two structures:

[0353] All tautomers are within the scope of this disclosure, and the naming of compounds does not exclude any tautomers.

[0354] The compounds disclosed herein may comprise transisomers. The term "transisomer" refers to a conformational stereoisomer resulting from restricted or significantly slowed rotation around a single bond in a molecule (as a result of steric interactions with other parts of the molecule and asymmetric substituents at the ends of the single bond), whose interconversion is slow enough to allow separation and isolation under predetermined conditions. For example, some compounds of this disclosure may exist as mixtures of transisomers (e.g., equal-proportion mixtures, mixtures enriched with one transisomer, etc.) or as a purified transisomer.

[0355] The compounds disclosed herein include all suitable isotopic derivatives thereof. The term "isotopic derivative" refers to a compound in which at least one atom is replaced by an atom having the same atomic number but a different atomic mass. Examples of isotopes that may be introduced into the compounds of this disclosure include stable and radioactive isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, sulfur, fluorine, chlorine, bromine, and iodine, for example, […]. 2 H (deuterium, D) 3 H (tritium, T) 11 C 13 C 14 C 15 N、 17 O、 18 O、 32 p、 33 p、 33 S, 34 S, 35 S, 36 S, 18 F, 36 Cl、 82 Br、 123 I, 124 I, 125 I, 129 I and 131 In some implementations, I is deuterium.

[0356] Compared to undeuterated drugs, deuterated drugs offer advantages such as reduced toxicity, increased drug stability, enhanced efficacy, and prolonged biological half-life. All isotopic variations of the compounds disclosed herein, regardless of radioactivity, are included within the scope of this disclosure. Each available hydrogen atom bonded to a carbon atom can be independently replaced by a deuterium atom, wherein the deuterium substitution can be partial or complete; partial deuterium substitution refers to the replacement of at least one hydrogen atom with at least one deuterium atom.

[0357] When a site is specifically designated as deuterium D, the site should be understood as having a deuterium abundance of at least 1,000 times greater than the natural abundance of deuterium (which is 0.015%) (i.e., at least 15% deuterium incorporation). The compounds in the examples having a natural abundance greater than deuterium can be at least 1000 times abundant deuterium (i.e., at least 15% deuterium doping), at least 2000 times abundant deuterium (i.e., at least 30% deuterium doping), at least 3000 times abundant deuterium (i.e., at least 45% deuterium doping), at least 3340 times abundant deuterium (i.e., at least 50.1% deuterium doping), at least 3500 times abundant deuterium (i.e., at least 52.5% deuterium doping), at least 4000 times abundant deuterium (i.e., at least 60% deuterium doping), or at least 4500 times abundant deuterium (i.e., at least 67.5% deuterium doping). The abundance of deuterium is at least 5000 times (i.e., at least 75% deuterium doping), at least 5500 times (i.e., at least 82.5% deuterium doping), at least 6000 times (i.e., at least 90% deuterium doping), at least 6333.3 times (i.e., at least 95% deuterium doping), at least 6466.7 times (i.e., at least 97% deuterium doping), at least 6600 times (i.e., at least 99% deuterium doping), at least 6633.3 times (i.e., at least 99.5% deuterium doping), or higher.

[0358] "Optional" or "optional" means that the event or situation subsequently described may but is not necessarily to occur; it includes both the possibility that the event or situation will occur or not occur. For example, "C optionally substituted with a halogen or cyano group..." 1-6 "Alkyl" includes cases where the alkyl group is substituted with a halogen or cyano group and cases where the alkyl group is not substituted with a halogen or cyano group.

[0359] "Substitution" or "substituted" refers to one or more hydrogen atoms in a group, in some embodiments 1 to 6, and in some embodiments 1 to 3 hydrogen atoms, which are independently substituted by the corresponding number of substituents. Those skilled in the art can determine possible or impossible substitutions without much effort (through experimentation or theory). For example, an amino or hydroxyl group with free hydrogen may be unstable when combined with a carbon atom having an unsaturated bond (such as an alkene).

[0360] "Pharmaceutical composition" means a mixture containing one or more of the compounds described herein or their pharmaceutically acceptable salts, along with other chemical components, such as pharmaceutically acceptable carriers and excipients. The purpose of a pharmaceutical composition is to facilitate administration to a living organism, thereby promoting the absorption of the active ingredient and its biological activity.

[0361] "Pharmacologically acceptable salt" refers to the salt of the compounds disclosed herein, which may be selected from inorganic or organic salts. Such salts are safe and effective when used in mammals and possess the expected biological activity. They can be prepared separately during the final isolation and purification of the compound, or by reacting a suitable group with a suitable base or acid. Bases commonly used to form pharmaceutically acceptable salts include inorganic bases, such as sodium hydroxide and potassium hydroxide, and organic bases, such as ammonia. Acids commonly used to form pharmaceutically acceptable salts include both inorganic and organic acids.

[0362] As used herein, the term "pharmaceutically acceptable" means that these compounds, materials, compositions, and / or dosage forms are suitable for contact with patient tissues without excessive toxicity, irritation, allergic reactions, or other problems or complications, within reasonable medical judgment, have a reasonable benefit / risk ratio, and are effective for their intended use.

[0363] As used herein, the singular forms of “a,” “an,” and “the” include plural references, and vice versa, unless the context clearly indicates otherwise.

[0364] When the term "about" is applied to parameters such as pH, concentration, temperature, etc., it indicates that the parameter can vary by ±10%, and in some embodiments within ±5%. As those skilled in the art will understand, when a parameter is not critical, figures are typically given for illustrative purposes only and not as limitations. Detailed Implementation

[0365] The following embodiments are used to further describe this disclosure, but these embodiments are not intended to limit the scope of this disclosure.

[0366] Example

[0367] The structure of the compound was determined by nuclear magnetic resonance (NMR) and / or mass spectrometry (MS). NMR shifts (δ) were expressed in 10⁻¹⁰ ohms. -6 The unit (ppm) is given. NMR determination was performed using a Bruker AVANCE-400 NMR spectrometer or a Bruker AVANCE NEO 500M. The solvents used were deuterated dimethyl sulfoxide (DMSO-d6), deuterated chloroform (CDCl3), and deuterated methanol (CD3OD). The internal standard was tetramethylsilane (TMS).

[0368] MS measurements were performed using an Agilent 1200 / 1290DAD-6110 / 6120 Quadrupole MS LC-MS system (manufacturer: Agilent, MS model: 6110 / 6120 Quadrupole MS). Other instruments used included: a waters ACQuity UPLC-QD / SQD system (manufacturer: waters, MS model: waters ACQuity Qda Detector / waters SQ Detector); and a THERMO Ultimate 3000-Q Exactive system (manufacturer: THERMO, MS model: THERMO Q Exactive).

[0369] High-performance liquid chromatography (HPLC) analysis was performed using an Agilent HPLC 1200DAD, an Agilent HPLC 1200VWD, and a Waters HPLC e2695-2489 HPLC system.

[0370] Chiral HPLC analysis was performed using an Agilent 1260DAD high-performance liquid chromatograph.

[0371] High performance liquid chromatography (HPLC) was performed using Waters 2545-2767, Waters 2767-SQ Detecor2, Shimadzu LC-20AP, and Gilson GX-281 preparative chromatographs.

[0372] Chiral preparation was performed using a Shimadzu LC-20AP preparative chromatograph.

[0373] The CombiFlash rapid preparation system uses a CombiFlash Rf200 (TELEDYNE ISCO).

[0374] Thin-layer chromatography silica gel plates are Yantai Huanghai HSGF254 or Qingdao GF254. The silica gel plates used in thin-layer chromatography (TLC) have a diameter of 0.15 mm to 0.2 mm, and the diameter of the silica gel plates used for thin-layer chromatography separation and purification products is 0.4 mm to 0.5 mm.

[0375] Silica gel column chromatography generally uses Yantai Huanghai silica gel with a mesh size of 200-300 as the carrier.

[0376] Mean inhibition rate of kinases and IC 50 The values ​​were determined using a NovoStar microplate reader (BMG GmbH, Germany).

[0377] The known starting materials disclosed herein can be synthesized using or in accordance with methods known in the art, or can be purchased from companies such as ABCR GmbH & Co. KG, Acros Organics, Aldrich Chemical Company, Accela ChemBio Inc, and Darui Chemicals.

[0378] Unless otherwise specified in the examples, all reactions can be carried out under an argon or nitrogen atmosphere.

[0379] Argon or nitrogen atmosphere refers to a reaction flask connected to an argon or nitrogen gas balloon with a volume of approximately 1L.

[0380] A hydrogen atmosphere refers to a reaction flask connected to a hydrogen balloon with a volume of approximately 1L.

[0381] The pressurized hydrogenation reaction was performed using a Parr 3916EKX hydrogenator and a Qinglan QL-500 hydrogen generator or an HC2-SS hydrogenator.

[0382] The hydrogenation reaction is usually carried out under vacuum, filled with hydrogen gas, and repeated 3 times.

[0383] The microwave reaction was performed using a CEM Discover-S 908860 microwave reactor.

[0384] Unless otherwise specified in the examples, "solution" refers to an aqueous solution.

[0385] Unless otherwise specified in the examples, the reaction temperature is room temperature.

[0386] The reaction process in the examples was monitored using thin-layer chromatography (TLC). The developing solvent used in the reaction, the eluent system for column chromatography used to purify the compounds, and the developing solvent system for TLC included: A: dichloromethane / methanol system, B: n-hexane / ethyl acetate system, and C: petroleum ether / ethyl acetate system. The volume ratio of the solvent was adjusted according to the polarity of the compounds, and small amounts of basic or acidic reagents such as triethylamine and acetic acid could also be added for adjustment.

[0387] Example 1

[0388] 2-((6-((5-chloro-2-(4-((1r,3r)-3-(7-(2,6-dioxopiperidin-3-yl)-6-oxo-7,8-dihydro-2H,6H-spiro[furano[2,3-e]isoindole-3,4'-piperidin]-1'-yl)cyclobutoxy)piperidin-1-yl)pyrimidin-4-yl)amino)-1-methyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide1

[0389] first step

[0390] 2-((6-((5-chloro-2-fluoropyrimidin-4-yl)amino)-1-methyl-2-oxo-1,2-dihydroquinolin-3-yl)oxy)-N-methylacetamide 1c

[0391] 2-((6-amino-1-methyl-2-oxo-1,2-dihydroquinolin-3-yl)oxy)-N-methylacetamide 1a (200 mg, 0.77 mmol, prepared by the method disclosed in step 2 on page 388 of patent application WO2021077010A1) was dissolved in dimethyl sulfoxide (5 mL), and 5-chloro-2,4-difluoropyrimidine 1b (161 mg, 0.77 mmol, Bioderm) and N,N-diisopropylethylamine (198 mg, 1.53 mmol, Sinopharm) were added. The reaction was carried out at 100 °C for 1.5 h. After cooling to room temperature, the solid was filtered off and washed with tetrahydrofuran (5 mL) to give the title compound 1c (250 mg, yield: 83.4%).

[0392] MS m / z(ESI): 392.4 [M+1] + .

[0393] Step 2

[0394] 4-Bromo-3-((tert-butyldimethylsilyl)oxy)-2-methylbenzoate methyl ester 1e

[0395] 4-Bromo-3-hydroxy-2-methylbenzoate methyl ester 1d (6.2 g, 25.39 mmol, BIDE) was dissolved in dichloromethane (100 mL), and imidazole (7.6 g, 111.63 mmol, BIDE) and tert-butyldimethylchlorosilane (5.8 g, 38.46 mmol, BIDE) were added. The mixture was reacted at room temperature for 12 hours. 10 mL of water was added, and the mixture was extracted with ethyl acetate (10 mL × 3). The organic phases were combined, washed with 10 mL of saturated sodium chloride solution, dried over anhydrous sodium sulfate, filtered, concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system B to give the title compound 1e (8.8 g, yield: 96.8%).

[0396] Step 3

[0397] 4-Bromo-2-(bromomethyl)-3-((tert-butyldimethylsilyl)oxy)methyl benzoate 1f

[0398] Compound 1e (8.8 g, 24.5 mmol) was dissolved in carbon tetrachloride (150 mL), and N-bromosuccinimide (5.2 g, 29.4 mmol, Shaoyuan) and azobisisobutyronitrile (404 mg, 2.46 mmol, Shaoyuan) were added. The mixture was reacted at 80 °C for 4 hours. After cooling to room temperature, the mixture was concentrated under reduced pressure. The residue was purified by column chromatography using eluent system B to give the title compound 1f (10.2 g, yield: 95.1%).

[0399] Step 4

[0400] 1g of 3-(5-bromo-4-hydroxy-1-oxoisoindoline-2-yl)piperidine-2,6-dione

[0401] Compound 1f (10.2 g, 23.3 mmol) was dissolved in N,N-dimethylformamide (250 mL), and 3-aminopiperidine-2,6-dione hydrochloride (4 g, 24.3 mmol, Sinopharm) and N,N-diisopropylethylamine (9.1 g, 70.4 mmol) were added. The mixture was reacted at 110 °C for 12 hours. After cooling to room temperature, the mixture was concentrated under reduced pressure. The residue was purified by column chromatography using eluent system A to give the title compound 1 g (7.8 g, yield: 99.2%).

[0402] MS m / z(ESI): 340.9 [M+1] + .

[0403] Step 5

[0404] 3-(5-bromo-4-((tert-butyldimethylsilyl)oxy)-1-oxoisoindololin-2-yl)piperidine-2,6-dione 1h

[0405] 1 g (8 g, 25.6 mmol) of the compound was dissolved in dichloromethane (160 mL), and imidazole (6.5 g, 95.5 mmol, BIDE) and tert-butyldimethylchlorosilane (5.5 g, 36.5 mmol, BIDE) were added. The mixture was reacted at room temperature for 2 hours. 20 mL of water was added, and the mixture was extracted with ethyl acetate (20 mL × 3). The organic phases were combined, washed with 20 mL of saturated sodium chloride solution, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by column chromatography using eluent system B to give the title compound 1h (2.8 g, yield: 26.2%).

[0406] MS m / z(ESI): 453.1 [M+1] + .

[0407] Step 6

[0408] 3-(5-bromo-4-((tert-butyldimethylsilyl)oxy)-1-oxoisoindoline-2-yl)-1-((2-(trimethylsilyl)ethoxy)methyl)piperidine-2,6-dione

[0409] Compound 1h (850 mg, 1.87 mmol) was dissolved in acetonitrile (30 mL), and N,N-diisopropylethylamine (970 mg, 7.51 mmol, BIDE) and 2-(trimethylsilyl)ethoxymethyl chloride (626 mg, 3.75 mmol, BIDE) were added. The mixture was reacted at 85 °C for 0.5 h. After cooling to room temperature, 20 mL of water was added, and the mixture was extracted with ethyl acetate (20 mL × 3). The organic phases were combined, washed with 20 mL of saturated sodium chloride solution, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by column chromatography using eluent system A to give the title compound 1i (1 g, yield: 91.4%).

[0410] Step 7

[0411] 3-(5-bromo-4-hydroxy-1-oxoisoindoline-2-yl)-1-((2-(trimethylsilyl)ethoxy)methyl)piperidine-2,6-dione

[0412] Compound 1i (730 mg, 1.25 mmol) was dissolved in methanol (12 mL), and tetrabutylammonium fluoride (328 mg, 1.25 mmol, 1 M) was added. The mixture was reacted at room temperature for 1 hour. The mixture was concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system A to give title compound 1j (490 mg, yield: 83.5%).

[0413] MS m / z (ESI): 467.2 [M-1] - .

[0414] Step 8

[0415] 4-(((5-bromo-2-(2,6-dioxo-1-((2-(trimethylsilyl)ethoxy)methyl)piperidin-3-yl)-1-oxoisoindoline-4-yl)oxy)methyl)-3,6-dihydropyridine-1(2H)-carboxylic acid tert-butyl ester 1k

[0416] Compound 1j (490 mg, 1.04 mmol) was dissolved in tetrahydrofuran (10 mL), and N-Boc-4-(hydroxymethyl)-1,2,3,6-tetrahydropyridine (268 mg, 1.26 mmol, BIDE), triphenylphosphine (411 mg, 1.57 mmol, BIDE), and di-tert-butyl azodicarbonate (361 mg, 1.57 mmol, BIDE) were added. The mixture was reacted at room temperature for 12 hours. The solution was concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system A to give the title compound 1k (690 mg, yield: 99.4%).

[0417] Step 9

[0418] 7-(2,6-dioxo-1-((2-(trimethylsilyl)ethoxy)methyl)piperidin-3-yl)-6-oxo-7,8-dihydro-2H,6H-spiro[furano[2,3-e]isoindole-3,4'-piperidin]-1'-carboxylic acid tert-butyl ester 1l

[0419] Compound 1k (600 mg, 0.91 mmol) was dissolved in toluene (20 mL), and tri-n-butyltin hydride (400 mg, 1.37 mmol, BIDE) and azobisisobutyronitrile (238 mg, 1.45 mmol, BIDE) were added. The mixture was reacted at 120 °C for 12 hours. After cooling to room temperature, the mixture was concentrated under reduced pressure. The residue was purified by column chromatography using eluent system A to give the title compound 1l (500 mg, yield: 94.6%).

[0420] Step 10

[0421] 3-(6-oxo-6,8-dihydro-2H,7H-spiro[furano[2,3-e]isoindole-3,4'-piperidin]-7-yl)piperidin-2,6-dione 1m

[0422] Compound 1l (500 mg, 0.85 mmol) was dissolved in trifluoroacetic acid (10 mL), the tube was sealed, and the reaction was carried out at 110 °C for 14 hours. After cooling to room temperature, the solution was concentrated under reduced pressure, 5 mL of saturated sodium bicarbonate solution was added, and the mixture was extracted with ethyl acetate (5 mL × 3). The organic phases were combined, washed with 5 mL of saturated sodium chloride solution, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by column chromatography using eluent system A to give the title compound 1m (282 mg, yield: 93.0%).

[0423] MS m / z(ESI): 356.1 [M+1] + .

[0424] Step 11

[0425] 4-((1r,3r)-3-(7-(2,6-dioxopiperidin-3-yl)-6-oxo-7,8-dihydro-2H,6H-spiro[furano[2,3-e]isoindole-3,4'-piperidin]-1'-yl)cyclobutoxy)piperidin-1-carboxylic acid tert-butyl ester 1n

[0426] Compound 1m (50 mg, 0.14 mmol) was dissolved in acetonitrile (1 mL), and N,N-diisopropylethylamine (55 mg, 0.43 mmol, from Bismuth Substrate) and 4-((1s,3s)-3-(((trifluoromethyl)sulfonyl)oxy)cyclobutoxy)piperidine-1-carboxylic acid tert-butyl ester (70 mg, 0.17 mmol, prepared by the method disclosed in step 5 on page 268 of patent application WO202396987 A1) were added. The mixture was reacted in a microwave oven at 60 °C for 1 hour. After cooling to room temperature, the mixture was concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system A to give the title compound 1n (60 mg, yield: 70.1%).

[0427] MS m / z(ESI): 609.3 [M+1] + .

[0428] Step Twelve

[0429] 3-(6-oxo-1'-((1r,3r)-3-(piperidin-4-yloxy)cyclobutyl)-6,8-dihydro-2H,7H-spiro[furano[2,3-e]isoindole-3,4'-piperidin]-7-yl)piperidin-2,6-dione 1o

[0430] Compound 1n (80 mg, 0.13 mmol) was dissolved in trifluoroacetic acid (2 mL) and reacted at room temperature for 1 hour. The solution was concentrated under reduced pressure, and 5 mL of saturated sodium bicarbonate solution was added. The mixture was extracted with ethyl acetate (5 mL × 3). The organic phases were combined, washed with 5 mL of saturated sodium chloride solution, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by column chromatography using eluent system A to give the title compound 1o (66 mg, yield: 98.7%).

[0431] MS m / z(ESI): 509.2 [M+1] + .

[0432] Step Thirteen

[0433] 2-((6-((5-chloro-2-(4-((1r,3r)-3-(7-(2,6-dioxopiperidin-3-yl)-6-oxo-7,8-dihydro-2H,6H-spiro[furano[2,3-e]isoindole-3,4'-piperidin]-1'-yl)cyclobutoxy)piperidin-1-yl)pyrimidin-4-yl)amino)-1-methyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide1

[0434] Compound 1o (70 mg, 0.14 mmol) was dissolved in dimethyl sulfoxide (2 mL), and N,N-diisopropylethylamine (54 mg, 0.42 mmol, BIDE) and compound 1c (60 mg, 0.15 mmol) were added. The mixture was heated to 100 °C and reacted for 1 hour. After cooling to room temperature, the mixture was concentrated under reduced pressure. The residue was purified by column chromatography using eluent system A to give title compound 1 (15 mg, yield: 12.4%).

[0435] MS m / z (ESI): 880.8 [M+1] + .

[0436] 1 H NMR (500MHz, DMSO-d6): δ10.99(s,1H),9.69(s,1H),8.94(s,1H),8.07(s,1H),7.99-7.96(m,2H),7.73-7.71 (m,1H),7.49-7.47(m,1H),7.31-7.21(m,2H),7.11-7.00(m,1H),5.25-5.22(m,1H),4.65-4.59(m,3H),4.42 -4.23(m,3H),4.15-4.13(m,2H),3.79-3.70(m,1H),3.59(s,3H),3.28-3.23(m,3H),2.96-2.92(m,3H),2.68 -2.62(m,3H),2.59-2.54(m,3H),2.48-2.25(m,4H),2.29-2.02(m,6H),1.89-1.86(m,2H),1.42-1.40(m,2H).

