Method for modifying double-stranded RNA molecule

Abstract

Provided in the present invention are a double-stranded RNA molecule having a specific modification combination, and the medical use thereof. The double-stranded RNA molecule comprises a sense strand and an antisense strand that at least partially form a double-stranded region. The antisense strand does not exceed 30 bp in length; comprises, from the 5' end, at least two nucleotides at positions 2-8 with a thermal destabilization modification, and nucleotides at positions 14 and 16 with a 2'-fluoro modification; and comprises at least 7 nucleotides with a 2'-fluoro modification.

Description

Modifications of double-stranded RNA molecules TECHNICAL FIELD

[0001] The present application belongs to the technical field of nucleic acids, and specifically relates to a modification method of double-stranded RNA molecules.

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] The present application claims priority to Chinese Patent Application No. 202411042640.9, filed on July 31, 2024, the contents of which are incorporated herein in their entirety.

[0004] The present application claims priority to Chinese Patent Application No. 202411888903.8, filed on December 20, 2024, the contents of which are incorporated herein in their entirety.

[0005] The present application claims priority to Chinese Patent Application No. 202411903291.5, filed on December 23, 2024, the contents of which are incorporated herein in their entirety. BACKGROUND

[0006] Small interfering RNA (siRNA) as a gene silencing technology has a wide application prospect in the field of disease treatment. In recent years, the research progress of siRNA modification methods mainly focuses on improving the stability, specificity, reducing immunogenicity of siRNA, and developing efficient delivery systems. siRNA molecules can be chemically modified to enhance their stability and reduce off-target effects. Common chemical modifications include phosphorothioate backbone modification, methoxy modification, fluorination modification, GNA modification, and 5’-(E)-VP modification, etc. These modifications help to improve the stability of siRNA in vivo, reduce the risk of degradation by nucleases, and reduce non-specific binding and immune response. There is still a need in the art for a new modification combination that can further reduce siRNA off-target and maintain activity in animals while enhancing activity.

[0007] SUMMARY

[0008] The technical problem to be solved by the present application is how to improve the effect of siRNA, such as improving the stability, specificity, reducing immunogenicity, and delivery efficiency of siRNA.

[0009] To solve the above technical problems, the present application provides a double-stranded RNA molecule, which comprises a sense strand and an antisense strand forming at least a double-stranded region, the length of the antisense strand is no more than 30 bp, each nucleotide of the antisense strand is independently modified or unmodified, wherein the 2nd-8th nucleotide from the 5' end of the antisense strand comprises at least 2 heat destabilization modified nucleotides, and the 14th and 16th nucleotide from the 5' end of the antisense strand is a 2'-fluoride modified nucleotide.

[0010] In the present application, the antisense strand of the double-stranded RNA molecule comprises at least 7 2'-fluoride modified nucleotides.

[0011] In the present application, the 2nd nucleotide from the 5' end of the antisense strand is a 2'-fluoride modified nucleotide.

[0012] In the present application, the 2nd and 18th nucleotide from the 5' end of the antisense strand is a 2'-fluoride modified nucleotide.

[0013] In the present application, the 2nd, 10th and 18th nucleotide from the 5' end of the antisense strand is a 2'-fluoride modified nucleotide.

[0014] In the present application, the 2nd, 10th, 12th and 18th nucleotide from the 5' end of the antisense strand is a 2'-fluoride modified nucleotide, or the 2nd, 10th, 12th, 18th and 20th nucleotide from the 5' end of the antisense strand is a 2'-fluoride modified nucleotide.

[0015] In the present application, the 2nd, 4th, 8th, 10th and 18th nucleotide from the 5' end of the antisense strand is a 2'-fluoride modified nucleotide, or the 2nd, 6th, 8th, 10th and 18th nucleotide from the 5' end of the antisense strand is a 2'-fluoride modified nucleotide, or the 2nd, 8th, 10th, 12th and 18th nucleotide from the 5' end of the antisense strand is a 2'-fluoride modified nucleotide.

[0016] In the present application, the heat destabilization modification is selected from 2'-deoxynucleotide, open ring nucleic acid nucleotide (UNA), ethylene glycol nucleic acid nucleotide (GNA), inosine nucleotide.

[0017] In the present application, the double-stranded RNA molecule comprises at least one heat destabilization modification.

[0018] In the present application, the double-stranded RNA molecule comprises two heat destabilization modifications.

[0019] In the present application, the two heat destabilization modifications are 2'-deoxynucleotide modification and ethylene glycol nucleic acid nucleotide (GNA) modification.

[0020] In the present application, the thermally destabilizing modification is at least one of positions 4, 5, 6, 7, or 8, counting from the 5' end of the antisense strand.

[0021] In the present application, the thermally destabilizing modification is at least two of positions 4, 5, 6, 7, or 8, counting from the 5' end of the antisense strand.

[0022] In the present application, at least one of positions 5, 6, 7, counting from the 5' end of the antisense strand, is a 2'-deoxynucleotide modified nucleotide.

[0023] In the present application, at least one of positions 5, 6, 7, counting from the 5' end of the antisense strand, is a glycol nucleic acid nucleotide (GNA) modified nucleotide.

[0024] In the present application, the double stranded RNA molecule has at least one 2'-deoxynucleotide modified nucleotide and at least one glycol nucleic acid nucleotide (GNA) modified nucleotide in positions 5, 6, 7, counting from the 5' end of the antisense strand.

[0025] In the present application, the antisense strand of the double stranded RNA molecule comprises at least 7 2'-fluoro modified nucleotides.

[0026] In the present application, the antisense strand of the double stranded RNA molecule comprises 7 2'-fluoro modified nucleotides.

[0027] In the present application, the antisense strand of the double stranded RNA molecule comprises 8 or 9 or 10 2'-fluoro modified nucleotides.

[0028] In the present application, the nucleotides in the antisense strand are also linked by phosphorothioate groups.

[0029] In the present application, the first and second, second and third nucleotides of the antisense strand, counting from the 5' end of the antisense strand, are linked by phosphorothioate groups.

[0030] In the present application, the first and second, second and third nucleotides of the 5' end and / or 3' end of the antisense strand of the double stranded RNA molecule are linked by phosphorothioate groups.

[0031] In the present application, the first and second, second and third, 19th and 20th, 20th and 21st nucleotides of the antisense strand of the double stranded RNA molecule, in the 5' to 3' direction, are linked by phosphorothioate groups,

[0032] Alternatively, the 1st and 2nd, 2nd and 3rd, 21st and 22nd, 22nd and 23rd nucleotides in the antisense strand of the double-stranded RNA molecule are linked by phosphorothioate group in the direction from 5' end to 3' end.

[0033] In the present application, the 1st nucleotide of the antisense strand from the 5' end of the antisense strand comprises vinylphosphate modification;

[0034] In the present application, the 1st nucleotide of the antisense strand from the 5' end of the antisense strand is 5'-(E)-vinyl-2'-methoxy modified phosphate group modified nucleotide

[0035] In the present application, the sense strand comprises at least 3 kinds of modifications.

[0036] In the present application, the sense strand comprises 2'-fluoro modified nucleotide, 2'-methoxy modified nucleotide and modified nucleotide linked by phosphorothioate group.

[0037] In the present application, the 5' end and / or 3' end of the sense strand is linked with inverted abasic nucleotide.

[0038] In the present application, the sense strand comprises heat destabilization modification.

[0039] In the present application, the sense strand comprises 2'-deoxynucleotide modification.

[0040] In the present application, the sense strand of the double-stranded RNA molecule is complementary to the antisense strand to form the double-stranded region of the siRNA, the 3' end of the sense strand forms a blunt end, and the 3' end of the antisense strand has 1-3 protruding nucleotides extending out of the double-stranded region;

[0041] Alternatively, the sense strand of the double-stranded RNA molecule is complementary to the antisense strand to form the double-stranded region of the siRNA, the 5' end of the sense strand forms a blunt end, and the 5' end of the antisense strand has 1-3 protruding nucleotides extending out of the double-stranded region;

[0042] Alternatively, the sense strand of the double-stranded RNA molecule is complementary to the antisense strand to form the double-stranded region of the siRNA, the 3' end of the sense strand forms a blunt end, and the 3' end of the antisense strand forms a blunt end;

[0043] Alternatively, the sense strand of the double-stranded RNA molecule is complementary to the antisense strand to form the double-stranded region of the siRNA, the 3' end of the sense strand and the antisense strand has 1-3 protruding nucleotides extending out of the double-stranded region or the 5' end of the sense strand and the antisense strand has 1-3 protruding nucleotides extending out of the double-stranded region;

[0044] Alternatively, the sense strand of the double-stranded RNA molecule is complementary to the antisense strand to form a double-stranded region of the siRNA, the 5' and 3' ends of the sense strand having 1-3 overhanging nucleotides extending out of the double-stranded region.

[0045] In the present application, the sense strand and / or the antisense strand of the double-stranded RNA molecule is coupled with a ligand.

[0046] In the present application, the ligand can be at one end or both ends of the sense strand and / or the antisense strand.

[0047] In the present application, the ligand can be inside the chain of the sense strand and / or the antisense strand.

[0048] In the present application, the ligand can be inside the chain of the sense strand and / or the antisense strand and / or at one end or both ends of the chain.

[0049] In the present application, the ligand can be an antibody, a small molecule or a polypeptide targeting a cell receptor.

[0050] In the present application, the ligand can be an antibody, a small molecule or a polypeptide targeting integrin receptor, transferrin receptor (TfR), low-density lipoprotein receptor-related protein 1 (LRP1), low-density lipoprotein receptor-related protein 2 (LRP2), low-density lipoprotein receptor (LDLR), asialoglycoprotein receptor (ASGPR), leptin receptor, nicotinic acetylcholine receptor (nAchR), insulin-like growth factor 1 receptor (IGF-1R).

[0051] In the present application, the sense strand of the double-stranded RNA molecule is coupled with a ligand.

[0052] In the present application, the ligand is one or more GalNAc attached by a divalent or trivalent branched linker.

[0053] The compound obtained by connecting the ligand GalNAc to the double-stranded RNA molecule modifier is as formula (34).

[0054] In the present application, the length of the antisense strand can be 15-30 nucleotides.

[0055] In the present application, the length of the antisense strand can be 19-30 nucleotides.

[0056] In the present application, the length of the antisense strand can be 19-25 nucleotides.

[0057] In the present application, the length of the antisense strand is not more than 23 nucleotides.

[0058] In the present application, the length of the antisense strand can be 21 nucleotides.

[0059] In the present application, the length of the antisense strand can be 23 nucleotides.

[0060] In the present application, the length of the double-stranded region in the double-stranded RNA molecule can be 17-21 nucleotides.

[0061] In the present application, the length of the double-stranded region in the double-stranded RNA molecule can be 19-21 nucleotides.

[0062] In the present application, the length of the double-stranded region in the double-stranded RNA molecule can be 21 nucleotides.

[0063] In the present application, the length of the double-stranded region in the double-stranded RNA molecule can be 19 nucleotides.

[0064] In the present application, the length of the sense strand in the double-stranded RNA molecule can be no more than 30 nucleotides.

[0065] In the present application, the length of the sense strand can be 15-30 nucleotides.

[0066] In the present application, the length of the sense strand can be 19-30 nucleotides.

[0067] In the present application, the length of the sense strand can be 19-25 nucleotides.

[0068] In the present application, the length of the sense strand can be no more than 23 nucleotides.

[0069] In the present application, the length of the sense strand can be 23 nucleotides.

[0070] In the present application, the length of the sense strand can be no more than 21 nucleotides.

[0071] In the present application, the length of the sense strand can be 21 nucleotides.

[0072] In the present application, the length of the sense strand can be no more than 19 nucleotides.

[0073] In the present application, the length of the sense strand can be 19 nucleotides.

[0074] In some embodiments of the present application, the modification mode comprises any one of the modification modes shown in M35 to M41, M48, AM4, AM1, L23M25 to L23M30, and the following modification structures are represented in the 5'-3' direction; the sense strand of the modification mode shown in M35 comprises the structure shown in a1), and the antisense strand comprises the structure shown in b1),

[0075] a1) NmsNmsNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNm;

[0076] b1) NmsNfsNmNfN(d)NmN(d)NfNmNfNmNmNmNfNmNfNmNfNmsNmsNm;

[0077] The sense strand of the modification pattern depicted by M36 comprises the structure as indicated by a2) and the antisense strand comprises the structure as indicated by b2),

[0078] a2) NmsNmsNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNm;

[0079] b2) NmsNfsNmNmN(d)NfN(d)NfNmNfNmNmNmNfNmNfNmNfNmsNmsNm;

[0080] The sense strand of the modification pattern depicted by M37 comprises the structure as indicated by a3) and the antisense strand comprises the structure as indicated by b3),

[0081] a3) NmsNmsNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNm;

[0082] b3) NmsNfsNmNmN(d)NmN(d)NfNmNfNmNfNmNfNmNfNmNfNmsNmsNm;

[0083] The sense strand of the modification pattern depicted by M38 comprises the structure as indicated by a4) and the antisense strand comprises the structure as indicated by b4),

[0084] a4) NmsNmsNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNm;

[0085] b4) NmsNfsNmNmN(d)NmN(d)NmNmNfNmNfNmNfNmNfNmNfNmsNfsNm;

[0086] The sense strand of the modification pattern depicted by M39 comprises the structure as indicated by a5) and the antisense strand comprises the structure as indicated by b5),

[0087] a5) NmsNmsNmNmNmNmN(d)NfN(d)NmNmNmNmNmNmNmNmNmNm;

[0088] b5) NmsNfsNmNmN(d)NmN(d)NfNmNfNmNfNmNfNmNfNmNfNmsNmsNm;

[0089] The sense strand of the modification pattern indicated by M40 comprises the structure indicated by a6) and the antisense strand comprises the structure indicated by b6),

[0090] a6) Nms Nms Nm Nm Nm Nm N(d) Nf N(d) Nm Nm Nm Nm Nm Nm Nm Nm Nm Nm Nm Nm;

[0091] b6) Nms Nfs Nm Nm N(d) Nm N(d) Nm Nm Nf Nm Nf Nm Nf Nm Nf Nm Nf Nms Nfs Nm;

[0092] The sense strand of the modification pattern indicated by M41 comprises the structure indicated by a7) and the antisense strand comprises the structure indicated by b7),

[0093] a7) Nms Nms Nm Nm Nm Nm N(d) Nf N(d) Nm Nm Nm Nm Nm Nm Nm Nm Nm Nm Nm Nm;

[0094] b7) Nms Nfs Nm N(d) Nm Nm N(d) Nm Nm Nf Nm Nf Nm Nf Nm Nf Nm Nf Nms Nfs Nm;

[0095] The sense strand of the modification pattern indicated by M48 comprises the structure indicated by a8) and the antisense strand comprises the structure indicated by b8),

[0096] a8) Nms Nms Nm Nm Nm Nm Nf Nf Nf Nm Nm Nm Nm Nm Nm Nm Nm Nm Nm Nm Nm Nm;

[0097] b8) Nms Nfs Nm Nm N(d) Nm N(GNA) Nm Nm Nf Nm Nf Nm Nf Nm Nf Nm Nf Nms Nfs Nm;

[0098] The sense strand of the modification pattern indicated by AM4 comprises the structure indicated by a9) and the antisense strand comprises the structure indicated by b9),

[0099] a9) (invAb) sNm Nm Nm Nm Nm Nm Nf Nf Nf Nm Nm Nm Nm Nm Nm Nm Nms (invAb);

[0100] b9) Nms Nfs Nm Nm N(d) Nm N(GNA) Nm Nm Nf Nm Nf Nm Nf Nm Nf Nm Nf Nms Nfs Nm;

[0101] The sense strand of the modification pattern indicated by AM1 comprises the structure indicated by a10) and the antisense strand comprises the structure indicated by b10),

[0102] a10) (invAb) sNmNmNmNmNmNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNms (invAb);

