Methods of modulating growth factor activity

Abstract

Provided herein are methods of modulating (e.g., increasing or decreasing) a growth factor activity in a cell that include delivering a nuclease (e.g., an RNase) to the cell, wherein the growth factor comprises a heparan binding domain (e.g., VEGF, FGF2), and wherein the nuclease degrades a cell surface bound RNA, thereby modulating (e.g., increasing or decreasing) the growth factor activity in the cell.

Description

[0001] METHODS OF MODULATING GROWTH FACTOR ACTIVITY

[0002] CLAIM OF PRIORITY

[0003] This application claims the benefit of U.S. Provisional Application Serial No. 63 / 676,252, filed on July 26, 2024. The entire contents of the foregoing are incorporated herein by reference.

[0004] FEDERALLY SPONSORED RESEARCH

[0005] This invention was made with Government support under Grant No. GM151157, awarded by the National Institutes of Health. The Government has certain rights in the invention.

[0006] TECHNICAL FIELD

[0007] The present disclosure relates to the field of biotechnology, and more specifically , to methods of controlling signal transduction of specific growth factors across the cell membrane.

[0008] BACKGROUND

[0009] Receptor-ligand interactions govern a wide array of biological pathways, facilitating a cell’s ability to interrogate and integrate information from the extracellular space. Heparan sulfate proteoglycans (HSPGs) are identified as a major component in the organizational mechanism of cell surface glycoRNA and cell surface RNA binding proteins (csRBPs). Furthermore, HSPGs are well characterized to bind extracellular growth factors leading to subsequent signal transduction by forming a growth factor-growth factor receptor complex on the cell surface. Among these heparan sulfate (HS)-binding growth factors, specific proteoforms of vascular endothelial growth factor (VEGF) promotes angiogenesis, endothelial cell migration, and endothelial cell proliferation; VEGF binding may depend on 6-O-sul fation of HS. VEGF receptors (VEGFR; e.g., VEGFR1 and VEGFR2) also occur as clusters on the cell surface, which may influence VEGF-VEGFR activation of Ras / Rafl / MEK, which in turn phosphorylates ERK1 / 2. Activated ERK has many effects on cells, including regulating cell growth, inflammatory signals, and cell death, however it is not clear if or how cell surface RNAs may impact these pathways. There is a need to manipulate cell surface RNAs to modulate receptor-ligand interactions and biological pathways. SUMMARY

[0010] Receptor-ligand interactions govern a wide array of biological pathways, facilitating a cell’s ability to interrogate and integrate information from the extracellular space. The present disclosure is based on the discovery that heparan sulfate proteoglycans (HSPGs) may function as a major component in the organizational mechanism of cell surface RNA including glycoRNAs and cell surface RNA binding proteins (csRBPs), and also that the direct binding and regulation of growth factors (e.g., VEGF-Aiss or FGF2) to cell surface glycoRNA may establish a mechanistic pathway for information to be transferred from outside to inside of a cell.

[0011] Provided herein, inter alia, are methods of modulating (e.g., increasing or decreasing) a growth factor activity’ in a cell that include delivering a nuclease (e.g., an RNase) to the cell, wherein the growth factor comprises a heparan binding domain, and wherein the nuclease degrades a cell surface bound RNA, thereby modulating (e.g., increasing or decreasing) the growth factor activity' in the cell. In some embodiments, the growth factor comprises a vascular endothelial growth factor A (VEGF-A). In some embodiments, the VEGF-A comprises VEGF 165 or VEGF189. In some embodiments, the growth factor comprises a fibroblast grow th factor 2 (FGF2). In some embodiments, the growth factor activity (e.g., VEGF-A activity7, FGF2 activity ) is increased. In some embodiments, the growth factor activity comprises: growth factor binding to a growth factor receptor on the cell surface (e.g., VEGF-A binding to VEGFR1 or VEGFR2, FGF2 binding to FGFR1, FGFR2, FGFR3, and / or FGFR4), signal pathways associated with the growth factor (e.g., activation thereof), and / or intracellular phosphorylation.

[0012] Also provided herein are methods of modulating (e.g.. increasing or decreasing) intracellular phosphorylation in a cell that include delivering a nuclease (e.g., an RNase) to the cell, wherein the intracellular phosphorylation is modulated (e.g., increased or decreased) by a growth factor binding to a growth factor receptor on the cell surface, wherein the nuclease (e.g., RNase) degrades a cell surface bound RNA, thereby modulating (e.g., increasing or decreasing) intracellular phosphorylation in the cell. In some embodiments, the growth factor comprises a vascular endothelial growth factor A (VEGF-A). In some embodiments, the VEGF-A comprises VEGF 165 or VEGF 189. In some embodiments, the growth factor comprises a fibroblast growth factor 2 (FGF2).

[0013] In some embodiments, the modulating of intracellular phosphorylation comprises the intracellular phosphorylation being increased. In some embodiments, the modulating of intracellular phosphorylation comprises the intracellular phosphorylation being decreased. Also provided herein are methods of modulating (e.g.. increasing or decreasing) VEGF-A activity in a cell that include delivering a nuclease (e.g.. an RNase) to the cell, wherein the nuclease (e.g., an RNase) degrades a cell surface bound RNA, thereby modulating (e.g., increasing or decreasing) VEGF-A activity in the cell. In some embodiments, the VEGF-A comprises VEGF165 or VEGF189. In some embodiments, the VEGF-A activity is increased. In some embodiments, the increased VEGF-A activity comprises any one or more of: increased VEGF-A binding to a growth factor receptor (e.g., VEGFR1 or VEGFR2) on the cell surface, increased activity of signal pathways associated with VEGF-A binding, and increased intracellular phosphorylation. In some embodiments, the VEGF-A activity is decreased. In some embodiments, the decreased VEGF-A activity comprises any one or more of: decreased VEGF-A binding to a growth factor receptor (e.g., VEGFR1 or VEGFR2) on the cell surface, decreased activity signal pathways associated with VEGF-A binding, and decreased intracellular phosphorylation (e.g., ERK phosphorylation).

[0014] Also provided herein are methods of modulating (e.g., increasing or decreasing) FGF2 activity in a cell that include delivering a nuclease (e.g.. an RNase) to the cell, wherein the nuclease (e.g., an RNase) degrades a cell surface bound RNA, thereby modulating (e.g., increasing or decreasing) FGF2 activity in the cell. In some embodiments, the FGF2 activity is increased. In some embodiments, the increased FGF2 activity comprises: increased FGF2 binding to a growth factor receptor (e.g., a receptor that binds F2F, such as any one or more of FGFR1, FGFR2, FGFR3. and FGFR4) on the cell surface, increased activity of signal pathways associated with FGF2 binding, and / or increased intracellular phosphorylation (e.g., ERK phosphorylation). In some embodiments, the FGF2 activity is decreased. In some embodiments, the decreased FGF2 activity comprises: decreased FGF2 binding to a growth factor receptor (e.g., a receptor that binds F2F, such as any one or more of FGFR1. FGFR2, FGFR3, and FGFR4) on the cell surface, decreased activity of signal pathw ays associated with FGF2 binding, and / or decreased intracellular phosphorylation (e.g., ERK phosphorylation).

[0015] In some embodiments of any of the methods described herein, the nuclease comprises an RNase. In some embodiments, the RNase comprises any one or more of: an RNase A, RNase 1, RNase 2, RNase 3, RNase 4, RNase 5, RNase 6, RNase 7, RNase 8, RNase C, RNase H, RNase E, RNase R, RNase, RNase Tl, RNase T2, RNase U2, RNase V, RNase III, and RNase I. In some embodiments, the RNase comprises RNase A, RNase III, or any combination thereof. In some embodiments, the cell comprises a cancer cell. In some embodiments, the cell comprises a non-transformed cell. In some embodiments, the cell is in a subject, such as a human.

[0016] Also provided herein are methods of treating a wound in a subject that include administering a therapeutically effective amount of a nuclease (e.g., an RNase) to the wound, wherein the nuclease (e.g., RNase) degrades a cell surface bound RNA, thereby treating the wound in the subj ect. In some embodiments, the wound is a skin wound and the administration comprises transdermal administration. In some embodiments, the wound is a skin wound and the administration comprises topical administration. In some embodiments, the wound is an internal wound and the administration comprises injection of the nuclease to the internal wound. In some embodiments, the wound is an internal wound and the administration comprises injection of the nuclease at or near the site of the internal wound. In some embodiments, the nuclease comprises an RNase. In some embodiments, the RNase comprises any one or more of: an RNase A, RNase 1, RNase 2, RNase 3, RNase 4, RNase 5, RNase 6, RNase 7, RNase 8, RNase C, RNase H, RNase E, RNase R, RNase, RNase Tl, RNase T2, RNase U2, RNase V. RNase III, RNase I , and / or any combination thereof. In some embodiments, the subject is a human.

[0017] Provided herein are also methods of modulating (e.g., increasing or decreasing) a growth factor activity7in a cell, the method comprising delivering a Tega oligo to the cell, thereby modulating (e.g., increasing or decreasing) the growth factor activity in the cell. In some embodiments, the growth factor is VEGF-A. In some embodiments, the VEGF-A comprises VEGF165 or VEGF189. In some embodiments, the VEGF-A activity is increased. In some embodiments, the increased VEGF-A activity comprises any one or more of: increased VEGF-A binding to a grow th factor receptor (e.g., VEGFR1 or VEGFR2) on the cell surface, increased activity of signal pathways associated with VEGF-A binding, and increased intracellular phosphorylation. In some embodiments, the VEGF-A activity is decreased. In some embodiments, the decreased VEGF-A activity comprises any one or more of: decreased VEGF-A binding to a grow th factor receptor (e.g., VEGFR1 or VEGFR2) on the cell surface, decreased activity signal pathways associated with VEGF-A binding, and decreased intracellular phosphorylation. In some embodiments, the growth factor is FGF2. In some embodiments, the FGF2 activity is increased. In some embodiments, the increased FGF2 activity7comprises: increased FGF2 binding to a grow th factor receptor (e.g., a receptor that binds F2F, such as any one or more of FGFR1, FGFR2, FGFR3, and FGFR4) on the cell surface, increased activity of signal pathways associated yvith FGF2 binding, and / or increased intracellular phosphorylation (e.g., ERK phosphorylation). In some embodiments, the FGF2 activity is decreased. In some embodiments, the decreased FGF2 activity comprises: decreased FGF2 binding to a growth factor receptor (e.g.. a receptor that binds F2F, such as any one or more of FGFR1, FGFR2, FGFR3, and FGFR4) on the cell surface, decreased activity of signal pathways associated with FGF2 binding, and / or decreased intracellular phosphorylation (e.g., ERK phosphory lation).

[0018] Also provided herein are methods of modulating (e.g., increasing or decreasing) signal transductions in a cell and / or disrupting RNA clusters, the method comprising delivering a Tega oligo to the cell, thereby modulating (e.g., increasing or decreasing) signal transductions in a cell and / or disrupting RNA clusters.

[0019] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials are described herein for use in the present invention; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

[0020] The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features and advantages of the invention will be apparent from the following detailed description and figures, and from the claims.

[0021] DESCRIPTION OF DRAWINGS

[0022] FIGs. 1A-1E shows Siglec-11 is a major RNA binding Siglec on the cell surface. FIG. 1A shows representative confocal images of U2OS and MOLM-13 cells treated with RNase A and RNase III (RNase pool) for 30 min and stained live with the indicated Siglec-Fc reagents (red). DNA was stained with DAPI (blue). Scale bar, 10 pm. FIG. IB shows quantification of the indicated Siglec dot numbers in U2OS and MOLM-13 cells treated with RNase A and RNase III for 30 min from 3 independent experiments with the number (n) of cells analyzed noted. FIG. 1C shows representative confocal images of U2OS and MOLM- 13 cells co-stained with the indicated Siglec-Fc reagents (yellow) and 9D5 (magenta). DNA was stained with DAPI (blue). An enlargement of the hatched box is shown, and a bright field (BF) is shown to represent the outline of the cell membrane. Scale bar, 10 pm. FIG. ID shows nearest neighbor distance analysis of the Siglec pairs imaged in FIG. 1C. For each pair, the distance (nanometers, nm) from that anchor (left side protein name in the figure key) to the other pair was calculated across the indicated number of cells. These values were plotted in a density histogram. FIG. IE shows RNA blotting of MOLM-13 cells stained while alive with IgG-Fc or Siglec- 11 and labeled with biotin aniline to tag cell surface RNAs. Whole cell RNA was then extracted, processed in vitro with RNase or sialidase, and then analyzed by gel. Total RNA (bottom) and biotin (top) images highlight selective labeling of glycoRNA material only with Siglec-11.

[0023] FIGs. 2A-2G show glycoRNA-csRBP clusters are dependent on heparan sulfate biogenesis. FIG. 2A shows dot plot of genes identified in the genome-wide knockout (KO) screen for loss of Siglec-11 cell surface binding ranked by CRISPR score. The top 15 gene names are displayed with a line drawn at the -0.8-score cut off. The inset cartoon illustrates how Siglec- 11 could interact with a cell surface glycoRNA. FIG. 2B shows dot plot of genes identified in the genome-wide KO screen as in FIG. 2A, here for the loss of 9D5 cell surface binding. The inset cartoon illustrates how 9D5 could interact with a cell surface glycoRNA. FIG. 2C shows upset plot analysis of genes with a score cutoff of -0.8 from the Siglec-11, 9D5, and MAA-I genome-wide KO screens. The common overlapping hits between 9D5 and Siglec-11 are highlighted in blue. The total number of hits for each intersection is noted. FIG. 2D shows representative confocal images of wild-type (WT). EXT2 knock-out (KO), EXT2 KO-mEmerald-EXT2, EXT2 KO-mEmerald-D517N / D573N EXT2 U2OS cells stained live with 10E4, Siglec-11 Fc, and 9D5, (all in red). DNA was stained with DAPI (blue). Scale bar, 10 pm. FIG. 2E shows quantification of 10E4, Siglec-11. 9D5, CS-DDX21, and cs-hnRNP-U dot numbers and intensity per cell from FIG. 2D and 2F from 3 independent experiments. FIG. 2F shows representative confocal images of WT, EXT2 KO, EXT2 KO-mEmerald- EXT2, EXT2 KO-mEmerald-D 17N / D573N EXT2 U2OS cell lines stained live with anti- DDX21 and anti-hnRNP-U (both in red). DNA was stained with DAPI (blue). Scale bar, 10 pm. FIG. 2G shows RNA blotting of U2OS small RNA labeled with Ac4ManNAz and detected with copper-free click of dibenzocyclooctyne-PEG4-biotin (DBCO-biotin). In gel detection of small RNA with SybrGold (Sybr, bottom) and on membrane detection of biotin (Strep, top) is shown. Quantification plotted on the right and statistical assessment of the intensities was performed with a t-test.