[0437] Example 2

[0438] 2-((6-((5-chloro-2-(4-((1r,3r)-3-(7-(2,6-dioxopiperidin-3-yl)-6-oxo-7,8-dihydro-2H,6H-spiro[furano[2,3-e]isoindole-3,4'-piperidin]-1'-yl)cyclobutoxy)piperidin-1-yl)pyrimidin-4-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide2

[0439] first step

[0440] 2-((6-((5-chloro-2-fluoropyrimidin-4-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide 2b

[0441] 2-((6-amino-1-isopropyl-2-oxo-1,2-dihydroquinolin-3-yl)oxy)-N-methylacetamide 2a (200 mg, 0.69 mmol, prepared by the method disclosed in step 5 on page 178 of patent application WO2022221673A1) was dissolved in dimethyl sulfoxide (5 mL), and compound 1b (105 mg, 0.70 mmol, Biotin) and N,N-diisopropylethylamine (179 mg, 1.39 mmol, Sinopharm) were added. The reaction was carried out at 100 °C for 1.5 hours. After cooling to room temperature, the solid was filtered off and washed with tetrahydrofuran (5 mL) to give title compound 2b (200 mg, yield: 68.9%).

[0442] MS m / z(ESI): 420.4 [M+1] + .

[0443] Step 2

[0444] 2-((6-((5-chloro-2-(4-((1r,3r)-3-(7-(2,6-dioxopiperidin-3-yl)-6-oxo-7,8-dihydro-2H,6H-spiro[furano[2,3-e]isoindole-3,4'-piperidin]-1'-yl)cyclobutoxy)piperidin-1-yl)pyrimidin-4-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide2

[0445] Compound 1o (70 mg, 0.14 mmol) was dissolved in dimethyl sulfoxide (2 mL), and N,N-diisopropylethylamine (55 mg, 0.43 mmol, BIDE) and compound 2b (64 mg, 0.15 mmol) were added. The mixture was heated to 100 °C and reacted for 1 hour. After cooling to room temperature, the mixture was concentrated under reduced pressure and purified by column chromatography using eluent system A to give title compound 2 (15 mg, yield: 12.0%).

[0446] MS m / z(ESI): 909.1 [M+1] + .

[0447] 1 H NMR (500MHz, DMSO-d6): δ10.99(s,1H),8.84(s,1H),8.05(s,1H),7.97-7.95(m,2H),7.72-7.70(m,2H),7. 41-7.40(m,1H),7.28-7.27(m,1H),7.04-7.02(m,1H),5.08-5.05(m,1H),4.55-4.51(m,4H),4.40-4.37(m, 1H),4.20-4.01(m,4H),3.54-3.51(m,1H),3.33-3.24(m,3H),2.88-2.85(m,4H),2.75-2.58(m,5H),2.30-2 .48(m,1H),2.24-2.20(m,2H),2.20-1.75(m,8H),1.70-1.60(m,2H),1.59-1.57(m,6H),1.38-1.24(m,2H).

[0448] Examples 2-1, 2-2

[0449] 2-((6-((5-chloro-2-(4-((1R,3r)-3-(7-((R)-2,6-dioxopiperidin-3-yl)-6-oxo-7,8-dihydro-2H,6H-spiro[furano[2,3-e]isoindole-3,4'-piperidin]-1'-yl)cyclobutoxy)piperidin-1-yl)pyrimidin-4-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide 2-1

[0450] 2-((6-((5-chloro-2-(4-((1S,3r)-3-(7-((S)-2,6-dioxopiperidin-3-yl)-6-oxo-7,8-dihydro-2H,6H-spiro[furano[2,3-e]isoindole-3,4'-piperidin]-1'-yl)cyclobutoxy)piperidin-1-yl)pyrimidin-4-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide 2-2

[0451] Compound 2 (40 mg) was resolved by a chiral column (Agilent, column: ChiralPak IC, 5 μm, 4.6 mm × 150 mm; mobile phase A: ethanol (0.1% diethylamine), mobile phase B: acetonitrile, gradient ratio: A:B = 60:40, flow rate: 1.0 mL / min) to give the title compound (8 mg, yield: 20%) and (8 mg, yield: 20%).

[0452] Single configuration compound (shorter retention time): (8 mg, yield: 20%).

[0453] MS m / z(ESI): 908.4 [M+1] + .

[0454] Chiral HPLC analysis: retention time 4.999 min, purity: 99.9% (column: ChiralPak IC, 4.6*150mm, 5μm; mobile phase A: ethanol (0.1% diethylamine), mobile phase B: acetonitrile, gradient ratio: A:B = 60:40, flow rate: 1.0 mL / min).

[0455] 1H NMR (500MHz, DMSO-d6): δ10.98(s,1H),8.84(s,1H),8.05(s,1H),8.00–7.94(m,2H),7.70(s,2H),7.43–7.38(m, 1H),7.30–7.25(m,1H),7.04(s,1H),5.13–5.06(m,1H),4.57–4.48(m,3H),4.42–4.35(m,1H),4.27–4.08(m,4H) ,3.56–3.52(m,2H),3.27–3.20(m,2H),2.97–2.79(m,4H),2.71–2.66(m,2H),2.64–2.56(m,2H),2.46–2.37(m,2 H),2.20–2.14(m,2H),2.08(s,2H),2.05–1.95(m,3H),1.92–1.67(m,7H),1.60–1.55(m,6H),1.41–1.36(m,1H).

[0456] Single-configuration compound (longer retention time): (8 mg, yield: 20%).

[0457] MS m / z(ESI): 908.4 [M+1] + .

[0458] Chiral HPLC analysis: retention time 6.9-10 min, purity: 98.1% (column: ChiralPak IC, 4.6*150mm, 5μm; mobile phase A: ethanol (0.1% diethylamine), mobile phase B: acetonitrile, gradient ratio: A:B = 60:40, flow rate: 1.0 mL / min).

[0459] 1H NMR (500MHz, DMSO-d6): δ10.98(s,1H),8.84(s,1H),8.05(s,1H),8.00–7.94(m,2H),7.70(s,2H),7.43–7.3 8(m,1H),7.30–7.25(m,1H),7.04(s,1H),5.13–5.06(m,1H),4.57–4.48(m,3H),4.42–4.35(m,1H),4.27–4. 06(m,4H),3.56–3.51(m,2H),3.27–3.20(m,2H),2.95–2.77(m,4H),2.71–2.56(m,4H),2.44–2.36(m,2H),2 .23–2.14(m,2H),2.08(s,3H),2.05–1.96(m,4H),1.87–1.71(m,5H),1.60–1.55(m,6H),1.41–1.36(m,1H).

[0460] Example 3

[0461] 2-((6-((5-chloro-2-(4-((1r,3r)-3-(7-(2,6-dioxopiperidin-3-yl)-6-oxo-7,8-dihydro-2H,6H-spiro[furano[2,3-e]isoindole-3,4'-piperidin]-1'-yl)cyclobutoxy)piperidin-1-yl)pyrimidin-4-yl)amino)-1-cyclopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide3

[0462] first step

[0463] 1-Cyclopropyl-3-hydroxy-6-nitroquinoline-2(1H)-one 3b

[0464] 1-Cyclopropyl-5-nitroindole-2,3-dione 3a (2.1 g, 9.04 mmol, prepared by the method disclosed in Exemplary Compound 336 on page 518 of patent application "WO2021077010") and triethylamine (2.01 g, 19.89 mmol) were dissolved in methanol (40 mL), and a 2M (trimethylsilyl)diazomethane solution in n-hexane (10 mL) was added. The mixture was stirred at room temperature for 12 hours. The reaction solution was filtered, and the filter cake was washed with a small amount of methanol and dried to obtain the crude title compound 3b (500 mg). The product was used directly in the next reaction without purification.

[0465] MS m / z(ESI): 247.2 [M+1] + .

[0466] Step 2

[0467] 2-((1-Cyclopropyl-6-nitro-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide 3c

[0468] The crude compound 3b (540 mg, 2.19 mmol) was dissolved in N,N-dimethylformamide (10 mL), and anhydrous potassium carbonate (606 mg, 4.38 mmol) and 2-bromo-N-methylacetamide (400 mg, 2.63 mmol, Shanghai Titan) were added. The mixture was stirred at room temperature for 2 hours. The reaction solution was poured into ice water, and a solid precipitated. The solid was filtered, the filter cake was washed with water, and dried to obtain the crude title compound 3c (600 mg). The product was used directly in the next reaction without purification.

[0469] MS m / z(ESI): 318.4 [M+1] + .

[0470] Step 3

[0471] 2-((6-amino-1-cyclopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide 3d

[0472] The crude compound 3c (560 mg, 1.76 mmol) was dissolved in methanol (8 mL) and N,N-dimethylformamide (8 mL), and 10% palladium on carbon (wet) (200 mg) was added. The mixture was purged with hydrogen and stirred at room temperature for 6 hours. The reaction solution was filtered, and the filtrate was concentrated under reduced pressure to obtain the crude title compound 3d (500 mg). The product was used directly in the next reaction without purification.

[0473] MS m / z(ESI): 288.4 [M+1] + .

[0474] Step 4

[0475] 2-((6-((5-chloro-2-(4-((1r,3r)-3-(7-(2,6-dioxopiperidin-3-yl)-6-oxo-7,8-dihydro-2H,6H-spiro[furano[2,3-e]isoindole-3,4'-piperidin]-1'-yl)cyclobutoxy)piperidin-1-yl)pyrimidin-4-yl)amino)-1-cyclopropyl

[0476] -2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide3

[0477] Using the synthetic route in Example 1, the title compound 3 (120 mg, yield: 29.9%) was obtained by replacing compound 1a in the first step with compound 3d.

[0478] MS m / z(ESI): 906.5 [M+1] + .

[0479] 1 H NMR (500MHz, DMSO-d6): δ10.99(s,1H),8.94(s,1H),8.07(s,1H),7.99–7.92(m,2H),7.79–7.74(m,1H),7.70–7.65(m,1H),7.38–7.3 3 .92–3.84(m,1H),3.29–3.21(m,2H),3.05–2.86(m,4H),2.70–2.66(m,2H),2.65–2.61(m,1H),2.60–2.52(m,1H),2.46–2.36(m,2H), 2.34–2.26(m,2H),2.13–1.94(m,5H),1.92–1.81(m,2H),1.48–1.37(m,2H),1.36–1.22(m,6H),0.89–0.83(m,1H),0.83–0.76(m,1H).

[0480] Example 4

[0481] 2-((6-((5-chloro-2-(4-((1r,3r)-3-(7-(2,6-dioxopiperidin-3-yl)-6-oxo-7,8-dihydro-2H,6H-spiro[furano[2,3-e]isoindole-3,4'-piperidin]-1'-yl)cyclobutoxy)piperidin-1-yl)pyrimidin-4-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-cyclopropylacetamide 4

[0482] first step

[0483] N-Cyclopropyl-2-((1-Isopropyl-6-nitro-2-oxo-1,2-dihydroquinoline-3-yl)oxy)acetamide 4b

[0484] 3-hydroxy-1-isopropyl-6-nitroquinoline-2(1H)-one 4a (500 mg, 2.01 mmol, prepared by the method disclosed in Exemplary Compound 263 on page 501 of patent application "WO2021077010") was dissolved in N,N-dimethylformamide (5 mL), and anhydrous potassium carbonate (278 mg, 2.01 mmol) and 2-bromo-N-cyclopropylacetamide (430 mg, 2.41 mmol) were added. The mixture was stirred for 3 hours, and the reaction solution was poured into ice water. A solid precipitated, which was filtered, the filter cake was washed with water, and dried to obtain crude title compound 4b (600 mg). The product was used directly in the next reaction without purification.

[0485] MS m / z(ESI): 346.4 [M+1] + .

[0486] Step 2

[0487] 2-((6-amino-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-cyclopropylacetamide 4c

[0488] The crude compound 4b (600 mg, 1.73 mmol) was dissolved in methanol (8 mL) and N,N-dimethylformamide (8 mL), and 10% palladium on carbon (wet) (200 mg) was added. The mixture was purged with hydrogen and stirred for 6 hours. The reaction solution was filtered, and the filtrate was concentrated under reduced pressure to obtain the crude title compound 4c (500 mg). The product was used directly in the next reaction without purification.

[0489] MS m / z (ESI): 316.4 [M+1] + .

[0490] Step 3

[0491] 2-((6-((5-chloro-2-(4-((1r,3r)-3-(7-(2,6-dioxopiperidin-3-yl)-6-oxo-7,8-dihydro-2H,6H-spiro[furano[2,3-e]isoindole-3,4'-piperidin]-1'-yl)cyclobutoxy)piperidin-1-yl)pyrimidin-4-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-cyclopropylacetamide 4

[0492] Using the synthetic route in Example 1, the title compound 4 (50 mg, yield: 21.7%) was prepared by replacing compound 1a in the first step with compound 4c.

[0493] MS m / z(ESI): 934.7 [M+1] + .

[0494] 1 H NMR (500MHz, DMSO-d6): δ10.98(s,1H),8.83(s,1H),8.18(d,1H),8.05(s,1H),7.94(t,1H),7.71(d,2H) ,7.40(d,1H),7.28(d,1H),7.04(s,1H),5.09(dd,1H),4.56–4.48(m,4H),4.39(d,1H),4.26–4.18(m,2H ),4.14(d,2H),3.53(dt,1H),3.24(t,2H),2.97–2.80(m,4H),2.72(tt,1H),2.63–2.56(m,1H),2.49–2. 37(m,2H),2.16(d,2H),2.00(dq,4H),1.94–1.65(m,9H),1.57(d,6H),0.66(td,2H),0.53–0.46(m,2H).

[0495] Example 5

[0496] 2-((6-((5-chloro-2-(4-((1r,3r)-3-(3-(2,6-dioxopiperidin-3-yl)-1-methyl-1H,7H-spiro[furano[2,3-g]indazole-8,4'-piperidin]-1'-yl)cyclobutoxy)piperidin-1-yl)pyrimidin-4-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide5

[0497] first step

[0498] 3-Iodo-6-methoxy-1-methyl-1H-indazole 5b

[0499] 3-Iodo-6-methoxy-1H-indazole 5a (9 g, 32.84 mmol, Bioderm) was dissolved in N,N-dimethylformamide (120 mL), and potassium carbonate (9.08 g, 65.70 mmol, Sinopharm) and iodomethane (9.32 g, 65.66 mmol, Adamas) were added. The reaction mixture was reacted at room temperature for 3 hours. The reaction solution was filtered, the filtrate was concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system B to give the title compound 5b (7 g, yield: 74.0%).

[0500] MS m / z(ESI): 289.1 [M+1] + .

[0501] Step 2

[0502] 3-Iodo-1-methyl-1H-indazole-6-phenol 5c

[0503] Compound 5b (2 g, 6.94 mmol) was dissolved in dichloromethane (20 mL), and boron tribromide (17.4 g, 69.45 mmol, Adamas) was slowly added at room temperature, followed by stirring at room temperature for 2 hours. The reaction was quenched by adding methanol (10 mL) dropwise at 0 °C, filtered, and dried to give the title compound 5c (1.35 g, yield: 70.9%), which was used directly in the next reaction without further purification.

[0504] MS m / z(ESI): 275.1 [M+1] + .

[0505] Step 3

[0506] 7-Bromo-3-iodo-1-methyl-1H-indazole-6-phenol 5d

[0507] Compound 5c (1.78 g, 6.49 mmol) was dissolved in tetrahydrofuran (20 mL), and N-bromosuccinimide (1.16 g, 6.51 mmol, Adamas) was slowly added at 0 °C. The mixture was stirred at 0 °C for 30 min. The reaction solution was concentrated under reduced pressure, dissolved in dichloromethane (10 mL), filtered, and dried to give the title compound 5d (1 g, yield: 43.6%), which was used directly in the next reaction without further purification.

[0508] MS m / z(ESI): 355.0 [M+2] + .

[0509] Step 4

[0510] 4-(((7-bromo-3-iodo-1-methyl-1H-indazol-6-yl)oxy)methyl)-3,6-dihydropyridine-1(2H)-carboxylic acid tert-butyl ester 5e

[0511] Compound 5d (1 g, 2.83 mmol) was dissolved in tetrahydrofuran (15 mL), and N-Boc-4-(hydroxymethyl)-1,2,3,6-tetrahydropyridine (725 mg, 3.40 mmol, BID), triphenylphosphine (2.23 g, 8.50 mmol, Adamas), and di-p-chlorophenyl azodicarbonate (3.12 g, 8.50 mmol, Adamas) were added. The reaction mixture was reacted at room temperature for 12 hours. The reaction solution was concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system B to give the title compound 5e (1.53 g, yield: 98.5%).

[0512] Step 5

[0513] 4-(((3-(2,6-bis(benzyloxy)pyridin-3-yl)-7-bromo-1-methyl-1H-indazol-6-yl)oxy)methyl)-3,6-dihydropyridine-1(2H)-carboxylic acid tert-butyl ester 5f

[0514] Compound 5e (1.53 g, 2.79 mmol) was dissolved in 1,4-dioxane (16 mL) and water (4 mL), and [1,1'-bis(diphenylphosphino)ferrocene]palladium dichloride (204 mg, 0.28 mmol, BIDE), 2,6-bis(benzyloxy)-3-(4,4,5,5-tetramethyl-1,3,2-dioxoboropentane-2-yl)pyridine (1.40 g, 3.35 mmol, BIDE) and cesium carbonate (1.82 g, 5.58 mmol, Adamas) were added. The mixture was purged with nitrogen three times and reacted at 100 °C for 2 hours. The reaction solution was cooled to room temperature, concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system B to give the title compound 5f (1.7 g, yield: 85.6%).

[0515] MS m / z(ESI): 713.6 [M+2] + .

[0516] Step 6

[0517] 3-(2,6-bis(benzyloxy)pyridin-3-yl)-1-methyl-2',3'-dihydro-1H,1'H,7H-spiro[furano[2,3-g]indazole-8,4'-pyridine]-1'-carboxylic acid tert-butyl ester 5g

[0518] Compound 5f (1 g, 1.40 mmol) was dissolved in N,N-dimethylformamide (20 mL), and palladium acetate (32 mg, 0.14 mmol, Bioderm), triphenylphosphine (74 mg, 0.28 mmol, Adamas), and potassium carbonate (388 mg, 2.81 mmol, Sinopharm) were added. The mixture was purged with nitrogen three times and reacted at 100 °C for 12 hours. The reaction solution was cooled to room temperature, concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system B to give the title compound 5 g (65 mg, yield: 7.3%).

[0519] MS m / z(ESI): 631.6 [M+1] + .

[0520] Step 7

[0521] 3-(2,6-dioxopiperidin-3-yl)-1-methyl-1H,7H-spiro[furano[2,3-g]indazole-8,4'-piperidin]-1'-carboxylic acid tert-butyl ester 5h

[0522] 5 g (65 mg, 0.1 mmol) of the compound was dissolved in methanol (4 mL) and tetrahydrofuran (2 mL), and palladium on carbon (16 mg, 0.15 mmol, Shaoyuan) and palladium hydroxide (22 mg, 0.15 mmol, Adamas) were added. The mixture was purged with hydrogen three times and reacted at 70 °C for 16 h. The reaction solution was cooled to room temperature, filtered, and the filtrate was concentrated under reduced pressure to give the title compound 5 h (45 mg, yield: 96.1%).

[0523] MS m / z (ESI): 455.5 [M+1] + .

[0524] Step 8

[0525] 3-(1-Methyl-1H,7H-spiro[furano[2,3-g]indazole-8,4'-piperidine]-3-yl)piperidine-2,6-dione 5i

[0526] Compound 5h (45 mg, 0.10 mmol) was dissolved in trifluoroacetic acid (2 mL) and reacted at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure, and 5 mL of saturated sodium bicarbonate solution was added. The mixture was extracted with ethyl acetate (5 mL × 3). The combined organic phases were washed with 5 mL of saturated sodium chloride solution, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by column chromatography using eluent system A to give the title compound 5i (35 mg, yield: 99.7%). MS m / z (ESI): 355.4 [M+1] + .

[0527] Step 9

[0528] 4-((1r,3r)-3-(3-(2,6-dioxopiperidin-3-yl)-1-methyl-1H,7H-spiro[furano[2,3-g]indazole-8,4'-piperidin]-1'-yl)cyclobutoxy)piperidin-1-carboxylic acid tert-butyl ester 5j

[0529] Compound 5i (35 mg, 0.098 mmol) was dissolved in acetonitrile (1 mL), and N,N-diisopropylethylamine (64 mg, 0.49 mmol, Adamas) and 4-((1s,3s)-3-(((trifluoromethyl)sulfonyl)oxy)cyclobutoxy)piperidine-1-carboxylic acid tert-butyl ester (80 mg, 0.19 mmol, prepared by the method disclosed in step 5 on page 268 of patent application WO202396987 A1) were added. The mixture was reacted in a microwave oven at 60 °C for 1 hour. The reaction solution was cooled to room temperature, concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system A to give title compound 5j (30 mg, yield: 49.9%).

[0530] MS m / z (ESI): 608.7 [M+1]+ .

[0531] Step 10

[0532] 3-(1-methyl-1'-((1r,3r)-3-(piperidin-4-yl)oxy)cyclobutyl)-1H,7H-spiro[furano[2,3-g]indazole-8,4'-piperidin]-3-yl)piperidin-2,6-dione 5k

[0533] Compound 5j (30 mg, 0.05 mmol) was dissolved in trifluoroacetic acid (1 mL) and reacted at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure, 5 mL of saturated sodium bicarbonate solution was added, and the mixture was extracted with ethyl acetate (5 mL × 3). The organic phases were combined, washed with 5 mL of saturated sodium chloride solution, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure to give the title compound 5k (25 mg, yield: 99.7%).

[0534] MS m / z(ESI): 508.5 [M+1] + .

[0535] Step 11

[0536] 2-((6-((5-chloro-2-(4-((1r,3r)-3-(3-(2,6-dioxopiperidin-3-yl)-1-methyl-1H,7H-spiro[furano[2,3-g]indazole-8,4'-piperidin]-1'-yl)cyclobutoxy)piperidin-1-yl)pyrimidin-4-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide5

[0537] Compound 5k (25 mg, 0.05 mmol) was dissolved in dimethyl sulfoxide (2 mL), and N,N-diisopropylethylamine (32 mg, 0.25 mmol, Adamas) and compound 2b (21 mg, 0.05 mmol) were added. The mixture was reacted at 100 °C for 1 hour. The reaction solution was cooled to room temperature, concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system A to give title compound 5 (4 mg, yield: 8.9%).

[0538] MS m / z(ESI): 907.8 [M+1] + .