[0103] b10) NmsNfsNmNmN(d)NmN(d)NmNmNfNmNfNmNfNmNfNmNfNmsNfsNm;

[0104] The sense strand of the modification pattern indicated as L23M25 comprises the structure as indicated as a11) and the antisense strand comprises the structure as indicated as b11),

[0105] a11) NmsNmsNmNmNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNm;

[0106] b11) NmsNfsNmNmN(d)NfN(d)NfNmNfNmNmNmNfNmNfNmNfNmNmNmsNmsNm;

[0107] The sense strand of the modification pattern indicated as L23M26 comprises the structure as indicated as a12) and the antisense strand comprises the structure as indicated as b12),

[0108] a12) NmsNmsNmNmNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNm

[0109] b12) NmsNfsNmNmN(d)NmN(d)NfNmNfNmNfNmNfNmNfNmNfNmNmNmsNmsNm

[0110] The sense strand of the modification pattern indicated as L23M27 comprises the structure as indicated as a13) and the antisense strand comprises the structure as indicated as b13),

[0111] a13) NmsNmsNmNmNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNm;

[0112] b13) NmsNfsNmNmN(d)NmN(d)NmNmNfNmNfNmNfNmNfNmNfNmNfNmsNmsNm;

[0113] The sense strand of the modification pattern indicated as L23M28 comprises the structure as indicated as a14) and the antisense strand comprises the structure as indicated as b14),

[0114] a14) NmsNmsNmNmNmNmNmNmNfN(d)NfNmNmNmNmNmNmNmNmNmNm;

[0115] b14) NmsNfsNmNmN(d)NfN(d)NfNmNfNmNmNmNfNmNfNmNfNmNmNmsNmsNm;

[0116] The sense strand of the modification pattern indicated by L23M29 comprises a structure as indicated by a15) and the antisense strand comprises a structure as indicated by b15),

[0117] a15) NmsNmsNmNmNmNmNmNmNfN(d)NfNmNmNmNmNmNmNmNmNmNm;

[0118] b15) NmsNfsNmNmN(d)NmN(d)NfNmNfNmNfNmNfNmNfNmNfNmNmNmsNmsNm;

[0119] The sense strand of the modification pattern indicated by L23M30 comprises a structure as indicated by a16) and the antisense strand comprises a structure as indicated by b16),

[0120] a16) NmsNmsNmNmNmNmNmNmNfN(d)NfNmNmNmNmNmNmNmNmNmNm;

[0121] b16) NmsNfsNmNmN(d)NmN(d)NmNmNfNmNfNmNfNmNfNmNfNmNfNmsNmsNm;

[0122] In the modification patterns indicated by M35 to M41, M48, AM4, AM1, L23M25 to L23M30, Nm is selected from any one of Am, Um, Cm and Gm, Am represents 2’- methoxyadenosine-3’-phosphate, Um represents 2’-methoxyuridine-3’-phosphate, Cm represents 2’-methoxycytidine-3’-phosphate, and Gm represents 2’- methoxyguanosine-3’-phosphate;

[0123] Nf is selected from any one of Af, Uf, Cf and Gf, Af represents 2’-fluoroadenosine-3’- phosphate, Uf represents 2’-fluorouridine-3’-phosphate, Cf represents 2’- fluorocytidine-3’-phosphate, and Gf represents 2’-fluoroguanosine-3’- phosphate;

[0124] N(d) is selected from any one of A(d), T(d), C(d) and G(d), A(d) represents 2’- deoxyadenosine-3’-phosphate, T(d) represents 2’-deoxythymidine-3’- phosphate, C(d) represents 2’-deoxycytidine-3’-phosphate, and G(d) represents 2’- deoxyguanosine-3’-phosphate;

[0125] N(GNA) is selected from any one of A(GNA), T(GNA), C(GNA), and G(GNA), A(GNA) represents an adenosine-glycol nucleic acid (GNA) S-isomer or an adenosine-glycol nucleic acid (GNA), T(GNA) represents a thymidine-glycol nucleic acid (GNA) S-isomer or a thymidine-glycol nucleic acid (GNA), C(GNA) represents a cytidine-glycol nucleic acid (GNA) S-isomer or a cytidine-glycol nucleic acid (GNA), C(GNA) represents a guanosine-glycol nucleic acid (GNA) S-isomer or a guanosine-glycol nucleic acid (GNA);

[0126] Nms is selected from any one of Ams, Ums, Cms, and Gms, Ams represents a 2’- methoxyadenosine-3’-phosphorothioate, Ums represents a 2’-methoxyuridine-3’- phosphorothioate, Cms represents a 2’-methoxycytidine-3’-phosphorothioate, Gms represents a 2’-methoxyguanosine-3’-phosphorothioate;

[0127] Nfs is selected from any one of Afs, Ufs, Cfs, and Gfs, Afs represents a 2’- fluoroadenosine-3’-phosphorothioate, Ufs represents a 2’-fluorouridine-3’- phosphorothioate, Cfs represents a 2’-fluorocytidine-3’-phosphorothioate, Gfs represents a 2’-fluoroguanosine-3’-phosphorothioate;

[0128] (invAb) represents an inverted abasic nucleotide.

[0129] The present application also provides a modified double-stranded RNA molecule, the sense strand of which has a general formula of: NmsNmsNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNm; and the antisense strand of which has a general formula of: NmsNfsNmNmN(d)NmN(d)NmNmNfNmNfNmNfNmNfNmNfNmsNfsNm;

[0130] Nm is selected from any one of Am, Um, Cm, and Gm, Am represents a 2’- methoxyadenosine-3’-phosphate, Um represents a 2’-methoxyuridine-3’-phosphate, Cm represents a 2’-methoxycytidine-3’-phosphate, Gm represents a 2’- methoxyguanosine-3’-phosphate;

[0131] Nf is selected from any one of Af, Uf, Cf, and Gf, Af represents a 2’- fluoroadenosine-3’-phosphate, Uf represents a 2’-fluorouridine-3’-phosphate, Cf represents a 2’-fluorocytidine-3’-phosphate, Gf represents a 2’- fluoroguanosine-3’-phosphate;

[0132] N(d) is selected from any one of A(d), T(d), C(d) and G(d), A(d) represents 2'-deoxyadenosine-3'-phosphate, T(d) represents 2'-deoxythymidine-3'-phosphate, C(d) represents 2'-deoxycytidine-3'-phosphate, and G(d) represents 2'-deoxyguanosine-3'-phosphate;

[0133] Nms is selected from any one of Ams, Ums, Cms and Gms, Ams represents 2'-methoxyadenosine-3'-phosphorothioate, Ums represents 2'-methoxyuridine-3'-phosphorothioate, Cms represents 2'-methoxycytidine-3'-phosphorothioate, and Gms represents 2'-methoxyguanosine-3'-phosphorothioate;

[0134] Nfs is selected from any one of Afs, Ufs, Cfs and Gfs, Afs represents 2'-fluoroadenosine-3'-phosphorothioate, Ufs represents 2'-fluorouridine-3'-phosphorothioate, Cfs represents 2'-fluorocytidine-3'-phosphorothioate, and Gfs represents 2'-fluoroguanosine-3'-phosphorothioate.

[0135] In the present application, the general formula of the sense strand of the modified double-stranded RNA molecule is: NmsNmsNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNm; and the general formula of the antisense strand is: NmsNfsNmNmN(d)NmN(d)NmNmNfNmNfNmNfNmNfNmNfNmsNfsNm.

[0136] The sense strand and / or the antisense strand of the double-stranded RNA molecule is coupled with a ligand;

[0137] The double-stranded RNA molecule is coupled with the ligand at one end or both ends of the sense strand and / or the antisense strand.

[0138] The double-stranded RNA molecule is coupled with the ligand in the interior of the sense strand and / or the antisense strand.

[0139] The double-stranded RNA molecule is coupled with the ligand in the interior of the sense strand.

[0140] The double-stranded RNA molecule is coupled with the ligand in the interior of the sense strand and / or the antisense strand and / or at one end or both ends of the sense strand and / or the antisense strand.

[0141] The ligand can be an antibody, a small molecule or a polypeptide targeting a cell receptor.

[0142] The ligand can be an antibody, small molecule, or polypeptide that targets an integrin receptor, transferrin receptor (TfR), low-density lipoprotein receptor-related protein 1 (LRP1), low-density lipoprotein receptor-related protein 2 (LRP2), low-density lipoprotein receptor (LDLR), asialoglycoprotein receptor (ASGPR), leptin receptor, nicotinic acetylcholine receptor (nAchR), insulin-like growth factor 1 receptor (IGF-1R).

[0143] The double-stranded RNA molecule, a sense strand of which is coupled with a ligand.

[0144] The ligand is one or more GalNAc attached using a bivalent or trivalent branched linker.

[0145] In the double-stranded RNA molecule, the 1st nucleotide counted from the 5' end of the antisense strand can be a VP-modified nucleotide.

[0146] In the present application, the double-stranded RNA molecule can be selected from at least one of the following modified double-stranded RNA molecules: hcAGT-173M38G, hcAGT-32M38G, hcAGT-358M38G, hcAGT-360M38G, hcAGT-363M38G, hcAGT-364M38G, hcAGT-365M38G, hcAGT-389M38G, hcAGT-391M38G, hcAGT-406M38G, hcAGT-41M38G, or ANG3-1045M38G.

[0147] (1) The sequences of the sense strand and the antisense strand of the hcAGT-173M38G are as follows, respectively:

[0148] UmsCmsAmAmCmUmGfGfAfUmGmAmAmGmAmAmAmCmUm-GalNAc and AmsGfsUmUmT(d)CmT(d)UmCmAfUmCfCmAfGmUfUmGfAmsGfsGm;

[0149] (2) The sequences of the sense strand and the antisense strand of the hcAGT-32M38G are as follows, respectively:

[0150] AmsUmsUmCmCmUmGfUfUfUmGmCmUmGmUmGmUmAmUm-GalNAc and AmsUfsAmCmA(d)CmA(d)GmCmAfAmAfCmAfGmGfAmAfUmsGfsGm;

[0151] (3) The sequences of the sense strand and the antisense strand of the hcAGT-358M38G are as follows, respectively:

[0152] UmsCmsCmCmAmCmCfUfUfUmUmCmUmAmAmUm-GalNAc and AmsUfsUmAmG(d)AmA(d)GmAmAfAmAfGmGfUmGfGmGfAmsGfsAm;

[0153] (4) The sequences of the sense strand and the antisense strand of the hcAGT-360M38G are as follows, respectively:

[0154] CmsCmsAmCmCmUmUfUfUfCmUmUmCmUmAmAmUmGmAm-GalNAc and UmsCfsAmUmT(d)AmG(d)AmAmGfAmAfAmAfGmGfUmGfGmsGfsAm;

[0155] (5) The sequences of the sense strand and the antisense strand of the hcAGT-363M38G are as follows, respectively:

[0156] CmsCmsUmUmUmUmCfUfUfCmUmAmAmUmGmAmGmUmCm-GalNAc and GmsAfsCmUmC(d)AmT(d)UmAmGfAmAfGmAfAmAfAmGfGmsUfsGm;

[0157] (6) The sequences of the sense strand and the antisense strand of the hcAGT-364M38G are as follows, respectively:

[0158] CmsGmsUmUmUmCmUfCfCfUmUmGmGmUmCmUmAmAmGm-GalNAc and CmsUfsUmAmG(d)AmC(d)CmAmAfGmGfAmGfAmAfAmCfGmsGfsCm;

[0159] (7) The sequences of the sense strand and the antisense strand of the hcAGT-365M38G are as follows, respectively:

[0160] GmsUmsUmUmCmUmCfCfUfUmGmGmUmCmUmAmAmGmUm-GalNAc and AmsCfsUmUmA(d)GmA(d)CmCmAfAmGfGmAfGmAfAmAfCmsGfsGm;

[0161] (8) The sequences of the sense and antisense strands of the hcAGT-389M38G are as follows, respectively: AmsGmsUmGmUmUmCfCfCfUmUmUmUmCmAmAmGmUmUm-GalNAc 276 and AmsAfsCmUmT(d)GmA(d)AmAmAfGmGfGmAfAmCfAmCfUmsUfsUm;

[0162] (9) The sequences of the sense and antisense strands of the hcAGT-391M38G are as follows, respectively:

[0163] UmsGmsUmUmCmCmCfUfUfUmUmCmAmAmGmUmUmGmAm-GalNAc and UmsCfsAmAmC(d)UmT(d)GmAmAfAmAfGmGfGmAfAmCfAmsCfsUm;

[0164] (10) The sequences of the sense and antisense strands of the hcAGT-406M38G are as follows, respectively:

[0165] UmsGmsAmGmAmAmCfAfAfAmAmAmUmUmGmGmGmUmUm-GalNAc and AmsAfsCmCmC(d)AmA(d)UmUmUfUmUfGmUfUmCfUmCfAmsAfsCm;

[0166] (11) The sequences of the sense and antisense strands of the hcAGT-41M38G are as follows, respectively:

[0167] CmsGmsAmCmCmAmGfCfUfUmGmUmUmUmGmUmGmAmAm-GalNAc and UmsUfsCmAmC(d)AmA(d)AmCmAfAmGfCmUfGmGfUmCfGmsGfsUm;

[0168] (12) The sequences of the sense and antisense strands of the ANG3-1045M38G are as follows, respectively:

[0169] CmsAmsAmAmAmUmCfAfAfGmAmUmUmUmGmCmUmAmUm-GalNAc and AmsUfsAmGmC(d)AmA(d)AmUmCfUmUfGmAfUmUfUmUfGmsGfsCm;

[0170] In the above (1) to (12), A represents adenosine-3'-phosphate, Af represents 2'-fluoro adenosine-3'-phosphate, Afs represents 2'-fluoro adenosine-3'-phosphorothioate, Am represents 2'-methoxy adenosine-3'-phosphate, Ams represents 2'-methoxy adenosine-3'-phosphorothioate, A(d) represents 2'-deoxy adenosine-3'-phosphate, C represents cytidine-3'-phosphate, Cf represents 2'-fluoro cytidine-3'-phosphate, Cfs represents 2'-fluoro cytidine-3'-phosphorothioate, Cm represents 2'-methoxy cytidine-3'-phosphate, Cms represents 2'-methoxy cytidine-3'-phosphorothioate, C(d) represents 2'-deoxy cytidine-3'-phosphate, G represents guanosine-3'-phosphate, Gf represents 2'-fluoro guanosine-3'-phosphate, Gm represents 2'-methoxy guanosine-3'-phosphate, Gms represents 2'-methoxy guanosine-3'-phosphorothioate, G(d) represents 2'-deoxy guanosine-3'-phosphate, U represents uridine-3'-phosphate, Uf represents 2'-fluoro uridine-3'-phosphate, Ufs represents 2'-fluoro uridine-3'-phosphorothioate, Um represents 2'-methoxy uridine-3'-phosphate, Ums represents 2'-methoxy uridine-3'-phosphorothioate, T(d) represents 2'-deoxy thymidine-3'-phosphate.

[0171] The sense strand of the double-stranded RNA molecule is conjugated with a ligand.

[0172] The ligand is one or more GalNAc attached using a divalent or trivalent branched linker.

[0173] Specifically, in the above (1) to (12), the 1st nucleotide from the 3' end of the sense strand is conjugated with a ligand GalNAc.

[0174] In the double-stranded RNA molecule, the 1st nucleotide from the 5' end of the antisense strand can be a VP-modified nucleotide.

[0175] Specifically, in the above (1) to (12), the 1st nucleotide from the 5' end of the antisense strand can be a VP-modified nucleotide.

[0176] The present application also provides use of the above double-stranded RNA molecule in the preparation of a pharmaceutical composition.

[0177] The present application also provides a pharmaceutical composition comprising the above double-stranded RNA molecule.

[0178] In the present application, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier.