[0024] FIGs. 3A-3D show cell surface glycoRNAs and csRBPs are dependent on intact heparan sulfate chains. FIG. 3A shows representative confocal images of U2OS cells treated with heparinase pool for 30 min. and stained live with 10E4, Siglec-11, 9D5, anti-DDX21, anti-hnRNP-U. Siglec-7-Fc, and Siglec-9-Fc (all in red). DNA was stained with DAPI (blue). Scale bar, 10 pm. FIG. 3B shows representative confocal images of U2OS cells treated with heparinase pool for 30 min, recovering for the indicated times, and co-stained with 10E4 (Cyan), Siglec-11 (yellow), and 9D5 (magenta). DNA was stained with DAPI (blue). An enlargement of the hatched box is shown, and a bright field (BF) is shown to represent the outline of the cell membrane. Scale bar. 10 pm. FIG. 3C shows nearest neighbor distance analysis of the 10E4 and Siglec-11 in FIG. 3B. For each pair, the nm distance from 10E4 to Siglec-11 was calculated across. These values were plotted in a density histogram. FIG. 3D shows quantification fraction of 10E4-occupied, Siglec-11 dots in FIG. 3B from 3 independent experiments.

[0025] FIGs. 4A-4C show proteoglycan sulfation modulates glycoRNA-csRBP clustering. FIG. 4A shows an exemplary schematic of a heparan sulfate proteoglycan with the regions of activity for the various enzymes and HS oligos perturbed in the following experiments. FIG. 4B shows representative confocal images of WT, NDST1 KO, HS6ST1 KO, HS2ST1 KO. Sulfl stably overexpressing (OE). Sulf2 stably overexpressing, and Tega HS #09 and Tega HS #37 treated U2OS cells stained with 10E4, Siglec-11, 9D5, anti-DDX21, and anti- hnRNP-U (all in red), separately. DNA was stained with DAPI (blue). Scale bar, 10 pm. FIG. 4C shows quantification of data in FIG. 4B with number of cells counted from 3 independent experiments.

[0026] FIGs. 5A-5K show glycoRNA-csRBP clusters suppress VEGF-A165-induced phosphorylation of ERK in primary endothelial cells. FIG. 5A shows quantification of 10E4, Siglec-11, 9D5, anti-DDX21, and anti-hnRNP-U intensity per cell from 3 independent experiments. FIG. 5B shows western blot analysis of whole cell lysate isolated from HUVEC cells after starvation and treatment with RNase pool followed by 3 ng / mL VEGF-A165 stimulation. Quantification of the ratio of phosphorylated ERK (pERK) to total ERK is calculated across the biological triplicates. Statistical assessment was performed with a t-test and p values are shown. FIG. 5C shows western blot analysis as in FIG. 5B with HUVEC cells stimulated with 3 ng / mL of VEGF-A121. FIG. 5D shows western blot analysis as in FIG. 5B with HUVEC cells stimulated with 3 ng / mL of EGF. FIG. 5E shows representative confocal images of HUVEC cells after serum starvation, treatment with or without RNase pool, and the treatment with VEGF-A165 or VEGF-A121, finally imaging with anti-VEGF- A165 (red) or anti-VEGF-A (red). DNA was stained with DAPI (blue). Scale bar, 10 pm. Quantification of the images with number of cells noted per biological triplicate. Statistical assessment was performed with a t-test and p values are shown. FIG. 5F shows representative confocal images of HUVEC cells with the treatment with or without RNase pool, and imaging with anti-VEGFR2 (red). DNA was stained with DAPI (blue). Scale bar, 10 pm. Quantification of the images with number of cells noted per biological triplicate. Statistical assessment was performed with a t-test and p values are shown. FIG. 5G shows representative confocal images of HUVEC cells after serum starvation and treated with or without VEGF-A165 and then costained with anti-VEGF-A165 (purple) and Siglec-11 (yellow). DNA was stained with DAPI (blue). Zoomed region shown as an inset. Scale bar, 10 pm. FIG. 5H shows lysates from HUVEC cells after serum stan ati on, treatment with 25 ng / mL VEGF-A165, and UV-crosslinking, were treated with or without RNase pool and immunoprecipitated (IP) with an anti-VEGFA antibody (Proteintech). Immunoprecipitated samples were analyzed by Western blot using an anti-VEGF-A165 antibody (R&D system). FIG. 51 shows 1 pg ofVEGF-A165 or VEGF-A121 was immunoprecipitated with an anti- VEGFA antibody. 1 pg of HUVEC small RNA was then incubated to beads preconjugated to anti-VEGF-A or 9D5 antibodies. RNA was extracted from the beads, purified, rPAL labeled, and finally analyzed by Northern blot. 1 pg of HUVEC small RNA served as input of glycoRNA. FIG. 5J shows western blot analysis of whole cell lysate isolated from HUVEC cells after starvation and treatment with RNase pool followed by 3 ng / mL VEGF-A165 stimulation. Quantification of the ratio of phosphorylated VEGFR2 (p VEGFR2) to total VEGFR2 is calculated across the biological triplicates. Statistical assessment was performed with a t-test and p values are shown. FIG. 5K shows microscale thermophoresis assay to measure the binding between 5 nM of HUVEC small RNA and VEGF-A165 or VEGF-A121 with the concentration varied from 30 pM to 14 nM.

[0027] FIGs. 6A-6D show the binding profile and RN as e-dependency of 13 human Siglec receptors. FIG. 6A shows representative confocal images of U2OS and MOLM-13 cells stained live with IgGl or the indicated Siglec-Fc reagents (red). DNA was stained with DAPI (blue). Scale bar, 10 pm. FIG. 6B shows quantification of the indicated Siglecs intensity in U2OS and MOLM-13 cells treated with RNase pool for 30 min from 3 independent experiments with the number (n) of cells analyzed noted. FIG. 6C shows representative histograms (left) from flow cytometry experiments of U2OS or MOLM-13 cells treated live with or without a sialidase pool and then analyzed for surface binding of Fc-IgG (control), Siglec-7, Siglec-11, or total surface glycan (periodate) signal. Triplicate experiments are quantified with the mean fluorescence intensity (MFI) on the right for each cell line, and t- tests were used to assess statistical differences, with the fold changes noted. FIG. 6D shows RNA blotting as in FIG. IE. here on U2OS cells.

[0028] FIGs. 7A-7G show EXT2 knockouts and rescues modulate glycoRNA-csRBP clusters. FIG. 7A shows dot plot of genes identified in the genome-wide CRISPR knockout (KO) screen for loss of MAA-I cell surface binding ranked by CRISPR score. The top 15 gene names are displayed with a line drawn at the -0.8-score cut off. The inset cartoon illustrates how MAA-I could interact with a cell surface glycoRNA. FIG. 7B shows gene ontology (GO) cellular compartment (top) and biological process (bottom) analysis of KO screen hits from MAA-I (blue), 9D5 (red), and Siglec-11 (green). The top 4 terms across the three screens were intersected and the union is displayed with the significance of each term represented by circle size and plotted on the x-axis by their fold enrichment. FIG. 7C shows sequence alignment of partial EXT2 coding sequences from WT and EXT2 KO U2OS cells. Protospacer adjacent motif (PAM), green; sgRNA target, blue; mutated sequence, red. FIG. 7D shows western blot analysis of whole cell lysate, (left) from wild-type (WT) and EXT2 knock-out U2OS cell lines and (right) EXT2-K01, K0-mEmerald-EXT2, EXT2 KO- mEmerald-D517N / D573N EXT2. In both. GAPDH served as loading control. FIG. 7E shows representative confocal images of WT, and EXT2 KO U2OS cells stained with Siglec- 7 and Siglec-9 (red), separately. DNA was stained with DAPI (blue). Scale bar, 10 pm. FIG. 7F shows number of cells quantified in FIGs. 2D. 2F, 7E, 7G across 3 independent experiments. FIG. 7G shows representative confocal images of EXT2 KO-mEmerald-EXT2 and EXT2 KO-mEmerald-D517N / D573N EXT2 U2OS cells. DNA was stained with DAPI (blue). Scale bar, 10 pm.

[0029] FIGs. 8A-8B show quantification of cell surface ligands after heparinase treatment. FIG. 8A shows quantification of data in FIG. 3A with the number of cells per condition from 3 independent experiments is shown. Statistical assessment was performed with a t-test and p values are shown. FIG. 8B shows RNA blotting of U2OS small RNA labeled with Ac4ManNAz detected DBCO-biotin and in vitro digested with no enzyme or heparinase pool, small RNA (Sybr, bottom) and biotin detection (Strep, top) is shown. Quantification plotted on the right and statistical assessment of the intensities was performed with a t-test.

[0030] FIGs. 9A-9F show effects of cellular sulfation and sulfatases on glycoRNA-csRBP clustering. FIG. 9A shows representative confocal images of WT, NDST1 KO, HS6ST1 KO, HS2ST1 KO, Sulfl stably overexpressing (OE). Sulf2 stably overexpressing, and Tega HS #09 and Tega HS #37 treated U2OS cells stained with 10E4, Siglec-11. 9D5. anti-DDX21. and anti-hnRNP-U (all in red), separately. DNA was stained with DAPI (blue). Scale bar, 10 pm. FIG. 9B shows sequence alignment of partial NDST1, HS6ST1, and HS2ST1 coding sequences from wild-type (WT) and the indicated knock-out (KO) U2OS cell lines. Protospacer adjacent motif (PAM), green; sgRNA target, blue; mutated sequence, red. FIG. 9C shows western blot analysis of whole cell lysate from WT, NDST1 KO, HS6ST1, and HS2ST1 KO U2OS cells. GAPDH served as loading control. FIG. 9D shows representative confocal images ofWT and NaCl orNaClO3 treated U2OS cells stained with 10E4, Siglec- 11. 9D5, anti-DDX21. and anti-hnRNP-U (all in red). DNA was stained with DAPI (blue). Scale bar, 10 pm. FIG. 9E shows representative confocal images of mEmerald-Sufll and mEmerald-Sulf2 stably overexpressing U2OS cells. DNA was stained with DAPI (blue). Scale bar, 10 pm. FIG. 9F shows western blot analysis of whole cell lysate isolated from mEmerald-Sufll and mEmerald-Sulf2 stably overexpressing U2OS cells. GAPDH served as loading control.

[0031] FIGs. 10A-10H show HUVEC response to live cell enzymes, VEGF-A, and EGF addition. FIG. 10A shows representative confocal images of HUVEC cells treated with the RNase pool or heparinase pool, and stained live with 10E4, Siglec-11, 9D5, anti-DDX21, and anti-hnRNP-U (all in red). DNA was stained with DAPI (blue). Scale bar, 10 pm. FIG. 10B shows western blot analysis of whole cell lysate isolated from HUVEC cells after starvation and treatment with RNase pool followed by 25 ng / mL VEGF-A165 stimulation. Quantification of the ratio of phosphorylated ERK (pERK) to total ERK is calculated across the biological triplicates. Statistical assessment was performed with a t-test and p values are shown. FIG. 10C shows western blot analysis as in FIG. 10B with HUVEC cells stimulated with 25 ng / mL of VEGF-A121. FIG. 10D shows western blot analysis as in FIG. 10B with HUVEC cells stimulated with 25 ng / mL of EGF. FIG. 10E shows representative confocal images of HUVEC cells after serum starvation and treated with or without VEGF-A165 and then co-stained with anti-VEGF-A165 (purple) and Siglec-11 (yellow). DNA was stained with DAPI (blue). Zoomed region shown as an inset. Scale bar, 10 pm. FIG. 10F shows nearest neighbor distance analysis of the VEGF-A165 and Siglec-11 in FIG. 10E. For each pair, the nm distance from VEGF-A165 to Siglec-11 was calculated across. These values were plotted in a density histogram. FIG. 10G shows western blot analysis of the indicated amount of VEGF-A 165 or VEGF-A121. FIG. 10H shows 1 pg of VEGF-A165 or VEGF- A121 was immunoprecipitated with an anti-VEGFA antibody (Proteintech). Immunoprecipitated samples were analyzed by Western blot using an anti-VEGF-A165 antibody (R&D system). FIG. 11 shows bFGF2 and VEGF165 directly binding to glycoRNA, wherein 1 pg of VEGF-A165 or FGF2 was immunoprecipitated with an anti-VEGFA antibody.

[0032] FIG. 12 shows western blot analysis of whole cell lysate isolated from HUVEC cells after starvation and treatment with RNase pool followed by 3 ng / mL and 25 ng / mL bFGF stimulation. Quantification of the ratio of phosphorylated ERK (pERK) to total ERK is calculated across the biological triplicates.

[0033] DETAILED DESCRIPTION

[0034] Cells leverage biophysical and regulatory interfaces to communicate with the extracellular environment. Heparan sulfate proteoglycans (HSPGs), a key class of cell surface glycoconjugates, consist of a core protein and one or more covalently linked heparan sulfate (HS) chains 1. Most of the HSPG core proteins are membrane-associated, anchored by way of a transmembrane domain (e.g., syndecans) or by a glycosylphosphatidylinositol (GPI) anchor (e.g., glypicans). The protein interactome of HSPGs is well established and includes chemokines, cytokines, growth factors, morphogens, cell adhesion proteins, heat shock proteins, and viral components like the SARS-CoV-2 spike protein. HSPGs are thought of conceptually as coreceptors that facilitate the formation of ligand-receptor complexes. A major source of control over protein-HS interactions occurs via sulfated domains of the chains, affected by the total extents of sulfation as well as the arrangement of sulfated residues in the chains. HS and HSPGs are critical to a diverse set of biological processes, spanning development, physiology, and pathophysiology.

