Sirna for inhibiting URAT1 gene expression, and modification and use thereof

Abstract

The present application relates to the technical field of nucleic acids, and discloses an siRNA for inhibiting URAT1 gene expression, and a modification and use thereof. Specifically, the present application provides a double-stranded RNA molecule targeting a URAT1 gene, and a modification thereof. Both in vivo and in vitro experiments demonstrate that the double-stranded RNA molecule and the modification thereof provided in the present application can effectively inhibit URAT1 gene expression. It is demonstrated that the double-stranded RNA molecule and the modification thereof provided in the present application have great druggability and application value in the prevention and / or treatment of diseases associated with abnormal URAT1 gene expression, such as hyperuricemia-related gout, hypertension, atherosclerosis, insulin resistance, and diabetes.

Description

siRNAs and their modifications for inhibiting URAT1 gene expression and their applications Technical Field

[0001] This application belongs to the field of nucleic acid technology, specifically relating to siRNA and its modifications for inhibiting URAT1 gene expression and their applications. Background Technology

[0002] Urate transporter 1 (URAT1) is a member of the organic anion transporter (OAT) family. It is located on the apical membrane of the proximal convoluted tubule epithelial cells in the kidney. Its function is to mediate the reabsorption of uric acid in the proximal convoluted tubule segment, thereby playing a key role in stabilizing blood uric acid levels.

[0003] Uric acid is the final product of purine metabolism in the body, formed by the oxidation of hypoxanthine and xanthine by xanthine oxidase / dehydrogenase. Uric acid in the blood is mainly excreted through the intestines and kidneys, accounting for 30% and 70% respectively. Uric acid homeostasis depends on the complex process of renal tubular secretion and reabsorption, as well as the balance between intestinal excretion. Under normal physiological conditions, approximately 90% of uric acid in the primary urine is reabsorbed into the blood by the proximal convoluted tubules of the kidneys to maintain normal blood uric acid levels, prevent loss of mineral density in bones, and prevent oxidative damage to the body. However, hyperuricemia can lead to gout by forming urate crystals; hyperuricemia unrelated to crystal formation is associated with hypertension, atherosclerosis, insulin resistance, and diabetes. In patients with gout and primary hyperuricemia, most patients show insufficient urinary uric acid when measuring partial uric acid clearance. Moderate inhibition of URAT1 can reduce the reabsorption of uric acid by the proximal convoluted tubules of the kidneys, appropriately increase urinary uric acid levels, alleviate or prevent urate crystal formation, and eliminate or alleviate gout symptoms. Therefore, inhibiting URAT1 gene expression to reduce uric acid reabsorption in the kidneys is an effective way to lower blood uric acid levels.

[0004] Currently, clinical gout treatments often lack specificity. For example, probenecid and benzbromarone, in addition to inhibiting URAT1-mediated uric acid reabsorption, also inhibit other renal organic anion transporters, causing significant side effects. Improving the specificity of URAT1-targeting inhibitors is crucial for developing next-generation gout prevention and treatment drugs.

[0005] Small interfering RNA (siRNA) technology is the third generation of innovative pharmaceutical technology following small molecule and antibody drugs. siRNA can specifically target the messenger RNA (mRNA) of a target gene, achieving effective and specific inhibition of the target protein's function. The URAT1 protein is encoded by the SLC22A12 gene. Using URAT1 siRNA to inhibit URAT1 protein expression to treat gout will solve the problem of strong side effects caused by the non-specific effects of current gout drugs. Summary of the Invention

[0006] The technical problem to be solved by this application is: how to effectively regulate the abnormal expression of the URAT1 gene, specifically, how to effectively inhibit the abnormal expression of the URAT1 gene.

[0007] To address the aforementioned technical problems, this application provides a double-stranded RNA molecule, which may be siRNA. The siRNA comprises a sense strand and an antisense strand that at least partially form the double-stranded region. The sense strand comprises 17-19 consecutive nucleotides of any odd-numbered sequence from nucleotide sequences 1-774.

[0008] Furthermore, the double-stranded RNA molecule may be siRNA, which includes a sense strand and an antisense strand that at least partially form the double-stranded region, wherein the sense strand includes a nucleotide sequence that may be any odd-numbered sequence from sequence 1 to 774.

[0009] Furthermore, the positive chain comprises 17-21 consecutive nucleotides of any odd-numbered sequence in nucleotide sequences 775-891, such as 17, 18, 19, 20, 21 nucleotides.

[0010] Furthermore, the positive chain includes or is selected from any odd-numbered sequence of nucleotide sequences 775-891.

[0011] In this application, the siRNA comprises a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises a nucleotide sequence that may be any odd-numbered sequence from sequence 1 to 774.

[0012] Furthermore, the length of the double-stranded region of the double-stranded RNA molecule can be 15-30bp, 23-27bp, 21-23bp, 19-21bp, 17-25bp, 17-23bp, 17-19bp, 19bp, or 21bp.

[0013] Furthermore, the length of the sense strand of the double-stranded RNA molecule does not exceed 30 nucleotides, and / or the length of the antisense strand does not exceed 30 nucleotides.

[0014] Furthermore, the sense and / or antisense strands of the double-stranded RNA molecule have 15-30 or 19-30 nucleotides.

[0015] Furthermore, the sense strand of the double-stranded RNA molecule has 17-21 nucleotides, and the antisense strand has 19-23 nucleotides.

[0016] Furthermore, the sense strand of the double-stranded RNA molecule has 19 nucleotides and the antisense strand has 21 nucleotides, or the sense strand of the double-stranded RNA molecule has 21 nucleotides and the antisense strand has 23 nucleotides.

[0017] Furthermore, at least one of the sense and antisense strands of the double-stranded RNA molecule contains a 3' overhang with at least one nucleotide, or at least one of the strands contains a 3' overhang with at least two nucleotides.

[0018] Furthermore, the antisense strand of the double-stranded RNA molecule comprises 17-21 consecutive nucleotides of any even-numbered sequence from nucleotide sequences 1-774, such as 17, 18, 19, 20, and 21 nucleotides.

[0019] Furthermore, the antisense strand of the double-stranded RNA molecule comprises a sequence whose nucleotide sequence is any even numbered sequence from 1 to 774.

[0020] Furthermore, the antisense strand of the double-stranded RNA molecule comprises 17-23 consecutive nucleotides of any even-numbered sequence in the nucleotide sequences 774-892, such as 17, 18, 19, 20, 21, 22, and 23 consecutive nucleotides.

[0021] Furthermore, the nucleotide sequence of the antisense strand of the double-stranded RNA molecule includes or is selected from any even-numbered sequence from 774-892.

[0022] Furthermore, in the double-stranded RNA molecule, the nucleotide sequence of the sense strand of the 387 siRNAs can be any odd-numbered sequence from Sequence 1 to 774 or a sequence with more than 90% identity to any odd-numbered sequence, and / or, the nucleotide sequence of the antisense strand can be any even-numbered sequence from Sequence 1 to 774 or a sequence with more than 90% identity to any even-numbered sequence.

[0023] The nucleotide sequence number of the sense strand of the 387 siRNAs can be n, and the nucleotide sequence number of the antisense strand of the 387 siRNAs can be n+1, where n can be any odd number from 1 to 774.

[0024] The nucleotide sequences of the positive strand of the 387 siRNAs also include sequences that have more than 90% identity with any of the odd-numbered sequences shown in Sequences 1 to 774;

[0025] The nucleotide sequences of the antisense strands of the 387 siRNAs also include sequences that have more than 90% identity with any of the even-numbered sequences shown in Sequences 1 to 774.

[0026] This application also provides double-stranded RNA molecule modifiers, which can be compounds containing modified nucleotides obtained by modifying at least one nucleotide of the double-stranded RNA molecule.

[0027] The double-stranded RNA molecule modifier may be a compound containing a modified nucleotide obtained by modifying at least one nucleotide of the above-mentioned double-stranded RNA molecule, wherein the positive strand of the double-stranded RNA molecule may be a nucleotide sequence that is any odd-numbered sequence from sequence 1 to 774.

[0028] Furthermore, at least one nucleotide in the sense or antisense strand of the double-stranded RNA molecule modification may be a modified nucleotide.

[0029] Furthermore, in the double-stranded RNA molecule modification, the modified nucleotide may be a compound formed by replacing the 2' hydroxyl group of the ribosyl group of the nucleotide with other groups, or it may be a compound formed by modifying the bases on the nucleotide.

[0030] Further, in the double-stranded RNA molecule modification, the modified nucleotide is selected from at least one of the following: 2'-methoxy modified nucleotides, 2'-methyl modified nucleotides, 2'-fluoro modified nucleotides, deoxy-nucleotides, 2'-deoxy-nucleotides, 3'-terminal deoxy-thymidine (dT) nucleotides, 2'-deoxy-modified nucleotides, locked nucleotides, non-locked nucleotides, configuration-restricted nucleotides, restricted ethyl nucleotides, base-free nucleotides, 2'-amino-modified nucleotides, 2'-O-allyl-modified nucleotides, 2'-C-alkyl-modified nucleotides, 2'-C 1-22 Alkyl-modified nucleotides, 2'-C 16 Alkyl-modified nucleotides, 2'-C 22Alkyl-modified nucleotides, 2'-hydroxy-modified nucleotides, 2'-methoxyethyl-modified nucleotides, 2'-O-alkyl-modified nucleotides, morpholinyl nucleotides, nucleotides containing non-natural bases, tetrahydropyran-modified nucleotides, 1,5-dehydrohexyl-modified nucleotides, cyclohexenyl-modified nucleotides, glycerol nucleotides (GNA), open-ring nucleotides (UNA), nucleotides containing methyl phosphate groups, nucleotides containing 5'-(E)vinyl phosphate groups, nucleotides containing 5'-phosphate groups, and nucleotides containing 5'-phosphate analogs.

[0031] Furthermore, the double-stranded RNA molecule modification includes a 2'-methoxy-modified nucleotide, which is located in the antisense and sense strands of the double-stranded RNA molecule modification. Specifically, in the direction from the 5' end to the 3' end, at least positions 1-6 and 10-19 of the sense strand may be 2'-methoxy-modified nucleotides; and at least positions 1, 3-5, 7-13, 15, and 17-21 of the antisense strand may be 2'-methoxy-modified nucleotides.

