Adeno-associated virus comprising variant capsid and use thereof

Abstract

The present invention provides a novel variant AAV capsid protein, a recombinant adeno-associated virus (rAAV) virion comprising same, and a pharmaceutical composition for the prevention or treatment of retinal or liver disease, comprising the rAAV virion.

Description

Adeno-associated virus comprising a variant capsid and uses thereof

[0001] The present invention relates to adeno-associated viruses comprising mutant capsids and uses thereof.

[0002] Over the past two decades, the development of AAV capsids through modification of capsid proteins to confer increased affinity for specific tissue types or to evade AAV-neutralizing antibodies has been a major strategy. However, the isolation of AAV from natural sources, such as tissues, blood, or cultured virus preparations from other animals, remains the primary method for identifying novel AAVs suitable for clinical applications. Anti-AAV antibodies have been detected in a variety of mammalian sources, indicating a vast AAV reservoir.

[0003] AAV is one of the most effective therapeutic gene delivery vectors for gene therapy due to its low immunogenicity and non-pathogenicity. However, despite its efficient gene transfer, current clinically used AAV vectors are associated with numerous adverse events (AEs) due to pre-existing immunity to the virus and limited tissue tropism, resulting in a low therapeutic window. Therefore, the development of novel AAV vectors with improved immunogenicity and enhanced target tissue-specific gene delivery efficiency is needed.

[0004] Accordingly, the present inventors discovered a mutant AAV capsid protein with excellent liver- or retina-specific delivery efficiency, thereby completing the present invention.

[0005] The present invention provides a mutant AAV capsid protein.

[0006] Additionally, the present invention provides rAAV virions comprising a mutant AAV capsid protein.

[0007] In addition, the present invention provides a pharmaceutical composition for treating or preventing retinal diseases comprising rAAV virions.

[0008] In addition, the present invention provides a pharmaceutical composition for treating or preventing liver disease comprising rAAV virions.

[0009] Additionally, the present invention provides an isolated and purified nucleic acid comprising a nucleotide sequence encoding a variant AAV capsid protein according to the present invention.

[0010] In addition, an isolated and purified genetically modified host cell comprising a nucleic acid according to the present invention is provided.

[0011] Additionally, a recombinant adeno-associated virus 8 (rAAV8) vector comprising a mutant AAV capsid protein according to the present invention is provided.

[0012] The present disclosure provides variant AAV capsid proteins and gene products capable of being carried thereby, rAAV virions comprising the capsid proteins, pharmaceutical compositions, methods of infecting cells (e.g., retinal cells, liver cells) using rAAV virions, treating and preventing diseases (e.g., eye-related diseases, liver-related diseases), and pharmaceutical uses.

[0013] definition

[0014] The term "retinal cell" herein may refer to any of the cell types of the retina, including retinal ganglion cells; amacrine cells; horizontal cells; bipolar cells; photoreceptor cells including rods and cones; Müller glial cells; astrocytes (e.g., retinal astrocytes); and retinal pigment epithelium.

[0015] In the present invention, "liver-specific" encompasses liver tissue and / or hepatocyte-specific properties. "Liver tissue" refers to the population of cells that make up the liver. For example, cells that make up liver tissue include hepatocytes, Kupffer cells, hepatic stellate cells, vascular and endothelial cells, cholangiocytes, and supporting cells.

[0016] Liver-specific expression according to the present invention means, for example, expression specifically in liver tissue, which may mean increased specific expression in the above-mentioned hepatocytes, Kupffer cells, hepatic stellate cells, vascular and endothelial cells, cholangiocytes, and / or supporting cells. More preferably, it may mean increased specific expression in hepatocytes. As used herein, "hepatocytes" refer to parenchymal cells that are responsible for the main function of the liver, the largest internal organ in the human body. The hepatocytes are known to generate and store energy through metabolism of carbohydrates, proteins, fats, etc., to produce urea to regulate metabolism, and to play a role in detoxifying drugs or toxic substances.

[0017] "AAV" stands for adeno-associated virus and can be used to refer to the virus itself or its derivatives. Except where otherwise required, the term encompasses all subtypes and both naturally occurring and recombinant forms. The abbreviation "rAAV" refers to recombinant adeno-associated virus, also known as recombinant AAV vector (or "rAAV vector"). The term "AAV" includes AAV type 1 (AAV-1), AAV type 2 (AAV-2), AAV type 3 (AAV-3), AAV type 4 (AAV-4), AAV type 5 (AAV-5), AAV type 6 (AAV-6), AAV type 7 (AAV-7), AAV type 8 (AAV-8), AAV type 9 (AAV-9), AAV type 10 (AAV-10), AAV type 11 (AAV-11), AAV type rh74 (AAV-rh74), avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, porcine AAV, and ovine AAV. The term "AAV" also includes chimeric AAV. “Primate AAV” refers to AAV isolated and purified from a primate, “non-primate AAV” refers to AAV isolated and purified from a non-primate mammal, and “bovine AAV” refers to AAV isolated and purified from a bovine mammal (e.g., a cow).

[0018] As used herein, "rAAV vector" refers to an AAV vector comprising a polynucleotide sequence that is not of AAV origin (i.e., a polynucleotide that is heterologous to AAV), typically a sequence of interest for genetic transformation of a cell. Typically, the heterologous polynucleotide is flanked by at least one, and typically two, AAV inverted terminal repeats (ITRs). The term rAAV vector encompasses both rAAV vector particles and rAAV vector plasmids.

[0019] "AAV virus" or "AAV virus particle" or "rAAV vector particle" refers to a viral particle composed of at least one AAV capsid protein (typically all capsid proteins of wild-type AAV) and an encapsidated polynucleotide rAAV vector. If the particle comprises a heterologous polynucleotide (i.e., a polynucleotide other than the wild-type AAV genome, such as a transgene to be delivered into a mammalian cell), it is typically referred to as an "rAAV vector particle" or simply an "rAAV vector." Therefore, the production of an rAAV particle necessarily includes the production of an rAAV vector, since such vector is contained within the rAAV particle.

[0020] “Packaging” refers to a series of intracellular events that result in the production of AAV viral proteins (VPs), replication of the viral genetic sequence, and self-assembly of the particles.

[0021] The AAV "rep" and "cap" genes refer to polynucleotide sequences encoding adeno-associated virus replication and viral proteins (VP1, VP2, VP3). AAV rep and cap are referred to herein as AAV "packaging genes."

[0022] A "helper virus" for AAV refers to a virus that activates the replication (rep) gene within the packaging genome of AAV (e.g., wild-type AAV) to allow replication, production, and self-assembly of AAV genetic sequences and viral proteins in a host cell. A variety of helper viruses for AAV are known in the art, including poxviruses such as adenovirus (Ad), herpesvirus, and vaccinia virus (VV). Adenoviruses encompass many different subgroups, but adenovirus type 5 (Ad5) of subgroup C is the most commonly used. Numerous adenoviruses of human, non-human mammalian, and avian origin are known and readily available from depositories such as the ATCC. Viruses of the herpes family include, for example, herpes simplex virus (HSV) and Epstein-Barr virus (EBV), as well as cytomegalovirus (CMV) and pseudorabies virus (PRV); they are also readily available from depositories such as the ATCC.

[0023] "Helper virus function(s)" refers to the function(s) encoded in the helper virus genome that allow for replication of AAV genetic sequences, production of viral proteins, and self-assembly (along with other requirements for replication and packaging described herein). As described herein, "helper virus functions" can be provided in a number of ways, including by providing the helper virus or, for example, by providing a polynucleotide sequence with the function(s) required for a producer cell.

[0024] An "infectious" virus or viral particle comprises a polynucleotide component capable of being delivered to a cell for which the virus is tropic. This term does not necessarily imply any replication capacity of the virus. As used herein, an "infectious" virus or viral particle is one capable of accessing a target cell, infecting the target cell, and expressing a heterologous nucleic acid in the target cell. Therefore, "infectivity" refers to the ability of a viral particle to access a target cell, infect the target cell, and express a heterologous nucleic acid in the target cell. Infectivity can refer to in vitro infectivity or in vivo infectivity. Assays for counting infectious viral particles are described elsewhere in this disclosure and in the art. Viral infectivity can be expressed as the ratio of infectious viral particles to total viral particles. Total viral particles can be expressed as the number of viral genome (vg) copies. The ability of a viral particle to express a heterologous nucleic acid in a cell can be referred to as "transduction." The ability of a viral particle to express a heterologous nucleic acid in a cell can be assayed using a number of techniques, including assessment of a marker gene, such as a red fluorescent protein (RFP) assay, in which red fluorescent protein (RFP) is produced and detected and / or measured in cells infected by the viral particle (e.g., the virus comprises a nucleotide sequence encoding RFP); or measurement of the produced protein, for example, by an enzyme-linked immunosorbent assay (ELISA). Viral infectivity can be expressed as the ratio of infectious virus particles to total virus particles. Methods for determining the ratio of infectious virus particles to total virus particles are known in the art.

[0025] The term "recombinant" as applied to a polynucleotide means that the polynucleotide is the product of various combinations of cloning, restriction or ligation steps, and other procedures that result in a construct distinct from polynucleotides found in nature. A recombinant virus is a viral particle comprising a recombinant polynucleotide. The terms encompass copies of the original polynucleotide construct and progeny of the original viral construct, respectively.

[0026] A "control element" or "control sequence" is a nucleotide sequence that participates in the interaction of molecules that contribute to the functional regulation of a polynucleotide, including replication, duplication, transcription, splicing, translation, or degradation of the polynucleotide. The regulation may affect the frequency, speed, or specificity of the process and may be either stimulatory or inhibitory in nature. Control elements known in the art include, for example, transcriptional regulatory sequences such as promoters and enhancers. A promoter is a region of DNA that, under certain conditions, can bind RNA polymerase and initiate transcription of a coding region, typically located downstream (3') of the promoter.

[0027] "Operably linked" or "operably linked" refers to the juxtaposition of genetic elements in a relationship that allows them to function in the expected manner. For example, if a promoter helps initiate transcription of a coding sequence, it is operably linked to the coding region. Intermediate residues may exist between the promoter and the coding region, as long as this functional relationship is maintained.

[0028] An "expression vector" is a vector containing a region encoding a polypeptide of interest and used to achieve expression of the protein in an intended target cell. The expression vector may also further comprise control elements operably linked to the coding region to facilitate expression of the protein in the target cell. The combination of the control elements and the gene or genes operably linked thereto for expression is sometimes referred to as an "expression cassette," many of which are known and readily available in the art or can be readily constructed from readily available components in the art.

