Nucleic acids and engineered cells for treating cancer
A nucleic acid construct in NK cells expressing CAR and IL-7/IL7Rα enhances NK cell function and persistence, addressing the limitations of CAR-based therapies by improving proliferation and anti-tumor activity against various cancers.
Patent Information
- Application Number
- PCT/US2025/039355
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-07-26
- Filing Date
- 2025-07-25
- Publication Date
- 2026-01-29
AI Technical Summary
Existing CAR-based cell therapies for cancer treatment face challenges due to immunosuppressive molecules in the tumor microenvironment, leading to reduced persistence and proliferation, necessitating persistent CAR expression and enhanced NK cell function.
A nucleic acid construct is engineered in NK cells to express a chimeric antigen receptor (CAR) and IL-7, along with IL-7 receptor α (IL7Rα), enhancing NK cell cytotoxicity and persistence through IL-7 secretion and receptor activation.
The engineered NK cells demonstrate improved proliferation, activation, and anti-tumor function, effectively targeting and destroying cancer cells, including malignant mesothelioma, pancreatic cancer, ovarian cancer, and others, with sustained activation and recruitment of immune cells.
Smart Images

Figure US2025039355_29012026_PF_FP_ABST
Abstract
Description
NUCLEIC ACIDS AND ENGINEERED CELLS FOR TREATING CANCER CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to U.S. Provisional Application No.63 / 676,213, filed on July 26, 2024, which is incorporated by reference in its entirety herein. STATEMENT REGARDING SEQUENCE LISTING
[0002] The sequence listing associated with this application is provided in XML format in lieu of paper copy, and is hereby incorporated by reference into the specification. The name of the XML file containing the sequence listing is “91016-425875_SeqListing”. The XML file is 45,056 bytes, and was created on July 21, 2025, and is being submitted electronically, concurrent with the filing of this application. FIELD
[0003] The present disclosure relates to a novel nucleic acid construct for the expression of a chimeric antigen receptor and IL-7, and further expressing IL-7 receptor α (IL7Rα), in a Natural Killer (NK) cell. Also described herein are methods of treating cancer using the same. BACKGROUND
[0004] Cells engineered to express chimeric antigen receptors (CAR) have been successful in patients, with some CAR cell therapies remaining detectable more than ten years after infusion. See, Melenhosrt et al., (2022). However, patients which relapse require persistent CAR expression in addition to efficacy. Studies have demonstrated that the tumor microenvironment may include immunosuppressive molecules that impair the ability of CAR based cell therapies, resulting in reduced persistence and proliferation. See, Kong et al., (2023).
[0005] IL-7 is a cytokine known to stimulate natural killer (NK) cells in several different ways. IL-7 has been found to enhance NK cell cytotoxicity, promote degranulation and cytolysis of target cells, and augment NK cell function. See, Su et al., (2014). Furthermore, IL-7 has been found to stimulate T cells, promoting an increase in theirpopulation within the tumor microenvironment. See, Fu et al., (2024) and Lum et al., (2004).
[0006] Therefore, immunotherapies using NK cells with high efficacy for the treatment of cancer may benefit from IL-7 and IL7Rα expression to enhance function and persistence. SUMMARY
[0007] One embodiment described herein is a nucleic acid for engineering a natural killer (NK) cell, comprising formula I: R1 – R2 – R3 – R4 – R5 – R6 – R7 – R8 (I), wherein: R1 encodes a single chain variable fragment (scFv) that binds a first extracellular protein; R2 encodes a cluster of differentiation 8 (CD8) hinge region; R3 encodes a CD8 transmembrane region; R4 encodes a 4-1BB costimulatory region; R5 encodes a cluster of differentiation 3 zeta (CD3ζ) intracellular region; R6 encodes a first cleavable linker; R7 encodes a interleukin-12 (IL-12) signaling peptide; and R8 encodes interleukin-7 (IL- 7); R1 to R8 are oriented 5’ to 3’.
[0008] Another embodiment described herein is a nucleic acid for engineering a natural killer (NK) cell comprising formula I: R1 – R2 – R3 – R4 – R5 – R6 – R7 – R8 (I), wherein: R1 encodes a single chain variable fragment (scFv) means for binding a first extracellular protein; R2 encodes a CD8 hinge region; R3 encodes a CD8 transmembrane region; R4 encodes a 4-1BB costimulatory region; R5 encodes a CD3 zeta intracellular region; R6 encodes a cleavable linker; R7 encodes a IL-12 signaling peptide; and R8 encodes interleukin-7 (IL-7); R1 to R8 are oriented 5’ to 3’. In one aspect, the nucleic acid further comprises R9 and R10, wherein R9 encodes a cleavable linker and R10 encodes IL-7 receptor alpha (IL7Rα).
[0009] In another aspect, R1 further comprises formula II: R11 – R12 (II), wherein: R11 encodes a light chain variable fragment (VL); and R12 encodes a heavy chain variable fragment (VH), optionally, R11 to R12 are oriented 5’ to 3’.
[0010] In another aspect, first extracellular protein is mesothelin (MESO). In another aspect, R1 comprises the nucleic acid sequence of SEQ ID NO: 1. In another aspect, R2 comprises the nucleic acid sequence of SEQ ID NO: 2. In another aspect, R3 comprises the nucleic acid sequence of SEQ ID NO: 3. In another aspect, R4 comprises the nucleic acid sequence of SEQ ID NO: 4. In yet another aspect, R5 comprises the nucleic acid sequence of SEQ ID NO: 5. In one aspect, R6 comprises the nucleic acid sequence of SEQ ID NO: 6. In another aspect, R7 comprises the nucleic acid sequence of SEQ ID NO: 7. In one aspect, R8 comprises the nucleic acid sequence of SEQ ID NO: 8. In one aspect, R9 comprises the nucleic acid sequence of SEQ ID NO: 9. In one aspect, R10 comprises the nucleic acid sequence of SEQ ID NO: 10. In one aspect, R11 comprises the nucleic acid sequence of SEQ ID NO: 11. In one aspect, R12 comprises the nucleic acid sequence of SEQ ID NO: 12.
[0011] In one aspect, the nucleic acid sequence comprises SEQ ID NO: 15 or SEQ ID NO: 16.
[0012] In another aspect described herein is a pharmaceutical composition, comprising an NK cell engineered with any of the nucleic acid sequences described herein, and one or more pharmaceutically acceptable carriers, diluents, or excipients.
[0013] Another embodiment described herein is a method of treating cancer in a patient in need thereof, the method comprising administering to the patient an effective amount of an NK cell engineered with any of the nucleic acid sequences, or pharmaceutical compositions described herein.
[0014] In one aspect, the cancer is malignant mesothelioma, pancreatic cancer, ovarian cancer, lung adenocarcinoma, endometrial cancer, biliary cancer, gastric cancer, or pediatric acute myeloid leukemia cancer cells.
[0015] Another embodiment described herein is an NK cell engineered with any of the nucleic acid sequences or pharmaceutical compositions described herein, for use in a therapy.
[0016] Another embodiment described herein is an NK cell engineered with any of the nucleic acid sequences or pharmaceutical compositions described herein for use in treating cancer.
[0017] In one aspect of the methods or uses, the cancer is malignant mesothelioma, pancreatic cancer, ovarian cancer, lung adenocarcinoma, endometrial cancer, biliary cancer, gastric cancer, or pediatric acute myeloid leukemia cancer cells.
[0018] Another embodiment described herein is a use of an NK cell engineered with any of the nucleic acid sequences, or the pharmaceutical compositions described herein, in the manufacture of a medicament for treating cancer. In one aspect, the cancer is malignant mesothelioma, pancreatic cancer, ovarian cancer, lung adenocarcinoma, endometrial cancer, biliary cancer, gastric cancer, or pediatric acute myeloid leukemia cancer cells.
[0019] Another embodiment described herein is a pharmaceutical composition for use in the treatment of cancer comprising, an NK cell engineered with any of the nucleic acid sequences, or the pharmaceutical compositions described herein.
[0020] Another embodiment described herein is a pharmaceutical composition for use in the treatment of cancer comprising, an NK cell engineered any of the nucleic acid sequences or pharmaceutical compositions described herein. In one aspect, the cancer is malignant mesothelioma, pancreatic cancer, ovarian cancer, lung adenocarcinoma, endometrial cancer, biliary cancer, gastric cancer, or pediatric acute myeloid leukemia cancer cells. BRIEF DESCRIPTION OF THE FIGURES
[0021] Figure 1 depicts construct design and validation. Fig.1A depicts a schematic representation of the gene constructs used for generating M-, M7-, and M7R-engineered NK cells. The nucleic acid construct M includes, from 5’ to 3’, a nucleic acid encoding a HA tag linked to a nucleic acid including SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6, linked to a nucleic acid encoding a green fluorescent protein (GFP), where the combination of SEQ ID Nos: 2-3 is the “Hinge- TM” region. The nucleic acid construct M7, from 5’ to 3’, a nucleic acid encoding a HA tag linked to a nucleic acid including SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, and SEQ ID NO: 8, where the combination of SEQ ID Nos: 2-3 is the “Hinge-TM” region. The nucleic acid construct M7R, from 5’ to 3’, a nucleic acid encoding a HA tag linked to a nucleic acid includingSEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, and SEQ ID NO: 10, where the combination of SEQ ID Nos: 2-3 is the “Hinge-TM” region. Fig.1B shows an analysis of the transduction efficiency through the expression of HA tag on the surface of CAR-NK cells by flow cytometry. Fig.1C is a graph of quantification of IL-7 secretion by CAR-NK cells measured by ELISA. Fig.1D is a graph depicting IL7Rα expression on the surface of CAR-NK cells by flow cytometry. Graphs display the mean and SD of 4 independent healthy donors, each with two technical replicates; M-NK cells are represented with circles, M7-NK cells with squares; M7R-NK cells with triangles. Statistical differences were assessed using ANOVA test (*p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p ≤ 0.0001).
[0022] Figure 2 shows the proliferation and activation status of NK cells engineered with IL7 / IL7R. Fig.2A shows cell proliferation analysis of CellTrace Violet (CTV) labeled CAR-NK cells in culture for 9 days. Donuts graphs represent NK cell divisions: generation 0 (undivided cells, G0); generation 1 (G1); generation 2 (G2); generation 3 (G3), and generation 4+(G4+). Fig.2B depicts the percentage of CTV-negative CAR-NK cells on day 9. Fig.2C shows the fold increase of IFN-γ production by CAR-NK cells targeting ASPC1 and Capan-2 cells for 24h. Fig.2D shows the fold increase of CD107a expression on the surface of CAR-NK cells targeting ASPC1 and Capan-2 cell lines for 6h. Graphs display the mean and SD of 4 independent healthy donors, each with two technical replicates; M-NK cells are represented with circles, M7-NK cells with squares; M7R-NK cells with triangles. Statistical differences were assessed using ANOVA test (*p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p ≤ 0.0001).
[0023] Figure 3 depicts CAR-T cell proliferation in culture with NK cells engineered with IL7 / IL7R. Fig.3A shows the cell proliferation analysis of CellTrace Violet (CTV) labeled CAR-T cells in culture with M-, M7-, and M7R-NK cells for 9 days. Fig.3B depicts percentage of CTV-negative CAR-T cells in culture with CAR-NK cells for 9 days. Fig.3C shows cell proliferation analysis of CTV labeled CD8+CAR-T cells in culture CAR-NK cells for 9 days in the presence of Capan-2 cells. Fig.3D depicts the percentage of CTV- negative CD8+CAR-T cells in culture with CAR-NK cells for 9 days. Donuts graphs represent CAR-T cell divisions: generation 0 (undivided cells, G0); generation 1 (G1); generation 2 (G2); generation 3 and 4 (G3-4), and generation 5+(G5+). Graphs displaythe mean and SD of 4 independent healthy donors, each with two technical replicates; M- NK cells are represented with circles, M7-NK cells with squares; M7R-NK cells with triangles. Statistical differences were assessed using ANOVA test (*p ≤ 0.05, **p ≤ 0.01).
[0024] Figure 4 shows the anti-tumor function of NK cells engineered with IL7 / IL7R against ovarian cancer cells in vitro. Fig.4A illustrates the evaluation of SKOV3 cell death during co-culture with NK cells (NK, M-, M7-, and M7R-NK cells) in 1:2 E: T ratio for 48h. Graphs display the mean and SD of 2 independent healthy donors, each with two technical replicates; NK cells are represented in grey bars, M-NK cells in green bars; M7- NK cells in blue bars, and M7R-NK cells in pink bars. Statistical differences were assessed using the ANOVA test (*p ≤ 0.05).
[0025] Figure 5 depicts Buddy-CAR NK cells (M7R-NK cells) display enhanced proliferation and survival in vivo. Fig.5A is a schematic of the in vivo mouse model for evaluating CAR NK cell proliferation. Fig.5B depicts flow cytometry analysis of the percentage of CAR-NK cells in CD45+(human and mouse) cells present in the bone marrow (BM), lungs, liver, and blood, 15 days after IV injection with 6x106of M-, M7-, or M7R-NK cells. Bar graphs show mean ± SD from four to five independent donors in two technical replicates. Statistical significance was determined using one-way ANOVA.
[0026] Figure 6 shows Buddy-CAR NK cells (M7R-NK cells) promote CAR-T cells cytotoxicity in vitro and in vivo. Fig.6A is an illustration of the in vitro experimental design. CD19-CAR-T cells were co-cultured with CD19+tumor cell lines (e.g. Raji or NALM6 cells) and M-NK, M7-NK, or M7R-NK cells (Buddy-CAR NK cells). Fig.6B shows cytotoxicity of CD19-CAR-T cells based on Luciferin assay against Luciferase+(Luc+) Raji cells in co-culture with M-, M7-, and M7R-NK cells. Firstly, CAR-T and CAR-NK cells were co-cultured for 72 h in a 1:1 ratio. Then, Luc+Raji cells were added for 24 h in a 1:1:1 ratio. Bar graphs show mean ± SD from three independent donors in two technical replicates. Statistical significance was determined using one-way ANOVA. Fig. 6C depicts a schematic of the in vivo mouse model for evaluating tumor control by CAR-T cells. Fig.6D shows the total flux (photons / sec) measured by bioluminescence imaging in mice bearing luciferase-expressing CD19+Raji cells at indicated time points. Data represent mean ± SD (n = 5 mice per group). Total flux was quantified using Living Imagesoftware by drawing regions of interest (ROIs) over the tumor site for each animal. Statistical significance was determined by ANOVA. DETAILED DESCRIPTION
[0027] The present disclosure relates to a novel nucleic acid construct for the expression of a chimeric antigen receptor (CAR) and IL-7, and further expressing IL-7 receptor α (IL7Rα), in a Natural Killer (NK) cell. Also described herein are methods of treating cancer using the same.
[0028] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In case of conflict, the present document, including definitions, will control. Methods and materials are described below, although methods and materials similar or equivalent to those described herein may be used in practice or testing of the present disclosure. All publications, patent applications, patents and other references mentioned herein are incorporated by reference in their entirety. The materials, methods, and examples disclosed herein are illustrative only and not intended to be limiting.