[0539] 1H NMR(500MHz,DMSO)δ10.88(s,1H),8.84(s,1H),8.05(s,1H),7.99–7.94(m,2H),7.71–7.68(m,2H),7.5 3(d,1H),7.03(s,1H),6.72(d,1H),4.55(s,2H),4.48(s,2H),4.35–4.31(m,1H),4.23–4.10(m,6H),3.5 7–3.52(m,1H),3.27–3.21(m,3H),2.93(d,2H),2.87–2.82(m,1H),2.69(d,3H),2.67–2.61(m,2H),2.39 –2.29(m,3H),2.22–2.15(m,3H),2.04–1.98(m,2H),1.87–1.73(m,6H),1.58(d,6H),1.42–1.35(m,2H).

[0540] Example 6

[0541] 2-((6-((5-chloro-2-(4-((1r,3r)-3-(3-(2,6-dioxopiperidin-3-yl)-1-methyl-1H,6H-spiro[furano[2,3-f]indazole-7,4'-piperidin]-1'-yl)cyclobutoxy)piperidin-1-yl)pyrimidin-4-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide6

[0542] first step

[0543] 6-Bromo-3-iodo-5-methoxy-1H-indazole 6b

[0544] Compound 6-bromo-5-methoxy-1H-indazole 6a (200 mg, 0.88 mmol, BIDE) was dissolved in N,N-dimethylformamide (5 mL), and 1-iodopyrrolidine-2,5-dione (234 mg, 1.04 mmol, BIDE) was added. The mixture was reacted at room temperature for 2 hours. 10 mL of water was added, and the mixture was extracted with ethyl acetate (10 mL × 3). The organic phases were combined, washed with 10 mL of saturated sodium chloride solution, dried over anhydrous sodium sulfate, filtered, concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system A to give the title compound 6b (310 mg, yield: 99.7%).

[0545] MS m / z(ESI): 353.1 [M+1] + .

[0546] Step 2

[0547] 6-Bromo-3-iodo-5-methoxy-1-methyl-1H-indazole 6c

[0548] Compound 6b (4.5 g, 12.75 mmol) was dissolved in N,N-dimethylformamide (90 mL), and iodomethane (3.4 g, 24.23 mmol, Shaoyuan) and cesium carbonate (6.3 g, 19.34 mmol, Shaoyuan) were added. The mixture was reacted at room temperature for 3 hours. The solution was concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system B to give the title compound 6c (4.3 g, yield: 91.9%).

[0549] MS m / z(ESI): 367.2 [M+1] + .

[0550] Step 3

[0551] 6-Bromo-3-iodo-1-methyl-1H-indazole-5-phenol 6d

[0552] Compound 6c (2.3 g, 6.27 mmol) was dissolved in dichloromethane (30 mL), and boron tribromide (16 g, 63.87 mmol, Sinopharm) was added at 0 °C. The reaction was carried out at 30 °C for 12 hours. After cooling to room temperature, the reaction was quenched with 5 mL of methanol and concentrated under reduced pressure. The residue was purified by column chromatography using eluent system A to give the title compound 6d (1.56 g, yield: 70.5%).

[0553] MS m / z(ESI): 353.1 [M+1] + .

[0554] Step 4

[0555] 4-(((6-bromo-3-iodo-1-methyl-1H-indazol-5-yl)oxy)methyl)-3,6-dihydropyridine-1(2H)-carboxylic acid tert-butyl ester 6e

[0556] Compound 6d (580 mg, 1.64 mmol) was dissolved in tetrahydrofuran (10 mL), and N-Boc-4-(hydroxymethyl)-1,2,3,6-tetrahydropyridine (421 mg, 1.97 mmol, BIDE), triphenylphosphine (1.3 g, 4.96 mmol, BIDE), and bis(4-chlorobenzyl)azodicarbonate (1.9 g, 5.17 mmol, BIDE) were added. The mixture was reacted at 36 °C for 12 hours. After cooling to room temperature, the mixture was concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system A to give the title compound 6e (522 mg, yield: 57.9%).

[0557] MS m / z (ESI): 492.3 [M-55] - .

[0558] Step 5

[0559] 4-(((3-(2,6-bis(benzyloxy)pyridin-3-yl)-6-bromo-1-methyl-1H-indazol-5-yl)oxy)methyl)-3,6-dihydropyridine-1(2H)-carboxylic acid tert-butyl ester 6f

[0560] Compound 6e (100 mg, 0.18 mmol, Bio-Tech Pharmaceuticals) was dissolved in N,N-dimethylformamide (2.5 mL), and 2,6-bisbenzyloxypyridine-3-boronic acid pinacol ester (80 mg, 0.19 mmol, Bio-Tech Pharmaceuticals), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (15 mg, 0.02 mmol, Bio-Tech Pharmaceuticals), and potassium carbonate (55 mg, 0.40 mmol, Bio-Tech Pharmaceuticals) were added. The reaction was carried out at 65 °C for 2.5 h under a nitrogen atmosphere. After cooling to room temperature, 20 mL of water was added. The mixture was extracted with ethyl acetate (50 mL × 3), the organic phases were combined, washed with 50 mL of saturated brine, dried over anhydrous sodium sulfate, filtered, concentrated, and the residue was purified by column chromatography using eluent system B to give the title compound 6f (62 mg, yield: 47.8%).

[0561] MS m / z(ESI): 711.5 [M+1] + .

[0562] Step 6

[0563] 6g of 3-(2,6-bis(benzyloxy)pyridin-3-yl)-1-methyl-2',3'-dihydro-1H,1'H,6H-spiro[furano[2,3-f]indazole-7,4'-pyridine]-1'-carboxylic acid tert-butyl ester

[0564] Compound 6f (30 mg, 0.04 mmol) was dissolved in N,N-dimethylformamide (0.8 mL), and sodium formate (5 mg, 0.07 mmol), sodium acetate (9 mg, 0.11 mmol), palladium acetate (1 mg, 0.004 mmol), and tetraethylammonium chloride (11 mg, 0.07 mmol) were added. The mixture was reacted at 75 °C for 12 hours. After cooling to room temperature, the mixture was concentrated under reduced pressure. The residue was purified by column chromatography using eluent system A to give the title compound 6 g (15 mg, yield: 56.4%).

[0565] MS m / z (ESI): 631.8 [M+1] + .

[0566] Step 7

[0567] 3-(2,6-dioxopiperidin-3-yl)-1-methyl-1H,6Hspiro[furano[2,3-f]indazole-7,4'-piperidin]-1'-carboxylic acid tert-butyl ester 6h

[0568] 6 g (15 mg, 0.02 mmol) of the compound was dissolved in 3 mL of a mixed solvent of tetrahydrofuran and methanol (V / V = 1:2), and palladium on carbon (4 mg, 0.04 mmol, Bio-Pharmaceutical) and palladium hydroxide (6 mg, 0.04 mmol, Shaoyuan) were added. The mixture was reacted at 70 °C for 16 hours under a hydrogen atmosphere, filtered, and concentrated to give the title compound 6h (11 mg, yield: 24.2%).

[0569] MS m / z (ESI): 455.6 [M+1] + .

[0570] Step 8

[0571] 3-(1-Methyl-1H,6H-spiro[furano[2,3-f]indazole-7,4'-piperidine]-3-yl)piperidine-2,6-dione 6i

[0572] Compound 6h (11 mg, 0.02 mmol) was dissolved in trifluoroacetic acid (2 mL) and reacted at room temperature for 1 hour. The mixture was concentrated under reduced pressure, and 5 mL of saturated sodium bicarbonate solution was added. The mixture was extracted with ethyl acetate (5 mL × 3). The organic phases were combined, washed with 5 mL of saturated sodium chloride solution, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by column chromatography using eluent system A to give the title compound 6i (8 mg, yield: 94.1%).

[0573] MS m / z(ESI): 355.1 [M+1] + .

[0574] Step 9

[0575] 2-((6-((5-chloro-2-(4-((1r,3r)-3-(3-(2,6-dioxopiperidin-3-yl)-1-methyl-1H,6H-spiro[furano[2,3-f]indazole-7,4'-piperidin]-1'-yl)cyclobutoxy)piperidin-1-yl)pyrimidin-4-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide6

[0576] Using the synthetic route of steps eleven to thirteen of Example 1, compound 1m was replaced with compound 6i and starting compound 1c was replaced with starting compound 2b to obtain title compound 6 (25 mg, yield: 28.0%).

[0577] MS m / z(ESI): 907.8 [M+1]+ .

[0578] 1 H NMR (500MHz, DMSO-d6): δ10.84(s,1H),8.84(s,1H),8.05(s,1H),7.97-7.95(m,2H),7.70(s,2H),7.5 2(s,1H),7.04(s,1H),6.91(s,1H),4.55(s,2H),4.39(s,2H),4.26-4.12(m,4H),3.95(s,3H),3.54-3 .50(m,1H),3.27-3.22(m,3H),2.89-2.87(m,3H),2.69-2.50(m,6H),2.17-2.14(m,2H),2.08-2.01(m ,3H),1.98-1.96(m,3H),1.87-1.71(m,6H),1.59-1.57(m,4H),1.40-1.38(m,1H),1.26-1.24(m,2H).

[0579] Examples 6-1, 6-2

[0580] 2-((6-((5-chloro-2-(4-((1R,3r)-3-(3-((R)-2,6-dioxopiperidin-3-yl)-1-methyl-1H,6H-spiro[furano[2,3-f]indazole-7,4'-piperidin]-1'-yl)cyclobutoxy)piperidin-1-yl)pyrimidin-4-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide 6-1

[0581] 2-((6-((5-chloro-2-(4-((1S,3r)-3-(3-((S)-2,6-dioxopiperidin-3-yl)-1-methyl-1H,6H-spiro[furano[2,3-f]indazole-7,4'-piperidin]-1'-yl)cyclobutoxy)piperidin-1-yl)pyrimidin-4-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide 6-2

[0582] Compound 6 (55 mg) was resolved by a chiral column (Shimadzu LC-20AP, column: ChiralPak IE, 5 μm, 20 mm × 250 mm; mobile phase A: acetonitrile, mobile phase B: ethanol, gradient ratio: A:B = 40:60, flow rate: 20 mL / min) to give the title compound (15 mg, yield: 27.2%) and (25 mg, yield: 45.4%).

[0583] Single configuration compound (shorter retention time): (15 mg, yield: 27.2%).

[0584] MS m / z(ESI): 907.8 [M+1] + .

[0585] Chiral HPLC analysis: retention time 9.535 min, purity: 99.9% (column: ChiralPak IE, 4.6*150mm, 5μm; mobile phase A: acetonitrile, mobile phase B: ethanol (0.1% diethylamine), gradient ratio: A:B = 40:60, flow rate: 1.0 mL / min).

[0586] 1 H NMR (500MHz, DMSO-d6): δ10.85(s,1H),8.84(s,1H),8.05(s,1H),7.99–7.94(m,2H),7.70(d,2H), 7.53(s,1H),7.04(s,1H),6.91(s,1H),4.55(s,2H),4.39(s,2H),4.25(dd,1H),4.23–4.16(m,1H) ,4.13(d,2H),3.95(s,3H),3.54(dt,1H),3.25(t,2H),2.88(d,3H),2.69(d,3H),2.65–2.54(m,3H ),2.31(ddt,1H),2.15(td,3H),2.05–1.92(m,4H),1.78(ddd,6H),1.58(d,6H),1.44–1.34(m,2H).

[0587] Single-configuration compound (longer retention time): (25 mg, yield: 45.4%).

[0588] MS m / z(ESI): 907.8 [M+1] + .

[0589] Chiral HPLC analysis: retention time 20.528 min, purity: 99.9% (column: ChiralPak IE, 4.6*150mm, 5μm; mobile phase A: acetonitrile, mobile phase B: ethanol (0.1% diethylamine), gradient ratio: A:B = 40:60, flow rate: 1.0 mL / min).

[0590] 1H NMR (500MHz, DMSO-d6): δ10.84(s,1H),8.84(s,1H),8.05(s,1H),8.00–7.94(m,2H),7.70(d,2H) ),7.53(s,1H),7.04(s,1H),6.91(s,1H),4.55(s,2H),4.39(s,2H),4.25(dd,1H),4.22–4.17(m, 1H),4.13(d,2H),3.95(s,3H),3.54(dt,1H),3.25(t,2H),2.86(dd,3H),2.69(d,3H),2.59(dq,3 H),2.31(dq,1H),2.15(td,3H),2.04–1.93(m,4H),1.85–1.69(m,6H),1.58(d,6H),1.39(q,2H).

[0591] Example 7

[0592] 2-((6-((5-chloro-2-(4-((1S,3r)-3-((7aS)-3-(2,6-dioxopiperidin-3-yl)-1-methyl-7a,8,10,11-tetrahydro-1H-pyrazino[1',2':4,5][1,4]oxazino[2,3-g]indazole-9(7H)-yl)cyclobutoxy)piperidin-1-yl)pyrimidin-4-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide7

[0593] first step

[0594] (S)-3-(((7-bromo-3-iodo-1-methyl-1H-indazol-6-yl)oxy)methyl)-4-(2,2,2-trifluoroacetyl)piperazine-1-carboxylic acid tert-butyl ester 7a

[0595] Compound 5d (1.8 g, 5.10 mmol) was dissolved in tetrahydrofuran (40 mL), and (S)-3-(hydroxymethyl)-4-(2,2,2-trifluoroacetyl)piperazine-1-carboxylic acid tert-butyl ester (1.9 g, 6.15 mmol, prepared by the method disclosed in intermediate 46 on page 87 of patent application WO2012123312A1), triphenylphosphine (4.1 g, 15.63 mmol, BIDE), and bis(4-chlorobenzyl)azodicarbonate (5.7 g, 15.52 mmol, BIDE) were added. The mixture was reacted at 36 °C for 12 hours. After cooling to room temperature, the mixture was concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system A to give title compound 7a (1.6 g, yield: 48.5%).

[0596] MS m / z (ESI): 647.3 [M+1] + .

[0597] Step 2

[0598] (S)-3-(((3-(2,6-bis(benzyloxy)pyridin-3-yl)-7-bromo-1-methyl-1H-indazol-6-yl)oxy)methyl)-4-(2,2,2-trifluoroacetyl)piperazine-1-carboxylic acid tert-butyl ester 7b

[0599] Compound 7a (1.56 g, 2.41 mmol) was dissolved in 1,4-dioxane (16 mL) and water (4 mL), and 2,6-bisbenzyloxypyridine-3-boronic acid pinacol ester (1.21 g, 2.90 mmol, Bio-Tech Pharmaceuticals), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (177 mg, 0.24 mmol, Bio-Tech Pharmaceuticals), and cesium carbonate (1.56 g, 4.79 mmol, Bio-Tech Pharmaceuticals) were added. The reaction was carried out at 100 °C for 1 hour under a nitrogen atmosphere. After cooling to room temperature, 20 mL of water was added. The mixture was extracted with ethyl acetate (50 mL × 3), the organic phases were combined, washed with 50 mL of saturated brine, dried over anhydrous sodium sulfate, filtered, concentrated, and the residue was purified by column chromatography using eluent system B to give title compound 7b (1.1 g, yield: 56.3%).

[0600] MS m / z (ESI): 810.8 [M+1] + .

[0601] Step 3

[0602] (S)-3-(((3-(2,6-bis(benzyloxy)pyridin-3-yl)-7-bromo-1-methyl-1H-indazol-6-yl)oxy)methyl)piperazine-1-carboxylic acid tert-butyl ester 7c

[0603] Compound 7b (1.1 g, 1.36 mmol) was dissolved in methanol (16 mL), and potassium carbonate (563 mg, 4.07 mmol, Bio-Pharmaceutical) was added. The mixture was reacted at room temperature for 1 hour. The solution was concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system A to give the title compound 7c (350 mg, yield: 36.1%).

[0604] MS m / z (ESI): 714.7 [M+1] + .

[0605] Step 4

[0606] (S)-3-(2,6-bis(benzyloxy)pyridin-3-yl)-1-methyl-7a,8,10,11-tetrahydro-1H-pyrazino[1',2':4,5][1,4]oxazino[2,3-g]indazole-9(7H)-tert-butyl carboxylate 7d

[0607] Compound 7c (350 mg, 0.49 mmol) was dissolved in 1,4-dioxane (8 mL), and cesium carbonate (479 mg, 1.47 mmol), tris(dibenzylacetone)palladium (45 mg, 0.049 mmol), and 2-dicyclohexylphosphine-2',6'-diisopropoxy-1,1'-biphenyl (46 mg, 0.099 mmol) were added. The mixture was reacted at 100 °C for 12 hours. After cooling to room temperature, the mixture was concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system B to give the title compound 7d (295 mg, yield: 95.0%).

[0608] MS m / z(ESI): 634.8 [M+1] + .

[0609] Step 5

[0610] 3-((S)-1-methyl-7,7a,8,9,10,11-hexahydro-1H-pyrazino[1',2':4,5][1,4]oxazino[2,3-g]indazol-3-yl)piperidine-2,6-dione 7e

[0611] Compound 7d (173 mg, 0.27 mmol) was dissolved in a mixed solvent of tetrahydrofuran and methanol (9 mL, V / V = 1:2), and palladium on carbon (44 mg, 0.41 mmol, Bio-Tech) and palladium hydroxide (57 mg, 0.41 mmol, Shaoyuan) were added. The mixture was reacted at 70 °C for 16 hours under a hydrogen atmosphere. After filtration and concentration, the crude product was directly dissolved in trifluoroacetic acid (2 mL) and reacted at room temperature for 1 hour. The mixture was concentrated under reduced pressure, and 5 mL of saturated sodium bicarbonate solution was added. The mixture was extracted with ethyl acetate (5 mL × 3), and the organic phases were combined. The mixture was washed with 5 mL of saturated sodium chloride solution, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by column chromatography using eluent system A to give the title compound 7e (95 mg, yield: 97.9%).

[0612] MS m / z(ESI): 356.2 [M+1] + .

[0613] Step 6

[0614] 2-((6-((5-chloro-2-(4-((1S,3r)-3-((7aS)-3-(2,6-dioxopiperidin-3-yl)-1-methyl-7a,8,10,11-tetrahydro-1H-pyrazino[1',2':4,5][1,4]oxazino[2,3-g]indazole-9(7H)-yl)cyclobutoxy)piperidin-1-yl)pyrimidin-4-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide7

[0615] Using the synthetic route of steps eleven to thirteen of Example 1, starting compound 1m was replaced with starting compound 7e, and starting compound 1c was replaced with starting compound 2b, respectively, to obtain title compound 7 (25 mg, yield: 10.5%).

[0616] MS m / z(ESI): 909.0 [M+1] + .

[0617] 1 H NMR (500MHz, DMSO-d6): δ10.86(s,1H),8.84(s,1H),8.05-7.96(m,3H),7.70(s,2H),7.27 -7.25(m,1H),7.03(s,1H),6.65-6.63(m,1H),4.55(s,3H),4.28-4.11(m,8H),3.54-3.52 (m,2H),3.27-3.21(m,4H),2.89-2.78(m,4H),2.69-2.50(m,5H),2.28-2.25(m,2H),2.18 -2.00(m,4H),1.98-1.96(m,2H),1.82-1.71(m,2H),1.59-1.57(m,6H),1.40-1.38(m,2H).

[0618] Example 8

[0619] 2-((6-((5-chloro-2-(4-((1R,3r)-3-((7aR)-3-(2,6-dioxopiperidin-3-yl)-1-methyl-7a,8,10,11-tetrahydro-1H-pyrazino[1',2':4,5][1,4]oxazino[2,3-g]indazole-9(7H)-yl)cyclobutoxy)piperidin-1-yl)pyrimidin-4-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide8

[0620] first step

[0621] (R)-3-(hydroxymethyl)-4-(2,2,2-trifluoroacetyl)piperazine-1-carboxylic acid tert-butyl ester 8b

[0622] (R)-3-(hydroxymethyl)piperazine-1-carboxylic acid tert-butyl ester 8a (5 g, 23.12 mmol, Shaoyuan) was dissolved in acetonitrile (30 mL), and ethyl 2,2,2-trifluoroacetate (3.7 g, 26.04 mmol, Shaoyuan) and triethylamine (2.7 g, 26.68 mmol, Sinopharm) were added. The reaction mixture was reacted at 90 °C for 16 hours. The reaction solution was cooled to room temperature, concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system B to give the title compound 8b (4 g, yield: 55.4%).

[0623] MS m / z(ESI): 311.2 [M-1] - .

[0624] Step 2

[0625] (R)-3-(((7-bromo-3-iodo-1-methyl-1H-indazol-6-yl)oxy)methyl)-4-(2,2,2-trifluoroacetyl)piperazine-1-carboxylic acid tert-butyl ester 8c

[0626] Compound 5d (1.8 g, 5.10 mmol) was dissolved in tetrahydrofuran (40 mL), and compound 8b (1.92 g, 6.15 mmol), triphenylphosphine (4.1 g, 15.63 mmol, Adamas), and di-p-chlorophenyl azodicarbonate (5.7 g, 15.52 mmol, Adamas) were added. The mixture was reacted at room temperature for 12 hours. The reaction solution was concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system B to give the title compound 8c (1.6 g, yield: 48.5%).

[0627] Step 3

[0628] (R)-3-(((3-(2,6-bis(benzyloxy)pyridin-3-yl)-7-bromo-1-methyl-1H-indazol-6-yl)oxy)methyl-4-(2,2,2-trifluoroacetyl)piperazine-1-carboxylic acid tert-butyl ester 8d

[0629] Compound 8c (1.56 g, 2.41 mmol) was dissolved in 1,4-dioxane (16 mL) and water (4 mL), and [1,1'-bis(diphenylphosphino)ferrocene]palladium dichloride (177 mg, 0.24 mmol, BIDE), 2,6-bis(benzyloxy)-3-(4,4,5,5-tetramethyl-1,3,2-dioxoboropentane-2-yl)pyridine (1.21 g, 2.90 mmol, BIDE) and cesium carbonate (1.56 g, 4.79 mmol, Adamas) were added. The mixture was purged with nitrogen three times and reacted at 100 °C for 2 h. The reaction solution was cooled to room temperature, concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system B to give the title compound 8d (1.1 g, yield: 56.3%).