[0029] "Heterologous" means derived from an entity that is genotypically distinct from the rest of the entity being compared. For example, a polynucleotide introduced by genetic engineering techniques into a plasmid or vector derived from a different species is a heterologous polynucleotide. A promoter that is removed from the natural coding sequence and operably linked to a coding sequence that is not found linked in nature is a heterologous promoter. Thus, for example, an rAAV comprising a heterologous nucleic acid encoding a heterologous gene product is an rAAV comprising a nucleic acid that is not normally included in naturally occurring wild-type AAV, and the encoded heterologous gene product is a gene product that is not normally encoded by naturally occurring wild-type AAV. As another example, a variant AAV capsid protein comprising a heterologous peptide inserted into the GH loop of the capsid protein is a variant AAV capsid protein that includes the insertion of a peptide that is not normally included in naturally occurring wild-type AAV.

[0030] The terms "genetic modification" and "genetic modification" are used interchangeably herein to refer to a process by which a genetic element (e.g., a polynucleotide) is introduced into a cell other than by mitosis or meiosis. This element may be heterologous to the cell, or it may be an additional copy or improved version of an element already present in the cell. Genetic modification can be achieved by transfecting the cell with a recombinant plasmid or other polynucleotide through any process known in the art, such as electroporation, calcium phosphate-genetic element precipitation, polyimide polymer-genetic element precipitation, or contact with a polynucleotide-liposome complex. Genetic modification can also be achieved by transduction or infection, for example, with a DNA or RNA virus or viral vector. Typically, the genetic element is introduced into a chromosome or minichromosome of the cell; however, any alteration that alters the phenotype and / or genotype of the cell and its progeny is encompassed by this term.

[0031] A cell is said to be "stably" altered, transduced, genetically modified, or transformed with a genetic sequence if the sequence remains available to perform its function during extended in vitro culture. Generally, such cells are "genetically" altered (transgenic) in that they have introduced a genetic alteration that is heritable by the offspring of the altered cell.

[0032] The terms "polypeptide," "peptide," and "protein" are used interchangeably herein to refer to a polymer of amino acids of any length. The terms also encompass amino acid polymers that have been modified, for example, by disulfide bond formation, glycosylation, lipidation, phosphorylation, or conjugation with labeling moieties. Polypeptides, such as anti-angiogenic polypeptides, neuroprotective polypeptides, and the like, when discussed in the context of delivering a gene product to a mammalian subject, refer to the respective intact polypeptide, or any fragment or genetically engineered derivative thereof that retains the desired biochemical function of the intact protein. Similarly, nucleic acids encoding anti-angiogenic polypeptides, nucleic acids encoding neuroprotective polypeptides, and other such nucleic acids for use in delivering gene products to mammalian subjects (which may be referred to as "transgenes" that are delivered to recipient cells) include polynucleotides encoding the intact polypeptide or any fragment or genetically engineered derivative possessing the desired biochemical function.

[0033] An "isolated and purified" plasmid, nucleic acid, vector, virus, virion, host cell, or other material refers to a preparation of the material that is free of at least a portion of other components that may additionally be present in the material or similar material in which it naturally occurs or was initially prepared. Thus, for example, an isolated and purified material may be prepared using purification techniques to concentrate it from a source mixture. Concentration may be measured on an absolute basis, such as weight per volume of solution, or may be measured relative to a second, potentially interfering substance present in the source mixture. Increasing concentration of the material produces increasingly isolated and purified material. An isolated and purified plasmid, nucleic acid, vector, virus, host cell, or other material is purified in some cases, for example, to about 80% to about 90% pure, at least about 90% pure, at least about 95% pure, at least about 98% pure, or at least about 99% or more pure.

[0034] As used herein, the terms "treatment," "treating," and the like refer to obtaining a desired pharmacological and / or physiological effect. The effect may be prophylactic in that it completely or partially prevents a disease or its symptoms, and / or therapeutic in that it partially or completely cures the disease and / or side effects due to the disease. As used herein, "treatment" covers any treatment of a disease in a mammal, particularly a human, and includes (a) preventing the onset of the disease in a subject who may be predisposed to or at risk of acquiring the disease, but has not yet been diagnosed as having the disease; (b) inhibiting the disease, i.e., arresting the development of the disease; and (c) relieving the disease, i.e., causing regression of the disease.

[0035] The terms "subject," "host," "subject," and "patient" are used interchangeably herein and refer to mammals, including, but not limited to, humans and non-human primates, such as apes and humans; mammalian sport animals (e.g., horses, camels, etc.); mammalian farm animals (e.g., sheep, goats, cows, etc.); mammalian pets (dogs, cats, etc.); and rodents (e.g., mice, rats, etc.). In some cases, the subject is a human.

[0036] Before further describing the present invention, it is important to understand that the present invention is not limited to the specific embodiments described, as such variations may of course occur. Furthermore, it is important to understand that the terminology used herein is for the purpose of describing specific embodiments only and is not intended to be limiting, as the scope of the present invention will be limited only by the appended claims.

[0037] Where a range of values ​​is provided, it is understood that each intervening value between the upper and lower limits of that range and any other stated or intervening value in the stated range is encompassed by the invention to the tenth of the unit of the lower limit, unless the context clearly dictates otherwise. The upper and lower limits of such smaller ranges may independently be included within the smaller ranges and, subject to any specifically excluded limit in the stated range, are also encompassed within the invention. Where a stated range includes one or both limits, ranges excluding either or both of those included limits are also encompassed by the invention.

[0038] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are now described. All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and / or materials in connection with which they are cited.

[0039]

[0040] mutant AAV capsid proteins

[0041] The present invention provides a mutant AAV capsid protein.

[0042] In one aspect, a variant AAV capsid protein is provided comprising a heterologous peptide having an amino acid sequence represented by the following formula I.

[0043] LQ-X1-G-X2-R-X3-X4-SVL-X5-VNGQ (Formula I) (SEQ ID NO: 97)

[0044] In the above equation 1,

[0045] X1 is arginine (R) or lysine (K);

[0046] X2 is alanine (A) or valine (V);

[0047] X3 is isoleucine (I) or proline (P);

[0048] X4 is alanine (A), proline (P), or valine (V); and

[0049] X5 is aspartic acid (D) or glutamic acid (E).

[0050]

[0051] Preferably, in the above formula I, X1 may be R or K; X2 may be V; X3 may be I; X4 may be A or V; and X5 may be D or E.

[0052] In one embodiment, the heterologous peptide may comprise at least one selected from the group consisting of SEQ ID NOs: 1 to 48 set forth in Table 1 below.

[0053] In one embodiment, the nucleotide sequence encoding the peptide consisting of the amino acid sequences of SEQ ID NOs: 1 to 48 presented in Table 1 sequentially corresponds to the nucleotide sequence consisting of the base sequences of SEQ ID NOs: 49 to 96, respectively.

[0054] More preferably, the heterologous peptide may comprise LQRGVRIASVLEVNGQ (SEQ ID NO: 5) or LQKGVRIVSVLDVNGQ (SEQ ID NO: 28).

[0055]

[0056] As described above, the variant AAV capsid proteins of the present invention are modified compared to a wild-type or other reference (“parental”) AAV capsid protein. Modifications include insertions and exchanges (e.g., substitution of a contiguous amino acid stretch with another contiguous amino acid stretch).

[0057] In some cases, the variant AAV capsid proteins of the present disclosure comprise insertion of a heterologous peptide represented by Formula I at an insertion site in a surface-accessible (e.g., solvent-accessible) portion of a parental AAV capsid protein, such that when the variant capsid protein is present in an AAV virion, particularly when the AAV virion is injected, the variant capsid protein confers increased infectivity of retinal or liver cells compared to infectivity of retinal or liver cells by an AAV virion comprising the corresponding parental AAV capsid protein.

[0058] Thus, the variant AAV capsid proteins of the present disclosure, when present in AAV virions, confer an increased ability of AAV virions to cross barriers between the vitreous humor (the "vitreous") and retinal cells, including, for example, the internal limiting membrane (ILM), the extracellular matrix of the retina, the cell membranes of the retinal cells themselves, the inner nuclear layer, the outer nuclear layer, the photoreceptor layer, the ganglion cell layer, and the retinal pigment epithelium. In some cases, the retinal cells are Müller cells. Other retinal cells include amacrine cells, bipolar cells, and horizontal cells.

[0059] Additionally, the variant AAV capsid proteins of the present disclosure, when present in AAV virions, confer an increased ability of AAV virions to cross barriers between liver cells or liver tissues, including, for example, the blood-biliary barrier (BBIB).

[0060] “Corresponding parental AAV capsid protein” refers to an AAV capsid protein of the same AAV serotype without a heterologous peptide insertion.

[0061] In some cases, the variant AAV capsid comprises a single heterologous peptide insert of the heterologous peptides of SEQ ID NO: 1 to 48. Preferably, it comprises a single heterologous peptide insert of SEQ ID NO: 5 or SEQ ID NO: 28.

[0062] Alterations to the AAV capsid can also involve exchanges, such as replacing a contiguous stretch of amino acids with a heterologous peptide. Thus, the exchange involves insertion of a heterologous peptide in place of a contiguous stretch of amino acids.

[0063] In some cases, the variant AAV capsid proteins of the present disclosure comprise insertion of a heterologous peptide represented by Formula I at an insertion site in a surface-accessible (e.g., solvent-accessible) portion of a parental AAV capsid protein, such that when the variant capsid protein is present in an AAV virion, particularly when the AAV virion is injected, the variant capsid protein confers increased infectivity of retinal or liver cells compared to infectivity of retinal or liver cells by an AAV virion comprising the corresponding parental AAV capsid protein.

[0064] Thus, the variant AAV capsid proteins of the present disclosure, when present in AAV virions, confer an increased ability of AAV virions to cross barriers between the vitreous humor (the "vitreous") and retinal cells, including, for example, the internal limiting membrane (ILM), the extracellular matrix of the retina, the cell membranes of the retinal cells themselves, the inner nuclear layer, the outer nuclear layer, the photoreceptor layer, the ganglion cell layer, and the retinal pigment epithelium. In some cases, the retinal cells are Müller cells. Other retinal cells include amacrine cells, bipolar cells, and horizontal cells.

[0065] Additionally, the variant AAV capsid proteins of the present disclosure, when present in AAV virions, confer an increased ability of AAV virions to cross barriers between liver cells or liver tissues, including, for example, the blood-biliary barrier (BBIB).

