RNA editing system activating wnt signaling pathway

By using the Cas13d protein RNA editing system to target Axin1 and Axin2 and delivering gRNA via the AAV vector, the Wnt signaling pathway was safely and effectively activated in adults. This solved the safety and effectiveness issues of traditional small molecule activation methods, promoting lung cell regeneration and inhibiting pulmonary fibrosis.

WO2026025245A1PCT designated stage Publication Date: 2026-02-05SHANGHAI TECH UNIV
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2024/108277
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-07-29
Publication Date
2026-02-05

AI Technical Summary

Technical Problem

In the current technology, how to safely and effectively activate the Wnt signaling pathway in adults is an unsolved problem. Traditional small molecule inhibitors cannot specifically target tissues or cells, and their safety and drug efficacy cannot be guaranteed.

Method used

Using the Cas13d protein RNA editing system, gRNA sequences targeting Axin1 and Axin2, members of the β-Catenin degradation complex, were designed. The editing elements were delivered via an AAV vector, transiently downregulating the mRNA levels of Axin1 and Axin2 and activating the Wnt signaling pathway.

Benefits of technology

It achieved safe and effective regulation of mRNA levels in specific cells, significantly upregulating Wnt activity, promoting lung cell regeneration and inhibiting pulmonary fibrosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2024108277_05022026_PF_FP_ABST
    Figure CN2024108277_05022026_PF_FP_ABST
Patent Text Reader

Abstract

Provided is an RNA editing system activating a Wnt signaling pathway, relating to the field of gene editing. Provided is an RNA editing element, comprising an Axin1-targeting RNA fragment and an Axin2-targeting RNA fragment. A gRNA that targets both Axin1 and Axin2 is constructed, which, compared with gRNAs targeting Axin1 or Axin2 alone, can significantly up-regulate Wnt activity. An AAV6 vector is screened from three AAV vectors of different serotypes, and exhibits relatively high expression intensity and efficiency and high infection efficiency with respect to airway epithelial cells and alveolar epithelial cells while exhibiting very low infection efficiency with respect to immune cells and endothelial cells. The AAV vector is assembled with a Cre-LoxP recombinase system to together infect a host cell, thereby facilitating the measurement of Cas13d knockdown efficiency by means of fluorescent labeling.
Need to check novelty before this filing date? Find Prior Art

Description

An RNA editing system that activates the Wnt signaling pathway Technical Field

[0001] This application relates to the field of gene editing, and in particular to an RNA editing system that activates the Wnt signaling pathway. Background Technology

[0002] The CRISPR system is an acquired immune defense mechanism discovered in bacteria, in which the Cas13 protein specifically targets RNA. In March 2018, Konermann of the Salk Institute and Yan et al. of Arbor Biotechnologies isolated a new Cas13 protein, named Cas13d, from different bacterial species. Cas13d functions by working synergistically with gRNA. The gRNA consists of two parts: a spacer sequence (approximately 30 nt in length) that specifically recognizes the target gene and a DR sequence for binding the Cas13d protein. When the spacer sequence recognizes the target RNA through base pairing, the Cas13d protein is recruited to a specific site and exerts cleavage activity, leading to RNA degradation. Because Cas13d is smaller, only about 930 amino acids, it is easier to deliver by viral vectors. In 2020, Zhou Haibo et al. used Cas13d to specifically knock down the expression of the Ptbp1 gene in retinal Müller glial cells and used an AAV vector to achieve retinal ganglion cell regeneration in adults, demonstrating the feasibility of in vivo RNA editing with Cas13d.

[0003] On the other hand, taking lung tissue as an example, alveoli are crucial sites for gas exchange, but they are easily damaged due to their close contact with the external environment. Alveoli have two types of epithelial cells: Type I alveolar epithelial cells and Type II alveolar epithelial cells. The former are responsible for gas exchange, while the latter reduce alveolar surface tension by secreting surfactants. Under normal conditions, the lungs are highly quiescent tissues, but studies have shown that different epithelial stem / progenitor cells exist in various regions of the lung. These cells can respond rapidly after lung injury, participating in the repair of tracheal and alveolar damage through proliferation and differentiation. These stem / progenitor cells include type II alveolar epithelial cells located in the alveoli, which have the potential to differentiate into type I alveolar epithelial cells; basal cells located in the trachea, which can differentiate into various types of airway epithelial cells; Club cells in the airways, which can differentiate into ciliated cells; bronchioalveolar stem cells (BASCs) at the bronchoalveolar junction, which can differentiate into alveolar and airway epithelial cells; stem / progenitor cells located in the distal airways, known as lineage negative epithelial stem / progenitor cells (LNEPs), which have the potential to differentiate into type II alveolar epithelial cells and basal-like cells; in addition, type II alveolar epithelial cells (AT2s) in the alveoli have the potential to differentiate into type I alveolar epithelial cells (AT1s).

[0004] The differentiation fate of these epithelial stem / progenitor cells is closely related to their microenvironment, with the Wnt / β-catenin signaling pathway involved in the proliferation and differentiation of stem / progenitor cells. In influenza models, activation of the Wnt / β-catenin signaling pathway in LNEPs can promote their differentiation towards AT2. In addition, the Wnt / β-catenin signaling pathway maintains the stem cell activity of AT2 cells and promotes their proliferation. Studies have shown that by developing a specific antibody against Frizzled5, activating the Wnt / β-catenin activity of AT2 cells can promote AT2 cell proliferation in both organoid systems and bleomycin-induced mouse models.

[0005] The Wnt signaling pathway is a highly conserved signal transduction pathway in organisms, playing a role in cell proliferation, differentiation, and migration. Previous studies have shown that activation of the Wnt signaling pathway plays a role in the regeneration of various tissues, such as promoting liver damage repair and skin epidermal renewal. However, how to safely and effectively activate the Wnt signaling pathway in adults remains an unsolved problem. Traditional small molecule inhibitors, such as CHIR99021 and LiCl, can activate the Wnt signaling pathway by inhibiting GSK3β activity; however, small molecule inhibitors cannot target specific tissues or cells, and their safety and efficacy cannot be guaranteed.

[0006] Summary of the Invention

[0007] In view of the shortcomings of the prior art described above, and to address the technical problem that the Wnt signaling pathway cannot be safely and effectively activated in existing technologies, this application aims to provide an RNA editing system for activating the Wnt signaling pathway. Based on Cas13 protein CasRx, RNA editing, compared to DNA editing, only alters the RNA level without changing the DNA sequence. Since RNA has many copies within the cell and is constantly being updated, this is a transient regulatory method with better safety. This application selects Cas13d and designs gRNA sequences specifically targeting the β-Catenin degradation complex members Axin1 and Axin2. By transiently downregulating the expression levels of Axin1 and Axin2 mRNA, β-Catenin is stabilized, activating the Wnt signaling pathway. Furthermore, this application also selects an AAV vector to deliver the editing element. By screening different AAV serotypes, the AAV serotype with optimal infection efficiency for specific cells was selected. The editing element is packaged into an AAV vector and further delivered into adults, ultimately achieving safe and effective regulation of the mRNA level in specific cells, thereby activating the Wnt signaling pathway.

[0008] To achieve the above and other related objectives, the first aspect of this application provides an RNA editing element, including an RNA fragment targeting Axin1 and an RNA fragment targeting Axin2.