[0032] Furthermore, the double-stranded RNA molecule modifier also includes a 2'-fluorinated nucleotide, which is located in the antisense and sense strands of the double-stranded RNA molecule modifier, and, in the direction from the 5' end to the 3' end, at least the nucleotides at positions 14 and 16 of the antisense strand may be 2'-fluorinated nucleotides.

[0033] Furthermore, the double-stranded RNA molecule modification includes a 2'-methoxy-modified nucleotide, which is located in the antisense and sense strands of the double-stranded RNA molecule modification. Specifically, in the direction from the 5' end to the 3' end, at least positions 1-6 and 10-19 of the sense strand may be 2'-methoxy-modified nucleotides; and at least positions 1, 3-5, 7-13, 15, and 17-21 of the antisense strand may be 2'-methoxy-modified nucleotides.

[0034] Furthermore, the double-stranded RNA molecule modifier also includes 2'-fluorinated nucleotides, which are located in the antisense and sense strands of the double-stranded RNA molecule modifier. In addition, at least the 7th, 8th, and 9th nucleotides of the sense strand can be 2'-fluorinated nucleotides in the direction from the 5' end to the 3' end, and at least the 2nd, 6th, 14th, and 16th nucleotides of the antisense strand can be 2'-fluorinated nucleotides.

[0035] Furthermore, the double-stranded RNA molecule modification further includes linking the modified nucleotides via phosphate thioesters.

[0036] Furthermore, the double-stranded RNA molecule modification comprises at least one phosphate thioester-modified backbone.

[0037] Furthermore, the thiophosphate is located in the antisense and sense strands of the double-stranded RNA molecule modification, and at least the nucleotides at positions 1 and 2, and positions 2 and 3 of the sense strand are linked by the thiophosphate in the direction from the 5' end to the 3' end, and at least the nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 of the antisense strand are linked by the thiophosphate.

[0038] Furthermore, a ligand is attached to any nucleotide at the 3'-end or 5'-end of the positive strand or in the middle of the positive strand of the double-stranded RNA molecule modification.

[0039] Furthermore, in the double-stranded RNA molecule modification, the ligand may be a small molecule, antibody, polypeptide, protein, or aptamer.

[0040] Furthermore, in the double-stranded RNA molecule modification, the small molecule may be GalNAc.

[0041] Furthermore, in the aforementioned double-stranded RNA molecule modification, the protein may be albumin.

[0042] Furthermore, in the aforementioned double-stranded RNA molecule modification, the ligand is linked to the double-stranded RNA molecule modification via a linker.

[0043] This application also provides the use of the described double-stranded RNA molecule or the modified double-stranded RNA molecule in any of the following:

[0044] Application of D1) in the preparation of compositions that inhibit URAT1 gene expression;

[0045] Application of D2 in inhibiting URAT1 gene expression;

[0046] Application of D3 in the treatment of diseases related to the URAT1 gene target;

[0047] Application of D4 in the preparation of compositions for treating diseases related to the URAT1 gene target.

[0048] This application also provides a composition for inhibiting URAT1 gene expression, wherein the active ingredient of the composition may be the double-stranded RNA molecule or a modified double-stranded RNA molecule.

[0049] Furthermore, the composition also includes a pharmaceutically acceptable carrier.

[0050] The composition may be a pharmaceutical composition or a kit.

[0051] The pharmaceutical composition described above also comprises an unbuffered solution.

[0052] The unbuffered solution in the pharmaceutical composition described above may be physiological saline or water.

[0053] The pharmaceutical composition described above also includes a buffer solution.

[0054] The buffer solution in the pharmaceutical composition described above comprises acetate, citrate, alcohol-soluble gluten, carbonate, or phosphate, or any combination thereof.

[0055] The buffer solution in the pharmaceutical composition described above may be phosphate-buffered saline (PBS).

[0056] Furthermore, the composition comprises lipid formulations, nanoformulations, or lipid-containing vesicles.

[0057] Furthermore, the lipid formulation is an LNP formulation, the nano-formulation is polymer nanoparticles, and the lipid-containing vesicles are exosomes, preferably artificially modified exosomes.

[0058] This application also provides a cell comprising the double-stranded RNA molecule, the double-stranded RNA molecule modification, and / or the composition described herein.

[0059] This application also provides a method for treating URAT1 gene target-related diseases, the method comprising administering the double-stranded RNA molecule, the double-stranded RNA molecule modification, and / or the composition to a subject suffering from URAT1 gene target-related diseases.

[0060] This application also provides a method for preventing and / or treating hyperuricemia, characterized in that the method comprises administering the double-stranded RNA molecule, the double-stranded RNA molecule modification, and / or the composition to a subject suffering from hyperuricemia.

[0061] This application also provides methods for preventing and / or treating gout, the methods comprising administering the double-stranded RNA molecule, the double-stranded RNA molecule modification, and / or the composition to a subject suffering from gout.

[0062] This application also provides a method for inhibiting the expression of the URAT1 gene in cells, the method comprising:

[0063] (a) Contact the cells with the double-stranded RNA molecule, the double-stranded RNA molecule modification, and / or the composition.

[0064] (b) Maintain the cells produced in step (a) for a period of time sufficient for the degradation of the URAT1 gene mRNA transcript, thereby suppressing URAT1 gene expression in the cells.

[0065] Furthermore, in the method, the cell is located within the subject.

[0066] Furthermore, in the method, the subject may be a human.

[0067] Furthermore, in the method described, the subject suffers from URAT1-related disease.

[0068] Furthermore, in the method, the expression of the URAT1 gene is suppressed by at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 100%.

[0069] The term "subject" as used in this article may refer to an animal, such as a mammal, including primates (e.g., humans or non-human primates, such as monkeys or chimpanzees), and non-primates (e.g., cattle, pigs, camels, llamas, horses, goats, rabbits, sheep, hamsters, guinea pigs, cats, dogs, rats, mice, horses, or whales). In some embodiments, the subject is a mouse.

[0070] In this application, the URAT1 gene target-related disease can be a disease caused by abnormal expression of the URAT1 gene.

[0071] In this application, the disease caused by abnormal URAT1 gene expression may be a disease caused by upregulation of URAT1 gene expression.

[0072] In this application, the diseases caused by the upregulation of the URAT1 gene include, but are not limited to, hyperuricemia, hyperuricemia-related gout, hypertension, atherosclerosis, insulin resistance, diabetes, renal hypouricemia, hyperuricemia, gout, kidney stones, and uric acid kidney stones.

[0073] In this application, "modified nucleotide" refers to a nucleotide or nucleotide analog formed by replacing the 2'-hydroxyl group and / or the 5'-hydroxyl group of the ribosyl group with other groups, or a nucleotide whose bases are modified bases. "Methoxy-modified nucleotide" refers to a nucleotide formed by replacing the 2'-hydroxyl group of the ribosyl group with a methoxy group. "Fluoro-modified nucleotide" refers to a nucleotide formed by replacing the 2'-hydroxyl group of the ribosyl group with fluorine. "Nucleotide analog" refers to a group that can replace a nucleotide in nucleic acids but has a structure different from adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide, or thymine deoxyribonucleotide. Examples include isonucleotides, bridged nucleic acids (BNAs), or acyclic nucleotides.

[0074] In one embodiment of this application, "fluorinated nucleotide" refers to a nucleotide formed by replacing the hydroxyl group at the 2' position of the ribosyl group with fluorine, having the structure shown in formula (1). The non-fluorinated nucleotide is independently selected from nucleotides or nucleotide analogs formed by replacing the hydroxyl group at the 2' position of the ribosyl group with a non-fluorinated group.

[0075] In one embodiment of this application, the nucleotide formed by replacing the hydroxyl group at the 2' position of the ribosome with a non-fluorinated group is well known to those skilled in the art. These nucleotides may be selected from one of the following: 2'-alkoxy modified nucleotides, 2'-substituted alkoxy modified nucleotides, 2'-alkyl modified nucleotides, 2'-substituted alkyl modified nucleotides, 2'-amino modified nucleotides, 2'-substituted amino modified nucleotides, and 2'-deoxynucleotides.

[0076] In one embodiment of this application, the 2'-alkoxy modified nucleotide is a 2'-methoxy (2'-OMe) modified nucleotide, as shown in formula (2), i.e., methoxy modified; the 2'-substituted alkoxy modified nucleotide, for example, can be a 2'-O-methoxyethyl (2'-MOE) modified nucleotide, as shown in formula (3), the 2'-amino (2'-NH2) modified nucleotide is shown in formula (4), and the 2'-deoxynucleotide (DNA) is shown in formula (5), where Base represents the modified or unmodified nucleotide base A, U, G, C, T or other nucleotide bases.

[0077] In one embodiment of this application, the nucleotide analogue refers to a group that can replace a nucleotide in nucleic acid, but whose structure is different from that of adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide, or thymine deoxyribonucleotide.

[0078] In one embodiment of this application, the nucleotide analog may be an isonucleotide, a bridged nucleotide, or an acyclic nucleotide.

[0079] In one embodiment of this application, the bridged nucleic acid (BNA) refers to a restricted or inaccessible nucleotide. The BNA may contain a bridging structure with a "fixed" C3'-endoglucan condensation, such as a five-membered ring, a six-membered ring, or a seven-membered ring. Typically, the bridge is incorporated into the 2'-, 4'-position of the ribose to provide a 2', 4'-BNA nucleotide.

[0080] In one embodiment of this application, the BNA may be LNA, ENA, cET BNA, etc., wherein LNA is as shown in formula (6), ENA is as shown in formula (7), and cET BNA is as shown in formula (8), where Base represents modified or unmodified nucleotide bases A, U, G, C, T or other nucleotide bases.

[0081] In one embodiment of this application, at least a portion of the phosphate ester groups in the phosphate-sugar backbone of at least one single strand of the sense and antisense strands of the siRNA are phosphate ester groups with modifying groups.

[0082] In one embodiment of this application, the phosphate ester group with the modifying group is a thiophosphate ester group formed by replacing at least one oxygen atom in the phosphate diester bond of the phosphate ester group with a sulfur atom.