[0035] While the expression of the protein component of HSPGs can control some aspects of HSPG biology, the particularities of the carbohydrate polymer have been found to be critical for many of the functional aspects of HSPGs. HS chains vary enormously in terms of length and degree of sulfation. Its assembly occurs in the Golgi apparatus in a template-independent manner. A series of enzymes initiate HS chain formation, eventually leading to a core glucuronic acid-galactose-xylose tetrasaccharide linkage region. EXTL3 initiates the formation of the repeating disaccharide units of HS by transfer of the first N-acetyl-D- glucosamine (GlcNAc) unit to the linkage region tetrasaccharide. A heterodimer complex of EXT1 and EXT2 adds alternating residues of D-glucuronic acid (GlcA) and GlcNAc to the nascent polymer. Sulfation of the chains is initiated by the one or more members of the NDST family of N-deacetylases-N-sulfotransferases acting on a subset of GlcNAc residues, followed by partial epimerization of adjacent GlcA residues to 1-Iduronic acid (Ido A) followed by 2-O-sulfation (catalyzed by Hs2st), 6-O-sulfation of GlcNAc and GlcNS residues (by Hs6stl-3), and occasional 3-O-sulfation of GlcNS residues (by Hs3stl, 2, 3a, 3b, 4, 5, or 6). On the cell surface, these sialoglycoRNAs are in physical proximity to specific RNA binding proteins on the plasma membrane of cells (csRBPs). The cell penetrating peptide (CPPs) TAT localizes to and enters cells in a manner partially dependent on RNA at sites where csRBPs cluster. CPPs are classically reported to leverage HSPGs for cell surface association and entry, highlighting the possibility that glycoRNA-csRBP clusters and HSPGs have some relationship. More broadly, HSPGs are well characterized to bind extracellular grow th factors leading to subsequent signal transduction by forming a grow th factor-gro w th factor receptor complex on the cell surface. Among these HS-binding growth factors, specific proteoforms of vascular endothelial growth factor (VEGF) promotes angiogenesis, endothelial cell migration, and proliferation; VEGF binding depends on 6-O-sulfation of HS. VEGF receptors (VEGFR) also occur as clusters on the cell surface, which may influence VEGF-VEGFR activation of Ras / Rafl / MEK, which in turn phosphorylates ERK1 / 2. Activated ERK has many effects on cells, including regulating cell growth, inflammatory signals, and cell death, however it is not clear if or how cell surface RNAs may impact these pathways.

[0036] The present disclosure takes a genetic approach to dissect the identity' and assembly of glycoRNA-csRBP clusters and provides tools that enable examination of these clusters on live cells and apply them to perform a genome-wide knockout screen. The screening effort revealed a major genetic dependency of glycoRNA-csRBP clusters on heparan sulfate biogenesis, a mechanism conserved across multiple cell types. Selective and rapid cleavage of heparan sulfate chains with heparin lyase diminished glycoRNA-csRBP clusters. Colocalization and time course experiments suggest HSPGs are sites of assembly for glycoRNA-csRBP clusters. Interrogation of the specific types of sulfation revealed that 6-O- sulfation is key to promoting the formation of glycoRNA-csRBP clusters. The present disclosure also shows that the growth factor VEGF-A165 can directly bind RNA on the cell surface and can interact with glycoRNAs in vitro. VEGF-A165 signaling, which traditionally is thought to leverage HSPGs for cell surface interaction, can be modulated by destruction of cell surface RNA.

[0037] Accordingly, provided herein are methods of modulating (e.g., increasing or decreasing) activity' of a grow th factor (e.g., VEGF-A activity or FGF2 activity) in a cell that include delivering a nuclease to the cell. In some embodiments, the growth factor comprises a heparan binding domain. In some embodiments, the growth factor comprises one or more arginine amino acid residues in C-terminus. In some embodiments, the nuclease degrades a cell surface bound RNA. Also provided herein are methods of modulating intracellular phosphorylation in a cell that include delivering a nuclease to the cell. In some embodiments, the growth factor comprises a heparan binding domain. In some embodiments, the growth factor comprises one or more arginine amino acid residues in C-terminus. Also provided herein are methods of treating a wound in a subject that include administering a therapeutically effective amount of a nuclease to the wound, wherein the nuclease degrades a cell surface bound RNA.

[0038] Various non-limiting aspects of these methods are described herein and can be used in any combination without limitation. Additional aspects of various components of the methods described herein are known in the art.

[0039] It must be noted that, as used in the specification and the appended claims, the singular forms “a,” “an” and “the” include plural referents unless the context clearly dictates otherwise.

[0040] As used herein, the term “about”, when used herein in reference to a value, refers to a value that is similar, in context to the referenced value. In general, those skilled in the art, familiar with the context, will appreciate the relevant degree of variance encompassed by “about” in that context. For example, in some embodiments, the term “about” may encompass a range of values that are within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%. 12%. 11%. 10%. 9%, 8%, 7%. 6%, 5%, 4%, 3%, 2%. 1%, or less of the referred value.

[0041] As used herein, the term “administration” typically refers to the administration of a composition to a subject or system to achieve delivery' of an agent that is, or is included in, the composition. Those of ordinary' skill in the art will be aware of a variety' of routes that may, in appropriate circumstances, be utilized for administration to a subject, for example a human. For example, in some embodiments, administration may be ocular, oral, parenteral, topical, etc. In some particular embodiments, administration may be bronchial (e.g., by bronchial instillation), buccal, dermal (which may be or comprise, for example, one or more of topical to the dermis, intradermal, interdermal, transdermal, etc.), enteral, intra-arterial, intradermal, intragastric. intramedullary, intramuscular, intranasal, intraperitoneal, intrathecal, intravenous, intraventricular, within a specific organ (e. g. intrahepatic), mucosal, nasal, oral, rectal, subcutaneous, sublingual, topical, tracheal (e.g., by intratracheal instillation), vaginal, vitreal, etc. In some embodiments, administration may involve only a single dose. In some embodiments, administration may involve application of a fixed number of doses. In some embodiments, administration may involve dosing that is intermittent (e.g., a plurality of doses separated in time) and / or periodic (e.g., individual doses separated by a common period of time) dosing. In some embodiments, administration may involve continuous dosing (e.g., perfusion) for at least a selected period of time.

[0042] As used herein, “modulating” can refer to modifying, regulating, or altering a particular activity or response in a cell. In some embodiments, the term “modulate” can include stimulation (e.g.. increasing or upregulating) and / or inhibition (e.g., decreasing or downregulating) of a particular activity or response.

[0043] As used herein, the term “subject” refers an organism, typically a mammal (e.g., a human). In some embodiments, a subject is suffering from a relevant disease, disorder or condition. In some embodiments, a subject is susceptible to a disease, disorder, or condition. In some embodiments, a subject displays one or more symptoms or characteristics of a disease, disorder, or condition. In some embodiments, a subject does not display any symptom or characteristic of a disease, disorder, or condition. In some embodiments, a subject is someone with one or more features characteristic of susceptibility to or risk of a disease, disorder, or condition. In some embodiments, a subject is a patient. In some embodiments, a subject is an individual to whom diagnosis and / or therapy is and / or has been administered.

[0044] GlycoRNAs and GlycoRNA-csRBP

[0045] RNAs localizing to the outer cell surface have been recently identified in mammalian cells, including RNAs with glycan modifications known as glycoRNAs. Glycans can modify lipids and proteins to mediate inter- and intramolecular interactions. In some embodiments, using synthetic chemistry or enzymatic processes, glycans can be attached to either RNA or DNAto form a glyconucleic acid, such as glycoRNA or glycoDNA. In some embodiments, the glycans that attach to RNA or DNA contain at least 1 (e.g., at least 2, at least 5, at least 7, at least 10) monosaccharide. In some embodiments, by attaching glycans to RNA or DNA. a more stable biophysical material can be created. Furthermore, glycans can facilitate targeting RNA to a cell population, and a cell can be targeted with or without internalization.

[0046] In addition, a group of RNA binding proteins (RBPs) are present on the surface of living cells. These cell surface RBPs (csRBPs) precisely organize into well-defined nanoclusters that are enriched for multiple RBPs, glycoRNAs, and their clustering can be disrupted by extracellular RNase addition. These glycoRNA-csRBP clusters further serve as sites of cell surface interaction. These glycoRNA-csRBP clusters can act as a regulator of communication between cells and the extracellular environment. In additions, these sites can be used for the cell penetrating peptide TAT. Removal of RNA from the cell surface, or loss of RNA binding activity by TAT, causes defects in TAT cell internalization.

[0047] As used herein, the term '‘glycoRNA” refers to a modified ribonucleic acid comprising a glycan moiety7. GlycoRNAs have been found to be present in multiple cell types and mammalian species, in cultured cells, and in vivo. The majority7of natural cellular glycoRNAs present on the cell surface, and the RNA species are small, highly conserved RNAs. In some embodiments, endogenous mammalian glycoRNA glycans can be structurally unique to those found on proteins. In some embodiments, different compositions of glycans can include fucosylated, sialylated, and asialylated glycans. In some embodiments, glycoRNA assembly depends on canonical N-glycan biosynthetic machinery and results in structures enriched in sialic acid and fucose. Furthermore, analysis of living cells revealed that the majority of glycoRNAs were present on the cell surface and can interact with anti- dsRNA antibodies and members of the Siglec receptor family. Collectively, these findings point to an expanded role for RNA in extracellular biology.

[0048] In some embodiments, conserved small noncoding RNAs can bear sialylated glycans. Recently, a negatively charged glycopolymer on the cell surface was described, called sialoglycoRNA, which present sialylated and / or fucosylated N-glycans on small RNAs. At least one covalent linkage between the RNA and N-glycans occurs via the modified RNA base 3 -(3-amino-3 -carboxy propyljuri dine (acp3U). On the cell surface, these sialoglycoRNAs are in physical proximity to specific RNA binding proteins on the plasma membrane of cells (csRBPs). The cell penetrating peptide (CPPs) TAT localizes to and enters cells in a manner partially dependent on RNA at sites where csRBPs cluster. CPPs are classically reported to leverage HSPGs for cell surface association and entry, highlighting the possibility that glycoRNA-csRBP clusters and HSPGs have some relationship.

[0049] HSPGs are w ell characterized to bind extracellular growth factors leading to subsequent signal transduction by forming a growth factor-growth factor receptor complex on the cell surface. Among these HS-binding growth factors, specific proteoforms of vascular endothelial growth factor (VEGF) promotes angiogenesis, endothelial cell migration, and proliferation; VEGF binding depends on 6-O-sulfation of HS. VEGF receptors (VEGFR) also occur as clusters on the cell surface, which may influence VEGF -VEGFR activation of Ras / Rafl / MEK, which in turn phosphorylates ERK1 / 2, wherein activated ERK has many effects on cells, including regulating cell growth, inflammatory signals, and cell death. In some embodiments, a glycan can be conjugated to one or more biomolecules, including RNA, such as linear mRNA, circular mRNA, siRNA. miRNA and the like, or DNA, including linear DNA or circular DNA. In addition, glycan composition can be modified with various monosaccharide enzy matically through the use of glycosyltransferases. In some embodiments, glycan orientation to create programmable binding interfaces for glycan receptors can be defined using an RNA that forms a particular structure and includes modified nucleotides in particular places.

[0050] In some embodiments, after a glycoRNAhas been created, it can be formulated for administration into the body by any desired methods such as parenteral administration, such as intravenous injection (IV), intramuscular injection, intrathecal injection, intraperitoneal injection, subcutaneous injection, or injection into a desired organ or tissue (e.g., intravitreal injection), topical application, or nasal or oral inhalation, for example following aerosolization. In some embodiments, the glycoRNA can be packed into an LNP, or it can be naked. In some embodiments, small RNA therapeutics may work better when using naked RNA since long RNA can be destroyed by a single cut. In some embodiments, for large naked RNA, local application may be best for systemic delivery.

[0051] The present disclosure shows that heparan sulfate proteoglycans (HSPGs) may function as a major component in the organizational mechanism of cell surface glycoRNA and cell surface RNA binding proteins (csRBPs), and also that the direct binding and regulation of glycoRNA-binding proteins (e.g., VEGF-Aies or FGF2) to cell surface glycoRNA may establish a mechanistic pathway for information to be transferred from outside to inside of a cell. Therefore, the present disclosure provides, inter alia, methods of modulating (e.g., increasing or decreasing) cell surface glycoRNA and / or cell surface RNA binding proteins (csRBPs), methods of modulating (e.g., increasing or decreasing) glycoRNA-csRBPs clusters, methods of modulating (e.g., increasing or decreasing) the binding of glycoRNA-binding proteins to glycoRNAs, and methods of modulating (e.g., increasing or decreasing) signaling pathways of these glycoRNA-binding proteins (e g., VEGF-A165 or FGF2).

[0052] Methods of Modulating GlycoRNAs and GlycoRNA-csRBP

[0053] Provided herein, inter alia, are methods of modulating (e.g., increasing or decreasing) cell surface glycoRNAs and glycoRNA-csRBPs in a cell. In various embodiments, these methods include, e.g., (i) disrupting heparan sulfate biosynthesis, (ii) blocking 6-O-sulfation of heparan, (hi) delivering a nuclease (e.g., an RNase: or a functional equivalent of a nuclease) to the cell, and any combinations thereof. In some embodiments, provided herein are methods of inhibiting the formation of GlycoRNA-csRBP. In some embodiments, provided herein are methods of inhibiting the formation of Heparan Sulfate. In some embodiments, provided herein are methods of inhibiting the expression of a csRBP. In some embodiments, provided herein are methods of inhibiting the expression of a GlycoRNA. In some embodiments, provided herein are methods of overexpressing or increasing expression of a csRBP. In some embodiments, provided herein are methods of overexpressing or increasing expression of a GlycoRNA. In some embodiments, provided herein are methods of promoting the formation of GlycoRNA-csRBP. In some embodiments, provided herein are methods of promoting the formation of Heparan Sulfate. Methods can comprise administering to a cell or a subject any one or more of: a nucleic acid molecule (e.g., a shRNA, a siRNA, antisense oligonucleotides, and aTega oligo), a small molecule, a nuclease (e.g., an RNase), an agent for genetic modification (e.g., a CRISPR / Cas9), functional variants thereof, and any combination thereof. In some embodiments, genetic modification is achieved by methods described herein and those known in the art. In some embodiments, genetic modification methods comprise gene editing, homologous recombination, nonhomologous recombination, RNA-mediated genetic modification, DNA-mediated genetic modification, zinc finger nucleases, meganucleases, RALEN, TALEN, megaTAL, CRISPR / Cas technology (e.g., CRISPR / Cas9 gene editing), or CRISPR / Cpfl . Methods of designing and using genetic modification technologies to target (e.g., knock out, down regulate, inhibit, overexpress, and upregulate) an endogenous target are well known in the art.