[0009] A second aspect of this application provides a biological material selected from any of the following:

[0010] 1) The biological material is a polynucleotide that encodes the aforementioned RNA editing element;

[0011] 2) The biomaterial is a nucleic acid construct containing the polynucleotides in 1);

[0012] 3) The biomaterial is a host cell, which includes the construct or genome of 2) containing polynucleotides of 1).

[0013] A third aspect of this application provides a gene editing system comprising: an RNA editing element or its encoding gene as described above; and a nuclease or its encoding gene, or a complex of the RNA editing element and the nuclease.

[0014] A fourth aspect of this application provides a pharmaceutical composition comprising the aforementioned gene editing system and a pharmaceutically acceptable carrier.

[0015] The fifth aspect of this application provides the use of the aforementioned RNA editing element, the aforementioned biomaterial, the aforementioned gene editing system, or the aforementioned pharmaceutical composition in the preparation of a product having one or more of the following functions:

[0016] a) Activate the Wnt pathway;

[0017] b) Treatment of lung injury-related diseases;

[0018] c) Promotes lung regeneration;

[0019] d) Promotes the proliferation and differentiation of type II alveolar epithelial cells.

[0020] The sixth aspect of this application provides a gene editing method in which the aforementioned gene editing system is brought into contact with the Axin1 and Axin2 genes to achieve the editing of the Axin1 and Axin2 genes.

[0021] The seventh aspect of this application provides a cell obtained by gene editing using the aforementioned gene editing method; preferably, the cell is a mammalian cell; more preferably, the cell is a lung epithelial stem cell.

[0022] Compared with the prior art, the beneficial effects of this application are as follows:

[0023] 1. The present invention constructs gRNA that simultaneously targets Axin1 and Axin2, which can significantly upregulate Wnt activity compared to gRNA that targets Axin1 or Axin2 alone.

[0024] 2. In this invention, the AAV6 vector was screened from three different serotypes of AAV vectors. It showed high expression intensity and infection efficiency, and high infection efficiency against airway epithelial cells and alveolar epithelial cells, but very low infection efficiency against immune cells and endothelial cells.

[0025] 3. The AAV vector is assembled with the Cre-LoxP recombinase system to co-infect host cells, which facilitates the detection of Cas13d knock-in efficiency by fluorescent labeling. Attached Figure Description

[0026] Figure 1 shows the mechanism of action of Cas13d and the structure of its gRNA (Konermann S et al. Cell, 2018, 173(3):665-676).

[0027] Figure 2 is a schematic diagram of the gRNA sequences targeting Axin1 and Axin2 screened in Example 3. CasRx and gRNAs targeting Axin1 and Axin2 were overexpressed in mouse cell lines, and the knockdown effects of different gRNAs on Axin1 and Axin2 were detected by qRT-PCR and Western Blot.

[0028] Figure 3 shows the effect of knocking down Axin1 and Axin2 on the activation of the Wnt pathway in Example 3. The effect of knocking down Axin1 and Axin2 on Wnt pathway activity was investigated using a luciferase reporter system with single gRNAs or combinations of gRNAs. The results showed that simultaneous knockdown of Axin1 and Axin2 significantly upregulated Wnt signaling pathway activity.

[0029] Figure 4 shows the structure of the AAV in Example 4.

[0030] Figure 5 shows the percentage of AAV-infected cells in each cell population as determined by flow cytometry in Example 4. Different AAV serotypes expressing GFP were delivered to mouse lung tissue via endotracheal intubation. The infection intensity and infection efficiency of different AAVs on different cell types were compared by flow cytometry, and the AAV6 serotype was ultimately selected.

[0031] Figure 6 is a schematic diagram of the proportion of AAV co-infected cells detected by flow cytometry in Example 5.

[0032] Figure 7 is a flow cytometry graph showing the recombination efficiency of the Split-Cre enzyme system in mice as detected in Example 6.

[0033] Figure 8 shows the AAV carrier packaging strategy of Example 6.

[0034] Figure 9 shows the activation of the in vivo Wnt signaling pathway mediated by AAV6 in Example 6.

[0035] Figure 10 shows the inhibition of pulmonary fibrosis development by activation of the Wnt signaling pathway in the preventive experimental group of Example 7.

[0036] Figure 11 shows that activation of the Wnt signaling pathway inhibited the development of pulmonary fibrosis in the therapeutic experimental group of Example 7. Detailed Implementation

[0037] To make the inventive objectives, technical solutions, and beneficial effects of this application clearer, the following description, in conjunction with embodiments, further illustrates this application. It should be understood that the embodiments described are for illustrative purposes only and are not intended to limit the scope of the application. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, and those skilled in the art can easily understand other advantages and effects of this application from the content disclosed in this description.

[0038] This application was completed based on extensive research and exploration that led to the discovery of an RNA editing system that activates the Wnt signaling pathway.

[0039] This application provides an RNA editing element comprising an RNA fragment targeting Axin1 and an RNA fragment targeting Axin2. The RNA editing element is gRNA. Axin1 and Axin2 are β-Catenin degradation complexes; degradation of Axin1 and Axin2 can affect the stability of β-Catenin, activate the Wnt signaling pathway, and thus affect the process of lung cell regeneration.

[0040] In the RNA editing elements provided in this application, both Axin1 and Axin2 include Exon. Exon is a gene sequence that is preserved during precursor mRNA splicing and eventually appears in mature mRNA, and can be encoded and translated into protein.

[0041] The RNA editing element provided in this application includes an RNA fragment targeting the Axin1 Exon region and an RNA fragment targeting the Axin2 Exon region. Preferably, the Axin1 Exon region is selected from Exon2, Exon6, Exon9, or Exon10 of Axin1, and the Axin2 Exon region is selected from Exon2, Exon6, Exon10, or Exon11 of Axin2. More preferably, the Axin1 Exon region is selected from Exon9 of Axin1, and the Axin2 Exon region is selected from Exon10 of Axin2.

[0042] The RNA editing elements provided in this application include the gene encoding the spacer of the RNA fragment targeting Axin1, which includes SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15 or SEQ ID NO: 16.

[0043] In some implementations, the spacer sequence encoding the Exon2 target for Axin1 includes SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, or SEQ ID NO: 8. Specifically, it is:

[0044] atcagtgaacaatgagcgctgca(g11, SEQ ID NO: 2);

[0045] atcttggtcatccagtaaggaatgcagtga(g1, SEQ ID NO: 3);

[0046] ctcctgcttcaggaaagtcctgaacaggct(g2, SEQ ID NO: 4);

[0047] gtcacagggctcaagcttcctgaagccact(g3, SEQ ID NO: 5);

[0048] gctcttagtggctggcttggtttgtctgga(g4, SEQ ID NO: 6);

[0049] ataaatgtcagacttaagaaaggaagggta(g5, SEQ ID NO: 7);

[0050] cggccatcatcctcatctgcatcttggt(g13, SEQ ID NO: 8);

[0051] gacacaatgccattgctatccag(g12, SEQ ID NO:9).

[0052] In some implementations, the spacer sequence encoding the Exon6 gene targeting Axin1 includes SEQ ID NO: 10 or SEQ ID NO: 11. Specifically, it is:

[0053] gaccctttgcacgtgctcatccaggatgct(g6, SEQ ID NO: 10);

[0054] tagcactgcagtcttagccacatgcccact(g7, SEQ ID NO: 11).