[0083] In one embodiment of this application, the phosphate ester having the modifying group is a thiophosphate ester having the structure shown in formula (9). In one embodiment of this application, the nucleotide linked to the thiophosphate ester is shown in formula (10), and the thiophosphate ester linkage is present at least at one of the following positions: between the first and second nucleotides at either end of the sense or antisense strand; between the second and third nucleotides at either end of the sense or antisense strand; or any combination thereof.

[0084] In one embodiment of this application, the VP-modified nucleotide is a vinyl phosphate ester modified nucleotide. In one embodiment of this application, the VP-modified and methoxy-modified nucleotide, namely the nucleotide modified with 5'-(E)-vinyl-2'-methoxy-modified phosphate ester (5'-(E)-VP-2'-OMe), is as shown in formula (11), where Base represents the modified or unmodified nucleotide base A, U, G, C, T or other nucleotide bases.

[0085] In the siRNA preparation methods referred to in this application, unless otherwise specified, nucleoside monomer refers to the modified or unmodified RNA phosphoramidites (sometimes RNAphosphoramidites are also called nucleoside phosphoramidites) used in phosphoramidite solid-phase synthesis, depending on the type and sequence of nucleotides in the siRNA to be prepared. Phosphoramidite solid-phase synthesis is a method known to those skilled in the art for the synthesis of siRNA. All nucleoside monomers used in this application are commercially available.

[0086] This application also relates to the following technical solutions:

[0087] 1. A double-stranded RNA molecule, wherein the double-stranded RNA molecule comprises a sense strand and an antisense strand that at least partially form a double-stranded region, the antisense strand comprising 15-19 consecutive nucleotides, such as 16, 17, or 18 consecutive nucleotides, of any even-numbered nucleotide sequence in SEQ ID NO. 1-774, and the sense strand comprising 15-19 consecutive nucleotides, such as 16, 17, or 18 consecutive nucleotides, of any odd-numbered nucleotide sequence in SEQ ID NO. 1-774.

[0088] 2. The double-stranded RNA molecule according to claim 1, wherein the length of the sense strand is no more than 30 nucleotides, and / or the length of the antisense strand is no more than 30 nucleotides, preferably, the length of the sense strand is no more than 23 nucleotides, and / or the length of the antisense strand is no more than 25 nucleotides, more preferably, the length of the sense strand is no more than 21 nucleotides, and / or the length of the antisense strand is no more than 23 nucleotides.

[0089] 3. The double-stranded RNA molecule of claim 1 or 2, wherein the sense and antisense strands are completely or partially complementary, and the length of the complementary region is 15, 16, 17, 18, 19, 20, or 21 nucleotides. 4. The double-stranded RNA molecule of any one of claims 1-3, wherein the sense and antisense strands of the double-stranded RNA molecule comprise or are selected from any combination of:

[0090] The sense strand with nucleotide sequence number n and the antisense strand with nucleotide sequence number n+1, where n is an odd number from 1 to 774.

[0091] 5. The double-stranded RNA molecule according to claim 4, wherein the sense strand and antisense strand of said double-stranded RNA molecule comprise or are selected from any combination of the following:

[0092] The positive chain shown in SEQ ID NO. 259 and the negative chain shown in SEQ ID NO. 260;

[0093] The positive chain shown in SEQ ID NO. 269 and the negative chain shown in SEQ ID NO. 270;

[0094] The positive chain shown in SEQ ID NO. 271 and the negative chain shown in SEQ ID NO. 272;

[0095] The positive chain shown in SEQ ID NO.291 and the negative chain shown in SEQ ID NO.292;

[0096] The positive chain shown in SEQ ID NO. 309 and the negative chain shown in SEQ ID NO. 310;

[0097] The positive chain shown in SEQ ID NO. 337 and the negative chain shown in SEQ ID NO. 338;

[0098] The positive chain shown in SEQ ID NO. 339 and the negative chain shown in SEQ ID NO. 340;

[0099] The positive chain shown in SEQ ID NO. 341 and the negative chain shown in SEQ ID NO. 342;

[0100] The positive chain shown in SEQ ID NO. 345 and the negative chain shown in SEQ ID NO. 346;

[0101] The positive chain shown in SEQ ID NO. 347 and the negative chain shown in SEQ ID NO. 348;

[0102] The positive chain shown in SEQ ID NO. 359 and the negative chain shown in SEQ ID NO. 360;

[0103] The positive chain shown in SEQ ID NO. 389 and the negative chain shown in SEQ ID NO. 390;

[0104] The positive chain shown in SEQ ID NO.403 and the negative chain shown in SEQ ID NO.404;

[0105] The positive chain shown in SEQ ID NO.427 and the negative chain shown in SEQ ID NO.428;

[0106] The positive chain shown in SEQ ID NO. 433 and the negative chain shown in SEQ ID NO. 434;

[0107] The positive chain shown in SEQ ID NO.439 and the negative chain shown in SEQ ID NO.440;

[0108] The positive chain shown in SEQ ID NO. 607 and the negative chain shown in SEQ ID NO. 608;

[0109] The positive chain shown in SEQ ID NO. 609 and the negative chain shown in SEQ ID NO. 610;

[0110] The positive chain shown in SEQ ID NO. 611 and the negative chain shown in SEQ ID NO. 612;

[0111] The positive chain shown in SEQ ID NO. 621 and the negative chain shown in SEQ ID NO. 622;

[0112] The positive chain shown in SEQ ID NO. 623 and the negative chain shown in SEQ ID NO. 624;

[0113] The positive chain shown in SEQ ID NO. 625 and the negative chain shown in SEQ ID NO. 626;

[0114] The positive chain shown in SEQ ID NO. 633 and the negative chain shown in SEQ ID NO. 634;

[0115] The justice chain shown in SEQ ID NO. 637 and the antisense chain shown in SEQ ID NO. 638;

[0116] The positive chain shown in SEQ ID NO. 649 and the negative chain shown in SEQ ID NO. 650;

[0117] The positive chain shown in SEQ ID NO. 663 and the negative chain shown in SEQ ID NO. 664;

[0118] The positive chain shown in SEQ ID NO. 665 and the negative chain shown in SEQ ID NO. 666;

[0119] The justice chain shown in SEQ ID NO. 677 and the antisense chain shown in SEQ ID NO. 678;

[0120] The positive chain shown in SEQ ID NO. 701 and the negative chain shown in SEQ ID NO. 702;

[0121] The positive chain shown in SEQ ID NO. 703 and the negative chain shown in SEQ ID NO. 704;

[0122] The positive chain shown in SEQ ID NO. 707 and the negative chain shown in SEQ ID NO. 708;

[0123] The positive chain shown in SEQ ID NO. 711 and the negative chain shown in SEQ ID NO. 712;

[0124] The positive chain shown in SEQ ID NO. 719 and the negative chain shown in SEQ ID NO. 720;

[0125] The justice chain shown in SEQ ID NO. 763 and the antisense chain shown in SEQ ID NO. 764;

[0126] The justice chain shown in SEQ ID NO. 765 and the antisense chain shown in SEQ ID NO. 766;

[0127] The justice chain shown in SEQ ID NO. 767 and the antisense chain shown in SEQ ID NO. 768;

[0128] The positive chain shown in SEQ ID NO. 769 and the negative chain shown in SEQ ID NO. 770;

[0129] The positive chain shown in SEQ ID NO. 771 and the negative chain shown in SEQ ID NO. 772;

[0130] The justice chain shown in SEQ ID NO. 773 and the antisense chain shown in SEQ ID NO. 774;

[0131] The positive chain shown in SEQ ID NO. 245 and the negative chain shown in SEQ ID NO. 246;

[0132] The positive chain shown in SEQ ID NO. 249 and the negative chain shown in SEQ ID NO. 250;

[0133] The positive chain shown in SEQ ID NO. 251 and the negative chain shown in SEQ ID NO. 252;

[0134] The positive chain shown in SEQ ID NO. 323 and the negative chain shown in SEQ ID NO. 324;

[0135] The positive chain shown in SEQ ID NO. 327 and the negative chain shown in SEQ ID NO. 328;

[0136] The positive chain shown in SEQ ID NO. 329 and the negative chain shown in SEQ ID NO. 330;

[0137] The positive chain shown in SEQ ID NO. 331 and the negative chain shown in SEQ ID NO. 332;

[0138] The positive chain shown in SEQ ID NO. 333 and the negative chain shown in SEQ ID NO. 334;

[0139] The positive chain shown in SEQ ID NO. 335 and the negative chain shown in SEQ ID NO. 336;

[0140] The positive chain shown in SEQ ID NO. 343 and the negative chain shown in SEQ ID NO. 344;

[0141] The positive chain shown in SEQ ID NO. 369 and the negative chain shown in SEQ ID NO. 370;

[0142] The positive chain shown in SEQ ID NO. 387 and the negative chain shown in SEQ ID NO. 388;

[0143] The positive chain shown in SEQ ID NO.401 and the negative chain shown in SEQ ID NO.402;

[0144] The positive chain shown in SEQ ID NO.405 and the negative chain shown in SEQ ID NO.406;

[0145] The positive chain shown in SEQ ID NO. 613 and the negative chain shown in SEQ ID NO. 614;

[0146] The positive chain shown in SEQ ID NO. 615 and the negative chain shown in SEQ ID NO. 616;

[0147] The positive chain shown in SEQ ID NO. 635 and the negative chain shown in SEQ ID NO. 636;

[0148] The positive chain shown in SEQ ID NO. 651 and the negative chain shown in SEQ ID NO. 652;

[0149] The positive chain shown in SEQ ID NO. 669 and the negative chain shown in SEQ ID NO. 670;

[0150] The positive chain shown in SEQ ID NO. 679 and the negative chain shown in SEQ ID NO. 680;

[0151] The justice chain shown in SEQ ID NO. 775 and the antisense chain shown in SEQ ID NO. 776;

[0152] The positive chain shown in SEQ ID NO. 777 and the negative chain shown in SEQ ID NO. 778;

[0153] The positive chain shown in SEQ ID NO. 779 and the negative chain shown in SEQ ID NO. 780;

[0154] The positive chain shown in SEQ ID NO. 781 and the negative chain shown in SEQ ID NO. 782;

[0155] The positive chain shown in SEQ ID NO. 783 and the negative chain shown in SEQ ID NO. 784;

[0156] The positive chain shown in SEQ ID NO. 785 and the negative chain shown in SEQ ID NO. 786;

[0157] The justice chain shown in SEQ ID NO. 787 and the antisense chain shown in SEQ ID NO. 788;