[0029] As used herein, the articles "a," "an," and "the" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an element" can mean one element or more than one element.
[0030] As used herein, the term "about" or "approximately" refers to a quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length that varies by as much as 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 % to a reference quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length. In some embodiments, the terms "about" or "approximately" when preceding a numerical value indicates the value plus or minus a range of 10%, 5%, or 1%.
[0031] As used herein, the term “chimeric antigen receptor cell” means a natural killer (NK) cell which is genetically modified to express a chimeric antigen receptor (CAR) with specificity for a particular antigen. The CAR may have specificity for any known antigen, including but not limited to, Mesothelin. CARs may include (1) an extracellular antigen-binding motif (e.g., single-chain variable fragment (scFv) antibody), (2) linking / transmembrane motifs, and (3) an intracellular domain, including a costimulatorydomain and an activity domain (e.g., CD137 (4-1BB) and CD247 (CD3ζ)-derived costimulatory domain and an activity domain, respectively). In aspects, the CAR expresses an anti-mesothelin antibody or scFv fragment thereof.
[0032] The term “comprise”, “comprises”, and “comprising” will be understood to imply the inclusion of a stated step or element or group of steps or elements but not the exclusion of any other step or element or group of steps or elements. By “consisting of” is meant to include, and be limited to, whatever follows the phrase “consisting of.” Thus, the phrase “consisting of” indicates that the listed elements are required or mandatory, and that no other elements may be present. By “consisting essentially of” is meant including any elements listed after the phrase, and be limited to other elements that do not interfere with or contribute to the activity or action specified in the disclosure for the listed elements.
[0033] The term “coding sequence” as used herein refers to a segment of a polynucleotide that encodes for protein or polypeptide. The region or sequence is bounded nearer the 5’ end by a start codon and nearer the 3’ end with a stop codon. Coding sequences may also be referred to as open reading frames.
[0034] As will be appreciated by the skilled practitioner, slight changes in nucleic acid sequence do not necessarily alter the amino acid sequence of the encoded polypeptide. This disclosure embraces the degeneracy of codon usage as would be understood by one of ordinary skill in the art. For example, as known in the art, different codons will code for the same amino acid.
[0035] As used herein, the phrase “codon degenerate nucleic acid sequence” when used with reference to a nucleic acid sequence refers to a nucleic acid sequence that differs from the referenced sequence, but that encodes a polypeptide having the same amino acid sequence as that encoded by the referenced sequence.
[0036] As used herein, "an effective amount" refers to an amount that causes relief of symptoms of a disorder or disease as noted through clinical testing and evaluation, patient observation, and / or the like. An "effective amount" may further designate a dose that causes a detectable change in biological or chemical activity. The detectable changes may be detected and / or further quantified by one skilled in the art for the relevant mechanism or process. Moreover, an "effective amount" may designate anamount that maintains a desired physiological state, i.e., reduces or prevents significant decline and / or promotes improvement in the condition of interest. An "effective amount" may further refer to a “therapeutically effective amount”.
[0037] An “expression vector” or “vector” is any genetic element, e.g., a plasmid, a mini-circle, a nanoplasmid, chromosome, virus, transposon, behaving either as an autonomous unit of polynucleotide replication within a cell. (i.e. capable of replication under its own control) or being rendered capable of replication by insertion into a host cell chromosome, having attached to it another polynucleotide segment, so as to bring about the replication and / or expression of the attached segment.
[0038] As used herein, the term "individual" and "subject" are often used interchangeably and refer to any human or domestic animal that may be treated with the methods disclosed herein. Suitable subjects (e.g., patients) include humans and domestic animals or pets (such as a cat or dog). Non–human primates and human patients are included. In one embodiment, subjects may include human patients that have been diagnosed with cancer. As used herein, the term "patient" refers to a subject that may receive a treatment of a disease or condition.
[0039] As used herein, the term “means for binding a first extracellular protein” includes any of the nucleic acid sequences of the tables herein that express an scFv nucleic acid, and equivalents thereof. A scFv nucleic acid may be any scFv nucleic acid as described herein, and its corresponding polypeptide, and functionally equivalent variants thereof. Thus, in one embodiment described herein is a means for binding a first extracellular protein. Equivalents of all sequences, including SEQ ID NO: 1 described herein are contemplated by this disclosure.
[0040] As used herein, the term “nucleic acid construct” also known as a DNA / RNA construct, is a segment of DNA / RNA that is genetically engineering a combination of different DNA / RNA sequences to achieve specific goals. These constructs are often used in genetic engineering and molecular biology for research, therapeutic, and biotechnological purposes.
[0041] The term “operably linked” as used herein refers to the physical and / or functional linkage of a DNA segment to another DNA segment in such a way as to allow the segments to function in their intended manners. A DNA sequence encoding a geneproduct is operably linked to a regulatory sequence when it is linked to the regulatory sequence, such as, for example, promoters, enhancers and / or silencers, in a manner, which allows modulation of transcription of the DNA sequence, directly or indirectly. For example, a DNA sequence is operably linked to a promoter when it is ligated to the promoter downstream with respect to the transcription initiation site of the promoter, in the correct reading frame with respect to the transcription initiation site and allows transcription elongation to proceed through the DNA sequence. An enhancer or silencer is operably linked to a DNA sequence coding for a gene product when it is ligated to the DNA sequence in such a manner as to increase or decrease, respectively, the transcription of the DNA sequence. Enhancers and silencers may be located upstream, downstream or embedded within the coding regions of the DNA sequence. A DNA for a signal sequence is operably linked to DNA coding for a polypeptide if the signal sequence is expressed as a pre-protein that participates in the secretion of the polypeptide. Linkage of DNA sequences to regulatory sequences is typically accomplished by ligation at suitable restriction sites or via adapters or linkers inserted in the sequence using restriction endonucleases known to one of skill in the art.
[0042] The term “promoter” refers to a region of a polynucleotide that initiates transcription of a coding sequence. Promoters are located near the transcription start sites of genes, on the same strand and upstream on the DNA (towards the 5’ region of the sense strand). Some promoters are constitutive as they are active in all circumstances in the cell, while others are regulated becoming active in response to specific stimuli, e.g., an inducible promoter. The term “promoter activity” and its grammatical equivalents as used herein refer to the extent of expression of nucleotide sequence that is operably linked to the promoter whose activity is being measured. Promoter activity may be measured directly by determining the amount of RNA transcript produced, for example by Northern blot analysis or indirectly by determining the amount of product coded for by the linked nucleic acid sequence, such as a reporter nucleic acid sequence linked to the promoter.
[0043] “Polynucleotide” as used herein refers to a polymeric form ofnucleotides or nucleic acids of any length, either ribonucleotides or deoxyribonucleotides. This term refers only to the primary structure of the molecule. Thus, this term includes double and single stranded DNA, triplex DNA, as well as double and single stranded RNA. It also includes modified, for example, by methylation and / or by capping, and unmodified.
[0044] Unless otherwise stated, nucleic acid sequences in the text of this specification are given, when read from left to right, in the 5′ to 3′ direction.
[0045] As used herein, the phrase “variant” when used with reference to a nucleic acid or polypeptide refers to a nucleic acid or polypeptide that differs from the referenced nucleic acid or polypeptide (for example, differing by at least one amino acid substitution from a wild-type sequence) but possesses the primary function of the referenced polypeptide. For example, a functional variant of a polypeptide that serves as a transmembrane domain is a fragment of that polypeptide that also serves as a transmembrane domain. When used with reference to a nucleic acid, the phrase “variant” refers to a nucleic acid that differs from the referenced nucleic acid but encodes a polypeptide having the same primary function as the polypeptide encoded by the referenced nucleic acid.
[0046] The terms “transfection,” “transformation,” “nucleofection,” or “transduction” as used herein refer to the introduction of one or more exogenous polynucleotides into a host cell or organism by using physical, chemical, and / or electrical methods. The nucleic acid sequences and vectors disclosed herein may be introduced into a cell or organism by any such methods, including, for example, by electroporation, calcium phosphate co–precipitation, strontium phosphate DNA co– precipitation, liposome mediated–transfection, DEAE dextran mediated– transfection, polycationic mediated– transfection, tungsten particle– facilitated microparticle bombardment, viral, and / or non– viral mediated transfection. In some cases, the method of introducing nucleic acids into the cell or organism involve the use of viral, retroviral, lentiviral, or transposon, or transposable element – mediated (e.g., Sleeping Beauty) vectors.
[0047] The terms “identical” and its grammatical equivalents as used herein or
[0048] “sequence identity” in the context of two nucleic acid sequences or amino acid sequences of polypeptides refer to the residues in the two sequences which are thesame when aligned for maximum correspondence over a specified comparison window. A “comparison window”, as may be used herein, refers to a segment of at least about 20 contiguous positions, usually about 50 to about 200, more usually about 100 to about 150 in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are aligned optimally. Methods of alignment of sequences for comparison are well-known in the art. Optimal alignment of sequences for comparison may be conducted by the local homology algorithm of Smith and Waterman, Adv. Appl. Math., 2:482 (1981); by the alignment algorithm of Needleman and Wunsch, J. Mol. Biol., 48:443 (1970); by the search for similarity method of Pearson and Lipman, Proc. Nat. Acad. Sci U.S.A., 85:2444 (1988); by computerized implementations of these algorithms (including, but not limited to CLUSTAL in the PC / Gene program by Intelligentics, Mountain View Calif., GAP, BESTFIT, BLAST, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group (GCG), 575 Science Dr., Madison, Wis., U.S.A.); the CLUSTAL program is well described by Higgins and Sharp, Gene, 73:237-244 (1988) and Higgins and Sharp, CABIOS, 5:151-153 (1989); Corpet et al., Nucleic Acids Res., 16:10881-10890 (1988); Huang et al., Computer Applications in the Biosciences, 8:155- 165 (1992); and Pearson et al., Methods in Molecular Biology, 24:307-331 (1994). Alignment may also be performed by inspection and manual alignment. In one class of embodiments, the nucleic acids described herein are at least 80%, 85%, 90%, 98% 99% or 100% identical to a reference polypeptide, or a fragment thereof, e.g., as measured by BLASTP (or CLUSTAL, or any other available alignment software) using default parameters. Similarly, nucleic acids may also be described with reference to a starting nucleic acid, e.g., they may be 50%, 60%, 70%, 75%, 80%, 85%, 90%, 98%, 99% or 100% identical to a reference nucleic acid or a fragment thereof, e.g., as measured by BLASTN (or CLUSTAL, or any other available alignment software) using default parameters. When one molecule is said to have certain percentage of sequence identity with a larger molecule, it means that when the two molecules are optimally aligned, the percentage of residues in the smaller molecule finds a match residue in the larger molecule in accordance with the order by which the two molecules are optimally aligned.
[0049] Homology is generally inferred from sequence identity between two or more nucleic acids (or sequences thereof). The precise percentage of identity between sequences that is useful in establishing homology varies with the nucleic acid and protein at issue, but as little as 25% sequence identity is routinely used to establish homology. Higher levels of sequence identity, e.g., 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99% or more may also be used to establish homology. Methods for determining sequence identity percentages (e.g., BLASTP and BLASTN using default parameters) are described herein and are generally available. Nucleic acids and / or nucleic acid sequences are “homologous” when they are derived, naturally or artificially, from a common ancestral nucleic acid or nucleic acid sequence. The homologous molecules may be termed “homologs.” For example, any naturally occurring proteins may be modified by any available mutagenesis method. When expressed, the mutagenized nucleic acid encodes a polypeptide that is homologous to the protein encoded by the original nucleic acid.
[0050] The term “pharmaceutically acceptable” refers to a molecule or composition that, when administered to a recipient, is not deleterious to the recipient thereof, or that any deleterious effect is outweighed by a benefit to the recipient thereof. With respect to a carrier, diluent, or excipient used to formulate a composition as disclosed herein, a pharmaceutically acceptable carrier, diluent, or excipient must be compatible with the other ingredients of the composition and not deleterious to the recipient thereof, or any deleterious effect must be outweighed by a benefit to the recipient. The term “pharmaceutically acceptable carrier” means a pharmaceutically acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, or solvent encapsulating material, involved in carrying or transporting an agent from one portion of the body to another (e.g., from one organ to another). Each carrier present in a pharmaceutical composition must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not deleterious to the patient, or any deleterious effect must be outweighed by a benefit to the recipient. Some examples of materials which may serve as pharmaceutically acceptable carriers comprise: sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl celluloseand cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients, such as cocoa butter and suppository waxes; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols, such as propylene glycol; polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; buffering agents, such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogenfree water; isotonic saline; Ringer’s solution; ethyl alcohol; pH buffered solutions; polyesters, polycarbonates and / or polyanhydrides; and other non-toxic compatible substances employed in pharmaceutical formulations.
[0116] The term “pharmaceutical composition” refers to a composition in which an active agent is formulated together with one or more pharmaceutically acceptable carriers. In some embodiments, the active agent is present in a unit dose amount appropriate for administration in a therapeutic regimen that shows a statistically significant probability of achieving a predetermined therapeutic effect when administered to a relevant subject or population. In some embodiments, a pharmaceutical composition may be formulated for administration in solid or liquid form, comprising, without limitation, a form adapted for the following: oral administration, for example, drenches (aqueous or non-aqueous solutions or suspensions), tablets, e.g., those targeted for buccal, sublingual, and systemic absorption, boluses, powders, granules, pastes for application to the tongue; parenteral administration, for example, by subcutaneous, intramuscular, intravenous or epidural injection as, for example, a sterile solution or suspension, or sustained-release formulation; topical application, for example, as a cream, ointment, or a controlled-release patch or spray applied to the skin, lungs, or oral cavity; intravaginally or intrarectally, for example, as a pessary, cream, or foam; sublingually; ocularly; transdermally; or nasally, pulmonary, and to other mucosal surfaces; or infusion.
[0051] As used herein, "treatment", "treat", and "treating" refer to reversing, alleviating, mitigating, or slowing the progression of, or inhibiting the progress of, a disorder or disease or symptoms associated with such disorder or disease, and as described in more detail herein.
[0052] For the recitation of numeric ranges herein, each intervening number there between with the same degree of precision is explicitly contemplated. For example, for the range of 6-9, the numbers 7 and 8 are contemplated in addition to 6 and 9, and for the range 6.0-7.0, the number 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are explicitly contemplated.
[0053] Natural killer (NK) cells are an immune cells responsible for the destruction of infected or malignant cells. The term “natural killer” is used since these cells do not require a prior exposure to a pathogen or antigen in order to find and destroy infected cells. These cells perform a surveillance of the body and recognize cell-surface markers for determining the difference between a healthy, infected or malignant cell. Some diseased cells will release chemicals signaling the NK cell to attack. NK cells generally attack their target by releasing perforin to create a “pore” in the target cell, followed by the release of granzymes for killing. Once activated, NK cells also release cytokines to signal other immune cells to arrive to attack the identified target. Thus, modifying the ability of the NK cell’s function and recruitment of immune cells is thought to be one way of increasing the impact of these cells on cancer (see, Mace, J Allergy Clin Immunol.2022.)