[0055] In some implementations, the spacer sequence encoding the Exon9 gene targeting Axin1 includes SEQ ID NO: 12, SEQ ID NO: 13, or SEQ ID NO: 14. Specifically, it is:

[0056] cccacagaaatagtaggccacaacaatgct(g8, SEQ ID NO: 12);

[0057] ggttagcagctccttgaactggcccagggt(g9, SEQ ID NO: 13);

[0058] ccacagaaatagtaggccacaac(g14, SEQ ID NO: 14).

[0059] In some implementations, the spacer sequence encoding the Exon10 gene targeting Axin1 includes SEQ ID NO: 15 or SEQ ID NO: 16. Specifically, it is:

[0060] actcactttcttaaagtagtatctgtagct(g10, SEQ ID NO: 15);

[0061] acatgtacaatatatagaggccc (g15, SEQ ID NO: 16).

[0062] The gene encoding the spacer of the RNA fragment targeting Axin2 includes the sequences shown in SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20 or SEQ ID NO: 21.

[0063] In some implementations, the spacer sequence encoding the Exon2 gene targeting Axin2 includes SEQ ID NO: 17. Specifically, it is:

[0064] acaagcaaaccagaagtccagcg (g21, SEQ ID NO: 17).

[0065] In some implementations, the spacer sequence encoding the Exon6 gene targeting Axin2 includes SEQ ID NO: 18. Specifically, it is:

[0066] caataataatctgttcccccagg (g25, SEQ ID NO: 18).

[0067] In some implementations, the spacer sequence encoding the Exon10 gene targeting Axin2 includes SEQ ID NO: 19. Specifically, it is:

[0068] cagaaaaagtaggtgacaaccag (g22, SEQ ID NO: 19).

[0069] In some implementations, the spacer sequence encoding the Exon11 target for Axin2 includes SEQ ID NO: 20 or SEQ ID NO: 21. Specifically, it is:

[0070] ttagtctatgaatttcagaaccc(g24, SEQ ID NO: 20);

[0071] attaacttaacacaaacccgagc (g23, SEQ ID NO: 21).

[0072] Preferably, the coding gene for the spacer of the RNA fragment targeting Axin1 includes the sequence shown in SEQ ID NO: 14 (g14), and the coding gene for the spacer of the RNA fragment targeting Axin2 includes the sequence shown in SEQ ID NO: 19 (g22).

[0073] The RNA editing elements provided in this application further include DR sequences for the RNA fragments targeting Axin1 and Axin2. Preferably, the gene encoding the DR sequence includes the sequence shown in SEQ ID NO: 1. Specifically, it is:

[0074] caagtaaacccctaccaactggtcggggtttgaaac (SEQ ID NO: 1).

[0075] Both the 5' and 3' ends of the gRNA targeting Axin1 and the gRNA targeting Axin2 contain DR sequences, with one or more spacer sequences between the two DR sequences; multiple spacer sequences are linked together by DR sequences.

[0076] The CRISPR sequence consists of a differentially expressed sequence (called the spacer sequence) integrated from a phage gene fragment and a scaffold sequence (called the scaffold or DR, Direct Repeat) for binding the Cas protein. The CRISPR sequence is transcribed into a guide RNA (gRNA) precursor sequence (pre-gRNA). After being processed into mature gRNA, the gRNA specifically recognizes a foreign sequence that can pair with it through base complementarity and mediates Cas protein cleavage of it, thereby preventing reinfection by the same phage.

[0077] The mechanism of action of Cas13d is shown in Figure 1A. In this application, gRNA is constructed into a plasmid vector that can be expressed by mammalian cells. Specifically, a 23nt spacer sequence that specifically targets Axin is inserted between two DR sequences. The two DR sequences are mainly to mimic the unprocessed and immature gRNA precursor sequence, as shown in Figure 1B.

[0078] The RNA editing elements provided in this application include gene encoding RNA fragments targeting Axin1, such as those shown in SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34 or SEQ ID NO: 35.

[0079] In some implementations, the gene encoding the Exon2 gRNA targeting Axin1 includes SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, or SEQ ID NO: 28. Specifically, it is:

[0080] caagtaaacccctaccaactggtcggggtttgaaacatcagtgaacaatgagcgctgcacaagtaaacccctaccaactggtcggggtttgaaac (gRNA encoding gene of g11, SEQ ID NO: 22);

[0081] caagtaaacccctaccaactggtcggggtttgaaacatcttggtcatccagtaaggaatgcagtgacaagtaaacccctaccaactggtcg gggtttgaaac (gRNA encoding gene of g1, SEQ ID NO: 23);

[0082] caagtaaacccctaccaactggtcggggtttgaaacctcctgcttcaggaaagtcctgaacaggctcaagtaaacccctaccaactggtcggggtttgaaac (gRNA encoding gene of g2, SEQ ID NO: 24);

[0083] caagtaaacccctaccaactggtcggggtttgaaacgtcacagggctcaagcttcctgaagccactcaagtaaacccctaccaactggtcggggtttgaaac (gRNA encoding gene of g3, SEQ ID NO: 25);

[0084] caagtaaacccctaccaactggtcggggtttgaaacgctcttagtggctggcttggtttgtctggacaagtaaacccctaccaactggtcggggtttgaaac (gRNA encoding gene of g4, SEQ ID NO: 26);

[0085] caagtaaacccctaccaactggtcggggtttgaaacataaatgtcagacttaagaaaggaagggtacaagtaaacccctaccaactggtcggggtttgaaac (gRNA encoding gene of g5, SEQ ID NO: 27);

[0086] caagtaaacccctaccaactggtcggggtttgaaaccggccatcatcctcatctgcatcttggtcaagtaaacccctaccaactggtcggggtttgaaac (gRNA encoding gene of g13, SEQ ID NO: 28);

[0087] caagtaaacccctaccaactggtcggggtttgaaacgacacaatgccattgctatccagcaagtaaacccctaccaactggtcggggtttgaaac (gRNA encoding gene for g12, SEQ ID NO: 29).

[0088] In some implementations, the gene encoding the Exon6 gRNA targeting Axin1 includes SEQ ID NO: 30 or SEQ ID NO: 31. Specifically, it is:

[0089] caagtaaacccctaccaactggtcggggtttgaaacgaccctttgcacgtgctcatccaggatgctcaagtaaacccctaccaactggtcggggtttgaaac (gRNA encoding gene for g6, SEQ ID NO: 30);

[0090] caagtaaacccctaccaactggtcggggtttgaaactagcactgcagtcttagccacatgcccactcaagtaaacccctaccaactggtcggggtttgaaac (gRNA encoding gene for g7, SEQ ID NO: 31).

[0091] In some implementations, the gene encoding the Exon9 gRNA targeting Axin1 includes SEQ ID NO: 32, SEQ ID NO: 33, or SEQ ID NO: 34. Specifically, it is:

[0092] caagtaaacccctaccaactggtcggggtttgaaaccccacagaaatagtaggccacaacaatgctcaagtaaacccctaccaactggtcggggtttgaaac (gRNA encoding gene for g8, SEQ ID NO: 32);

[0093] caagtaaacccctaccaactggtcggggtttgaaacggttagcagctccttgaactggcccagggtcaagtaaacccctaccaactggtcggggtttgaaac (gRNA encoding gene of g9, SEQ ID NO: 33);

[0094] caagtaaacccctaccaactggtcggggtttgaaacccacagaaatagtaggccacaaccaagtaaacccctaccaactggtcggggtttgaaacttttt (gRNA encoding gene for g14, SEQ ID NO: 34).