[0158] The positive chain shown in SEQ ID NO. 789 and the negative chain shown in SEQ ID NO. 790;

[0159] The positive chain shown in SEQ ID NO. 791 and the negative chain shown in SEQ ID NO. 792;

[0160] The positive chain shown in SEQ ID NO. 793 and the negative chain shown in SEQ ID NO. 794;

[0161] The positive chain shown in SEQ ID NO. 795 and the negative chain shown in SEQ ID NO. 796;

[0162] The positive chain shown in SEQ ID NO. 797 and the negative chain shown in SEQ ID NO. 798;

[0163] The positive chain shown in SEQ ID NO. 799 and the negative chain shown in SEQ ID NO. 800;

[0164] The positive chain shown in SEQ ID NO. 801 and the negative chain shown in SEQ ID NO. 802;

[0165] The positive chain shown in SEQ ID NO. 803 and the negative chain shown in SEQ ID NO. 804;

[0166] The positive chain shown in SEQ ID NO. 805 and the negative chain shown in SEQ ID NO. 806;

[0167] The positive chain shown in SEQ ID NO. 807 and the negative chain shown in SEQ ID NO. 808;

[0168] The positive chain shown in SEQ ID NO. 809 and the negative chain shown in SEQ ID NO. 810;

[0169] The positive chain shown in SEQ ID NO. 811 and the negative chain shown in SEQ ID NO. 812;

[0170] The positive chain shown in SEQ ID NO. 813 and the negative chain shown in SEQ ID NO. 814;

[0171] The positive chain shown in SEQ ID NO. 815 and the negative chain shown in SEQ ID NO. 816;

[0172] The positive chain shown in SEQ ID NO. 817 and the negative chain shown in SEQ ID NO. 818;

[0173] The positive chain shown in SEQ ID NO. 819 and the negative chain shown in SEQ ID NO. 820;

[0174] The positive chain shown in SEQ ID NO. 821 and the negative chain shown in SEQ ID NO. 822;

[0175] The positive chain shown in SEQ ID NO. 823 and the negative chain shown in SEQ ID NO. 824;

[0176] The positive chain shown in SEQ ID NO. 825 and the negative chain shown in SEQ ID NO. 826;

[0177] The positive chain shown in SEQ ID NO. 827 and the negative chain shown in SEQ ID NO. 828;

[0178] The positive chain shown in SEQ ID NO. 829 and the negative chain shown in SEQ ID NO. 830;

[0179] The positive chain shown in SEQ ID NO. 831 and the negative chain shown in SEQ ID NO. 832;

[0180] The positive chain shown in SEQ ID NO. 833 and the negative chain shown in SEQ ID NO. 834;

[0181] The positive chain shown in SEQ ID NO. 835 and the negative chain shown in SEQ ID NO. 836;

[0182] The justice chain shown in SEQ ID NO. 837 and the antisense chain shown in SEQ ID NO. 838;

[0183] The positive chain shown in SEQ ID NO. 839 and the negative chain shown in SEQ ID NO. 840;

[0184] The positive chain shown in SEQ ID NO. 841 and the negative chain shown in SEQ ID NO. 842;

[0185] The positive chain shown in SEQ ID NO. 843 and the negative chain shown in SEQ ID NO. 844;

[0186] The positive chain shown in SEQ ID NO. 845 and the negative chain shown in SEQ ID NO. 846;

[0187] The positive chain shown in SEQ ID NO. 847 and the negative chain shown in SEQ ID NO. 848;

[0188] The positive chain shown in SEQ ID NO. 849 and the negative chain shown in SEQ ID NO. 850;

[0189] The positive chain shown in SEQ ID NO. 851 and the negative chain shown in SEQ ID NO. 852;

[0190] The positive chain shown in SEQ ID NO. 853 and the negative chain shown in SEQ ID NO. 854;

[0191] The positive chain shown in SEQ ID NO. 855 and the negative chain shown in SEQ ID NO. 856;

[0192] The positive chain shown in SEQ ID NO. 857 and the negative chain shown in SEQ ID NO. 858;

[0193] The positive chain shown in SEQ ID NO. 859 and the negative chain shown in SEQ ID NO. 860;

[0194] The positive chain shown in SEQ ID NO. 861 and the negative chain shown in SEQ ID NO. 862;

[0195] The positive chain shown in SEQ ID NO. 863 and the negative chain shown in SEQ ID NO. 864;

[0196] The positive chain shown in SEQ ID NO. 865 and the negative chain shown in SEQ ID NO. 866;

[0197] The positive chain shown in SEQ ID NO. 867 and the negative chain shown in SEQ ID NO. 868;

[0198] The positive chain shown in SEQ ID NO. 869 and the negative chain shown in SEQ ID NO. 870;

[0199] The positive chain shown in SEQ ID NO. 871 and the negative chain shown in SEQ ID NO. 872;

[0200] The justice chain shown in SEQ ID NO. 873 and the antisense chain shown in SEQ ID NO. 874;

[0201] The positive chain shown in SEQ ID NO. 875 and the negative chain shown in SEQ ID NO. 876;

[0202] The positive chain shown in SEQ ID NO. 877 and the negative chain shown in SEQ ID NO. 878;

[0203] The positive chain shown in SEQ ID NO. 879 and the negative chain shown in SEQ ID NO. 880;

[0204] The positive chain shown in SEQ ID NO. 881 and the negative chain shown in SEQ ID NO. 882;

[0205] The positive chain shown in SEQ ID NO. 883 and the negative chain shown in SEQ ID NO. 884;

[0206] The positive chain shown in SEQ ID NO. 885 and the negative chain shown in SEQ ID NO. 886;

[0207] The positive chain shown in SEQ ID NO. 887 and the negative chain shown in SEQ ID NO. 888;

[0208] The positive chain shown in SEQ ID NO. 889 and the negative chain shown in SEQ ID NO. 890;

[0209] The positive chain shown in SEQ ID NO.891 and the negative chain shown in SEQ ID NO.892.

[0210] 6. A modified double-stranded RNA molecule comprising any one of claims 1-5, wherein at least one nucleotide is chemically modified, preferably, the chemical modification comprising replacing the 2'-hydroxyl group of the ribosyl group of the nucleotide with another group, and / or modifying a base on the nucleotide, and / or replacing the 5'-hydroxyl group of the ribosyl group of the nucleotide with another group, more preferably, the chemically modified nucleotide is selected from at least one of the following: 2'-methoxy modified nucleotides, 2'-fluoro modified nucleotides, 5'-(E)-vinylphosphonate modified nucleotides, 2'-methyl modified nucleotides, deoxy-nucleotides, 2'-deoxy-nucleotides, 3'-terminal deoxy-thymidine (dT) nucleotides, 2'-deoxy-modified nucleotides, locked nucleotides, non-locked nucleotides, configuration-restricted nucleotides, restricted ethyl nucleotides, baseless nucleotides, 2'-amino-modified nucleotides, 2'-O-allyl-modified nucleotides, 2'-C-alkyl-modified nucleotides, 2'-C 1-22 Alkyl-modified nucleotides, 2'-C 16 Alkyl-modified nucleotides, 2'-C 22 Alkyl-modified nucleotides, 2'-hydroxy-modified nucleotides, 2'-methoxyethyl-modified nucleotides, 2'-O-alkyl-modified nucleotides, morpholinyl nucleotides, nucleotides containing non-natural bases, tetrahydropyran-modified nucleotides, 1,5-dehydrohexyl-modified nucleotides, cyclohexenyl-modified nucleotides, glycerol nucleotides (GNA), open-ring nucleotides (UNA), nucleotides containing methylphosphonate groups, nucleotides containing 5'-phosphate groups, and nucleotides containing 5'-phosphate analogs, more preferably, the chemically modified nucleotides are selected from at least one of the following: 2'-methoxy-modified nucleotides, 2'-fluoro-modified nucleotides, and 5'-(E)-vinylphosphonate-modified nucleotides.

[0211] 7. The modified double-stranded RNA molecule according to item 6, further comprising modification of the phosphodiester between nucleotides, preferably, the modification of the phosphodiester is a thiophosphate diester modification.

[0212] 8. A modified double-stranded RNA molecule according to item 6 or 7, wherein the modified double-stranded RNA molecule is obtained by modifying the double-stranded RNA molecule according to any one of items 1-5 according to any of the following modification patterns:

[0213] (1) In the direction from the 5' end to the 3' end, the nucleotides at positions 1-6 and 10-19 of the sense strand are 2'-methoxy modified nucleotides, the nucleotides at positions 7-9 are 2'-fluorinated modified nucleotides, and the nucleotides at positions 1 and 2, and 2 and 3 are linked by thiophosphate; the nucleotides at positions 1, 3-5, 7-13, 15, and 17-21 of the antisense strand are 2'-methoxy modified nucleotides, the nucleotides at positions 2, 6, 14, and 16 are 2'-fluorinated modified nucleotides, and the nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 are linked by thiophosphate.

[0214] (2) In the direction from the 5' end to the 3' end, the nucleotides at positions 1-6 and 10-19 of the sense strand are 2'-methoxy modified nucleotides, the nucleotides at positions 7-9 are 2'-fluorinated modified nucleotides, and the nucleotides at positions 1 and 2, and positions 2 and 3 are linked by thiophosphate; the nucleotide at position 1 of the antisense strand is a nucleotide modified by 2'-methoxy and 5'-(E)-vinyl phosphate, the nucleotides at positions 3-5, 7-13, 15, and 17-21 are 2'-methoxy modified nucleotides, the nucleotides at positions 2, 6, 14, and 16 are 2'-fluorinated modified nucleotides, and the nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 are linked by thiophosphate.

[0215] (3) In the direction from the 5' end to the 3' end, the nucleotides at positions 7 and 9-11 of the sense strand are 2'-fluorinated nucleotides, and the nucleotides at the remaining positions are 2'-methoxyinated nucleotides. The nucleotides at positions 1 and 2, and positions 2 and 3 are linked by thiophosphate. The nucleotides at positions 2, 6, 14, and 16 of the antisense strand are 2'-fluorinated nucleotides, and the nucleotides at the remaining positions are 2'-methoxyinated nucleotides. The nucleotides at positions 1 and 2, and positions 2 and 3 are linked by thiophosphate.