[0630] MS m / z(ESI): 812.8 [M+2] + .

[0631] Step 4

[0632] (R)-3-(((3-(2,6-bis(benzyloxy)pyridin-3-yl)-7-bromo-1-methyl-1H-indazol-6-yl)oxy)methyl)piperazine-1-carboxylic acid tert-butyl ester 8e

[0633] Compound 8d (1.1 g, 1.35 mmol) was dissolved in methanol (16 mL), and potassium carbonate (563 mg, 4.07 mmol, Sinopharm) was added. The mixture was reacted at room temperature for 3 hours. The reaction solution was concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system A to give the title compound 8e (350 mg, yield: 36.1%).

[0634] MS m / z(ESI): 716.7 [M+2] + .

[0635] Step 5

[0636] (R)-3-(2,6-bis(benzyloxy)pyridin-3-yl)-1-methyl-7a,8,10,11-tetrahydro-1H-pyrazino[1',2':4,5][1,4]oxazino[2,3-g]indazole-9(7H)-tert-butyl carboxylate 8f

[0637] Compound 8e (350 mg, 0.49 mmol) was dissolved in 1,4-dioxane (8 mL), and tris(dibenzylacetone)palladium (45 mg, 0.05 mmol, Bide), 2-dicyclohexylphosphine-2',6'-diisopropoxy-1,1'-biphenyl (46 mg, 0.1 mmol, Shaoyuan), and cesium carbonate (479 mg, 1.47 mmol, Adamas) were added. The mixture was purged with nitrogen three times and reacted at 100 °C for 12 hours. The reaction solution was cooled to room temperature, concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system B to give the title compound 8f (295 mg, yield: 95.0%).

[0638] MS m / z (ESI): 634.7 [M+1] + .

[0639] Step 6

[0640] (7aR)-3-(2,6-dioxopiperidin-3-yl)-1-methyl-7a,8,10,11-tetrahydro-1H-pyrazino[1',2':4,5][1,4]oxazino[2,3-g]indazole-9(7H)-carboxylic acid tert-butyl ester 8g

[0641] Compound 8f (178 mg, 0.28 mmol) was dissolved in methanol (6 mL) and tetrahydrofuran (3 mL), and palladium on carbon (45 mg, 0.42 mmol, Shaoyuan) and palladium hydroxide (59 mg, 0.42 mmol, Adamas) were added. The mixture was purged with hydrogen three times and reacted at 70 °C for 16 hours. The reaction solution was cooled to room temperature, filtered, and the filtrate was concentrated under reduced pressure to give compound 8 g (127 mg, yield: 99.2%).

[0642] MS m / z (ESI): 456.6 [M+1] + .

[0643] Step 7

[0644] 3-((R)-1-methyl-7,7a,8,9,10,11-hexahydro-1H-pyrazino[1',2':4,5][1,4]oxazino[2,3-g]indazol-3-yl)piperidine-2,6-dione 8h

[0645] 8 g (127 mg, 0.27 mmol) of the compound was dissolved in 3 mL of trifluoroacetic acid and reacted at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure, 5 mL of saturated sodium bicarbonate solution was added, and the mixture was extracted with ethyl acetate (5 mL × 3). The organic phases were combined, washed with 5 mL of saturated sodium chloride solution, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by column chromatography using eluent system A to give the title compound 8h (99 mg, yield: 99.9%).

[0646] MS m / z(ESI): 356.4 [M+1] + .

[0647] Step 8

[0648] 4-((1R,3r)-3-((7aR)-3-(2,6-dioxopiperidin-3-yl)-1-methyl-7a,8,10,11-tetrahydro-1H-pyrazino[1',2':4,5][1,4]oxazino[2,3-g]indazole-9(7H)-yl)cyclobutoxy)piperidin-1-carboxylic acid tert-butyl ester 8i

[0649] Compound 8h (99 mg, 0.28 mmol) was dissolved in acetonitrile (5 mL), and N,N-diisopropylethylamine (180 mg, 1.39 mmol, Adamas) and 4-((1s,3s)-3-(((trifluoromethyl)sulfonyl)oxy)cyclobutoxy)piperidine-1-carboxylic acid tert-butyl ester (224 mg, 0.55 mmol, prepared by the method disclosed in step 5 on page 268 of patent application WO202396987 A1) were added. The mixture was microwaved at 60 °C for 1 hour. The reaction solution was cooled to room temperature, concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system A to give the title compound 8i (165 mg, yield: 97.3%).

[0650] MS m / z (ESI): 609.7 [M+1] + .

[0651] Step 9

[0652] 3-((R)-1-methyl-9-((1r,3R)-3-(piperidin-4-yloxy)cyclobutyl)-7,7a,8,9,10,11-hexahydro-1H-pyrazino[1',2':4,5][1,4]oxazino[2,3-g]indazol-3-yl)piperidin-2,6-dione 8j

[0653] Compound 8i (165 mg, 0.27 mmol) was dissolved in trifluoroacetic acid (3 mL) and reacted at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure, 5 mL of saturated sodium bicarbonate solution was added, and the mixture was extracted with ethyl acetate (5 mL × 3). The organic phases were combined, washed with 5 mL of saturated sodium chloride solution, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure to give the title compound 8j (132 mg, yield: 92.9%).

[0654] MS m / z (ESI): 509.6 [M+1] + .

[0655] Step 10

[0656] 2-((6-((5-chloro-2-(4-((1R,3r)-3-((7aR)-3-(2,6-dioxopiperidin-3-yl)-1-methyl-7a,8,10,11-tetrahydro-1H-pyrazino[1',2':4,5][1,4]oxazino[2,3-g]indazole-9(7H)-yl)cyclobutoxy)piperidin-1-yl)pyrimidin-4-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide8

[0657] Compound 8j (132 mg, 0.26 mmol) was dissolved in dimethyl sulfoxide (2 mL), and N,N-diisopropylethylamine (180 mg, 1.39 mmol, Adamas) and compound 2b (117 mg, 0.28 mmol) were added. The mixture was reacted at 100 °C for 1 hour. The reaction solution was cooled to room temperature, concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system A to give title compound 8 (36 mg, yield: 15.2%).

[0658] MS m / z(ESI): 908.3 [M+1] + .

[0659] 1 H NMR(500MHz,DMSO)δ10.86(s,1H),8.84(s,1H),8.05(s,1H),7.98–7.94(m,2H),7.69(d,2H),7.26(dd,1 H),7.03(s,1H),6.64(d,1H),4.57–4.49(m,3H),4.27(dd,1H),4.21–4.10(m,6H),3.57–3.50(m,1H),3. 31–3.20(m,5H),3.01(d,1H),2.95–2.86(m,2H),2.83–2.78(m,1H),2.69(d,3H),2.67–2.59(m,2H),2.3 4–2.26(m,2H),2.22–2.10(m,4H),2.02–1.96(m,3H),1.87–1.81(m,2H),1.58(d,6H),1.40–1.38(m,2H).

[0660] Example 9

[0661] 2-((6-((5-chloro-2-(4-((1R,3r)-3-((7aR)-3-(2,6-dioxopiperidin-3-yl)-1-methyl-7a,8,10,11-tetrahydro-1H-pyrazino[1',2':4,5][1,4]oxazino[2,3-g]indazole-9(7H)-yl)cyclobutoxy)piperidin-1-yl)pyrimidin-4-yl)amino)-1-methyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide9

[0662] first step

[0663] 2-((6-((5-chloro-2-(4-((1R,3r)-3-((7aR)-3-(2,6-dioxopiperidin-3-yl)-1-methyl-7a,8,10,11-tetrahydro-1H-pyrazino[1',2':4,5][1,4]oxazino[2,3-g]indazole-9(7H)-yl)cyclobutoxy)piperidin-1-yl)pyrimidin-4-yl)amino)-1-methyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide9

[0664] Using the synthetic route of steps eleven to thirteen of Example 1, compound 1m was replaced with compound 8h to obtain title compound 9 (40 mg, yield: 39.8%).

[0665] MS m / z(ESI): 880.9 [M+1] + .

[0666] 1 H NMR (500MHz, DMSO-d6): δ10.86(s,1H),8.86(s,1H),8.05-7.94(m,3H),7.75-7.73(m,1H),7.4 9-7.47(m,1H),7.27-7.25(m,1H),7.12(s,1H),6.65-6.63(m,1H),4.55(s,3H),4.29-4.11(m, 8H),3.69(s,3H),3.51-3.49(m,1H),3.27-3.22(m,4H),2.68-2.62(m,4H),2.55-2.50(m,5H), 2.31-2.29(m,2H),2.18-2.10(m,4H),1.98-1.96(m,2H),1.81-1.70(m,2H),1.40-1.37(m,2H).

[0667] Example 10

[0668] 2-((6-((5-chloro-2-(4-((((7aS)-3-(2,6-dioxopiperidin-3-yl)-1-methyl-7a,8,10,11-tetrahydro-1H-pyrazino[1',2':4,5][1,4]oxazino[2,3-g]indazol-9(7H)-yl)methyl)piperidin-1-yl)pyrimidin-4-yl)amino)-1-methyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide10

[0669] first step

[0670] 4-(((7aS)-3-(2,6-dioxopiperidin-3-yl)-1-methyl-7a,8,10,11-tetrahydro-1H-pyrazino[1',2':4,5][1,4]oxazino[2,3-g]indazole-9(7H)-yl)methyl)piperidin-1-carboxylic acid tert-butyl ester 10a

[0671] Compound 7e (68 mg, 191 μmol) and 1-tert-butoxycarbonylpiperidine-4-carboxaldehyde (45 mg, 211 μmol, Shanghai Bide) were dissolved in 1,2-dichloroethane (5 mL) and methanol (1 mL). Sodium triacetoxyborohydride (121 mg, 574 μmol) was added, and the mixture was stirred for 1 hour. The reaction solution was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography with eluent system A to give title compound 10a (100 mg, yield: 94.5%).

[0672] MS m / z (ESI): 553.3 [M+1] + .

[0673] Step 2

[0674] 2-((6-((5-chloro-2-(4-((((7aS)-3-(2,6-dioxopiperidin-3-yl)-1-methyl-7a,8,10,11-tetrahydro-1H-pyrazino[1',2':4,5][1,4]oxazino[2,3-g]indazol-9(7H)-yl)methyl)piperidin-1-yl)pyrimidin-4-yl)amino)-1-methyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide10

[0675] Using steps 12 and 13 of the synthetic route in Example 1, the compound 1n in step 12 was replaced with compound 10a to obtain title compound 10 (40 mg, yield: 26.8%).

[0676] MS m / z(ESI): 824.8 [M+1] + .

[0677] 1H NMR (500MHz, CDCl3): δ8.04(s,1H),7.92(s,1H),7.89(d,1H),7.73(dd,1H),7.47(s,1H),7.37(d,1H),7 .23(d,1H),7.05(s,1H),6.94(s,1H),6.73(d,1H),4.75(t,2H),4.68(d,2H),4.58(s,2H),4.27–4.21(m, 4H),4.13(dd,1H),3.84(s,3H),3.32(d,1H),3.25(d,1H),3.10(t,2H),3.03–2.96(m,2H),2.93(d,3H), 2.73–2.63(m,3H),2.51–2.44(m,2H),2.36(td,2H),2.24(td,2H),2.05–2.02(m,1H),1.89–1.81(m,3H).

[0678] Example 11

[0679] 2-((6-((5-chloro-2-(4-((((7aR)-3-(2,6-dioxopiperidin-3-yl)-1-methyl-7a,8,10,11-tetrahydro-1H-pyrazino[1',2':4,5][1,4]oxazino[2,3-g]indazol-9(7H)-yl)methyl)piperidin-1-yl)pyrimidin-4-yl)amino)-1-methyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide11

[0680] first step

[0681] 4-(((7aR)-3-(2,6-dioxopiperidin-3-yl)-1-methyl-7a,8,10,11-tetrahydro-1H-pyrazino[1',2':4,5][1,4]oxazino[2,3-g]indazole-9(7H)-yl)methyl)piperidin-1-carboxylic acid tert-butyl ester 11a

[0682] Compound 8h (50 mg, 0.14 mmol) was dissolved in 1,4-dioxane (8 mL) and methanol (1 mL), and tert-butyl 1-carboxylate-piperidine-4-carboxaldehyde (61 mg, 0.29 mmol) and sodium triacetoxyborohydride (90 mg, 0.42 mmol) were added. The reaction was carried out at room temperature for 1 hour. The mixture was concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system B to give the title compound 11a (70 mg, yield: 90.0%).

[0683] MS m / z (ESI): 553.3 [M+1] + .

[0684] Step 2

[0685] 3-((R)-1-methyl-9-(piperidin-4-ylmethyl)-7,7a,8,9,10,11-hexahydro-1H-pyrazino[1',2':4,5][1,4]oxazino[2,3-g]indazol-3-yl)piperidin-2,6-dione 11b

[0686] Compound 11a (70 mg, 0.13 mmol) was dissolved in trifluoroacetic acid (5 mL) and reacted at room temperature for 1 hour. The solution was concentrated under reduced pressure, and 5 mL of saturated sodium bicarbonate solution was added. The mixture was extracted with ethyl acetate (5 mL × 3). The organic phases were combined, washed with 5 mL of saturated sodium chloride solution, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by column chromatography using eluent system A to give title compound 11b (57 mg, yield: 99.4%).

[0687] MS m / z (ESI): 453.5 [M+1] + .

[0688] Step 3

[0689] 2-((6-((5-chloro-2-(4-((((7aR)-3-(2,6-dioxopiperidin-3-yl)-1-methyl-7a,8,10,11-tetrahydro-1H-pyrazino[1',2':4,5][1,4]oxazino[2,3-g]indazol-9(7H)-yl)methyl)piperidin-1-yl)pyrimidin-4-yl)amino)-1-methyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide11

[0690] Using the thirteenth step of the synthetic route in Example 1, starting compound 1o was replaced with starting compound 11b to obtain title compound 11 (28 mg, yield: 27.0%).

[0691] MS m / z(ESI): 824.9 [M+1] + .

[0692] 1H NMR (500MHz, DMSO-d6): δ10.84(s,1H),8.82(s,1H),8.04-7.92(m,3H),7.79-7.76(m,1H), 7.49-7.47(m,1H),7.27-7.25(m,1H),7.12(m,1H),6.65-6.63(m,1H),4.58-4.49(m,5H),4. 28-4.16(m,5H),3.69(s,3H),3.26-3.23(m,2H),2.98-2.96(m,2H),2.85-2.82(m,3H),2.6 7-2.62(m,5H),2.51-2.53(m,1H),2.29-2.15(m,5H),1.81-1.75(m,3H),1.05-1.02(m,2H).

[0693] Example 12

[0694] 2-((6-((5-chloro-2-(4-((1S,3r)-3-((7aS)-3-(2,6-dioxopiperidin-3-yl)-1-methyl-7a,8,10,11-tetrahydro-1H-pyrazino[1',2':4,5][1,4]oxazino[2,3-g]indazole-9(7H)-yl)cyclobutoxy)piperidin-1-yl)pyrimidin-4-yl)amino)-1-methyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide12

[0695] Using the synthetic route of steps eleven to thirteen of Example 1, compound 1m was replaced with compound 7e to obtain title compound 12 (30 mg, yield: 26.4%).

[0696] MS m / z (ESI): 880.8 [M+1] + .

[0697] 1H NMR (500MHz, DMSO-d6): δ10.86(s,1H),8.86(s,1H),8.05(d,1H),7.98(d,1H),7.94(d,1H),7.74(dd,1H),7.48(d,1H),7. 29–7.23(m,1H),7.12(s,1H),6.67–6.62(m,1H),4.59(s,2H),4.53(t,1H),4.27(dd,1H),4.22–4.17(m,2H),4.15(s,3H), 4.12(d,2H),3.69(s,3H),3.58–3.50(m,1H),3.28–3.20(m,4H),3.01(d,1H),2.96–2.85(m,2H),2.86–2.80(m,1H),2.68( d,3H),2.66–2.60(m,2H),2.32-2.22(m,2H),2.19–2.08(m,4H),2.03–1.96(m,2H),1.88–1.80(m,2H),1.41–1.32(m,2H).

[0698] Example 13

[0699] 2-((6-((5-chloro-2-(4-((1S,3r)-3-((5aS)-1-(2,6-dioxopiperidin-3-yl)-3-methyl-5a,6,8,9-tetrahydro-3H-pyrazino[1',2':4,5][1,4]oxazino[3,2-g]indazole-7(5H)-yl)cyclobutoxy)piperidin-1-yl)pyrimidin-4-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide13

[0700] first step

[0701] 6-Bromo-7-methoxy-1H-indazole 13b

[0702] 4-Bromo-2-fluoro-3-methoxybenzaldehyde 13a (9 g, 38.62 mmol, Bioderm) was dissolved in ethylene glycol dimethyl ether (100 mL), and hydrazine hydrate (16 g, 271.67 mmol, 85%, Sinopharm) was added. The reaction mixture was reacted at 100 °C for 48 hours. The reaction solution was cooled to room temperature, concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system B to give the title compound 13b (950 mg, yield: 10.8%).

[0703] MS m / z(ESI): 229.1 [M+2] + .

[0704] Step 2

[0705] 6-Bromo-3-iodo-7-methoxy-1H-indazole 13c

[0706] Compound 13b (1.1 g, 4.84 mmol) was dissolved in N,N-dimethylformamide (15 mL), and N-iodosuccinimide (1.42 g, 6.30 mmol, Adamas) was added. The reaction mixture was reacted at room temperature for 3 hours. The reaction solution was concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system B to give the title compound 13c (1.41 g, yield: 82.4%).

[0707] MS m / z(ESI): 355.0 [M+2] + .

[0708] Step 3

[0709] 6-Bromo-3-iodo-7-methoxy-1-methyl-1H-indazole 13d

[0710] Compound 13c (1.41 g, 4.0 mmol) was dissolved in N,N-dimethylformamide (15 mL), and potassium carbonate (1.10 g, 8.0 mmol, Sinopharm) and methyl iodide (1.13 g, 8.0 mmol, Adamas) were added. The reaction mixture was reacted at room temperature for 3 hours. The reaction solution was filtered, the filtrate was concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system B to give the title compound 13d (900 mg, yield: 61.3%).

[0711] MS m / z(ESI): 369.1 [M+2] + .

[0712] Step 4

[0713] 6-Bromo-3-iodo-1-methyl-1H-indazole-7-phenol 13e

[0714] Compound 13d (900 mg, 2.45 mmol) was dissolved in N,N-dimethylformamide (10 mL), and sodium ethanethiol (2.06 g, 24.52 mmol, Adamas) was added. The reaction mixture was reacted at 80 °C for 30 min. The reaction solution was cooled to room temperature, 50 mL of water was added, and the mixture was extracted with ethyl acetate (50 mL × 3). The aqueous phases were combined, the pH was adjusted to 6-7 with 1 M hydrochloric acid, and the mixture was extracted with ethyl acetate (50 mL × 3). The organic phases were combined, washed with saturated sodium chloride solution, dried over anhydrous sodium sulfate, filtered, concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system B to give the title compound 13e (800 mg, yield: 92.4%).

[0715] MS m / z(ESI): 355.0 [M+2] + .

[0716] Step 5

[0717] (S)-3-(((6-bromo-3-iodo-1-methyl-1H-indazol-7-yl)oxy)methyl)-4-(2,2,2-trifluoroacetyl)piperazine-1-carboxylic acid tert-butyl ester 13f

[0718] Compound 13e (800 mg, 2.26 mmol) was dissolved in tetrahydrofuran (10 mL), and (S)-3-(hydroxymethyl)-4-(2,2,2-trifluoroacetyl)piperazine-1-carboxylic acid tert-butyl ester (710 mg, 2.27 mmol, prepared by the method disclosed in intermediate 46 on page 87 of patent application WO2012123312A1), triphenylphosphine (1.78 g, 6.80 mmol, Adamas), and di-p-chlorophenyl azodicarbonate (2.49 g, 6.80 mmol, Adamas) were added. The reaction mixture was reacted at room temperature for 12 hours. The reaction solution was concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system B to give the title compound 13f (300 mg, yield: 20.4%).

[0719] Step 6

[0720] (S)-3-(((3-(2,6-bis(benzyloxy)pyridin-3-yl)-6-bromo-1-methyl-1H-indazol-7-yl)oxy)methyl)-4-(2,2,2-trifluoroacetyl)piperazine-1-carboxylic acid tert-butyl ester 13g

[0721] Compound 13f (350 mg, 0.54 mmol) was dissolved in 1,4-dioxane (4 mL) and water (1 mL), and [1,1'-bis(diphenylphosphino)ferrocene]palladium dichloride (40 mg, 0.05 mmol, BIDE), 2,6-bis(benzyloxy)-3-(4,4,5,5-tetramethyl-1,3,2-dioxoboropentane-2-yl)pyridine (340 mg, 0.81 mmol, BIDE) and cesium carbonate (350 mg, 1.07 mmol, Adamas) were added. The mixture was purged with nitrogen three times and reacted at 100 °C for 2 hours. The reaction solution was cooled to room temperature, concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system B to give the title compound 13 g (245 mg, yield: 55.9%).

[0722] MS m / z(ESI): 812.5 [M+2] + .

[0723] Step 7

[0724] (S)-3-(((3-(2,6-bis(benzyloxy)pyridin-3-yl)-6-bromo-1-methyl-1H-indazol-7-yl)oxy)methyl)piperazine-1-carboxylic acid tert-butyl ester 13h

[0725] 13 g (245 mg, 0.30 mmol) of compound was dissolved in methanol (5 mL), and potassium carbonate (125 mg, 0.90 mmol, Sinopharm) was added. The mixture was reacted at room temperature for 3 hours. The reaction solution was concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system A to give the title compound 13h (170 mg, yield: 78.7%).

[0726] MS m / z(ESI): 716.6 [M+2] + .