[0095] In some implementations, the gene encoding the Exon10 gRNA targeting Axin1 includes SEQ ID NO: 35 or SEQ ID NO: 36. Specifically, it is:

[0096] caagtaaacccctaccaactggtcggggtttgaaacactcactttcttaaagtagtatctgtagctcaagtaaacccctaccaactggtcggggtttgaaac (gRNA encoding gene for g10, SEQ ID NO: 35);

[0097] caagtaaacccctaccaactggtcggggtttgaaacacatgtacaatatatagaggccccaagtaaacccctaccaactggtcggggtttg aaac (gRNA encoding gene for g15, SEQ ID NO: 36).

[0098] The RNA editing elements provided in this application include gene encoding RNA fragments targeting Axin2, such as sequences shown in SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, or SEQ ID NO: 41.

[0099] In some implementations, the gene encoding the Exon2 gRNA targeting Axin2 includes SEQ ID NO: 37. Specifically, it is:

[0100] caagtaaacccctaccaactggtcggggtttgaaacacaagcaaaccagaagtccagcgcaagtaaacccctaccaactggtcggggtttgaaac (gRNA encoding gene of g21, SEQ ID NO: 37).

[0101] In some implementations, the gene encoding the Exon6 gRNA targeting Axin2 includes SEQ ID NO: 38. Specifically, it is:

[0102] caagtaaacccctaccaactggtcggggtttgaaaccaataataatctgttcccccaggcaagtaaacccctaccaactggtcggggtttgaaac (gRNA encoding gene for g25, SEQ ID NO: 38).

[0103] In some implementations, the gene encoding the Exon10 gRNA targeting Axin2 includes SEQ ID NO: 39. Specifically, it is:

[0104] caagtaaacccctaccaactggtcggggtttgaaaccagaaaaagtaggtgacaaccagcaagtaaacccctaccaactggtcggggtttgaaacttttt (gRNA encoding gene for g22, SEQ ID NO: 39).

[0105] In some implementations, the gene encoding the Exon11 gRNA targeting Axin2 includes SEQ ID NO: 40 or SEQ ID NO: 41. Specifically, it is:

[0106] caagtaaacccctaccaactggtcggggtttgaaacttagtctatgaatttcagaaccccaagtaaacccctaccaactggtcggggtttgaaac (gRNA encoding gene of g24, SEQ ID NO: 40);

[0107] caagtaaacccctaccaactggtcggggtttgaaacattaacttaacacaaacccgagccaagtaaacccctaccaactggtcggggtttgaaac (gRNA encoding gene for g23, SEQ ID NO: 41).

[0108] Preferably, the gene encoding the RNA fragment targeting Axin1 includes the sequence shown in SEQ ID NO: 34, and the gene encoding the RNA fragment targeting Axin2 includes the sequence shown in SEQ ID NO: 39.

[0109] The RNA editing element provided in this application encodes a gene including the sequence shown in SEQ ID NO: 42.

[0110] In a specific embodiment of this application, the gRNA encoding gene that simultaneously targets Axin1 and Axin2 includes, starting from the 5' end, a DR sequence, a g14 sequence, a DR sequence, a g22 sequence, and a DR sequence connected sequentially. The encoding gene is shown in SEQ ID NO: 42, and is as follows:

[0111] caagtaaacccctaccaactggtcggggtttgaaacccacagaaatagtaggccacaaccaagtaaacccctaccaactggtcggggtttgaaaccagaaaaagtaggtgacaaccagcaagtaaacccctaccaactggtcggggtttgaaacttttt (SEQ ID NO: 42).

[0112] In another aspect, this application provides a biological material selected from any of the following:

[0113] 1) The biological material is a polynucleotide that encodes the aforementioned RNA editing element;

[0114] 2) The biomaterial is a nucleic acid construct containing the polynucleotides in 1);

[0115] 3) The biomaterial is a host cell, which includes the construct or genome of 2) containing polynucleotides of 1).

[0116] The construct can typically be obtained by inserting the polynucleotide fragment into a suitable expression vector, and those skilled in the art can select a suitable expression vector. Expression vectors include, but are not limited to, viral vectors (e.g., vaccinia virus-based viral vectors; poliovirus; adenovirus; adeno-associated virus; SV40; herpes simplex virus; human immunodeficiency virus); retroviral vectors (e.g., murine leukemia virus, spleen necrosis virus, and vectors derived from retroviruses, such as Rous sarcoma virus, Harvey sarcoma virus, avian leukemia virus, lentivirus, human immunodeficiency virus, myeloproliferative sarcoma virus, and mammary tumor virus), etc.

[0117] Any cell suitable for expression via the expression vector can serve as a host cell. This can be a prokaryotic cell, such as a bacterial cell; a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Preferably, the host cell is selected from mouse cells or human cells.

[0118] This application also provides a gene editing system, comprising: the aforementioned RNA editing element or its encoding gene; and a nuclease or its encoding gene, or a complex of the aforementioned RNA editing element and nuclease.

[0119] In the gene editing system provided in this application, the nuclease is a CRISPR nuclease. Preferably, the nuclease is selected from the Cas9, Cas12, Cas13 protein families or variants thereof. More preferably, the nuclease is selected from Cas13d.

[0120] In a specific embodiment of this application, Cas13d, or CasRx, is derived from the intestinal bacterium Ruminococcus flavefaciens XPD3002. It exhibits stronger specificity and higher knockout efficiency during RNA lysis in mammalian cells in vitro and in vivo. Moreover, CasRx is much smaller than the previously discovered Cas13 protein, making it easier to package into AAV vectors for in vivo delivery. Therefore, it has great application potential in RNA editing.

[0121] The gene editing system provided in this application further includes a vector, which comprises the aforementioned RNA editing element encoding gene and / or nuclease encoding gene. The vector is an AAV vector.

[0122] As shown in Figure 1A, the spacer sequence in the gRNA specifically recognizes the target sequence that can pair with it through complementary base pairing. The Cas13d protein is recruited to the specific site and exerts its cleavage activity, leading to RNA degradation. Due to its small size, only about 930 amino acids, Cas13d is more easily delivered by AAV vectors.

[0123] Adeno-Associated Virus (AAV) is a small DNA-containing particle isolated from simian adenovirus. These particles can only replicate under conditions of co-culturing with adenovirus. They are approximately 25 nm in diameter and consist of a capsid protein and a 4.7 kb single-stranded DNA genome, lacking an envelope. They exhibit good infectivity in skeletal muscle, retina, hepatocytes, cardiac smooth muscle cells, neurons, pancreatic beta cells, and synovial cells.

[0124] The wild-type AAV genome consists of two open reading frames that encode the Rep and Cap proteins, respectively. The Rep protein is associated with viral replication and is divided into Rep78, Rep68, Rep52, and Rep40, while the Cap protein is involved in the assembly of capsid proteins. The open reading frames are flanked by 145 bp inverted terminal repeats (ITRs), which are the only cis-acting elements required for viral genome replication and packaging.