[0216] (4) In the direction from the 5' end to the 3' end, the nucleotides at positions 7 and 9-11 of the sense strand are 2'-fluoromodified nucleotides, and the remaining positions are 2'-methoxymodified nucleotides. The nucleotides at positions 1 and 2, and positions 2 and 3 are linked by thiophosphate. The nucleotide at position 1 of the antisense strand is a nucleotide modified by 2'-methoxy and 5'-(E)-vinyl phosphate. The nucleotides at positions 2, 6, 14, and 16 are 2'-fluoromodified nucleotides, and the remaining positions are 2'-methoxymodified nucleotides. The nucleotides at positions 1 and 2, and positions 2 and 3 are linked by thiophosphate.

[0217] 9. A double-stranded RNA molecule according to any one of items 1-5, or a modified double-stranded RNA molecule according to any one of items 6-8, further coupled with a ligand, preferably, said ligand being selected from one or more small molecule compounds, polypeptides, short peptides, proteins, and antibodies.

[0218] 10. A pharmaceutical composition comprising a double-stranded RNA molecule as described in any one of claims 1-5 or a modified double-stranded RNA molecule as described in any one of claims 5-9, and a pharmaceutically acceptable carrier.

[0219] 11. The use of the double-stranded RNA molecule of any one of items 1-5, or the modified double-stranded RNA molecule of any one of items 6-9, or the pharmaceutical composition of item 10, in any of the following:

[0220] Application of D1 in the preparation of drugs that inhibit URAT1 gene expression;

[0221] Application of D2 in inhibiting URAT1 gene expression;

[0222] Application of D3 in the treatment of diseases related to the URAT1 gene target;

[0223] Application of D4 in the preparation of drugs for treating diseases related to the URAT1 gene target.

[0224] 12. A method for treating a disease related to the URAT1 gene target, comprising administering to a subject a therapeutically effective amount of any one of items 1-5, or a modified double-stranded RNA molecule as described in any one of items 6-9, or the pharmaceutical composition described in item 10.

[0225] 13. A method for inhibiting URAT1 gene expression in cells, the method comprising:

[0226] The cells are brought into contact with the double-stranded RNA molecule of any one of items 1-5, or the modified double-stranded RNA molecule of any one of items 6-9, or the pharmaceutical composition of item 10.

[0227] The cells are maintained for a period of time sufficient to allow for the degradation of the URAT1 gene mRNA transcript, thereby inhibiting URAT1 gene expression in the cells. Preferably, the cells are located in or outside the subject, and more preferably, the subject suffers from a disease related to the URAT1 gene target.

[0228] 14. The application according to item 11, or the method according to item 12 or 13, wherein the URAT1 gene target-related disease is selected from one or more of the following group:

[0229] High uric acid, high uric acid-related gout, hypertension, arteriosclerosis, insulin resistance, diabetes, renal hypouricemia, hyperuricemia, gout, kidney stones, uric acid kidney stones.

[0230] In summary, the innovation of this application lies in the development of a class of siRNAs that effectively inhibit URAT1 protein expression by degrading SLC22A12 mRNA. This siRNA can be used, but is not limited to, the prevention and treatment of hyperuricemia-related diseases such as gout, hypertension, atherosclerosis, insulin resistance, and diabetes. Compared with current clinical drugs, this siRNA drug has high specificity, which can improve the safety issues caused by the poor specificity of current clinical drugs.

[0231] Compared with the prior art, the beneficial technical effects achieved by this application are as follows:

[0232] This application provides novel double-stranded RNA molecules targeting the URAT1 gene and their modifications. In vitro and in vivo experiments demonstrate that the double-stranded RNA molecules and their modifications can effectively inhibit URAT1 gene expression. This indicates that the double-stranded RNA molecules and their modifications provided in this application have significant drug development potential and application value in the prevention and / or treatment of diseases with abnormal URAT1 gene expression, such as hyperuricemia-related gout, hypertension, atherosclerosis, insulin resistance, and diabetes. Detailed Implementation

[0233] The present application is further illustrated below with reference to embodiments. It should be understood that the embodiments are only used to further illustrate and explain the present application and are not intended to limit the present application.

[0234] The present application will now be described in further detail with reference to specific embodiments. The embodiments given are merely illustrative of the present application and are not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the present application in any way.

[0235] definition

[0236] In this application, "siRNA" is defined as a class of double-stranded RNA molecules that can mediate the silencing of a target RNA (e.g., mRNA, such as a transcript of a gene encoding a protein) that is complementary to it. siRNA comprises an antisense strand complementary to the target RNA and a sense strand complementary to that antisense strand. For convenience, such mRNA is also referred to herein as the mRNA to be silenced. Such genes are also referred to as target genes. Typically, the RNA to be silenced is an endogenous gene or a pathogen gene. Additionally, RNA other than mRNA (e.g., tRNA) and viral RNA can also be targeted.

[0237] In this application, "antisense strand" refers to a strand of siRNA that contains regions that are fully or substantially complementary to the target sequence. As used herein, the term "complementary region" refers to a region on the antisense strand that is substantially complementary to a sequence (e.g., the target sequence). When the complementary region is not fully complementary to the target sequence, the mismatch typically occurs in the internal or terminal regions of the molecule. In some embodiments, the double-stranded nucleic acid molecule includes nucleotide mismatches in the antisense strand.

[0238] In this application, as understood by those skilled in the art, the term “complementary” when used to describe the first nucleoside sequence relative to the second nucleoside sequence refers to the ability of an oligonucleotide containing the first nucleoside sequence to hybridize with an oligonucleotide containing the second nucleoside sequence under certain conditions and form a double-stranded structure.

[0239] In the application, the term "sense chain" refers to a chain of siRNA that includes regions substantially complementary to the region defined herein as the antisense chain.

[0240] In this application, the term "protrusion" refers to at least one unpaired nucleotide that protrudes from the double-stranded structure of the siRNA. A nucleotide protrusion exists, for example, when the 3' end of one strand of the siRNA extends beyond the 5' end of the other strand, or vice versa. The siRNA may contain a protrusion having at least one nucleotide; alternatively, the protrusion may contain at least two, three, four, five, or more nucleotides. The nucleotide protrusion may contain or consist of a nucleotide / nucleoside analogue (including deoxynucleotides / nucleosides). One or more protrusions may be located on the sense strand, the antisense strand, or any combination thereof. Additionally, one or more nucleotides of the protrusion may be present at the 5' end, 3' end, or both ends of the antisense strand or the sense strand of the siRNA.

[0241] In this application, complementary sequences within a double-stranded RNA molecule include base pairings along the entire length of the sense and antisense strands. Such sequences may be referred to as “perfectly complementary” to each other in this application. However, when the sense strand is referred to as “fundamentally complementary” or “partially complementary” relative to the antisense strand herein, the two sequences may be perfectly complementary, or they may form one or more mismatched base pairs, such as 1, 2, 3, 4, or 5 mismatched base pairs, but preferably no more than 5, while maintaining the ability to hybridize under the conditions most relevant to its final application. In determining complementarity, overhangs should not be considered mismatches. For example, a double-stranded RNA molecule containing a 19-nucleotide sense strand and a 21-nucleotide antisense strand, where the longer nucleotide contains a 19-nucleotide sequence perfectly complementary to the shorter nucleotide, can still be referred to as “perfectly complementary.”

[0242] In this application, "modified nucleotide" refers to a nucleotide or nucleotide analog formed by replacing the 2'-hydroxyl group of the ribosyl group with another group, or a nucleotide or nucleotide analog formed by replacing the 5'-hydroxyl group of the ribosyl group with another group, or a nucleotide in which the bases are modified bases. "Methoxy-modified nucleotide" refers to a nucleotide formed by replacing the 2'-hydroxyl group of the ribosyl group with a methoxy group. "Fluoro-modified nucleotide" refers to a nucleotide formed by replacing the 2'-hydroxyl group of the ribosyl group with fluorine. "Nucleotide analog" refers to a group that can replace a nucleotide in nucleic acids but has a structure different from adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide, or thymine deoxyribonucleotide. Examples include isonucleotides, bridged nucleic acids (BNA), or acyclic nucleotides.

[0243] In this application, "ligand" refers to a chemical moiety conjugated to siRNA that can alter the distribution, targeting, or lifetime of the siRNA. In a preferred embodiment, such a ligand provides enhanced affinity for selected targets (e.g., molecules, cells or cell types), compartments (e.g., cell or organ compartments, tissues, organs, or regions of the body) compared to siRNA, for example, siRNA without such a ligand.

[0244] In this application, Base represents a modified or unmodified nucleotide base A, U, G, C, T or other nucleotide base.

[0245] In this application, the term “suppression” is used interchangeably with “reduction,” “silence,” “downregulation,” and other similar terms, and includes any level of suppression.

[0246] In this application, "inhibiting URAT1 expression" means inhibiting the expression of any URAT1 gene and its variants or mutants. Therefore, the URAT1 gene can be a wild-type URAT1 gene, a mutant URAT1 gene, or a transgenic URAT1 gene in the case of genetically manipulated cells, cell groups, or organisms.

[0247] In this application, "inhibition of URAT1 gene expression" includes inhibition of the URAT1 gene at any level, such as at least partial repression of URAT1 gene expression. URAT1 gene expression can be assessed based on the level or level change of any variable associated with URAT1 gene expression, such as URAT1 mRNA level, URAT1 protein level, or lipid level. This level can be assessed in individual cells or in a group of cells (including, for example, samples derived from a subject).

[0248] Inhibition can be assessed by a decrease in the absolute or relative level of one or more variables associated with URAT1 expression compared to a control level. A control level can be any type of control level utilized in the art, such as baseline levels before administration or levels determined from similar untreated or controlled (e.g., buffer-only control or inert agent control) subjects, cells, or samples.

[0249] In this application, "treatment" means a beneficial or desired outcome, including but not limited to the relief or improvement of one or more symptoms related to gene expression. "Treatment" can also mean extended survival compared to expected survival without treatment. Treatment may include prevention of the development of comorbidities, such as reducing liver injury in individuals with liver infections.

[0250] In this application, "therapeutic effective amount" is intended to include an amount of nucleic acid (e.g., siRNA) that, when administered to a patient to treat a subject with a disease, is sufficient to achieve treatment of the disease (e.g., by alleviating, improving, or maintaining an existing disease, or one or more symptoms of the disease or its associated comorbidities).