[0054] Chimeric antigen receptors (CARs) have been used as an immunotherapy to treat cancer by genetically modifying an immune cell to target and kill cancer cells. CARs include antigen binding domains that recognize and bind to specific proteins on the cancer cell-surface. There are currently six CAR-T cell therapies approved by the Food and Drug Administration. See, CAR T Cells: Engineering Patients’ Immune Cells to Treat Their Cancers. Thus, without being bound by any theory, it is believed that an NK cell modified by the expression of a CAR specific for a cancer cell target may amplify the NK cell’s ability to target these malignant cells. Further engineering the same NK cell to express IL-7 for secretion may augment NK cell activation, function and enhance recruitment of other immune cells. In addition, a further modification to allow co-expression of the IL-7 receptor α (IL7Rα) in the same NK cell may allow for sustained NK cell activation due to secreted IL-7. Thus, a single engineered NK cell modified to co-express a CAR and IL-7, and additionally IL7Rα in this way may target and destroy malignant cells, stimulate the cellular microenvironment to attract other immune cells to the target, and do it in a sustained and persistent manner.
[0055] Accordingly, one embodiment described herein is a nucleic acid construct comprising a CAR and IL-7. Another embodiment described herein a nucleic acid construct comprising a CAR, IL-7 and IL7Rα.
[0056] Another embodiment described herein is a nucleic acid of Formula (I) comprising: R1 – R2 – R3 – R4 – R5 – R6 – R7 – R8 – R9 (I), wherein, from N’ terminal to C’ terminal end, or from the 5’ end to the 3’ end, R1 encodes a single chain variable fragment (scFv) that binds a first extracellular protein; R2 encodes a Cluster of Differentiation (CD8) hinge region; R3 encodes a CD8 transmembrane region; R4 encodes a 4-1BB costimulatory region; R5 encodes a Cluster of Differentiation 3 (CD3) zeta intracellular region; R6 encodes a first cleavable linker; R7 encodes an IL- 12 signaling peptide; and R8 encodes IL7.
[0057] In one aspect, R1 encodes an antigen binding domain that specifies one of the antigen targets for the CAR portion of the NK cell (e.g., an antigen target on a cancer cell). In some aspects, R1 may encode a single chain variable fragment (scFv) that binds a first extracellular protein. A scFv is a molecule that contains a variable region of the light chain (VL) and a variable region of the heavy chain (VH) of an antibody, and may be joined by a linker, which enables the two variable regions to be expressed as a single polypeptide chain (see, e.g., Bird et al., Science, 242: 423-426 (1988); Huston et al., Proc. Natl. Acad Sci. USA, 85: 5879-5883 (1988); and Osbourn et al., Nat. Biotechnol., 16: 778 (1998)).
[0058] Binding of a domain of a polypeptide to an extracellular protein (e.g., a first extracellular protein) can be assessed using any appropriate method. For example, an enzyme-linked immunosorbent assay (ELISA) or flow cytometry may be used to assess binding of a domain of a polypeptide encoded by the nucleic acid construct described herein to an extracellular protein.
[0059] The extracellular protein may be an antigen target on a cancer cell, such as an antigen target on a hematological cancer (e.g., an antigen target on a pancreatic cancer cell or ovarian cancer cell). In some aspects, the extracellular protein is expressed or overexpressed on cancer or tumor cells. For example, in some aspects, the extracellular protein is expressed or overexpressed on pancreatic cancer cells. In other aspects, the extracellular protein is expressed or overexpressed on ovarian cancercells. In some aspects, the extracellular protein is mesothelin (MSLN). As used herein, “MSLN” refers to a mesothelin, a cell-surface protein found to be highly overexpressed the surface of a variety of cancers including pancreatic, ovarian, lung and mesothelioma cancer. The amino acid and nucleic acid sequences of MSLN from various species can be found in public databases, such as GenBank, UniProt, and Swiss-Prot. In one aspect described herein, is a MSLN-specific scFv (e.g., a MSLN-specific scFv encoded by R1) having the components of Table 1. Table 1. MSLN-specific scFv sequencessequence having at least 80% sequence identity (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity) to SEQ ID NO: 1 or a codon degenerate nucleic acid sequence thereof. In some aspects, the scFv comprising a nucleic acid sequence having at least 80% sequence identity to SEQ ID NO: 1 binds to MSLN. Described herein is a MSLN-specific scFv (e.g., a MSLN-specific scFv encoded by R1) as described in Table 1.
[0061] In some aspects, R1 comprises an scFv comprising a nucleic acid sequence having at least 80% sequence identity (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity) to SEQ ID NO: 1 or a codon degenerate nucleic acid sequence thereof. In some aspects, the scFv of R1 comprises a nucleic acid sequence having at least 85% sequence identity to SEQ ID NO: 1. In some aspects, the scFv of R1 comprises a nucleic acid sequence having at least 90% sequence identity to SEQ ID NO: 1. In some aspects, the scFv of R1 comprises a nucleic acid sequence having at least 95% sequence identity to SEQ ID NO: 1. In some aspects, the scFv of R1 comprises a nucleic acid sequence having at least 96% sequence identity to SEQ ID NO: 1. In some aspects, the scFv of R1 comprises a nucleic acid sequence having at least 97% sequence identity to SEQ ID NO: 1. In some aspects, the scFv of R1 comprises a nucleic acid sequence having at least 98% sequence identity to SEQ ID NO: 1. In some aspects, the scFv of R1 comprises a nucleic acid sequence having at least 99% sequence identity to SEQ ID NO: 1. In some aspects, the scFv of R1 comprises a nucleic acid sequence having 100% sequence identity to SEQ ID NO: 1.
[0062] R1 may be further comprised of additional subdomains. Thus, in some aspects, R1 further comprises the nucleic acid of formula II: R11 – R12 (II), where R11 encodesa VL domain and R12 encodes a VH domain. In some aspects, R1 further comprises the nucleic acid of formula II. In some aspects, R11 comprises a nucleic acid sequence having at least 80% sequence identity (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity) to SEQ ID NO: 11 (See Table 1). In other aspects, R12 comprises a nucleic acid sequence having at least 80% sequence identity (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity) to SEQ ID NO: 12 (See Table 1).
[0063] In some aspects, R3 comprises a CD8 hinge region of SEQ ID NO: 2: ACCACTACCCCAGCACCGAGGCCACCCACCCCGGCTCCTACCATCGCCTCCCAG CCTCTGTCCCTGCGTCCGGAGGCATGTAGACCCGCAGCTGGTGGGGCCGTGCAT ACCCGGGGTCTTGACTTCGCCTGCGAT (SEQ ID NO: 2) or a codon degenerate nucleic acid sequence thereof. The hinge region of a CAR is an extracellular structure that binds the scFv and the transmembrane domains. Thus, the hinge region impacts the scFv’s access to the target epitope and ability of CAR recognition of the target cells. See, Sterner et al., (2021). Thus, in one aspect the CD8 hinge region of R3 comprises a nucleic acid sequence having at least 80% sequence identity (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity) to SEQ ID NO: 2. In some aspects, the CD8 hinge region of R2 comprises a nucleic acid sequence having at least 85% sequence identity to SEQ ID NO: 2. In some aspects, the CD8 hinge region of R2 comprises a nucleic acid sequence having at least 90% sequence identity to SEQ ID NO: 2. In some aspects, the CD8 hinge region of R2 comprises a nucleic acid sequence having at least 95% sequence identity to SEQ ID NO: 2. In some aspects, the CD8 hinge region of R2 comprises a nucleic acid sequence having at least 96% sequence identity to SEQ ID NO: 2. In some aspects, the CD8 hinge region of R2 comprises a nucleic acid sequence having at least 97% sequence identity to SEQ ID NO: 2. In some aspects, the CD8 hinge region of R2 comprises a nucleic acid sequence having at least 98% sequence identity to SEQ ID NO: 2. In some aspects, the CD8 hinge region of R2 comprises a nucleic acid sequence having at least 99% sequence identity to SEQ ID NO: 2. In some aspects, the CD8 hinge region of R2 comprises a nucleic acid sequence having 100% sequence identity to SEQ ID NO: 2.
[0064] In one aspect, R3 comprises a CD8 transmembrane domain of SEQ ID NO: 3: ATCTACATTTGGGCCCCTCTGGCTGGTACTTGCGGGGTCCTGCTGCTTTCACTCGT GATCACTCTTTACTGT (SEQ ID NO: 3) or a codon degenerate nucleic acid sequence thereof. The transmembrane domain serves to facilitate activation of the CAR upon scFv binding of the target, by transducing signals to the intracellular domains. Thus, in one aspect the CD8 transmembrane region of R3 comprises a nucleic acid sequence having at least 80% sequence identity (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity) to SEQ ID NO: 3. In some aspects, the CD8 transmembrane region of R3 comprises a nucleic acid sequence having at least 85% sequence identity to SEQ ID NO: 3. In some aspects, the CD8 transmembrane region of R3 comprises a nucleic acid sequence having at least 90% sequence identity to SEQ ID NO: 3. In some aspects, the CD8 transmembrane region of R3 comprises a nucleic acid sequence having at least 95% sequence identity to SEQ ID NO: 3. In some aspects, the CD8 transmembrane region of R3 comprises a nucleic acid sequence having at least 96% sequence identity to SEQ ID NO: 3. In some aspects, the CD8 transmembrane region of R3 comprises a nucleic acid sequence having at least 97% sequence identity to SEQ ID NO: 3. In some aspects, the CD8 transmembrane region of R3 comprises a nucleic acid sequence having at least 98% sequence identity to SEQ ID NO: 3. In some aspects, the CD8 transmembrane region of R3 comprises a nucleic acid sequence having at least 99% sequence identity to SEQ ID NO: 3. In some aspects, the CD8 transmembrane region of R3 comprises a nucleic acid sequence having 100% sequence identity to SEQ ID NO: 3.
[0065] In another aspect, R4 comprises a 4-1BB co-stimulatory domain of SEQ ID NO: 4: AAGCGCGGTCGGAAGAAGCTGCTGTACATCTTTAAGCAACCCTTCATGAGGCCTG TGCAGACTACTCAAGAGGAGGACGGCTGTTCATGCCGGTTCCCAGAGGAGGAGG AAGGCGGCTGCGAACTG (SEQ ID NO: 4) or a codon degenerate nucleic acid sequence thereof. 4-1BB is a widely used costimulatory domain used in CAR cells. CAR architecture using 4-1BB exhibit long term function and persistence. See, Singh et al., (2024). Thus, in one aspect, the 4-1BB of R4 comprises a nucleic acid sequence having at least 80% sequence identity (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%,98%, 99%, or 100% sequence identity) to SEQ ID NO: 4. In some aspects, the 4-1BB of R4 comprises a nucleic acid sequence having at least 85% sequence identity to SEQ ID NO: 4. In some aspects, the 4-1BB of R4 comprises a nucleic acid sequence having at least 90% sequence identity to SEQ ID NO: 4. In some aspects, the 4-1BB of R4 comprises a nucleic acid sequence having at least 95% sequence identity to SEQ ID NO: 4. In some aspects, the 4-1BB of R4 comprises a nucleic acid sequence having at least 96% sequence identity to SEQ ID NO: 4. In some aspects, the 4-1BB of R4 comprises a nucleic acid sequence having at least 97% sequence identity to SEQ ID NO: 4. In some aspects, the 4-1BB of R4 comprises a nucleic acid sequence having at least 98% sequence identity to SEQ ID NO: 4. In some aspects, the 4-1BB of R4 comprises a nucleic acid sequence having at least 99% sequence identity to SEQ ID NO: 4. In some aspects, the 4-1BB of R4 comprises a nucleic acid sequence having 100% sequence identity to SEQ ID NO: 4.
[0066] In another aspect R5 comprises a CD3 zeta intracellular region of SEQ ID NO: 5: CGCGTGAAATTCAGCCGCAGCGCAGATGCTCCAGCCTACAAGCAGGGGCAGAAC CAGCTCTACAACGAACTCAATCTTGGTCGGAGAGAGGAGTACGACGTGCTGGACA AGCGGAGAGGACGGGACCCAGAAATGGGCGGGAAGCCGCGCAGAAAGAATCCC CAAGAGGGCCTGTACAACGAGCTCCAAAAGGATAAGATGGCAGAAGCCTATAGCG AGATTGGTATGAAAGGGGAACGCAGAAGAGGCAAAGGCCACGACGGACTGTACC AGGGACTCAGCACCGCCACCAAGGACACCTATGACGCTCTTCACATGCAGGCCCT GCCGCCTCGG (SEQ ID NO: 5) or a codon degenerate nucleic acid sequence thereof. The CD3 zeta intracellular region facilitates intracellular signaling after scFv binding to activate the NK cells. Thus in one aspect, the CD3ζ intracellular region of R5 comprises a nucleic acid sequence having at least 80% sequence identity (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity) to SEQ ID NO: 5. In some aspects, the CD3ζ intracellular region of R5 comprises a nucleic acid sequence having at least 85% sequence identity to SEQ ID NO: 5. In some aspects, the CD3ζ intracellular region of R5 comprises a nucleic acid sequence having at least 90% sequence identity to SEQ ID NO: 5. In some aspects, the CD3ζ intracellular region of R5 comprises a nucleic acid sequence having at least 95% sequence identity to SEQ ID NO: 5. In some aspects, the CD3ζ intracellular region of R5 comprises a nucleic acidsequence having at least 96% sequence identity to SEQ ID NO: 5. In some aspects, the CD3ζ intracellular region of R5 comprises a nucleic acid sequence having at least 97% sequence identity to SEQ ID NO: 5. In some aspects, the CD3ζ intracellular region of R5 comprises a nucleic acid sequence having at least 98% sequence identity to SEQ ID NO: 5. In some aspects, the CD3ζ intracellular region of R5 comprises a nucleic acid sequence having at least 99% sequence identity to SEQ ID NO: 5. In some aspects, the CD3ζ intracellular region of R5 comprises a nucleic acid sequence having 100% sequence identity to SEQ ID NO: 5.
[0067] In some aspects, R1 through R5 comprise the complete CAR coding region of the nucleic acid construct.
[0068] In other aspects, R6 encodes a cleavable linker. Examples of cleavable linkers include 2A linkers (for example T2A), 2A-like linkers or functional equivalents thereof and combinations thereof. In some embodiments, the linkers include the porcine teschovirus (P2A), virus (T2A) or combinations, variants and functional equivalents thereof. In one aspect, R6 encodes the P2A cleavable linker of SEQ ID NO: 6: GGATCCGGCGCAACAAACTTCTCTCTGCTGAAACAAGCCGGAGATGTCGAAGAGA ATCCTGGACCG (SEQ ID NO: 6) or a codon degenerate nucleic acid sequence thereof. Cleavable linkers positioned between the CAR coding region and an IL-7 coding region allow for separating the CAR polypeptide from the IL-7 polypeptide during expression. Thus, a single nucleic acid construct allows for a co-expression of a separate CAR polypeptide and IL-7 polypeptide. Any suitable linkers may be used within the nucleic acid construct described herein.