[0727] Step 8

[0728] (S)-1-(2,6-bis(benzyloxy)pyridin-3-yl)-3-methyl-5a,6,8,9-tetrahydro-3H-pyrazino[1',2':4,5][1,4]oxazino[3,2-g]indazole-7(5H)-carboxylic acid tert-butyl ester 13i

[0729] Compound 13h (170 mg, 0.24 mmol) was dissolved in 1,4-dioxane (8 mL), and tris(dibenzylacetone)palladium (22 mg, 0.02 mmol, BID), 2-dicyclohexylphosphine-2',6'-diisopropoxy-1,1'-biphenyl (22 mg, 0.05 mmol, Shaoyuan), and cesium carbonate (235 mg, 0.72 mmol, Adamas) were added. The mixture was purged with nitrogen three times and reacted at 100 °C for 12 hours. The reaction solution was cooled to room temperature, concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system B to give the title compound 13i (140 mg, yield: 92.8%).

[0730] MS m / z (ESI): 634.5 [M+1] + .

[0731] Step 9

[0732] (5aS)-1-(2,6-dioxopiperidin-3-yl)-3-methyl-5a,6,8,9-tetrahydro-3H-pyrazino[1',2':4,5][1,4]oxazino[3,2-g]indazole-7(5H)-carboxylic acid tert-butyl ester 13j

[0733] Compound 13i (140 mg, 0.22 mmol) was dissolved in methanol (6 mL) and tetrahydrofuran (3 mL), and palladium on carbon (35 mg, 0.33 mmol, Shaoyuan) and palladium hydroxide (46 mg, 0.33 mmol, Adamas) were added. The mixture was purged with hydrogen three times and reacted at 70 °C for 16 hours. The reaction solution was cooled to room temperature, filtered, and the filtrate was concentrated under reduced pressure to give the title compound 13j (100 mg, yield: 99.4%).

[0734] MS m / z(ESI): 456.4 [M+1] + .

[0735] Step 10

[0736] 3-((S)-3-methyl-5,5a,6,7,8,9-hexahydro-3H-pyrazino[1',2':4,5][1,4]oxazino[3,2-g]indazol-1-yl)piperidine-2,6-dione 13k

[0737] Compound 13j (100 mg, 0.22 mmol) was dissolved in trifluoroacetic acid (3 mL) and reacted at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure, 5 mL of saturated sodium bicarbonate solution was added, and the mixture was extracted with ethyl acetate (5 mL × 3). The organic phases were combined, washed with 5 mL of saturated sodium chloride solution, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by column chromatography using eluent system A to give the title compound 13k (75 mg, yield: 96.1%).

[0738] MS m / z (ESI): 356.3 [M+1] + .

[0739] Step 11

[0740] 4-((1S,3r)-3-((5aS)-1-(2,6-dioxopiperidin-3-yl)-3-methyl-5a,6,8,9-tetrahydro-3H-pyrazino

[0741] [1',2':4,5][1,4]Oxazino[3,2-g]indazole-7(5H)-yl)cyclobutoxy)piperidine-1-carboxylic acid tert-butyl ester 13l

[0742] Compound 13k (75 mg, 0.21 mmol) was dissolved in acetonitrile (5 mL), and N,N-diisopropylethylamine (135 mg, 1.04 mmol, Adamas) and 4-((1S,3S)-3-(((trifluoromethyl)sulfonyl)oxy)cyclobutoxy)piperidine-1-carboxylic acid tert-butyl ester (170 mg, 0.42 mmol, prepared by the method disclosed in step 5 on page 268 of patent application WO202396987 A1) were added. The mixture was microwaved at 60 °C for 1 hour. The reaction solution was cooled to room temperature, concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system A to give the title compound 13l (105 mg, yield: 81.7%).

[0743] MS m / z(ESI): 609.4 [M+1] + .

[0744] Step Twelve

[0745] 3-((S)-3-methyl-7-((1r,3S)-3-(piperidin-4-yloxy)cyclobutyl)-5,5a,6,7,8,9-hexahydro-3H-pyrazino[1',2':4,5][1,4]oxazino[3,2-g]indazol-1-yl)piperidin-2,6-dione 13m

[0746] Compound 13l (105 mg, 0.17 mmol) was dissolved in trifluoroacetic acid (3 mL) and reacted at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure, 5 mL of saturated sodium bicarbonate solution was added, and the mixture was extracted with ethyl acetate (5 mL × 3). The combined organic phases were washed with 5 mL of saturated sodium chloride solution, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure to give the title compound 13m (85 mg, yield: 96.9%).

[0747] MS m / z(ESI): 509.3 [M+1] + .

[0748] Step Thirteen

[0749] 2-((6-((5-chloro-2-(4-((1S,3r)-3-((5aS)-1-(2,6-dioxopiperidin-3-yl)-3-methyl-5a,6,8,9-tetrahydro-3H-pyrazino[1',2':4,5][1,4]oxazino[3,2-g]indazole-7(5H)-yl)cyclobutoxy)piperidin-1-yl)pyrimidin-4-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide13

[0750] Compound 13m (85 mg, 0.16 mmol) was dissolved in dimethyl sulfoxide (2 mL), and N,N-diisopropylethylamine (105 mg, 0.81 mmol, Adamas) and compound 2b (85 mg, 0.20 mmol) were added. The mixture was reacted at 100 °C for 1 hour. The reaction solution was cooled to room temperature, concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system A to give title compound 13 (25 mg, yield: 16.4%).

[0751] MS m / z(ESI): 908.8 [M+1] + .

[0752] 1 H NMR(500MHz,DMSO)δ10.88(s,1H),8.84(s,1H),8.05(s,1H),8.01(d,1H),7.96(s,1H),7.70(s,2H),7.09(dd,1H) ,7.04(s,1H),6.86(d,1H),4.55(s,2H),4.42(dd,1H),4.25–4.20(m,2H),4.14–4.11(m,2H),4.06–4.01(m,4H),3. 84(d,2H),3.57–3.52(m,1H),3.25–3.21(m,3H),3.12–3.08(m,1H),2.95(d,2H),2.85–2.79(m,1H),2.69–2.58(m ,6H),2.31–2.14(m,4H),2.04–1.96(m,3H),1.86–1.76(m,2H),1.58(d,6H),1.49–1.44(m,1H),1.42–1.35(m,1H).

[0753] Example 14

[0754] 2-((6-((5-chloro-2-(4-((1R,3r)-3-((5aR)-1-(2,6-dioxopiperidin-3-yl)-3-methyl-5a,6,8,9-tetrahydro-3H-pyrazino[1',2':4,5][1,4]oxazino[3,2-g]indazole-7(5H)-yl)cyclobutoxy)piperidin-1-yl)pyrimidin-4-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide14

[0755] Using the synthetic route of Example 13, the title compound 14 (9 mg, yield: 6.1%) was prepared by replacing (S)-3-(hydroxymethyl)-4-(2,2,2-trifluoroacetyl)piperazine-1-carboxylate tert-butyl ester in step 5 with compound 8b.

[0756] MS m / z(ESI): 908.4 [M+1] + .

[0757] 1 H NMR (500MHz, DMSO-d6): δ10.87(s,1H),8.91(s,1H),8.07(s,1H),8.00–7.94(m,2H),7.73–7.63(m,2H),7.21–7.15(m,1 H),7.02(s,1H),7.00–6.92(m,1H),4.55(s,2H),4.49–4.43(m,1H),4.36–4.22(m,4H),4.19–4.10(m,3H),4.08(s,2H),3 .98–3.89(m,2H),3.61–3.57(m,2H),3.29–3.21(m,2H),3.08–2.95(m,3H),2.90–2.78(m,2H),2.71–2.62(m,4H),2.39–2 .35(m,1H),2.33–2.25(m,2H),2.18–2.10(m,2H),2.05–1.95(m,3H),1.89–1.81(m,2H),1.58(d,6H),1.50–1.37(m,1H).

[0758] Example 15

[0759] 2-((6-((5-chloro-2-(4-((1R,3r)-3-((4aR)-8-(2,6-dioxopiperidin-3-yl)-10-methyl-1,2,4a,5-tetrahydro-10H-pyrazino[1',2':4,5][1,4]oxazino[2,3-f]indazole-3(4H)-yl)cyclobutoxy)piperidin-1-yl)pyrimidin-4-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide15

[0760] Using the synthetic route of Example 8, the second-step compound 5d was replaced with compound 6d to obtain title compound 15 (8 mg, yield: 11.2%).

[0761] MS m / z(ESI): 908.8 [M+1] + .

[0762] 1H NMR(500MHz,DMSO)δ10.82(s,1H),8.84(s,1H),8.05(s,1H),7.99-7.93(m,2H ),7.70(s,2H),7.04(s,1H),6.92-6.90(m,2H),4.55(s,2H),4.27-4.11(m,5H ),3.93-3.87(m,4H),3.58-3.54(m,2H),3.32-2.82(m,6H),2.76-2.51(m,7H) ,2.37-2.01(m,4H),1.97-1.83(m,6H),1.58-1.51(m,6H),1.40-1.25(m,2H).

[0763] Example 16

[0764] 2-((6-((5-chloro-2-(4-((1S,3r)-3-((4aS)-8-(2,6-dioxopiperidin-3-yl)-10-methyl-1,2,4a,5-tetrahydro-10H-pyrazino[1',2':4,5][1,4]oxazino[3,2-f]indazole-3(4H)-yl)cyclobutoxy)piperidin-1-yl)pyrimidin-4-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide16

[0765] Using steps 2 to 10 of the synthetic route of Example 8, the second compound 8b was replaced with (S)-3-(hydroxymethyl)-4-(2,2,2-trifluoroacetyl)piperazine-1-carboxylic acid tert-butyl ester, and the second compound 5d was replaced with compound 6d to obtain title compound 16 (15 mg, yield: 4.4%).

[0766] MS m / z(ESI): 908.4 [M+1] + .

[0767] 1H NMR (500MHz, DMSO-d6): δ10.84(s,1H),8.93(s,1H),8.07(s,1H),8.01–7.95(m,2H),7.73–7.64(m,2H),7.13– 7.08(m,1H),7.05–6.98(m,2H),4.55(s,2H),4.36–4.29(m,3H),4.26–4.18(m,1H),4.16–4.10(m,2H),4.03–3. 95(m,1H),3.89(s,3H),3.60–3.55(m,3H),3.29–3.22(m,3H),3.13–3.03(m,2H),2.82–2.74(m,1H),2.68(d,3H ),2.66–2.55(m,5H),2.35–2.25(m,3H),2.17–1.95(m,2H),1.89–1.82(m,2H),1.58(d,6H),1.46–1.39(m,2H).

[0768] Example 17

[0769] 2-((6-((5-chloro-2-(4-((1r,3r)-3-(3-(2,6-dioxopiperidin-3-yl)-1-methyl-1H,7H-spiro[furano[3,2-g]indazole-6,4'-piperidin]-1'-yl)cyclobutoxy)piperidin-1-yl)pyrimidin-4-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide 17

[0770] Method 1:

[0771] Steps one through eight of the route follow the synthetic route of steps four through nine of Example 6, except that compound 6d in step four is replaced with compound 13e to obtain title compound 17 (13 mg, yield: 7.2%).

[0772] Method 2:

[0773] first step

[0774] 4-(((6-bromo-3-iodo-1-methyl-1H-indazol-7-yl)oxy)methyl)-3,6-dihydropyridine-1(2H)-carboxylic acid tert-butyl ester 17a

[0775] Compound 13e (20 g, 56.6 mmol) was dissolved in N,N-dimethylformamide (200 mL), and potassium carbonate (15.6 g, 113.3 mmol, Sinopharm) and tert-butyl 4-(bromomethyl)-3,6-dihydropyridine-1(2H)-carboxylic acid (16.4 g, 59.4 mmol) were added. The reaction mixture was reacted at room temperature for 30 minutes. The reaction solution was concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system A to give title compound 17a (26.8 g, yield: 86.2%).

[0776] MS m / z (ESI): 494.1 [M-55] - .

[0777] Step 2

[0778] 4-(((3-(2,6-bis(benzyloxy)pyridin-3-yl)-6-bromo-1-methyl-1H-indazol-7-yl)oxy)methyl)-3,6-dihydropyridine-1(2H)-carboxylic acid tert-butyl ester 17b

[0779] Compound 17a (10 g, 18.2 mmol) was dissolved in 1,4-dioxane (200 mL) and water (40 mL), and 2,6-bisbenzyloxypyridine-3-boronic acid pinacol ester (11.4 g, 27.3 mmol, Bio-Tech Pharmaceuticals), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (1.33 g, 1.82 mmol, Bio-Tech Pharmaceuticals), and potassium carbonate (5 g, 36.46 mmol, Bio-Tech Pharmaceuticals) were added. The reaction was carried out at 90 °C for 3 hours under a nitrogen atmosphere. After cooling to room temperature, 200 mL of water was added. The mixture was extracted with ethyl acetate (500 mL × 3), the organic phases were combined, washed with 500 mL of saturated brine, dried over anhydrous sodium sulfate, filtered, the filtrate was concentrated, and the residue was purified by column chromatography using eluent system B to give title compound 17b (7 g, yield: 53.9%).

[0780] MS m / z(ESI): 713.6 [M+1] + .

[0781] Step 3

[0782] 3-(2,6-bis(benzyloxy)pyridin-3-yl)-1-methyl-2',3'-dihydro-1H,1'H,7H-spiro[furano[3,2-g]indazole-6,4'-pyridine]-1'-carboxylic acid tert-butyl ester 17c

[0783] Compound 17b (10 g, 14 mmol) was dissolved in 1,4-dioxane (300 mL), and sodium formate (1.91 g, 28 mmol, Adamas), sodium acetate (2.3 g, 28 mmol, Adamas), bis(tri-tert-butylphosphine)palladium (1.07 g, 2.1 mmol, Adamas), and tetraethylammonium chloride (4.65 g, 28 mmol, Adamas) were added. The mixture was reacted at 90 °C for 16 hours. After cooling to room temperature, the mixture was concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system A to give the title compound 17c (5.5 g, yield: 62.1%).

[0784] MS m / z (ESI): 631.3 [M+1] + .

[0785] Step 4

[0786] 3-(2,6-dioxopiperidin-3-yl)-1-methyl-1H,7H-spiro[furano[3,2-g]indazole-6,4'-piperidin]-1'-carboxylic acid tert-butyl ester 17d

[0787] Compound 17c (5.5 g, 8.72 mmol) was dissolved in a mixed solvent of tetrahydrofuran (70 mL) and methanol (30 mL). Palladium on carbon (2.78 g, 13 mmol, Bio-Tech) and palladium hydroxide (3.67 g, 13 mmol, Shaoyuan) were added, and the system was reacted at 70 °C for 16 hours under a hydrogen atmosphere at 20 atm. The mixture was filtered, and the filtrate was concentrated to give the title compound 17d (3.5 g, yield: 88.3%).

[0788] MS m / z (ESI): 455.4 [M+1] + .

[0789] Step 5

[0790] 3-(1-Methyl-1H,7H-spiro[furano[3,2-g]indazole-6,4'-piperidine]-3-yl)piperidine-2,6-dione 17e

[0791] Compound 17d (5.2 g, 11.4 mmol) was dissolved in dichloromethane (100 mL), and dioxane hydrochloride solution (10 mL, 4 M, Adamas) was added. The reaction mixture was reacted at room temperature for 1 hour. After removing the supernatant, the reaction mixture was concentrated under reduced pressure to give the crude hydrochloride of the title compound 17e (3.6 g).

[0792] MS m / z (ESI): 355.2 [M+1] + .

[0793] Step 6

[0794] 4-((1r,3r)-3-(3-(2,6-dioxopiperidin-3-yl)-1-methyl-1H,7H-spiro[furano[3,2-g]indazole-6,4'-piperidin]-1'-yl)cyclobutoxy)piperidin-1-carboxylic acid tert-butyl ester 17f

[0795] The hydrochloride salt of compound 17e (3.6 g, 9.2 mmol) was dissolved in acetonitrile (200 mL), and N,N-diisopropylethylamine (10.5 g, 81.2 mmol, Adamas) and 4-((1s,3s)-3-(((trifluoromethyl)sulfonyl)oxy)cyclobutoxy)piperidine-1-carboxylic acid tert-butyl ester (4.1 g, 10.1 mmol, prepared by the method disclosed in step 5 on page 268 of patent application WO202396987 A1) were added. The reaction was carried out at room temperature until the reaction was detected to be complete. The reaction solution was concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system A to give title compound 17f (6 g, yield: 97.2%).

[0796] MS m / z (ESI): 608.4 [M+1] + .

[0797] Step 7

[0798] 3-(1-methyl-1'-((1r,3r)-3-(piperidin-4-yloxy)cyclobutyl)-1H,7H-spiro[furano[3,2-g]indazole-6,4'-piperidin]-3-yl)piperidin-2,6-dione 17g

[0799] Compound 17f (6 g, 9.87 mmol) was dissolved in dichloromethane (100 mL), and trifluoroacetic acid (20 mL) was added. The reaction was carried out at room temperature for 1 hour. The reaction solution was concentrated under reduced pressure to give 5 g of crude trifluoroacetate of the title compound 17f.

[0800] MS m / z(ESI): 508.6 [M+1] + .

[0801] Step 8

[0802] 2-((6-((5-chloro-2-(4-((1r,3r)-3-(3-(2,6-dioxopiperidin-3-yl)-1-methyl-1H,7H-spiro[furano[3,2-g]indazole-6,4'-piperidin]-1'-yl)cyclobutoxy)piperidin-1-yl)pyrimidin-4-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide 17

[0803] Compound 17 g of trifluoroacetate (5 g, 8.04 mmol) was dissolved in dimethyl sulfoxide (10 mL), and N,N-diisopropylethylamine (10.2 g, 78.8 mmol, Adamas) and compound 2b (3.3 g, 7.86 mmol) were added. The mixture was heated to 60 °C and reacted for 3 hours. After cooling to room temperature, the mixture was poured into water, and a solid precipitated. The solid residue was filtered and purified by column chromatography using eluent system A to give title compound 17 (1.37 g, yield: 18.8%).

[0804] MS m / z(ESI): 908.1 [M+1] + .

[0805] 1 H NMR (500MHz, DMSO): δ10.89(s,1H),8.84(s,1H),8.05(s,1H),7.99–7.93(m,2H),7.70(s,2H),7.20(d,1H),7.04–6.97(m ,2H),4.57–4.55(m,4H),4.32(dd,1H),4.22–4.18(m,1H),4.14–4.11(m,2H),4.08(s,3H),3.56–3.52(m,1H),3.26–3.22( m,3H),2.89–2.87(m,2H),2.84–2.80(m,1H),2.69(d,3H),2.61–2.55(m,1H),2.35–2.29(m,1H),2.21–2.13(m,2H),2.03– 1.97(m,3H),1.94–1.89(m,2H),1.85–1.75(m,4H),1.69–1.67(m,2H),1.58(d,6H),1.48–1.45(m,1H),1.41–1.36(m,2H).

[0806] Examples 17-1, 17-2

[0807] 2-((6-((5-chloro-2-(4-((1S,3r)-3-(3-((S)-2,6-dioxopiperidin-3-yl)-1-methyl-1H,7H-spiro[furano[3,2-g]indazole-6,4'-piperidin]-1'-yl)cyclobutoxy)piperidin-1-yl)pyrimidin-4-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide 17-1

[0808] 2-((6-((5-chloro-2-(4-((1R,3r)-3-(3-((R)-2,6-dioxopiperidin-3-yl)-1-methyl-1H,7H-spiro[furano[3,2-g]indazole-6,4'-piperidin]-1'-yl)cyclobutoxy)piperidin-1-yl)pyrimidin-4-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide 17-2

[0809] Compound 17 (50 mg) was resolved by a chiral column (Shimadzu LC-20AP, column: ChiralPak IE, 5 μm, 20 mm × 250 mm; mobile phase A: acetonitrile, mobile phase B: ethanol, gradient ratio: A:B = 40:60, flow rate: 20 mL / min) to give title compounds 17-1 (16 mg, yield: 32.0%) and 17-2 (13 mg, yield: 26.0%).

[0810] Monomorphic compound 17-2 (shorter retention time): (13 mg, yield: 26.0%).

[0811] MS m / z(ESI): 908.1 [M+1] + .

[0812] Chiral HPLC analysis: retention time 9.008 min (column: ChiralPak IE, 4.6×150 mm, 5 μm; mobile phase A: acetonitrile, mobile phase B: ethanol (0.1% diethylamine), gradient ratio: A:B = 40:60, flow rate: 1.0 mL / min).

[0813] 1H NMR (500MHz, DMSO-d6): δ10.85(s,1H),8.80(s,1H),8.05(s,1H),7.98–7.93(m,2H),7.71(s,2H),7.20(d,1H),7.04–6.97 (m,2H),4.57–4.55(m,4H),4.32(dd,1H),4.22–4.18(m,1H),4.14–4.11(m,2H),4.08(s,3H),3.56–3.52(m,1H),3.26–3.22 (m,3H),2.89–2.87(m,2H),2.84–2.80(m,1H),2.69(d,3H),2.60–2.53(m,1H),2.35–2.27(m,1H),2.20–2.13(m,2H),2.03 –1.97(m,3H),1.94–1.88(m,2H),1.85–1.77(m,4H),1.69–1.67(m,2H),1.59(d,6H),1.48–1.45(m,1H),1.41-1.36(m,2H).

[0814] Single configuration compound 17-1 (longer retention time): (16 mg, yield: 32.0%).

[0815] MS m / z(ESI): 908.1 [M+1] + .

[0816] Chiral HPLC analysis: retention time 13.4-10 min (column: ChiralPak IE, 4.6*150mm, 5μm; mobile phase A: acetonitrile, mobile phase B: ethanol (0.1% diethylamine), gradient ratio: A:B = 40:60, flow rate: 1.0 mL / min).