[0251] In this application, "pharmaceutically acceptable" means a compound, material, composition, or dosage form suitable for tissue contact with human and animal subjects without excessive toxicity, irritation, allergic reactions, or other problems or complications, and with a reasonable benefit / risk ratio.

[0252] In this application, "pharmaceutically acceptable carrier" means a pharmaceutically acceptable material, composition, or medium, such as a liquid or solid filler, diluent, excipient, manufacturing aid, or solvent encapsulating material, for carrying or transporting a target compound from one organ or body part to another. Each carrier must be "acceptable," meaning it is compatible with other components in the formulation and will not cause harm to the subject receiving treatment.

[0253] Double-stranded RNA molecules

[0254] On one hand, this application provides an unmodified double-stranded RNA molecule, specifically an siRNA, wherein the double-stranded RNA molecule comprises a sense strand and an antisense strand that at least partially form the double-stranded region, the antisense strand comprising 15-19 consecutive nucleotides of any even-numbered nucleotide sequence in SEQ ID NO. 1-774, such as 15, 16, 17, 18, or 19 consecutive nucleotides, and the sense strand comprising 15-19 consecutive nucleotides of any odd-numbered nucleotide sequence in SEQ ID NO. 1-774, such as 15, 16, 17, 18, or 18 consecutive nucleotides.

[0255] In some embodiments, the length of the double-stranded region is 15-30 bp, for example, it can be 15 bp, 16 bp, 17 bp, 18 bp, 19 bp, 20 bp, 21 bp, 22 bp, 23 bp, 24 bp, 25 bp, 26 bp, 27 bp, 28 bp, 29 bp, or 30 bp. In some embodiments, the length of the double-stranded region is 17-27 bp. In some embodiments, the length of the double-stranded region is 19-23 bp. In some embodiments, the length of the double-stranded region is 19-21 bp. In some embodiments, the length of the double-stranded region is 17-25 bp. In some embodiments, the length of the double-stranded region is 17-23 bp. In some embodiments, the length of the double-stranded region is 17-19 bp. In some embodiments, the length of the double-stranded region is 19 bp, 20 bp, or 21 bp.

[0256] In some embodiments, the length of the positive strand is no more than 30 nucleotides, and / or the length of the negative strand is no more than 30 nucleotides. In some embodiments, the length of the positive strand is no more than 23 nucleotides, and / or the length of the negative strand is no more than 25 nucleotides. In some embodiments, the length of the positive strand is no more than 19 nucleotides, and / or the length of the negative strand is no more than 21 nucleotides. In some embodiments, the length of the positive strand is 19 nucleotides, and / or the length of the negative strand is 21 nucleotides.

[0257] In some embodiments, the sense strand and the antisense strand are fully or partially complementary. In some embodiments, the length of the complementary region is 15, 16, 17, 18, 19, 20, or 21 nucleotides.

[0258] In some embodiments, at least one of the sense and antisense strands includes a 3' overhang having at least one or at least two nucleotides.

[0259] In some embodiments, the sense strand of the double-stranded RNA molecule has a nucleotide sequence with any odd number in SEQ ID NO.1-774, and the antisense strand has a nucleotide sequence with any even number in SEQ ID NO.1-774.

[0260] In some embodiments, the sense and antisense strands of the double-stranded RNA molecule include or are any combination of those in Table 1 of this application.

[0261] In some embodiments, the sense and antisense strands of the double-stranded RNA molecule comprise or are any combination selected from the following:

[0262] The following chains of reference are listed: SEQ ID NO. 259 (forward chain) and SEQ ID NO. 260 (antisense chain); SEQ ID NO. 269 (forward chain) and SEQ ID NO. 270 (antisense chain); SEQ ID NO. 271 (forward chain) and SEQ ID NO. 272 ​​(antisense chain); SEQ ID NO. 291 (forward chain) and SEQ ID NO. 292 (antisense chain); SEQ ID NO. 309 (forward chain) and SEQ ID NO. 310 (antisense chain); SEQ ID NO. 337 (forward chain) and SEQ ID NO. 338 (antisense chain); SEQ ID NO. 339 (forward chain) and SEQ ID NO. 340 (antisense chain); SEQ ID NO. 341 (forward chain) and SEQ ID NO. 342 (antisense chain); SEQ ID NO. 345 (forward chain) and SEQ ID NO. 346 (antisense chain); SEQ ID NO. 347 (forward chain) and SEQ ID NO. 348 (antisense chain); SEQ ID NO. 359 (forward chain) and SEQ ID NO. 260 (antisense chain); SEQ ID NO. 269 (forward chain) and SEQ ID NO. 270 (antisense chain); SEQ ID NO. 271 (forward chain) and SEQ ID NO. 272 ​​(antisense chain); SEQ ID NO. 291 (forward chain) and SEQ ID NO. 292 (antisense chain); SEQ ID NO. 309 (forward chain) and SEQ ID NO. 310 (antisense chain); SEQ ID NO. 337 (forward chain) and SEQ ID NO. 338 (antisense chain); SEQ ID NO. 339 (forward chain) and SEQ ID NO. 34 The following are examples of SEQ ID NO. 360: the antisense chain; SEQ ID NO. 389: the right-hand chain and SEQ ID NO. 390: the antisense chain; SEQ ID NO. 403: the right-hand chain and SEQ ID NO. 404: the antisense chain; SEQ ID NO. 427: the right-hand chain and SEQ ID NO. 428: the antisense chain; SEQ ID NO. 433: the right-hand chain and SEQ ID NO. 434: the antisense chain; SEQ ID NO. 439: the right-hand chain and SEQ ID NO. 440: the antisense chain; SEQ ID NO. 607: the right-hand chain and SEQ ID NO. 608: the antisense chain; SEQ ID NO. 609: the right-hand chain and SEQ ID NO. 610: the antisense chain; SEQ ID NO. 611: the right-hand chain and SEQ ID NO. 612: the antisense chain; SEQ ID NO. 621: the right-hand chain and SEQ ID NO. 622: the antisense chain; SEQ ID NO. 623: the right-hand chain and SEQ ID NO. 624: the antisense chain; SEQ ID NO. The chain of justice shown in SEQ ID NO. 625 and the chain of antisense shown in SEQ ID NO. 626; the chain of justice shown in SEQ ID NO. 633 and the chain of antisense shown in SEQ ID NO. 634; the chain of justice shown in SEQ ID NO. 637 and the chain of antisense shown in SEQ ID NO. 638; the chain of justice shown in SEQ ID NO. 649 and the chain of antisense shown in SEQ ID NO.The following are examples of SEQ ID NO. 650: the antisense chain; the right-hand chain shown in SEQ ID NO. 663 and the antisense chain shown in SEQ ID NO. 664; the right-hand chain shown in SEQ ID NO. 665 and the antisense chain shown in SEQ ID NO. 666; the right-hand chain shown in SEQ ID NO. 677 and the antisense chain shown in SEQ ID NO. 678; the right-hand chain shown in SEQ ID NO. 701 and the antisense chain shown in SEQ ID NO. 702; the right-hand chain shown in SEQ ID NO. 703 and the antisense chain shown in SEQ ID NO. 704; the right-hand chain shown in SEQ ID NO. 707 and the antisense chain shown in SEQ ID NO. 708; the right-hand chain shown in SEQ ID NO. 711 and the antisense chain shown in SEQ ID NO. 712; the right-hand chain shown in SEQ ID NO. 719 and the antisense chain shown in SEQ ID NO. 720; the right-hand chain shown in SEQ ID NO. 763 and the antisense chain shown in SEQ ID NO. 764; the right-hand chain shown in SEQ ID NO. 765 and the antisense chain shown in SEQ ID NO. 766; SEQ ID The following are examples of SEQ ID NO. 767 and SEQ ID NO. 768: the right chain and the wrong chain; SEQ ID NO. 769 and SEQ ID NO. 770: the right chain and the wrong chain; SEQ ID NO. 771 and SEQ ID NO. 772: the right chain and the wrong chain; SEQ ID NO. 773 and SEQ ID NO. 774: the right chain and the wrong chain; SEQ ID NO. 245 and SEQ ID NO. 246: the right chain and the wrong chain; SEQ ID NO. 249 and SEQ ID NO. 250: the right chain; SEQ ID NO. 251 and SEQ ID NO. 252: the right chain; SEQ ID NO. 323 and SEQ ID NO. 324: the right chain; SEQ ID NO. 327 and SEQ ID NO. 328: the right chain; SEQ ID NO. 329 and SEQ ID NO. 330: the right chain; SEQ ID NO. 331 and SEQ ID NO. 768: the right chain and the wrong chain; SEQ ID NO. 769 and SEQ ID NO. 770: the right chain; SEQ ID NO. 771 and SEQ ID NO. 772: the right chain; SEQ ID NO. 773 and SEQ ID NO. 774: the right chain; SEQ ID NO. 245 and SEQ ID NO. 246: the right chain; SEQ ID NO. 249 and SEQ ID NO. 250: the right chain; SEQ ID NO. 251 and SEQ ID NO. 252: the right chain; SEQ ID NO. 323 and SEQ ID NO. 324: the right chain; SEQ ID NO. 327 and SEQ ID NO. 328: the right chain; SEQ ID NO. 329 and SEQ ID NO. 330: the right chain; SEQ The following chains are listed: the antisense chain shown in SEQ ID NO. 332; the right chain shown in SEQ ID NO. 333 and the antisense chain shown in SEQ ID NO. 334; the right chain shown in SEQ ID NO. 335 and the antisense chain shown in SEQ ID NO. 336; the right chain shown in SEQ ID NO. 343 and the antisense chain shown in SEQ ID NO. 344; and the right chain shown in SEQ ID NO. 369 and SEQ ID NO. 332.The following chains are listed: SEQ ID NO. 370 (antisense chain); SEQ ID NO. 387 (justice chain) and SEQ ID NO. 388 (antisense chain); SEQ ID NO. 401 (justice chain) and SEQ ID NO. 402 (antisense chain); SEQ ID NO. 405 (justice chain) and SEQ ID NO. 406 (antisense chain); SEQ ID NO. 613 (justice chain) and SEQ ID NO. 614 (antisense chain); SEQ ID NO. 615 (justice chain) and SEQ ID NO. 616 (antisense chain); SEQ ID NO. 635 (justice chain) and SEQ ID NO. 636 (antisense chain); SEQ ID NO. 651 (justice chain) and SEQ ID NO. 652 (antisense chain); SEQ ID NO. 669 (justice chain) and SEQ ID NO. 670 (antisense chain); SEQ ID NO. 679 (justice chain) and SEQ ID NO. 680 (antisense chain).