[0125] As shown in Figure 3, the AAV vector used in this application is obtained by modifying a wild-type AAV vector, replacing the AAV genome itself (i.e., the portion encoding Rep and Cap proteins) between the IRT sequences at both ends with a promoter and a delivery gene. The promoter includes one or more of CMV, PGK, CAG, EF1α, AFP, and U6. Preferably, the promoter regulating nuclease expression is CMV, and the promoter regulating RNA editing elements is U6. The AAV vector also includes a WPRE element, which enhances the stability of the mRNA after transcription and improves mRNA splicing efficiency.

[0126] In one specific embodiment of this application, the delivery gene in the AAV vector can be GFP or RFP.

[0127] In a specific embodiment of this application, the delivery gene in the AAV vector may also be one or more of Cas13d, Ncre, CCre, gRNA, and Cre.

[0128] The AAV vector used in this application is selected from AAV5, AAV6, or AAV9 serotype vectors. Different serotypes have different infection efficiencies and spread capabilities at different sites in the body. The appropriate serotype is crucial to whether the gene can be expressed efficiently and stably, and even to the final research results. Therefore, it is essential to select the appropriate AAV serotype by comprehensively considering factors such as the characteristics of the cells and each AAV serotype.

[0129] The injection method of AAV vectors significantly affects their infection efficiency in animals. Common injection methods include endotracheal intubation, tail vein injection, intraperitoneal injection, enema, stereotactic injection into the brain, and in situ injection. Tissue-specific gene regulation can be achieved by selecting an appropriate injection method. For specific sites, local in situ injection is usually used, such as stereotactic injection into the brain, intramuscular injection, liver parenchyma injection, myocardial in situ injection, ocular in situ injection, and intra-articular injection. In a specific embodiment of this application, the AAV vector is injected into the lung tissue of an animal via endotracheal intubation.

[0130] The gene editing system provided in this application also includes a Cre enzyme or its encoding gene for tracking. In a specific embodiment of this application, the Cre enzyme is assembled with a fluorescent gene such as RFP. When the gene editing system successfully infects cells carrying loxp, the Cre enzyme recognizes the loxp site, and RFP can be expressed normally.

[0131] In some implementations, the AAV vector is typically used in conjunction with the Cre-LoxP recombinase system. The AAV vector, assembled with the Cre-LoxP recombinase system, co-infects host cells, facilitating the detection of Cas13d knockdown efficiency via fluorescent labeling.

[0132] In the gene editing system provided in this application, the RNA editing element coding gene and the nuclease coding gene are located in the same vector. The Crease coding gene is not located in the same vector as the RNA editing element coding gene and the nuclease coding gene.

[0133] In a specific embodiment of this application, as shown in Figure 8, when the reporter gene is RFP, the AAV genome length is limited to no more than 4.7kb. If all the elements to be packaged were packaged into one AAV vector, it would exceed its own length limit. Therefore, the elements are split into two AAV vectors for separate packaging. One AAV vector contains the CMV promoter and its Cas13d and U6 promoters and their induced gRNAs, while the other AAV vector contains the CMV promoter and its induced Cre, used to recognize the loxp site and express RFP. When both vectors are injected into the host, the infection status of the other vector can be determined by the RFP expression status of one vector.

[0134] This application also provides a pharmaceutical composition comprising the aforementioned gene editing system and a pharmaceutically acceptable carrier.

[0135] Pharmaceutically acceptable carriers should be compatible with gene-editing systems, meaning they can be mixed with them without significantly reducing the efficacy of the drug composition. Substances that can serve as carriers include sugars such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium methylcellulose, ethylcellulose, and methylcellulose; tragacanth gum powder; malt; gelatin; talc; solid lubricants such as stearic acid and magnesium stearate; calcium sulfate; vegetable oils such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil, and cocoa butter; polyols such as propylene glycol, glycerin, sorbitol, mannitol, and polyethylene glycol; alginic acid; emulsifiers such as Tween; wetting agents such as sodium lauryl sulfate; colorants; flavoring agents; tableting agents, stabilizers, antioxidants; preservatives; pyrogen-free water; isotonic salt solutions; and phosphate buffers, etc. These substances can be used, as needed, to aid in the stability of the formulation, improve its activity, or produce an acceptable taste and aroma when taken orally.

[0136] This application also provides the use of the aforementioned RNA editing element, the aforementioned biomaterial, the aforementioned gene editing system, or the aforementioned pharmaceutical composition in the preparation of a product having any one or more of the following functions:

[0137] a) Activate the Wnt pathway;

[0138] b) Treatment of lung injury-related diseases;

[0139] c) Promotes lung regeneration;

[0140] d) Promotes the proliferation and differentiation of type II alveolar epithelial cells.

[0141] In this application, lung injury includes pulmonary fibrosis. This application can downregulate pulmonary fibrosis genes, such as Fn1, Col1a1, Col1a2, and Col3a1; it can also downregulate the level of pulmonary fibrosis proteins, such as Fibronectin. In some embodiments, this application can reduce the area of ​​fibrotic regions in immunofluorescence staining, for example, in myofibroblasts ACTA2. + and fibroblast PDGFRb + The area decreased, and the type II alveolar epithelial cells SPC + and type I alveolar epithelial cells RAGE + The area of ​​alveoli increased (Fig. 10H-M, Fig. 11H-M), suggesting that activation of the Wnt signaling pathway in epithelial cells promotes alveolar regeneration and repair to some extent and inhibits the development of pulmonary fibrosis.

[0142] This application also provides a gene editing method in which the aforementioned gene editing system is brought into contact with the Axin1 and Axin2 genes to achieve the editing of the Axin1 and Axin2 genes.

[0143] This application also provides a cell obtained by gene editing using the aforementioned gene editing method. Preferably, the cell is a mammalian cell; more preferably, the cell is a lung epithelial stem cell. Specifically, by degrading Axin1 and Axin2, β-catenin can be stabilized, thereby activating the Wnt signaling pathway. Wnt signaling affects various physiological and biochemical functions of the cell, including lung regeneration in lung injury diseases. Lung regeneration includes promoting the proliferation and differentiation of type II alveolar epithelial cells.

[0144] The present application will be further illustrated by the following examples, but these examples do not limit the scope of the present application.

[0145] Unless otherwise specified, the conventional technical operations such as molecular biology, microbiology, cell biology, biochemistry and immunology used in the implementation of this invention are all within the understanding and knowledge of those skilled in the art. These techniques are widely used and can be well illustrated in the following literature, such as: "Molecular cloning: A Laboratory Manual, Fourth edition" (MR. Green, et al. 2014); "Oligonucleotide Synthesis" (MJ Gait, et al. 1984); "Polymerase Chain Reaction: Principles, Applications and Troubleshooting" (ME Babar, et al. 2011); "Short Protocols in Molecular Biology, Fifth edition" (FMAusubel, et al. 2002); "Methods in Molecular Biology" (Humana Press); "Gene Transfer Vectors for Mammalian Cells" (JH Miller and MPCalos. 1987); "Culture of Animal Cell" (RI Freshney, et al. 2010); "Methods in Enzymology" (Academic Press, Inc.); "Using Antibodies: A Laboratory Manual" (E. Harlow and D. Lane. 1999); "Handbook of Experimental Immunology" (LA Herzenberg, et al. 1997); "Current Protocols in Immunology" (JEColigan, et al. 2002).