[0179] Substance X, or a composition comprising substance X, used as a pharmaceutical composition, is also protected by this invention, wherein substance X is the aforementioned double-stranded RNA molecule.

[0180] The present invention also provides a pharmaceutical composition for inhibiting AGT, said pharmaceutical composition comprising at least one of the following double-stranded RNA molecules: hcAGT-173M38G, hcAGT-32M38G, hcAGT-358M38G, hcAGT-360M38G, hcAGT-363M38G, hcAGT-364M38G, hcAGT-365M38G, hcAGT-389M38G, hcAGT-391M38G, hcAGT-406M38G, hcAGT-41M38G, and ANG3-1045M38G.

[0181] The present invention also provides the use of at least one of the following double-stranded RNA molecules: hcAGT-173M38G, hcAGT-32M38G, hcAGT-358M38G, hcAGT-360M38G, hcAGT-363M38G, hcAGT-364M38G, hcAGT-365M38G, hcAGT-389M38G, hcAGT-391M38G, hcAGT-406M38G, hcAGT-41M38G, and ANG3-1045M38G in the preparation of pharmaceutical compositions for the prevention and / or treatment of hypertension or dyslipidemia.

[0182] The present invention also provides the use of the above-described double-stranded RNA molecules or pharmaceutical compositions for the prevention and / or treatment of hypertension or dyslipidemia.

[0183] The present invention also provides a method for treating and / or preventing hypertension or dyslipidemia, the method comprising administering to a subject an effective dose of the above-described double-stranded RNA molecule or pharmaceutical composition to treat and / or prevent hypertension or dyslipidemia.

[0184] In this invention, the subjects exhibit abnormal blood pressure or blood lipids.

[0185] In this invention, the application, use, or method is intended for the diagnosis and treatment of diseases.

[0186] In this invention, the application, use or method may not be for the purpose of diagnosing and treating diseases, but its direct purpose is only to obtain intermediate results.

[0187] The present invention also provides the siRNA molecules and their modifications described in Table 2.

[0188] The present invention also provides the modification methods of the siRNA molecules described in Table 3. Attached Figure Description

[0189] Figure 1 shows the AGT mRNA expression level in female mice at a dose of 1 mg / kg.

[0190] Figure 2 shows the AGT mRNA expression level in male rats at a dose of 3 mg / kg.

[0191] Figure 3 shows the AGT mRNA expression level in female mice at a dose of 1 mg / kg.

[0192] Figure 4 shows the in vivo experimental comparison of modified siRNA targeting ANGPTL3 mRNA.

[0193] Figure 5 shows the in vivo experimental comparison of modified siRNA targeting AGT mRNA.

[0194] Figure 6 shows the effect verification of the siRNA modification method provided by the present invention for the KLKB1 target.

[0195] Figure 7 shows the effect verification of a set of siRNAs used for the C3 target by the siRNA modification method provided by the present invention.

[0196] Figure 8 shows another set of siRNA effects verifications provided by the present invention for the C3 target. Embodiments of the present invention

[0197] I. Terminology in this invention

[0198] In this invention, "modified nucleotide" refers to a nucleotide or nucleotide analog formed by replacing the 2'-hydroxyl group of the ribosyl group with another group, or a nucleotide in which the bases on the nucleotide are modified bases. "Methoxy-modified nucleotide" refers to a nucleotide formed by replacing the 2'-hydroxyl group of the ribosyl group with a methoxy group. "Fluoro-modified nucleotide" refers to a nucleotide formed by replacing the 2'-hydroxyl group of the ribosyl group with fluorine. "Nucleotide analog" refers to a group that can replace a nucleotide in nucleic acids, but whose structure differs from adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide, or thymine deoxyribonucleotide. Examples include isonucleotides, bridged nucleic acids (BNA), or acyclic nucleotides.

[0199] In one embodiment of the present invention, a "fluorinated nucleotide" refers to a nucleotide formed by replacing the hydroxyl group at the 2' position of the ribosyl group with fluorine, having the structure shown in formula (1). The non-fluorinated nucleotide is independently selected from nucleotides or nucleotide analogs formed by replacing the hydroxyl group at the 2' position of the ribosyl group with a non-fluorinated group.

[0200] In one embodiment of the present invention, the nucleotide formed by replacing the hydroxyl group at the 2' position of the ribosome with a non-fluorinated group is well known to those skilled in the art, and these nucleotides may be selected from one of 2'-alkoxy modified nucleotides, 2'-substituted alkoxy modified nucleotides, 2'-alkyl modified nucleotides, 2'-substituted alkyl modified nucleotides, 2'-amino modified nucleotides, 2'-substituted amino modified nucleotides, and 2'-deoxynucleotides.

[0201] In one embodiment of the present invention, the 2'-alkoxy modified nucleotide is a 2'-methoxy (2'-OMe) modified nucleotide, as shown in formula (2), i.e., methoxy modified; the 2'-substituted alkoxy modified nucleotide, for example, can be a 2'-O-methoxyethyl (2'-MOE) modified nucleotide, as shown in formula (3); the 2'-amino (2'-NH2) modified nucleotide is shown in formula (4); and the 2'-deoxynucleotide (DNA) is shown in formula (5).

[0202] In one embodiment of the present invention, the nucleotide analogue refers to a group that can replace a nucleotide in nucleic acids, but whose structure is different from that of adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide, or thymine deoxyribonucleotide.

[0203] In one embodiment of the present invention, the nucleotide analog may be a heteronucleotide, a bridged nucleotide, or an acyclic nucleotide.

[0204] In one embodiment of the invention, the bridged nucleic acid (BNA) refers to a restricted or inaccessible nucleotide. The BNA may contain a bridging structure with a "fixed" C3'-endoglucan condensation of a five-membered ring, a six-membered ring, or a seven-membered ring. Typically, the bridge is incorporated into the 2'-, 4'-position of the ribose to provide a 2',4'-BNA nucleotide.

[0205] In one embodiment of the present invention, the BNA may be LNA, ENA, cET BNA, etc., wherein LNA is as shown in formula (6), ENA is as shown in formula (7), and cET BNA is as shown in formula (8):

[0206] In one embodiment of the present invention, the thermally unstable modification may include, but is not limited to, debasement modification; mismatch with relative nucleotides in the opposite chain; and sugar modification, such as 2'-deoxy modification or acyclic nucleotides, for example, unlocked nucleic acid (UNA) or glycol nucleic acid (GNA).

[0207] Examples of debasing modifications include, but are not limited to, the following, with structural formulas as shown in formulas (9) to (15):

[0208] Where R = H, Me, Et or OMe; R' = H, Me, Et or OMe; R” = H, Me, Et or OMe.

[0209] In one embodiment of the present invention, sugar modification includes, but is not limited to, the following: 2'-deoxynucleotides, unlocked nucleic acids, and glycol-based nucleic acids.

[0210] In one embodiment of the invention, an acyclic nucleotide refers to any nucleotide having a noncyclic ribose, for example, wherein any bond between ribose carbons in the nucleotide (e.g., C1'-C2', C2'-C3', C3'-C4', C4'-O4', or C1'-O4') is absent and / or at least one of the ribose carbons or oxygen (e.g., C1', C2', C3', C4', or O4') is absent independently or in combination.

[0211] In one embodiment of the invention, UNA represents an unlocked acyclic nucleic acid (or open-ring nucleotide) in which any bond of the sugar is removed, forming an unlocked "sugar" residue. In one instance, UNA also encompasses monomers in which the bond between C1' and C4' has been removed (i.e., the covalent carbon-oxygen-carbon bond between C1' and C4' carbons). In another instance, the C2'-C3' bond of the sugar (i.e., the covalent carbon-carbon bond between C2' and C3' carbons) is removed (see Mikhailov et al., Tetrahedron Letters, 26(17):2059(1985); and Fluiter et al., Mol. Biosyst., 10:1039(2009), which are incorporated herein by reference in their entirety). Acyclic derivatives provide greater skeletal flexibility without affecting Watson-Crick pairing. Acyclic nucleotides can be linked via 2'-5' or 3'-5' bonds.

[0212] In one embodiment of the present invention, GNA represents diol nucleic acid, which is a polymer similar to DNA or RNA, but with a different "backbone" composed of repeating glycerol units linked by phosphodiester bonds. The structure of A (GNA) is shown in Formula (16), the structure of G (GNA) is shown in Formula (17), the structure of C (GNA) is shown in Formula (18), the structure of U (GNA) is shown in Formula (19), and the structure of T (GNA) is shown in Formula (20).

[0213] The thermally unstable modification of the duplex can be a mismatch (i.e., a non-complementary base pair) between a thermally unstable nucleotide and a corresponding nucleotide in the opposite strand of the dsRNA duplex. Exemplary mismatched base pairs include G:G, G:A, G:U, G:T, A:A, A:C, C:C, C:U, C:T, U:U, T:T, U:T, or combinations thereof. Other mismatched base pairs known in the art are also applicable to the present invention. Mismatches can occur between nucleotides, which are naturally occurring nucleotides or modified nucleotides; that is, mismatched base pairs can occur between nucleobases from the respective nucleotides, regardless of modifications to the ribose of the nucleotides. In some embodiments, the dsRNA molecule contains at least one nucleobase in the mismatched pair that is a 2'-deoxynucleobase; for example, a 2'-deoxynucleobase in the sense strand.

[0214] Further examples of thermally unstable modified nucleotides are described in detail in WO2018098328A1 (the entire contents of which are incorporated herein by reference), and in this invention, thermally unstable modification is equivalent to thermal destabilization modification in WO2018098328A1.

[0215] In one embodiment of the present invention, the nucleotides at least the 5th and 7th positions of the antisense strand are thermally unstable modified nucleotides, in the direction from the 5' end to the 3' end; the thermally unstable modified nucleotides are ethylene glycol nucleonucleotides (GNA) and / or 2′-deoxynucleotides, wherein the 2′-deoxynucleotides are located in the antisense strand of the nucleotide sequence.

[0216] In one embodiment of the present invention, inosine nucleotide is also a thermally unstable modification. Inosine nucleotide is represented by the following structures: dI structure as shown in formula (21), I structure as shown in formula (22), (If) structure as shown in formula (23), and (Im) structure as shown in formula (24).

[0217] In one embodiment of the present invention, at least one phosphate group in the sense or antisense strand of the siRNA is a phosphate group with a modifying group.

[0218] In one embodiment of the present invention, at least a portion of the phosphate ester groups and / or ribosomes in the phosphate-sugar backbone of at least one single strand of the sense and antisense strands of the siRNA are phosphate ester groups and / or ribosomes with modifying groups.

[0219] In one embodiment of the present invention, the phosphate ester group with the modifying group is a thiophosphate ester group formed by replacing at least one oxygen atom in the phosphate diester bond of the phosphate ester group with a sulfur atom.

[0220] In one embodiment of the present invention, the phosphate group having the modifying group is a thiophosphate group having the structure shown in formula (25). In one embodiment of the present invention, the nucleotide linked to the thiophosphate group is shown in formula (26). In one embodiment of the present invention, the VP-modified nucleotide is a vinyl phosphate modified nucleotide. In one embodiment of the present invention, the nucleotide modified by VP and methoxy groups, i.e., the nucleotide modified by 5'-(E)-vinyl-2'-methoxy phosphate group (5'-(E)-VP-2'-OMe), is shown in formula (27). In one embodiment of the present invention, the nucleotide modified by VP, methoxy groups, and thiophosphate groups, i.e., the nucleotide modified by 5'-PS (i.e., the nucleotide modified by 5'-(E)-vinyl-2'-methoxy thiophosphate group), is shown in formula (28).

[0221] In one embodiment of the invention, the thiophosphate group linkage is present at least at one of the following positions: between the first and second nucleotides at either end of the sense or antisense strand; between the second and third nucleotides at either end of the sense or antisense strand; or any combination thereof.

[0222] In one embodiment of the invention, the thiophosphate group linkage is present at all of the above-mentioned positions except for the end of the positive chain 5'.

[0223] In one embodiment of the invention, the thiophosphate group linkage is present at all of the above-mentioned positions except for the end of the positive chain 3'.

[0224] In one embodiment of the invention, the thiophosphate group is present at at least one of the following positions:

[0225] Between the first and second nucleotides at the 5' end of the positive strand;

[0226] Between the second and third nucleotides at the 5' end of the positive strand;

[0227] Between the first and second nucleotides at the 3' end of the positive strand;

[0228] Between the second and third nucleotides at the 3' end of the positive strand;

[0229] Between the first and second nucleotides at the 5' end of the antisense strand;

[0230] Between the second and third nucleotides at the 5' end of the antisense strand;

[0231] Between the first and second nucleotides at the 3' end of the antisense strand; and

[0232] Between the second and third nucleotides at the 3' end of the antisense strand.

[0233] In one embodiment of the present invention, the reverse nucleotide is represented by the following structure, as shown in formulas (29) to (32).

[0234] In one embodiment of the present invention, invAb represents a reverse abase-free nucleotide, and the structural formula of invAb is shown in formula (33).

[0235] In one embodiment of the present invention, the 5' end and / or 3' end of the siRNA sense strand or antisense strand is connected to at least one reverse abase-free nucleotide.

[0236] In one embodiment of the present invention, at least one inverted abase-free nucleotide is attached to the 5' end and / or 3' end of the siRNA positive strand.

[0237] In one embodiment of the present invention, the reverse abase-free nucleotide is linked to the positive strand of the siRNA via a phosphate thioester.

[0238] In one embodiment of the present invention, the siRNA is coupled to a functional molecule, the coupled functional molecule including N-acetylgalactosamine (GalNAc), lipophilic molecules, peptides, small molecule drugs, antibodies, etc.

[0239] In one embodiment of the present invention, siRNA may be coupled to one or more coupling groups containing functional molecules.

[0240] In one embodiment of the present invention, the pharmaceutically acceptable target group in the siRNA conjugate formed by coupling the siRNA with a target group or functional molecule is galactose or N-acetylgalgactosamine (GalNAc). N-acetylgalgactosamine (GalNAc) is a ligand that binds to the asialoglycoprotein receptor (ASGPR) on the liver surface. The ASGPR is an endocytic receptor specifically expressed by hepatocytes. N-acetylgalgactosamine serves as a target molecule to deliver small RNA to the liver.

[0241] In one embodiment of the present invention, the galactose or N-acetylgalactosamine molecule can be monovalent, divalent, trivalent, or tetravalent; the monovalent, divalent, trivalent, and tetravalent respectively refer to the siRNA molecule forming an siRNA conjugate with a coupling group containing a galactose or N-acetylgalactosamine molecule as a targeting group, wherein the molar ratio of the siRNA molecule to the galactose or N-acetylgalactosamine molecule in the siRNA conjugate is 1:1, 1:2, 1:3, or 1:4.

[0242] In one embodiment of the present invention, when siRNA is coupled to a coupling group containing N-acetylgalactosamine, the N-acetylgalactosamine molecule is trivalent or tetravalent.

[0243] In one embodiment of the present invention, when siRNA is coupled to a coupling group containing N-acetylgalactosamine, the N-acetylgalactosamine molecule is trivalent.

[0244] In one embodiment of the present invention, siRNA may be coupled to one or more coupling groups containing N-acetylgalactosamine.

[0245] In one embodiment of the present invention, the targeting group can be linked to the siRNA molecule via a suitable adapter, and those skilled in the art can select a suitable adapter according to the specific type of the targeting group.

[0246] The types of adapters, targeting groups, and the methods of ligation with siRNA are described in detail in WO2015006740A2 (the entire contents of which are incorporated herein by reference).

[0247] In one embodiment of the present invention, the 5' and / or 3' ends of the sense or antisense strand of the siRNA are coupled with a ligand, which may be a lipophilic moiety or GalNAc.

[0248] In one embodiment of the present invention, the siRNA has a ligand coupled to the 3' end of the positive strand, the ligand being GalNAc.

[0249] In one embodiment of the present invention, the 3' end of the positive strand of the siRNA is connected to the ligand via a thiophosphate group.