[0263] In some embodiments, the antisense strand comprises any even-numbered nucleotide sequence in SEQ ID NO.775-892, and the sense strand comprises any odd-numbered nucleotide sequence in SEQ ID NO.775-892.

[0264] In some embodiments, the length of the double-stranded region is 15-30 bp, for example, it can be 15 bp, 16 bp, 17 bp, 18 bp, 19 bp, 20 bp, 21 bp, 22 bp, 23 bp, 24 bp, 25 bp, 26 bp, 27 bp, 28 bp, 29 bp, or 30 bp. In some embodiments, the length of the double-stranded region is 23-27 bp. In some embodiments, the length of the double-stranded region is 21-23 bp. In some embodiments, the length of the double-stranded region is 19-21 bp. In some embodiments, the length of the double-stranded region is 17-25 bp. In some embodiments, the length of the double-stranded region is 17-23 bp. In some embodiments, the length of the double-stranded region is 17-19 bp. In some embodiments, the length of the double-stranded region is 21 bp.

[0265] In some embodiments, the length of the positive strand is no more than 30 nucleotides, and / or the length of the negative strand is no more than 30 nucleotides. In some embodiments, the length of the positive strand is no more than 21 nucleotides, and / or the length of the negative strand is no more than 23 nucleotides. In some embodiments, the length of the positive strand is 21 nucleotides, and / or the length of the negative strand is 23 nucleotides.

[0266] In some embodiments, the sense strand and the antisense strand are fully or partially complementary. In some embodiments, the length of the complementary region is 15, 16, 17, 18, 19, 20, or 21 nucleotides.

[0267] In some embodiments, at least one of the sense and antisense strands includes a 3' overhang having at least one or at least two nucleotides.

[0268] In some embodiments, the sense strand of the double-stranded RNA molecule has a nucleotide sequence with any odd number in SEQ ID NO.775-892, and the antisense strand has a nucleotide sequence with any even number in SEQ ID NO.775-892.

[0269] In some embodiments, the sense and antisense strands of the double-stranded RNA molecule include or are any combination of those in Table 2 of this application.

[0270] In some embodiments, the sense and antisense strands of the double-stranded RNA molecule comprise or are any combination selected from the following:

[0271] The following chains of expression are shown: SEQ ID NO. 775 (forward chain) and SEQ ID NO. 776 (antisense chain); SEQ ID NO. 777 (forward chain) and SEQ ID NO. 778 (antisense chain); SEQ ID NO. 779 (forward chain) and SEQ ID NO. 780 (antisense chain); SEQ ID NO. 781 (forward chain) and SEQ ID NO. 782 (antisense chain); SEQ ID NO. 783 (forward chain) and SEQ ID NO. 784 (antisense chain); SEQ ID NO. 785 (forward chain) and SEQ ID NO. 786 (antisense chain); SEQ ID NO. 787 (forward chain) and SEQ ID NO. 788 (antisense chain); SEQ ID NO. 789 (forward chain) and SEQ ID NO. 790 (antisense chain); SEQ ID NO. 791 (forward chain) and SEQ ID NO. 792 (antisense chain); SEQ ID NO. 793 (forward chain) and SEQ ID NO. 794 (antisense chain); SEQ ID NO. 795 (forward chain) and SEQ ID NO. 796 (antisense chain); SEQ ID NO. 793 (forward chain) and SEQ ID NO. 794 (antisense chain); SEQ ID NO. 795 (forward chain) and SEQ ID NO. 796 (antisense chain). The following are examples of SEQ ID NO. 796: the antisense chain; SEQ ID NO. 797: the right-hand chain and SEQ ID NO. 798: the antisense chain; SEQ ID NO. 799: the right-hand chain and SEQ ID NO. 800: the antisense chain; SEQ ID NO. 801: the right-hand chain and SEQ ID NO. 802: the antisense chain; SEQ ID NO. 803: the right-hand chain and SEQ ID NO. 804: the antisense chain; SEQ ID NO. 805: the right-hand chain and SEQ ID NO. 806: the antisense chain; SEQ ID NO. 807: the right-hand chain and SEQ ID NO. 808: the antisense chain; SEQ ID NO. 809: the right-hand chain and SEQ ID NO. 810: the antisense chain; SEQ ID NO. 811: the right-hand chain and SEQ ID NO. 812: the antisense chain; SEQ ID NO. 813: the right-hand chain and SEQ ID NO. 814: the antisense chain; SEQ ID NO. 815: the right-hand chain and SEQ ID NO. 816: the antisense chain; SEQ ID NO. The positive chain shown in SEQ ID NO. 817 and the negative chain shown in SEQ ID NO. 818; the positive chain shown in SEQ ID NO. 819 and the negative chain shown in SEQ ID NO. 820; the positive chain shown in SEQ ID NO. 821 and the negative chain shown in SEQ ID NO. 822; the positive chain shown in SEQ ID NO. 823 and the negative chain shown in SEQ ID NO.The following are examples of SEQ ID NO. 824: the antisense chain; the right-hand chain shown in SEQ ID NO. 825 and the antisense chain shown in SEQ ID NO. 826; the right-hand chain shown in SEQ ID NO. 827 and the antisense chain shown in SEQ ID NO. 828; the right-hand chain shown in SEQ ID NO. 829 and the antisense chain shown in SEQ ID NO. 830; the right-hand chain shown in SEQ ID NO. 831 and the antisense chain shown in SEQ ID NO. 832; the right-hand chain shown in SEQ ID NO. 833 and the antisense chain shown in SEQ ID NO. 834; the right-hand chain shown in SEQ ID NO. 835 and the antisense chain shown in SEQ ID NO. 836; the right-hand chain shown in SEQ ID NO. 837 and the antisense chain shown in SEQ ID NO. 838; the right-hand chain shown in SEQ ID NO. 839 and the antisense chain shown in SEQ ID NO. 840; the right-hand chain shown in SEQ ID NO. 841 and the antisense chain shown in SEQ ID NO. 842; the right-hand chain shown in SEQ ID NO. 843 and the antisense chain shown in SEQ ID NO. 844; SEQ ID NO. The following are examples of SEQ ID NO. 845 and SEQ ID NO. 846: the right chain and the wrong chain; SEQ ID NO. 847 and SEQ ID NO. 848: the right chain and the wrong chain; SEQ ID NO. 849 and SEQ ID NO. 850: the right chain; SEQ ID NO. 851 and SEQ ID NO. 852: the right chain; SEQ ID NO. 853 and SEQ ID NO. 854: the right chain; SEQ ID NO. 855 and SEQ ID NO. 856: the right chain; SEQ ID NO. 857 and SEQ ID NO. 858: the right chain; SEQ ID NO. 859 and SEQ ID NO. 860: the right chain; SEQ ID NO. 861 and SEQ ID NO. 862: the right chain; SEQ ID NO. 863 and SEQ ID NO. 864: the right chain; SEQ ID NO. 865 and SEQ ID NO. 846: the right chain; SEQ ID NO. 864: the right chain; SEQ ID NO. 865 and SEQ ID NO. 846: the right chain; SEQ ID NO. 846: the right chain; SEQ ID NO. 847 and SEQ ID NO. 848: the right chain; SEQ ID NO. 849 and SEQ ID NO. 850: the right chain; SEQ ID NO. 851 and SEQ ID NO. 852: the right chain; SEQ ID NO. 853 and SEQ ID NO. 854: the right chain; SEQ ID NO. 855 and SEQ ID NO. 856: the right chain; SEQ ID NO. 857 and SEQ ID NO. 858: the right chain; SEQ ID NO. 859 and SEQ ID NO. 860: the right chain; SEQ ID NO. 861 and SEQ ID NO The antisense chain shown in SEQ ID NO. 866; the right chain shown in SEQ ID NO. 867 and the antisense chain shown in SEQ ID NO. 868; the right chain shown in SEQ ID NO. 869 and the antisense chain shown in SEQ ID NO. 870; the right chain shown in SEQ ID NO. 871 and the antisense chain shown in SEQ ID NO. 872; the right chain shown in SEQ ID NO. 873 and SEQ ID NO.The following chains are listed: SEQ ID NO. 874 (antisense chain); SEQ ID NO. 875 (justice chain) and SEQ ID NO. 876 (antisense chain); SEQ ID NO. 877 (justice chain) and SEQ ID NO. 878 (antisense chain); SEQ ID NO. 879 (justice chain) and SEQ ID NO. 880 (antisense chain); SEQ ID NO. 881 (justice chain) and SEQ ID NO. 882 (antisense chain); SEQ ID NO. 883 (justice chain) and SEQ ID NO. 884 (antisense chain); SEQ ID NO. 885 (justice chain) and SEQ ID NO. 886 (antisense chain); SEQ ID NO. 887 (justice chain) and SEQ ID NO. 888 (antisense chain); SEQ ID NO. 889 (justice chain) and SEQ ID NO. 890 (antisense chain); SEQ ID NO. 891 (justice chain) and SEQ ID NO. 892 (antisense chain).

[0272] On the other hand, this application also provides modified double-stranded RNA molecules, comprising any of the aforementioned unmodified double-stranded RNA molecules, wherein at least one nucleotide is chemically modified. That is, it is obtained by modifying at least one nucleotide of any of the aforementioned unmodified double-stranded RNA molecules, resulting in a compound containing the modified nucleotide.

[0273] The chemical modification can be the substitution of the 2' hydroxyl group of the ribosyl group of the nucleotide by other groups, or the modification of the bases on the nucleotide, or the substitution of the 5' hydroxyl group of the ribosyl group of the nucleotide by other groups, or the modification of the phosphodiester between nucleotides, or any combination of these types of modifications.

[0274] In some embodiments, the chemical modification includes replacing the 2' hydroxyl group of the nucleotide with another group, and / or modifying the bases on the nucleotide, and / or replacing the 5' hydroxyl group of the nucleotide with another group.