[0817] 1H NMR (500MHz, DMSO-d6): δ10.89(s,1H),8.84(s,1H),8.06(s,1H),7.98–7.93(m,2H),7.70(s,2H),7.20(d,1H),7.04–6.97 (m,2H),4.57–4.55(m,4H),4.30(dd,1H),4.23–4.18(m,1H),4.14–4.10(m,2H),4.08(s,3H),3.56–3.52(m,1H),3.26–3.22 (m,3H),2.89–2.87(m,2H),2.84–2.80(m,1H),2.69(d,3H),2.61–2.50(m,1H),2.36–2.29(m,1H),2.21–2.13(m,2H),2.02 –1.97(m,3H),1.95–1.89(m,2H),1.85–1.76(m,4H),1.69–1.66(m,2H),1.59(d,6H),1.48–1.46(m,1H),1.40–1.36(m,2H).

[0818] Example 18

[0819] 2-((6-((5-chloro-2-(4-((1r,3r)-3-(7-(2,6-dioxopiperidin-3-yl)-6-oxo-7,8-dihydro-2H,6H-spiro[furano[2,3-e]isoindole-3,4'-piperidin]-1'-yl)cyclobutoxy)piperidin-1-yl)pyrimidin-4-yl)amino)-1-isopropyl-2-oxo-1,2-dihydro-1,8-naphthidin-3-yl)oxy)-N-methylacetamide18

[0820] Using the synthetic route in Example 1, the first-step compound 1a was replaced with 2-((6-amino-1-isopropyl-2-oxo-1,2-dihydro-1,8-naphthid-3-yl)oxy)-N-methylacetamide (prepared using the method disclosed in compound 103 on page 233 of patent application WO2023244917A1) to obtain title compound 18 (22 mg, yield: 24.6%).

[0821] MS m / z (ESI): 909.5 [M+1] + .

[0822] 1H NMR (500MHz, DMSO-d6): δ10.99(s,1H),9.15–9.11(m,1H),8.69–8.65(m,1H),8.31(d,1H),8.10(s,1H),7.99–7.94(m,1H),7.39–7.27(m ,2H),7.10(s,1H),5.14–5.07(m,1H),4.69–4.61(m,2H),4.59(s,2H),4.44–4.37(m,1H),4.33–4.29(m,1H),4.28–4.21(m,1H),4.15–4. 04(m,2H),3.90–3.85(m,1H),3.28–3.20(m,2H),2.98–2.87(m,3H),2.71–2.67(m,2H),2.66–2.60(m,1H),2.60–2.55(m,1H),2.46–2.41 (m,2H),2.38–2.35(m,1H),2.33–2.26(m,2H),2.12–1.95(m,6H),1.88–1.80(m,2H),1.58(d,6H),1.50–1.38(m,3H),1.32–1.27(m,2H).

[0823] Example 19

[0824] 2-((6-((5-chloro-2-(4-((3-(2,6-dioxopiperidin-3-yl)-1-methyl-1H,6H-spiro[furano[2,3-f]indazole-7,4'-piperidin]-1'-yl)methyl)piperidin-1-yl)pyrimidin-4-yl)amino)-1-methyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide 19

[0825] first step

[0826] 4-((3-(2,6-dioxopiperidin-3-yl)-1-methyl-1H,6H-spiro[furano[2,3-f]indazole-7,4'-piperidin]-1'-yl)methyl)piperidin-1-carboxylic acid tert-butyl ester 19a

[0827] Compound 6i (1 g, 2.82 mmol) and 1-tert-butoxycarbonylpiperidine-4-carboxaldehyde (655 mg, 3.07 mmol) were dissolved in 1,2-dichloroethane (20 mL) and methanol (5 mL). Sodium triacetoxyborohydride (1.08 g, 2.11 mmol) and sodium cyanoborohydride (306 mg, 5.11 mmol) were added, and the mixture was stirred for 16 hours. The reaction solution was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography using eluent system A to give title compound 19a (630 mg, yield: 44.6%).

[0828] MS m / z(ESI): 552.6 [M+1] + .

[0829] Step 2

[0830] 2-((6-((5-chloro-2-(4-((3-(2,6-dioxopiperidin-3-yl)-1-methyl-1H,6H-spiro[furano[2,3-f]indazole-7,4'-piperidin]-1'-yl)methyl)piperidin-1-yl)pyrimidin-4-yl)amino)-1-methyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide 19

[0831] Using steps 12 and 13 of the synthetic route in Example 1, the title compound 19 (400 mg, yield: 54.8%) was prepared by replacing compound 1n in step 12 with compound 19a.

[0832] MS m / z(ESI): 823.6 [M+1] + .

[0833] 1 H NMR (500MHz, DMSO-d6): δ10.84(s,1H),8.83(s,1H),8.05(s,1H),7.95(dd,2H),7.78(dd,1H ),7.53–7.45(m,2H),7.14(s,1H),6.91(s,1H),4.60(s,2H),4.51(d,2H),4.40(s,2H),4.25( dd,1H),3.95(s,3H),3.70(s,3H),2.87(d,3H),2.68(d,3H),2.65–2.53(m,3H),2.36–2.27( m,1H),2.19(d,2H),2.17–2.09(m,1H),1.99(dd,5H),1.78(d,2H),1.70(d,2H),1.05(q,2H).

[0834] Example 20

[0835] 2-((6-((5-chloro-2-(4-((3-(2,6-dioxopiperidin-3-yl)-1-methyl-1H,6H-spiro[furano[2,3-f]indazole-7,4'-piperidin]-1'-yl)methyl)piperidin-1-yl)pyrimidin-4-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide20

[0836] Using steps 12 and 13 of the synthetic route in Example 13, the title compound 20 (80 mg, yield: 42.4%) was prepared by replacing compound 13l in step 12 with compound 19a.

[0837] MS m / z (ESI): 851.6 [M+1] + .

[0838] 1 H NMR (500MHz, DMSO-d6): δ10.84(s,1H),8.81(s,1H),8.05(s,1H),7.96(dd,2H),7.76–7 .69(m,2H),7.52(s,1H),7.05(s,1H),6.91(s,1H),4.53(d,4H),4.40(s,2H),4.28–4.2 4(m,1H),3.95(s,3H),2.87(t,4H),2.68(d,3H),2.65–2.55(m,3H),2.31(dd,1H),2.20 (d,2H),2.13(dd,2H),1.98(d,4H),1.79(d,2H),1.71(s,2H),1.59(d,6H),1.07(d,2H).

[0839] Examples 21-1, 21-2

[0840] 2-((6-((5-chloro-2-(4-(((1R,3R)-3-(7-(2,6-dioxopiperidin-3-yl)-6-oxo-7,8-dihydro-2H,6H-spiro[furano[2,3-e]isoindole-3,4'-piperidin]-1'-yl)cyclopentyl)oxy)piperidin-1-yl)pyrimidin-4-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide 21-1

[0841] and

[0842] 2-((6-((5-chloro-2-(4-(((1R,3S)-3-(7-(2,6-dioxopiperidin-3-yl)-6-oxo-7,8-dihydro-2H,6H-spiro[furano[2,3-e]isoindole-3,4'-piperidin]-1'-yl)cyclopentyl)oxy)piperidin-1-yl)pyrimidin-4-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide 21-2

[0843] first step

[0844] (1S,3R)-3-hydroxycyclopentyl acetate 21b

[0845] (1R,4S)-4-hydroxycyclopent-2-en-1-yl acetate 21a (3 g, 21.11 mmol) was dissolved in ethanol (15 mL) and tetrahydrofuran (15 mL), and platinum dioxide (480 mg, 2.11 mmol, Shaoyuan) was added. The mixture was stirred for 4 hours under a hydrogen atmosphere. The reaction solution was filtered, and the filtrate was concentrated under reduced pressure to obtain crude title compound 21b (2.4 g, yield: 78.9%). The product was used directly in the next reaction without purification.

[0846] Step 2

[0847] 4-(((1R,3S)-3-acetoxycyclopentyl)oxy)piperidine-1-carboxylic acid benzyl ester 21c

[0848] Crude compound 21b (2.3 g, 15.9 mmol) was dissolved in acetonitrile (50 mL), and 1-(benzyloxycarbonyl)-4-piperidinone (5.7 g, 24.2 mmol, Shaoyuan) was added. The mixture was purged with nitrogen three times, and dimethylchlorosilane (2.78 g, 29.4 mmol, Shaoyuan) was added dropwise at 0 °C. The reaction mixture was reacted at room temperature for 12 hours. The reaction solution was concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system B to give title compound 21c (1.43 g, yield: 24.8%).

[0849] Step 3

[0850] 4-(((1R,3S)-3-hydroxycyclopentyl)oxy)piperidine-1-carboxylic acid benzyl ester 21d

[0851] Compound 21c (1.4 g, 3.87 mmol) was dissolved in tetrahydrofuran (10 mL) and water (10 mL), and lithium hydroxide (243.8 mg, 5.81 mmol) was added. The reaction mixture was reacted at room temperature for 12 hours. The reaction solution was concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system B to give the title compound 21d (680 mg, yield: 54.9%).

[0852] MS m / z(ESI): 320.2 [M+1] + .

[0853] Step 4

[0854] 4-(((1R,3S)-3-hydroxycyclopentyl)oxy)piperidine-1-carboxylic acid tert-butyl ester 21e

[0855] Compound 21d (680 mg, 2.13 mmol) was dissolved in ethanol (5 mL) and tetrahydrofuran (5 mL), and di-tert-butyl dicarbonate (697 mg, 3.19 mmol) and palladium on carbon (340 mg, 0.3 mmol) were added. The mixture was purged three times with hydrogen and reacted at room temperature for 12 hours. The reaction solution was filtered, and the filtrate was concentrated under reduced pressure to give the title compound 21e (545 mg, yield: 89.7%). The product was used directly in the next reaction without purification.

[0856] Step 5

[0857] (R)-4-((3-oxocyclopentyl)oxy)piperidine-1-carboxylic acid tert-butyl ester 21f

[0858] The crude compound 21e (545 mg, 1.9 mmol) was dissolved in dichloromethane (10 mL), and Dys-Martin oxidant (1.2 g, 2.8 mmol, BIDE) was added at 0 °C. The reaction was carried out at room temperature for 2 hours. 10 mL of saturated sodium bicarbonate solution was added, and the mixture was extracted with dichloromethane (10 mL × 3). The organic phases were combined, washed with 20 mL of saturated sodium chloride solution, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by column chromatography using eluent system B to give the title compound 21f (480 mg, yield: 88.7%).

[0859] Step 6

[0860] 4-(((1R,3R)-3-(7-(2,6-dioxopiperidin-3-yl)-6-oxo-7,8-dihydro-2H,6H-spiro[furano[2,3-e]isoindole-3,4'-piperidin]-1'-yl)cyclopentyl)oxy)piperidin-1-carboxylic acid tert-butyl ester 21g-1

[0861] and

[0862] 4-(((1R,3S)-3-(7-(2,6-dioxopiperidin-3-yl)-6-oxo-7,8-dihydro-2H,6H-spiro[furano[2,3-e]isoindole-3,4'-piperidin]-1'-yl)cyclopentyl)oxy)piperidin-1-carboxylic acid tert-butyl ester 21g-2

[0863] Compound 1m (62.7 mg, 0.17 mmol) was dissolved in methanol (1 mL) and tetrahydrofuran (5 mL). Compound 21f (50 mg, 0.17 mmol) and acetic acid (10 mg, 0.01 mmol) were added, and the mixture was reacted at room temperature for 1 hour. Sodium triacetoxyborohydride (186.9 mg, 0.88 mmol, BID) and sodium cyanoborohydride (52.7 mg, 0.88 mmol, SAO) were added, and the mixture was reacted at 45 °C for 12 hours. The reaction solution was concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system A to give a mixture of title compounds 21g-1 and 21g-2 (100 mg, yield: 91.1%).

[0864] MS m / z(ESI): 623.6 [M+1] + .

[0865] Step 7

[0866] 2-((6-((5-chloro-2-(4-((1R,3R)-3-(7-(2,6-dioxopiperidin-3-yl)-6-oxo-7,8-dihydro-2H,6H-spiro[furano[2,3-e]isoindole-3,4'-piperidin]-1'-yl)cyclopentyl)oxy)piperidin-1-yl)pyrimidin-4-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide 21-1

[0867] and

[0868] 2-((6-((5-chloro-2-(4-((1R,3S)-3-(7-(2,6-dioxopiperidin-3-yl)-6-oxo-7,8-dihydro-2H,6H-spiro[furano[2,3-e]isoindole-3,4'-piperidin]-1'-yl)cyclopentyl)oxy)piperidin-1-yl)pyrimidin-4-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide 21-2

[0869] Using the ten-to-eleven-step synthetic route of Example 5, compound 5j was replaced with a mixture of compounds 21g-1 and 21g-2, and purified by preparative high-performance liquid chromatography (Waters-2545, column: ODS-BIO C18, 30*250mm; mobile phase: aqueous phase (0.1% ammonium acetate) and acetonitrile, gradient ratio: acetonitrile 40%-50%, flow rate: 30mL / min) to obtain the title compound (9mg, yield: 4.5%) and (22mg, yield: 11.1%). Single-configuration compound (shorter retention time): (9mg, yield: 4.5%).

[0870] MS m / z(ESI): 922.5 [M+1]+ .

[0871] HPLC analysis: Retention time 3.11 min, purity: 95% (Column: ACQUITY) C18, 1.7 μm, 2.1 × 50 mm; mobile phase: water (10 mM ammonium bicarbonate), acetonitrile, gradient ratio: acetonitrile 10%-95%).

[0872] 1 H NMR (500MHz, DMSO-d6): δ10.98(s,1H),8.84(s,1H),8.05(s,1H),8.03–7.98(m,1H),7.96(s,1H),7.70(s,2H),7 .42–7.33(m,1H),7.29(d,1H),7.03(s,1H),5.12–5.03(m,1H),4.55(s,4H),4.39(d,1H),4.22(d,1H),4.19–4.04 (m,3H),3.62–3.54(m,2H),3.27–3.19(m,4H),2.98–2.84(m,2H),2.68(d,2H),2.66–2.56(m,2H),2.45–2.35(m, 2H),2.08–1.89(m,6H),1.88–1.70(m,5H),1.58(d,6H),1.50–1.43(m,1H),1.42–1.32(m,2H),1.26–1.18(m,2H).

[0873] Single-configuration compound (longer retention time): (22 mg, yield: 11.1%).

[0874] MS m / z(ESI): 922.5 [M+1] + .

[0875] HPLC analysis: Retention time 3.16 min, purity: 90% (Column: ACQUITY) C18, 1.7μm, 2.1*50mm; Mobile phase: water (10mM ammonium bicarbonate), acetonitrile, gradient ratio: acetonitrile 10%-95%).

[0876] 1H NMR (500MHz, DMSO-d6): δ10.98(s,1H),8.84(s,1H),8.07–8.01(m,2H),7.96(s,1H),7.71–7.68(m,2H),7. 38(s,1H),7.29(d,1H),7.04(s,1H),5.12–5.05(m,1H),4.55(s,4H),4.38(d,1H),4.22(d,1H),4.15–4.06 (m,3H),3.61–3.57(m,2H),3.29–3.19(m,4H),2.96–2.86(m,2H),2.70–2.57(m,4H),2.48–2.37(m,2H),2. 02–1.82(m,6H),1.81–1.62(m,5H),1.57(d,6H),1.50–1.43(m,1H),1.41–1.33(m,2H),1.29–1.15(m,2H).

[0877] Examples 22-1, 22-2

[0878] 2-((6-((5-chloro-2-(4-(((1S,3S)-3-(7-(2,6-dioxopiperidin-3-yl)-6-oxo-7,8-dihydro-2H,6H-spiro[furano[2,3-e]isoindole-3,4'-piperidin]-1'-yl)cyclopentyl)oxy)piperidin-1-yl)pyrimidin-4-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide 22-1

[0879] 2-((6-((5-chloro-2-(4-(((1S,3R)-3-(7-(2,6-dioxopiperidin-3-yl)-6-oxo-7,8-dihydro-2H,6H-spiro[furano[2,3-e]isoindole-3,4'-piperidin]-1'-yl)cyclopentyl)oxy)piperidin-1-yl)pyrimidin-4-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide 22-2

[0880] Using the synthetic routes in Examples 21-1 and 21-2, compound 21a was replaced with (1S,4R)-4-hydroxycyclopent-2-en-1-yl acetate (Shanghai Bide), and purified by high performance liquid chromatography (Waters-2545, column: ODS-BIO C18, 30×250mm; mobile phase: aqueous phase (0.1% ammonium acetate) and acetonitrile, gradient ratio: acetonitrile 40%-50%, flow rate: 30mL / min) to obtain the title compound (11mg, yield: 2.8%) and (35mg, yield: 9.0%).

[0881] Single configuration compound (shorter retention time): (11 mg, yield: 2.8%).

[0882] MS m / z(ESI): 922.3 [M+1] + .

[0883] HPLC analysis: Retention time 2.20 min, purity: 97% (Column: ACQUITY) C18, 1.7μm, 2.1*50mm; Mobile phase: water (10mM ammonium bicarbonate), acetonitrile, gradient ratio: acetonitrile 10%-95%).

[0884] 1 H NMR (500MHz, DMSO-d6): δ10.98(s,1H),8.83(s,1H),8.05(s,1H),8.00(q,1H),7.95(s,1H),7.70(s, 2H),7.39(d,1H),7.27(d,1H),7.04(s,1H),5.09(dd,1H),4.54(d,4H),4.38(d,1H),4.22(d,1H),4. 11(d,3H),3.59–3.54(m,1H),3.28–3.21(m,1H),2.91(td,3H),2.75(q,1H),2.68(d,3H),2.62–2.57 (m,1H),2.42(qd,1H),2.01–1.83(m,10H),1.68(t,2H),1.58(d,7H),1.41–1.33(m,3H),1.24(s,3H).

[0885] Single-configuration compound (longer retention time): (35 mg, yield: 9.0%).

[0886] MS m / z(ESI): 922.3 [M+1] + .

[0887] HPLC analysis: Retention time 2.27 min, purity: 90% (Column: ACQUITY) C18, 1.7μm, 2.1*50mm; Mobile phase: water (10mM ammonium bicarbonate), acetonitrile, gradient ratio: acetonitrile 10%-95%).

[0888] 1 H NMR (500MHz, DMSO-d6): δ10.98(s,1H),8.84(s,1H),8.05(s,1H),8.00(q,1H),7.96(s,1H),7.74–7.67(m, 2H),7.39(d,1H),7.28(d,1H),7.03(s,1H),5.09(dd,1H),4.54(d,4H),4.38(d,1H),4.22(d,1H),4.09(dd d,3H),3.58(dd,1H),3.28–3.21(m,1H),3.03–2.85(m,3H),2.68(d,3H),2.62–2.57(m,1H),2.42(qd,1H), 2.21(s,1H),2.04–1.90(m,6H),1.85(dq,2H),1.80–1.66(m,4H),1.58(d,7H),1.38(ddd,3H),1.24(d,3H).

[0889] Example 23

[0890] 2-((6-((5-chloro-2-(4-((1R,3r)-3-((6aR)-1-(2,6-dioxopiperidin-3-yl)-3-methyl-3,4,6a,7,9,10-hexahydropyrazino[2',1':3,4][1,4]oxazheptancyclo[5,6-g]indazol-8(6H)-yl)cyclobutoxy)piperidin-1-yl)pyrimidin-4-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide23

[0891] first step

[0892] 6-Bromo-3-iodo-1,7-dimethyl-1H-indazole 23b

[0893] 6-Bromo-3-iodo-7-methyl-1H-indazole 23a (3.19 g, 9.47 mmol, prepared by the method disclosed in Example EX61 on page 58 of patent application WO2024208187) was dissolved in tetrahydrofuran (50 mL). Potassium tert-butoxide (1.49 g, 13.28 mmol) was added at 0 °C, and the mixture was stirred for 0.5 hours while maintaining the temperature. Iodomethane (1.88 g, 13.24 mmol) was then added, and the mixture was stirred at 0 °C for 0.5 hours. The mixture was then allowed to return to room temperature and stirred for 4 hours. Water was added to the reaction mixture, and the mixture was extracted with ethyl acetate (50 mL × 3). The organic phases were combined, washed with saturated sodium chloride solution, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by column chromatography using eluent system B to give the title compound 23b (1.9 g, yield: 57.1%).

[0894] MS m / z (ESI): 350.7 [M+1] + .

[0895] Step 2

[0896] 6-Bromo-7-(bromomethyl)-3-iodo-1-methyl-1H-indazole 23c

[0897] Compound 23b (1.9 g, 5.41 mmol) was dissolved in carbon tetrachloride (20 mL), and azobisisobutyronitrile (300 mg, 1.83 mmol) and N-bromosuccinimide (1 g, 5.62 mmol) were added. The mixture was stirred at 90 °C for 10 hours. After cooling the reaction solution to room temperature, water was added, and the mixture was extracted with ethyl acetate (30 mL × 3). The organic phases were combined, washed with saturated sodium chloride solution, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by column chromatography using eluent system B to give the title compound 23c (1.92 g, yield: 82.5%).

[0898] MS m / z(ESI): 428.6 [M+1] + .

[0899] Step 3

[0900] (R)-3-(((6-bromo-3-iodo-1-methyl-1H-indazol-7-yl)methoxy)methyl)piperazine-1-carboxylic acid tert-butyl ester 23d

[0901] Compound 23c (200 mg, 465 μmol) and compound 8a (105 mg, 486 μmol) were dissolved in tetrahydrofuran (5 mL). Sodium hydride (42 mg, 1.05 mmol, 60% purity) was added at 0 °C. After stirring at room temperature for 2 hours, the mixture was quenched with saturated ammonium chloride solution. Extraction was performed with ethyl acetate (15 mL × 3). The organic phases were combined, washed with saturated sodium chloride solution, dried over anhydrous sodium sulfate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by column chromatography using eluent system B to give the title compound 23d (225 mg, yield: 85.5%).

[0902] MS m / z (ESI): 565.3 [M+1] + .