[0054] In some embodiments, the nucleic acid molecule is an inhibitory nucleic acid, such as an antisense oligonucleotide (ASO), e.g., locked nucleic acid (LNA), an shRNA, or an siRNA. Methods of designing and making inhibitory nucleic acids to target an endogenous target are w ell known in the art.

[0055] In some embodiments, methods of modulating (e.g.. increasing or decreasing) cell surface glycoRNAs and glycoRNA-csRBPs in a cell can include disrupting heparan sulfate biosynthesis, w herein disrupting heparan sulfate biosynthesis includes inhibiting a gene expressing an enzy me of heparan sulfate biosynthesis. In some embodiments, the gene expressing an enzyme of heparan sulfate biosynthesis can include, but is not limited to, EXT1, EXT2, and UXS 1. Numerous methods are known in the art that can be used to inhibit the gene expression. For example, in some embodiments, the gene is modified, edited, or knocked out using any of the following technologies: gene editing, homologous recombination, nonhomologous recombination, RNA-mediated genetic modification, DNA- mediated genetic modification, a zinc finger nuclease, a meganuclease, RALEN, TALEN, megaTAL, CRISPR / CAS9, or CRISPR / Cpfl. In some embodiments, one or more of these genes e.g., EXT1, EXT2, and UXS1 have been knocked out. In some embodiments, shRNA that target one or more of these genes e.g.. EXT1, EXT2, and UXS1 can be delivered to a cell or administered to a subject. In some embodiments, a Tega oligo can be delivered to a cell or administered to a subject. In some embodiments, an antisense oligonucleotide, a shRNA, or a siRNA can be delivered to a cell or administered to a subject. In some embodiments, a small molecule can be delivered to a cell or administered to a subj ect.

[0056] In some embodiments, methods of modulating (e.g.. increasing or decreasing) cell surface glycoRNAs and glycoRNA-csRBPs in a cell comprise blocking 6-O-sulfation of heparan sulfate chains, wherein the blocking 6-O-sulfation of heparan sulfate chains inhibits glycoRNA-csRBP cell surface clustering. In some embodiments, the blocking 6-O-sulfation of heparan sulfate chains can include treating the cell with sodium chlorate, a metabolic inhibitor of sulfation. In some embodiments, an effective amount of sodium chlorate can be administered to a subject. In some embodiments, methods of modulating (e.g., increasing or decreasing) cell surface glycoRNAs and glycoRNA-csRBPs in a cell can include treating the cell with synthetic heparan sulfate oligonucleotides. In some embodiments, methods of modulating (e.g.. increasing or decreasing) cell surface glycoRNAs and glycoRNA-csRBPs in a cell can include treating the cell with a reagent that can selectively modulate clustering of the glycoRNAs and glycoRNA-csRBPs (e.g., Tega HS #9, Tega HS #37).

[0057] In some embodiments, methods of modulating (e.g., increasing or decreasing) cell surface glycoRNAs and glycoRNA-csRBPs in a cell can include delivering a nuclease (e.g., an RNase), or a functional equivalent thereof, to the cell. In some embodiments, the nuclease is an RNase. In some embodiments, the RNase is selected from RNase A, RNase C, RNase H, RNase III, and RNase I. In some embodiments, the RNase comprises or consists of at least one of: RNase A, RNase C, RNase H, RNase III, and RNase I. In some embodiments, the RNase includes an RNase A, an RNase III, or any combination thereof. In some embodiments, the RNase comprises at least one of, or at least two of, RNase A, RNase 1, RNase 2, RNase 3, RNase 4, RNase 5, RNase 6, RNase 7, RNase 8, RNase C, RNase H, RNase E. RNase R, RNase, RNase Tl, RNase T2, RNase U2, RNase V, RNase III, RNase I, and any combination thereof. In some embodiments of any of the methods described herein, the cell comprises a cancer cell. In some embodiments of any of the methods described herein, the cell comprises anon-transformed cell. In some embodiments of any of the methods described herein, the cell is in a subject, such as a human.

[0058] Methods of Modulating GlycoRNA Binding Proteins

[0059] Provided herein, inter alia, are methods of modulating (e.g., increasing or decreasing) glycoRNA binding proteins. As used herein, a “glycoRNA binding protein” refers to a protein that binds to a cell surface glycoRNA. In some embodiments, these glycoRNA binding proteins are ligands of cell receptors and can activate signaling pathways in the target cells.

[0060] In some embodiments, the glycoRNA binding protein has an arginine (R)-rich domain at the C-terminal. In some embodiments, the glycoRNA binding protein has a heparan sulfate binding domain.

[0061] In some embodiments, an example of a glycoRNA binding protein can include, but is not limited to, Siglec-11, VEGF-A, FGF2, Siglec-14, 9D5, csDDX21, and cs-hnRNP-U.

[0062] The present disclosure shows glycoRNA-csRBP clusters suppress glycoRNA binding protein-induced signaling in cells. Therefore, in one aspect, the present disclosure provides methods of modulating (e.g., increasing or decreasing) glycoRNA binding protein-induced signaling pathway. These glycoRNA binding proteins include e.g., Siglec-11, VEGF-A, FGF2, Siglec-14, 9D5, csDDX21, and / or cs-hnRNP-U. In some embodiments, the methods can increase the activity of the signal pathways, e.g., by disrupting glycoRNA-csRBP clusters, removing glycoRNA. disrupting heparan sulfate biosynthesis, and / or blocking 6-0- sulfation of heparan. In some embodiments, the methods can decrease the activity of the signal pathways, e.g., by adding more glycoRNA to the cells.

[0063] In some embodiments, the methods as described herein can modulate (e.g., increase or decrease) the signaling pathway of Siglec- 11. Siglec- 11 is a protein that belongs to the subgroup of CD33 / Siglec-3-related Siglecs, wherein, as with others in this subgroup, the cytosolic domain of Siglec-11 is phosphorylated at tyrosine residue(s) upon pervanadate treatment of cells and then recruits the protcin-tyrosine phosphatases SHP-1 and SHP-2. Siglec-11 is also expressed on brain microglia, wherein siglec-11 specifically binds to the brain-enriched polysialic acid (polySia / PSA) where its microglial expression in the brain is unique to humans. In some embodiments, the methods as described herein can modulate (e.g., increase or decrease) the signaling pathway of vascular endothelial growth factor A (VEGF-A). VEGF-A pathways play a central role in the wound healing process, including revascularization of damaged tissues, improving vascular permeability, and formation of new blood vessels (angiogenesis). Furthermore, VEGF-A plays pivotal roles in regulating tumor angiogenesis as well as physiological vascular function, wherein the major VEGF-A isoforms, VEGF-A121 and VEGF-A165, can be found in serum, plasma, and platelets. Thus, the methods described herein can be used for promoting wound healing process, promoting revascularization of damaged tissues, improving vascular permeability, improving physiological vascular function, and / or promoting formation of new blood vessels (angiogenesis).

[0064] In some embodiments, the methods as described herein can modulate (e.g., increase or decrease) the signaling pathway of Fibroblast growth factor 2 (FGF2). FGF2 is know n to play crucial roles in the growth and development of several tissues. It has been known that FGF2 stimulates ERK phosphorylation while having multiple roles in cutaneous wound healing. Thus, the methods described herein can be used for promoting growth and development of tissues, stimulating ERK phosphorylation, and promoting wound healing.

[0065] Methods of Modulating Activity and Signaling of Proteins Comprising a Heparan Binding Domain

[0066] Provided herein, Inter alia, are methods of modulating (e.g., increasing or decreasing) an activity of a protein comprising a heparan binding domain in a cell that include delivering a nuclease (e g., an RNase), or a functional equivalent (e g., siRNA or small molecule inhibitor), to the cell, wherein the nuclease (or the functional equivalent thereof) degrades a cell surface bound RNA, thereby modulating (e.g., increasing or decreasing) the activity of the protein comprising a heparan binding domain in the cell. In some embodiments, the protein comprising a heparan binding domain is a growth factor comprising a heparan binding domain, In some embodiments, the growth factor comprises a vascular endothelial growth factor A (VEGF-A). In some embodiments, the VEGF-A comprises VEGF165. In some embodiments, the VEGF-A comprises VEGF189. In some embodiments, the growth factor comprises a fibroblast growth factor 2 (FGF2). In some embodiments, the growth factor activity (e.g., VEGF-A activity, FGF2 activity) is increased. In some embodiments, the grow th factor activity comprises: grow th factor binding to a growth factor receptor on the cell surface (e.g.. VEGF-A binding to VEGFR1 or VEGFR2, FGF2 binding to FGFR1, FGFR2, FGFR3, and / or FGFR4), signal pathways associated with the grow th factor (e.g., activation thereof), and / or intracellular phosphorylation.

[0067] Provided herein are also methods of modulating (e.g., increasing or decreasing) a growth factor activity in a cell. In some embodiments, the methods involve delivering a nuclease to the cell, wherein the nuclease degrades a cell surface bound RNA. In some embodiments, the grow th factor comprises a heparan binding domain or an arginine-rich domain.

[0068] As used herein, the term '‘growth factor’’ refers to a biologically active molecule that can have an effect on living tissues, such as promoting the growth of tissues. A growth factor can be a naturally occurring substance that is capable of stimulating cell proliferation, wound healing, and cell differentiation. In some embodiments, a growth factor comprises a secreted protein. In some embodiments, a growth factor comprises a steroid hormone. Exemplary growth factors include, but are not limited to, platelet-derived epidermal growth factor (PDEGF), platelet factor 4 (PF 4), transforming growth factor beta (TGF-P), acidic fibroblast growth factor (FGF-A), basic fibroblast growth factor (FGF-B), transforming growth factor A (TGF A), insulin-like growth factors 1 and 2 (IGF-1 and IGF-2), B thromboglobulin-related proteins (BTG), thrombospondin (TSP), fibronectin, von Willibrand's factor (vWF), fibropeptide A, fibrinogen, albumin, plasminogen activator inhibitor 1 (PAI-1), osteonectin, regulated upon activation normal T cell expressed and presumably secreted (RANTES), gro- A, vitronectin, fibrin D-dimer. factor V, antithrombin III, immunoglobulin-G (IgG), immunoglobulin-M (IgM), immunoglobulin A (IgA), a2-macroglobulin, aniogenin, Fg-D, elastase, keratinocyte growth factor (KGF), epidermal growth factor (EGF), tumor necrosis factor (TNF), fibroblast growth factor (FGF) and interleukin- 1 (IL-1), Keratinocyte Growth Factor-2 (KGF-2), vascular endothelial growth factor (VEGF), and combinations thereof.

[0069] In some embodiments, a growth factor comprises a vascular endothelial growth factor A (VEGF-A). In some embodiments, a VEGF-A comprises VEGF165 or VEGF189. In some embodiments, a growth factor comprises a fibroblast growth factor 2 (FGF2).

[0070] In some embodiments, the methods described herein comprise delivering one or more nucleases to cells or a subject. The nuclease can include, e.g.. an RNase. In some embodiments, the RNase is selected from RNase A superfamily (e g., RNase 1, RNase 2, RNase 3, RNase 4, RNase 5, RNase 6, RNase 7, and RNAse 8), RNase C, RNase H, RNase III, and RNase I. In some embodiments, the RNase includes RNase A, RNase III, or any combination thereof. Provided herein, inter alia, are methods of modulating (e.g., increasing or decreasing) intracellular phosphorylation in a cell. In some embodiments, the methods involve delivering a nuclease to the cell, wherein the nuclease degrades a cell surface bound RNA. In some embodiments, the intracellular phosphorylation is activated by a growth factor binding to a growth factor receptor on the cell surface. Also provided herein are methods of modulating (e.g., increasing or decreasing) VEGF activity in a cell that include: delivering a nuclease to the cell, wherein the nuclease degrades a cell surface bound RNA, thereby modulating (e.g., increasing or decreasing) VEGF activity in the cell. In some embodiments, the cell is in a human subject.

[0071] Growth factors are involved in a variety of cellular responses such as growth, differentiation, migration, metabolism, and transformation. In some embodiments, binding of the growth factor to its corresponding cell surface receptor results in activation of the receptor's intrinsic tyrosine kinase activity (e.g., intracellular phosphorylation), and subsequently in activation of complex multistep signal transduction cascades. In some embodiments, a growth factor comprises a vascular endothelial growth factor A (VEGF -A). In some embodiments, a VEGF-A comprises VEGF165 or VEGF189. In some embodiments, a growth factor comprises a fibroblast growth factor 2 (FGF2; also called basic fibroblast growth factor, or bFGF).

[0072] Vascular endothelial growth factor (VEGF) is a key component in the signaling cascade to form new blood vessels from existing vessels and can trigger proliferation, migration, and survival of cells through a single growth factor-receptor binding event. VEGF is a critical growth factor that controls many central pathways in cell biology. Without being bound by theory, VEGF is secreted and operates in the extracellular space by first interacting with heparan sulfates and then later brought to the cell surface to interact with a VEGF receptor to communicate its signaling activity. In some embodiments, due to alternative splicing, VEGF can exist as many different isoforms with different affinities for the extracellular matrix (ECM). In some embodiments, a VEGF (e.g., a VEGF-A) can be VEGF 165 that binds to the ECM, wherein VEGF 165 contains a 44 amino acid long heparin- binding domain located at the C-terminus end of the protein and is coded by exons 6 and 7 of the VEGF gene. In some embodiments, a VEGF (e.g., a VEGF-A) can be VEGF189 that also binds to heparan sulfate both on the cell surface and in the extracellular matrix (ECM). In some embodiments, a VEGF activity within a cell can include intracellular phosphorylation.

[0073] Fibroblast growth factor-2 (FGF-2) is a heparin-binding protein that induces proliferation and differentiation of a variety of cell types. Furthermore, FGF-2, a potent angiogenic factor, may stimulate hematopoiesis and play an important role in the differentiation and function of the central nervous system, wherein FGF-2 can stimulate neonatal and adult brain neurogenesis, playing an important role in regeneration after CNS injury and participating in a cascade of events to facilitate neuronal repair and survival. In some embodiments, a FGF-2 activity' within a cell can include inhibition of intracellular phosphorylation.