[0250] In one embodiment of the present invention, the siRNA conjugate formed by GalNAc and siRNA molecules has the structure shown in formula (34) below:

[0251] In one embodiment of the present invention, siRNA may be coupled to one or more coupling groups containing functional molecules or linked to a target group.

[0252] The targeting group is a small molecule, peptide, aptamer, or antibody that targets integrin.

[0253] The targeting group is a small molecule, polypeptide, aptamer, or antibody that targets integrin avβ6.

[0254] The types of adapters, targeting groups, and the methods of linking to siRNA are described in detail in WO2022056286A1, WO2024129931A1, WO2025067433A1, and WO2025067423A1 (the entire contents of which are incorporated herein by reference).

[0255] The ligand may be an antibody, small molecule, or peptide targeting integrin receptor, transferrin receptor (TfR), low-density lipoprotein receptor-associated protein 1 (LRP1), low-density lipoprotein receptor-associated protein 2 (LRP2), low-density lipoprotein receptor (LDLR), desialylate glycoprotein receptor (ASGPR), leptin receptor, nicotinic acetylcholine receptor (nAchR), or insulin-like growth factor 1 receptor (IGF-1R).

[0256] In one embodiment of the invention, the functional molecule is a lipophilic molecule (or a lipophilic or lipophilic moiety). The siRNA comprises one or more lipophilic moieties coupled or conjugated to one or more nucleotides on at least one chain via a linker or vector. The lipophilic moieties include, but are not limited to, one or more of saturated alkanes, unsaturated alkanes, saturated fatty acids, unsaturated fatty acids, and cholesterol of varying chain lengths.

[0257] In one embodiment of the invention, the lipophilic moiety is aliphatic, cyclic (e.g., alicyclic), or polycyclic, such as alicyclic compounds, such as steroids (e.g., sterols), or straight-chain or branched aliphatic hydrocarbons. Exemplary lipophilic moieties include lipids, cholesterol, retinoic acid, cholic acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O-(hexadecyl)glycerol, geraniol, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecanyl, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, ibuprofen, naproxen, dimethoxytriphenylmethyl, or phenoxazine.

[0258] In one embodiment of the invention, the lipophilic portion also includes saturated or unsaturated C4-C. 30 Hydrocarbon chains (e.g., C4-C) 30 A lipophilic moiety comprising an alkyl or alkenyl group and optional functional groups selected from the group consisting of hydroxyl, amine, carboxylic acid, sulfonate, phosphate, thiol, azide, and alkyne. These functional groups can be used to attach the lipophilic moiety to an iRNA agent. In some embodiments, the lipophilic moiety contains saturated or unsaturated C6-C6 groups.18 Hydrocarbon chains (e.g., straight-chain C6-C) 18 (alkyl or alkenyl). In one embodiment, the lipophilic moiety contains saturated or unsaturated C. 16 Hydrocarbon chains (e.g., straight-chain C) 16 (alkyl or alkenyl).

[0259] In one embodiment of the present invention, the lipophilic portion is C6-C. 30 Acids (e.g., hexanoic acid, heptanoic acid, octanoic acid, nonanoic acid, decanoic acid, undecanoic acid, dodecanoic acid, tridecanoic acid, tetradecanoic acid, pentadecanoic acid, hexadecanoic acid, heptadecanoic acid, octadecanoic acid, oleic acid, linoleic acid, arachidonic acid, cis-4,7,10,13,16,19-docosahexaenoic acid, vitamin A, vitamin E, cholesterol, etc.) or C6-C 30 Alcohols (e.g., hexanol, heptanol, octanol, nonanol, decanol, undecanol, dodecanol, tridecanol, tetradecanol, pentadecanol, hexadecanol, heptadecanol, octadecanol, oleyl alcohol, linolenic acid, arachidonic acid, cis-4,7,10,13,16,19-docosahexaenoic acid, retinol, vitamin E, cholesterol, etc.).

[0260] In one embodiment of the invention, the lipophilic portion may conjugate to the iRNA agent via direct attachment to the ribose of the iRNA agent. Alternatively, the lipophilic portion may conjugate to the iRNA agent via a linker or a vector.

[0261] In one embodiment of the invention, the lipophilic portion is conjugated to the iRNA agent via one or more linkers (ligands).

[0262] In one embodiment of the invention, the lipophilic portion is conjugated to a double-stranded iRNA agent via a linker containing an ether, thioether, urea, carbonate, amine, amide, maleimide-thioether, disulfide, phosphate diester, sulfonamide bond, product of a click reaction (e.g., a triazole from an azide-alkyne cycloaddition), or carbamate.

[0263] In one embodiment of the invention, at least one connector (chain linker) is a redox-cleavable connector (such as a reductant connector, e.g., a disulfide group), an acid-cleavable connector (e.g., an hydrazone group, an ester group, an acetal group, or a ketal group), an esterase-cleavable connector (e.g., an ester group), a phosphatase-cleavable connector (e.g., a phosphate ester), or a peptidase-cleavable connector (e.g., a peptide bond).

[0264] In one embodiment of the invention, at least one linker (tether) is a biolytic linker selected from the group consisting of: DNA, RNA, disulfides, amides, functionalized monosaccharides or oligosaccharides of galactosamine, glucosamine, glucose, galactose, and mannose, or combinations thereof.

[0265] In one embodiment of the invention, the lipophilic portion is conjugated to a double-stranded iRNA agent via a carrier that replaces one or more nucleotides. The carrier can be a cyclic group or an acyclic group. In one embodiment, the cyclic group is selected from the group consisting of: pyrrolidinyl, pyrazolinyl, pyrazolinyl, imidazolinyl, imidazolinyl, piperidinyl, piperazinyl, [1,3]dioxolane, oxazolinyl, isoxazolinyl, morpholinyl, thiazolinyl, isothiazolinyl, quinoxalinyl, pyridazinoneyl, tetrahydrofuranyl, and decahydronaphthalene. In one embodiment, the acyclic group is a portion based on a serine or diethanolamine backbone.

[0266] In one embodiment of the invention, the lipophilic portion is C16 or C22, and further examples of the lipophilic portion are described in detail in WO2019217459A1, WO2024086633A1, WO2023064530A1 and WO2024216155A1 (the entire contents of which are incorporated herein by reference).

[0267] C16 represents 2'-O-hexadecyl, a short lipid chain attached to siRNA. It is lipophilic and can interact with cell membranes or membrane proteins. The structural formula of the nucleotide modified with 2'-O-hexadecyl is shown in formula (35).

[0268] In one embodiment of the present invention, the C16 may be attached to any nucleotide of the positive strand.

[0269] In one embodiment of the present invention, C22 may be coupled to any one of the nucleotides of the sense strand or the antisense strand.

[0270] The lipophilic portion is described in detail in WO2019217459A1, WO2024086633A1, WO2023064530A1 and WO2024216155A1 (the entire contents of which are incorporated herein by reference).

[0271] In the siRNA preparation method described in this invention, unless otherwise specified, the nucleoside monomer refers to the modified or unmodified RNA phosphoramidites (sometimes also called nucleoside phosphoramidites) used in phosphoramidite solid-phase synthesis, depending on the type and sequence of nucleotides in the desired siRNA. Phosphoramidite solid-phase synthesis is a method known to those skilled in the art for siRNA synthesis. All nucleoside monomers used in this invention are commercially available.

[0272] In this invention, the positive strand of the double-stranded RNA molecule is conjugated to a ligand attached at the 3'-end, wherein the ligand is one or more GalNAc derivatives attached using a divalent or trivalent branched linker.

[0273] The siRNA conjugate formed by GalNAc and double-stranded RNA molecules in this invention has the structure shown in formula (34).

[0274] It is worth noting that the raw materials used in this invention are all commercially available products, and their sources are not specifically limited.

[0275] When used in a list of two or more items, the term "and / or" means that any of the listed items can be used alone or in combination with any one or more of the listed items. For example, the expression "A and / or B" is intended to mean either or both of A and B, i.e., A alone, B alone, or a combination of A and B. The expression "A, B and / or C" means A alone, B alone, C alone, a combination of A and B, a combination of A and C, a combination of B and C, or a combination of A, B and C.

[0276] The term "comprising" is not intended to be restrictive, but rather inclusive and implies the presence of other elements besides those listed, and can be interpreted as "including but not limited to". The term "comprising" also encompasses the terms "consisting of" and "substantially consisting of". In this document, the terms "including" and "comprise" are used interchangeably.

[0277] As used in this article, “transfection,” “conversion,” or “transduction” refers to the introduction of one or more exogenous polynucleotides into a host cell using physical or chemical methods.

[0278] The term "transformation" refers to the introduction of one or more exogenous polynucleotides into bacterial cells that are already capable of transformation, for example, by using dimethyl sulfoxide, divalent cations (such as calcium), or polyethylene glycol. Many transformation techniques are known in the art and include heat shock and electroshock.

[0279] The phrase “pharmaceutically acceptable” used in conjunction with the compositions described herein refers to the molecular entities and other components of such compositions that are physiologically tolerable and typically do not produce adverse effects when administered to mammals (e.g., humans). Preferably, the term “pharmaceutically acceptable” means listed in recognized pharmacopoeias for use in mammals, and more particularly for use in humans.

[0280] The term “treat” or “treatment” refers to therapeutic treatment in which the aim is to slow or alleviate undesirable physiological changes or disease, or to provide a beneficial or desired clinical outcome during treatment. Beneficial or desired clinical outcomes include symptom reduction, disease severity reduction, disease state stabilization (i.e., cessation of worsening), delay or slowing of disease progression, improvement or mitigation of disease state, and / or remission (whether partial or complete, and whether detectable or undetectable). “Treatment” can also mean prolonged survival compared to the expected survival of a subject without treatment. Subjects requiring treatment include those who already have undesirable physiological changes or disease, and those who are predisposed to developing such changes or disease. Treatment may involve therapeutic agents, also referred to herein as “medicaments” or “medication,” which may be designed to help achieve the beneficial or desired clinical outcome of interest through their action. Therapeutic agents or medications can be administered to subjects via many routes, including at least intravenous and oral routes. The term “intravenous” in relation to the administration of a therapeutic agent or medication means administration of said therapeutic agent or medication into one or more veins. The term “oral” in relation to the administration of a therapeutic agent or drug means that the therapeutic agent or drug is administered via the oral cavity, such as through the mouth.

[0281] In this invention, "subject" includes a person who is being treated or prevented from having a disease. The methods described herein can be used to treat animal subjects belonging to any classification. Examples of such animals include mammals. Mammals include, but are not limited to, rodents such as mice and hamsters, and lagomorphs such as rabbits. Mammals can be carnivores, including felines (cats) and canines (dogs). Mammals can be artiodactyla, including bovines (cattle) and suidae (pigs), or perissodactyla, including equines (horses). Mammals can be primates, ceboids, or simoids (monkeys) or hominids.

[0282] The term "effective" when applied to dosage or amount refers to an amount of compound or pharmaceutical composition sufficient to produce the desired activity when administered to a subject in need. Note that when a combination of active ingredients is administered, the effective amount of the combination may or may not include the amount of each ingredient that would be effective if administered alone. The exact amount required will vary depending on the subject, including their species, age and general condition, the severity of the condition being treated, one or more specific medications being used, the mode of administration, etc.

[0283] The term "therapeutic effective dose" generally refers to the dosage of a drug used to (i) treat or prevent a particular disease, condition, or disorder; (ii) reduce, improve, or eliminate one or more symptoms of a particular disease, condition, or disorder; or (iii) prevent or delay the onset of one or more symptoms of a particular disease, condition, or disorder described herein. A therapeutic effective dose can be determined by testing in a known in vitro or in vivo (e.g., animal model) system.

[0284] II. Implementation Examples

[0285] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0286] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0287] Unless otherwise specified, the quantitative experiments in the following examples were performed in triplicate, and the results were averaged.

[0288] The following examples use GraphPad Prism statistical software to process the data, and the experimental results are expressed as mean ± standard deviation.

[0289] In the following examples, uppercase letters C, G, U, and A represent four types of ribonucleotides. Lowercase letter m indicates that the nucleotide adjacent to the left of lowercase letter m is 2'-methoxy modified; lowercase letter f indicates that the nucleotide adjacent to the left of lowercase letter f is 2'-fluorinated modified; lowercase letter s indicates that the two nucleotides adjacent to the left and right of lowercase letter s are linked by a thiophosphate group. Lowercase letter ms indicates that the nucleotide adjacent to the left of ms is a 2'-methoxy modified nucleotide, and this 2'-methoxy modified nucleotide is linked to the nucleotide adjacent to the right of ms by a thiophosphate group. Lowercase letter fs indicates that the nucleotide adjacent to the left of fs is a 2'-fluorinated modified nucleotide, and this 2'-fluorinated modified nucleotide is linked to the nucleotide adjacent to the right of fs by a thiophosphate group; VP indicates that the nucleotide adjacent to the right of VP is modified with vinyl phosphate.

[0290] In the following examples, A represents adenosine-3'-phosphate (adenine ribonucleotide). Af represents 2'-fluoroadenosine-3'-phosphate (2'-fluoro-modified adenine ribonucleotide). Afs represents 2'-fluoroadenosine-3'-thiophosphate (2'-fluoro- and 3'-thiophosphate-modified adenine ribonucleotide). Am represents 2'-methoxyadenosine-3'-phosphate (2'-methoxy-modified adenine ribonucleotide). Ams represents 2'-methoxyadenosine-3'-thiophosphate (2'-methoxy- and 3'-thiophosphate-modified adenine ribonucleotide). A(d) represents 2'-deoxyadenosine-3'-phosphate (2'-deoxy-modified adenine ribonucleotide). A(d)s represents 2'-deoxyadenosine-3'-thiophosphate (adenosine ribonucleotide modified with 2'-deoxy and 3'-thiophosphate). A(GNA) represents adenosine-glycol nucleic acid (GNA). A(LNA) represents adenosine ribonucleotide modified with locked nucleic acid. A(MOE) represents adenosine ribonucleotide modified with 2'-methoxyethyl.

[0291] C represents cytidine-3'-phosphate (cytosine ribonucleotide). Cf represents 2'-fluorocytidine-3'-phosphate (2'-fluoro-modified cytosine ribonucleotide). Cfs represents 2'-fluorocytidine-3'-thiophosphate (2'-fluoro and 3'-thiophosphate-modified cytosine ribonucleotide). Cm represents 2'-methoxycytidine-3'-phosphate (2'-methoxy-modified cytosine ribonucleotide). Cms represents 2'-methoxycytidine-3'-thiophosphate (2'-methoxy- and 3'-thiophosphate-modified cytosine ribonucleotide). C(d) represents 2'-deoxycytidine-3'-phosphate (2'-deoxy-modified cytosine ribonucleotide). C(GNA) represents cytidine-glycol nucleic acid (GNA). C(LNA) represents locked nucleic acid-modified cytosine ribonucleotide. C(MOE) represents 2'-methoxyethyl modified cytosine ribonucleotide.

[0292] G represents guanosine-3'-phosphate (guanine ribonucleotide). Gf represents 2'-fluoroguanosine-3'-phosphate (2'-fluoro-modified guanine ribonucleotide). Gfs represents 2'-fluoroguanosine-3'-thiophosphate (2'-fluoro and 3'-thiophosphate-modified guanine ribonucleotide). Gm represents 2'-methoxyguanosine-3'-phosphate (2'-methoxy-modified guanine ribonucleotide). Gms represents 2'-methoxyguanosine-3'-thiophosphate (2'-methoxy and 3'-thiophosphate-modified guanine ribonucleotide). G(d) represents 2'-deoxyguanosine-3'-phosphate (2'-deoxy-modified guanine ribonucleotide). G(d)s represents 2'-deoxyguanosine-3'-thiophosphate (2'-deoxy and 3'-thiophosphate-modified guanine ribonucleotide). G(GNA) represents guanosine-glycol (GNA). G(LNA) represents locked nucleic acid modified guanine ribonucleotide. G(MOE) represents 2'-methoxyethyl modified guanine ribonucleotide.