[0903] Step 4: (R)-3-(((3-(2,6-bis(benzyloxy)pyridin-3-yl)-6-bromo-1-methyl-1H-indazol-7-yl)methoxy)methyl)piperazine

[0904] -1-tert-butyl carboxylate 23e

[0905] Compound 23d (225 mg, 398 μmol) was dissolved in 1,4-dioxane (4 mL) and water (1 mL), and [1,1'-bis(diphenylphosphine)ferrocene]palladium dichloride (31 mg, 42 μmol), 2,6-bis(benzyloxy)-3-(4,4,5,5-tetramethyl-1,3,2-dioxoboropentane-2-yl)pyridine (220 mg, 527 μmol) and cesium carbonate (264 mg, 810 μmol) were added. The reaction was carried out at 100 °C for 2 hours under a nitrogen atmosphere. After cooling the reaction solution to room temperature, the mixture was filtered, the filtrate was concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system B to give the title compound 23e (282 mg, yield: 97.2%).

[0906] MS m / z(ESI): 728.5 [M+1] + .

[0907] Step 5 (R)-1-(2,6-bis(benzyloxy)pyridin-3-yl)-3-methyl-3,4,6a,7,9,10-hexahydropyrazino[2',1':3,4][1,4]oxazaheptancyclo[5,6-g]indazole-8(6H)-carboxylic acid tert-butyl ester 23f

[0908] Compound 23e (202 mg, 277 μmol) was dissolved in 1,4-dioxane (4 mL), and methanesulfonic acid (2-dicyclohexylphosphino-2',6'-diisopropoxy-1,1'-biphenyl)(2-amino-1,1'-biphenyl-2-yl)palladium(II) (49 mg, 58 μmol), 2-dicyclohexylphosphino-2',6'-diisopropoxy-1,1'-biphenyl (55 mg, 118 μmol), and cesium carbonate (275 mg, 844 μmol) were added. The reaction was carried out at 100 °C for 16 hours under a nitrogen atmosphere. After cooling the reaction solution to room temperature, it was filtered, the filtrate was concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system B to give the title compound 23f (116 mg, yield: 64.6%).

[0909] MS m / z (ESI): 648.5 [M+1] + .

[0910] Step 6

[0911] 2-((6-((5-chloro-2-(4-((1R,3r)-3-((6aR)-1-(2,6-dioxopiperidin-3-yl)-3-methyl-3,4,6a,7,9,10-hexahydropyrazino[2',1':3,4][1,4]oxazheptancyclo[5,6-g]indazol-8(6H)-yl)cyclobutoxy)piperidin-1-yl)pyrimidin-4-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide23

[0912] Using steps nine through thirteen of the synthetic route in Example 13, the title compound 23 (15 mg, yield: 9.5%) was obtained by replacing compound 13i in step nine with compound 23f.

[0913] MS m / z(ESI): 922.4 [M+1] + .

[0914] 1H NMR (500MHz, DMSO-d6): δ10.87(s,1H),8.84(s,1H),8.03(d,2H),7.95(s,1H),7.70(s,2H),7.55(dd,1H),7.04(s ,1H),6.84(d,1H),5.22(d,1H),5.10(d,1H),4.55(s,2H),4.29(dd,1H),4.21(td,1H),4.13(d,2H),4.04(s,3H), 3.83(s,1H),3.75(d,1H),3.56–3.52(m,2H),3.26–3.21(m,2H),2.91–2.83(m,1H),2.69(d,3H),2.67–2.64(m,1H ),2.60(dt,2H),2.34–2.11(m,6H),2.00(dt,3H),1.88–1.79(m,2H),1.58(d,6H),1.42–1.36(m,2H),1.24(d,3H).

[0915] Example 24

[0916] 2-((6-((5-chloro-2-(4-((1r,3r)-3-(4-(2,6-dioxopiperidin-3-yl)-7,8,8a,9,11,12-hexahydro-10H-pyrazino-[1',2':4,5][1,4]diazaheptanecyclo[3,2,1-hi]indazol-10-yl)cyclobutoxy)piperidin-1-yl)pyrimidin-4-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide 24

[0917] first step

[0918] 3-(2-hydroxyethyl)-4-(2,2,2-trifluoroacetyl)piperazine-1-carboxylic acid tert-butyl ester 24b

[0919] 3-(2-hydroxyethyl)piperazine-1-carboxylic acid tert-butyl ester 24a (5 g, 21.71 mmol, Acon) was dissolved in acetonitrile (50 mL), and ethyl 2,2,2-trifluoroacetate (4.01 g, 28.22 mmol, Shaoyuan) and triethylamine (2.2 g, 21.74 mmol, Sinopharm) were added. The reaction mixture was reacted at 90 °C for 16 hours. The reaction solution was cooled to room temperature, concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system B to give the title compound 24b (3.5 g, yield: 49.4%).

[0920] MS m / z(ESI): 327.2 [M+1] + .

[0921] Step 2

[0922] 3-(2-(7-bromo-3-iodo-1H-indazol-1-yl)ethyl)-4-(2,2,2-trifluoroacetyl)piperazine-1-carboxylic acid tert-butyl ester 24d

[0923] Compound 7-bromo-3-iodo-1H-indazole 24c (4 g, 12.39 mmol) was dissolved in tetrahydrofuran (60 mL), and compound 24b (4.04 g, 12.38 mmol), triphenylphosphine (6.5 g, 24.78 mmol, Adamas), and diisopropyl azodicarboxylate (5.01 g, 24.78 mmol, Adamas) were added. The reaction mixture was reacted at room temperature for 12 hours. The reaction solution was concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system B to give the title compound 24d (3.7 g, yield: 47.3%).

[0924] MS m / z(ESI): 631.0 [M+1] + .

[0925] Step 3

[0926] 2-((6-((5-chloro-2-(4-((1r,3r)-3-(4-(2,6-dioxopiperidin-3-yl)-7,8,8a,9,11,12-hexahydro-10H-pyrazino-[1',2':4,5][1,4]diazaheptanecyclo[3,2,1-hi]indazol-10-yl)cyclobutoxy)piperidin-1-yl)pyrimidin-4-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide 24

[0927] Using the synthetic route from step 3 to step 10 in Example 8, starting compound 8c was replaced with starting compound 24d to obtain title compound 24 (59 mg, yield: 35.7%).

[0928] MS m / z(ESI): 893.1 [M+1] + .

[0929] 1H NMR (500MHz, DMSO-d6): δ10.89(s,1H),8.91(s,1H),8.07-7.96(m,3H),7.71-7.66(m,2H),7.25-7.1 9(m,1H),7.03(s,1H),6.99-6.97(m,1H),6.78-6.76(m,1H),5.34-5.32(m,1H),4.70-4.65(m,1H),4. 55(s,2H),4.46-4.45(m,1H),4.34-4.29(m,2H),4.15-4.11(m,2H),3.79-3.58(m,6H),3.31-3.24(m ,3H),2.69-2.53(m,5H),2.31-2.18(m,5H),2.09-1.97(m,5H),1.59-1.57(m,4H),1.28-1.24(m,6H).

[0930] Example 25

[0931] 2-((6-((5-chloro-2-(4-((3-(2,6-dioxopiperidin-3-yl)-1-methyl-1H,7H-spiro[furano[3,2-g]indazole-6,4'-piperidin]-1'-yl)methyl)piperidin-1-yl)pyrimidin-4-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide 25

[0932] first step

[0933] 4-((3-(2,6-dioxopiperidin-3-yl)-1-methyl-1H,7H-spiro[furano[3,2-g]indazole-6,4'-piperidin]-1'-yl)methyl)piperidin-1-carboxylic acid tert-butyl ester 25a

[0934] Compound 17e (389 mg, 1.10 mmol) and 1-tert-butoxycarbonylpiperidine-4-carboxaldehyde (281 mg, 2.19 mmol, Biot) were dissolved in 1,2-dichloroethane (15 mL), and sodium triacetoxyborohydride (465 mg, 2.19 mmol, Shaoyuan) and sodium cyanoborohydride (131 mg, 2.19 mmol, Shaoyuan) were added. The mixture was stirred for 16 hours, and the reaction solution was concentrated under reduced pressure. The residue was purified by silica gel column chromatography with eluent system A to give title compound 25a (600 mg, yield: 99%).

[0935] MS m / z (ESI): 552.3 [M+1] + .

[0936] Step 2

[0937] 2-((6-((5-chloro-2-(4-((3-(2,6-dioxopiperidin-3-yl)-1-methyl-1H,7H-spiro[furano[3,2-g]indazole-6,4'-piperidin]-1'-yl)methyl)piperidin-1-yl)pyrimidin-4-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide 25

[0938] Using steps 12 and 13 of the synthetic route in Example 13, the title compound 25 (230 mg, yield: 15.2%) was prepared by replacing compound 13l in step 12 with compound 25a.

[0939] MS m / z (ESI): 851.7 [M+1] + .

[0940] 1 H NMR (500MHz, DMSO-d6): δ10.89(s,1H),8.81(s,1H),8.05(s,1H),7.96(t,2H),7.77–7.6 8(m,2H),7.20(d,1H),7.04(s,1H),6.99(d,1H),4.59(s,2H),4.56(s,2H),4.52(d,2H),4 .32(dd,1H),4.08(s,2H),3.30(s,2H),2.87(t,4H),2.69(d,4H),2.63–2.52(m,2H),2.33 (dt,2H),2.17(dd,3H),1.96(t,4H),1.79(d,2H),1.67(d,2H),1.59(d,5H),1.06(d,2H).

[0941] Example 26

[0942] 2-((6-((5-chloro-2-(4-((3-(2,6-dioxopiperidin-3-yl)-1-methyl-1H,7H-spiro[furano[3,2-g]indazole-6,4'-piperidin]-1'-yl)methyl)piperidin-1-yl)pyrimidin-4-yl)amino)-1-methyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide26

[0943] Using steps 12 and 13 of the synthetic route in Example 1, the title compound 26 (103 mg, yield: 37.6%) was prepared by replacing compound 1n in step 12 with compound 25a.

[0944] MS m / z(ESI): 823.6 [M+1] + .

[0945] 1 H NMR (500MHz, DMSO-d6): δ10.89(s,1H),8.83(s,1H),8.05(s,1H),7.95(dd,2H),7.78( dd,1H),7.50(d,1H),7.20(d,1H),7.13(s,1H),6.99(d,1H),4.59(d,4H),4.51(d,2H), 4.32(dd,1H),4.08(s,3H),3.70(s,3H),2.86(t,4H),2.68(d,4H),2.63–2.53(m,2H), 2.33(ddd,2H),2.24–2.12(m,3H),1.95(d,3H),1.78(d,2H),1.67(d,2H),1.05(d,2H).

[0946] Example 27

[0947] 2-((6-((5-chloro-2-(4-((1r,3r)-3-(3-(2,6-dioxopiperidin-3-yl)-1-methyl-1H,7H-spiro[furano[3,2-g]indazole-6,4'-piperidin]-1'-yl)cyclobutoxy)piperidin-1-yl)pyrimidin-4-yl)amino)-1-isopropyl-2-oxo-1,2-dihydro-1,8-naphthidin-3-yl)oxy)-N-methylacetamide 27

[0948] first step

[0949] 2-((6-((5-chloro-2-(4-((1r,3r)-3-(3-(2,6-dioxopiperidin-3-yl)-1-methyl-1H,7H-spiro[furano[3,2-g]indazole-6,4'-piperidin]-1'-yl)cyclobutoxy)piperidin-1-yl)pyrimidin-4-yl)amino)-1-isopropyl-2-oxo-1,2-dihydro-1,8-naphthidin-3-yl)oxy)-N-methylacetamide 27

[0950] 17 g (460 mg, 0.91 mmol) of compound was dissolved in dimethyl sulfoxide (10 mL), and N,N-diisopropylethylamine (586 mg, 4.53 mmol, from Bismuth Substrate) and 2-((6-(((2,5-dichloropyrimidin-4-yl)amino)-1-isopropyl-2-oxo-1,2-dihydro-1,8-naphthidin-3-yl)oxo)-N-methylacetamide (381 mg, 0.91 mmol, prepared by the method disclosed in compound 103 on page 233 of patent application WO2023244917A1) were added. The mixture was heated to 60 °C and reacted for 5 hours. After cooling to room temperature, the mixture was concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system A to give title compound 27 (350 mg, yield: 42.5%).

[0951] MS m / z(ESI): 908.3 [M+1] + .

[0952] 1 H NMR (500MHz, DMSO-d6): δ10.91(s,1H),9.15(s,1H),8.73–8.63(m,1H),8.33–8.29(m,1H),8.11(s,1H),7.99–7. 95(m,1H),7.31–7.25(m,1H),7.10(s,1H),6.91–6.83(m,1H),4.70(s,2H),4.59(s,2H),4.37–4.30(m,2H),4.11 –4.07(m,4H),3.92–3.84(m,2H),3.50–3.44(m,2H),3.28–3.21(m,3H),3.02–2.94(m,2H),2.74–2.53(m,7H),2. 37–2.26(m,3H),2.20–2.09(m,3H),2.05–1.96(m,3H),1.88–1.79(m,2H),1.61–1.56(m,6H),1.44–1.38(m,2H).

[0953] Example 28

[0954] 2-((6-((5-chloro-2-(4-((1r,3r)-3-(3-(2,6-dioxopiperidin-3-yl)-1-methyl-1H,7H-spiro[furano[3,2-g]indazole-6,4'-piperidin]-1'-yl)cyclobutoxy)piperidin-1-yl)pyridin-4-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide 28

[0955] first step

[0956] 3-(1'-((1r,3r)-3-((1-(5-chloro-4-iodopyridin-2-yl)piperidin-4-yl)oxy)cyclobutyl)-1-methyl-1H,7H-spiro[furano[3,2-g]indazole-6,4'-piperidin]-3-yl)piperidin-2,6-dione 28b

[0957] 17 g (835 mg, 1.64 mmol) of compound was dissolved in dimethyl sulfoxide (18 mL), and 5-chloro-2-fluoro-4-iodopyridine 28a (1.3 g, 5.05 mmol, Bioderm) and N,N-diisopropylethylamine (1.1 g, 8.51 mmol, Sinopharm) were added. The mixture was reacted at 100 °C for 2 hours. After cooling to room temperature, the mixture was concentrated under reduced pressure. The residue was purified by column chromatography using eluent system A to give title compound 28b (610 mg, yield: 49.8%).

[0958] MS m / z (ESI): 745.4 [M+1] + .

[0959] Step 2

[0960] 2-((6-((5-chloro-2-(4-((1r,3r)-3-(3-(2,6-dioxopiperidin-3-yl)-1-methyl-1H,7H-spiro[furano[3,2-g]indazole-6,4'-piperidin]-1'-yl)cyclobutoxy)piperidin-1-yl)pyridin-4-yl)amino)-1-isopropyl-2-oxo-1,2-dihydroquinoline-3-yl)oxy)-N-methylacetamide 28

[0961] Compound 28b (200 mg, 0.27 mmol) was dissolved in 1,4-dioxane (16 mL), and cesium carbonate (176 mg, 0.54 mmol, BID), compound 2a (117 mg, 0.41 mmol), and methanesulfonic acid (2-dicyclohexylphosphino-2',6'-diisopropoxy-1,1'-biphenyl)(2-amino-1,1'-biphenyl-2-yl)palladium(II) (25 mg, 0.30 mmol) were added. The mixture was heated to 90 °C for 5 hours. After cooling to room temperature, the mixture was concentrated under reduced pressure, and the residue was purified by column chromatography using eluent system A to give the title compound 28 (15 mg, yield: 12.0%).

[0962] MS m / z(ESI): 906.6 [M+1] + .

[0963] 1H NMR (500MHz, DMSO-d6): δ10.89(s,1H),8.04(s,1H),7.94(s,2H),7.74-7.72(m,1H),7.51-7.50 (m,1H),7.39-7.37(m,1H),7.22-7.18(m,2H),7.00-6.98(m,1H),6.39(s,1H),4.56-4.53(m,4H) ,4.33-4.31(m,1H),4.15-4.07(m,4H),3.78-3.75(m,2H),3.46-3.44(m,1H),2.98-2.80(m,6H) ,2.69-2.51(m,6H),2.45-2.12(m,5H),1.99-1.66(m,8H),1.59-1.56(m,6H),1.37-1.35(m,2H).

[0964] Biological evaluation

[0965] The following test examples further describe and explain this disclosure, but these test examples are not intended to limit the scope of this disclosure.

[0966] Test Example 1: Degradation activity of the disclosed compound against BCL6 in OCI-LY1 human B-cell lymphoma.

[0967] OCI-LY1 cells (Nanjing Kebai Biotechnology, catalog number: CBP60557) were centrifuged (300g / min, 3min), the supernatant was discarded, and the cell pellet was resuspended in fresh culture medium and counted. A cell suspension with a cell density of 5E5 / mL was prepared and mixed well. 50 μL of the suspension was added to each well of a 96-well round-bottom plate, along with 187.5 μL of fresh culture medium. The plates were incubated at 37℃. The compound was prepared into a 20 mM stock solution using DMSO, and then diluted in the 96-well round-bottom plate to an initial concentration of 2.5 μM. This was followed by 4-fold dilutions with DMSO, resulting in 9 concentration points. The DMSO blank wells served as a blank control. The resulting DMSO compound solution was then diluted 50-fold: 3 μL of the DMSO compound solution was added to 147 μL of fresh culture medium and the plates were shaken for 10 min to mix. DMSO was added to each well at a concentration of 12.5 μL, with duplicates, and incubated at 37°C for 24 hours. Cell lysis was performed after 24 hours: the cell plates were removed from the 37°C incubator and centrifuged at 400 g / min for 5 min. 200 μL of supernatant was discarded from each well, and 12.5 μL of 5X lysis buffer was added to each well of the remaining cells. The cells were shaken for 5 min and then sonicated for 5 min to fully lyse the cells. The lysed cell plates were centrifuged at 800 g / min for 5 min, and the supernatant was transferred to new 96-well round-bottom plates. BCL6 protein levels were measured using the MSD method.

[0968] MSD 96-well plates (Meso Scale Discovery, catalog number: L15XA-3) were coated one day in advance with PBS buffer containing 1 μg / mL BCL6 goat-derived antibody (R&D Systems, catalog number: AF5046) and incubated overnight at 4°C. Before testing, the coating solution was discarded, and 150 μL of 5% BSA phosphate buffer was added to each well for blocking for 1 hour. The plates were washed three times with PBS + 0.05% Tween 20 wash buffer. 25 μL of lysed cell sample or BCL6 standard curve solution was added to each well, and the plates were incubated with shaking at 500 rpm for 1.5 hours. The samples were discarded, and the plates were washed three times. 25 μL of primary antibody solution containing 1 μg / mL rabbit BCL6 antibody (GeneTex, #GTX638196) was added, and the plates were incubated with shaking at 500 rpm for 1 hour. The primary antibody was discarded, and the plates were washed three times. Add 25 μL of a solution containing 1 μg / mL SULFO-TAG-labeled anti-rabbit secondary antibody (Meso Scale Discovery, #R32AB-1), and incubate at 500 rpm in the dark for 1 hour. Discard the secondary antibody, wash the plate 3 times, add 150 μL of 1X MSD detection buffer to each well, and read the signal value using a MESO SECTOR S600.

[0969] The BCL6 content in the samples was calculated based on the BCL6 standard curve. DMSO-treated wells were used as positive control wells, and blank cell lysate wells were used as negative control wells. Degradation rate % = (BCL6 content) 阳性对照孔 -BCL6 content 待测化合物孔 ) / (BCL6 content 阳性对照孔 -BCL6 content 阴性对照孔 ×100%. Using Graphpad software, curves were plotted based on the compound's concentration points and corresponding degradation rates, and the compound concentration (DC) at a degradation rate of 50% was calculated. 50 The value, Dmax%, represents the maximum degradation rate of each compound.

[0970] Table 1. Degradation activity of the disclosed compounds against BCL6 in OCI-LY1 human B-cell lymphoma.

[0971] Conclusion: The disclosed compound exhibits excellent degradation activity against BCL6 in OCI-LY1 human B-cell lymphoma.

[0972] Test Example 2: Degradation activity of the disclosed compound on BCL6 in SU-DHL-4HiBiT cells.

[0973] The degradation rate of BCL6 in SU-DHL-4HiBiT cells treated with the compound was detected by cryoluminescence, thereby evaluating the degradation activity of the compound on intracellular BCL6.

[0974] SU-DHL-4BCL6-HiBiT cells were constructed by Genewiz: The HiBiT tag sequence was knocked into the BCL6 (gene ID: 604) gene sequence of SU-DHL-4 cells (ATCC, #CRL-2957) at the insertion site before the TGA terminator. The inserted gene sequence was: GTGAGAGGCGGCTGGCGGCTGTTCAAGAAGATTAGC (HiBiT tag).

[0975] SU-DHL-4BCL6-HiBiT cells were suspended in RPMI 1640 medium containing FBS to a cell suspension with a density of 2.8E5 / mL and mixed well. 36 μL of the suspension was added to each well of a 384 cell culture plate, for a total cell count of 10,000. The plates were incubated at 37°C. A 20 mM stock solution of the compound was prepared using DMSO and then diluted with DMSO in 96-well round-bottom plates to an initial concentration of 64 μM. This was followed by 4-fold dilutions with DMSO, resulting in 9 concentration points. The resulting DMSO solution was then diluted 40-fold to obtain a 10× compound solution: 4 μL of the DMSO compound solution was added to 156 μL of medium and mixed by pipetting 10 times. 4 μL of the 10× compound solution was added to each well of the cell culture plate, in duplicate (left and right replicates), with a final DMSO concentration of 0.25%. DMSO blank wells served as a blank control, and ARV-393 160 nM wells served as a positive control. After adding the compound solution, the cell culture plate was shaken at 420 rpm for 10 minutes on a shaker to mix thoroughly. The plate was then incubated at 37°C for 24 hours. Detection was performed using the Promega Nano-Glo HiBiT Lytic Detection System kit (catalog number: N3040). LgBiT protein was diluted 1:100, and Nano-Glo HiBiT Lytic substrate was diluted 1:50 to an appropriate volume of Nano-Glo HiBiT Lytic buffer to prepare the HiBiT Lytic reagent. The mixture was inverted and allowed to stand at room temperature. The cell culture plate was removed from the incubator and equilibrated to room temperature. 40 μL of HiBiT Lytic reagent (equal to the volume of cell culture medium) was added to each well. The plate was shaken at 500 rpm for 10 minutes, then allowed to stand for 10 minutes before luminescence signal values ​​were read using Pherastar. DMSO-treated wells served as blank control wells (Max). Blank cell culture medium wells served as negative control wells, and ARV-393 160 nM-treated wells served as degradation positive control wells (Min). Degradation rate % = (signal value) 空白对照孔 -Signal value 待测化合 物孔 ) / (signal value) 空白对照孔 -Signal value 阴性对照孔 ×100%. Using Graphpad Prism software, curves were plotted based on the compound's concentration points and corresponding degradation rates, and the compound concentration (DC) at a degradation rate of 50% was calculated. 50 Value. Dmax% is the maximum degradation rate of each compound.