[0066] "Amino acid replacement" is also referred to herein as "peptide exchange" (e.g., replacement of a contiguous amino acid stretch with a heterologous peptide). "Corresponding parental AAV capsid protein" refers to an AAV capsid protein of the same AAV serotype without the heterologous peptide. In some cases, the variant AAV capsid comprises a single heterologous peptide replacement of SEQ ID NOs: 1-48.

[0067] For the purposes of the following discussion, "insertion" refers to both insertion of a heterologous peptide without replacing an adjacent stretch of amino acids and insertion of a heterologous peptide that replaces an adjacent stretch of amino acids. The insertion site is in the GH loop or loop IV of the AAV capsid protein, for example, in a solvent-accessible portion of the GH loop or loop IV of the AAV capsid protein. For example, the insertion site may be within amino acids 411-650 of the AAV capsid protein. It may also be within amino acids 570-611 of AAV2, within amino acids 571-612 of AAV1, within amino acids 560-601 of AAV5, within amino acids 571-612 of AAV6, within amino acids 572-613 of AAV7, within amino acids 573 to 614 of AAV8, within amino acids 571 to 612 of AAV9, or within amino acids 573 to 614 of AAV10.

[0068] In some cases, the insertion site of the heterologous peptide may be between amino acids 587 and 588 of AAV2, between amino acids 590 and 591 of AAV1, between amino acids 575 and 576 of AAV5, between amino acids 590 and 591 of AAV6, between amino acids 589 and 590 of AAV7, between amino acids 590 and 591 of AAV8, between amino acids 588 and 589 of AAV9, between amino acids 588 and 589 of AAV10, or between amino acids 585 and 586 of AAV4.

[0069] Additionally, in some cases, the insertion site is between amino acids 590 and 591 of the AAV8 capsid protein, or the corresponding insertion site of AAV of another serotype.

[0070] In some cases, the replacement site is between amino acids 590 and 591 of the AAV8 capsid protein or the corresponding site in an AAV of a different serotype.

[0071] In some cases, the heterologous peptide represented by Formula I is inserted into the insertion site of the GH loop or loop IV of the capsid protein relative to the corresponding parental AAV capsid protein. In some cases, the heterologous peptide of SEQ ID NOs: 1-48 is inserted into the insertion site of the GH loop or loop IV of the capsid protein relative to the corresponding parental AAV capsid protein. For example, the insertion site can be between amino acids 590 and 591 of AAV8, or the corresponding position of a capsid subunit of another AAV serotype. It should be noted that insertion sites 590 / 591 are based on the AAV8 capsid protein. The heterologous peptide represented by Formula I can be inserted into the corresponding site of an AAV serotype other than AAV8 (e.g., AAV2, AAV9, etc.). The heterologous peptide of SEQ ID NOs: 1-48 can be inserted into the corresponding site of an AAV serotype other than AAV8 (e.g., AAV2, AAV9, etc.). One skilled in the art will recognize, based on a comparison of the amino acid sequences of the capsid proteins of various AAV serotypes, that an insertion site "corresponding to amino acids 590-591 of AAV8" will be within the capsid protein of any given AAV serotype.

[0072] For example, the insertion site may be between amino acids 590 and 591 of AAV8, represented by SEQ ID NO: 98.

[0073]

[0074] recombinant adeno-associated virus (rAAV) virions

[0075] The present invention provides a recombinant adeno-associated virus (rAAV) virion comprising (a) a variant AAV capsid protein comprising a heterologous peptide having an amino acid sequence represented by Formula I below; and (b) a heterologous nucleic acid comprising one or more nucleotide sequences encoding one or more heterologous gene products.

[0076] LQ-X1-G-X2-R-X3-X4-SVL-X5-VNGQ (Formula I) (SEQ ID NO: 97)

[0077] In the above equation 1,

[0078] X1 is arginine (R) or lysine (K);

[0079] X2 is alanine (A) or valine (V);

[0080] X3 is isoleucine (I) or proline (P);

[0081] X4 is alanine (A), proline (P), or valine (V); and

[0082] X5 is aspartic acid (D) or glutamic acid (E).

[0083]

[0084] In one embodiment, a rAAV virion of the invention comprises a capsid protein comprising an amino acid sequence having at least about 85%, at least about 90%, at least about 95%, at least about 98%, or at least about 99% amino acid sequence identity to the amino acid sequence of SEQ ID NO: 99; and an insertion of a heterologous peptide represented by Formula I at the GH loop or Loop IV relative to a corresponding parental AAV capsid protein. In some embodiments, a subject rAAV virion comprises a capsid protein comprising an amino acid sequence having at least about 85%, at least about 90%, at least about 95%, at least about 98%, or at least about 99% amino acid sequence identity to the amino acid sequence of SEQ ID NO: 99; and an insertion of a heterologous peptide represented by Formula I between amino acids 590 and 591 relative to the amino acid sequence of SEQ ID NO: 98, or at the corresponding site relative to a corresponding parental AAV capsid protein.

[0085] In one embodiment, an rAAV virion of the invention comprises a capsid protein comprising an amino acid sequence having at least about 85%, at least about 90%, at least about 95%, at least about 98%, or at least about 99% amino acid sequence identity to the amino acid sequence of SEQ ID NO: 99; and an insertion of a heterologous peptide represented by Formula I in the GH loop or loop IV relative to a corresponding parental AAV capsid protein.

[0086] The rAAV virions of the present invention exhibit increased retinal cell infectivity that is at least 5-fold, at least 10-fold, at least 15-fold, at least 20-fold, at least 25-fold, at least 50-fold, or more than 50-fold, compared to the retinal cell infectivity of AAV virions comprising the corresponding parental AAV capsid protein.

[0087] The rAAV virions of the present invention exhibit increased infectivity of liver cells / tissues by at least 5-fold, at least 10-fold, at least 15-fold, at least 20-fold, at least 25-fold, at least 50-fold, or more than 50-fold compared to the infectivity of liver cells / tissues by AAV virions comprising the corresponding parental AAV capsid protein.

[0088] The rAAV virion of the present invention may comprise a mutant AAV capsid protein in which the heterologous peptide is inserted between amino acids 590 and 591 of AAV1, between amino acids 587 and 588 of AAV2, between amino acids 585 and 586 of AAV4, between amino acids 575 and 576 of AAV5, between amino acids 590 and 591 of AAV6, between amino acids 589 and 590 of AAV7, between amino acids 590 and 591 of AAV8, between amino acids 588 and 589 of AAV9, or between amino acids 588 and 589 of AAV10.

[0089] Additionally, the heterologous peptide may be inserted at a position between amino acids corresponding to amino acid positions 590 and 591 of AAV8 having the amino acid sequence of SEQ ID NO: 98.

[0090] Additionally, the heterologous peptide may be LQRGVRIASVLEVNGQ (SEQ ID NO: 5) or LQKGVRIVSVLDVNGQ (SEQ ID NO: 28).

[0091]

[0092] gene product

[0093] The rAAV virion of the invention comprises a heterologous nucleic acid comprising nucleotides encoding one or more gene products (one or more heterologous gene products).

[0094] In one embodiment, the gene product is a polypeptide.

[0095] In one embodiment, the gene product is RNA.

[0096] In one embodiment, an rAAV virion of the invention comprises a heterologous nucleotide sequence encoding both a heterologous nucleic acid gene product and a heterologous polypeptide gene product. When the gene product is RNA, in one embodiment, the RNA gene product encodes a polypeptide. When the gene product is RNA, in one embodiment, the RNA gene product does not encode a polypeptide. In one embodiment, an rAAV virion of the invention comprises a single heterologous nucleic acid comprising a nucleotide sequence encoding a single heterologous gene product. In one embodiment, an rAAV virion of the invention comprises a single heterologous nucleic acid comprising nucleotide sequences encoding two heterologous gene products. When a single heterologous nucleic acid encodes two heterologous gene products, in some instances, the nucleotide sequences encoding the two heterologous gene products are operably linked to the same promoter. When a single heterologous nucleic acid encodes two heterologous gene products, in one embodiment, the nucleotide sequences encoding the two heterologous gene products are operably linked to two different promoters. In one embodiment, an rAAV virion of the present invention comprises a single heterologous nucleic acid comprising nucleotide sequences encoding three heterologous gene products. When a single heterologous nucleic acid encodes three heterologous gene products, in one embodiment, the nucleotide sequences encoding the three heterologous gene products are operably linked to the same promoter. When a single heterologous nucleic acid encodes three heterologous gene products, in one embodiment, the nucleotide sequences encoding the three heterologous gene products are operably linked to two or three different promoters. In one embodiment, an rAAV virion of the present invention comprises two heterologous nucleic acids, each heterologous nucleic acid comprising a nucleotide sequence encoding a heterologous gene product.

[0097] In one embodiment, the gene product is a polypeptide-encoding RNA. In one embodiment, the gene product is an interfering RNA. In one embodiment, the gene product is an aptamer. In some instances, the gene product is a polypeptide. In one embodiment, the gene product is a therapeutic polypeptide, e.g., a polypeptide that provides a clinical benefit.

[0098] interfering RNA

[0099] When the gene product is interfering RNA (RNAi), suitable RNAi includes RNAi that reduces the levels of apoptotic or angiogenic factors within the cell. For example, the RNAi may be shRNA or siRNA that reduces the levels of a gene product that induces or promotes apoptosis within the cell. Genes whose gene products induce or promote apoptosis are referred to herein as "pro-apoptotic genes," and the products (mRNA; proteins) of these genes are referred to herein as "pro-apoptotic gene products." Pro-apoptotic gene products include, for example, the gene products of Bax, Bid, Bak, and Bad.

[0100] The interfering RNA may also be directed against angiogenic products, such as vascular endothelial growth factor (VEGF); VEGF receptor-1 (VEGFR1); or VEGF receptor-2 (VEGFR2), RTP801, caspase-2, Procollagen a1(I), TANGO1, HSP47, aCP2, TGFb1, Gremlin 1, BMP-9, TROM7, Hic-5, PDGFR-b, TIMP-1, CTGF, TIMP-2, Tb4, ELF, PIGF, GRB2, RAGE, NLRC5.