[0069] In one aspect, R7 encodes an interleukin-12 (IL-12) signaling peptide of SEQ ID NO: 7: ATGTGTCACCAGCAGTTGGTCATCTCTTGGTTTTCCCTGGTTTTTCTGGCATCTCCC CTCGTGGCC (SEQ ID NO: 7) or a codon degenerate nucleic acid sequence thereof. The signaling peptide positioned before the IL-7 coding region allows for secretion of the polypeptide outside the NK cell. Any suitable signaling peptide may be used within the nucleic acid construct described herein.
[0070] In another aspect, R8 encodes IL-7 of SEQ ID NO: 8: GATTGTGATATTGAAGGTAAAGATGGCAAACAATATGAGAGTGTTCTAATGGTCAGCATCGATCAATTATTGGACAGCATGAAAGAAATTGGTAGCAATTGCCTGAATAATGA ATTTAACTTTTTTAAAAGACATATCTGTGATGCTAATAAGGAAGGTATGTTTTTATTC CGTGCTGCTCGCAAGTTGAGGCAATTTCTTAAAATGAATAGCACTGGTGATTTTGAT CTCCACTTATTAAAAGTTTCAGAAGGCACAACAATACTGTTGAACTGCACTGGCCA GGTTAAAGGAAGAAAACCAGCTGCCCTGGGTGAAGCCCAACCAACAAAGAGTTTG GAAGAAAATAAATCTTTAAAGGAACAGAAAAAACTGAATGACTTGTGTTTCCTAAAG AGACTATTACAAGAGATAAAAACTTGTTGGAATAAAATTTTGATGGGCACTAAAGAA CAC (SEQ ID NO: 8) or a codon degenerate nucleic acid sequence thereof. In one aspect, the IL-7 of R8 comprises a nucleic acid sequence having at least 80% sequence identity (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity) to SEQ ID NO: 8. In some aspects, the IL-7 of R8 comprises a nucleic acid sequence having at least 85% sequence identity to SEQ ID NO: 8. In some aspects, the IL-7 of R8 comprises a nucleic acid sequence having at least 90% sequence identity to SEQ ID NO: 8. In some aspects, the IL-7 of R8 comprises a nucleic acid sequence having at least 95% sequence identity to SEQ ID NO: 8. In some aspects, the IL-7 of R8 comprises a nucleic acid sequence having at least 96% sequence identity to SEQ ID NO: 8. In some aspects, the IL-7 of R8 comprises a nucleic acid sequence having at least 97% sequence identity to SEQ ID NO: 8. In some aspects, the IL-7 of R8 comprises a nucleic acid sequence having at least 98% sequence identity to SEQ ID NO: 8. In some aspects, the IL-7 of R8 comprises a nucleic acid sequence having at least 99% sequence identity to SEQ ID NO: 8. In some aspects, the IL-7 of R8 comprises a nucleic acid sequence having 100% sequence identity to SEQ ID NO: 8.
[0071] In another aspect, a second linker may separate the IL-7 coding region with an IL7Rα coding region. Thus, in one aspect R9 comprises a T2A cleaving sequence of SEQ ID NO: 9: GGCAGCGGCGAGGGCAGGGGCAGCCTGCTGACCTGCGGCGACGTGGAGGAGAA CCCCGGCCCC (SEQ ID NO: 9) or a codon degenerate nucleic acid sequence thereof. The T2A cleaving sequence is positioned between IL-7 and IL7Rα. Thus, a single nucleic acid construct allows for a co-expression of a separate IL-7 polypeptide and IL7Rα polypeptide. Any suitable linkers may be used within the nucleic acid construct described herein.
[0072] In one aspect, R10 comprises an IL7Rα sequence of SEQ ID NO: 10:
[0073] ATGACCATCCTGGGCACCACCTTCGGCATGGTGTTCAGCCTGCTGCAGGTG GTGAGCGGCGAGAGCGGCTACGCCCAGAACGGCGACCTGGAGGACGCCGAGCT GGACGACTACAGCTTCAGCTGCTACAGCCAGCTGGAGGTGAACGGCAGCCAGCA CAGCCTGACCTGCGCCTTCGAGGACCCCGACGTGAACATCACCAACCTGGAGTTC GAGATCTGCGGCGCCCTGGTGGAGGTGAAGTGCCTGAACTTCAGGAAGCTGCAG GAGATCTACTTCATCGAGACCAAGAAGTTCCTGCTGATCGGCAAGAGCAACATCTG CGTGAAGGTGGGCGAGAAGAGCCTGACCTGCAAGAAGATCGACCTGACCACCAT CGTGAAGCCCGAGGCCCCCTTCGACCTGAGCGTGGTGTACAGGGAGGGCGCCAA CGACTTCGTGGTGACCTTCAACACCAGCCACCTGCAGAAGAAGTACGTGAAGGTG CTGATGCACGACGTGGCCTACAGGCAGGAGAAGGACGAGAACAAGTGGACCCAC GTGAACCTGAGCAGCACCAAGCTGACCCTGCTGCAGAGGAAGCTGCAGCCCGCC GCCATGTACGAGATCAAGGTGAGGAGCATCCCCGACCACTACTTCAAGGGCTTCT GGAGCGAGTGGAGCCCCAGCTACTACTTCAGGACCCCCGAGATCAACAACAGCA GCGGCGAGATGGACCCCATCCTGCTGACCATCAGCATCCTGAGCTTCTTCAGCGT GGCCCTGCTGGTGATCCTGGCCTGCGTGCTGTGGAAGAAGAGGATCAAGCCCAT CGTGTGGCCCAGCCTGCCCGACCACAAGAAGACCCTGGAGCACCTGTGCAAGAA GCCCAGGAAGAACCTGAACGTGAGCTTCAACCCCGAGAGCTTCCTGGACTGCCAG ATCCACAGGGTGGACGACATCCAGGCCAGGGACGAGGTGGAGGGCTTCCTGCAG GACACCTTCCCCCAGCAGCTGGAGGAGAGCGAGAAGCAGAGGCTGGGCGGCGA CGTGCAGAGCCCCAACTGCCCCAGCGAGGACGTGGTGATCACCCCCGAGAGCTT CGGCAGGGACAGCAGCCTGACCTGCCTGGCCGGCAACGTGAGCGCCTGCGACG CCCCCATCCTGAGCAGCAGCAGGAGCCTGGACTGCAGGGAGAGCGGCAAGAACG GCCCCCACGTGTACCAGGACCTGCTGCTGAGCCTGGGCACCACCAACAGCACCC TGCCCCCCCCCTTCAGCCTGCAGAGCGGCATCCTGACCCTGAACCCCGTGGCCC AGGGCCAGCCCATCCTGACCAGCCTGGGCAGCAACCAGGAGGAGGCCTACGTGA CCATGAGCAGCTTCTACCAGAACCAG (SEQ ID NO: 10) or a codon degenerate nucleic acid sequence thereof. In one aspect, the IL7Rα of R10 comprises a nucleic acid sequence having at least 80% sequence identity (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity) to SEQ ID NO: 10. In some aspects, he IL7Rα of R10 comprises a nucleic acid sequence having at least 85%sequence identity to SEQ ID NO: 10. In some aspects, the IL7Rα of R10 comprises a nucleic acid sequence having at least 90% sequence identity to SEQ ID NO: 10. In some aspects, the IL7Rα of R10 comprises a nucleic acid sequence having at least 95% sequence identity to SEQ ID NO: 10. In some aspects, the IL7Rα of R10 comprises a nucleic acid sequence having at least 96% sequence identity to SEQ ID NO: 10. In some aspects, he IL7Rα of R10 comprises a nucleic acid sequence having at least 97% sequence identity to SEQ ID NO: 10. In some aspects, the IL7Rα of R10 comprises a nucleic acid sequence having at least 98% sequence identity to SEQ ID NO: 10. In some aspects, the IL7Rα of R10 comprises a nucleic acid sequence having at least 99% sequence identity to SEQ ID NO: 10. In some aspects, the IL7Rα of R10 comprises a nucleic acid sequence having 100% sequence identity to SEQ ID NO: 10.
[0074] In another embodiment described herein the nucleic acid construct described herein comprises a CAR coding region and an IL-7 coding region. In one aspect, the nucleic acid construct described herein comprises the nucleic acid sequence of SEQ ID NO: 13: GACGTCGTGATGACCCAGACTCCAGCCTCCGTGTCTGAACCTGTGGGAGGCACAG TCACCATCAAGTGCCAGGCCAGTCAGAGGATTAGTAGTTACTTATCCTGGTATCAG CAGAAACCAGGGCAGCGTCCCAAGCTCCTGATCTTTGGTGCATCCACTCTGGCAT CTGGGGTCCCCTCGCGGTTCAAAGGCAGTGGATCTGGGACAGAATACACTCTCAC CATCAGCGACCTGGAGTGTGCCGATGCTGCCACTTACTACTGTCAGAGTTATGCTT ATTTTGATAGTAATAATTGGCATGCTTTCGGCGGAGGGACCGAGGTGGTGGTCggtg gaggtggcagcggaggaggtgggtccggcggtggaggaagcCAGCAGCAGCTGGAGGAGTCCGGG GGAGGCCTGGTCAAGCCTGAGGGATCCCTGACACTCACCTGCAAAGCCTCTGGAT TCGACCTCGGTTTCTACTTTTACGCCTGTTGGGTCCGCCAGGCTCCAGGGAAGGG CCTGGAGTGGATCGCATGCATTTATACTGCTGGTAGTGGTAGCACGTACTACGCG AGCTGGGCGAAAGGCCGATTCACCATCTCCAAAGCCTCGTCGACCACGGTGACTC TGCAAATGACCAGTCTGGCAGCCGCGGACACGGCCACCTATTTCTGTGCGAGATC TACTGCTAATACTAGAAGTACTTATTATCTTAACTTGTGGGGCCCAGGCACCCTGG TCACCGTCTCCTCAaccactaccccagcaccgaggccacccaccccggctcctaccatcgcctcccagcctct gtccctgcgtccggaggcatgtagacccgcagctggtggggccgtgcatacccggggtcttgacttcgcctgcgatatcta catttgggcccctctggctggtacttgcggggtcctgctgctttcactcgtgatcactctttactgtaagcgcggtcggaagaagctgctgtacatctttaagcaacccttcatgaggcctgtgcagactactcaagaggaggacggctgttcatgccggttccca gaggaggaggaaggcggctgcgaactgcgcgtgaaattcagccgcagcgcagatgctccagcctacaagcaggggc agaaccagctctacaacgaactcaatcttggtcggagagaggagtacgacgtgctggacaagcggagaggacggga cccagaaatgggcgggaagccgcgcagaaagaatccccaagagggcctgtacaacgagctccaaaaggataagat ggcagaagcctatagcgagattggtatgaaaggggaacgcagaagaggcaaaggccacgacggactgtaccaggg actcagcaccgccaccaaggacacctatgacgctcttcacatgcaggccctgccgcctcggGGATCCGGCGCA ACAAACTTCTCTCTGCTGAAACAAGCCGGAGATGTCGAAGAGAATCCTGGACCGAT GTGTCACCAGCAGTTGGTCATCTCTTGGTTTTCCCTGGTTTTTCTGGCATCTCCCCT CGTGGCCGATTGTGATATTGAAGGTAAAGATGGCAAACAATATGAGAGTGTTCTAA TGGTCAGCATCGATCAATTATTGGACAGCATGAAAGAAATTGGTAGCAATTGCCTG AATAATGAATTTAACTTTTTTAAAAGACATATCTGTGATGCTAATAAGGAAGGTATGT TTTTATTCCGTGCTGCTCGCAAGTTGAGGCAATTTCTTAAAATGAATAGCACTGGTG ATTTTGATCTCCACTTATTAAAAGTTTCAGAAGGCACAACAATACTGTTGAACTGCA CTGGCCAGGTTAAAGGAAGAAAACCAGCTGCCCTGGGTGAAGCCCAACCAACAAA GAGTTTGGAAGAAAATAAATCTTTAAAGGAACAGAAAAAACTGAATGACTTGTGTTT CCTAAAGAGACTATTACAAGAGATAAAAACTTGTTGGAATAAAATTTTGATGGGCAC TAAAGAACAC (SEQ ID NO: 13) or a codon degenerate nucleic acid sequence thereof.