[0293] T represents thymidine-3'-phosphate (thymidine deoxyribonucleotide). T(GNA) represents thymidine-glycol nucleic acid (GNA). T(d) represents 2'-deoxythymidine-3'-phosphate (2'-deoxy-modified uracil ribonucleotide). U represents uridine-3'-phosphate (uracil ribonucleotide). Uf represents 2'-fluorouridine-3'-phosphate (2'-fluoro-modified uracil ribonucleotide). Ufs represents 2'-fluorouridine-3'-thiophosphate (2'-fluoro- and 3'-thio-phosphate-modified uracil ribonucleotide). Um represents 2'-methoxyuridine-3'-phosphate (2'-methoxy-modified uracil ribonucleotide). Ums represents 2'-methoxyuridine-3'-thiophosphate (2'-methoxy- and 3'-thio-phosphate-modified uracil ribonucleotide). U(LNA) represents a locked nucleic acid modified uracil ribonucleotide. U(MOE) represents a 2'-methoxyethyl modified uracil ribonucleotide.

[0294] GalNAc represents N-acetylgalactosamine. The presence of GalNAc in the positive strand indicates that the siRNA is a conjugate formed by the 3' end of the positive strand of the siRNA and the ligand GalNAc linked by a thiophosphate group, and its structure is shown in formula (34).

[0295] VP indicates that the nucleotide has been modified with vinyl phosphate. For example, VPAms represents 5'-(E)-vinyl-2'-methoxyadenosine-3'-thiophosphate.

[0296] invAb represents reverse debasing nucleotide.

[0297] In this invention, ANGPTL3 mRNA refers to mRNA with GeneBank registration numbers NM_014495.4, XM_005543185.3, or NM_013913.4.

[0298] In this invention, AGT mRNA refers to mRNA with GeneBank registration numbers NM_001382817.3 or NM_001384479.1.

[0299] In this invention, MUC5AC mRNA refers to mRNA with the sequences shown in GeneBank registration numbers NM_001304359.2, XM_045372409.1, and NM_010844.3.

[0300] In this invention, the GeneBank numbers of the KLKB1 mRNA are the sequences shown in the following sequences: NM_000892.5, NM_001318394.2, NM_001318396.2, XM_011531930.3, XM_017008181.2, XM_017008182.2, XM_017008183.2, XM_017008184.2, and XM_047415661.1.

[0301] In this invention, C3 mRNA refers to mRNA with the sequences shown in GeneBank registration numbers C3 NM_000064.4, mouse C3NM_009778.3, cynomolgus monkey C3 XM_005587719.4, and rat C3 NM_016994.2.

[0302] Unless otherwise specified, the reagents and culture media used in the following examples are all commercially available products, and the nucleic acid electrophoresis, real-time PCR and other operations used are all performed in accordance with the methods described in Molecular Biology (4th Edition) (Alexander McLennan et al., 2019).

[0303] The siRNAs involved in the following examples were synthesized by solid-phase phosphorus amide synthesis and were synthesized by Suzhou Gemma Gene Co., Ltd.

[0304] When transfecting cells with siRNA, siRNA conjugates, or siRNA or siRNA conjugates used as negative controls in the following examples, Lipofectamine 2000 (purchased from Invitrogen) or Lipofectamine RNAiMAX (purchased from Invitrogen) was used as the transfection reagent. Specific procedures were performed according to the manufacturer's instructions. For qPCR detection, HiScript III RT SuperMix for qPCR (purchased from Vazyme) was used as the reverse transcription reagent. Specific procedures were performed according to the manufacturer's instructions.

[0305] The rearing conditions for rats or mice are as follows: the temperature of the rearing environment should be controlled at 20-22℃, the humidity should be maintained within the range of 40-60%, a 12-hour light / 12-hour dark cycle should be adopted, and food and water should be freely available.

[0306] Method of administration of siRNA to rats or mice: Subcutaneous injection in the back of the neck for all experimental animals;

[0307] qPCR was used to calculate the relative fold change in mRNA expression, and the data were analyzed using the ΔΔCt method with the control group as a reference.

[0308] ΔCt(test group) = Ct(target gene in test group) – Ct(internal reference gene in test group)

[0309] ΔCt(control group) = Ct(target gene in control group) – Ct(internal reference gene in control group)

[0310] ΔCt(test group) = ΔCt(test group) - ΔCt(control group average)

[0311] ΔCt(control group) = ΔCt(control group) - ΔCt(control group average)

[0312] Using the control group as a baseline, the expression level of mRNA in the test group was normalized, and the mRNA expression level of the control group was defined as 100%.

[0313] The relative mRNA expression level in the test group was 2. -ΔΔCt (Test group) × 100%.

[0314] For the same test group siRNA, the average relative expression level of the test group mRNA at each concentration is the arithmetic mean of the relative expression levels of multiple biological replicates at that concentration.

[0315] The inhibition rate of siRNA on the expression level of mRNA in the test group was calculated according to the following equation: Inhibition rate = (1 - relative expression level of mRNA in the test group) × 100%.

[0316] The modified siRNA information in Table 1 is obtained by modifying the sequences in Table 3 according to the modification patterns in Table 2.

[0317] Table 1. Summary of information on modified siRNA

[0318] Table 2 General formulas for siRNA modification methods provided in this invention

[0319] In Table 2, the capital letter N is selected independently from ribonucleotides with bases A, U, C or G.

[0320] The lowercase letter 'm' indicates that the ribonucleotide adjacent to the left of 'm' is a ribonucleotide whose ribose group has a 2'-O-CH3 modification. Specifically, Nm is selected from any one of Am, Um, Cm, and Gm.

[0321] The lowercase letter 'f' indicates that the ribonucleotide adjacent to the left of 'f' is a ribonucleotide whose ribose group has a 2'-F modification. Specifically, 'Nf' is selected from any one of 'Af', 'Uf', 'Cf', and 'Gf'.

[0322] (d) indicates that the ribonucleotide adjacent to its left is a deoxyribonucleotide. When the ribonucleotide adjacent to its left is uracil ribonucleotide, thymine deoxyribonucleotide is used instead of uracil ribonucleotide. Specifically, N(d) is selected from any one of A(d), T(d), C(d), and G(d).

[0323] The lowercase letter 's' indicates that two adjacent nucleotides are linked by a phosphothioester bond. Specifically, Nms is selected from any one of Ams, Ums, Cms, and Gms. Nfs is selected from any one of Afs, Ufs, Cfs, and Gfs. N(d)s is selected from any one of A(d)s, T(d)s, C(d)s, and G(d)s.

[0324] (GNA) indicates that the ribonucleotide to its left is a ribonucleotide modified with GNA. When the ribonucleotide to its left is uracil ribonucleotide, thymine deoxyribonucleotide is used instead of uracil ribonucleotide. Specifically, N(GNA) is selected from any one of A(GNA), T(GNA), C(GNA), and G(GNA).

[0325] (LNA) indicates that the ribonucleotide adjacent to it on the left is an LNA-modified ribonucleotide. Specifically, N(LNA) is selected from any one of A(LNA), U(LNA), C(LNA), and G(GNA).

[0326] (MOE) indicates that the ribonucleotide adjacent to it on the left is a ribonucleotide modified with MOE. Specifically, N(MOE) is selected from any one of A(MOE), U(MOE), C(MOE), and G(MOE).

[0327] (dI) represents deoxyinosine nucleotide.

[0328] (invAb) indicates a reverse abase-free nucleotide.

[0329] Table 3. Summary of information on pre-modified siRNA

[0330] Note: In the ST.26 sequence listing, U is represented by T in the RNA sequences in Table 3.

[0331] Example 1: siRNA inhibiting ANGPTL3 and its efficacy verification

[0332] 1.1 Detection of siRNA sequence activity in the in vitro psiCHECK system using dual-luciferase assay

[0333] Select the following names from Table 1: ANG3-1041M1, ANG3-1041M2, ANG3-1041M3, ANG3-1041M4, ANG3-1041M28, ANG3-1041M29, ANG3-1041M30, ANG3-1041M31, ANG3-1041M32, ANG3-1041M33, ANG3-1041M34, ANG3-1041M35, ANG3-1041M36, ANG3-1041M37, ANG3-1041M38, ANG3-1041M39, ANG3-1041M40, ANG3-1041M41, ANG3- The modified siRNAs ANG3-1045M1, ANG3-1045M2, ANG3-1045M3, ANG3-1045M4, ANG3-1045M28, ANG3-1045M29, ANG3-1045M30, ANG3-1045M31, ANG3-1045M32, ANG3-1045M33, ANG3-1045M35, ANG3-1045M36, ANG3-1045M37, ANG3-1045M38, ANG3-1045M39, and ANG3-1045M40 were used to detect the activity of the siRNA sequences in the in vitro psiCHECK system using a dual-luciferase assay. The specific steps are as follows:

[0334] (1) Constructing plasmids

[0335] Using psiCHECK TM -2(Promega TMConstruct a detection plasmid containing a target sequence that is completely complementary to the antisense strand of the siRNA sequence, i.e., the siRNA target sequence. The target sequence for the siRNA sequence ANG3-1041 is as follows: CAGAGCCAAAATCAAGATTTG (SEQ ID NO: 103, i.e., the target sequence contained in the detection plasmid, hereinafter the same); the target sequence for the siRNA sequence ANG3-1045 is as follows: GCCAAAATCAAGATTTGCTAT (SEQ ID NO: 104). A single copy of the target sequence is cloned into psiCHECK. TM The detection plasmid was obtained by analyzing the Xho I / Not I sites of the -2 plasmid.

[0336] (2) Cell culture and transfection

[0337] The experiment was divided into an experimental group and a control group. The treatment for the experimental group was as follows:

[0338] In a 96-well plate, add 5 μL siRNA, 12.5 μL Opti-MEM containing 20 ng of detection plasmid, 32.5 μL Opti-MEM, and 0.3 μL Lipofectamine 2000 (Invitrogen, catalog number 11668-019) to each well and incubate at room temperature for 15 minutes. Then add 50 μL of a solution containing 1 × 10⁻⁶ nitric acid plasmid to each well of the above mixture. 4 Two 293T cells were cultured in DMEM complete medium (purchased from Transgen Biotech, catalog number FI101-01) at 37°C for 24 h for subsequent dual-luciferase assays. Experimental concentrations were performed at 1 nM and 0.1 nM final siRNA concentrations.

[0339] The control group (also known as the MOCK group) followed the same procedure as the experimental group, except that the siRNA was replaced with an equal volume of water.

[0340] (3) Dual-luciferase detection

[0341] Dilute the 5× lysis buffer from the Dual Luciferase Assay Kit (Promega, catalog number E2940) to 1× lysis buffer with water. Take the cells obtained from step (2), discard the supernatant, dilute and wash each well twice with PBS buffer (Hyclone, catalog number SH30256.01), add 50 μL / well of 1× lysis buffer to each cell plate, and lyse at room temperature for 20 min to obtain lysed cell plates. Take 30 μL / well of lysis buffer from the lysed cell plates and add it to an opaque 96-well assay plate. Take the Dual Luciferase Assay Kit, prepare two substrates according to the instructions, and add the two substrates to a new 96-well plate respectively. Add 30 μL / well of substrate 1 and substrate 2 respectively, and use a multi-mode microplate reader to detect after each addition of substrates to obtain the numerical results of firefly luciferase and Renilla luciferase.

[0342] The luminescence ratio of each well in the ELISA plate was calculated as Renilla / Firefly. The luminescence ratio of each test group or control group was the average of the luminescence ratios of the three culture wells. Using the control group's luminescence ratio as a baseline, the luminescence ratios of each test group were normalized to obtain the ratio R of luminescence ratio (test) / luminescence ratio (control), which represents the expression level of the Renilla reporter gene, i.e., its relative residual activity. The inhibition rate of siRNA was (1-R)×100%.

[0343] The target activity results are shown in the table below (normalized to 0 for the MOCK group inhibition rate).

[0344] Table 1-1. Activity of siRNA sequences in the in vitro psiCHECK system

[0345] 1.2 Off-target activity assay of modified siRNA in the in vitro psiCHECK system

[0346] The off-target activity of the modified siRNA provided in 1.1 was tested in the in vitro psiCHECK system. The specific steps are as follows:

[0347] (1) Constructing plasmids

[0348] Using psiCHECK TM -2(Promega TMConstruct a detection plasmid containing an off-target sequence that is partially complementary to the siRNA sequence. The target sequence for the siRNA sequence ANG3-1041 is as follows: ACTCTAACCCCGAAAGATTTG (SEQ ID NO: 105, the target sequence contained in the detection plasmid, hereinafter the same); the target sequence for the siRNA sequence ANG3-1045 is as follows: TAACCCCGACCTCTTTGCTAT (SEQ ID NO: 106). A single copy of the target sequence is cloned into psiCHECK. TM -2 Xho I / Not I sites of plasmid were used to obtain the detection plasmid;

[0349] The transfection and detection steps were performed according to the method described in Example 2. The transfection concentration was 1 nM. The off-target detection results are shown in the table below (normalized to 0 for the MOCK group inhibition rate).

[0350] Table 1-2 Off-target testing of siRNA sequences in the in vitro psiCHECK system

[0351] 1.3 In vivo experiments with modified siRNA

[0352] Alnylam Pharmaceuticals, Inc. first reported the interfering activity of GalNAc-conjugated siRNA in mice (Nair et al., J. Am. Chem. Soc., 2014, 136, 16958-16961). Literature reports siRNA conjugated to three GalNAc clusters, demonstrating good delivery activity in both in vivo and in vitro experiments. Following the preparation method described in the aforementioned literature, GalNAc was used to conjugate the 3' terminal nucleotide of the positive strand of the modified siRNA, resulting in compounds as shown in formula (34). The obtained GalNAc-conjugated modified siRNAs were named ANG3-1045M1G, ANG3-1045M1GVP, ANG3-1045M38G, and ANG3-1045M38GVP, respectively. Specific information is shown in Table 1 of this invention.

[0353] siRNA source: synthesized by Suzhou Gemma Gene Co., Ltd.;

[0354] Hep3B cells cultured in 10cm dishes were routinely trypsinized 48 hours after passage. The cells were resuspended in complete culture medium and diluted to 3 x 10⁻⁶. 5siRNA was seeded at 50 μL / well in 96-well plates and transfected using Lipofectamine RNAiMAX. Three biological replicates were set up for each siRNA. NC, MOCK, and BLANK were set up as controls. The MOCK group received only interference reagent without any sequence; the BLANK group contained only cells. The transfection concentrations for each sequence were 3 nM, 1 nM, 0.333 nM, 0.111 nM, 0.037 nM, 0.012 nM, 0.004 nM, 0.001 nM, 0.00045 nM, and 0.00015 nM. Forty-eight hours after transfection, the culture medium was removed and cells were collected for RNA extraction. Total RNA was extracted using a magnetic bead-based total RNA extraction kit (Germage-E31008-96) according to the manufacturer's instructions.

[0355] Follow the steps below to perform qPCR to detect the ANGPTL3 gene expression level.

[0356] (1) RNA template preparation

[0357] Genomic DNA removal: Add samples in the order shown in the table below, and gently mix with a pipette. Reaction program: 42°C, 2 min.

[0358] Table 1-3. Genome Removal Reaction System

[0359] (2) Reverse transcription

[0360] Prepare 20 μL of the first-strand cDNA synthesis reaction solution and gently mix with a pipette. Incubate at 50°C for 15 min; then at 85°C for 2 min. After reverse transcription, dilute the cDNA 5-fold for qPCR detection and store at -20°C for later use (or store at 4°C for short-term storage).