[0101] polypeptide

[0102] When the gene product is a polypeptide, in some instances, the polypeptide is a polypeptide that enhances the function of a retinal cell, such as a rod or cone photoreceptor cell, a retinal ganglion cell, a Müller cell, a bipolar cell, an amacrine cell, a horizontal cell, or a retinal pigment epithelial cell. Exemplary polypeptides include, but are not limited to, neuroprotective polypeptides (e.g., glial-derived neurotrophic factor (GDNF), ciliary neurotrophic factor (CNTF), neurotrophin-4 (NT4), nerve growth factor (NGF), and neurturin (NTN)); anti-angiogenic polypeptides (e.g., soluble VEGF receptors; VEGF-binding antibodies; VEGF-binding antibody fragments (e.g., single-chain anti-VEGF antibodies); endostatin; tumstatin; angiostatin; soluble Flt polypeptides; Fc fusion proteins comprising soluble Flt polypeptides; pigment endothelial-derived factor (PEDF); soluble Tie-2 receptors; etc.); Tissue inhibitors of metalloproteinase-3 (TIMP-3); light-sensitive opsins such as rhodopsin; anti-apoptotic polypeptides (e.g., Bcl-2, Bcl-Xl; XIAP); and the like. Suitable polypeptides include, but are not limited to, glial-derived neurotrophic factor (GDNF); fibroblast growth factor; fibroblast growth factor 2; neurturin (NTN); ciliary neurotrophic factor (CNTF); nerve growth factor (NGF); neurotrophin-4 (NT4); brain-derived neurotrophic factor (BDNF); epidermal growth factor; rhodopsin; X-linked inhibitor of apoptosis; and sonic hedgehog.

[0103] Suitable polypeptides include opsins, short-wave opsins (SW-opsins), medium-wave opsins (MW-opsins), long-wave opsins (LW-opsins), rhodopsins, cone opsins, human opsins, non-human opsins, and humanized opsins.

[0104] Suitable polypeptides include light-gated ion channel polypeptides. For example, a suitable polypeptide is the light-gated ionotropic glutamate receptor (LiGluR). Expression of LiGluR in retinal ganglion cells and ON bipolar cells in the presence of a photoisomerizable compound renders the cells photoresponsive. LiGluR includes the L439C substitution. Photoisomerizable compounds include, for example, maleimide-azobenzene-glutamate 0 (MAG0460), which has a peak activity at 460 nm.

[0105] In one embodiment, the polypeptide includes, but is not limited to, retinosin, retinitis pigmentosa GTPase regulator (RGPR) interacting protein-1 (GenBank Accession Nos. Q96KN7, Q9EPQ2, and Q9GLM3), peripherin-2 (Prph2) (GenBank Accession No. NP_000313), and retinal pigment epithelium specific protein (RPE65) (GenBank Accession No. AAC39660).

[0106] In some specific embodiments, the polypeptide is a polypeptide that, when damaged or deleted, induces choroideremia, e.g., CHM (Rab escort protein 1); a polypeptide that, when damaged or deleted, induces Leber's congenital amaurosis; and a polypeptide of retinitis pigmentosa, e.g., crumbs homolog 1 (CRB1) (GenBank Accession No. CAM23328); and polypeptides that induce achromatopsia when damaged or deleted, such as, but not limited to, rod light-sensitive cGMP-gated channel subunit α (CNGA3) (GenBank Accession No. NP_001289), rod light-sensitive cGMP-gated channel β subunit (CNGB3), guanine nucleotide-binding protein (G protein), α transduction-activating polypeptide 2 (GNAT2) (ACHM4), ACHM5, L-opsin, M-opsin, and S-opsin.

[0107] Additionally, when the gene product is a polypeptide, in some cases, the polypeptide is a polypeptide that enhances the function of liver cells or liver tissue. Examples include, but are not limited to, Phenylalanine amomonia lysase (PAL), G6Pase (G6PC), ATPase copper transporting beta (ATP7B), acid alpha-glucosidase (GAA), alpha-galactosidase A (GLA), Ornithine Transcarbamylase (OTC), human factor VIII (hFVIII), human factor IX (hFIX), and low-density lipoprotein receptor (LDLR).

[0108]

[0109] regulatory sequence

[0110] In some instances, the nucleotide sequence encoding the gene product of interest is operably linked to a transcription control element. For example, in some instances, the nucleotide sequence encoding the gene product of interest is operably linked to a constitutive promoter. In other instances, the nucleotide sequence encoding the gene product of interest is operably linked to a promoter. The promoter may be a heterologous promoter, a tissue-specific promoter, a cell-specific promoter, a constitutive promoter, an inducible promoter, or any combination thereof. In one embodiment, the nucleotide sequence encoding the gene product of interest is operably linked to a tissue-specific or cell type-specific regulatory element.

[0111] Additionally, in one embodiment, the nucleotide sequence encoding the gene product of interest is operably linked to a retinal cell-specific promoter. For example, the nucleotide sequence encoding the gene product of interest is operably linked to a photoreceptor-specific regulatory element (e.g., a photoreceptor-specific promoter, a liver-specific promoter), e.g., a regulatory element that confers selective expression of the operably linked gene in photoreceptor cells. Suitable photoreceptor-specific regulatory elements include, e.g., a retinocystin promoter, a rhodopsin promoter, a rhodopsin kinase promoter, a beta-phosphodiesterase gene promoter, a retinitis pigmentosa gene promoter, a photoreceptor-internal retinoid-binding protein (IRBP) gene enhancer, and an IRBP gene promoter.

[0112] Additionally, in one embodiment, the nucleotide sequence encoding the gene product of interest is operably linked to a liver-specific promoter. For example, the nucleotide sequence encoding the gene product of interest is operably linked to a liver-specific regulatory element, e.g., a regulatory element that confers selective expression of the operably linked gene in liver tissue or liver cells. Suitable liver-specific regulatory elements include, e.g., the G6PC promoter; the LP1 promoter, the Apolipoprotein E (ApoE) promoter, the Alpha-1-Antittypsin (AAT) promoter, the Albumin promoter, and the Transthyretin (TTR) promoter.

[0113]

[0114] pharmaceutical composition

[0115] The present invention provides a pharmaceutical composition for preventing or treating retinal diseases, comprising an rAAV virion according to the present invention.

[0116] Specifically, a pharmaceutical composition for preventing or treating a retinal disease is provided, comprising (a) an AAV capsid protein or rAAV virion according to the present invention; and (b) one or more pharmaceutically acceptable carriers, diluents, excipients, or buffers.

[0117] The present invention provides a pharmaceutical composition for preventing or treating liver disease comprising an rAAV virion according to the present invention.

[0118] Specifically, a pharmaceutical composition for preventing or treating liver disease is provided, comprising (a) an AAV capsid protein or rAAV virion according to the present invention; and (b) one or more pharmaceutically acceptable carriers, diluents, excipients, or buffers.

[0119] In some embodiments, the pharmaceutical composition can comprise from 0.01 to 99% by weight of a polynucleotide (e.g., a polynucleotide encoding a VEGF inhibitor, or aflibercept) or rAAV virions in a unit dose. In some specific embodiments, the pharmaceutical composition can comprise from 0.1 to 10 x 10 of the gene product (e.g., a VEGF inhibitor, or aflibercept). 13 The pharmaceutical composition comprises a unit dose of rAAV virions. In some specific embodiments, the concentration of rAAV virions in the pharmaceutical composition is 1 × 10 per ml. 8 More than 1 × 10 per ml, typically 15 It's below a dog.

[0120] In some embodiments, cells can be transfected with any of the aforementioned rAAV virions of the present disclosure, and the cells are subsequently delivered to or transplanted into a subject.

[0121] In some embodiments, the pharmaceutical composition comprises any of the aforementioned rAAV virions of the present disclosure, wherein the polynucleotide is enveloped in the rAAV virion.

[0122] In one embodiment, an rAAV virion comprising an AAV capsid protein comprising a heterologous peptide of any one of SEQ ID NOs: 1 to 48 of the present invention is liver-specific and suitable for use in treating liver diseases.

[0123] In one embodiment, an rAAV virion comprising an AAV capsid protein comprising a heterologous peptide of any one of SEQ ID NOS: 1 to 48 of the present invention is retina-specific and suitable for use in treating retinal diseases or ophthalmic diseases.

[0124] In one embodiment, an rAAV virion comprising an AAV capsid protein comprising a heterologous peptide of SEQ ID NO: 5 or 28 of the present invention is liver-specific and is suitable for use in treating liver diseases.

[0125] In one embodiment, an rAAV virion comprising an AAV capsid protein comprising a heterologous peptide of SEQ ID NO: 5 or 28 of the present invention is retina-specific and is suitable for use in treating retinal diseases or ophthalmic diseases.

[0126] In the present invention, excipients, carriers, diluents, and buffers include any pharmaceutical preparation that can be administered without undue toxicity. Pharmaceutically acceptable excipients include, but are not limited to, liquids such as water, saline, glycerol, and ethanol. Pharmaceutically acceptable salts may be included herein, examples of which include inorganic acid salts such as hydrochlorides, hydrobromides, phosphates, sulfates, and the like; and organic acid salts such as acetates, propionates, malonates, benzoates, and the like. Additionally, auxiliary substances such as wetting or emulsifying agents, pH buffering substances, and the like may be present in such vehicles. Various pharmaceutically acceptable excipients are well known in the art and need not be discussed in detail herein. Pharmaceutically acceptable excipients are fully described in various publications, including, for example: A. Gennaro (2000) "Remington: The Science and Practice of Pharmacy", 20th edition, Lippincott, Williams, & Wilkins; Pharmaceutical Dosage Forms and Drug Delivery Systems (1999) HC Ansel et al., eds., 7 th ed., Lippincott, Williams, & Wilkins; and Handbook of Pharmaceutical Excipients (2000) AH Kibbe et al., eds., 3rd edition. Amer. Pharmaceutical Assoc.

[0127]

[0128] Dosage and treatment method

[0129] Methods for delivering gene products to retinal cells or liver and therapeutic methods

[0130] The present invention provides a method of delivering a gene product to a retinal cell or liver of a subject, the method comprising administering to the subject a target rAAV virion as described above.

[0131] The gene product may be a polypeptide as described above, or an interfering RNA (e.g., shRNA, siRNA, etc.), an aptamer, or a site-specific endonuclease (e.g., an RNA-guided endonuclease).

[0132] Delivering the gene product to retinal cells can provide a treatment for retinal diseases. The retinal cells may be photoreceptors, retinal ganglion cells, Müller cells, bipolar cells, amacrine cells, horizontal cells, or retinal pigmented epithelial cells. In some cases, the retinal cells are photoreceptor cells, such as rods or cones.

[0133] Delivering gene products to the liver may provide a treatment for liver disease. Delivery to the liver may involve targeting liver tissue, hepatocytes, liver cells, or hepatocyte cell lines.

[0134]

[0135] The present invention provides a method for treating a retinal disease, comprising administering to a subject in need thereof an effective amount of an rAAV virion of the present invention, or a composition comprising an rAAV virion of the present invention.