[0075] In another embodiment described herein the nucleic acid construct described herein comprises a CAR coding region, an IL-7 coding region and an IL7Rα coding region. In one aspect, the nucleic acid construct described herein comprises the nucleic acid sequence of SEQ ID NO: 14: GACGTCGTGATGACCCAGACTCCAGCCTCCGTGTCTGAACCTGTGGGAGGCACAG TCACCATCAAGTGCCAGGCCAGTCAGAGGATTAGTAGTTACTTATCCTGGTATCAG CAGAAACCAGGGCAGCGTCCCAAGCTCCTGATCTTTGGTGCATCCACTCTGGCAT CTGGGGTCCCCTCGCGGTTCAAAGGCAGTGGATCTGGGACAGAATACACTCTCAC CATCAGCGACCTGGAGTGTGCCGATGCTGCCACTTACTACTGTCAGAGTTATGCTT ATTTTGATAGTAATAATTGGCATGCTTTCGGCGGAGGGACCGAGGTGGTGGTCggtg gaggtggcagcggaggaggtgggtccggcggtggaggaagcCAGCAGCAGCTGGAGGAGTCCGGG GGAGGCCTGGTCAAGCCTGAGGGATCCCTGACACTCACCTGCAAAGCCTCTGGAT TCGACCTCGGTTTCTACTTTTACGCCTGTTGGGTCCGCCAGGCTCCAGGGAAGGG CCTGGAGTGGATCGCATGCATTTATACTGCTGGTAGTGGTAGCACGTACTACGCGAGCTGGGCGAAAGGCCGATTCACCATCTCCAAAGCCTCGTCGACCACGGTGACTC TGCAAATGACCAGTCTGGCAGCCGCGGACACGGCCACCTATTTCTGTGCGAGATC TACTGCTAATACTAGAAGTACTTATTATCTTAACTTGTGGGGCCCAGGCACCCTGG TCACCGTCTCCTCAaccactaccccagcaccgaggccacccaccccggctcctaccatcgcctcccagcctct gtccctgcgtccggaggcatgtagacccgcagctggtggggccgtgcatacccggggtcttgacttcgcctgcgatatcta catttgggcccctctggctggtacttgcggggtcctgctgctttcactcgtgatcactctttactgtaagcgcggtcggaagaa gctgctgtacatctttaagcaacccttcatgaggcctgtgcagactactcaagaggaggacggctgttcatgccggttccca gaggaggaggaaggcggctgcgaactgcgcgtgaaattcagccgcagcgcagatgctccagcctacaagcaggggc agaaccagctctacaacgaactcaatcttggtcggagagaggagtacgacgtgctggacaagcggagaggacggga cccagaaatgggcgggaagccgcgcagaaagaatccccaagagggcctgtacaacgagctccaaaaggataagat ggcagaagcctatagcgagattggtatgaaaggggaacgcagaagaggcaaaggccacgacggactgtaccaggg actcagcaccgccaccaaggacacctatgacgctcttcacatgcaggccctgccgcctcggGGATCCGGCGCA ACAAACTTCTCTCTGCTGAAACAAGCCGGAGATGTCGAAGAGAATCCTGGACCGAT GTGTCACCAGCAGTTGGTCATCTCTTGGTTTTCCCTGGTTTTTCTGGCATCTCCCCT CGTGGCCGATTGTGATATTGAAGGTAAAGATGGCAAACAATATGAGAGTGTTCTAA TGGTCAGCATCGATCAATTATTGGACAGCATGAAAGAAATTGGTAGCAATTGCCTG AATAATGAATTTAACTTTTTTAAAAGACATATCTGTGATGCTAATAAGGAAGGTATGT TTTTATTCCGTGCTGCTCGCAAGTTGAGGCAATTTCTTAAAATGAATAGCACTGGTG ATTTTGATCTCCACTTATTAAAAGTTTCAGAAGGCACAACAATACTGTTGAACTGCA CTGGCCAGGTTAAAGGAAGAAAACCAGCTGCCCTGGGTGAAGCCCAACCAACAAA GAGTTTGGAAGAAAATAAATCTTTAAAGGAACAGAAAAAACTGAATGACTTGTGTTT CCTAAAGAGACTATTACAAGAGATAAAAACTTGTTGGAATAAAATTTTGATGGGCAC TAAAGAACACGGCAGCGGCGAGGGCAGGGGCAGCCTGCTGACCTGCGGCGACG TGGAGGAGAACCCCGGCCCCATGACCATCCTGGGCACCACCTTCGGCATGGTGTT CAGCCTGCTGCAGGTGGTGAGCGGCGAGAGCGGCTACGCCCAGAACGGCGACCT GGAGGACGCCGAGCTGGACGACTACAGCTTCAGCTGCTACAGCCAGCTGGAGGT GAACGGCAGCCAGCACAGCCTGACCTGCGCCTTCGAGGACCCCGACGTGAACAT CACCAACCTGGAGTTCGAGATCTGCGGCGCCCTGGTGGAGGTGAAGTGCCTGAA CTTCAGGAAGCTGCAGGAGATCTACTTCATCGAGACCAAGAAGTTCCTGCTGATCG GCAAGAGCAACATCTGCGTGAAGGTGGGCGAGAAGAGCCTGACCTGCAAGAAGA TCGACCTGACCACCATCGTGAAGCCCGAGGCCCCCTTCGACCTGAGCGTGGTGTACAGGGAGGGCGCCAACGACTTCGTGGTGACCTTCAACACCAGCCACCTGCAGAA GAAGTACGTGAAGGTGCTGATGCACGACGTGGCCTACAGGCAGGAGAAGGACGA GAACAAGTGGACCCACGTGAACCTGAGCAGCACCAAGCTGACCCTGCTGCAGAG GAAGCTGCAGCCCGCCGCCATGTACGAGATCAAGGTGAGGAGCATCCCCGACCA CTACTTCAAGGGCTTCTGGAGCGAGTGGAGCCCCAGCTACTACTTCAGGACCCCC GAGATCAACAACAGCAGCGGCGAGATGGACCCCATCCTGCTGACCATCAGCATCC TGAGCTTCTTCAGCGTGGCCCTGCTGGTGATCCTGGCCTGCGTGCTGTGGAAGAA GAGGATCAAGCCCATCGTGTGGCCCAGCCTGCCCGACCACAAGAAGACCCTGGA GCACCTGTGCAAGAAGCCCAGGAAGAACCTGAACGTGAGCTTCAACCCCGAGAGC TTCCTGGACTGCCAGATCCACAGGGTGGACGACATCCAGGCCAGGGACGAGGTG GAGGGCTTCCTGCAGGACACCTTCCCCCAGCAGCTGGAGGAGAGCGAGAAGCAG AGGCTGGGCGGCGACGTGCAGAGCCCCAACTGCCCCAGCGAGGACGTGGTGATC ACCCCCGAGAGCTTCGGCAGGGACAGCAGCCTGACCTGCCTGGCCGGCAACGTG AGCGCCTGCGACGCCCCCATCCTGAGCAGCAGCAGGAGCCTGGACTGCAGGGAG AGCGGCAAGAACGGCCCCCACGTGTACCAGGACCTGCTGCTGAGCCTGGGCACC ACCAACAGCACCCTGCCCCCCCCCTTCAGCCTGCAGAGCGGCATCCTGACCCTGA ACCCCGTGGCCCAGGGCCAGCCCATCCTGACCAGCCTGGGCAGCAACCAGGAGG AGGCCTACGTGACCATGAGCAGCTTCTACCAGAACCAGTGA (SEQ ID NO: 14) or a codon degenerate nucleic acid sequence thereof.
[0076] In another embodiment described herein is a nucleic acid construct comprising a M7-NK cell (aMSLN-CAR-NK-IL7) construct comprising a MSLN scFv coding region, a Hinge-TM coding region, a 4-1BB coding region, a CD3 coding region, a P2A coding region, a SP-12 coding region, and an IL-7 coding region. In one aspect, the nucleic acid construct comprises the nucleic acid sequence of SEQ ID NO: 15: gtcgacggatcgggagatctcccgatcccctatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagtat ctgctccctgcttgtgtgttggaggtcgctgagtagtgcgcgagcaaaatttaagctacaacaaggcaaggcttgaccgac aattgcatgaagaatctgcttagggttaggcgttttgcgctgcttcgcgatgtacgggccagatatacgcgttgacattgattat tgactagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaat ggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagg gactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagta cgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgact cacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgt cgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagcgcgttttgcctg tactgggtctctctggttagaccagatctgagcctgggagctctctggctaactagggaacccactgcttaagcctcaataa agcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagacccttttagtcagt gtggaaaatctctagcagtggcgcccgaacagggacttgaaagcgaaagggaaaccagaggagctctctcgacgca ggactcggcttgctgaagcgcgcacggcaagaggcgaggggcggcgactggtgagtacgccaaaaattttgactagc ggaggctagaaggagagagatgggtgcgagagcgtcagtattaagcgggggagaattagatcgcgatgggaaaaaa ttcggttaaggccagggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggagctagaacgattcg cagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactgggacagctacaaccatcccttcagacagga tcagaagaacttagatcattatataatacagtagcaaccctctattgtgtgcatcaaaggatagagataaaagacaccaag gaagctttagacaagatagaggaagagcaaaacaaaagtaagaccaccgcacagcaagcggccggccgctgatctt cagacctggaggaggagatatgagggacaattggagaagtgaattatataaatataaagtagtaaaaattgaaccatta ggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctttgttcc ttgggttcttgggagcagcaggaagcactatgggcgcagcgtcaatgacgctgacggtacaggccagacaattattgtct ggtatagtgcagcagcagaacaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcat caagcagctccaggcaagaatcctggctgtggaaagatacctaaaggatcaacagctcctggggatttggggttgctctg gaaaactcatttgcaccactgctgtgccttggaatgctagttggagtaataaatctctggaacagatttggaatcacacgac ctggatggagtgggacagagaaattaacaattacacaagcttaatacactccttaattgaagaatcgcaaaaccagcaa gaaaagaatgaacaagaattattggaattagataaatgggcaagtttgtggaattggtttaacataacaaattggctgtggt atataaaattattcataatgatagtaggaggcttggtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggc agggatattcaccattatcgtttcagacccacctcccaaccccgaggggacccgacaggcccgaaggaatagaagaag aaggtggagagagagacagagacagatccattcgattagtgaacggatcggcactgcgtgcgccaattctgcagacaa atggcagtattcatccacaattttaaaagaaaaggggggattggggggtacagtgcaggggaaagaatagtagacata atagcaacagacatacaaactaaagaattacaaaaacaaattacaaaaattcaaaattttcgggtttattacagggacag cagagatccagtttggttagtaccgggcccgctctagcgtgaggctccggtgcccgtcagtgggcagagcgcacatcgcc cacagtccccgagaagttggggggaggggtcggcaattgaaccggtgcctagagaaggtggcgcggggtaaactggg aaagtgatgtcgtgtactggctccgcctttttcccgagggtgggggagaaccgtatataagtgcagtagtcgccgtgaacgt tctttttcgcaacgggtttgccgccagaacacaggtaagtgccgtgtgtggttcccgcgggcctggcctctttacgggttatgg cccttgcgtgccttgaattacttccacctggctgcagtacgtgattcttgatcccgagcttcgggttggaagtgggtgggagag ttcgaggccttgcgcttaaggagccccttcgcctcgtgcttgagttgaggcctggcctgggcgctggggccgccgcgtgcgaatctggtggcaccttcgcgcctgtctcgctgctttcgataagtctctagccatttaaaatttttgatgacctgctgcgacgcttttt ttctggcaagatagtcttgtaaatgcgggccaagatctgcacactggtatttcggtttttggggccgcgggcggcgacgggg cccgtgcgtcccagcgcacatgttcggcgaggcggggcctgcgagcgcggccaccgagaatcggacgggggtagtct caagctggccggcctgctctggtgcctggcctcgcgccgccgtgtatcgccccgccctgggcggcaaggctggcccggt cggcaccagttgcgtgagcggaaagatggccgcttcccggccctgctgcagggagctcaaaatggaggacgcggcgc tcgggagagcgggcgggtgagtcacccacacaaaggaaaagggcctttccgtcctcagccgtcgcttcatgtgactcca cggagtaccgggcgccgtccaggcacctcgattagttctcgagcttttggagtacgtcgtctttaggttggggggaggggttt tatgcgatggagtttccccacactgagtgggtggagactgaagttaggccagcttggcacttgatgtaattctccttggaattt gccctttttgagtttggatcttggttcattctcaagcctcagacagtggttcaaagtttttttcttccatttcaggtgtcgtgagcggc cgctgagttaactattctagatggccctccctgtcaccgccctgctgcttccgctggctcttctgctccacgccgctcggcccta cccatacgacgttccagactacgctgctagcGACGTCGTGATGACCCAGACTCCAGCCTCCGTGT CTGAACCTGTGGGAGGCACAGTCACCATCAAGTGCCAGGCCAGTCAGAGGATTAG TAGTTACTTATCCTGGTATCAGCAGAAACCAGGGCAGCGTCCCAAGCTCCTGATCT TTGGTGCATCCACTCTGGCATCTGGGGTCCCCTCGCGGTTCAAAGGCAGTGGATC TGGGACAGAATACACTCTCACCATCAGCGACCTGGAGTGTGCCGATGCTGCCACT TACTACTGTCAGAGTTATGCTTATTTTGATAGTAATAATTGGCATGCTTTCGGCGGA GGGACCGAGGTGGTGGTCggtggaggtggcagcggaggaggtgggtccggcggtggaggaagcCAG CAGCAGCTGGAGGAGTCCGGGGGAGGCCTGGTCAAGCCTGAGGGATCCCTGACA CTCACCTGCAAAGCCTCTGGATTCGACCTCGGTTTCTACTTTTACGCCTGTTGGGT CCGCCAGGCTCCAGGGAAGGGCCTGGAGTGGATCGCATGCATTTATACTGCTGGT AGTGGTAGCACGTACTACGCGAGCTGGGCGAAAGGCCGATTCACCATCTCCAAAG CCTCGTCGACCACGGTGACTCTGCAAATGACCAGTCTGGCAGCCGCGGACACGG CCACCTATTTCTGTGCGAGATCTACTGCTAATACTAGAAGTACTTATTATCTTAACTT GTGGGGCCCAGGCACCCTGGTCACCGTCTCCTCAaccactaccccagcaccgaggccaccca ccccggctcctaccatcgcctcccagcctctgtccctgcgtccggaggcatgtagacccgcagctggtggggccgtgcat acccggggtcttgacttcgcctgcgatatctacatttgggcccctctggctggtacttgcggggtcctgctgctttcactcgtgat cactctttactgtaagcgcggtcggaagaagctgctgtacatctttaagcaacccttcatgaggcctgtgcagactactcaa gaggaggacggctgttcatgccggttcccagaggaggaggaaggcggctgcgaactgcgcgtgaaattcagccgcag cgcagatgctccagcctacaagcaggggcagaaccagctctacaacgaactcaatcttggtcggagagaggagtacg acgtgctggacaagcggagaggacgggacccagaaatgggcgggaagccgcgcagaaagaatccccaagaggg cctgtacaacgagctccaaaaggataagatggcagaagcctatagcgagattggtatgaaaggggaacgcagaagaggcaaaggccacgacggactgtaccagggactcagcaccgccaccaaggacacctatgacgctcttcacatgcaggc cctgccgcctcggGGATCCGGCGCAACAAACTTCTCTCTGCTGAAACAAGCCGGAGATG TCGAAGAGAATCCTGGACCGATGTGTCACCAGCAGTTGGTCATCTCTTGGTTTTCC CTGGTTTTTCTGGCATCTCCCCTCGTGGCCGATTGTGATATTGAAGGTAAAGATGG CAAACAATATGAGAGTGTTCTAATGGTCAGCATCGATCAATTATTGGACAGCATGA AAGAAATTGGTAGCAATTGCCTGAATAATGAATTTAACTTTTTTAAAAGACATATCTG TGATGCTAATAAGGAAGGTATGTTTTTATTCCGTGCTGCTCGCAAGTTGAGGCAATT TCTTAAAATGAATAGCACTGGTGATTTTGATCTCCACTTATTAAAAGTTTCAGAAGG CACAACAATACTGTTGAACTGCACTGGCCAGGTTAAAGGAAGAAAACCAGCTGCC CTGGGTGAAGCCCAACCAACAAAGAGTTTGGAAGAAAATAAATCTTTAAAGGAACA GAAAAAACTGAATGACTTGTGTTTCCTAAAGAGACTATTACAAGAGATAAAAACTTG TTGGAATAAAATTTTGATGGGCACTAAAGAACACTGAGCTAGCCTCGAGatcgataccgt cgacctcgatcgagacctagaaaaacatggagcaatcacaagtagcaatacagcagctaccaatgctgattgtgcctgg ctagaagcacaagaggaggaggaggtgggttttccagtcacacctcaggtacctttaagaccaatgacttacaaggcag ctgtagatcttagccactttttaaaagaaaaggggggactggaagggctaattcactcccaacgaagacaagatatccttg atctgtggatctaccacacacaaggctacttccctgattggcagaactacacaccagggccagggatcagatatccactg acctttggatggtgctacaagctagtaccagttgagcaagagaaggtagaagaagccaatgaaggagagaacacccg cttgttacaccctgtgagcctgcatgggatggatgacccggagagagaagtattagagtggaggtttgacagccgcctag catttcatcacatggcccgagagctgcatccggactgtactgggtctctctggttagaccagatctgagcctgggagctctct ggctaactagggaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgac tctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagcagcatgtgagcaaaaggccagcaaaa ggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcga cgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgct ctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctg taggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgcc ttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggatt agcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagaacagtattt ggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggt agcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacgggg tctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatcctttta aattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttac catctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagc cggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagt aagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggctt cattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcct ccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccat ccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcc cggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcga aaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttacttt caccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgt tgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttag aaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgac (M7, SEQ ID NO: 15) or a codon degenerate nucleic acid sequence thereof.