[0074] In some embodiments, provided herein are methods of modulating (e.g., increasing or decreasing) VEGF-A activity in a cell that include delivering a nuclease (e.g., an RNase) , or a functional equivalent (e.g., siRNA or small molecule inhibitor), to the cell, wherein the nuclease (e.g., an RNase; or functional equivalent thereof) degrades a cell surface bound RNA, thereby modulating (e.g., increasing or decreasing) VEGF-A activity in the cell. In some embodiments, the VEGF-A comprises VEGF165 or VEGF189. In some embodiments, the VEGF-A activity is increased. In some embodiments, the increased VEGF-A activity' comprises any one or more of: increased VEGF-A binding to a growth factor receptor (e.g., VEGFR1 or VEGFR2) on the cell surface, increased activity of signal pathways associated with VEGF-A binding, and increased intracellular phosphorylation. In some embodiments, the VEGF-A activity' is decreased. In some embodiments, the decreased VEGF-A activity comprises any one or more of: decreased VEGF-A binding to a growth factor receptor (e.g., VEGFR1 or VEGFR2) on the cell surface, decreased activity signal pathways associated with VEGF-A binding, and decreased intracellular phosphorylation.

[0075] In some embodiments, provided herein are methods of modulating (e.g., increasing or decreasing) FGF2 activity in a cell that include delivering a nuclease (e.g., an RNase) , or a functional equivalent (e.g.. siRNA or small molecule inhibitor), to the cell, wherein the nuclease (e.g., an RNase; or the functional equivalent thereof) degrades a cell surface bound RNA, thereby modulating (e.g., increasing or decreasing) FGF2 activity in the cell. In some embodiments, the FGF2 activity is increased. In some embodiments, the increased FGF2 activity comprises: increased FGF2 binding to a growth factor receptor (e.g., a receptor that binds F2F, such as any one or more of FGFR1, FGFR2. FGFR3, and FGFR4) on the cell surface, increased activity of signal pathways associated with FGF2 binding, and / or increased intracellular phosphorylation (e.g., ERK phosphorylation). In some embodiments, the FGF2 activity' is decreased. In some embodiments, the decreased FGF2 activity' comprises: decreased FGF2 binding to a growth factor receptor (e.g., a receptor that binds F2F, such as any one or more of FGFR1, FGFR2. FGFR3, and FGFR4) on the cell surface, decreased activity of signal pathways associated with FGF2 binding, and / or decreased intracellular phosphorylation.

[0076] In some embodiments, a cell comprises a cancer cell. In some embodiments, a cell comprises a non-transformed cell. In some embodiments, the cell is in a human subject (e.g., a human suffering from a cancer or a human in need of stimulating cell proliferation, wound healing, and / or cell differentiation).

[0077] Method of Treatment

[0078] Provided herein, inter alia, are methods of treating a disease in a subject comprising: administering a therapeutically effective amount of a nuclease (e.g., an RNase), wherein the nuclease degrades a cell surface bound RNA. Provided herein, inter laia, are methods of treating a wound in a subject comprising: administering a therapeutically effective amount of a nuclease (e.g., an RNase) to the wound, wherein the nuclease degrades a cell surface bound RNA.

[0079] Generally, the terms "treat", “treating”, or “treatment” refer to therapeutic or palliative measures. Beneficial or desired clinical results include, but are not limited to, any one or more of the following: alleviation, in whole or in part, of one or more symptoms associated with a disease or disorder, diminishment of the extent of a disease or disorder, stabilization (i.e., not worsening) state of a disease or disorder, delay or slowing of disease progression, amelioration or palliation of the disease state (e.g., one or more symptoms of the disease or disorder), and remission (whether partial or total); whether detectable or undetectable, and can be determined by various clinical assessments including clinical evaluation and self-reporting. “Treatment” can also mean prolonging survival as compared to the expected survival if not receiving treatment.

[0080] As used herein, a “therapeutically effective amount” can refer to an amount of compound that, when administered to a subject (e.g., a in need of such treatment), is sufficient to (i) treat a disease or disorder as described herein (e.g., a wound), (ii) attenuate, ameliorate, or eliminate one or more symptoms of the particular disease or disorder, or (iii) delay the onset of one or more symptoms of the particular disease or disorder described herein.

[0081] In some embodiments, a wound is a skin wound. In some embodiments, a wound is an internal wound. In some embodiments, a wound is a surgical wound on a visceral organ (e g., heart, lung, liver, pancreas, and intestines). In some embodiments, the administration comprises transdermal administration (e.g., of a nuclease). In some embodiments, the administration comprises injection (e.g., of a nuclease) to an internal wound. In some embodiments, the administration comprises intravenous administration. In some embodiments, the administration comprises intranasal administration. In some embodiments, the administration comprises contacting a cell (e.g., a cell in a subject, such as a human) with any agent (e.g., a nuclease) described herein.

[0082] In some embodiments, the subject is a human.

[0083] EXAMPLES

[0084] The invention is further described in the following examples, which do not limit the scope of the invention described in the claims.

[0085] Methods

[0086] Cell culture

[0087] MOLM-13 cells were cultured in Roswell Park Memorial Institute 1640 Medium (Thermo Fisher Scientific). U2OS (ATCC) were cultured in McCoy’s 5 A Medium (Thermo Fisher Scientific). MOLM-13 and U2OS cells were supplemented with 10% fetal bovine serum (FBS, Thermo Fisher Scientific) and lx Penicillin / Streptomycin (Thermo Fisher Scientific). Primary umbilical vein endothelial cells (HUVEC) (ATCC) were cultured in Vascular Cell Basal Medium (ATCC) supplemented with Endothelial Cell Growth Kit-VEGF (ATCC). All the experiments on HUVEC are performed before passage 10. All cells were cultured at 37°C with 5% CO2 and maintained as mycoplasma negative. U2OS cells were transfected with Avalanche-Omni Transfection Reagent (EZ Biosystems).

[0088] Live cell enz me and chemical treatments

[0089] For RNase treatment, RNase A (Sigma) and Shortcut RNase III (New England Biolabs, NEB) were added directly to the cell culture at a final concentration of 18 pM and 100 U / mL, separately. MOLM-13, U2OS. and HUVEC cells were all treated for 45 minutes. For Ac4ManNAz labeling, stocks of N-azidoacetylmannosamine-tetraacylated (Ac4ManNAz) were made to 500 mM in sterile dimethyl sulfoxide (DMSO). Ac4ManNAz was added to the cell culture at a final concentration of 100 pM for 24 hours before collection.

[0090] For heparinase treatment, heparinase I (NEB), heparinase II (NEB), and heparinase III (NEB) were added directly to the cell culture at a final concentration of 4 units / mL (each) for 30 minutes. For sodium chloride (NaCl) and sodium chlorate (NaCICh) treatment, NaCl and NaClOs were added to the cell culture at a final concentration of 50 mM for 24 hours. For exogenous Tega heparan sulfate chain treatment, rHS09 (TEGA Therapeutics) and rHS37 (TEGA Therapeutics) were added directly to the cell culture at a final concentration of 4 pM for 60 minutes.

[0091] For serum starvation. HUVECs were cultured in Vascular Cell Basal Medium (Bioresource Center. PCS 100030) without Endothelial Cell Grow th Kit-VEGF (Biosource Center) after being washed briefly for 3 times with phosphate buffer saline (PBS). VEGF- Ai65 (Thermo Fisher Scientific), VEGF-A121 (Thermo Fisher Scientific) and EGF (Thermo Fisher Scientific) were then added to starved HUVECs at a final concentration of 3 ng / mL and 25 ng / mL for 5 minutes, separately.

[0092] Live cell labeling, confocal microscopy, quantification, and statistical analysis

[0093] Adherent cells were cultured on glass coverslips # 1.5 (Bioscience Tools) 24 hours before labeling. MOLM-13 cells were counted and then blocked as per the manufacturer's protocol with Human TruStain FcX (Fc block, BioLegend) for 15 minutes on ice before labeling. For Siglecs staining in live cells, 1 pg / mL of recombinant human IgGl Fc (R&D Systems), Siglec-1 Fc chimera protein (R&D Systems), Siglec-2 Fc chimera protein (R&D Systems), Siglec-3 Fc chimera protein (R&D Systems), Siglec-4 Fc chimera protein (R&D Systems), Siglec-5 Fc chimera protein (R&D Systems). Siglec-6 Fc chimera protein (R&D Systems), Siglec-7 Fc chimera protein (R&D Systems), Siglec-8 Fc chimera protein (R&D Systems), Siglec-9 Fc chimera protein (R&D Systems), Siglec-10 Fc chimera protein (R&D Systems), Siglec-11 Fc chimera protein (R&D Systems), Siglec-14 Fc chimera protein (R&D Systems), and Siglec-15 Fc chimera protein (R&D Systems) were precomplexed with 0.5 pg / mL of donkey anti-human IgG AF647 (ImmunoResearch) secondary antibody in FACS buffer (0.5% BSA (Sigma) in lx PBS) for 45 minutes on ice. For 9D5 and 10E4 staining, 2.5 pg / mL of 9D5 (Absolute Antibody), 1 pg / mL of anti-heparan sulfate 10E4 (amsbio), and anti-VEGF (R&D Systems) were precomplexed w ith 1.25 pg / mL of goat anti-Rabbit AF647 secondary antibody (ThermoFisher Scientific), 0.5 pg / mL of goat anti-Mouse AF647 secondary antibody (ThermoFisher Scientific), or donkey anti-Goat IgG AF647 (ThermoFisher Scientific) secondary' antibodies in FACS buffer for 45 minutes on ice, separately. For VEGF-A165, VEGF-A121, and VEGFR2 staining, 1 pg / mL of anti-VEGF-Ai65 (R&D Systems), 1 pg / mL of anti-VEGFA (Proteintech), and 1 pg / mL anti-VEGFR2 (R&D Systems) w ere precomplexed with 0.5 pg / mL of goat anti-Rabbit AF647 secondary antibody and donkey anti-Goat AF647 secondary antibody (ThermoFisher Scientific). Precomplexed antibodies were then incubated with cells for 45 minutes on ice. For DDX21 and hnRNP-U staining, 2.5 pg / mL of anti-DDX21 (Novus Biological) and anti-hnRNP-U (Proteintech) were incubated with cells for 45 minutes on ice. Cells were gently washed twice by FACS buffer and then stained with 2.5 pg / mL of goat anti-Rabbit AF647 for 30 minutes on ice.

[0094] For 9D5 and Siglecs co-staining. recombinant human Siglec Fc chimera proteins were precomplexed with donkey anti-Human IgG AF488 (ImmunoResearch), 9D5 was precomplexed with goat anti-Rabbit AF647 secondary' antibody. For 9D5, Siglec-11, and 10E4 co-staining, 10E4 was precomplexed with goat anti-mouse AF568 (ThermoFisher Scientific). For VEGF-A165 and Siglec-11 co-staining, anti-VEGF-Ai65 was precomplexed with donkey anti-Goat AF647 secondary’ antibody, recombinant human Siglec-11 Fc chimera protein was precomplexed with donkey anti-Human IgG AF488. Antibodies or regents were precomplexed in separate tubes with the same concentration as used in single channel staining and then mixed before adding to cells. After staining, cells were washed three times with ice-cold PBS and a fixation was performed with 3.7% formaldehyde for 15 minutes at room temperature in the dark. Nuclei were stained with 0.1 pg / mL DAPI in PBS. MOLM-13 cells were applied to glass slides using a CytoSpin centrifuge (ThermoFisher Scientific) at 500x g for 5 minutes.

[0095] For mEmerald-positive U2OS cell imaging, cells were fixed with 3.7% formaldehyde for 15 minutes at room temperature and then stained with DAPI. Finally, all samples above were mounted in ProLong Diamond Antifade Mountant (ThermoFisher Scientific) and a cover glass w as sealed over the samples with nail polish. All samples w ere then imaged on a Leica SP8 STED ONE microscope with 63x oil lens. Images were acquired using Leica LAS X software. The DAPI channel was acquired with a PMT detector while all other channels were imaged using Hybrid detectors.

[0096] For quantification and statistical analysis, at least three random regions of interest (ROIs) from three independent samples were acquired across one or more z-slices. To analyze the colocalization, images were processed using Imaris Microscopy Image Analysis software (Oxford Instruments). A single z-slice from each ROI was taken, selected to be near the middle of the cells (with respect to their z-thickness), and the spot-finder function was used to identify spots of roughly 0.5 pm. In-software background subtraction w as used as the default settings, and spots were selected by thresholding spot quality at the elbow' of the distribution. This resulted in a series of x- and y-positions for each spot from each channel, which were then exported for quantitative analysis. Colocalization of spots from paired channels were analyzed by implementing a custom Python script to identify the nearest neighbors of each spot (in nanometers, nm) with a k-d tree algorithm (scipy.spatial.KDTree). Then, the distances between nearest neighbors were calculated for each pair of targets across all ROIs and plotted in a histogram. To assess the relative fraction of each spot type (channel #1) within the other pair’s spots (channel #2), a Manders’ colocalization coefficient (MCC) was calculated using the aforementioned Python script. This calculation was performed in both directions: spots of channel #1 in total channel #2 spots, and the reverse.

[0097] To quantify' and compare the intensities of spots on the cell surface, Leica LAS X software was used to identify ROIs throughout the entire 4x slice z-stack. To quantify and compare the spot numbers of spots on the cell surface, Imaris was used to identify spots throughout the entire 4x slice z-stack. The mean intensities and numbers of ROIs were then divided by the cell numbers and compared across groups. Statistical analysis and data plotting were performed using GraphPad Prism 10.