[0136] The target rAAV virions can be administered via intraocular injection, e.g., intravitreal injection, subretinal injection, suprachoroidal injection, or any other convenient mode or route of administration. Other convenient modes or routes of administration include, e.g., intravenous, intranasal, etc.

[0137] Ocular diseases that can be treated using the method of the present invention include, but are not limited to, acute macular neuroretinopathy; Behcet's disease; choroidal neovascularization; diabetic uveitis; histoplasmosis; macular degeneration, such as acute macular degeneration, age-related non-exudative macular degeneration, and age-related exudative macular degeneration; edema, such as macular edema, cystoid macular edema, and diabetic macular edema; multifocal choroiditis; ocular trauma affecting the posterior ocular region or location; ocular tumors; retinal disorders, such as central retinal vein occlusion, diabetic retinopathy (including proliferative diabetic retinopathy), proliferative vitreoretinopathy (PVR), retinal artery occlusive disease, retinal detachment, uveitic retinal disease; sympathetic ophthalmia; Vogt-Koyanagi-Harada (VKH) syndrome; uveal proliferation; posterior ocular conditions induced or affected by ocular laser treatment; Posterior ocular conditions induced or influenced by photodynamic therapy; photocoagulation, radiation retinopathy; epiretinal membrane disorders; branch retinal vein occlusion; anterior ischemic optic neuropathy; non-retinopathy diabetic retinal dysfunction; retinoschisis; retinitis pigmentosa; glaucoma; Usher syndrome, cone-rod dystrophy; Stargardt disease (yellow dot fundus); hereditary macular degeneration; chorioretinal degeneration; Leber's congenital amaurosis; congenital stationary night blindness; panchoroidal atrophy; Bardet-Biedl syndrome; macular telangiectasia; Leber's hereditary optic neuropathy; retinopathy of prematurity; color vision disorders including complete achromatopsia, protanopia, deuteranopia, and cyanopia; and Vietti's crystalline dystrophy.

[0138] Non-limiting methods for evaluating treatment of retinal diseases include measuring functional changes, such as changes in visual acuity (e.g., BCVA), visual field (e.g., perimetry), electrophysiological response to contrast (e.g., ERG, VEP), color vision, and / or contrast sensitivity; measuring anatomical or health changes using anatomic and / or photographic measurements, such as OCT, fundus photography, and / or autofluorescence; and measuring ocular motility (e.g., nystagmus, fixation preference, and stability). For example, one skilled in the art can readily determine an effective dose of rAAV virions by testing the effect on one or more parameters, such as visual acuity, visual field, electrophysiological response to contrast, color vision, contrast sensitivity, anatomy, retinal health and vasculature, ocular motility, fixation preference, and stability. In some instances, administering an effective amount of rAAV virions of the invention results in a decrease in the rate of loss of retinal function, anatomical integrity, or retinal health, e.g., a 2-fold, 3-fold, 4-fold, or 5-fold or more decrease in the rate of loss, and consequent disease progression, e.g., a 10-fold or more decrease in the rate of loss and consequent disease progression. In some instances, administering an effective amount of rAAV virions of the invention results in an increase in retinal function, an improvement in retinal anatomy or health, and / or stabilization of ocular motility, e.g., a 2-fold, 3-fold, 4-fold, or 5-fold or more increase in retinal function, retinal anatomy or health, and / or orbital stability, e.g., a 10-fold or more increase in retinal function, retinal anatomy or health, and / or orbital stability.

[0139]

[0140] The present invention provides a method for treating a liver disease, comprising administering to a subject in need thereof a therapeutically effective amount of an rAAV virion of the present invention, or a composition comprising an rAAV virion of the present invention, as described above.

[0141] The target rAAV virions can be administered intravenously, by intravenous route, by intrahepatic portal vein injection, or intrahepatically or intratumorally, respectively.

[0142] In particular, the treatment method according to the present invention is a method for therapeutic treatment of a disease related to hepatocytes or for treating HCC. Examples include bleeding disorders including hemophilia A, hemophilia B, von Willebrand disease, alpha-1-antitrypsin deficiency, familial hypercholesterolemia, ornithine transcarbamirase deficiency, Crigler-Najjar syndrome, Gaucher's disease, Fabry disease, Pompe's disease, Wilson's disease, Phenylketonuria (PKU), Ornithine transcarbamylase (OTC) deficiency, acute intermittent porphyria, glycogen storage disease type 1a, liver cancer including hepatocellular carcinoma, hepatoblastoma, cholangiocarcinoma, multiple sclerosis, delayed-onset autoimmune diabetes, autoimmune disorders including induction of tolerance to allogeneic transplantation involving liver, kidney, heart, and stem cells, lipoprotein lipase deficiency, diabetes mellitus, and ornithine transcarbamirase deficiency. Includes surrogate liver-specific gene therapy.

[0143] Additionally, a method for delivering a gene of interest to hepatocytes or HCC ex vivo or in vivo, particularly by gene therapy, i.e., liver-specific AAV gene therapy, is disclosed.

[0144]

[0145] A "therapeutically effective dose" can be determined through experimental and / or clinical trials and will fall within a relatively wide range. For example, for in vivo injections (i.e., subretinal injections, intravitreal injections, etc.), a therapeutically effective dose is about 10 6 About 10 15 Dog rAAV virions, e.g., about 10 8 10 inland 12 The therapeutically effective dose would be approximately 10 for in vivo injection, i.e., direct injection into the eye. 6 Dog virus genome (vg) to about 10 15 rAAV virions of canine vg, e.g., about 10 8 10 inland 12 The effective dose of rAAV virions delivered to cells for in vitro transduction is approximately 10 8 About 10 13 The effective dose of rAAV virions delivered to cells for in vitro transduction will be approximately 10 8 About 10 13 The effective dose of rAAV virions delivered to cells for in vitro transduction will be approximately 10 vg / cell to approximately 14 vg / cell. Other effective doses can be readily determined by those skilled in the art through routine studies that generate dose-response curves.

[0146] In some embodiments, more than one administration (e.g., 2, 3, 4, or more administrations) may be used to achieve a desired level of gene expression. In some instances, the one or more administrations are administered at various intervals, e.g., daily, weekly, twice monthly, monthly, every three months, every six months, annually, etc. In some instances, multiple administrations are administered over a period of 1 to 2 months, 2 to 4 months, 4 to 8 months, 8 to 12 months, 1 to 2 years, 2 to 5 years, or more than 5 years.

[0147]

[0148] Nucleic acids and host cells

[0149] The present invention provides an isolated and purified nucleic acid comprising a nucleotide sequence encoding a variant adeno-associated virus (AAV) capsid protein of the present invention as described above.

[0150] Specifically, an isolated and purified nucleic acid comprising a nucleotide sequence encoding a variant AAV capsid protein, wherein the variant AAV capsid protein comprises an insertion of a heterologous peptide in the capsid protein GH loop relative to a corresponding parent AAV capsid protein, wherein the heterologous peptide comprises an amino acid sequence of Formula 1 below.

[0151] LQ-X1-G-X2-R-X3-X4-SVL-X5-VNGQ (Formula I) (SEQ ID NO: 97)

[0152] In the above equation 1,

[0153] X1 is arginine (R) or lysine (K);

[0154] X2 is alanine (A) or valine (V);

[0155] X3 is isoleucine (I) or proline (P);

[0156] X4 is alanine (A), proline (P), or valine (V); and

[0157] X5 is aspartic acid (D) or glutamic acid (E).

[0158]

[0159] wherein the variant AAV capsid protein comprises an insertion of an amino acid of formula I in the GH loop or loop IV compared to the corresponding parental AAV capsid protein, or wherein the variant AAV capsid protein comprises a replacement of a heterologous peptide of formula I in the GH loop or loop IV compared to the corresponding parental AAV capsid protein; and when the variant capsid protein is present in an AAV virion, it provides increased infectivity of retinal or liver cells compared to the infectivity of retinal or liver cells by an AAV virion comprising the corresponding parental AAV capsid protein. The isolated nucleic acid of the subject may be an AAV vector, e.g., a recombinant AAV vector.

[0160] A variant AAV capsid protein encoded by the subject nucleic acid comprises an insertion peptide inserted into the GH loop of the AAV capsid, wherein the insertion peptide comprises a peptide of Formula I described above. Suitable insertion peptides include peptides set forth in SEQ ID NOs: 1 to 48.

[0161] In some cases, the variant AAV capsid protein encoded by the subject nucleic acid comprises a replacement of the GH loop or loop IV relative to the corresponding parent AAV capsid protein by a heterologous peptide of formula I described above, wherein a suitable heterologous peptide comprises a peptide as described above. In other cases, the variant AAV capsid protein encoded by the subject nucleic acid comprises a replacement of the GH loop or loop IV relative to the corresponding parent AAV capsid protein by a heterologous peptide of formula I described above, wherein a suitable heterologous peptide comprises a peptide as described above, a peptide of formula I described above, or a peptide of SEQ ID NO: 1 to 48, preferably LQRGVRIASVLEVNGQ (SEQ ID NO: 5) or LQKGVRIVSVLDVNGQ (SEQ ID NO: 28).

[0162] The above heterologous peptide may be inserted at a position between amino acids corresponding to amino acid positions 590 and 591 of AAV8 having the amino acid sequence of SEQ ID NO: 98.

[0163]

[0164] The present invention provides an isolated and purified genetically modified host cell containing a target nucleic acid.

[0165] The subject host cell may be an isolated and purified cell, for example, a cell in an in vitro culture. The subject host cell is useful for producing the subject rAAV virion, as described below. When the subject host cell is used to produce the subject rAAV virion, it is referred to as a "packaging cell." In some cases, the subject host cell is stably genetically modified with the subject nucleic acid. In other cases, the subject host cell is transiently genetically modified with the subject nucleic acid.

[0166] The target nucleic acid is stably or transiently introduced into the host cell using established techniques, including but not limited to electroporation, calcium phosphate precipitation, liposome-mediated transfection, etc. For stable transformation, the target nucleic acid will typically additionally include a selectable marker, such as any of several known selectable markers, such as neomycin resistance.