[0077] In another embodiment described herein the nucleic acid construct described herein comprises a M7R-NK cell (aMSLN-CAR-NK-IL7-IL7Rα) construct comprising a MSLN scFv coding region, a Hinge-TM coding region, a 4-1BB coding region, a CD3 coding region, a P2A coding region, a SP-12 coding region, an IL-7 coding region, a T2A coding region, and an IL7Ra coding region. In one aspect, the nucleic acid construct comprises the nucleic acid sequence of SEQ ID NO: 16: gtcgacggatcgggagatctcccgatcccctatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagtat ctgctccctgcttgtgtgttggaggtcgctgagtagtgcgcgagcaaaatttaagctacaacaaggcaaggcttgaccgac aattgcatgaagaatctgcttagggttaggcgttttgcgctgcttcgcgatgtacgggccagatatacgcgttgacattgattat tgactagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaat ggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagg gactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagta cgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttgg cagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgact cacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgt cgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagcgcgttttgcctg tactgggtctctctggttagaccagatctgagcctgggagctctctggctaactagggaacccactgcttaagcctcaataa agcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagcagtggcgcccgaacagggacttgaaagcgaaagggaaaccagaggagctctctcgacgca ggactcggcttgctgaagcgcgcacggcaagaggcgaggggcggcgactggtgagtacgccaaaaattttgactagc ggaggctagaaggagagagatgggtgcgagagcgtcagtattaagcgggggagaattagatcgcgatgggaaaaaa ttcggttaaggccagggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggagctagaacgattcg cagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactgggacagctacaaccatcccttcagacagga tcagaagaacttagatcattatataatacagtagcaaccctctattgtgtgcatcaaaggatagagataaaagacaccaag gaagctttagacaagatagaggaagagcaaaacaaaagtaagaccaccgcacagcaagcggccggccgctgatctt cagacctggaggaggagatatgagggacaattggagaagtgaattatataaatataaagtagtaaaaattgaaccatta ggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctttgttcc ttgggttcttgggagcagcaggaagcactatgggcgcagcgtcaatgacgctgacggtacaggccagacaattattgtct ggtatagtgcagcagcagaacaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcat caagcagctccaggcaagaatcctggctgtggaaagatacctaaaggatcaacagctcctggggatttggggttgctctg gaaaactcatttgcaccactgctgtgccttggaatgctagttggagtaataaatctctggaacagatttggaatcacacgac ctggatggagtgggacagagaaattaacaattacacaagcttaatacactccttaattgaagaatcgcaaaaccagcaa gaaaagaatgaacaagaattattggaattagataaatgggcaagtttgtggaattggtttaacataacaaattggctgtggt atataaaattattcataatgatagtaggaggcttggtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggc agggatattcaccattatcgtttcagacccacctcccaaccccgaggggacccgacaggcccgaaggaatagaagaag aaggtggagagagagacagagacagatccattcgattagtgaacggatcggcactgcgtgcgccaattctgcagacaa atggcagtattcatccacaattttaaaagaaaaggggggattggggggtacagtgcaggggaaagaatagtagacata atagcaacagacatacaaactaaagaattacaaaaacaaattacaaaaattcaaaattttcgggtttattacagggacag cagagatccagtttggttagtaccgggcccgctctagcgtgaggctccggtgcccgtcagtgggcagagcgcacatcgcc cacagtccccgagaagttggggggaggggtcggcaattgaaccggtgcctagagaaggtggcgcggggtaaactggg aaagtgatgtcgtgtactggctccgcctttttcccgagggtgggggagaaccgtatataagtgcagtagtcgccgtgaacgt tctttttcgcaacgggtttgccgccagaacacaggtaagtgccgtgtgtggttcccgcgggcctggcctctttacgggttatgg cccttgcgtgccttgaattacttccacctggctgcagtacgtgattcttgatcccgagcttcgggttggaagtgggtgggagag ttcgaggccttgcgcttaaggagccccttcgcctcgtgcttgagttgaggcctggcctgggcgctggggccgccgcgtgcg aatctggtggcaccttcgcgcctgtctcgctgctttcgataagtctctagccatttaaaatttttgatgacctgctgcgacgcttttt ttctggcaagatagtcttgtaaatgcgggccaagatctgcacactggtatttcggtttttggggccgcgggcggcgacgggg cccgtgcgtcccagcgcacatgttcggcgaggcggggcctgcgagcgcggccaccgagaatcggacgggggtagtct caagctggccggcctgctctggtgcctggcctcgcgccgccgtgtatcgccccgccctgggcggcaaggctggcccggt cggcaccagttgcgtgagcggaaagatggccgcttcccggccctgctgcagggagctcaaaatggaggacgcggcgctcgggagagcgggcgggtgagtcacccacacaaaggaaaagggcctttccgtcctcagccgtcgcttcatgtgactcca cggagtaccgggcgccgtccaggcacctcgattagttctcgagcttttggagtacgtcgtctttaggttggggggaggggttt tatgcgatggagtttccccacactgagtgggtggagactgaagttaggccagcttggcacttgatgtaattctccttggaattt gccctttttgagtttggatcttggttcattctcaagcctcagacagtggttcaaagtttttttcttccatttcaggtgtcgtgagcggc cgctgagttaactattctagatggccctccctgtcaccgccctgctgcttccgctggctcttctgctccacgccgctcggcccta cccatacgacgttccagactacgctgctagcGACGTCGTGATGACCCAGACTCCAGCCTCCGTGT CTGAACCTGTGGGAGGCACAGTCACCATCAAGTGCCAGGCCAGTCAGAGGATTAG TAGTTACTTATCCTGGTATCAGCAGAAACCAGGGCAGCGTCCCAAGCTCCTGATCT TTGGTGCATCCACTCTGGCATCTGGGGTCCCCTCGCGGTTCAAAGGCAGTGGATC TGGGACAGAATACACTCTCACCATCAGCGACCTGGAGTGTGCCGATGCTGCCACT TACTACTGTCAGAGTTATGCTTATTTTGATAGTAATAATTGGCATGCTTTCGGCGGA GGGACCGAGGTGGTGGTCggtggaggtggcagcggaggaggtgggtccggcggtggaggaagcCAG CAGCAGCTGGAGGAGTCCGGGGGAGGCCTGGTCAAGCCTGAGGGATCCCTGACA CTCACCTGCAAAGCCTCTGGATTCGACCTCGGTTTCTACTTTTACGCCTGTTGGGT CCGCCAGGCTCCAGGGAAGGGCCTGGAGTGGATCGCATGCATTTATACTGCTGGT AGTGGTAGCACGTACTACGCGAGCTGGGCGAAAGGCCGATTCACCATCTCCAAAG CCTCGTCGACCACGGTGACTCTGCAAATGACCAGTCTGGCAGCCGCGGACACGG CCACCTATTTCTGTGCGAGATCTACTGCTAATACTAGAAGTACTTATTATCTTAACTT GTGGGGCCCAGGCACCCTGGTCACCGTCTCCTCAaccactaccccagcaccgaggccaccca ccccggctcctaccatcgcctcccagcctctgtccctgcgtccggaggcatgtagacccgcagctggtggggccgtgcat acccggggtcttgacttcgcctgcgatatctacatttgggcccctctggctggtacttgcggggtcctgctgctttcactcgtgat cactctttactgtaagcgcggtcggaagaagctgctgtacatctttaagcaacccttcatgaggcctgtgcagactactcaa gaggaggacggctgttcatgccggttcccagaggaggaggaaggcggctgcgaactgcgcgtgaaattcagccgcag cgcagatgctccagcctacaagcaggggcagaaccagctctacaacgaactcaatcttggtcggagagaggagtacg acgtgctggacaagcggagaggacgggacccagaaatgggcgggaagccgcgcagaaagaatccccaagaggg cctgtacaacgagctccaaaaggataagatggcagaagcctatagcgagattggtatgaaaggggaacgcagaaga ggcaaaggccacgacggactgtaccagggactcagcaccgccaccaaggacacctatgacgctcttcacatgcaggc cctgccgcctcggGGATCCGGCGCAACAAACTTCTCTCTGCTGAAACAAGCCGGAGATG TCGAAGAGAATCCTGGACCGATGTGTCACCAGCAGTTGGTCATCTCTTGGTTTTCC CTGGTTTTTCTGGCATCTCCCCTCGTGGCCGATTGTGATATTGAAGGTAAAGATGG CAAACAATATGAGAGTGTTCTAATGGTCAGCATCGATCAATTATTGGACAGCATGAAAGAAATTGGTAGCAATTGCCTGAATAATGAATTTAACTTTTTTAAAAGACATATCTG TGATGCTAATAAGGAAGGTATGTTTTTATTCCGTGCTGCTCGCAAGTTGAGGCAATT TCTTAAAATGAATAGCACTGGTGATTTTGATCTCCACTTATTAAAAGTTTCAGAAGG CACAACAATACTGTTGAACTGCACTGGCCAGGTTAAAGGAAGAAAACCAGCTGCC CTGGGTGAAGCCCAACCAACAAAGAGTTTGGAAGAAAATAAATCTTTAAAGGAACA GAAAAAACTGAATGACTTGTGTTTCCTAAAGAGACTATTACAAGAGATAAAAACTTG TTGGAATAAAATTTTGATGGGCACTAAAGAACACGGCAGCGGCGAGGGCAGGGGC AGCCTGCTGACCTGCGGCGACGTGGAGGAGAACCCCGGCCCCATGACCATCCTG GGCACCACCTTCGGCATGGTGTTCAGCCTGCTGCAGGTGGTGAGCGGCGAGAGC GGCTACGCCCAGAACGGCGACCTGGAGGACGCCGAGCTGGACGACTACAGCTTC AGCTGCTACAGCCAGCTGGAGGTGAACGGCAGCCAGCACAGCCTGACCTGCGCC TTCGAGGACCCCGACGTGAACATCACCAACCTGGAGTTCGAGATCTGCGGCGCCC TGGTGGAGGTGAAGTGCCTGAACTTCAGGAAGCTGCAGGAGATCTACTTCATCGA GACCAAGAAGTTCCTGCTGATCGGCAAGAGCAACATCTGCGTGAAGGTGGGCGAG AAGAGCCTGACCTGCAAGAAGATCGACCTGACCACCATCGTGAAGCCCGAGGCCC CCTTCGACCTGAGCGTGGTGTACAGGGAGGGCGCCAACGACTTCGTGGTGACCTT CAACACCAGCCACCTGCAGAAGAAGTACGTGAAGGTGCTGATGCACGACGTGGCC TACAGGCAGGAGAAGGACGAGAACAAGTGGACCCACGTGAACCTGAGCAGCACC AAGCTGACCCTGCTGCAGAGGAAGCTGCAGCCCGCCGCCATGTACGAGATCAAG GTGAGGAGCATCCCCGACCACTACTTCAAGGGCTTCTGGAGCGAGTGGAGCCCC AGCTACTACTTCAGGACCCCCGAGATCAACAACAGCAGCGGCGAGATGGACCCCA TCCTGCTGACCATCAGCATCCTGAGCTTCTTCAGCGTGGCCCTGCTGGTGATCCT GGCCTGCGTGCTGTGGAAGAAGAGGATCAAGCCCATCGTGTGGCCCAGCCTGCC CGACCACAAGAAGACCCTGGAGCACCTGTGCAAGAAGCCCAGGAAGAACCTGAAC GTGAGCTTCAACCCCGAGAGCTTCCTGGACTGCCAGATCCACAGGGTGGACGACA TCCAGGCCAGGGACGAGGTGGAGGGCTTCCTGCAGGACACCTTCCCCCAGCAGC TGGAGGAGAGCGAGAAGCAGAGGCTGGGCGGCGACGTGCAGAGCCCCAACTGC CCCAGCGAGGACGTGGTGATCACCCCCGAGAGCTTCGGCAGGGACAGCAGCCTG ACCTGCCTGGCCGGCAACGTGAGCGCCTGCGACGCCCCCATCCTGAGCAGCAGC AGGAGCCTGGACTGCAGGGAGAGCGGCAAGAACGGCCCCCACGTGTACCAGGAC CTGCTGCTGAGCCTGGGCACCACCAACAGCACCCTGCCCCCCCCCTTCAGCCTGCAGAGCGGCATCCTGACCCTGAACCCCGTGGCCCAGGGCCAGCCCATCCTGACCA GCCTGGGCAGCAACCAGGAGGAGGCCTACGTGACCATGAGCAGCTTCTACCAGA ACCAGTGAGCTAGCCTCGAGatcgataccgtcgacctcgatcgagacctagaaaaacatggagcaatcac aagtagcaatacagcagctaccaatgctgattgtgcctggctagaagcacaagaggaggaggaggtgggttttccagtc acacctcaggtacctttaagaccaatgacttacaaggcagctgtagatcttagccactttttaaaagaaaaggggggactg gaagggctaattcactcccaacgaagacaagatatccttgatctgtggatctaccacacacaaggctacttccctgattgg cagaactacacaccagggccagggatcagatatccactgacctttggatggtgctacaagctagtaccagttgagcaag agaaggtagaagaagccaatgaaggagagaacacccgcttgttacaccctgtgagcctgcatgggatggatgacccg gagagagaagtattagagtggaggtttgacagccgcctagcatttcatcacatggcccgagagctgcatccggactgtac tgggtctctctggttagaccagatctgagcctgggagctctctggctaactagggaacccactgcttaagcctcaataaagc ttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtgg aaaatctctagcagcatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttcc ataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataa agataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgccttt ctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggct gtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacg acttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaag tggtggcctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaaga gttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaa aaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttg gtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagt aaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctga ctccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacg ctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatcc gcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattg ctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgat cccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactc atggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtc attctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaa ctttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgt aacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatc agggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccga aaagtgccacctgac (M7R, SEQ ID NO: 16) or a codon degenerate nucleic acid sequence thereof.
[0078] Also described herein are a nucleic acid for engineering a natural killer (NK) cell comprising SEQ ID NO.15 or SEQ ID NO: 16.