[0361] Table 1-4. cDNA Synthesis Reaction System

[0362] (3) RT-qPCR reaction system

[0363] Table 1-5 RT-qPCR Reaction System

[0364] Table 1-6 Primer Sequences

[0365] exist Quantitative real-time PCR was performed. To calculate relative fold changes, the ΔΔCt method was used to analyze the data, and the analysis was standardized for the MOCK group.

[0366] ΔCt(test group) = Ct(target gene in test group) – Ct(internal reference gene in test group)

[0367] ΔCt(control group) = Ct(target gene in control group) – Ct(internal reference gene in control group)

[0368] ΔCt(test group) = ΔCt(test group) - ΔCt(control group average)

[0369] ΔCt(control group) = ΔCt(control group) - ΔCt(control group average)

[0370] Using the control group as a baseline, the expression level of ANGPTL3 mRNA in the test group was normalized, and the expression level of ANGPTL3 mRNA in the control group was defined as 100%.

[0371] The relative expression level of ANGPTL3 mRNA in the test group was 2^(-ΔΔCt) (test group).

[0372] For the same test group siRNA, the average relative expression level of ANGPTL3 mRNA at each concentration is the arithmetic mean of the relative expression levels of the three culture wells at that concentration.

[0373] The inhibition rate of siRNA on ANGPTL3 mRNA expression was calculated using the following equation: Inhibition rate = (1 - relative expression level of ANGPTL3 mRNA in the test group) × 100%.

[0374] The control group in the above formula is the MOCK group.

[0375] The experimental results are as follows:

[0376] Table 1-7. Inhibition rate of siRNA on ANGPTL3 mRNA expression

[0377] Example 2: siRNA inhibiting AGT and its activity detection

[0378] 2.1 Detection of siRNA sequence activity in the in vitro psiCHECK system using dual-luciferase assay

[0379] Select the following names from Table 1: hcAGT-365M1, hcAGT-365M28, hcAGT-365M29, hcAGT-365M31, hcAGT-365M35, hcAGT-365M38, hcAGT-365M41, hcAGT-364M1, hcAGT-364M28, hcAGT-364M29, hcAGT-364M30, hcAGT -364M31, hcAGT-364M32, hcAGT-364M33, hcAGT-364M34, hcAGT-364M36, hcAGT-364M38, hcAG T-364M40, hcAGT-364M41, hcAGT-363M1, hcAGT-363M28, hcAGT-363M38, hcAGT-41M3, hcAGT-4 1M34, hcAGT-41M36, hcAGT-41M37, hcAGT-41M38, hcAGT-41M40, hcAGT-41M28, hcAGT-41M30, hcAGT-41M31, hcAGT-41M32, hcAGT-41M33, hcAGT-173M1, hcAGT-173M28, hcAGT-173M29, hcA The siRNA modified products of GT-173M30, hcAGT-173M33, hcAGT-173M35, hcAGT-173M36, hcAGT-173M37, hcAGT-173M38, hcAGT-173M39, hcAGT-173M40, and hcAGT-173M41 were analyzed using a dual-luciferase assay to detect the activity of the siRNA in the in vitro psiCHECK system. The specific steps are as follows:

[0380] (1) Constructing plasmids

[0381] Using psiCHECK TM -2(Promega TMThe detection plasmid is constructed by means of a plasmid containing a target sequence that is completely complementary to the antisense strand of the siRNA sequence, i.e., the siRNA target sequence. The target sequence for the siRNA sequence hcAGT-32 is as follows: CCATTCCTGTTTGCTGTGTAT (SEQ ID NO: 111); the target sequence for hcAGT-41 is as follows: ACCGACCAGCTTGTTTGTGAA (SEQ ID NO: 112); the target sequence for hcAGT-173 is as follows: CCTCAACTGGATGAAGAAACT (SEQ ID NO: 113); the target sequence for hcAGT-363 is as follows: CACCTTTTCTTCTAATGAGTC (SEQ ID NO: 114); and the target sequence for hcAGT-364 is as follows: GCCGTTTCTCCTTGGTCTAAG (SEQ ID NO: 114). NO:115); The target sequence for the siRNA sequence hcAGT-365 to be tested is as follows: CCGTTTCTCCTTGGTCTAAGT (SEQ ID NO:116); A single copy of the target sequence is cloned into psiCHECK. TM The detection plasmid was obtained by analyzing the Xho I / Not I sites of the -2 plasmid.

[0382] The experimental procedure for dual-luciferase detection was performed according to Example 1, and the experimental results are shown in Table 2-1.

[0383] Table 2-1. Activity of siRNA sequences in the in vitro psiCHECK system

[0384] 2.3 In vivo experiments with modified siRNA

[0385] Referring to the method in 1.3 of Example 1, GalNAc was used to conjugate the 3' terminal nucleotide of the positive strand of the modified siRNA listed in Table 1. The names of the conjugated compounds are: hcAGT-173M38G, hcAGT-32M38G, hcAGT-358M38G, hcAGT-360M38G, hcAGT-363M38G, hcAGT-364M38G, hcAGT-365M38G, hcAGT-389M38G, hcAGT-391M38G, hcAGT-406M38G, and hcAGT-41M38G, which were used for in vivo activity verification.

[0386] The procedure for in vivo screening in animals is as follows:

[0387] GalNAc-conjugated modified siRNA was used: Two to three C57BL / 6J-hAGT humanized mice (purchased from Jicui Pharmaceutical, female or male, 8–10 weeks old) were administered a single subcutaneous dose of 3 mg / kg or 1 mg / kg of GalNAc-conjugated modified siRNA, or a saline control, at a volume of 100 μL per mouse. Mice were sacrificed on day 14 post-administration, liver samples were collected, and liver mRNA was extracted and analyzed using RT-qPCR. The RT-qPCR detection steps are as follows:

[0388] Step 1: RNA extraction

[0389] 1) Take 10-20 mg of mouse liver tissue, place it in RNA protection solution, incubate overnight at 4°C, discard the RNA protection solution, add 1 mL of Trizol Lysis Buffer (purchased from Life Technology, catalog number 410701), and grind the tissue at low temperature to lyse it. After thorough grinding, transfer it to an RNase-free 1.5 mL centrifuge tube; shake vigorously for about 10-15 seconds to fully lyse the tissue cells, and let it stand at room temperature for 3-5 minutes.

[0390] 2) Carefully open the tube cap, add 200 μL of chloroform (purchased from Shanghai Lingfeng Chemical Reagent Co., Ltd., catalog number 20140925); shake vigorously for 15-20 seconds, let stand at room temperature for 2-3 minutes; centrifuge at 12000×g for 20 minutes at 4℃.

[0391] 3) After centrifugation, carefully remove the centrifuge tubes to the centrifuge tube rack, transfer the supernatant to a new 2.0 mL centrifuge tube, add 1.5 times the volume of anhydrous ethanol (purchased from Jiangsu Qiangsheng Functional Chemical Co., Ltd., product number 20210802) to the supernatant, and mix by inverting.

[0392] 4) Take a purification column with a collection tube (purchased from VWI, catalog number 11822AG0627), add 700 μL of the mixture from step 3), let stand for 2 min; centrifuge at 10000×g for 1 min at 4℃, discard the filtrate; repeat the above steps with the remaining mixture.

[0393] 5) Add 700 μL of 80% ethanol to the purification column, centrifuge at 10000×g for 1 min at 4℃, and discard the filtrate;

[0394] 6) Add 700 μL of 80% ethanol to the purification column, centrifuge at 10000×g for 1 min at 4℃, and discard the filtrate;

[0395] 7) Centrifuge the purification column at 4℃, 10000×g for 2 min (empty).

[0396] 8) After centrifugation, carefully remove the purification column with the collection tube (if there is liquid in the collection tube, please be careful not to splash the liquid onto the purification column), discard the collection tube, put the purification column into a new 1.5mL centrifuge tube, add 100μL of DEPC water to the purification column, let it stand at room temperature for 2min; centrifuge at 10000×g for 1min at 4℃.

[0397] 9) RNA can be temporarily stored at 4°C and used for qPCR experiments within one day. (For long-term storage, it should be stored at -80°C).

[0398] Step 2: qPCR experiment

[0399] The primer and probe sequence listing is as follows:

[0400] Table 2-2, qPCR primer sequences

[0401] In Table 2-2, probe AGT-P is a DNA probe with a 6-HEX modification at position 1 of its 5' end (a modified nucleotide comprising 6-HEX).

[0402] mGAPDH-P is a DNA probe with a 5'FAM (5-Carboxyfluorescein) modification at position 1A at its 5' end. qPCR: Prepare the qPCR reaction system in a 384-well plate according to the table below.

[0403] Table 2-3, qPCR reaction system

[0404] exist A real-time PCR reaction was performed. The expression level of the AGT gene was compared with that of the internal reference gene GAPDH, and the value was normalized to the mean of the saline control group. The data are expressed as a percentage relative to the saline control group. The results are shown in Figures 1 and 2.

[0405] Example 3: Activity of siRNA Modifiers in the In Vitro PsiCHECK System

[0406] 3.1 Detection of the activity of modified siRNA in the in vitro psiCHECK system using a dual-luciferase assay.

[0407] The activity of modified siRNAs AD-85481, AD85481L23M1, AD85481L23M24, AD85481L23M25, AD85481L23M26, AD85481L23M27, AD85481L23M28, AD85481L23M30, AD85481L23M31, AD85481L23M32, AD85481L23M33, or AD85481L23M34 in the in vitro psiCHECK system was detected using a dual-luciferase assay. The specific detection steps are as follows:

[0408] (1) Constructing plasmids

[0409] Using psiCHECK TM -2(Promega TM Construct a detection plasmid containing a target sequence that is completely complementary to the antisense strand of the siRNA sequence, i.e., the siRNA target sequence. The target sequence for the siRNA sequence AD85481 and its variants is as follows: TCGTCATCCACAATGAGAGTACC (SEQ ID NO. 123, i.e., the target sequence contained in the detection plasmid). A single copy of the target sequence is cloned into psiCHECK. TM The detection plasmid was obtained by analyzing the Xho I / Not I sites of the -2 plasmid.

[0410] The experimental procedures are the same as in Example 1, except that the experimental concentrations were 3.0000 nM, 1.0000 nM, 0.3333 nM, 0.1111 nM, 0.0370 nM, 0.0123 nM, 0.0041 nM, 0.0014 nM and 0.0005 nM of final siRNA concentration.

[0411] Using the log value of siRNA concentration as the X-axis and the percentage inhibition rate as the Y-axis, the dose-response curve was fitted using the "log (inhibitor) vs. response – variable slope" function module of the analysis software GraphPadPrism 8 to obtain the IC50 of each siRNA. 50 value.

[0412] The fitting formula is: Y = Bottom + (Top – Bottom) / (1 + 10^(LogIC)) 50 –X)×HillSlope))

[0413] Where: Top represents the percentage inhibition rate at the top plateau, and the standard for the Top of the curve is generally between 80% and 120%; Bottom represents the percentage inhibition rate at the bottom plateau, and the Bottom of the curve is generally between -20% and 20%; HillSlope represents the slope of the percentage inhibition rate curve.

[0414] The experimental results are shown in Table 3-1. The siRNA of this invention has a low IC50 value. 50 .

[0415] 3-1. Activity of siRNA sequences in the in vitro psiCHECK system (IC50) 50 )

[0416] 3.2 Detection of siRNA activity in cells

[0417] This example uses Hep3B cells transfected with siRNA to detect the in vitro activity of modified siRNAs named AD-85481-19M46, AD-85481-19M47, AD-85481-19M48, AD-85481, hcAGT-365L23M27, hcAGT-365L23M28, hcAGT-365L23M29, hcAGT-365L23M30, hcAGT-365L23M31, hcAGT-383L23M24, hcAGT-383L23M29, and hcAGT-383L23M31. The experimental method is described in Section 1.1 of Example 1. The control group was MOCK. The final siRNA transfection concentration was 0.1 nM. The qPCR primer and probe sequences are shown in the table below.

[0418] Table 3-2, qPCR primer and probe sequences

[0419] In Table 3-2, AGT-P is a DNA probe with a 6-HEX modification at position 1 of its 5' end (a modified nucleotide comprising 6-HEX).

[0420] hGAPDH-P is a DNA probe with a 5'FAM (5-Carboxyfluorescein) modification at position 1 of its 5' end.

[0421] The experimental results are shown in Table 3-3.

[0422] Table 3-3. Relative expression levels of AGT mRNA

[0423] 3.4 In vivo experiments with modified siRNA

[0424] Following the method described in 1.4, GalNAc was used to conjugate the modified siRNA described in 3.1. The names of the GalNAc-conjugated modified siRNAs obtained are: AD-85481G, AD85481L23M1G, AD85481L23M25G, AD85481L23M26G, AD85481L23M27G, AD85481L23M28G, AD85481L23M31G, and AD85481L23M33G. Their specific information is shown in Table 1.

[0425] Three to four C57BL / 6J-hAGT humanized mice (purchased from Jicui Pharmaceutical, female, 8–10 weeks old) were administered a single subcutaneous dose of 1 mg / kg GalNAc-conjugated siRNA or a saline control, with a drug volume of 100 μL per mouse. Mice were sacrificed on day 14 post-administration, and liver samples were collected. Liver mRNA was extracted following the steps in Example 2, section 2.3 and analyzed by RT-qPCR, following the steps in Example 2. The RT-qPCR detection steps are as follows:

[0426] The results are shown in Figure 3. After a single dose of 1 mg / kg was administered to mice for 14 days, it showed a good inhibitory effect on AGT gene expression.

[0427] Example 4: Activity of modified siRNA in in vitro cell lines

[0428] This example provides modified siRNAs named AD-85481, AD-85481-19M46, AD-85481-19M47, AD-85481-19M48, hcAGT-41M45, hcAGT-41M47, hcAGT-41M48, hcAGT-360M45, hcAGT-360M46, hcAGT-360M47, hcAGT-360M48, hcAGT-363M45, hcAGT-363M46, hcAGT-363M47, and hcAGT-363M48 from Table 1 for activity detection.

[0429] In this embodiment, Hep3B cells were transfected with siRNA for in vitro activity testing. The experimental method is described in Example 4. The final siRNA transfection concentration was 0.1 nM. 48 h after transfection, qPCR was performed to detect the AGT gene expression level according to the primer and probe sequences in 3.2 of Example 3.

[0430] The experimental results are shown in Table 4.

[0431] Table 4. Relative expression levels of AGT mRNA

[0432] Example 5: Comparison of in vivo experiments with modified siRNA

[0433] 5.1 Comparison of in vivo experiments of modified siRNAs targeting ANGPTL3 mRNA

[0434] Following the method described in Example 1.3, GalNAc was used to conjugate the 3' terminal nucleotide of the positive strand of the modified siRNA. The resulting compound has the structural formula shown in Formula (34). The modified siRNAs conjugated with GalNAc were named as follows: ANG3-1041L23M27G, ANG3-1041L23M31G, ANG3-1041L23M34G, ANG3-1041M28G, ANG3-1041M38G, ANG3-1041M45G, ANG3-1045L21AM4G, ANG3-1045L23M24G, ANG3-1045L23M34G, ANG3-1045M38G, and ANG3-1045M45G. Their specific sequences are shown in Table 1.

[0435] In vivo validation was performed according to the method in 1.3. The test mice were replaced with C57BL / 6J mice (female, 6-8 weeks old, purchased from Jicui Yaokang). The dosage of GalNAc-conjugated modified siRNA was 3 mg / kg. The primer and probe sequences for detecting the relative expression level of ANGPTL3 mRNA are shown in the table below:

[0436] Table 5. Primer and probe sequences

[0437] In Table 5, mGAPDH-P is a DNA probe with 5'FAM (5-Carboxyfluorescein) modification at position 1A of its 5' end.

[0438] The probe mANGPTL3-P is a DNA probe with a 6-HEX modification at position 1 of its 5' end (a modified nucleotide comprising 6-HEX).

[0439] Mice were sacrificed on day 28 after drug administration, and liver samples were collected. ANGPTL3 expression levels were detected following the steps outlined in Example 1.3.