[0167] The subject host cell is produced by introducing the subject nucleic acid into any of a variety of cells, such as mammalian cells, including, for example, murine cells and primate cells (e.g., human cells). Suitable mammalian cells include, but are not limited to, primary cells and cell lines, wherein suitable cell lines include, but are not limited to, 293 cells, 293T cells, COS cells, HeLa cells, Vero cells, 3T3 mouse fibroblasts, C3H10T1 / 2 fibroblasts, CHO cells, and the like. Non-limiting examples of suitable host cells include, for example, HeLa cells (e.g., American Type Culture Collection (ATCC) no. CCL-2), CHO cells (e.g., ATCC nos. CRL9618, CCL61, CRL9096), 293 cells (e.g., ATCC no. CRL-1573), Vero cells, NIH 3T3 cells (e.g., ATCC no. CRL-1658), Huh-7 cells, BHK cells (e.g., ATCC no. CCL10), PC12 cells (ATCC no. CRL1721), COS cells, COS-7 cells (ATCC no. CRL1651), RAT1 cells, mouse L cells (ATCC no. CCLI.3), human embryonic kidney (HEK) cells (ATCC no. CRL1573), HLHepG2 cells, and the like. Target host cells can also be produced using baculovirus to infect insect cells, such as Sf9 cells that produce AAV.

[0168] In some cases, the subject genetically modified host cell comprises, in addition to a nucleic acid comprising a nucleotide sequence encoding the aforementioned variant AAV capsid protein, a nucleic acid comprising a nucleotide sequence encoding one or more AAV rep proteins. In other cases, the subject host cell further comprises a rAAV vector. rAAV virions can be produced using the subject host cell. Methods for producing rAAV virions can be methods known in the art.

[0169]

[0170] The present invention provides a recombinant adeno-associated virus 8 (rAAV8) vector comprising a mutant AAV capsid protein.

[0171] The recombinant AAV8 vector described above can be used to produce recombinant AAV virions of interest, as described above. Accordingly, the present disclosure provides a recombinant AAV vector capable of producing recombinant AAV virions of interest when introduced into a suitable cell.

[0172] The present invention provides a mutant AAV capsid protein that is retinal and / or liver-specific, optimized for AAV8, and exhibits excellent delivery efficiency. AAV8 vectors are actively used in clinical studies targeting retinal tissue and diseases, as well as in clinical studies targeting liver tissue and diseases. The novel AAV mutant and gene delivery system of the present invention can be utilized for the successful development of gene therapy by reducing the effective dose and increasing the safety of gene therapy through improved gene delivery efficiency in retinal tissue and / or liver tissue compared to existing AAV and AAV8 vectors of other serotypes.

[0173] Figure 1 illustrates a vector for producing an AAV capsid library prepared according to Example 1. Specifically, Figure 1a illustrates a vector backbone for amino acid insertion into the N590-T591 site in wild-type AAV8 (wtAAV8); Figure 1b illustrates a pRep-Intron vector for producing Mwt AAV.

[0174] Figure 2 shows the results of a precise analysis of the gene transfer efficiency of each modified capsid AAV library using liver organoids. Specifically, Figure 2a shows the results of analyzing the gene transfer efficiency of AAVs with modified capsids A01 to A48 in liver organoids; Figure 2b shows the results of a comparative analysis of the gene transfer efficiency of wild-type AAV8 (wtAAV8) or Mwt AAV produced with representative modified capsids AAV-A02 / A05 / A15 / A16 / A28 / A29 / A30 using liver organoids; Figure 2c shows the results of delivering / expressing the CAG-mCherry gene in wild-type AAV8 (wtAAV) or representative modified tap-seed AAV-A28 using liver organoids.

[0175] Figure 3 shows the results of a precise analysis of gene transfer efficiency by modified capsid AAV library using retinal organoids. Specifically, Figure 3a shows the results of analyzing the gene transfer efficiency of A01 to A48 modified capsid AAVs in retinal organoids; Figure 3b shows the results of quantitative analysis of mCherry gene expression 12 to 30 days after delivering the CAG-mCherry gene inside wild-type AAV8 (wtAAV8) or modified capsid AAV-A28 using retinal organoids; Figure 3c shows the results of TUNEL staining analysis to analyze the cytotoxicity of wild-type AAV8 (wtAAV8) or modified capsid AAV-A28 using retinal organoids, and Figure 3d shows the results of analyzing the types of cells expressing the mCherry gene 30 days after delivering the CAG-mCherry gene inside the wild-type AAV8 (wtAAV8) or modified capsid AAV-A28 using retinal organoids. To analyze the cells expressing the mCherry gene, the results of comparative analysis of co-localization with recoverin, a photoreceptor-specific protein, and rhodopsin are shown.

[0176] Figure 4 shows the results of a precise analysis of the delivery / expression efficiency of the mCherry reporter gene of wild-type AAV8 (wtAAV8) and a representative modified capsid AAV-A28 in HEK293T, a liver cell line (HepaRG), and a retinal cell line (ARPE-19, MIO-M1).

[0177] Figure 5 shows the results of a precise analysis of gene transfer / expression in normal or disease-mimicking mouse retina tissues by loading the CAG-mCherry gene in wild-type AAV8 (wtAAV), representative modified capsid AAV-A5, or A28. Specifically, Figure 5a shows the results of a comparative analysis of the CAG-mCherry reporter gene transfer efficiency in the subretinal administration of wild-type AAV8 (wtAAV8) and representative modified capsid AAV-A5 or AAV-A28 in normal mouse retina tissues; Figure 5b shows the results of a comparative analysis of the CAG-mCherry reporter gene transfer efficiency in the intravitreal administration of wild-type AAV8 (wtAAV8) and representative modified capsid AAV-A5 in normal mouse retina tissues; Figure 5c shows the results of a comparative analysis of the CAG-mCherry reporter gene transfer efficiency in the intravitreal administration of wild-type AAV8 (wtAAV8) and representative modified capsid AAV-A5 in RS1 disease-mimicking mouse retina tissues.

[0178] Hereinafter, preferred examples are presented to aid understanding of the present invention. However, the following examples are provided solely to facilitate understanding of the present invention and are not intended to limit the scope of the present invention.

[0179] <Example>

[0180] Example 1. Construction of plasmids for producing modified wild-type AAV.

[0181] In order to produce wild-type AAV (wtAAV) that is incapable of replicating in vivo, we aim to produce modified wtAAV (Mwt AAV) that includes a Rep gene with a stop codon inserted into the inverted terminal repeats (ITR) and a Cap gene that includes the capsid gene sequence. For this purpose, we plan to produce and utilize the pAAV ITR-Rep-Stop-Cap-ITR vector. In order to replace the Rep gene that includes the stop codon during the AAV production (packaging) step, we produce a pRep-Intron vector with an added intron. The Rep gene is expressed, but even if the Rep gene without a stop codon is packaged into Mwt AAV through recombination, we aim to exceed the packaging size limit of AAV.

[0182] To create the pAAV ITR-Rep-Stop-Cap-ITR vector, primers (Forward: ggggttttaaaagattgtga (SEQ ID NO: 100), Reverse: tcacaatcttttaaaacccc (SEQ ID NO: 101)) were constructed and cloned to insert a stop codon at position Y5 in the Rep2 (NCBI Gene ID. NC_001401.2) gene sequence, and confirmed through Sanger sequencing. To create a library of the Cap gene, a new vector was created by creating a sequence that can undergo AjuI restriction enzyme reaction at position N590 in the Cap8 gene sequence using Primer (Forward: accagcgaggaagaaatcaaaaccactaaccctgtggctacagaggaatacggtatcgtggcagataacttgcagcagcaaaacTAGTCGCGAACAGAAGCTTGGCTGTACacggctcctcaaattgg (SEQ ID NO: 102), Reverse: gtgtgaggaatcttggcccagatgggaccctgcaggtacacgtcccggttctgccagaccataccgggtaaggccccctggctgttgacagttccaatttgaggagccgtGTACAGCCAAGCTTCTGTTC (SEQ ID NO: 103)). The library of the Cap gene was constructed by oligonucleotide synthesis followed by T4 ligation to include the gene sequence below, including the gene sequence processable by AjuI (ER1951, ThermoFisherScientific) restriction enzyme, and then inserting it into N590-T591 of the Cap8 gene to construct a library vector (Fig. 1a).

[0183]

[0184]

[0185]

[0186]

[0187]

[0188] The description in this specification is expressed as AAV-Name based on the Name in Table 1.

[0189] The pRep-Intron vector was constructed as follows. To insert the 8th intron sequence of the human nebulin gene (NCBI Gene ID. NC_000002.12) into position K234 in the Rep2 (NCBI Gene ID. NC_001401.2) gene sequence, the genomic DNA of human-derived cells was PCR-amplified and purified using Primers (Forward: atggagctggtcgggtggctcgtggacaaggtaagggtctgctccattgc (SEQ ID NO: 104), Reverse: tccactgcttctccgaggtaatcccctaaatcaaaaaagagtgaaaagtt (SEQ ID NO: 105)). The purified PCR product was PCR-purified using primers (1st Forward: ctcctaacttttcactcttttttgatttaggggattacctcggagaagca (SEQ ID NO: 106), 1st Reverse: ctaatacaggacctctagtcctgcaggtttccctcagagaggttgtcctc (SEQ ID NO: 107), 2nd forward: agattggctcgaggacaacctctctgagggaaacctgcaggactagaggt (SEQ ID NO: 108), 2nd Reverse: gacagaagtggcaatggagcagacccttaccttgtccacgagccacccga (SEQ ID NO: 109)) in the pAAV2 / 8 vector, and ligated using the nebuline PCR product and the Gibson assembly method. The completed vector was confirmed by the sanger sequence using primers (Forward: acgcaggagcagaacaaaga (SEQ ID NO: 110), Reverse: taatctttcccgcattgtcc (SEQ ID NO: 111)). The pRep-Intron schematic is as shown in Figure 1b.

[0190]

[0191] Example 2. Animal cell and organoid culture

[0192] Example 2-1. Animal cell and liver organoid culture

[0193] AAV293pro (632273, Takara), HEK293FT (R70007, ThermoFisher), and MIO-M1 (Institute of Ophthalmology, UK, kindly provided by Professor G.Astrid Limb, JM.Lawrence et al.Stem Cells2007) were cultured in 10 cm cell culture plates (Corning, Cell culture dish, 430167) at 37°C in a 5% CO2 cell incubator (ThermoFisherScientific, BB15 CO2incubator, 51023121). AAV293pro, HEK293FT, cells were cultured in a medium containing high-glucose DMEM (Dulbecco's Modified Eagle Medium, Gibco, 11995-065), 10% FBS (Fetal Bovine Serum, Gibco, 12483020), and 1% P / S (Penicillin / Streptomycin, Gibco, 15140122). MIO-M1 cells were cultured in a medium containing high-glucose DMEM, 10% FBS, 1 × GlutaMax (ThermoFisherScientific, 35050061), and 1% P / S.

[0194] Liver organoids were prepared in a DM state and differentiated as described in 'SJ Mun et al., J. Hepatol. 2019', and used in experiments to analyze AAV gene transfer / expression efficiency.