[0079] In some aspects, the nucleic constructs described herein are engineered into a recombinant vector. In order to obtain expression of the nucleic acid sequences, the sequences may be incorporated in a vector having one or more control sequences operably linked to the nucleic acid to control its expression. The vectors may include other sequences such as promoters or enhancers to drive the expression of the inserted nucleic acid, nucleic acid sequences so that the polypeptide or peptide is produced as a fusion and / or nucleic acid encoding secretion signals so that the polypeptide produced in the host cell is secreted from the cell. Polypeptide can then be obtained by transforming the vectors into host NK cells in which the vector is functional, culturing the host cells so that the polypeptide is produced and recovering the polypeptide from the host cells or the surrounding medium. Prokaryotic and eukaryotic cells are used for this purpose in the art, including strains of E. coli, yeast, and eukaryotic cells such as COS or CHO cells. Suitable vectors include, but are not limited to, plasmids, transposons, bacteriophages, cosmids or virus based vectors. Vectors may contain polynucleotide sequences which are necessary to effect ligation or insertion of the vector into a desired host cell and to effect the expression of the attached segment. Such sequences differ depending on the host organism; they include promoter sequences to effect transcription, enhancer sequences to increase transcription, ribosomal binding site sequences and transcription and translation termination sequences. Alternatively, expression vectors may be capable of directly expressing nucleic acid sequence products encoded therein without ligation or integration of the vector into host cell DNA sequences. In some aspects, the vector is an “episomal expression vector” or “episome,” which is able to replicate in a host cell, and persists as an extrachromosomal segment of DNA within the host cell in the presence of appropriate selective pressure (see, e.g., Conese et al., Gene Therapy,11:1735-1742 (2004)). Representative commercially available episomal expression vectors include, but are not limited to, episomal plasmids that utilize Epstein Barr Nuclear Antigen 1 (EBNA1) and the Epstein Barr Virus (EBV) origin of replication (oriP). The vectors pREP4, pCEP4, pREP7, and pcDNA3.1 from Invitrogen (Carlsbad, Calif.) and pBK-CMV from Stratagene (La Jolla, Calif.) represent non-limiting examples of an episomal vector that uses T-antigen and the SV40 origin of replication in lieu of EBNA1 and oriP. However, any suitable vector may be used.
[0080] In some aspects, the NK cells described herein are autologous with respect to the subject receiving the cells. In some aspects, the cells are allogeneic to the subject receiving the cells, that is, the cells have a complete or at least partial HLA-match with the subject. For example, the cells can be obtained from one subject and administered to the same subject (autologous) or a different, compatible subject (allogeneic).
[0081] Pharmaceutical compositions comprising the modified NK cells described herein are also contemplated, and may further comprise buffers such as neutral buffered saline, phosphate buffered saline and the like; carbohydrates such as glucose, mannose, sucrose or dextrans, mannitol; proteins; polypeptides or amino acids such as glycine; antioxidants; chelating agents such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and preservatives. Compositions of the present disclosure may be formulated for cellular infusion, parenteral administration, e.g., intravascular (intravenous or intra–arterial), intraperitoneal, intramuscular administration. Thus, another aspect described herein is a pharmaceutical composition comprising the nucleic acid constructs or vectors described herein.
[0082] In some aspects, compositions contemplated herein comprise an effective amount of an expanded modified NK cell composition, alone or in combination with one or more therapeutic agents. Thus, the NK cell compositions described herein may be administered alone or in combination with other known cancer treatments, such as radiation therapy, chemotherapy, or immunotherapy. Exemplary therapeutic agents contemplated include cytokines, growth factors, steroids, NSAIDs, DMARDs, anti–inflammatories, chemotherapeutics, radiotherapeutics, therapeutic antibodies, or other active and ancillary agents.
[0083] Another aspect described herein is a method of treating a cancer in a subject in need thereof comprising administering an effective amount, e.g., therapeutically effective amount of a composition comprising the modified NK cells expressing the nucleic acid constructs as described herein. The quantity and frequency of administration will be determined by such factors as the condition of the patient, and the type and severity of the patient's disease, although appropriate dosages may be determined by clinical trials. In some aspects the cancer may be any cancer. Exemplary cancers include, but are not limited to, malignant mesothelioma, pancreatic cancer, ovarian cancer, lung adenocarcinoma, endometrial cancer, biliary cancer, gastric cancer, or pediatric acute myeloid leukemia cancer. In some aspects the cancer is pancreatic cancer. In other aspects the cancer is ovarian cancer. Other cancers which may overexpress MSLN are also contemplated herein.
[0084] In some aspects, the compositions and methods contemplated herein may be used for treating a cancer in a subject in need thereof, in combination with one or more additional therapies to treat cancer, for example, radiation, surgery, transplantation, chemotherapy, immunotherapy, hormone therapy, targeted therapy, or other engineered cell therapies. Use of the engineered NK cells of the of the present disclosure in combination with chemotherapy or other immunotherapy is contemplated. In aspects, the additional treatment is directed to targeting similar or the same antigens (e.g., one or more engineered NK cells of provided herein may be used in combination, such as engineered cells expressing CD8+ and engineered cells expressing CD3+ at the cell surface). As used herein, “combination” therapy or use in combination refers to the administration of the engineered NK cells of the present disclosure to a patient in conjunction with (i.e., before, simultaneously, or following) any number of relevant treatments.
[0085] In some aspects, the engineered NK cells of the disclosure and compositions thereof may be administered alone or in combination with effective amount one or more therapeutic agents. Thus, the CAR-NK cells and compositions described herein may be administered alone or in combination with other known cancer treatments, such as CAR-T therapy, radiation therapy, chemotherapy, surgery, or immunotherapy. Exemplary therapeutic agents contemplated include cytokines, growth factors, steroids,NSAIDs, DMARDs, anti–inflammatories, chemotherapeutics, radiotherapeutics, therapeutic antibodies, or other active and ancillary anti-cancer agents.
[0086] Anti-cancer agents that may be used in combination with the described engineered NK cells and CAR cells are known in the art. See, e.g., U.S. Patent No. 9,101,622 (Section 5.2 thereof). An “anti-cancer” agent is capable of negatively affecting cancer in a subject, for example, by killing cancer cells, inducing apoptosis in cancer cells, reducing the growth rate of cancer cells, reducing the incidence or number of metastases, reducing tumor size, inhibiting tumor growth, reducing the blood supply to a tumor or cancer cells, promoting an immune response against cancer cells or a tumor, preventing or inhibiting the progression of cancer, or increasing the lifespan of a subject with cancer. More generally, these other compositions would be provided in a combined amount effective to kill or inhibit proliferation of cancerous cells. This process may involve contacting the cancer cells with recipient cells and the agent(s) or multiple factor(s) at the same time. This may be achieved by contacting the cancer cells with a single composition or pharmacological formulation that includes both agents, or by contacting the cancer cells with two distinct compositions or formulations, at the same time, wherein one composition includes recipient cells and the other includes the second agent(s).
[0087] Although the foregoing disclosure has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be readily apparent to one of ordinary skill in the art in light of the teachings of this disclosure that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims. The following examples are provided by way of illustration only and not by way of limitation. Those skilled in the art will readily recognize a variety of noncritical parameters that could be changed or modified to yield essentially similar results. EXAMPLES Example 1
[0088] NK and T cell isolation and culture
[0089] NK cells were obtained from leukapheresis collars of anonymous healthy donors through Ficoll-Paque density gradient using a RosetteSep™ human NK cell enrichment kit (Stemcell™ technologies #15065). Purified NK cells were cultured in RPMI media (Sigma #11875- 119) with 10% heat-inactivated FBS (Sigma #10082-147), 2 mM L- Glutamine (ThermoFisher #25030081), 1% penicillin / streptomycin (Pen / Strep, Sigma #15140-122), and HEPES in the presence of 1 ng / mL of IL-15 (R&D, #219-IL-005 / CF) and incubated at 37 °C.
[0090] T cells were isolated from the peripheral blood mononuclear cells (PBMCs) of anonymous healthy donors using EasySep™ Release Human CD3 Positive Selection Kit (Stemcell™ #17751) following the manufacturer's instructions. Subsequently, 5 x 106T cells were activated in 5 mL TexMACS media with 50 U / mL IL-2 (Miltenyi #130- 097-746) and 50 μL of TransAct beads (Miltenyi #130-111-160) and incubated at 37 °C for three days. NK and T cells were isolated from the same donor to perform co-culture experiments. Example 2
[0091] Generation of CIML NK cells
[0092] To generate Cytokine-induced memory-like (CIML) NK cells, conventional NK cells were pre-activated with 10 ng / mL IL-12 (R&D, #219-IL-005 / CF), 50 ng / mL IL-15 (R&D, #219-IL-005 / CF), and 50 ng / mL IL-18 (R&D, #9124-IL-010 / CF) for 12-18 hours at 37°C. Following this activation period, cells were washed twice and rested in media with 1 ng / mL IL-15 (R&D, #219-IL-005 / CF). Example 3
[0093] NK cell transduction
[0094] CIML NK cells were used for NK cell transduction. 48-well plates were coated with 20 µg / mL RetroNectin® for 2 hours at room temperature, followed by blocking with 2% BSA solution for 30 minutes. After a PBS wash post-blocking, plates were treated with 10 µg / mL Vectofusion®-1. Then, CIML NK cells (250,000 per well) and BaEV virus were added to the plate, at MOI of 1 to 2.5, previously titrated using Jurkat cells. Spinfection was performed for 90 minutes at 1000 rcf at 37 °C. After spinfection, NKMACS media (Miltenyi #130-114-429) with 5% human serum (HS, Sigma # H3667), and 1% Pen / Strep, supplemented with 500 U / mL IL-2 (Miltenyi #130-097-746) was added to the transduced NK cells. After a three-day incubation, transduced NK cells were washed and cultured in NK MACS medium supplemented with 500 U / mL IL-2 (Miltenyi #130-097-746). Media was replaced every other day.
[0095] Three CAR constructs were designed: (1) Mesothelin (MSLN)-CAR (M), (2) MSLN-CAR secreting IL7 (M7) (SEQ ID NO: 15) and (3) MSLN-CAR expressing IL7Rα and secreting IL7 (M7R) (SEQ ID NO: 16). A visual representation of the three constructs is shown in Fig.1A.
[0096] Flow cytometry assessed NK cell transduction by staining them with the following antibodies: CD56-PE (clone HCD56, BioLegend® #318306), HA tag-APC (clone HA.11, BioLegend® #901523), IL7Rα-PE (clone A019D5, BioLegend® #351340), GFP, and live dead (ThermoFisher #L34964). As seen in Fig.1B, the NK cells transduced by the tested constructs was analyzed through expression of HA tag on the surface of the CAR-NK cells. Fig.1B shows the M7R-NK cells exhibited the largest percentage of IL7Rα in the CAR-NK cells, significantly higher compared to M-NK cells and M7-NK cells, at approximately 50% (Fig.1B). IL-7 release was quantified using an ELISA kit (Abcam® #ab270218). Fig.1C shows the quantification of IL-7 secreted by the CAR- NK cells transduced wit the three constructs. M7R-NK cells secrete the most IL-7, at between 1000-3000 pg / mL, followed by M7-NK cells secreting between 500-1500 pg / mL (Fig.1C). Later, CAR-CIML NK cells were enriched using EasySep™ Release APC positive Selection kit (StemCell™ #100-0031), previously stained with HA tag-APC (clone HA.11, BioLegend® #901523). Example 4
[0097] T cell transduction
[0098] CD3+T cell transduction was similar to the NK cell transduction protocol, but VSV-G lentiviral supernatants were used instead of BaEV. After spinfection, T cells were cultured in TexMACS media with 50 U / mL IL-2 (Miltenyi #130-097-746). Flow cytometry assessed T cell transduction via CD3-APC (clone HIT3a, BioLegend® #300312), HA tag-FITC (clone 16B12, BioLegend® #901507), GFP, and live dead(ThermoFisher #L34964). Later, CAR-T cells were sorted based on the GFP+cells and cultured in TexMACS media with 50 U / mL IL-2 (Miltenyi #130-097-746). Example 5
[0099] NK cell proliferation assay
[0100] CAR-NK cells (M-, M7-, and M7R-NK cells) were labeled with CellTrace™ Violet (CTV) dye to assess their proliferation capacity. CTV+NK cells were cultured in a 96- well plate at a concentration of 50 x 103NK cells per well in RPMI (Sigma #11875- 119) supplemented with 10% heat-inactivated FBS (Sigma #10082-147), 2 mM L-Glutamine (ThermoFisher #25030081), 1% penicillin / streptomycin (Pen / Strep, Sigma #15140-122), and HEPES in the presence of 1 ng / mL of IL-15 (R&D, #219-IL-005 / CF) for 12 days. Fresh media was added every other day. At days 9 and 12, NK cells were collected and stained with CD56-PE (clone HCD56, BioLegend® #318306), CD16-APCCy7 (clone 3G8, BioLegend® #302018), HA-FITC (clone 16B12, BioLegend® #901507), IL7Rα-APC (clone A019D5, BioLegend® #351316), and live / dead dye (ThermoFisher #L34959) for 30 minutes at 4°C. Then, cells were washed and acquired using flow cytometry. This approach allowed for the evaluation of NK cell proliferation by measuring the percentage of NK cells in each cell division. The percentage of NK cells in each generation is shown in Fig.2A. NK cells transduced with M-NK and M7-NK are mostly in generation 0 (G0), whereas the majority of M7R-NK cells are in multiple generations (i.e. G0, G1, G2, G3, G4+). The intensity of the CTV signal and the percentage of CTV-negative NK cells were also quantified, as in Fig.2B. The results show that the % of CTV-negative cells in M-NK cells as a mean of 14.3%, for M7-NK cells, a mean of 13.5%, and for M7R-NK cells, 59.5%. The percentage for NK cells transduced with M7R was significantly higher compared to M-NK and M7-NK (Fig.2B). Example 6
[0101] NK cell functional assay
[0102] To evaluate NK cell function, the levels of CD107a (indicative of NK cell degranulation) and IFN-γ molecules released by NK cells were measured during the co- culture with pancreatic tumor cell lines (ASPC1 and Capan-2 cell lines) at an E: T ratioof 2:1. On day 1, 25 x 103cancer cells were plated per well and incubated overnight. NK cells were cultured for 6 h or 24 h in RPMI media (Sigma #11875- 119) with 10% heat-inactivated FBS (Sigma #10082-147), 2 mM L-Glutamine (ThermoFisher #25030081), 1% penicillin / streptomycin (Pen / Strep, Sigma #15140-122), and HEPES in the presence of 1 ng / mL of IL-15 (R&D, #219-IL-005 / CF). In the last 5 h of incubation, GolgiPlug and GolgiStop (Brefeldin A and Monensin, BD biosciences) were added to the culture. After 5 hours, cells were collected and a 30-minute staining for extracellular surface proteins was performed at 4 °C with the following antibodies: CD56-PE (clone HCD56, BioLegend® #318306), CD3-BV510 (BioLegend® #300448), CD16-A700 (BioLegend® #360718), HA-FITC (BioLegend® #901507), and CD107a-APC (BioLegend® #328620), as well as live / dead dye (ThermoFisher #L34964). Then, cells were washed with staining buffer and fixed for 30 minutes (BD Cytofix / Cytoperm #554714). After fixation and washing, intracellular staining of IFNγ-PECy7 (BioLegend® #506518) was done for 30 minutes at 4 °C. Data was reported as a fold change of the percentage of CD107a and IFNγ-positive NK cells, calculated by gating on CD56+CD3- NK cells.