[0146] Example 1

[0147] In this embodiment, different spacer sequences with a length of 23nt were designed for different exon positions of Axin1 and Axin2, resulting in the following spacer sequences:

[0148] The gene encoding the spacer of the RNA fragment targeting Axin1 includes the sequences shown in SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15 or SEQ ID NO: 16.

[0149] The gene encoding the spacer of the RNA fragment targeting Axin2 includes the sequences shown in SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20 or SEQ ID NO: 21.

[0150] Example 2

[0151] This embodiment constructs vectors containing gRNA and vectors containing Cas13d.

[0152] Both the 5' and 3' ends of gRNAs targeting Axin1 or Axin2 contain DR sequences, with one or more spacer sequences between two DR sequences; multiple spacer sequences are linked together by DR sequences.

[0153] The gene encoding the obtained gRNA is as follows:

[0154] The gene encoding the gRNA targeting Axin1 includes sequences such as SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35 or SEQ ID NO: 36.

[0155] The gene encoding the gRNA targeting Axin2 includes sequences as shown in SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40 or SEQ ID NO: 41.

[0156] The coding genes for Exon9, which targets Axin1, and Exon10, which targets Axin2, are shown in SEQ ID NO: 42.

[0157] gRNA and Cas13d were constructed into two vectors that could be expressed in mammalian cells. The vector containing gRNA included a U6 promoter, a gRNA sequence, an EF1a promoter, and mCherry expressed by the EF1a promoter in sequence.

[0158] The U6 boot sequence is as follows:

[0159] The EF1a bootstrap sequence is as follows:

[0160] The mCherry sequence is:

[0161] Vectors containing Cas13d consist of the CAG promoter, SV40 NLS-1, Cas13d, SV40 NLS-2, P2A, and EGFP linked together in sequence.

[0162] The sequence of the CAG promoter is as follows:

[0163] The sequence of SV40 NLS-1 is:

[0164] The sequence of Cas13d is:

[0165] The sequence of SV40 NLS-2 is as follows:

[0166] The sequence of P2A is:

[0167] The EGFP sequence is:

[0168] Example 3

[0169] This embodiment selects the spacer sequence with the best knockdown efficiency.

[0170] First, the knockdown efficiency of gRNAs targeting Axin1 or Axin2 alone was screened, and the results are shown in Figures 2C and 2D. Vectors containing gRNA and vectors containing Cas13d were transfected into mouse cell lines (Neuro-2a, N2a) via liposome transfection (Lipofectamine 2000, Invitrogen, 11668019). Specifically, one day before transfection, N2a cells in 10cm culture dishes were digested, counted, and seeded into 24-well plates at approximately 70% cell density. Cells were cultured overnight until the cell density reached 80% before transfection. For the transfection step, taking a single 24-well cell as an example, 50 μL of Opti-MEM I (Invitrogen, 31985062) was taken, and 650 ng of the vector expressing Cas13d and 350 ng of the vector expressing gRNA from Example 2 were added. Another 50 μL of Opti-MEM I was taken, and 1.5 μL of Lipofectamine 2000 was added. The 50 μL of Opti-MEM I containing the transfection reagent was mixed into the Opti-MEM I containing the vector. After incubating at room temperature for 15 min, a total of 100 μL was added evenly to the cell wells by hanging drop. After culturing for 72 h, the cells were obtained, and the knockdown effect of different gRNAs on Axin1 and Axin2 was detected by qRT-PCR.

[0171] The qRT-PCR screening steps are as follows: RNA was extracted from cells cultured for 72 h using an RNA extraction kit (Zymo Research, R2062). The RNA was reverse transcribed into cDNA using a reverse transcription reagent (Vazyme, R222-01). The qRT-PCR system was prepared by adding qRT-PCR reactivity enzyme (Vazyme, Q711-03), primers (Axin1, Axin2, and the internal reference gene HPRT), and cDNA.

[0172] The upstream primer for Axin1 is tgtccagtgatgctgacacg (SEQ ID NO: 52), and the downstream primer is aagtgcgaggaatgtgaggta (SEQ ID NO: 53).

[0173] The upstream primer for Axin2 is: aacctatgcccgtttcctcta (SEQ ID NO: 54), and the downstream primer is: gaggtaaagacttggtccacc (SEQ ID NO: 55).

[0174] The upstream primer for HPRT is ctggtgaaaaggacctctcg (SEQ ID NO: 56), and the downstream primer is tgaagtactcattatagtcaagggca (SEQ ID NO: 57).

[0175] After the qRT-PCR reaction, the cycle threshold (Ct value) for each reaction can be obtained. The Ct values ​​of the target gene and the internal reference gene are standardized before comparing the expression levels of the same target gene between different samples. Specifically, the Ct value of the target gene minus the Ct value of the internal reference gene is recorded as ΔCt. The average ΔCt of the control group is taken, and the average ΔCt of the experimental group minus the average ΔCt of the control group is recorded as ΔΔCt. The expression level of the target gene in the experimental group compared to the control group is 2^-ΔΔCt. In other words, with the expression level of the target gene in the control group as 1, the expression level of the target gene in the experimental group compared to the control group is...

[0176] Figures 2C and 2D show that the knockdown efficiency of Axin1 is 70%-80%, and that of Axin2 is 60%-70%. A significant decrease in the protein levels of both Axin1 and Axin2 can also be observed (Figures 2E-F). The spacer sequences with the optimal knockdown efficiency for gRNAs targeting Axin1 or Axin2 individually were identified as g14 for Axin1 and g22 for Axin2, respectively.

[0177] Next, the effects of knocking down Axin1 and Axin2 on Wnt pathway activity were investigated using a dual-luciferase reporter system (Promega, E1910) with single gRNAs or combinations of gRNAs. When Wnt signaling is activated, Wnt ligands bind to the seven-transmembrane protein Frizzled (Fz) and low-density lipoprotein receptor-related protein (LRP), activating the downstream cell signal transduction factor Dishevelled (Dvl), which further phosphorylates GSK3β. This inhibits the phosphorylation of β-catenin by the degradation complex formed by CK1, GSK3β, Axin, and APC, leading to the accumulation of β-catenin in the cytoplasm and its transport to the nucleus, where it binds to TCF / LEF transcription factors and activates the expression of downstream target genes.

[0178] The two luciferases were Renilla luciferase expressed in the Renilla plasmid vector and firefly luciferase expressed in the 8XTOP plasmid vector, respectively. The Renilla luciferase expressed in the Renilla plasmid vector served as an internal control. In the 8XTOP plasmid vector, the firefly luciferase element is initiated by an 8-segment repeating TCF / LEF fragment. This means that when Wnt signaling is activated, β-catenin accumulates and is transported to the nucleus, where it binds to the TCF / LEF transcription factor to activate firefly luciferase expression. CasRx and pre-gRNA were overexpressed in N2a cells. Twenty-four hours after transfection, the cells were transfected with the 8XTOP and Renilla plasmids, following the transfection steps described above. After 48 hours, cells were obtained and lysed using the lysis buffer provided in the kit. Fluorescein substrate was added, and the chemiluminescence value was read using a microplate reader and recorded as Luciferase. Stop&Glo Reagent (Promega, E1910) was then added to terminate the Fluorescein luciferase reaction and initiate the Renilla luciferase reaction. The chemiluminescence value was read using a microplate reader and recorded as Renilla. The Luciferase / Renilla ratio represents the intensity of Wnt signal activity in each sample. The average Luciferase / Renilla ratio of the control group was taken. The Luciferase / Renilla ratio of the experimental group was divided by the average Luciferase / Renilla ratio of the control group to obtain the intensity of Wnt signal activity in the experimental group compared to the control group. The intensity of Wnt signal activity in the control group was recorded as 1.