[0098] Live cell flow cytometry

[0099] MOLM-13 cells were directly counted. U2OS cells were gently lifted with Accutase (Sigma- Aldrich) for 3 minutes at 37°C, quenched with growth media, and then counted. For each condition, 50,000 cells were used. For antibody staining, MOLM-13 cells were blocked as per the manufacturer's protocol with Human TruStain FcX in FACS buffer for 15 minutes on ice. 1 pg / mL of recombinant human IgGl Fc, Siglec-7 Fc chimera protein, and Siglec-11 Fc chimera protein were precomplexed with 0.5 pg / mL of donkey anti-human IgG AF647 secondary antibody in FACS buffer for 45 minutes on ice. Precomplexed antibodies were then added to bind cells on ice for 45 minutes. For live cell periodate labeling of cell surface glycans, cells were washed twice with cold PBS + Ca + Mg and then incubated at 4°C in cold PBS + 1 mM sodium periodate for 5 minutes at 1 million cells per mL. Cells were then quenched with 1 mM glycerol added to the PBS, and then cells were washed twice with cold PBS. Cells were then incubated at 4°C in cold FACS buffer + 25 pM aminooxy -biotin (Cayman Chemical) + 10 mM aniline for 30 minutes at 1 million cells per mL. Cells were mixed via pipetting halfway through the incubation. Cells were then washed once with cold lx PBS and blocked as per the manufacturer's protocol with Human TruStain FcX in FACS buffer for 15 minutes on ice. Cells were then stained for 30 minutes on ice with Strep-AF647 at 1 pg / mL. After staining, all cells were spun at 4°C for 3 minutes at 400x g and supernatant discarded. Cells were washed once with 150 pL of FACS buffer, spun under the same conditions, and finally resuspended in FACS buffer containing 0. 1 pg / mL DAPI. Data collection occurred on a BD Biosciences LSRFortessa 3 and a gating strategy was used to isolate live, single cell, to examine antibody binding using FlowJo Software (FlowJo LLC).

[0100] Live cell RNA proximity labelin

[0101] Samples were prepared similarly to the flow cy tometry7workflow as described above however rather than dye-conjugated secondaries, here horseradish peroxidase (HRP) conjugates secondaries were used. 1 pg / mL of recombinant human IgGl Fc or Siglec-11 Fc chimera protein was precomplexed with 0.5 pg / mL of Protein A -HRP (Cell Signaling Technology7) on ice for 30 minutes. Cells were adjusted to 1 million cells per mL of FACS and then the precomplexed antibodies were added for staining. Staining occurred for 60 minutes at 4°C on rotation, after which cells were pelleted, supernatants discarded, and cells washed once in ice-cold PBS. This wash is important to remove excess BSA in the FACS buffer. Next, cells were gently but quickly resuspended in 985 pL of 200 pM biotin-aniline (Iris Biotech) in PBS at 25°C. To this, 15 pL of 100 mM H2O2 was quickly added, tubes capped and inverted, and the reaction allowed to proceed for 2 minutes at 25°C. Precisely after 2 minutes, the samples were quenched by adding FACS buffer with sodium azide and sodium ascorbate to a final concentration of 5 mM and 10 mM, respectively. Samples were inverted and pelleted at 4°C. Cell pellets were directly lysed in 500 pL of RNAzol RT (Molecular Research Center). Samples were shaken at 50°C for 5 minutes. To phase separate the RNA, 0.4X volumes of water was added, vortexed, let to stand for 5 minutes at 25°C and lastly spun at 12,000x g at 4°C for 15 minutes. The aqueous phase was transferred to clean tubes and 1.1X volumes of isopropanol was added. The RNA was then purified over a Zymo column (Zymo Research). For all column cleanups, the following protocol was followed. First, 350 pL of pure water was added to each column and spun at 10,000x g for 30 seconds, and the flowthrough was discarded. Next, precipitated RNA from the RNAzol RT extraction (or binding buffer precipitated RNA, below) was added to the columns, spun at 10,000x g for 20 seconds, and the flowthrough w as discarded. This step w as repeated until all the precipitated RNA was passed over the column once. Next, the column was washed three times total: once using 400 pL of RNA Prep Buffer (3M GuHCl in 80% EtOH), twice with 400 pL of 80% ethanol. The first two spins were at 10,000x g for 20 seconds, the last for 30 seconds. The RNA w as then treated with Proteinase K (Ambion) on the column. Proteinase K is diluted 1: 19 in water and added directly to the column matrix and then allowed to incubate on the column at 37°C for 45 minutes. The column top was sealed with either a cap or parafilm to avoid evaporation. After the digestion, the columns w ere brought to room temperature for 5 minutes; lowering the temperature is important before proceeding. Next, eluted RNA was spun out into fresh tubes and a second elution with water was performed. To the eluate, 1.5 pg of the mucinase StcE (Sigma- Aldrich) was added for every 50 pL of RNA and placed at 37°C for 30 minutes to digest. The RNA was then cleaned up again using a Zymo column. Here, 2X RNA Binding buffer (Zymo Research) was added and vortexed for 10 seconds, and then 2X (samples + buffer) of 100% ethanol was added and vortexed for 10 seconds. The final RNA was quantified using a Nanodrop. In vitro RNase or Sialidase digestions took place by digesting 50 pg total RNA with either, nothing, 4 pL RNase Cocktail (ThermoFisher Scientific), or 4 pL of a2-3,6,8,9 Neuraminidase A (NEB,) in lx NEB Glyco Buffer #1 (NEB) for 60 minutes at 37°C. After digestion, RNA was purified using a Zymo column as noted above and was then ready for gel analysis.

[0102] In order to visualize the labeled RNA, the samples were run on a denaturing agarose gel, transferred to nitrocellulose membranes (Bio-Rad Laboratories), stained with IRDye 800CW Streptavidin (LI-COR Biosciences). After elution from the column as described above, the RNA is combined with 12 pL of Gel Loading Buffer II (GLBII, 95% formamide, 18 mM EDTA. 0.025% SDS) with a final concentration of lx SybrGold (ThermoFisher Scientific) and denatured at 55°C for 10 minutes. It is important to not use GLBII with dyes. Immediately after this incubation, the RNA is placed on ice for at least 2 minutes. The samples were then loaded into a 1% agarose, 0.75% formaldehyde, 1.5x MOPS buffer (Lonza) denaturing gel. Precise and consistent pouring of these gels is critical to ensure a similar thickness of the gel for accurate transfer conditions; it was aimed for approximately 1 cm thick of solidified gel. RNA was electrophoresed in lx MOPS at 115V for between 34 or 45 minutes, depending on the length of the gel. Subsequently, the RNA was visualized on a UV gel imager, and excess gel was cut away; leaving -0.75 cm of gel around the outer edges of samples lanes will improve transfer accuracy. The RNA was transferred with 3M NaCl pH 1 (with HC1) to a nitrocellulose membrane for 90 minutes at 25°C. Post transfer, the membrane was rinsed in lx PBS and dried on Whatman Paper (GE Healthcare). Dried membranes were rehydrated in Intercept Protein-Free Blocking buffer (LI-COR Biosciences) for 30 minutes at room temperature. After the blocking, the membranes were stained using IRDye IR800 streptavidin for 30 minutes at 25°C. Excess Streptavidin-IR800 was washed from the membranes using three washes with 0.1% Tween-20 in lx PBS for 3 minutes each at 25°C. The membranes were scanned on a LI-COR Odyssey CLx scanner (LI-COR Biosciences). Images and intensity of bands were acquired using LI-COR Image Studio software. SialoglycoRNA labeling, and in vitro enzyme digestions

[0103] Small RNA was isolated and Ac4ManNAz was labeled with copper-free click using dibenzocyclooctyne-PEG4-biotin (DBCO-biotin, Sigma). After labeling RNA was analyzed via gel as described above. For in vitro heparinase digestions, 2 pg of small RNA was reacted in a final volume of 20 pL with lx Heparinase Buffer (NEB) and 0.5 pL of each of the three heparinase enzymes described above. After 45 minutes at 37°C, the RNA was cleaned up with a Zymo column and analyzed by RNA blotting.

[0104] Western blot

[0105] Cells were quickly rinsed with ice-cold PBS, and directly lysed with samples buffer (150 mM Nad, 50 mM Tris, 0.5% TritonX-100, pH 7.4) containing phosphatase inhibitor cocktail (Cell Signaling Technology) on ice for 15 minutes. After centrifugation at 12,000x g for 15 minutes at 4°C, lysates were heated at 95°C for 10 minutes in lx NuPAGE LDS loading buffer (ThermoFisher Scientific) containing 5 mM DTT. Samples were then resolved by SDS-PAGE using AnyKD Criterion TGX Precast Midi Protein Gels (Bio-Rad Laboratories) and transferred to nitrocellulose membranes. Membranes were blocked in blocking buffer and incubated with primary7antibodies (diluted in blocking buffer) at 4°C overnight. After washing three times for 3 minutes each in lx PBS with 0.1% Tween-20 (PBST), membranes were incubated with secondary antibodies at room temperature for 45 minutes, followed by the same 3x PBST washing. Membranes were finally rinsed in lx PBS and scanned on a LI-COR Odyssey CLx scanner. Images and intensity of bands were acquired using LI-COR Image Studio software.

[0106] Primary antibodies used: mouse monoclonal anti-EXT2 (Santa Cruz, sc-514092, immunoblot 1 : 1000), mouse monoclonal anti-GAPDH (Santa Cruz, sc-47724, immunoblot 1: 1000), rabbit polyclonal anti-GFP (Invitrogen, Al 1122, immunoblot 1 :1000), mouse monoclonal anti- NDST1 (Santa Cruz, scl00790, immunoblot 1: 1000), mouse monoclonal anti-HS6STl (Santa Cruz, sc-398231. immunoblot 1: 1000), mouse monoclonal anti-HS2STl (Santa Cruz, sc- 376530, immunoblot 1: 1000), rabbit monoclonal anti-phospho-p44 / 42 MAPK (Erkl / 2) (Thr202 / Tyr204) (Cell Signaling Technology, 4696S, immunoblot 1:500), mouse monoclonal anti-p44 / 42 MAPK (Erkl / 2) (Cell Signaling Technology7, 4370S, immunoblot 1:500). Secondary antibodies used: IRDye 800CW goat anti-Rabbit IgG secondary antibody (LI- COR Biosciences, 926032211, immunoblot 1 : 1000) and IRDye 800CW goat anti-Mouse IgG Secondary antibody (LI-COR Biosciences, 926-32210, immunoblot 1: 1000). Genome-wide CRISPR / Cas9 screening

[0107] MOLM-13 cells expressing Cas9 under blasticidin selection were grown as above and selected with 10 pg / mL blasticidin for 3 days to ensure a homogenous starting population. Starting after selection on Day 0, 30 million cells were infected with 1: 150 the genomewide- sgRNA lentivirus in 60 mL of fresh media with 8 pg / mL polybrene. On Day 3 cells were spun dow n and resuspended in 70 mL of fresh media with 1 pg / mL puromycin to select for sgRNA infected cells. On Day 5 the media was exchanged for fresh media with 1 pg / mL puromycin. On Day 6 the cells were switched to normal media without puromycin for expansion. From Days 7 to 18 the cells were counted and passaged as needed in fresh media to maintain a cell density between 750,000 and 2,000.000 cells per mL. On Day 18 cells were counted: 40M cells were saved prior to sorting for an input population reference and 200M cells for each Siglec-11 and 9D5 were saved for staining and sorting. To stain, 1000 pg Siglec-11 was precomplexed with 270 pg secondary' antibody, 450 pg 9D5 was precomplexed with 225 pg secondary antibody, and 266 pg of MAAI was precomplexed with 266 pg Streptavidin AF647. Live cell staining was performed as noted above with Fc blocking; however, before FACS sorting, cells were filtered over a 40 pm strainer (Coming) and stained with DAPI. Cells were selected for DAPI negative (live) and then the bottom 5% intensity of cells stained with each Siglec-11 or 9D5 were sorted into tubes. Cells were collected in FACS buffer after sorting spun down into pellets at 500x g for 4 minutes at room temperature; input cells were processed in a similar fashion to obtain a cell pellet. After removing the supernatant, cell pellets were frozen at -80°C for later processing. Cells were then processed by resuspending in 200 pL lx PBS + 5 pL RNaseA + 20 pL Proteinase K and incubated at 25°C for 5 minutes. Then 200 pL of Buffer AL (Qiagen) was added and samples were carefully vortexed to mix without shearing genomic DNA (gDNA). The samples were then headed to 56°C for 60 minutes. After heating, 200 pL of 100% ethanol was added, gentle vortexing was again used, and then the material was purified over Zymo columns. All spins were performed at 6,000x g for 20 seconds: after spinning the sample through, the columns were washed twice with 80% ethanol and then the DNA was eluted with 2x 15 pL water. For input samples the initial volumes were scaled up from 200 pL to 1000 pL of digestion and Qiagen buffers.

[0108] To amplify the sgRNAs out of the gDNA real-time PCR was performed and for each sample performed 12 parallel reactions each with 1 pg of input gDNA. The PCR reactions were 50 pL final with 200 nM forward and reverse primers with lx Q5 PCR Master Mix (NEB); 23 cycles of 98°C for 20 seconds, 65°C for 20 seconds, and 72°C for 90 seconds were completed. After PCR, the 12 reactions were pooled and purified over a Zymo column following the manufacturer's recommended protocol for PCR DNA. To add a final index primer for sequencing, a final round of PCR was performed by taking 100 ng of amplified sgRNA library and 5 cycles of the above PCR program was run followed by Zymo column clean up. The finally indexed libraries were assessed for size and concentration on a BioAnalyzer High Sensitivity DNA Chip (Agilent). Libraries were pooled equimolar and then sequencing on the NextSeq platform (Illumina) with a 19 bp Read 1 and two 8 bp index reads. For the Read 1 a custom sequencing primer 5’- TCTTCCGATCTCTTGTGGAAAGGACGAAACACCG-3’ (SEQ ID NO: 1) was used. Enrichment of guides and genes were analyzed using the MAGeCK statistical package by comparing read counts from each cell line with counts from matching plasmid as the initial population.

[0109] Generation and characterization of KO and stabl expressing, cell lines

[0110] All CRISPR-Cas9 knockout assays used PX459. The target oligonucleotides used were: EXT2: TCTCCCGGGAGTATAATGAA (SEQ ID NO: 2); NDST1: CCGGAGGCTGTGTCGGCACG (SEQ ID NO: 3); HS6ST1: CTACCTGAGCGAGTGGCGGC (SEQ ID NO: 4); HS2ST1: AATTGAGCAGCGACATACAA (SEQ ID NO: 5). U2OS cells were transfected with gDNA vectors. Two days later, puromycin (Invivogen, ant-pr-1) was added to the cell culture at a final concentration of 2 pg / mL and the live cells were selected by flow cytometry (BD science, FACS Calibur 2) for isolation of single clones. The expanded individual clones were screened by genomic DNA sequencing and western blot analysis.