[0103] Quantification of IFN-γ for the NK cells engineered with IL7 or IL7R (M7-NK cells and M7R-NK cells, respectively) shows that IFN-γ increased significantly in an ASPC1 cell line for NK cells transduced with M7R, as well as a highly significant increase in IFN-γ in a Capan-2 cell line (Fig.2C). M7R showed a 3.9-fold increased IFN-γ production versus M7 (0.9, p=0.0002) and M (1, p=0.0005). Monitoring of the fold increase of CD107a expression mirrored the findings for IFN-γ for the same NK cells. That is, NK cells engineered with IL7 and IL7R (M7R-NK cells) showed a significant increase in CD107a in both ASPC1 and Capan-2 cell lines (Fig.2D). The incorporation of IL7Rα and IL7 also led to increased expression of NKp30, NKp46, pSTAT1 and pSTAT5. Example 7
[0104] T-cell proliferation assay
[0105] CAR-T cells were labeled with CTV dye to assess their proliferation capacity. 96- well plates were coated with MSLN+target cells (ASPC1 and Capan-2 cell lines) at aconcentration of 1 x 104cells per well and incubated at 37 C overnight. Then, 50 x 103CTV+T cells were co-cultured with NK cells in a 1:1 ratio and placed on pre-coated plates (with Capan-2, ASPC1, or no target cells) for 12 days. The cell culture media used was RPMI with 10% FBS, 1% Pen / Strep, and 1 ng / mL IL-15, replaced every three days. The immune cells were transferred to a new target cell-coated plate every three days to ensure the presence of target cells during the whole experiment. On days 9 and 12, cells were collected and stained for CD56-PE (BioLegend® #318306), CD3- APC (clone UCHT1, BioLegend® #300412), CD8-APCCy7 (clone RPA-T8, BioLegend® #301016), CD4-A700 (clone SK3, BioLegend® #344622), HA-FITC (clone 16B12, BioLegend® #901507), CTV-BV421 and live / dead dye (ThermoFisher #L34959) for 30 minutes at 4 °C. Then, cells were washed and acquired. This approach evaluated CAR-T cell proliferation by analyzing the percentage of CTV+CAR-T cells in cell divisions. The intensity of the CTV signal and percentage of CTV-negative T cells were also quantified.
[0106] This experiment evaluated the Buddy-CAR system’s ability to stimulate bystander T cells by co-culturing IL7-releasing CAR-NK cells (M7 and M7R) with donor- matched MSLN-CAR T cells in a 1:1 ratio. In the CTV flow cytometry assay, CAR-T cells showed a higher percentage of cells in >G3 when co-cultured with M7 (26.3%, p=0.048) and M7R (27.6%, p=0.035), versus M (2.72%) (Fig.3A). Moreover, the percentage of CTV-negative cells in the culture with CAR-NK cells was quantified and showed that the NK cells transduced with either M7 or M7R showed a significant increase in % CTV-negative T cells compared to M transduced NK cells, at averages of 45.4% and 44.1%, respectively (Fig.3B).
[0107] A similar evaluation of CD8+T cells was conducted. In the presence of Capan-2 cells, the cell proliferation of CTV labeled CD8+T cells in culture with CAR-NK cells was quantified and is shown in Fig.3C. The proportion of cells in G5+ increases for M7-NK cells compared to M-NK cells, as well as for M7R-NK cells compared to M-NK cells and M7-NK cells (Fig.3C). The results of the percentage of CTV-negative CD8+T cells for the same culture indicates that the % CTV-negative CD8+T cells increased significantly for both M7-NK cells (average of 49.5%) and M7R-NK cells at an average of 50% (Fig. 3D).Example 8
[0108] NK cell killing assay using CCK8
[0109] NK cell killing capacity was assessed using the CCK8 / WST-8 assay (Abcam #ab228554), measuring the cell viability of target cells. MSLN-positive ovarian cancer cells (SKOV3 cell line), at a concentration of 10 x 103cells, were coated overnight in a 96-well plate. Then, NK cells were co-cultured at a 1:2 E:T (Effector: Target cell) ratio for 48 hours in media with 1 ng / mL of IL-15. After 48 h, 10 μL of WST-8 solution was added per well (100 μL) and incubated for 5-8 hours. Following incubation, absorbance was measured at 460 nm using a microplate reader. NK cells alone and media were used as the baseline.
[0110] The anti-tumor activity of NK cells engineered with IL7 / IL7R against ovarian cancer cells was evaluated in vitro. The percentage of cell death of ovarian cancer cells (SKOV3) was monitored during co-culture with NK cells. The baseline, where the NK cells were not transduced with any construct, and NK cells transduced with one of the engineered constructs (M-, M7-, and M7R-NK cells). Each of the constructs showed a significant increase in cell death compared to the non-transduced NK cells (Fig.4). Co- cultures of M7-NK cells and M7R-NK cells exhibited around 80% cell death. Example 9
[0111] T-cell cytotoxicity
[0112] CAR-T cells were co-cultured with CAR-NK cells (M-NK, M7-NK, and M7R-NK cells) in a 1:1 ratio for 72 hours to allow for cellular crosstalk and pre-conditioning. Following this pre-incubation, CAR-T and CAR-NK cells were added to cultures containing Luciferase+Raji cells. After 24 hours of co-culture, D-Luciferin substrate (Promega #P1041) was added to the media and, bioluminescence was quantified using a microplate reader. CAR-T cell-mediated cytotoxicity was determined by normalizing the luminescence signal to that of Raji cells cultured alone. Example 10
[0113] NK cell proliferation in vivo
[0114] To evaluate the impact of IL-7 signaling in CAR NK cell proliferation in vivo, 6 x 106CAR-NK cells (M, M7 and M7R groups) were intravenously (IV) injected into NGS- Tg (Hu-15) mice. As shown in a schematic in Fig.5A. Two weeks post-injection, NK cells were isolated from major organs, including bone marrow (BM), lungs, liver, spleen, and blood, and analyzed by flow cytometry.
[0115] All animal experiments were conducted according to a DFCI-approved protocol. NGS-Tg (Hu-15) mice were intravenously (IV) injected with 6 x 106CAR-NK cells from each group (M, M7 and M7R groups). Two weeks post-injection, mice were euthanized, and major organs, including bone marrow (BM), lungs, liver, spleen, and peripheral blood, were harvested. Single-cell suspensions were prepared and stained with the following antibodies: human CD45-APC (clone 2D1, Biolegend #368512), mouse CD45- PE (clone 30-F11, Biolegend #103106), CD56-PECy7 (clone HCD56, Biolegend #318318), MESO protein-FITC (Acro Biosystems 296-580), and live / dead dye (ThermoFisher #L34959). Flow cytometry was performed to quantify the percentage of human CD45 cells infiltrating each organ, calculated as a proportion of total CD45+ cells (human + mouse).
[0116] Mice injected with M7R showed a significantly higher percentage of human CD45+infiltrating cells in the bone marrow (47.6%, p=0.02), liver (66.7%, p<0.0001), and spleen (69.8%, p=0.03), two weeks post-injection compared to M7-NK cells (<3%), indicating superior trafficking and proliferation in vivo (Fig.5B). Example 11
[0117] CAR-T cell cytotoxicity in vivo
[0118] In vivo cytotoxicity studies were conducted in NGS-Tg (Hu-15) mice following DFCI-approved protocols. Mice were intravenously (IV) injected with 0.25 x 106 Luciferase+ Raji cells. The method of generating the CD19-CAR-T cells is illustrated in Fig.6A. Three days later, mice received 10 x 106 CAR-NK cells and 1 x 106 CAR-T cells, according to the following experimental groups: (1) CAR-T cells alone, (2) CAR-T cells plus M-NK, (3) CAR-T cells plus M7-NK, (4) CAR-T cells plus M7R-NK cells. A diagram of the experimental setup is depicted in Fig.6C. Peripheral blood was collected weekly for flow cytometry analysis of human CD45+ cells, as well as T and NK cellpopulations. Serum cytokine levels were also measured to assess systemic toxicity and cytokine release syndrome (CRS). Tumor burden was monitored weekly via in vivo bioluminescence imaging (BLI), with quantification of total flux (photons / second) to assess tumor progression or regression.
[0119] The cytotoxicity of CD19-CAR-T cells in co-culture with Raji cells (a lymphoma cell line) as well as one of the engineered NK cells constructs was evaluated and the results are shown in Fig.6B. The cytotoxicity of the CAR-T cells alone was greater compared to the target. When the CAR-NK cells were included in the co-culture, the killing capacity increased. The co-culture of CAR-T cells and CAR-NK cells transduced with either M7 or M7R exhibited the highest cytotoxicity (Fig.6B).
[0120] The evaluation of the tumor burdens for the mice model evaluating tumor control by CAR-T cells or with the introduction of CAR-NK cells is shown in Fig.6D. The bioluminescence imaging of the mice at 5, 10, 15, and 20 days was quantified. The mice treated with the CAR-T cells in conjunction with the M7- and M7R-NK cells show the smallest tumor site, as monitored by the total flux of the tumor (Fig.6D).
[0121] Although the foregoing disclosure has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be readily apparent to one of ordinary skill in the art in light of the teachings of this disclosure that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims. The examples are provided by way of illustration only and not by way of limitation. Those skilled in the art will readily recognize a variety of noncritical parameters that could be changed or modified to yield essentially similar results. EQUIVALENTS
[0122] Various aspects of the present disclosure may be used alone, in combination, or in a variety of arrangements not specifically discussed in the embodiments described in the foregoing and is, therefore, not limited in its application to the details and arrangement of components set forth in the foregoing description or illustrated in thedrawings. For example, aspects described in one embodiment may be combined in any manner with aspects described in other embodiments.
Claims
What is claimed:
1. A nucleic acid for engineering a natural killer (NK) cell, comprising formula I: R1 – R2 – R3 – R4 – R5 – R6 – R7 – R8 (I), wherein: R1 encodes a single chain variable fragment (scFv) that binds a first extracellular protein; R2 encodes a cluster of differentiation 8 (CD8) hinge region; R3 encodes a CD8 transmembrane region; R4 encodes a 4-1BB costimulatory region; R5 encodes a cluster of differentiation 3 zeta (CD3ζ) intracellular region; R6 encodes a first cleavable linker; R7 encodes a interleukin-12 (IL-12) signaling peptide; and R8 encodes interleukin7 (IL-7); R1 to R8 are oriented 5’ to 3’.
2. A nucleic acid for engineering a natural killer (NK) cell comprising formula I: R1 – R2 – R3 – R4 – R5 – R6 – R7 – R8 (I), wherein: R1 encodes a single chain variable fragment (scFv) means for binding a first extracellular protein; R2 encodes a CD8 hinge region; R3 encodes a CD8 transmembrane region; R4 encodes a 4-1BB costimulatory region; R5 encodes a CD3 zeta intracellular region; R6 encodes a cleavable linker; R7 encodes a IL-12 signaling peptide; and R8 encodes interleukin-7 (IL-7); R1 to R8 are oriented 5’ to 3’.
3. The nucleic acid of claim 1 further comprising R9 and R10, wherein R9 encodes a cleavable linker and R10 encodes IL-7 receptor alpha (IL7Rα).
4. The nucleic acid of claim 1, wherein R1 further comprises formula II: R11 – R12 (II), wherein: R11 encodes a light chain variable fragment (VL); and R12 encodes a heavy chain variable fragment (VH), optionally, R11 to R12 are oriented 5’ to 3’. The nucleic acid of claim 1, wherein the first extracellular protein is mesothelin (MESO).
5. The nucleic acid of claim 1, wherein R1 comprises the nucleic acid sequence of SEQ ID NO:
1.
6. The nucleic acid of claim 1, wherein R2 comprises the nucleic acid sequence of SEQ ID NO:
2.
7. The nucleic acid of claim 1, wherein R3 comprises the nucleic acid sequence of SEQ ID NO:
3.
8. The nucleic acid of claim 1, wherein R4 comprises the nucleic acid sequence of SEQ ID NO:
4.
9. The nucleic acid of claim 1, wherein R5 comprises the nucleic acid sequence of SEQ ID NO:
5.
10. The nucleic acid of claim 1, wherein R6 comprises the nucleic acid sequence of SEQ ID NO: 6.
11. The nucleic acid of claim 1, wherein R7 comprises the nucleic acid sequence of SEQ ID NO:
7.
12. The nucleic acid of claim 1, wherein R8 comprises the nucleic acid sequence of SEQ ID NO:
8.
13. The nucleic acid of claim 1, wherein R9 comprises the nucleic acid sequence of SEQ ID NO:
9.
14. The nucleic acid of claim 2, wherein R10 comprises the nucleic acid sequence of SEQ ID NO:
10.
15. The nucleic acid of claim 3, wherein R11 comprises the nucleic acid sequence of SEQ ID NO:
11.
16. The nucleic acid of claim 3, wherein R12 comprises the nucleic acid sequence of SEQ ID NO:
12.
17. The nucleic acid of claim 1, comprising the nucleic acid sequence of SEQ ID NO: 15 or SEQ ID NO:
16.
18. A pharmaceutical composition, comprising an NK cell engineered with the nucleic acid of any one of claims 1-17, and one or more pharmaceutically acceptable carriers, diluents, or excipients.
19. A method of treating cancer in a patient in need thereof, the method comprising administering to the patient an effective amount of an NK cell engineered with the nucleic acid of any one of claims 1-17, or the pharmaceutical composition of claim 18.
20. The method of claim 19, wherein the cancer is malignant mesothelioma, pancreatic cancer, ovarian cancer, lung adenocarcinoma, endometrial cancer, biliary cancer, gastric cancer, or pediatric acute myeloid leukemia cancer cells.
21. An NK cell engineered with the nucleic acid of any one of claims 1-17, or the pharmaceutical composition of claim 18, for use in a therapy.
22. An NK cell engineered with the nucleic acid of any one of claims 1-17, or the pharmaceutical composition of claim 18, for use in treating cancer.
23. The use of claim 22, wherein the cancer is malignant mesothelioma, pancreatic cancer, ovarian cancer, lung adenocarcinoma, endometrial cancer, biliary cancer, gastric cancer, or pediatric acute myeloid leukemia cancer cells.
24. Use of the NK cell engineered with the nucleic acid of any one of claims 1-17, or the pharmaceutical composition of claim 18, in the manufacture of a medicament for treating cancer.
25. The use of claim 24, wherein the cancer is malignant mesothelioma, pancreatic cancer, ovarian cancer, lung adenocarcinoma, endometrial cancer, biliary cancer, gastric cancer, or pediatric acute myeloid leukemia cancer cells.
26. A pharmaceutical composition for use in the treatment of cancer, comprising an NK cell engineered with the nucleic acid of any one of claims 1-17, or the pharmaceutical composition of claim 18.
27. A pharmaceutical composition for use in the treatment of cancer, comprising an NK cell engineered with the nucleic acid of any one of claims 1-16, or the pharmaceutical composition of claim 18.
28. The pharmaceutical composition of claim 26 or claim 27, wherein the cancer is malignant mesothelioma, pancreatic cancer, ovarian cancer, lung adenocarcinoma, endometrial cancer, biliary cancer, gastric cancer, or pediatric acute myeloid leukemia cancer cells.
Citation Information
Patent Citations
Methods for treating newly diagnosed multiple myeloma 3-(4-amino-1-oxo-1,3-dihydro-isoindol-2-yl)-piperidine-2,6-dione in combination with dexamethasone
US9101622B2
NKG2D-CAR-T (Chimeric Antigen Receptor-T) cell of co-expression cell factor IL-7 and application thereof
CN109306016A
Genetically engineered cell and application thereof
EP3822345A1
Engineered ipsc and persistent immune effector cells
WO2022098914A1