[0179] Positive control: The serine at positions 33, 37, and 45 and the threonine at position 41 in β-Catenin were all mutated to alanine (SEQ ID NO: 58), which prevented β-Catenin from being degraded and served as the positive control for this experiment.

[0180] The sequence of the mutated β-Catenin is as follows:

[0181] The results are shown in Figure 3: Compared with the control, knocking down Axin1 and Axin2 alone upregulated Wnt activity by approximately 2-3 times, but knocking down Axin1 and Axin2 simultaneously significantly upregulated Wnt activity by approximately 250 times (Figure 3A). The positive control showed a significant upregulation of Wnt activity by approximately 800 times (Figure 3A). Protein levels also showed that when Axin1 and Axin2 were knocked down simultaneously, the protein level of β-Catenin was significantly higher than when Axin1 or Axin2 were knocked down alone (Figure 3B).

[0182] Example 4

[0183] This embodiment screens for AAV serotypes. Serotypes include AAV5, AAV6, and AAV9.

[0184] As shown in Figure 4, the specific AAV structure consists of an EGFP sequence initiated by the CMV promoter packaged between the two ITR sequences. Different serotypes of AAV are delivered to mouse lung tissue via endotracheal intubation, with an injection dose of 10... 11 vg / mouse. On day 14 of infection, mouse lung tissue was collected, and flow cytometry analysis was used to determine the infection intensity of different serotypes of AAV and the infection efficiency against different cell types. Different cell types distinguished by flow cytometry antibodies included CD45. + Immune cells (BD, 564279), CD31 + Endothelial cells (Biolegend, 102449), and CD326 + CD104 in epithelial cells (Biolegend, 118225) + airway epithelial cells and CD104 - The alveolar epithelial cells (Biolegend, 123610).

[0185] As shown in Figure 5, mice infected with AAV6 exhibited the highest GFP expression intensity and the highest proportion of positive cells. Furthermore, AAV6 showed high infection efficiency against airway and alveolar epithelial cells, but very low infection efficiency against immune cells and endothelial cells (Figure 5C). This invention aims to activate the Wnt signaling pathway in lung epithelial cells through AAV delivery; therefore, the AAV6 serotype was chosen as the vector for subsequent experiments.

[0186] Example 5

[0187] This embodiment investigates the proportion of two AAV vectors co-infecting the same cell.

[0188] Since the AAV vector packaging size is limited to 4.7kb, it is considered to split the components to be packaged into two AAV vectors. This can be handled by PackGene, using standard methods to package AAV6-GFP and AAV6-Cre separately. Both GFP and Cre are expressed using the CMV promoter. After being mixed in equal volumes, they are injected via endotracheal intubation into the lung tissue of loxp-Stop-loxp-tdTomato mice at a dose of 2 × 10⁻⁶ kb. 11 vg / mouse. Fourteen days after infection, mouse lung tissue was obtained, digested into single-cell suspensions using Dispase II (Invitrogen, 17105041), and GFP was analyzed by flow cytometry. + Cells and RFP + Co-expression status in cells.

[0189] The results are shown in Figure 6: the vertical axis represents GFP, and the horizontal axis represents RFP. + Cells comprise approximately 13% of living cells (Q1+Q2), RFP + Cells comprise approximately 19% of living cells (Q2+Q3), of which GFP... + All cells were RFP + And RFP + Approximately 68% (Q2 / (Q2+Q3)) of the cells expressed GFP. The high co-expression ratio of GFP and RFP indicates that AAV co-infection of the same cell is highly efficient.

[0190] Example 6

[0191] This embodiment employs two different packaging strategies.

[0192] The first packaging strategy: As shown in Figure 7A, the editing element combined with the Split-Cre enzyme system was packaged into two AAV vectors by PackGene using conventional methods. After mixing the two AAVs, they were injected intratracheally into the lung tissue of mice carrying loxp-stop-loxp-tdTomato at a dose of 2 × 10⁻⁶. 11 Vg / mouse. Only after recombination of n-Cre and c-Cre can Cre enzyme recognize the loxp site, allowing tdTomato to be expressed normally. Fourteen days after infection, mouse lung tissue was collected, digested into a single-cell suspension, and PE from epithelial cells was separated by flow cytometry. + The cells were sorted out and the knockdown efficiency was detected by qRT-PCR.

[0193] The flow cytometry results are shown in Figure 7B: PE + The proportion of viable cells was only 1.44%, indicating that the Split-Cre enzyme system is not very efficient at assembling into complete Cre enzymes and undergoing LOXP recombination in vivo. PE + Cells were sorted, and qRT-PCR was used to detect the knockdown efficiency, which was found to be low. Therefore, it is concluded that the method of using editing elements combined with the Split-Cre enzyme system to simultaneously achieve in vivo tracking and knockdown is not feasible.

[0194] The second packaging strategy, as shown in Figure 8, is limited by the AAV genome length of no more than 4.7 kb. Two AAV vectors are packaged. One AAV vector (AAV-Cre) contains the CMV promoter and its promoted Cre, used to recognize the loxp site. The other AAV vector has the following four packaging methods:

[0195] 1. Contains the CMV promoter and its activated CasRx, U6 promoter and its activated non-specifically targeting gRNA (Non-Targeting, NT).

[0196] 2. Contains the CMV promoter and its CasRx promoter, and the U6 promoter and its gRNA targeting Axin1 and Axin2;

[0197] 3. Contains a CMV promoter and the GFP it promotes;

[0198] 4. Contains the CMV promoter and the mutated β-Catenin as described in Example 3.

[0199] Five types of AAV were packaged separately, and AAV-Cre was mixed with the other four viruses and injected into mice with the genotype loxp-stop-loxp-tdTomato.

[0200] After packaging, the subsequent steps were the same as the first packaging strategy: PE+ cells from alveolar epithelial cells were sorted out, and the activation of Wnt signaling in vivo was verified by qRT-PCR and Western Blot. The results showed that the knockdown efficiency of CasRx-mediated Axin1 and Axin2 transcription levels was approximately 50% (Figure 9A). After knockdown of Axin1 and Axin2, the protein level of β-Catenin increased, while the level of phosphorylated β-Catenin decreased (Figure 9B), indicating that the decrease in Axin1 and Axin2 transcription levels can stabilize the level of β-Catenin. Compared with GFP, overexpression of β-Catenin (S>A) showed an approximately 50-fold upregulation of Ctnnb1 mRNA levels (Figure 9C), and the β-Catenin protein level also increased (Figure 9D).

[0201] As described above, this application uses CasRx to knock down the mRNA levels of Axin1 and Axin2, stabilize β-Catenin, and activate the Wnt signaling pathway. In mouse cell lines, the effect of knocking down Axin1 and Axin2 on Wnt activity was investigated using a dual-luciferase reporter gene system, demonstrating that simultaneous knockdown of Axin1 and Axin2 effectively activates the Wnt signaling pathway. Injection of packaged AAV into mice further demonstrated that knockdown of Axin1 and Axin2 stabilizes β-Catenin and activates the Wnt signaling pathway.

[0202] Example 7

[0203] This embodiment applies an animal model.