[0976] Table 2. Degradation activity of the disclosed compounds against BCL6 in SU-DHL-4HiBiT cells.

[0977] Conclusion: The compound disclosed herein exhibits good degradation activity against BCL6 in SU-DHL-4HiBiT cells.

[0978] Test Example 3: Inhibitory activity of the disclosed compound against the proliferation of OCI-LY1 human B-cell lymphoma.

[0979] OCI-LY1 cells (Nanjing Kebai Biotechnology, #CBP60557) were centrifuged (300g / min, 3min), the supernatant was discarded, and the cell pellet was resuspended in fresh culture medium and counted. A cell suspension with a cell density of 5E4 / mL was prepared and mixed well. 50 μL of the suspension was added to each well of a 96-well plate, along with 187.5 μL of fresh culture medium, for a total cell count of 2500. The plates were incubated at 37℃. The compound was prepared into a 20 mM stock solution using DMSO, and then diluted with DMSO in 96-well plates to an initial concentration of 10 μM (the final maximum concentration was 10 nM). This was followed by 3-fold dilutions with DMSO, resulting in a total of 9 concentration points.

[0980] The obtained DMSO solution was diluted 50-fold to obtain a 20× compound solution: 3 μL of DMSO compound solution was added to 147 μL of fresh culture medium and mixed by pipetting 15 times. The 20× compound solution was added to cell culture plates at 12.5 μL / well, in triplicate, with a final DMSO concentration of 0.1%. DMSO blank wells served as blank controls, and wells treated with the highest concentration of the positive reference compound served as positive controls. The plates were shaken at 350 rpm for 5 minutes to mix. The cell culture plates were incubated at 37°C for 5 days. On the fifth day, cell counts were performed on the DMSO-treated wells, and the dilution factor to 2500 cells per well was calculated. All cell wells were diluted to this factor and transferred to new 96-well black plates. Fresh culture medium was added to bring the total volume to 237.5 μL. The compound solution was prepared as described above and added to new black 96-well plates at the same concentration as on the first day, at 12.5 μL. The plates were incubated at 37°C for 4 days.

[0981] Cell viability was detected using the CellTiter-Glo kit (Promega, #G7573): After centrifuging the 96-well cell culture plate (300 g / min, 5 min), discard 150 μL of supernatant, add 100 μL of CTG reagent, vortex and mix for 5 min, then incubate in the dark for 10 min, and measure the bioluminescent fluorescence signal value using an EnVision microplate reader.

[0982] DMSO-treated wells served as blank control wells, and blank cell culture medium wells served as negative control wells. Inhibition rate % = (signal value) 空白对照孔 -Signal value 待测化合物孔 ) / (signal value)空白对照孔 - Signal value 阴性对照孔 ) × 100%. Use Graphpad prism software to draw an inhibition curve based on the concentrations of each compound and the corresponding inhibition rates, and calculate the compound concentration when the inhibition rate is 50%, that is, the IC 50 value. Take the maximum value of the inhibition rate of each compound as the Imax% value.

[0983] Table 3. Inhibitory activity of the compounds of the present disclosure on the proliferation of OCI-LY1 tumor cells

[0984] Conclusion: The compounds of the present disclosure have good inhibitory activity on the proliferation of OCI-LY1 tumor cells.

[0985] Test Example 4. Pharmacokinetic evaluation

[0986] 1. Abstract

[0987] Using C57 mice as test animals, the drug concentrations in plasma at different times after oral gavage (i.g.) or intravenous injection (i.v.) of the compounds of the examples were measured by LC / MS / MS method to study the pharmacokinetic behavior of the compounds of the present disclosure in C57 mice and evaluate their pharmacokinetic characteristics.

[0988] 2. Test protocol

[0989] 2.1 Test drugs [[ID=2,9]]

[0990] Compounds 9, 17, 25, 27 and 28.

[0991] 2.2 Test animals

[0992] 81 C57 mice, female, evenly divided into 9 groups. Supplied by Vital River Laboratory Animal Technology Co., Ltd. (SCXK(zhe)2024-0001 and SCXK(jing)2021-0006).

[0993] 2.3 Drug preparation

[0994] Weigh a certain amount of the test compound respectively, add 5% DMSO + 5% Tween 80 + 90% normal saline to prepare a clear and transparent solution of 0.1 mg / mL.

[0995] 2.4 Drug administration

[0996] Oral gavage: The administration dose is 2 mg / kg, and the administration volume is 20 mL / kg;

[0997] Intravenous injection: The administration dose is 1 mg / kg, and the administration volume is 10 mL / kg.

[0998] 3. Operation

[0999] Gavage: C57 mice were administered the drug by gavage (ig), and 0.1 mL of blood was collected from the orbital cavity at 0.25, 0.5, 1.0, 2.0, 4.0, 6.0, 8.0, 11.0 and 24.0 hours after administration. The blood was placed in EDTA anticoagulant tubes and centrifuged to separate the plasma.

[1000] Intravenous injection: C57 mice were administered the drug via intravenous injection (iv). At 5 minutes, 0.25 hours, 0.5 hours, 1.0 hours, 2.0 hours, 4.0 hours, 8.0 hours, 11.0 hours, and 24.0 hours after administration, 0.1 mL of blood was collected from the orbital cavity, placed in EDTA anticoagulant tubes, and the plasma was separated after centrifugation.

[1001] Plasma samples were analyzed at various time points after drug administration using LC / MS / MS.

[1002] Table 4-1. Pharmacokinetic parameters of the compounds disclosed herein in C57 mice.

[1003] Table 4-2. Pharmacokinetic parameters of the compounds disclosed herein in C57 mice.

[1004] Conclusion: The compound disclosed herein exhibits high blood concentrations and high exposure levels in C57 mice, demonstrating pharmacokinetic advantages.

Claims

A compound of the general formula (I) or a pharmaceutically acceptable salt thereof, wherein: Cy is an arbitrary ring controlled by one or more R. 8 The replacement of the four rings; is a double bond or a single bond; X is N or CR 9 ; R 9 selected from the group consisting of a hydrogen atom, a halogen, a hydroxyl group, an alkyl group, a hydroxyalkyl group, a haloalkyl group, and a cyano group; L c selected from a bond, -(CR a R b ) a -, -O-, -S-, -NR c -, -C(O)-, -C(O)NR c - and -NR c C(O)-; L is -(L A ) n -; n is an integer from 0 to 20; each L A the same or different, and each independently selected from O, S(O) v , NR c , C(O), C(O)NR c , NR c C(O), C(O)O, OC(O), alkylene, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl; each of said alkylene, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is independently optionally substituted with one or more R L ; R 1 is selected from the group consisting of hydrogen atom, alkyl, haloalkyl, hydroxyalkyl, alkoxy, haloalkoxy, alkoxyalkyl, -alkylene-NR 17 R 18 , cycloalkyl, cycloalkylalkyl, heterocyclyl, aryl, and heteroaryl; each of said alkyl, alkylene, alkoxy, alkoxyalkyl, cycloalkyl, cycloalkylalkyl, heterocyclyl, aryl, and heteroaryl is independently optionally substituted with one or more R 1a ; X 1 is N or CR 2a ; X 2 is N or CR 2b ; X 3 is N or CR 2c ; R 2a , R 2b , R 2c and R 3a are the same or different and each is independently selected from the group consisting of a hydrogen atom, halogen, alkyl, haloalkyl, hydroxyalkyl, alkoxy, haloalkoxy, cyano, hydroxy, -NR 17 R 18 , cycloalkyl and heterocyclyl; R 3 R 1 R 4a R 4b ) t R 2 R 2 ; R 4a and R 4b are the same or different and each is independently selected from the group consisting of a hydrogen atom, a halogen, an alkyl group, a haloalkyl group, a hydroxyalkyl group, an alkoxy group, a haloalkoxy group, a cyano group, and a hydroxyl group; or R 4a and R 4b together with the carbon atom to which they are attached form a cycloalkyl group or a heterocyclyl group, each independently optionally substituted with one or more R 4c groups; t is 1, 2, 3, 4, or 5; A 1 selected from NR Y , O and S; R Y is selected from the group consisting of a hydrogen atom, an alkyl group, a haloalkyl group, a hydroxyalkyl group, a cycloalkyl group, and a cycloalkylalkyl group; A 2 selected from -C(O)NR 4 R 5 , -C(O)R 6 , -C(O)OR 6 , -S(O) 1-2 R 6 , -P(O)-R 6 R 6 and -C(=NH)NH2; R 4 and R 5 are the same or different and each is independently selected from the group consisting of a hydrogen atom, an alkyl group, an alkenyl group, an alkynyl group, a haloalkyl group, a hydroxyalkyl group, an alkoxy group, a haloalkoxy group, a cycloalkyl group, a heterocyclyl group, an aryl group, and a heteroaryl group, each of said alkyl group, alkoxy group, alkenyl group, alkynyl group, cycloalkyl group, heterocyclyl group, aryl group, and heteroaryl group is independently optionally substituted with one or more R 5a ; alternatively, R 4 and R 5 together with the nitrogen atom to which they are attached form a heterocyclyl group optionally substituted with one or more R 5a ; R 6 the same or different, and each independently selected from the group consisting of a hydrogen atom, an alkyl group, an alkenyl group, an alkynyl group, a haloalkyl group, a hydroxyalkyl group, a cycloalkyl group, a heterocyclyl group, an aryl group, and a heteroaryl group, each independently optionally substituted with one or more R 6a substituents; X a is N or CR 7a ; X b is N or CR 7b ; X c is N or CR 7c ; R 7 , R 7a , R 7b and R 7c are the same or different and each independently selected from the group consisting of a hydrogen atom, halogen, alkyl, alkenyl, alkynyl, cyano, haloalkyl, hydroxyalkyl, alkoxy, alkoxyalkyl, haloalkoxy, cycloalkyl, heterocyclyl, aryl, heteroaryl, -OR 16 , -NR 17 R 18 , -alkylene-NR 17 R 18 , -C(O)R 16 , -C(O)OR 16 , -C(O)NR 17 R 18 and -S(O) v R 16 ; each R 8 , R L , R 1a , R 4c , R 5a , and R 6a are the same or different and each is independently selected from the group consisting of halogen, alkyl, alkenyl, alkynyl, haloalkyl, hydroxyalkyl, alkoxy, haloalkoxy, alkoxyalkyl, -alkylene-NR 17 R 18 , cyano, amino, hydroxyl, nitro, -OR 16 , -NR 17 R 18 , -C(O)R 16 , -C(O)OR 16 , -C(O)NR 17 R 18 , -OC(O)NR 17 R 18 , -OC(O)R 16 , -OC(O)OR 16 , -NR 19 C(O)R 16 , -NR 19 C(O)OR 16 , -C(=NR 20 )NR 17 R 18 , -S(O) v R 16 , -S(O) v NR 17 R 18 , -NR 19 S(O) v R 16 , -NR 19 S(O) v NR 17 R 18 , =O, =S, =CR 21 R 22 , cycloalkyl, heterocyclyl, aryl, and heteroaryl; wherein each of said alkyl, alkylene, alkenyl, alkynyl, alkoxy, alkoxyalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is independently optionally substituted with one or more R 0 ; R 16 , R 17 and R 18 are the same or different and each is independently selected from the group consisting of a hydrogen atom, an alkyl group, an alkenyl group, an alkynyl group, a cycloalkyl group, a heterocyclyl group, an aryl group and a heteroaryl group; wherein each of said alkyl group, alkenyl group, alkynyl group, cycloalkyl group, heterocyclyl group, aryl group and heteroaryl group is independently optionally substituted with one or more R 0 ; or R 17 and R 18 together with the nitrogen atom to which they are attached form a heterocyclyl group optionally substituted with one or more R 0 . R 19 the same or different and each independently selected from the group consisting of a hydrogen atom, an alkyl group and a cycloalkyl group; R 20 the same or different and each independently selected from the group consisting of a hydrogen atom, an alkyl group, an alkoxy group, a hydroxy group and a cycloalkyl group; R 21 and R 22 are the same or different and each is independently selected from the group consisting of a hydrogen atom, a halogen, an alkyl group, a haloalkyl group, a hydroxyalkyl group, and a cycloalkyl group; or, R 21 and R 22 together with the carbon atom to which they are attached form a cycloalkyl group; R 0 the same or different, and each independently selected from =0, =S, =CH2, =CHF, =CF2, halogen, hydroxyl, alkenyl, alkynyl, cyano, nitro, amino, -NHalkyl, -N(alkyl)2, -C(0)Oalkyl, -C(0)OH, -C(0)NH2, -C(0)NH(alkyl), -C(0)N(alkyl)2, -C(0)halogen, -C(0)alkyl, alkyl, haloalkyl, hydroxyalkyl, alkoxy, haloalkoxy, alkoxyalkyl, aminoalkyl, -S(alkyl), cycloalkyl, cycloalkylalkyl, cycloalkyloxy, heterocyclyl, heterocyclylalkyl, heterocyclyloxy, aryl, arylalkyl, aryloxy, heteroaryl, heteroarylalkyl, and heteroaryloxy; R a and R b are the same or different and each is independently selected from the group consisting of a hydrogen atom, a halogen, an alkyl group, a haloalkyl group, an alkoxy group, a hydroxyalkyl group, a cyano group, and a hydroxyl group; R c is selected from the group consisting of a hydrogen atom, an alkyl group, a haloalkyl group, a hydroxyalkyl group, a cycloalkyl group, and a cycloalkylalkyl group; a is 0, 1, 2, 3, 4, or 5; v is 0, 1, or 2. The compound of Formula (I) or a pharmaceutically acceptable salt thereof according to claim 1, wherein L is -(L A ) n -; n is 1, 2, 3, 4 or 5; each L A is the same or different, and each is independently selected from O, NH, C(O), C 1-6 alkylene, 4- to 8-membered cycloalkyl, and 4- to 8-membered heterocyclyl; each of said 4- to 8-membered cycloalkyl and 4- to 8-membered heterocyclyl is independently optionally substituted with one or more R L ; R L are the same or different, and each is independently selected from halogen, C 1-6 alkyl, C 1-6 haloalkyl, hydroxyl, and =O; Preferably, L is selected from The compound of Formula (I) according to claim 1, which is a compound of Formula (II) or a pharmaceutically acceptable salt thereof, wherein: Z 1 is N or CR Z1 ; Z 2 is N or CR Z2 ; Z 3 is N or CR Z3 ; Z 4 is N or CR Z4 ; R Z1 , R Z2 , R Z3 and R Z4 are the same or different and each is independently selected from the group consisting of a hydrogen atom, halogen, alkyl, hydroxyalkyl, haloalkyl, hydroxyl, cyano, alkoxy, alkoxyalkyl, cycloalkyl, and cycloalkylalkyl; b1, b2, b3, and b4 are each independently 0, 1, 2, 3, or 4; x1and x2are each independently 0, 1, 2, 3, or 4; L A1 selected from a bond, -O-, -C(O)-, -S(O) v -, c - and -(CR 10b R 10c ) b -; b is 0, 1, 2, 3, or 4; R 10b and R 10c are the same or different and each is independently selected from the group consisting of a hydrogen atom, halogen, alkyl, hydroxyalkyl, haloalkyl, hydroxyl, cyano, alkoxy, alkoxyalkyl, cycloalkyl, and cycloalkylalkyl; or R 10b and R 10c together with the carbon atom to which they are attached form a cycloalkyl or heterocyclyl; ring Cy, R 1 ring Cy, R 2a ring Cy, R 2b ring Cy, R 2c ring Cy, R 4 ring Cy, R 5 ring Cy, R 7 ring Cy, R L ring Cy, R c and v are as defined in claim 1. The compound of general formula (I) or pharmaceutically acceptable salt thereof according to any one of claims 1 to 3, wherein ring Cy is selected from A 1 For N or CR A1 A 2 For N or CR A2 ;R A1 and R A2 The same or different, and each independently selected from hydrogen atoms, halogens, alkyl groups, hydroxyalkyl groups, haloalkyl groups, hydroxyl groups, cyano groups, alkoxy groups, alkoxyalkyl groups, cycloalkyl groups, and cycloalkylalkyl groups; R 8a R 8b R 8c and R 8d They may be the same or different, and each is independently a hydrogen atom or R. 8 Y is selected from CR 12 R 13 O, S, NR 14 and C(O); M and M 1 Each is independently selected from bond, O, S, C(O), C(O)O, OC(O), NR m C(O)NR m and NR m C(O); R m R 11 and R 14 They may be the same or different, and each is independently selected from hydrogen atoms, alkyl, haloalkyl, hydroxyalkyl, cycloalkyl, and cycloalkylalkyl; R 12 and R 13 They may be the same or different, and each is independently selected from hydrogen atoms, halogens, alkyl groups, haloalkyl groups, and hydroxyalkyl groups; or, R 12 and R 13 Together with the adjacent carbon atom, it forms a cycloalkyl group; m1 and m2 are each independently 0, 1, 2, 3, or 4; m3 and m4 are each independently 0, 1, 2, 3, or 4; R 8 As defined in claim 1; Preferably, the ring Cy is selected from end to L or Z 1 connected. The compound of general formula (I) or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 4, wherein R 1 is selected from a hydrogen atom, C 1-6 alkyl, C 1-6 haloalkyl, C 1-6 alkoxy, C 1-6 alkyl, 3- to 6-membered cycloalkyl and 3- to 6-membered cycloalkyl C 1-6 alkyl; preferably, R 1 is C 1-6 alkyl; more preferably, R 1 is methyl or isopropyl. The compound of general formula (I) or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 5, wherein R 2a , R 2b and R 2c are the same or different and each independently selected from a hydrogen atom, a halogen and a C 1-6 alkyl group; preferably, R 2a , R 2b and R 2c are hydrogen atoms. The compound of general formula (I) or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 6, wherein R 4 and R 5 are the same or different and each independently selected from a hydrogen atom, a C 1-6 alkyl group and a 3- to 6-membered cycloalkyl group; preferably, R 4 and R 5 are the same or different and each independently a hydrogen atom or a C 1-6 alkyl group; more preferably, R 4 is a hydrogen atom and R 5 is a methyl group. The compound of general formula (I) or pharmaceutically acceptable salt thereof according to any one of claims 1 to 7, wherein R 7 is halogen; preferably, R 7 is Cl. The compound of general formula (I) or pharmaceutically acceptable salt thereof according to any one of claims 3 to 8, wherein Z 1 is N or CH; Z 2 is N or CH; Z 3 is N or CH; Z 4 is N or CH; and / or b1, b2, b3 and b4 are each independently 0 or 1; and / or x1 and x2 are 0; and / or L A1 is -O- or -CH2-. The compound of general formula (I) or pharmaceutically acceptable salt thereof according to any one of claims 1 to 9, is selected from the following compounds: A compound represented by General Formula (IIA) or a salt thereof, wherein: R w1 is a hydrogen atom or an amino protecting group; ring Cy, Z 1 ring Cy, Z 2 ring Cy, Z 3 b1, b2, b3, b4, R L x1, x2 and L A1 as defined in claim 3. a compound or salt thereof selected from the following compounds: A method of preparing a compound of general formula (II) as defined in claim 3, or a pharmaceutically acceptable salt thereof, comprising: a compound represented by General Formula (IIA) or a salt thereof and a compound represented by General Formula (IIB) or a salt thereof undergo a nucleophilic substitution reaction to obtain a compound represented by General Formula (II) or a pharmaceutically acceptable salt thereof; wherein: Z 4 is N; R LP is a leaving group; preferably, R LP is halogen, more preferably, R LP is F; ring Cy, Z 1 ring Cy, Z 2 ring Cy, Z 3 b1, b2, b3, b4, R L x1, x2, L A1 R 1 R 2a R 2b R 2c R 4 R 5 and R 7 as defined in claim 3. A pharmaceutical composition containing a compound represented by General Formula (I) or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 10, and one or more pharmaceutically acceptable carriers, diluents, or excipients. Use of a compound represented by General Formula (I) or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 10 or a pharmaceutical composition according to claim 14 in the manufacture of a medicament for inhibiting or degrading BCL6. Use of a compound represented by General Formula (I) or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 10 or a pharmaceutical composition according to claim 14 in the manufacture of a medicament for treating and / or preventing a disease or disorder mediated or dependent on BCL6. Use of a compound represented by General Formula (I) or a pharmaceutically acceptable salt thereof according to any one of claims 1 to 10 or a pharmaceutical composition according to claim 14 in the manufacture of a medicament for treating and / or preventing a tumor or an autoimmune disease; wherein the tumor is preferably selected from the group consisting of lymphoma, leukemia, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, hepatocellular carcinoma, renal cell carcinoma, bladder cancer, intestinal cancer, breast cancer, cervical cancer, colon cancer, esophageal cancer, kidney cancer, liver cancer, lung cancer, head and neck cancer, ovarian cancer, pancreatic cancer, prostate cancer, stomach cancer, melanoma, sarcoma, Ewing sarcoma, angiosarcoma, Kaposi sarcoma, liposarcoma, myosarcoma, peripheral neuroepithelioma, synovial sarcoma, glioma, astrocytoma, glioblastoma, neuroblastoma, ganglioglioma, medulloblastoma, pineal cell tumor, meningioma, meningeal sarcoma, neurofibroma, and Schwannoma, prostate cancer, endometrial cancer, testicular cancer, thyroid cancer, astrocytoma, carcinosarcoma, Hodgkin's disease, Wilms' tumor, and teratocarcinoma; more preferably selected from the group consisting of lymphoma, leukemia, breast cancer, and lung cancer.

Images