[0195]

[0196] Example 2-2. Animal cell and retinal organoid culture

[0197] HepG2 (CRL-8024, ATCC), Huh7 (60104, KCLB), SKHep1 (HTB-52, ATCC), PCL / PRF / 5 (CRL-8024, ATCC) were cultured in 10 cm cell culture plates (Corning, Cell culture dish, 430167) at 37°C in a 5% CO2 cell incubator (Thermo Fisher Scientific, BB15 CO2incubator, 51023121). AAV293pro, HEK293FT, HepG2, Huh7, SKHep1 cells were cultured in a cell culture medium containing High-glucose DMEM (Dulbecco's Modified Eagle Medium, Gibco, 11995-065), 10% FBS (Fetal Bovine Serum, Gibco, 12483020), and 1% P / S (Penicillin / Streptomycin, Gibco, 15140122).

[0198] Retinal organoids were prepared by sufficiently differentiating retinal organoids for more than 120 days according to the method described in 'HJ Na et al., Int. J. Stem Cells, 2024' and used in experiments to analyze AAV gene transfer / expression efficiency.

[0199]

[0200] Example 3. Optimization of Mwt AAV production protocol

[0201] When the AAV293pro production cell line was used in a 15cm cell culture dish (Corning, Cell culture dish 430599) with ~80% cell density, Ca 2+ / PO4 3- / AAV was produced through the plasmid DNA gene injection (transfection) method. Specifically, 2.5 M CaCl2 + 3 plasmid DNA + 2x Hepes buffer solution (pH 7.05) were mixed and then delivered into AAV293pro cells to produce AAV. Helper virus (herpes virus, adenovirus, etc.) for AAV production was omitted. 3 plasmid gene injection was performed by mixing the pHelper plasmid (Takara) to replace the role of the helper virus and the pAAV ITR-Rep-Stop-Cap-ITR, pRep-Intron plasmid produced in Example 1.

[0202]

[0203] Example 4. Evaluation of Mwt AAV gene transfer efficiency through next-generation sequencing.

[0204] To measure the gene transfer efficiency of the Mwt AAV library, the base sequence of the library within the capsid gene was amplified through first, second, and third round polymerase chain reaction (PCR), and deep sequencing analysis was performed using Miseq (Illumina) next-generation sequencing (NGS). The sequence information of the primers used in the first, second, and third rounds is shown in Table 2 below.

[0205]

[0206] The first PCR amplified the library sequence using a PCR (T100, Bio-Rad) device using the KOD multi & epi protocol (Pre-denaturation; 94℃, 2 min, {Denaturation; 98℃, 10 sec, Annealing; 57℃, 10 sec, Extension; 68℃, 30 sec} x 35 cycles, Final extension; 68℃, 5 min, Hold; 12℃). The second PCR was performed using T100, Bio-Rad with KOD multi & epi protocol (Pre-denaturation; 94℃, 2 min, {Denaturation; 98℃, 10 sec, Annealing; 60℃, 10 sec, Extension; 68℃, 30 sec} x 35 cycles, Final extension; 68℃, 5 min, Hold; 12℃) to attach the third PCR primer. The third PCR was performed using KOD multi & epi protocol (Pre-denaturation; 94℃, 2 min, {Denaturation; 98℃, 10 sec, Annealing; 57℃, 10 sec, Extension; 68℃, 30 sec} x 35 cycles, Final extension; 68℃, 5 min, Hold; 12℃) to attach the third PCR primer. The results of electrophoresis confirmed that the library sequence was amplified as a single band.

[0207]

[0208] Example 5. Screening of a modified AAV capsid library using liver organoids.

[0209] To screen a liver tissue-specific Mwt AAV library, liver organoids prepared according to Example 2 were used for analysis using the gene transfer efficiency assay method of Example 4.

[0210] For liver organoids, Mwt AAV library 10 was added to differentiated DM-state liver organoids (SJ Mun et al., J. Hepatol. 2019). 6 , 10 7 10 8 After delivery of viral genomes, the delivery efficiency was analyzed (Fig. 2a).

[0211] In addition, using liver organoids, representative variant capsids AAV-A02 / A05 / A15 / A16 / A28 / A29 / A30 and wild-type AAV8 (wtAAV8) were produced in the manner of Example 3, and the transduction efficiency was precisely analyzed in the manner of Example 4 (Fig. 2b).

[0212] The analysis results confirmed that the gene transfer efficiency of the modified capsids AAV-A02 / A05 / A15 / A16 / A28 / A29 was statistically significantly improved compared to wild-type AAV8 (wtAAV) (Fig. 2b).

[0213] In addition, to analyze the gene transfer efficiency of representative variant capsid AAV-A28 and wild-type AAV8 (wtAAV8) using liver organoids, wild-type AAV8 (wtAAV8) and CAG-mCherry gene inside the representative variant capsid AAV-A28 were produced in sufficiently differentiated liver organoids, and then 1 x 10 10 1 x 10 13 Two to four weeks after virus delivery, mCherry gene expression was precisely analyzed using fluorescence microscopy (EVOS M5000, ThermoFisherScientific), confocal fluorescence microscopy (LSM900, Carl Zeiss), and mRNA RT-PCR. The results are shown in Fig. 2c.

[0214] The analysis results confirmed that the gene transfer efficiency of the representative modified capsid AAV-A28 in liver organoids was improved compared to that of wild-type AAV8 (wtAAV8) (Fig. 2c).

[0215]

[0216] Example 6. Analysis of the delivery efficiency of modified AAV capsids using retinal organoids.

[0217] To screen a retinal tissue-specific Mwt AAV library, retinal organoids prepared according to Example 2 were used for analysis using the gene transfer efficiency assay method of Example 4.

[0218] For retinal organoids, 10 Mwt AAV libraries were transfected into retinal organoids differentiated for more than 120 days (HJ Na et al., Int. J. Stem Cells, 2024). 6 , 10 7 10 8 The delivery efficiency was analyzed after delivery of viral genomes (Fig. 3a).

[0219] In addition, to compare and analyze the gene transfer efficiency of representative variant capsid AAV-A28 and wild-type AAV8 (wtAAV8) using retinal organoids, specifically, wild-type AAV8 (wtAAV8) and CAG-mCherry gene inside the representative variant capsid AAV-A28 were produced in sufficiently differentiated retinal organoids, and then 1 x 10 10 1 x 10 13 To precisely analyze the expression of the mCherry gene 2 to 4 weeks after virus delivery of vg, fluorescence microscopy (Cytation 5, BioTek) and confocal fluorescence microscopy (LSM900, Carl Zeiss) were performed. The analysis results are shown in Fig. 3b.

[0220] The analysis results confirmed that the gene transfer efficiency of the representative modified capsid AAV-A28 was improved compared to wild-type AAV8 (wtAAV8) (Fig. 3b).

[0221] Additionally, to compare the cytotoxicity of wild-type AAV8 (wtAAV8) and the representative variant capsid AAV-A28 in retinal organoids, retinal organoid frozen section samples were analyzed using TUNEL staining. The analysis results are shown in Fig. 3c.

[0222] The analysis results confirmed that the cytotoxicity of the representative modified capsid AAV-A28 did not increase compared to wild-type AAV8 (wtAAV8) (Fig. 3c).

[0223] In addition, to precisely analyze the gene transfer / expression into photoreceptors of wild-type AAV8 (wtAAV) and the representative modified capsid AAV-A28 in retinal organoids, the results of comparative analysis of co-localization of photoreceptor markers Recoverin and Rhodopsin and mCherry reporter gene expression are presented. The analysis results are as shown in Fig. 3d.

[0224] Analysis results showed that, similar to the existing wild-type AAV8 (wtAAV8), the mCherry gene expression of the representative modified capsid AAV-A28 co-localized with the recoverin and rhodopsin markers (Fig. 3d).

[0225]

[0226] Example 7. Analysis of gene transfer efficiency of representative modified AAV capsids in liver and retinal cell lines.

[0227] The transduction efficiency of wild-type AAV8 (wtAAV8) and modified capsid AAV-A28 was confirmed in HepaRG, MIO-M1, and ARPE-19 cell lines.

[0228] Specifically, 1 x 10 4 3 x 10 5HepaRG, MIO-M1, and ARPE-19 cells were plated on 48-cell culture dishes, and the CAG-mCherry gene was delivered inside the wild-type AAV8 (wtAAV) or AAV-A28 vector. After 2 to 3 days, quantitative analysis of the protein expression level of the mCherry reporter gene was performed using a fluorescence microscope and a flow cytometer (Attenue NXT, ThermoFisherScientific). The analysis results are shown in Fig. 4.

[0229] The analysis results showed that the gene transfer efficiency of the modified capsid AAV-A28 treatment group significantly increased in all cell lines compared to the existing wtAAV8 treatment group.

[0230]

[0231] Example 8. Analysis of gene transfer efficiency in normal and disease-mimicking mice by subretinal and intravitreal administration of modified AAV capsids (in vivo)

[0232] (1) Analysis of delivery efficiency in normal mouse subretinal (SR) administration of modified AAV capsids

[0233] The transduction efficiency of wild-type wtAAV8 and modified capsid AAV-A5 and AAV-A28 in subretinal administration to normal mice was compared and analyzed.

[0234] Specifically, 5 × 10 wild-type wtAAV8 and variant capsid AAV-A5 and AAV-A28 were injected into the retina of wild-type mice (WT mice). 9 After subretinal injection (SR injection) at vg / 1.5 μL, the animals were sacrificed at 8 weeks and analyzed. The entire retina was observed using SLO (Scanning Laser Ophthalmoscopy), and tissue slides were observed using a confocal microscope (LSM900, Carl Zeiss) after frozen sectioning. The results are shown in Fig. 5a.

[0235] Analysis results showed that compared to wild-type wtAAV8, administration of modified capsids AAV-A5 and AAV-A28 significantly increased mCherry gene transfer efficiency in mouse retinal tissue, and stronger fluorescent signals were observed throughout the entire tissue area.

[0236] Therefore, we confirmed that the modified capsids AAV-A5 and AAV-A28 can deliver genes broadly and efficiently throughout the retinal tissue compared to the conventional wild-type wtAAV8.

[0237] (2) Analysis of delivery efficiency in normal mice intravitreal injection (IVT) of modified AAV capsids

[0238] The transduction efficiency of wild-type wtAAV8 and modified capsid AAV-A5 in intravitreal administration to normal mice was compared and analyzed.