[0111] Complementary DNA (cDNA) for human EXT2 was amplified from cDNA library' (Takara Bio); cDNAs for Sulfl and Sulf2 were gifts from Steven Rosen (Addgene plasmid). All three cDNA were inserted into mEmerald-Cl (Addgene). All plasmids were verified by DNA sequencing. To generate U2OS cells stably expressing mEmerald-EXT2, mEmerald-EXT2 D517N / D573N, mEmerald-Sulfl, or mEmerald-Sulf2, cells were transfected with the indicated plasmids and selected using 200-1,000 pg / pL (gradually increasing) G418 (Invivogen) for two weeks; green-positive cells were sorted into mono-clones by flow cytometry' and cultured in the presence of 200 pg / pL G418 for 2 weeks. Proliferated clones were verified by immunoblotting and fluorescence imaging. UV crosslinking

[0112] 25 ng / mL of VEGF-A165 were added to starved HUVECs for 5 minutes. Cells were treated by UV (60000 pJ. 2 minutes) on the ice and then directly lysed with samples buffer. For RNase treatment, RNaseA and RNaselll were added to the samples at a final concentration of 1000 ng / mL and 20 U / mL, separately. Samples were all incubated at 37°C for 10 minutes and then lysed on ice for another 10 minutes. After centrifugation at 12,000x g for 15 minutes at 4°C, lysates were incubated with 5 pL Protein-G bead (Thermo Scientific) pre-conjugated with 1 pg of anti-VEGF-A (Proteintech) at 4°C overnight. The beads were washed three times with PBS and heated at 95°C for 10 minutes in lx NuPAGE LDS loading buffer containing 5 mM DTT. Samples were then analyzed by Western blot described above. Anti-VEGF-Ai65 (R&D Systems, AF293-NA. immunoblot 1: 1000) and donkey anti-Goat IgG secondary antibody (LI-COR Biosciences, 92632214, immunoblot 1 :1000) were used as primary and secondary' antibodies, separately.

[0113] In vitro IP and rPAL

[0114] 5 pL Protein-G bead was pro-conjugated with 1 pg of anti-VEGF-A or 9D5 antibodies in samples buffer for 1 hour at 4°C. After washing three times with samples buffer, beads were incubated with 1 pg of VEGF-A165 or VEGF-A121 for 2 hours at 4°C. The beads were w ashed three times with samples buffer and then incubated with 1 pg of HUVEC small RNA for 2 hours at 4°C. After washing three times with samples buffer, the beads were suspended in 50 pL RNA binding buffer and heated for 5 minutes at 50°C. Remove the beads and transfer the RNA extract solution to a new tube. Here, 100 pL of pure water w as added and vortexed for 10 seconds, and then 300 pL of 100% ethanol was added and vortexed for 10 seconds. The RNAs were purified over a Zymo column.

[0115] For rP AL labeling, experiments were performed as described previously. Briefly, lypophilized RNAs were suspended with 28 pL blocking buffer (1 pL 16 mM mPEG3-Ald (BroadPharm), 15 pL 1 M MgSC>4 and 12 pL 1 M NH4OAC pH5 (w ith HC1)) and then incubated for 45 minutes at 37°C. 1 pL 30 mM aldehyde reactive probe (Cayman Chemicals, ARP / aminooxy biotin) is added first, then 2 pL mM NalCh (periodate) is added. The periodate is allowed to perform oxidation for exactly 10 minutes at room temperature in the dark. The periodate is then quenched by adding 3 pL of 22 mM sodium sulfite. The reaction is allow ed to proceed for 5 minutes at 25°C, and then moved to 35°C for 90 minutes. The reaction is then cleaned up by Zymo column. The RNAs were eluted from the column using 2X 6.2 pL water and denatured at 55°C for 10 minutes with 12 pL of Gel loading Buffer II. Immediately after the heating, the RNAs were placed on ice for 2 minutes. Samples were then analyzed by RNA northern blotting and Streptavidin staining described above.

[0116] Example 1. Siglec-11 binds cells in an RNA-dependent manner and is in proximity to glycoRNAs on the cell surface

[0117] It was previously found that Siglec-11 (recombinant form of the extracellular domain of Siglec-11 fused to a human Fc domain) binds to the surface of HeLa cells in an RNA- dependent manner. To expand the understanding of which Siglecs have RNA-dependent cell surface binding, the 13 commercially available Siglec-Fc fusion proteins were screened for binding to suspension (MOLM-13) and adherent (U2OS) cell lines. Siglec-4, Siglec-7, Siglec-9, and Siglec-11 strongly bound both cell types above the level shown by the control IgG-Fc (FIGs. 1A, 6A). A pooled RNase treatment (RNase A, a single stranded RNase and RNase III, a double stranded RNase) resulted in a significant reduction of Siglec-11 binding ability7, as measured by total dots per cell (FIGs. 1A, IB) and intensity per cell (FIGs. 1A, 6B), on both cell types. Live cell RNase treatment had no impact on the binding of Siglec-4, Siglec-7, or Siglec-9 (FIGs. 1A, IB, 6B). These data support the initial observation of RNA- dependent binding of Siglec-1 1. As a control for reagent specificity, live cells were also treated with a sialidase cocktail to evaluate the impact of removal of cell surface sialic acids. Both Siglec-7 binding and cell surface periodate labeling demonstrated robust and significant loss of binding after sialidase treatment (FIG. 6C), whereas Siglec-11 binding was not impacted (MOLM-13) or only mildly impacted (U2OS, FIG. 6C) under the same conditions.

[0118] Examining the confocal imaging data of Siglec- 11 binding showed the ligands of Siglec-11 formed as clusters or puncta on the cell surface (FIG. 1A). Cell surface puncta of Siglec ligands has been seen previously, for example with super resolution imaging of Siglec- 7 and Siglec-9 binding. Given the observed punctate nature of Siglec-1 1 binding and its RNA-dependency, it was predicted that RNA should colocalize with Siglec-11 on the cell surface. Recently, a new domain on the cell surface was described, glycoRNA-csRBP clusters, where cell surface RNA binding proteins (csRBPs) and glycoRNAs colocalize to facilitate the functional entry of molecules such as cell penetrating peptides. To address the possible association of Siglec-11 ligands near or within these glycoRNA-csRBP clusters, an anti-dsRNA antibody (9D5) was used that detects cell surface RNA. Costaining of U2OS and MOLM-13 cells with 9D5 and Siglec-11 showed that 42% and 61% of 9D5 puncta overlapped with Siglec-11 on MOLM-13 and U2OS cells, respectively. Co-staining 9D5 with Siglec-7 and separately with Siglec-9, both of which are not sensitive to RNases (FIGs. 1A, IB, 6B) showed that only 2.5% and 1.4% of 9D5 puncta overlapped with Siglec-7 or Siglec-9 in MOLM-13, and 0% and 2.8% of 9D5 puncta overlapped with Siglec-7 or Siglec-9 in U2OS, respectively (FIGs. 1C, ID). The well-correlated binding of 9D5 and Siglec-11 suggests that Siglec-11 ligands are near RNA on the cell surface.

[0119] To directly assess if Siglec-11 ligands are in proximity' to glycoRNAs, cell surface proximity’ labeling was performed, using biotin aniline to label RNAs in proximity to bound Siglec-11. Analysis of biotin signal from total RNA extracted from labeled cells showed that the IgG-Fc control had no signal, whereas Siglec-11 staining produced an extended smear to higher molecular yveights from both MOLM-13 and U2OS cells (FIGs. IE, 6D). In vitro digestion of total RNA from labeled cells demonstrated that the biotin signal was sensitive to RNase whereas sialidase treatment resulted in a more slowly migrating smear (FIG. IE). This RNase and sialidase sensitivity is consistent with previous results using plant lectins (WGA and MAA-II) to label cell surface RNAs. Together these data demonstrate that Siglec- 11 binding on living cells depends on cell surface RNA, and that the binding region is in proximity’ to glycoRNA, suggesting that Siglec-11 ligands are near to or within glycoRNA- csRBP clusters.

[0120] Example 2. Heparan sulfate biogenesis is a major genetic determinant of glycoRNA- csRBP clustering

[0121] To gain insight into the genetic basis of Siglec-11 and 9D5 binding, a genome-wide CRISPR-Cas9 gene knockout approach was developed based on flow cytometry of MOLM- 13 cells using Siglec-11, 9D5, and the plant lectin MAA-I, which is yvell characterized to selectively bind sialic acid. sgRNA sequencing data was analyzed from unsorted input and the bottom 5% of sorted cells and it was determined which sgRNAs and corresponding genes were enriched for reducing the binding of the three probes (FIGs. 2A, 2B, 7A). Using a CRISPR-score cutoff of -0.8, 154, 187, and 246 hits yvere found in the Siglec-11, 9D5, and MAA-I screens, respectively. The top hits enriched in the MAA-I screen were related to sialic acid biosynthesis (FIG. 7A). for example CMAS and NANS, but both of these genes scored poorly in the Siglec-11 and 9D5 screen, confirming the specificity of the screen. Analysis of these enriched genes showed a more robust overlap between 9D5 and Siglec-11 enriched sgRNAs, compared to MAA-I yvith either of the other two probes (FIG. 2C). Gene ontology analysis (GO) of the cellular compartment and biological process demonstrated that enriched genes were related to membrane compartments (FIG. 7B), suggesting each probe yvas addressing cell surface biology. Inspection of the top hits of Siglec-11 revealed EXT1, EXT2, and UXS1 as the top three genes, which are key enzymes of heparan sulfate biogenesis (FIG. 2A). The 9D5 screen also revealed EXT1 as a highly scoring hit, while UXS1 and EXT2 were present but below the -0.8 cutoff (FIG. 2B).

[0122] Both Siglec-11 and 9D5 demonstrated genetic dependency on heparan sulfate (HS) biosynthesis. The HS chain is initiated by xylosylation of proteoglycan core proteins, which depends on UDP-Xylose formation catalyzed by UXS1, and is subsequently elongated by a hetero-dimeric complex formed by EXT1 and EXT2 in the golgi apparatus. Next, two individual knockout clones of EXT2 in U2OS cells were generated, to validate the effect of HS biogenesis on Siglec-11 and 9D5 binding outside of the genome-wide screen and in another cell type (U2OS, FIGs. 7C, 7D, 2D). The live EXT2 knockout (KO) cells were stained with 10E4. a specific antibody recognizing mature HS, and it was verified that HS was not produced (FIGs. 2D, 2E, 7E, 7F). Consistent with the high score for EXT2 in the genome-wide screen, EXT2 deficiency resulted in complete loss of both Siglec-11 and 9D5 binding (FIGs. 2D, 2E, 7E, 7F). Binding of Siglec-7 and Siglec-9 was not affected (dots per cell or intensity’ per cell) in EXT2-KO cells (FIGs. 2D, 2E, 7E, 7F). To assess if csRBPs were also regulated by HS biogenesis, live cell staining was performed using anti-DDX21 and anti-hnRNP-U antibodies. Consistent with 9D5 and Siglec-11 signals, no DDX21 and hnRNP-U antibody binding occurred on the cell surface in EXT2 KO cells (FIGs. 2E, 2F, 7F, 7G). To understand if this effect was due to the enzymatic activity or some other role of EXT2, EXT knockout cells were transfected with WT EXT2 or a catalytically inactive (D517N / D573N) mutant EXT2 cDNA. WT EXT2 rescued the loss of 9D5, Siglec- 11 , csDDX21, and cs-hnRNP-U signal (FIGs. 2D-2F, 7D-7G), whereas the catalytically inactive mutant did not. This finding indicates that the N-acetylglucosaminyltransferase (GlcNAc-T) activity of EXT2 in HS polymerization is required to facilitate glycoRNA-csRBP clustering on the cell surface. Finally, the levels of sialoglycoRNA were examined in EXT2 KO cells. Loss of EXT2 led to partial (42.5% in KOI and 21.2% in KO2) reduction in sialoglycoRNA signal (FIG. 2G). Together these data suggest that HS biogenesis is required for glycoRNA- csRBP clustering on the cell surface and that there may be close physical interaction.

[0123] Example 3. GlycoRNA-csRBP clusters are colocalized with, and dependent on, intact heparan sulfate polymers

[0124] Mature HS proteoglycans present on the cell surface or in the extracellular matrix after biogenesis and vesicular trafficking to the plasma membrane. To determine whether the mature HS chains structure on the cell surface or the intracellular HS biogenesis process facilitates glycoRNA-csRBP clustering on the cell surface, live cell staining was performed on U2OS cells after heparin lyase treatment (45 min, heparin lyases I / II / III), which cleaves heparan sulfate chains in the extracellular space. As predicted, binding of 10E4 was lost in heparin lyase-treated cells (FIGs. 3A, 8A). Heparin lyase treatment also completely removed the Siglec-11 and 9D5 binding on cells (FIGs. 3A, 8A), but did not affect Siglec-7 and Siglec-9 binding (FIGs. 3A, 8A). Staining with anti-DDX21 and anti-hnRNP-U antibodies showed that cleavage of mature HS chains also resulted in the loss of csDDX21 and cs- hnRNP-U puncta on the cell surface (FIGs. 3A, 8A). Given the robust sensitivity of 9D5 and Siglec-11 binding to heparin lyase, the activity of the enzyme was tested on glycoRNAs in vitro. Heparin lyase had no direct effect on glycoRNAs. indicating that HS was not covalently linked to the RNAs (FIG. 8B). These data show that mature HS chains are required for glycoRNA-csRBP cluster formation.

[0125] Given the co-localization of 9D5 and Siglec-11 and sensitivity to heparin lyases, it was sought to understand the spatial relationship between 9D5, Siglecll, and HS. Therefore, a three-color co-staining experiment was performed in U2OS cells and it was found that Siglec-11 puncta are highly correlated in localization with 10E4 puncta (FIGs. 3B, 3C; green line). Next, the temporal regulation on glycoRNA-csRBP clustering was assessed by conducting a recovery experiment in cells after heparin lyase treatment, removal of the enzymes and incubation of the cells with fresh media for 0, 45, 90, or 180 minutes. HS puncta reappeared up after a 45-minute recovery from heparinase treatment (9.4%) while Siglec-11 or 9D5 clustering was not detected (FIGs. 3B, 3C, 3D). After 90 minutes, 9D5 and Siglec-11 started to recover together at sites of large HS clusters. (FIGs. 3B, 3C, 3D). Finally, all the signals of HS, Siglec-11, and 9D5 recovered to normal after 180 minutes (FIGs. 3C, 3D), confirming that cell surface HS chains are vital for the formation of glycoRNA-csRBP clusters.