[0204] Pulmonary fibrosis was induced in C57BL / 6J mice using bleomycin. 1.6 mg / kg of bleomycin was injected into the mice via endotracheal intubation. In this model, the activation of the Wnt signaling pathway was investigated to explore whether it could inhibit the occurrence and development of pulmonary fibrosis and promote the repair of epithelial cell damage.

[0205] The experiment was divided into preventative and therapeutic experiments. In the preventative experiment, mice were injected with AAV using the second packaging method described in Example 6 14 days before bleomycin injury, and were collected on day 14 (Figure 10A). In the therapeutic experiment, mice were injected with AAV using the second packaging method described in Example 6 6 days after bleomycin injury, and were collected on day 17 (Figure 11A). The role of Wnt signaling activation in the development and progression of fibrosis in epithelial cells was investigated by qRT-PCR, Western blotting, and immunofluorescence staining.

[0206] The results showed that after activation of the Wnt signaling pathway, the expression levels of fibrotic genes Fn1, Col1a1, Col1a2, and Col3a1 were downregulated at the transcriptional level (Fig. 10D-G, Fig. 11D-G), the protein level of Fibronectin was downregulated, while the expression intensity of SPC was increased (Fig. 10B-C, Fig. 11B-C). Immunofluorescence staining revealed that the fibrotic region, i.e., myofibroblasts, was ACTA2. + and fibroblast PDGFRb + The area decreased, and the type II alveolar epithelial cells SPC + and type I alveolar epithelial cells RAGE + The area of ​​alveoli increased (Fig. 10H-M, Fig. 11H-M), suggesting that activation of the Wnt signaling pathway in epithelial cells promotes alveolar regeneration and repair to some extent and inhibits the development of pulmonary fibrosis.

[0207] The above embodiments are merely illustrative of the principles and effects of the present invention and are not intended to limit this application. Any person skilled in the art can modify or alter the above embodiments without departing from the spirit and scope of this application. Therefore, all equivalent modifications or alterations made by those skilled in the art without departing from the spirit and technical concept disclosed in this invention should still be covered by the claims of this application.

Claims

1. An RNA editing element, characterized in that, The RNA editing element comprises an RNA segment targeting Axin1 and an RNA segment targeting Axin2.

2. The RNA editing element of claim 1, wherein, The RNA editing element comprises an RNA segment targeting an Axin1 Exon region and an RNA segment targeting an Axin2 Exon region; preferably, the Axin1 Exon region is selected from Exon 2, Exon 6, Exon 9 or Exon 10 of Axin1, and the Axin2 Exon region is selected from Exon 2, Exon 6, Exon 10 or Exon 11 of Axin2; more preferably, the Axin1 Exon region is Exon 9 of Axin1, and the Axin2 Exon region is Exon 10 of Axin2.

3. The RNA editing element of claim 1, wherein, The coding gene of the spacer of the RNA segment targeting Axin1 comprises a sequence as set forth in SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15 or SEQ ID NO: 16; the coding gene of the spacer of the RNA segment targeting Axin2 comprises a sequence as set forth in SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20 or SEQ ID NO: 21; preferably, the coding gene of the spacer of the RNA segment targeting Axin1 comprises a sequence as set forth in SEQ ID NO: 14, and the coding gene of the spacer of the RNA segment targeting Axin2 comprises a sequence as set forth in SEQ ID NO:

19. And / or, the RNA segment targeting Axin1 and the RNA segment targeting Axin2 further comprise a DR sequence, preferably, the coding gene of the DR sequence comprises a sequence as set forth in SEQ ID NO:

1.

4. The RNA editing element of claim 1, wherein, The coding gene of the RNA fragment targeting Axin1 comprises a sequence as shown in SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, or SEQ ID NO: 36, and the coding gene of the RNA fragment targeting Axin2 comprises a sequence as shown in SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, or SEQ ID NO: 41; preferably, the coding gene of the RNA fragment targeting Axin1 comprises a sequence as shown in SEQ ID NO: 34, and the coding gene of the RNA fragment targeting Axin2 comprises a sequence as shown in SEQ ID NO:

39.

5. The RNA editing element of claim 1, wherein, The coding gene of the RNA editing element comprises a sequence as shown in SEQ ID NO:

42.

6. A biological material selected from any one of the following: 1) the biological material is a polynucleotide encoding the RNA editing element according to any one of claims 1-5; 2) the biological material is a nucleic acid construct comprising the polynucleotide of 1); 3) the biological material is a host cell comprising the construct of 2) or the polynucleotide of 1) integrated into the genome.

7. A gene editing system, characterized in that, The gene editing system comprises: the RNA editing element according to any one of claims 1-5 or a coding gene thereof; and a nuclease or a coding gene thereof, or a complex of the RNA editing element and the nuclease according to any one of claims 1-5.

8. The gene editing system of claim 7, wherein, The nuclease is a CRISPR nuclease; preferably, the nuclease is selected from the Cas9, Cas12, Cas13 protein family or a variant thereof; further preferably, the nuclease is selected from Cas13d.

9. The gene editing system of claim 7, wherein, The gene editing system further comprises a vector comprising the coding gene of the RNA editing element according to any one of claims 1-5 and / or the coding gene of the nuclease. The gene editing system further comprises a Cre enzyme or a coding gene thereof for tracing.

10. The gene editing system of claim 9, wherein, The vector is an AAV vector; preferably, the AAV vector is selected from the AAV5, AAV6, or AAV9 serotype vector.

11. The gene editing system of claim 10, wherein, The AAV vector comprises a regulatory element; preferably, the regulatory element comprises a cis-acting element and a promoter; preferably, the cis-acting element comprises an inverted terminal repeat sequence; the promoter comprises one or more of CMV, PGK, CAG, EF1a, AFP, U6; more preferably, the promoter regulating the expression of the nuclease is CMV, and the promoter regulating the RNA editing element is U6.

12. The gene editing system of claim 10, wherein, Also included are: The RNA editing element encoding gene and the nuclease encoding gene are located in the same vector; And / or, the Cre enzyme encoding gene is not located in the same vector as the RNA editing element encoding gene and the nuclease encoding gene.

13. A pharmaceutical composition, characterized by, The pharmaceutical composition comprises the gene editing system according to any one of claims 7-12, and a pharmaceutically acceptable carrier.

14. Use of the RNA editing element according to any one of claims 1-5, the biomaterial according to claim 6, the gene editing system according to any one of claims 7-12, or the pharmaceutical composition according to claim 13, in the preparation of a product having any one or more of the following functions: a) activating the Wnt pathway; b) treating lung injury-related diseases; c) promoting lung regeneration; d) promoting the proliferation and differentiation of type II alveolar epithelial cells.

15. A method of gene editing, comprising, The gene editing system according to any one of claims 7-12 is contacted with Axin1 and Axin2 genes to achieve editing of the Axin1 and Axin2 genes.

16. A cell obtained by the gene editing method according to claim 15; preferably, the cell is a mammalian cell; more preferably, the cell is a lung epithelial stem cell.

Citation Information

Patent Citations

  • RNA editing system for activating Wnt signal channel

    CN118185931A

  • Proteins that promote activation of wnt / β-catenin pathway

    JP2021078381A

  • Compositions and methods for homology directed repair

    US20220220468A1

  • Treatment of liver injury

    US20230053540A1