[0239] Specifically, 1 × 10 wild-type wtAAV8 and modified capsid AAV-A5 were injected into the retina of wild-type mice (WT mice). 9 After intravitreal injection (IVT) at vg / 1.5 μL, the animals were sacrificed and analyzed at 6 weeks. The entire retina was observed using SLO (Scanning Laser Ophthalmoscopy), and tissue slides were observed using a confocal microscope (LSM900, Carl Zeiss) after frozen sectioning. The results are shown in Fig. 5b.

[0240] The analysis results confirmed that the gene transfer efficiency in retinal tissue of the representative modified capsid AAV-A5 was improved compared to the wild-type wtAAV8.

[0241] (3) Analysis of delivery efficiency in intravitreal (IVT) administration of modified AAV capsids to disease-mimicking mice

[0242] We precisely analyzed the pattern of gene transfer / expression in retinal tissue after intravitreal administration of the representative variant capsid AAV-A5 to RS1 disease-mimicking mice.

[0243] Specifically, the representative variant capsid AAV-A5 was produced by loading the CAG-mCherry gene inside and then administered intravitreal (IVT inj.) to 5 x 10 mice for delivery into the retinal tissue of RS1 disease-mimetic mice. 9 After 8 weeks of vg / 1.5 μL, the animals were sacrificed and analyzed. The entire retina was observed using SLO (Scanning Laser Ophthalmoscopy), and tissue slides were observed using a confocal microscope (LSM900, Carl Zeiss) after cryosectioning. The analysis results are shown in Fig. 5c.

[0244] The analysis results confirmed that the mCherry reporter gene delivered by the representative modified capsid AAV-A5 in the RS1 disease mimicking mouse model was strongly expressed throughout zones 1 to 4, centered on the optic nerve.

Claims

1. A variant AAV capsid protein comprising a heterologous peptide having an amino acid sequence represented by the following formula I: LQ-X1-G-X2-R-X3-X4-SVL-X5-VNGQ (Formula I) In the above formula I, X1 is arginine (R) or lysine (K); X2 is alanine (A) or valine (V); X3 is isoleucine (I) or proline (P); X4 is alanine (A), proline (P), or valine (V); and X5 is aspartic acid (D) or glutamic acid (E).

2. In paragraph 1, X1 is R or K; X2 is V; X3 is I; X4 is A or V; and X5 is a mutant AAV capsid protein that is either D or E.

3. In the first paragraph, the heterologous peptide is LQRGVRIPSVLEVNGQ (SEQ ID NO: 1), LQRGVRIPSVLDVNGQ (SEQ ID NO: 2), LQRGVRIVSVLEVNGQ (SEQ ID NO: 3), LQRGVRIVSVLDVNGQ (SEQ ID NO: 4), LQRGVRIASVLEVNGQ (SEQ ID NO: 5), LQRGVRIASVLDVNGQ (SEQ ID NO: 6), LQRGVRPPSVLEVNGQ (SEQ ID NO: 7), LQRGVRPPSVLDVNGQ (SEQ ID NO: 8), LQRGVRPVSVLEVNGQ (SEQ ID NO: 9), LQRGVRPVSVLDVNGQ (SEQ ID NO: 10), LQRGVRPASVLEVNGQ (SEQ ID NO: 11), LQRGVRPASVLDVNGQ (SEQ ID NO: 12), LQRGARIPSVLEVNGQ (SEQ ID NO: 13), LQRGARIPSVLDVNGQ (SEQ ID NO: 14), LQRGARIVSVLEVNGQ (SEQ ID NO: 15), LQRGARIVSVLDVNGQ (SEQ ID NO: 16), LQRGARIASVLEVNGQ (SEQ ID NO: 17), LQRGARIASVLDVNGQ (SEQ ID NO: 18), LQRGARPPSVLEVNGQ (SEQ ID NO: 19), LQRGARPPSVLDVNGQ (SEQ ID NO: 20), LQRGARPVSVLEVNGQ (SEQ ID NO: 21), LQRGARPVSVLDVNGQ (SEQ ID NO: 22), LQRGARPASVLEVNGQ (SEQ ID NO: 23), LQRGARPASVLDVNGQ (SEQ ID NO: 24), LQKGVRIPSVLEVNGQ (SEQ ID NO: 25), LQKGVRIPSVLDVNGQ (SEQ ID NO: 26), LQKGVRIVSVLEVNGQ (SEQ ID NO: 27), LQKGVRIVSVLDVNGQ (SEQ ID NO: 28), LQKGVRIASVLEVNGQ (SEQ ID NO: 29), LQKGVRIASVLDVNGQ (SEQ ID NO: 30), LQKGVRPPSVLEVNGQ (SEQ ID NO: 31), LQKGVRPPSVLDVNGQ (SEQ ID NO: 32), LQKGVRPVSVLEVNGQ (SEQ ID NO: 33), LQKGVRPVSVLDVNGQ (SEQ ID NO: 34), LQKGVRPASVLEVNGQ (SEQ ID NO: 35),LQKGVRPASVLDVNGQ (SEQ ID NO: 36), LQKGARIPSVLEVNGQ (SEQ ID NO: 37), LQKGARIPSVLDVNGQ (SEQ ID NO: 38), LQKGARIVSVLEVNGQ (SEQ ID NO: 39), LQKGARIVSVLDVNGQ (SEQ ID NO: 40), LQKGARIASVLEVNGQ (SEQ ID NO: 41), LQKGARIASVLDVNGQ (SEQ ID NO: 42), LQKGARPPSVLEVNGQ (SEQ ID NO: 43), LQKGARPPSVLDVNGQ (SEQ ID NO: 44), LQKGARPVSVLEVNGQ (SEQ ID NO: 45), LQKGARPVSVLDVNGQ (SEQ ID NO: 46), LQKGARPASVLEVNGQ (SEQ ID NO: 47), and LQKGARPASVLDVNGQ (SEQ ID NO: 48). A variant AAV capsid protein comprising at least one selected from the group consisting of:

4. A mutant AAV capsid protein according to claim 1, wherein the heterologous peptide comprises LQRGVRIASVLEVNGQ (SEQ ID NO: 5) or LQKGVRIVSVLDVNGQ (SEQ ID NO: 28).

5. A variant AAV capsid protein according to claim 1, wherein the heterologous peptide is inserted at a position between amino acids corresponding to amino acid positions 590 and 591 of AAV8 having an amino acid sequence of SEQ ID NO:

50. 6.(a) A variant AAV capsid protein comprising a heterologous peptide having an amino acid sequence represented by the following formula I; and (b) a recombinant adeno-associated virus (rAAV) virion comprising a heterologous nucleic acid comprising one or more nucleotide sequences encoding one or more heterologous gene products; LQ-X1-G-X2-R-X3-X4-SVL-X5-VNGQ (Formula I) In the above equation 1, X1 is arginine (R) or lysine (K); X2 is alanine (A) or valine (V); X3 is isoleucine (I) or proline (P); X4 is alanine (A), proline (P), or valine (V); and X5 is aspartic acid (D) or glutamic acid (E).

7. In the 6th paragraph, the gene product is an interfering RNA, an aptamer or a polypeptide, rAAV virion.

8. In the 6th paragraph, the gene product is rhodopsin, retinoschisin, glial-derived neurotrophic factor, fibroblast growth factor 2, neurturin, ciliary neurotrophic factor, nerve growth factor, brain-derived neurotrophic factor, epidermal growth factor, X-linked inhibitor of apoptosis, retinitis pigmentosa GTPase-interacting protein-1 (RPGR), peripherin, peripherin-2, Rod-derived Con Viability Factor (RdCVF), Cyclic Nucleotide-gated Chanel-alpha, beta3 (CNGA3, CNGB3), Choroidermia (CDM), Retinal Pigment Epithelium 65kDa protein (RPE65), Retinoschisin (RS1), anti-VEGFR, An rAAV virion containing shVEGF-C, sonic hedgehog, Phenylalanine amomonia lysase (PAL), G6Pase (G6PC), ATPase copper transporting beta (ATP7B), acid alpha-glucosidase (GAA), alpha-galactosidase A (GLA), ornithine transcarbamylase (OTC), human factor VIII (hFVIII), human factor IX (hFIX), and low-density lipoprotein receptor (LDLR).

9. An rAAV virion according to claim 6, wherein the heterologous peptide is inserted between amino acids 590 and 591 of AAV1, between amino acids 587 and 588 of AAV2, between amino acids 585 and 586 of AAV4, between amino acids 575 and 576 of AAV5, between amino acids 590 and 591 of AAV6, between amino acids 589 and 590 of AAV7, between amino acids 590 and 591 of AAV8, between amino acids 588 and 589 of AAV9, or between amino acids 588 and 589 of AAV10.

10. An rAAV virion according to claim 6, wherein the heterologous peptide is inserted at a position between amino acids corresponding to amino acid positions 590 and 591 of AAV8 having an amino acid sequence of SEQ ID NO:

50.

11. An rAAV virion according to claim 6, wherein the heterologous peptide is LQRGVRIASVLEVNGQ (SEQ ID NO: 5) or LQKGVRIVSVLDVNGQ (SEQ ID NO: 28).

12. A pharmaceutical composition for preventing or treating retinal disease comprising rAAV virions according to Article 6.

13. A pharmaceutical composition for preventing or treating liver disease comprising rAAV virions according to Article 6.

14. An isolated and purified nucleic acid comprising a nucleotide sequence encoding a mutant AAV capsid protein, The above mutant AAV capsid protein comprises an insertion of a heterologous peptide in the capsid protein GH loop relative to the corresponding parental AAV capsid protein, The above heterologous peptide is an isolated and purified nucleic acid comprising an amino acid sequence of the following formula I: LQ-X1-G-X2-R-X3-X4-SVL-X5-VNGQ (Formula I) In the above equation 1, X1 is arginine (R) or lysine (K); X2 is alanine (A) or valine (V); X3 is isoleucine (I) or proline (P); X4 is alanine (A), proline (P), or valine (V); and X5 is aspartic acid (D) or glutamic acid (E).

15. An isolated and purified nucleic acid according to claim 14, wherein the insertion site is inserted at a position between amino acids corresponding to amino acid positions 590 and 591 of AAV8 having the amino acid sequence of SEQ ID NO:

50.

16. An isolated and purified nucleic acid according to claim 14, wherein the heterologous peptide comprises LQRGVRIASVLEVNGQ (SEQ ID NO: 5) or LQKGVRIVSVLDVNGQ (SEQ ID NO: 28).

17. An isolated and purified genetically modified host cell comprising a nucleic acid according to Article 14.

18. A recombinant adeno-associated virus 8 (rAAV8) vector comprising a mutant AAV capsid protein according to paragraph 1.

Images