[0126] Example 4. 6-D-sulfation of Heparan sulfate chains facilitates glycoRNA-csRBP cell surface clustering

[0127] Next, it was examined how the sulfation of heparan sulfate chains participates in the glycoRNA-csRBP clusters. NDST1 catalyzes GlcNAc N-deacetylation / N-sulfation of the HS chains (FIG. 4A). Deletion of NDST1 in U2OS cells (FIGs. 9A, 9B) resulted in a 74% loss of N-sulfo glucosamine residues as measured by reduction of 10E4 staining, which is known to depend on N-sulfation (FIGs. 4B, 4C). Staining of NDST1 knockout cells with Siglec-11, 9D5, anti-DDX21, and anti-hnRNP-U revealed that NDSTl deficiency caused 77%, 72%, 62%, and 63% loss of dot number per cell in Siglec-11, 9D5, csDDX21, and cs-hnRNP-U (FIGs. 4B, 4C). Because the NDST family has four members and U2OS cells express both NDST1 and NDST2, only a partial effect was expected when NDST1 was deleted. To broadly inhibit sulfation, cells were treated with sodium chlorate, a metabolic inhibitor of sulfation, and near complete loss of 10E4, Siglec-11, 9D5, csDDX21, and cs-hnRNP-U was found, whereas sodium chloride (control) had no effect (FIG. 9C, 9D).

[0128] To refine the understanding of the role of HS sulfation, next, it was assessed how modulating uronyl 2-O-sulfation and glucosaminyl 6-O-sul fation impacts glycoRNA-csRBP clustering, by generating HS2ST1 and HS6ST1 knockout U2OS cells, respectively (FIGs. 4A, 9A, 9B). Loss of 2-O-sulfation did not significantly alter the binding of the antibody panel (FIGs. 4B, 4C), whereas loss of 6-O-sulfation reduced Siglec-11, 9D5. csDDX21. and cs-hnRNP-U bindings by 76%, 67%, 56%, and 53%, respectively (FIGs. 4B, 4C). Sulfl and Sulf2 are two extracellular sulfatases that can remove sulfate from the C-6 position of glucosamine of intact HS (FIG. 4A). Stable expression of Sulfl and Sulf2 (FIGs. 9E, 9F) removed total Siglec-11. 9D5, csDDX21, and cs-hnRNP-U on U2OS cells (FIGs. 4B, 4C), suggesting that 6-O-sul fation of HS facilitates glycoRNA-csRBP clustering on the cell surface. Addition of exogenous HS chains with high V-, 6-O-, and 2-O-sulfation (rHS09) caused a loss of clustering of Siglec-11, 9D5, csDDX21, and cs-hnRNP-U, whereas the addition ofHS chains with only high A- and 6-O-sulfation (rHS37) actually increased the average level of binding 2- to 3-fold) (FIGs. 4B, 4C). The combined genetic and chemical evidence indicates that 6-<9-s til Ration of HS promotes glycoRNA-csRBP cluster formation on the cell surface.

[0129] Example 5. GlycoRNA-csRBP clusters suppress VEGF-Aies-induced signaling in primary endothelial cells

[0130] Collectively, the data suggests a biophysical mechanism underlies the HS-dependent clustering of glycoRNA-csRBP on the cell surface. To extend these studies, which were performed in tumor cell lines, to primary’ cells, the human umbilical vein endothelial cells (HUVECs) were treated with the pooled heparin lyases, which resulted in complete loss of binding of the antibody panel (FIGs. 5A, 10A). Treatment of HUVECs with RNases reduced binding Siglec-11, 9D5, csDDX21, and cs-hnRNP-U puncta by 73%, 83%, 96%, and 93%, respectively, without affecting 10E4 staining (FIGs. 5A, 10A). These results confirm that control of glycoRNA-csRBP clustering by HSPG is conserved between cancer cell lines and at least one primary cell model. The colocalization of HS with glycoRNA-csRBPs suggested the possibility that growth factor signaling normally thought to depend on HS action as a coreceptor might in fact be modulated by glycoRNA-csRBP clusters. To test this hypothesis, serum starvation of HUVECs and western blotting was used to detect total and phosphorylated ERK (ERK and pERK) after VEGF-A stimulation. Various proteoforms of VEGF-A including VEGF-A121 and VEGF-A165 bind the VEGFR via their N-terminal domains; the extended C-terminus of VEGF-A165 enables interactions with heparan sulfates and neuropilin-1 (a VEGFR coreceptor). Serum starvation of the HUVECs reduced phosphorylation of ERK relative to total ERK by -77% (FIG. 5B); upon stimulation with 3 ng / mL of VEGF-A165 or VEGF-A121, >50% recovery of the pERK levels was observed (FIG. 5B, brown bars). Pre-treatment of the cells with the RNase pool before the addition of VEGF-A165 resulted in a 3-fold and 2.1 -fold increase in pERK compared to cells without RNase treatment and to homeostatic levels in untreated cells, respectively (FIG. 5C). This was not true for VEGF-A121 which showed no change in the recovery pERK levels with or without RNase pre-treatment (FIG. 5C). Outside of VEGF-A, other growth factors like epidermal growth factor (EGF) can also signal through the ERK pathway; however EGF is not a HSPG-binding protein. EGF (3 ng / mL) was able to fully restore pERK to pre-starved levels and was similarly insensitive to RNase as VEGF- A121 (FIG. 5D). The RNase-dependent effect of VEGF-A165 (and the insensitivity of VEGF- A121 and EGF) are also seen at 25 ng / mL of each growth factor demonstrating robustness of this mechanism across a range of concentrations (FIGs. 10B-10D).

[0131] To directly assess if the RNase-dependent enhancement of pERK after VEGF-A165 treatment is downstream of VEGFR2 signaling, we next monitored phospho-VEGFR2 at tyrosine 1175. Only after the addition ofVEGF-Ai65 did we observe detectable pVEGFR2 and this was enhanced by 2.69-fold upon RNase-treatment of the HUVEC cells (FIG. 5J). These findings suggest that exRNA antagonizes VEGF-A165 activation of ERK signaling at least in part through VEGFR2.

[0132] Next, it w as assessed how7the loss of cell surface RNA directly impacts cell surface association of VEGF-A. Serum starv ation and pre-treatment with the RNase pool led to ~2x more binding of VEGF-Aies to the cell surface while VEGF-A121 saw- no changes on its cell surface association (FIG. 5E). To determine if this was related to change only in VEGF-Aies or its receptor on HUVECs VEGFR2, VEGFR2 w as imaged under the same conditions and no changes w ere found in the receptor abundance on the cell surface (FIG. 5F). To further explore the mechanism of enhanced signal transduction after the loss of cell surface RNA, the spatial relationship between VEGF-A165 and glycoRNA-csRBP clusters was examined. Co- staining of VEGF-Aies and Siglec-11 on HUVECs revealed 78% of Siglec-11 puncta overlapped with VEGF-Aies and 40% of VEGF-A165 puncta overlapped with Siglec-11 (FIGs. 5G, 10E, 10F). VEGF-A165 was absent on cells without the exogenous addition of VEGF-A, while Siglec-11 clusters were clearly present (FIG. 10E).

[0133] Finally, to understand how the cell surface RNA itself could repress the ability for VEGF-A165 to bind the cell surface, it was investigated if VEGF- Ai65 directly interacts with cell surface RNA. After starvation and VEGF-Aies addition, cells were UV-C crosslinked to produce covalent bonds between directly bound RNA-protein complex and immunoprecipitates of the bound VEGF- Aies were evaluated. Without UV-C, VEGF-Aies was recovered, however, upon crosslinking the native migrating band disappears (FIG. 5H). It was predicted this was due to covalent UV-crosslinking of VEGF-Aies to RNA and consistent with this, RNase treating the lysate after UV-C exposure restores the native migrating VEGF-Aies band (FIG. 5H). Next, it was tested if VEGF- Aies could directly interact with glycoRNAs. Co-incubating VEGF-Aies with small RNA from HUVEC cells and subsequent VEGF-A IP and rPAL labeling resulted in selective capture of glycoRNAs (FIG. 51). If VEGF-Aies were omitted or VEGF-A121 were added, glycoRNAs could not be isolated (FIG. 51). Further, the anti-RNA antibody 9D5 was able to capture bulk small RNA (Sybr signal) but unable to preferentially isolate glycoRNA species in vitro like when using VEGF- Aies to capture small RNA (FIG. 51, 10G, 10H), indicating that VEGF-Aies selectively interacts with glycoRNAs.

[0134] The interactions between RNA and VEGF-A are dependent on the C-terminal domain of the WT form of VEGF-Aies (FIG. 5K). The VEGF-A121 protein has no observable binding to small RNA from HUVEC cells, while VEGF-A6165 has an approximate Kd of 370nm to the pool of small RNA from HUVEC cells (FIG. 5K).

[0135] Example 6. bFGF2 and VEGF165 directly binds glycoRNA

[0136] Purified small RNA was added to bFGF2 / VEGF 165 conjugated on beads via antibodies. After incubation. rPAL analysis, a periodate oxidation and aldehyde ligation method, was used to detect sialoglycoRNAs (FIG. 11).

[0137] Example 7. Cell surface glycoRNA participates in bFGF activated signaling

[0138] Phosphorylation of ERK is a mark of bFGF signaling, promoting cellular process including proliferation. Nutrient including growth factor was removed from media for primary HUVEC, which inhibits phosphorylation of ERK and provides a background for specific grow th factor. Live cell RNase treatment was used to remove cell surface glycoRNA, and then bFGF2 was added to the media. After incubation for 5 minutes, western blot analysis was used to detect the phosphorylation of ERK and total ERK as a control (FIG. 12). OTHER EMBODIMENTS

[0139] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

WHAT IS CLAIMED IS:

1. A method of modulating a growth factor activity in a cell, the method comprising: delivering an RNase to the cell, wherein the grow th factor comprises a heparan binding domain, and wherein the RNase degrades a cell surface bound RNA, thereby modulating the growth factor activity in the cell.

2. The method of claim 1, w herein the growth factor comprises a vascular endothelial growth factor A (VEGF-A).

3. The method of claim 2, wherein the VEGF-A comprises VEGF165 or VEGF189.

4. The method of claim 1, wherein the growth factor comprises a fibroblast growth factor 2 (FGF2).

5. The method of any one of claims 1-4, wherein the growth factor activity is increased and comprises any one or more of: increased growth factor binding to a growth factor receptor on the cell surface, increased signal pathways associated with the growth factor, and increased intracellular phosphorylation.

6. The method of any one of claims 1-4, wherein the growth factor activity is decreased and comprises any one or more of: decreased growth factor binding to a growth factor receptor on the cell surface, decreased signal pathways associated with the growth factor, and decreased intracellular phosphorylation.

7. A method of modulating intracellular phosphorylation in a cell, the method comprising: delivering an RNase to the cell, wherein the intracellular phosphorylation is modulated by a growth factor binding to a growth factor receptor on the cell surface, wherein the RNase degrades a cell surface bound RNA, thereby modulating intracellular phosphorylation in the cell.

8. The method of claim 7, wherein the growth factor comprises a vascular endothelial growth factor A (VEGF-A).

9. The method of claim 8, wherein the VEGF-A comprises VEGF165 or VEGF189.

10. The method of claim 7, wherein the growth factor comprises a fibroblast growth factor 2 (FGF2).

11. The method of any one of claims 7-10, wherein the modulating of intracellular phosphorylation comprises the intracellular phosphorylation being increased.

12. The method of any one of claims 7-10, wherein the modulating of intracellular phosphorylation comprises the intracellular phosphorylation being decreased.

13. A method of modulating VEGF-A activity in a cell, the method comprising: delivering an RNase to the cell, wherein the RNase degrades a cell surface bound RNA, thereby modulating VEGF-A activity in the cell.

14. The method of claim 13. wherein the VEGF-A comprises VEGF165 or VEGF189.

15. The method of any one of claims 13-14, wherein the VEGF-A activity is increased and comprises any one or more of: increased VEGF-A binding to a growth factor receptor (e.g., VEGFR2) on the cell surface, increased signal pathways associated with VEGF-A activity, and increased intracellular phosphorylation.

16. A method of modulating FGF2 activity in a cell, the method comprising: delivering an RNase to the cell, wherein the RNase degrades a cell surface bound RNA, thereby modulating FGF2 activity in the cell.

17. The method of claim 16, wherein the FGF2 activity is increased and comprises anyone or more of: increased FGF2 binding to a growth factor receptor (e.g., a receptor that binds F2F) on the cell surface, increased signal pathways associated with FGF2 activity, and increased intracellular phosphorylation (e.g., ERK phosphorylation)18. The method of any one of claims 1-17, wherein the RNase comprises any one or more of: an RNase A, RNase 1, RNase 2, RNase 3, RNase 4, RNase 5, RNase 6, RNase 7,RNase 8, RNase C. RNase H, RNase E, RNase R, RNase, RNase Tl, RNase T2, RNase U2, RNase V. RNase III, and RNase I.

19. The method of any one of claims 1-18, wherein the RNase comprises RNase A, RNase III, or any combination thereof.

20. The method of any one of claims 1-19, wherein the cell comprises a cancer cell.

21. The method of any one of claims 1-19, wherein the cell comprises a non-transformed cell.

22. The method of any one of claims 1-21, wherein the cell is in a human subject.

23. A method of treating a wound in a subject, the method comprising: administering a therapeutically effective amount of an RNase to the wound, wherein the RNase degrades a cell surface bound RNA, thereby treating the wound in the subj ect.

24. The method of claim 23. wherein the wound is a skin wound and the administration comprises transdermal administration or topical administration of the RNase.

25. The method of claim 23, wherein the wound is an internal wound and the administration comprises injection of the RNase at or near the site of the internal wound.

26. The method of any one of claims 23-25, wherein the RNase comprises any one or more of: an RNase A, RNase 1, RNase 2, RNase 3, RNase 4, RNase 5, RNase 6, RNase 7. RNase 8. RNase C, RNase H, RNase E, RNase R. RNase. RNase Tl. RNase T2, RNase U2, RNase V, RNase III, and RNase I.

27. The method of claim 26, wherein the RNase comprises RNase A, RNase III, or any combination thereof.

28. The method of any one of claims 23-27, wherein the subject is a human.

Images