[0440] The results are shown in Figure 4. The results indicate that the in vivo data of siRNA modified by the modification method provided by the present invention has unexpected technical effects compared with the closest existing technology.

[0441] 5.2 Comparison of in vivo experiments of modified siRNA targeting AGT mRNA

[0442] Following the method described in Example 1.3, GalNAc was used to conjugate the 3' terminal nucleotide of the positive strand of the modified siRNA. The resulting compound has the structural formula shown in Formula (34). The modified siRNAs conjugated with GalNAc were named as follows: hcAGT-173L21AM4G, hcAGT-173L23M27G, hcAGT-173M28G, hcAGT-173M38G, hcAGT-173M45G, hcAGT-173M50G, hcAGT-358L23M24G, hcAGT-358L23M31G, hcAGT-358M38G, hcAGT-358M5 The specific sequences of hcAGT-363L21AM4G, hcAGT-363L23M27G, hcAGT-363M28G, hcAGT-363M38G, hcAGT-363M45G, hcAGT-363M50G, hcAGT-41L23M24G, hcAGT-41L23M31G, hcAGT-41L23M35G, hcAGT-41M38G, and hcAGT-41M48G are shown in Table 1.

[0443] The obtained GalNAc-conjugated modified siRNA was used to verify the in vivo siRNA efficacy according to the method described in Example 5.1, except that the dosage of GalNAc-conjugated modified siRNA was 3 mg / kg. Mice were sacrificed on day 21 after administration, liver samples were collected, and AGT expression levels were detected according to the steps in Example 5.1.

[0444] The results are shown in Figure 5. The results indicate that the in vivo data of siRNA modified by the modification method provided by the present invention has unexpected technical effects compared with the closest existing technology.

[0445] Example 6: Modified siRNA for inhibiting MUC5AC and its activity detection

[0446] Select the following names from Table 1: MUC5AC-20CAM1, MUC5AC-28CAM1, MUC5AC-29CAM1, MUC5AC-39CAM1, MUC5AC-40CAM1, MUC5AC-42CAM1, MUC5AC-49CAM1, MUC5AC-69CAM1, MUC5AC-78CAM1, MUC5AC-87CAM1, MUC5AC-90CAM1, MUC5AC-103CAM1, MUC5AC-125CAM1, MUC5AC-138CAM1, MUC5AC-182CAM1, MUC5AC-20CAM2, MUC5AC-28CAM2, MUC5AC-29CAM2, MUC5AC-39CAM2, MUC5AC-40CAM2, MUC5AC-42CAM2, and MUC5AC-49CAM2. 2. The relative inhibitory levels of MUC5AC mRNA by siRNA modifiers of MUC5AC-69CAM2, MUC5AC-78CAM2, MUC5AC-87CAM2, MUC5AC-90CAM2, MUC5AC-103CAM2, MUC5AC-120CAM2, MUC5AC-125CAM2, MUC5AC-138CAM2, MUC5AC-182CAM2, and MUC5AC-185CAM2 on MUC5AC mRNA were determined in A549 cells.

[0447] The experimental procedure is as follows:

[0448] A549 cells were cultured in F12K complete medium (Hyclone) containing 10% fetal bovine serum (FBS, Hyclone) and 0.2% penicillin-streptomycin (Gibco, Invitrogen). The cultured cells were then diluted to 5.55 × 10⁻⁶ cells in F-12K complete medium. 4 siRNA was seeded at 90 μL / well in 96-well plates. Lipofectamine RNAiMAX was used to transfect siRNA, with three biological replicates per siRNA. A MOCK control group was also included, containing only interference reagent and no additional sequence. Transfection concentrations for each sequence were 10 nM, 1 nM, and 0.1 nM. Forty-eight hours post-transfection, the culture medium was removed, and cells were collected for RNA extraction. Total RNA was extracted using a magnetic bead-based total RNA extraction kit (Germage Gene-E31008-96) according to the manufacturer's instructions.

[0449] The experimental procedure was performed using HiScript III RT SuperMix for qPCR (purchased from Novizan, catalog number R323-01) following the product instructions. A 20 μL reverse transcription reaction system was prepared according to the reverse transcription procedure in the kit instructions to reverse transcribe total RNA from cells. The reverse transcription conditions were as follows: the reverse transcription reaction system was incubated at 37°C for 15 min, then at 85°C for 5 s. 80 μL of DEPC water was added to each reverse transcription reaction system to obtain a solution containing cDNA.

[0450] For each reverse transcription reaction system, take 4 μL of the above-mentioned cDNA-containing solution as a template. Using the reagents provided in the AceQ Universal SYBR qPCR Master Mix kit (purchased from Vazyme, catalog number Q511-02), prepare a 20 μL qPCR reaction system on an ice box according to Table 6-1. Primer 1 and Primer 2 are the PCR primer sequences for amplifying the target gene MUC5AC and the internal reference gene GAPDH, respectively (as shown in Table 6-2). Place each qPCR reaction system in an ABIStepOnePlus Real-Time... On a PCR instrument, a three-step amplification method was used. The amplification program was 95℃ pre-denaturation for 10 min, followed by 95℃ denaturation for 30 s, 60℃ annealing for 30 s, and 72℃ extension for 30 s. This denaturation, annealing, and extension process was repeated 40 times to obtain product W containing the amplified target gene MUC5AC and the internal reference gene GAPDH. Product W was then incubated sequentially at 95℃ for 15 s, 60℃ for 1 min, and 95℃ for 15 s. The melting curves of the target gene MUC5AC and the internal reference gene GAPDH in product W were collected by a real-time quantitative PCR instrument to obtain the Ct values ​​of the target gene MUC5AC and the internal reference gene GAPDH.

[0451] Table 6-1. RNA Amplification Reaction System

[0452] Table 6-2 Primer Information

[0453] The relative quantification of the target gene MUC5AC in each test group was performed using the Ct(ΔΔCt) method.

[0454] The MUC5AC mRNA level was compared with the internal reference gene GAPDH, and the value was normalized to the mean of the saline control group. The data were expressed as a percentage relative to the MOCK control group and presented as the mean plus standard deviation.

[0455] The activity results of the modified siRNA in A549 cells are shown in Tables 6-3 and 6-4.

[0456] Table 6-3 Results of transfection experiments at 10 nM, 1 nM, and 0.1 nM

[0457] Table 6-4 Results of transfection experiments at 10 nM, 1 nM, and 0.1 nM

[0458] Example 7: The present invention provides siRNA modification methods for verifying the siRNA effects on different target sites.

[0459] Referring to the method in 1.3 of Example 1, GalNAc was used to conjugate the 3' terminal nucleotide of the positive strand of the modified siRNA. The names of the compounds obtained by conjugation are: PKK-74M38G, PKK-80M38G, PKK-110M38G, hC3_1164AM4, hC3_3298AM4, hC3_445AM4, hC3_448AM4, hC3-445AM1G, hC3-445AM3G, and hC3-445L23M24G. The specific modification types and sequences are shown in Table 1.

[0460] The modified siRNAs conjugated with GalNAc (PKK-74M38G, PKK-80M38G, and PKK-110M38G) were used for in vivo siRNA interference verification according to the method in 1.3, with the following differences: the corresponding test mice were hKLKB1 transgenic female mice (6-8 weeks old, provided by Suzhou Gemma Gene Co., Ltd.); the dosage of GalNAc-conjugated modified siRNAs was 3 mg / kg; the mice were sacrificed on day 14 after administration, liver samples were collected, and the KLKB1 expression level was detected according to the method in Example 6. The primer sequences for detecting the relative expression level of the KLKB1 gene are shown in the table below.

[0461] Table 7-1 Primer sequences for detecting the relative expression level of the KLKB1 gene

[0462] GalNAc-conjugated modified siRNAs with the names hC3_1164AM4, hC3_3298AM4, hC3_445AM4, hC3_448AM4, hC3-445AM1G, hC3-445AM3G, and hC3-445L23M24G were used for in vivo siRNA interference verification according to the method in 1.3. The differences are as follows: the corresponding test mice were C57BL / 6J mice (female, 6-8 weeks old, from Jicui Yaokang); the dosage of GalNAc-conjugated modified siRNAs was 3 mg / kg; the mice were sacrificed on day 14 after administration, liver samples were collected, and the relative expression level of the C3 gene was detected according to the method in Example 6. The primer sequences for detecting the relative expression level of the C3 gene are as follows:

[0463] Table 7-2 Primer sequences for detecting the relative expression level of the C3 gene

[0464] The results are shown in Figures 6 to 8. The results indicate that the modification method provided by this invention achieved ideal interference effects against siRNAs targeting different sites. This demonstrates that the siRNA modification method provided by this invention is not limited to specific siRNA targets.

[0465] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, any changes, uses, or improvements to the invention are intended to include, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Industrial applicability

[0466] The siRNA modification method provided by this invention has broad applicability across different targets and exhibits unexpected technical effects compared to existing technologies in improving siRNA stability, specificity, reducing immunogenicity, and achieving efficient delivery. It is expected to play a role in the diagnosis and treatment of siRNA-related diseases and has significant industrialization potential and promotional value.

Claims

1. A double-stranded RNA molecule, said double-stranded RNA molecule comprising a sense strand and an antisense strand that at least partially form a double-stranded region, characterized in that, The antisense strand is no more than 30 bp in length, and each nucleotide of the antisense strand is independently modified or unmodified. Starting from the 5' end of the antisense strand, positions 2-8 of the antisense strand contain at least two thermally destabilized nucleotides. Starting from the 5' end of the antisense strand, positions 14 and 16 of the antisense strand are 2'-fluorinated nucleotides, and the antisense strand contains at least seven 2'-fluorinated nucleotides.

2. The double-stranded RNA molecule as described in claim 1, characterized in that, Starting from the 5' end of the antisense strand, the second nucleotide of the antisense strand is a 2'-fluorinated nucleotide.

3. The double-stranded RNA molecule as described in claim 1, characterized in that, Starting from the 5' end of the antisense strand, the nucleotides at positions 2 and 18 of the antisense strand are nucleotides modified with 2'-fluorination.

4. The double-stranded RNA molecule as described in claim 1, characterized in that, Starting from the 5' end of the antisense strand, the nucleotides at positions 2, 10, and 18 of the antisense strand are nucleotides modified with 2'-fluorine.

5. The double-stranded RNA molecule as described in claim 1, characterized in that, Starting from the 5' end of the antisense strand, the nucleotides at positions 2, 10, 12, and 18 of the antisense strand are 2'-fluorinated nucleotides, or the nucleotides at positions 2, 10, 12, 18, and 20 of the antisense strand are 2'-fluorinated nucleotides.

6. The double-stranded RNA molecule as described in claim 1, characterized in that, Starting from the 5' end of the antisense strand, the nucleotides at positions 2, 4, 8, 10, and 18 of the antisense strand are 2'-fluorinated nucleotides, or the nucleotides at positions 2, 6, 8, 10, and 18 of the antisense strand are 2'-fluorinated nucleotides, or the nucleotides at positions 2, 8, 10, 12, and 18 of the antisense strand are 2'-fluorinated nucleotides.

7. The double-stranded RNA molecule according to any one of claims 1, characterized in that, The thermal destabilization modification is selected from 2′-deoxynucleotides, open-ring nucleotides (UNA), ethylene glycol nucleotides (GNA), and inosine nucleotides.

8. The double-stranded RNA molecule as described in claim 1, characterized in that, The double-stranded RNA molecule contains at least one thermal destabilization modification.

9. The double-stranded RNA molecule as described in claim 8, characterized in that, The double-stranded RNA molecule contains two thermal destabilization modifications.

10. The double-stranded RNA molecule as described in claim 9, characterized in that, The two thermal destabilization modifications are 2′-deoxynucleotide modification and ethylene glycol nucleotide (GNA) modification.

11. The double-stranded RNA molecule according to any one of claims 7 to 10, characterized in that, The thermal destabilization modification is located at at least one of the positions 4, 5, 6, 7, or 8, counting from the 5' end of the antisense chain.

12. The double-stranded RNA molecule as described in claim 11, characterized in that, The antisense strand of the double-stranded RNA molecule contains at least seven 2'-fluorinated nucleotides.

13. The double-stranded RNA molecule according to any one of claims 1 to 12, characterized in that, It also includes linking the nucleotides in the antisense strand via thiophosphate groups.

14. The double-stranded RNA molecule as described in claim 13, characterized in that, Starting from the 5' end of the antisense strand, the nucleotides at positions 1 and 2, and positions 2 and 3 of the antisense strand are linked by thiophosphate groups.

15. The double-stranded RNA molecule according to claim 13, characterized in that, The antisense strand of the double-stranded RNA molecule has its 5' and / or 3' ends connected at positions 1 and 2, and positions 2 and 3, by thiophosphate groups.

16. The double-stranded RNA molecule according to claim 1, characterized in that, The justice chain has an invAb attached to its 5' end and / or 3' end.

17. The double-stranded RNA molecule according to claim 1, characterized in that, The 5' end of the antisense chain contains a VP modification.

18. The double-stranded RNA molecule according to claim 16 or 17, characterized in that, The justice chain includes a thermal destabilization modification.

19. The double-stranded RNA molecule as described in claim 1, characterized in that, The sense and antisense strands of the double-stranded RNA molecule are complementary to form the double-stranded region of the siRNA, the 3' end of the sense strand forms a blunt end, and the 3' end of the antisense strand has 1-3 protruding nucleotides extending out of the double-stranded region. Alternatively, the sense and antisense strands of the double-stranded RNA molecule are complementary to form the double-stranded region of the siRNA, the 5' end of the sense strand forms a blunt end, and the 5' end of the antisense strand has 1-3 protruding nucleotides extending out of the double-stranded region. Alternatively, the sense and antisense strands of the double-stranded RNA molecule are complementary to form the double-stranded region of the siRNA, with the 3' end of the sense strand forming a blunt end and the 3' end of the antisense strand forming a blunt end; Alternatively, the sense and antisense strands of the double-stranded RNA molecule are complementary to form the double-stranded region of the siRNA, and the 5' and 3' ends of the sense strand have 1-3 protruding nucleotides extending out of the double-stranded region.

20. The double-stranded RNA molecule as claimed in claim 1, characterized in that, The modification of the double-stranded RNA molecule includes at least one of the following modifications: M35 to M41, M48, AM4, AM1, and L23M25 to L23M30: The justice chain of the modification shown in M35 includes the structure shown in a1), and the antisense chain includes the structure shown in b1). a1)NmsNmsNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNmNm; b1)NmsNfsNmNfN(d)NmN(d)NfNmNfNmNmNmNfNmNfNmNfNmsNmsNm; The justice chain of the modification shown in M36 includes the structure shown in a2), and the antisense chain includes the structure shown in b2). a2)NmsNmsNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNmNm; b2)NmsNfsNmNmN(d)NfN(d)NfNmNfNmNmNmNfNmNfNmNfNmsNmsNm; The justice chain of the modification shown in M37 includes the structure shown in a3), and the antisense chain includes the structure shown in b3). a3)NmsNmsNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNmNm; b3)NmsNfsNmNmN(d)NmN(d)NfNmNfNmNfNmNfNmNfNmNfNmsNmsNm; The justice chain of the modification shown in M38 includes the structure shown in a4), and the antisense chain includes the structure shown in b4). a4)NmsNmsNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNmNm; b4)NmsNfsNmNmN(d)NmN(d)NmNmNfNmNfNmNfNmNfNmNfNmsNfsNm; The justice chain of the modification shown in M39 includes the structure shown in a5), and the antisense chain includes the structure shown in b5). a5)NmsNmsNmNmNmNmN(d)NfN(d)NmNmNmNmNmNmNmNmNmNmNm; b5)NmsNfsNmNmN(d)NmN(d)NfNmNfNmNfNmNfNmNfNmNfNmsNmsNm; The justice chain of the modification shown in M40 includes the structure shown in a6), and the antisense chain includes the structure shown in b6). a6)NmsNmsNmNmNmNmN(d)NfN(d)NmNmNmNmNmNmNmNmNmNmNm; b6)NmsNfsNmNmN(d)NmN(d)NmNmNfNmNfNmNfNmNfNmNfNmsNfsNm; The justice chain of the modification shown in M41 includes the structure shown in a7), and the antisense chain includes the structure shown in b7). a7)NmsNmsNmNmNmNmN(d)NfN(d)NmNmNmNmNmNmNmNmNmNmNm; b7)NmsNfsNmN(d)NmNmN(d)NmNmNfNmNfNmNfNmNfNmNfNmsNfsNm; The justice chain of the modification shown in M48 includes the structure shown in a8), and the antisense chain includes the structure shown in b8). a8)NmsNmsNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNmNm; b8)NmsNfsNmNmN(d)NmN(GNA)NmNmNfNmNfNmNfNmNfNmNfNmsNfsNm; The justice chain of the modification method shown in AM4 includes the structure shown in a9), and the antisense chain includes the structure shown in b9). a9)(invAb)sNmNmNmNmNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNmNms(invAb); b9)NmsNfsNmNmN(d)NmN(GNA)NmNmNfNmNfNmNfNmNfNmNfNmsNfsNm; The justice chain of the modification shown in AM1 includes the structure shown in a10), and the antisense chain includes the structure shown in b10. a10)(invAb)sNmNmNmNmNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNmNms(invAb); b10)NmsNfsNmNmN(d)NmN(d)NmNmNfNmNfNmNfNmNfNmNfNmsNfsNm; The justice chain of the modification shown in L23M25 includes the structure shown in a11), and the antisense chain includes the structure shown in b11). a11)NmsNmsNmNmNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNm; b11)NmsNfsNmNmN(d)NfN(d)NfNmNfNmNmNmNfNmNfNmNfNmNmNmsNmsNm; The justice chain of the modification shown in L23M26 includes the structure shown in a12), and the antisense chain includes the structure shown in b12). a12)NmsNmsNmNmNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNm b12)NmsNfsNmNmN(d)NmN(d)NfNmNfNmNfNmNfNmNfNmNfNmNmNmsNmsNm The justice chain of the modification shown in L23M27 includes the structure shown in a13), and the antisense chain includes the structure shown in b13). a13)NmsNmsNmNmNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNm; b13)NmsNfsNmNmN(d)NmN(d)NmNmNfNmNfNmNfNmNfNmNfNmNfNmsNmsNm; The justice chain of the modification shown in L23M28 includes the structure shown in a14), and the antisense chain includes the structure shown in b14). a14)NmsNmsNmNmNmNmNmNmNmNfN(d)NfNmNmNmNmNmNmNmNmNmNmNm; b14)NmsNfsNmNmN(d)NfN(d)NfNmNfNmNmNmNfNmNfNmNfNmNmNmsNmsNm; The justice chain of the modification shown in L23M29 includes the structure shown in a15), and the antisense chain includes the structure shown in b15. a15)NmsNmsNmNmNmNmNmNmNmNfN(d)NfNmNmNmNmNmNmNmNmNmNmNm; b15)NmsNfsNmNmN(d)NmN(d)NfNmNfNmNfNmNfNmNfNmNfNmNmNmsNmsNm; The justice chain of the modification shown in L23M30 includes the structure shown in a16), and the antisense chain includes the structure shown in b16). a16)NmsNmsNmNmNmNmNmNmNmNfN(d)NfNmNmNmNmNmNmNmNmNmNmNm; b16)NmsNfsNmNmN(d)NmN(d)NmNmNfNmNfNmNfNmNfNmNfNmNfNmsNmsNm; The modifications shown in M35 to M41, M48, AM4, AM1, L23M25 to L23M30 are all represented in 5'-3' order, where Nm is selected from any one of Am, Um, Cm and Gm, Am represents 2'-methoxyadenosine-3'-phosphate, Um represents 2'-methoxyuridine-3'-phosphate, Cm represents 2'-methoxycytidine-3'-phosphate, and Gm represents 2'-methoxyguanosine-3'-phosphate; Nf is selected from any one of Af, Uf, Cf and Gf, where Af represents 2'-fluoroadenosine-3'-phosphate, Uf represents 2'-fluorouridine-3'-phosphate, Cf represents 2'-fluorocytidine-3'-phosphate, and Gf represents 2'-fluoroguanosine-3'-phosphate. N(d) is selected from any one of A(d), T(d), C(d) and G(d), where A(d) represents 2'-deoxyadenosine-3'-phosphate, T(d) represents 2'-deoxythymidine-3'-phosphate, C(d) represents 2'-deoxycytidine-3'-phosphate, and G(d) represents 2'-deoxyguanosine-3'-phosphate. N(GNA) is selected from any one of A(GNA), T(GNA), C(GNA) and G(GNA), where A(GNA) represents the S-isomer of adenosine-ethylene glycol nucleic acid (GNA) or adenosine-ethylene glycol nucleic acid (GNA), T(GNA) represents the S-isomer of thymidine-ethylene glycol nucleic acid (GNA) or thymidine-ethylene glycol nucleic acid (GNA), C(GNA) represents the S-isomer of cytidine-ethylene glycol nucleic acid (GNA) or cytidine-ethylene glycol nucleic acid (GNA), and C(GNA) represents the S-isomer of guanosine-ethylene glycol nucleic acid (GNA) or guanosine-ethylene glycol nucleic acid (GNA); Nms is selected from any one of Ams, Ums, Cms and Gms, where Ams represents 2'-methoxyadenosine-3'-thiophosphate, Ums represents 2'-methoxyuridine-3'-thiophosphate, Cms represents 2'-methoxycytidine-3'-thiophosphate, and Gms represents 2'-methoxyguanosine-3'-thiophosphate. Nfs is selected from any one of Afs, Ufs, Cfs and Gfs, where Afs represents 2'-fluoroadenosine-3'-thiophosphate, Ufs represents 2'-fluorouridine-3'-thiophosphate, Cfs represents 2'-fluorocytidine-3'-thiophosphate, and Gfs represents 2'-fluoroguanosine-3'-thiophosphate. (invAb) indicates a reverse abase-free nucleotide.

21. The double-stranded RNA molecule according to any one of claims 1 to 20, characterized in that, The positive strand of the double-stranded RNA molecule is coupled with a ligand.

22. The double-stranded RNA molecule as described in claim 21, characterized in that, The ligand is one or more GalNAcs attached using divalent or trivalent branched bonds.

23. A modified double-stranded RNA molecule, characterized in that, The general formula of the double-stranded RNA molecule includes: sense strand: NmsNmsNmNmNmNmNfNfNmNmNmNmNmNmNmNmNmNm; antisense strand: NmsNfsNmNmN(d)NmN(d)NmNmNfNmNfNmNfNmNfNmNmNfNmsNfsNm; Nm is selected from any one of Am, Um, Cm and Gm, where Am represents 2'-methoxyadenosine-3'-phosphate, Um represents 2'-methoxyuridine-3'-phosphate, Cm represents 2'-methoxycytidine-3'-phosphate, and Gm represents 2'-methoxyguanosine-3'-phosphate. Nf is selected from any one of Af, Uf, Cf and Gf, where Af represents 2'-fluoroadenosine-3'-phosphate, Uf represents 2'-fluorouridine-3'-phosphate, Cf represents 2'-fluorocytidine-3'-phosphate, and Gf represents 2'-fluoroguanosine-3'-phosphate. N(d) is selected from any one of A(d), T(d), C(d) and G(d), where A(d) represents 2'-deoxyadenosine-3'-phosphate, T(d) represents 2'-deoxythymidine-3'-phosphate, C(d) represents 2'-deoxycytidine-3'-phosphate, and G(d) represents 2'-deoxyguanosine-3'-phosphate. Nms is selected from any one of Ams, Ums, Cms and Gms, where Ams represents 2'-methoxyadenosine-3'-thiophosphate, Ums represents 2'-methoxyuridine-3'-thiophosphate, Cms represents 2'-methoxycytidine-3'-thiophosphate, and Gms represents 2'-methoxyguanosine-3'-thiophosphate. Nfs is selected from any one of Afs, Ufs, Cfs and Gfs, where Afs represents 2'-fluoroadenosine-3'-thiophosphate, Uf represents 2'-fluorouridine-3'-phosphate, Cfs represents 2'-fluorocytidine-3'-thiophosphate, and Gfs represents 2'-fluoroguanosine-3'-thiophosphate.

24. The double-stranded RNA molecule according to claim 23, characterized in that, The double-stranded RNA molecule is selected from at least one of the modified double-stranded RNA molecules with the names shown below: hcAGT-173M38G, hcAGT-32M38G, hcAGT-358M38G, hcAGT-360M38G, hcAGT-363M38G, hcAGT-364M38G, hcAGT-365M38G, hcAGT-389M38G, hcAGT-391M38G, hcAGT-406M38G, hcAGT-41M38G, or ANG3-1045M38G; (1) The sequences of the sense and antisense chains of the hcAGT-173M38G are as follows: UmsCmsAmAmCmUmGfGfAfUmGmAmAmGmAmAmAmCmUm-GalNAc and AmsGfsUmUmT(d)CmT(d)UmCmAfUmCfCmAfGmUfUmGfAmsGfsGm; (2) The sequences of the sense and antisense chains of the hcAGT-32M38G are as follows: AmsUmsUmCmCmUmGfUfUfUmGmCmUmGmUmGmUmAmUm-GalNAc and AmsUfsAmCmA(d)CmA(d)GmCmAfAmAfCmAfGmGfAmAfUmsGfsGm; (3) The sequences of the sense and antisense chains of the hcAGT-358M38G are as follows: UmsCmsCmCmAmCmCfUfUfUmUmCmUmUmCmUmAmAmUm-GalNAc and AmsUfsUmAmG(d)AmA(d)GmAmAfAmAfGmGfUmGfGmGfAmsGfsAm; (4) The sequences of the sense chain and antisense chain of the hcAGT-360M38G are as follows: CmsCmsAmCmCmUmUfUfUfCmUmUmCmUmAmAmUmGmAm-GalNAc and UmsCfsAmUmT(d)AmG(d)AmAmGfAmAfAmAfGmGfUmGfGmsGfsAm; (5) The sequences of the sense and antisense chains of the hcAGT-363M38G are as follows: CmsCmsUmUmUmUmCfUfUfCmUmAmAmUmGmAmGmUmCm-GalNAc and GmsAfsCmUmC(d)AmT(d)UmAmGfAmAfGmAfAmAfAmGfGmsUfsGm; (6) The sequences of the sense and antisense chains of the hcAGT-364M38G are as follows: CmsGmsUmUmUmCmUfCfCfUmUmGmGmUmCmUmAmAmGm-GalNAc and CmsUfsUmAmG(d)AmC(d)CmAmAfGmGfAmGfAmAfAmCfGmsGfsCm; (7) The sequences of the sense and antisense chains of the hcAGT-365M38G are as follows: GmsUmsUmUmCmUmCfCfUfUmGmGmUmCmUmAmAmGmUm-GalNAc and AmsCfsUmUmA(d)GmA(d)CmCmAfAmGfGmAfGmAfAmAfCmsGfsGm; (8) The sequences of the sense chain and antisense chain of hcAGT-389M38G are as follows: AmsGmsUmGmUmUmCfCfCfUmUmUmUmCmAmAmGmUmUm-GalNAc276 and AmsAfsCmUmT(d)GmA(d)AmAmAfGmGfGmAfAmCfAmCfUmsUfsUm; (9) The sequences of the sense and antisense chains of the hcAGT-391M38G are as follows: UmsGmsUmUmCmCmCfUfUfUmUmCmAmAmGmUmUmGmAm-GalNAc and UmsCfsAmAmC(d)UmT(d)GmAmAfAmAfGmGfGmAfAmCfAmsCfsUm; (10) The sequences of the sense and antisense chains of the hcAGT-406M38G are as follows: UmsGmsAmGmAmAmCfAfAfAmAmAmUmUmGmGmGmUmUm-GalNAc and AmsAfsCmCmC(d)AmA(d)UmUmUfUmUfGmUfUmCfUmCfAmsAfsCm; (11) The sequences of the sense and antisense chains of the hcAGT-41M38G are as follows: CmsGmsAmCmCmAmGfCfUfUmGmUmUmUmGmUmGmAmAm-GalNAc and UmsUfsCmAmC(d)AmA(d)AmCmAfAmGfCmUfGmGfUmCfGmsGfsUm; (12) The sequences of the sense and antisense chains of ANG3-1045M38G are as follows: CmsAmsAmAmAmUmCfAfAfGmAmUmUmUmGmCmUmAmUm-GalNAc and AmsUfsAmGmC(d)AmA(d)AmUmCfUmUfGmAfUmUfUmUfGmsGfsCm; In (1)-(12) above, A represents adenosine-3'-phosphate, Af represents 2'-fluoroadenosine-3'-phosphate, Afs represents 2'-fluoroadenosine-3'-thiophosphate, Am represents 2'-methoxyadenosine-3'-phosphate, Ams represents 2'-methoxyadenosine-3'-thiophosphate, A(d) represents 2'-deoxyadenosine-3'-phosphate, C represents cytidine-3'-phosphate, Cf represents 2'-fluorocytidine-3'-phosphate, Cfs represents 2'-fluorocytidine-3'-thiophosphate, Cm represents 2'-methoxycytidine-3'-phosphate, Cms represents 2'-methoxycytidine-3'-thiophosphate, C(d) represents 2'-methoxycytidine-3'-thiophosphate, and C(d) represents 2'-methoxycytidine-3'-thiophosphate. The symbols represent 2'-deoxycytidine-3'-phosphate, G represents guanosine-3'-phosphate, Gf represents 2'-fluoroguanosine-3'-phosphate, Gm represents 2'-methoxyguanosine-3'-phosphate, Gms represents 2'-methoxyguanosine-3'-thiophosphate, G(d) represents 2'-deoxyguanosine-3'-phosphate, U represents uridine-3'-phosphate, Uf represents 2'-fluorouridine-3'-phosphate, Ufs represents 2'-fluorouridine-3'-thiophosphate, Um represents 2'-methoxyuridine-3'-phosphate, Ums represents 2'-methoxyuridine-3'-thiophosphate, and T(d) represents 2'-deoxythymidine-3'-phosphate.

25. The double-stranded RNA molecule as described in claim 23 or 24, characterized in that, The positive strand of the double-stranded RNA molecule is coupled with a ligand.

26. The double-stranded RNA molecule as described in claim 25, characterized in that, The ligand is one or more GalNAcs attached using divalent or trivalent branched bonds.

27. The double-stranded RNA molecule as described in claim 23 or 24, characterized in that, The first nucleotide counting from the 5' end of the antisense strand can be a VP-modified nucleotide.

28. Use of the double-stranded RNA molecule according to any one of claims 23 to 27 in the preparation of a pharmaceutical composition.

29. A pharmaceutical composition, characterized in that: The pharmaceutical composition comprises the double-stranded RNA molecule according to any one of claims 23 to 27.

30. A substance X or a composition comprising substance X, used as a pharmaceutical composition, characterized in that, The substance X is the double-stranded RNA molecule as described in any one of claims 23 to 27.

31. Use of the double-stranded RNA molecule according to any one of claims 23 to 27 in the preparation of pharmaceutical compositions for the prevention and / or treatment of diseases of high blood pressure or dyslipidemia.

32. Use of the double-stranded RNA molecule of any one of claims 23 to 27, or the pharmaceutical composition of claim 29, for the prevention and / or treatment of diseases of high blood pressure or dyslipidemia.

33. A method for treating or / and preventing hypertension or dyslipidemia, the method comprising administering to a subject an effective dose of the double-stranded RNA molecule of any one of claims 23 to 27 or the pharmaceutical composition of claim 29 to treat or / and prevent hypertension or dyslipidemia.

Images