[0275] In some embodiments, the modified nucleotide is selected from at least one of the following:

[0276] 2'-Methoxy-modified nucleotides, 2'-fluoro-modified nucleotides, 5'-(E)-vinylphosphonate-modified nucleotides, 2'-methyl-modified nucleotides, deoxy-nucleotides, 2'-deoxy-nucleotides, 3'-terminal deoxy-thymidine (dT) nucleotides, 2'-deoxy-modified nucleotides, locked nucleotides, non-locked nucleotides, configuration-restricted nucleotides, restricted ethyl nucleotides, base-free nucleotides, 2'-amino-modified nucleotides, 2'-O-allyl-modified nucleotides, 2'-C-alkyl-modified nucleotides, 2'-C 1-22 Alkyl-modified nucleotides, 2'-C 16 Alkyl-modified nucleotides, 2'-C 22 Alkyl-modified nucleotides, 2'-hydroxy-modified nucleotides, 2'-methoxyethyl-modified nucleotides, 2'-O-alkyl-modified nucleotides, morpholinyl nucleotides, nucleotides containing non-natural bases, tetrahydropyran-modified nucleotides, 1,5-dehydrohexyl-modified nucleotides, cyclohexenyl-modified nucleotides, glycerol nucleotides (GNA), open-ring nucleotides (UNA), nucleotides containing methylphosphonate groups, nucleotides containing 5'-phosphate esters, and nucleotides containing 5'-phosphate ester mimics.

[0277] In some embodiments, the chemically modified nucleotide is selected from at least one of the following: 2'-methoxy modified nucleotides, 2'-fluoro modified nucleotides, and 5'-(E)-vinylphosphonate modified nucleotides.

[0278] In some embodiments, the chemical modification further includes modification of the phosphodiester between the nucleotides. In some embodiments, the modification of the phosphodiester is a thiophosphate diester modification.

[0279] In one embodiment of this application, "fluorinated nucleotide" refers to a nucleotide formed by replacing the hydroxyl group at the 2' position of the ribosyl group with fluorine, having the structure shown in formula (1). The non-fluorinated nucleotide is independently selected from nucleotides or nucleotide analogs formed by replacing the hydroxyl group at the 2' position of the ribosyl group with a non-fluorinated group.

[0280] In one embodiment of this application, the nucleotide formed by replacing the hydroxyl group at the 2' position of the ribosome with a non-fluorinated group is well known to those skilled in the art. These nucleotides may be selected from one of the following: 2'-alkoxy modified nucleotides, 2'-substituted alkoxy modified nucleotides, 2'-alkyl modified nucleotides, 2'-substituted alkyl modified nucleotides, 2'-amino modified nucleotides, 2'-substituted amino modified nucleotides, and 2'-deoxynucleotides.

[0281] In one embodiment, the modified double-stranded RNA molecule is obtained by modifying the double-stranded RNA molecule described in the first aspect according to the following modification pattern: In the direction from the 5' end to the 3' end, the nucleotides at positions 1-6 and 10-19 of the sense strand are 2'-methoxy modified nucleotides, the nucleotides at positions 7-9 are 2'-fluoro modified nucleotides, and the nucleotides at positions 1 and 2, and 2 and 3 are linked by thiophosphate; the nucleotides at positions 1, 3-5, 7-13, 15, and 17-21 of the antisense strand are 2'-methoxy modified nucleotides, the nucleotides at positions 2, 6, 14, and 16 are 2'-fluoro modified nucleotides, and the nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 are linked by thiophosphate.

[0282] In one embodiment, the modified double-stranded RNA molecule is obtained by modifying the double-stranded RNA molecule described in the first aspect according to the following modification pattern: In the direction from the 5' end to the 3' end, the nucleotides at positions 1-6 and 10-19 of the sense strand are 2'-methoxy modified nucleotides, the nucleotides at positions 7-9 are 2'-fluoro modified nucleotides, and the nucleotides at positions 1 and 2, and 2 and 3 are linked by thiophosphate; the nucleotide at position 1 of the antisense strand is a 2'-methoxy modified and 5'-(E)-vinylphosphate modified nucleotide, the nucleotides at positions 3-5, 7-13, 15, and 17-21 are 2'-methoxy modified nucleotides, the nucleotides at positions 2, 6, 14, and 16 are 2'-fluoro modified nucleotides, and the nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 are linked by thiophosphate.

[0283] In one embodiment, the modified double-stranded RNA molecule is obtained by modifying the double-stranded RNA molecule described in the first aspect according to the following modification pattern: the nucleotides at positions 7 and 9-11 of the sense strand are 2'-fluoro-modified nucleotides, and the nucleotides at the remaining positions are 2'-methoxy-modified nucleotides, with the nucleotides at positions 1 and 2, and 2 and 3 linked by thiophosphate; the nucleotides at positions 2, 6, 14, and 16 of the antisense strand are 2'-fluoro-modified nucleotides, and the nucleotides at the remaining positions are 2'-methoxy-modified nucleotides, with the nucleotides at positions 1 and 2, and 2 and 3 linked by thiophosphate.

[0284] In one embodiment, the modified double-stranded RNA molecule is obtained by modifying the double-stranded RNA molecule described in the first aspect according to the following modification pattern: In the direction from the 5' end to the 3' end, the nucleotides at positions 7 and 9-11 of the sense strand are 2'-fluoromodified nucleotides, and the remaining positions are 2'-methoxymodified nucleotides; the nucleotides at positions 1 and 2, and positions 2 and 3 are linked by thiophosphate; the nucleotide at position 1 of the antisense strand is a nucleotide modified by both 2'-methoxy and 5'-(E)-vinylphosphate, the nucleotides at positions 2, 6, 14, and 16 are 2'-fluoromodified nucleotides, and the remaining positions are 2'-methoxymodified nucleotides; the nucleotides at positions 1 and 2, and positions 2 and 3 are linked by thiophosphate.

[0285] The double-stranded RNA molecules used in this application can all be prepared using methods known in the art. For example, the phosphoramide solid-phase method is well-known to those skilled in the art. The nucleoside monomers used in this application are all commercially available.

[0286] The unmodified or modified double-stranded RNA molecules of this application can be further coupled with ligands.

[0287] In some embodiments, the ligand is selected from small molecule compounds, polypeptides, short peptides, proteins, antibodies, etc.

[0288] In some embodiments, the ligand may be coupled to any nucleotide at the 3'-terminus or 5'-terminus of the sense strand or in the middle of the sense strand. In some embodiments, the ligand is coupled to the 3'-terminus of the sense strand.

[0289] In some embodiments, the ligand is L96, i.e., a compound represented by the following formula:

[0290] In some embodiments, the siRNA conjugate formed by L96 and siRNA molecules of this application has the following structure:

[0291] Those skilled in the art will understand that the coupling of the ligand to the sense strand can be direct coupling or indirect coupling via a linker. In some embodiments, the ligand is coupled to the 3'-terminus of the sense strand via a linker.

[0292] Pharmaceutical Composition

[0293] Thirdly, this application also provides a pharmaceutical composition comprising the above-described unmodified double-stranded RNA molecule or modified double-stranded RNA molecule, and a pharmaceutically acceptable carrier.

[0294] The pharmaceutically acceptable carrier may be an excipient, stabilizer, suspending agent, or diluent, as is well known to those skilled in the art.

[0295] The pharmaceutical composition of this application can be administered at a dose sufficient to inhibit gene expression. Typically, a suitable dose of the double-stranded RNA molecule of this application is about 0.001 to about 200.0 mg per kilogram of body weight per day, usually about 1 to 50 mg per kilogram of body weight per day. Typically, a suitable dose of the double-stranded RNA molecule of this application is about 0.1 mg / kg to about 10 mg / kg, for example, about 1 mg / kg to about 5 mg / kg, about 1 mg / kg, about 2 mg / kg, about 3 mg / kg, about 4 mg / kg.

[0296] Repeated dosing regimens may include the administration of therapeutic doses of nucleic acid at regular intervals (e.g., every other day or once a year). In some implementations, the frequency of administration of nucleic acid (e.g., siRNA) is from about once a month to about once a year, such as about once every three months, about once every six months, or about once every nine months.

[0297] In some embodiments, the double-stranded RNA molecule of this application is administered at a dose of about 0.1 mg / kg to about 5.0 mg / kg, approximately once a week, once a month, once every two months, once a quarter (i.e., once every three months), once every six months, once every nine months, or once a year. In some embodiments, the double-stranded RNA molecule of this application is administered to the subject once a week. In some embodiments, the double-stranded RNA molecule of this application is administered to the subject once a month. In some embodiments, the double-stranded RNA molecule of this application is administered once a quarter (i.e., once every three months). In some embodiments, the double-stranded RNA molecule of this application is administered once every six months.

[0298] After the initial treatment regimen, the frequency of treatment can be reduced. For example, after applying once a week or every two weeks for three months, it can be repeated once a month for six months or a year; or longer.

[0299] The pharmaceutical composition of this application can be administered in a variety of ways, depending on whether local or systemic treatment is required and depending on the area to be treated. Administration can be local (e.g., via a transdermal patch), pulmonary (e.g., by inhalation or blowing of powder or aerosol, including via a nebulizer), intratracheal, intranasal, epidermal and transdermal, oral, or parenteral. Parenteral administration includes intravenous, intra-arterial, subcutaneous, intraperitoneal, or intramuscular injection or infusion; subcutaneous, for example, via an implanted device; or intracranial, for example, via intraparenchymal, intrathecal, or intraventricular administration. In some preferred embodiments, the composition is administered by intravenous infusion or injection. In some embodiments, the composition is administered by subcutaneous injection. In some embodiments, the double-stranded RNA molecule of this application is administered subcutaneously to the subject.

[0300] Treatment methods and therapeutic uses

[0301] This application also provides the use of the above-mentioned unmodified double-stranded RNA molecules or modified double-stranded RNA molecules in any of the following:

[0302] Application of D1 in the preparation of drugs that inhibit URAT1 gene expression;

[0303] Application of D2 in inhibiting URAT1 gene expression;

[0304] Application of D3 in the treatment of diseases related to the URAT1 gene target;

[0305] Application of D4 in the preparation of drugs for treating diseases related to the URAT1 gene target.

[0306] Inhibition of URAT1 gene expression can refer to inhibition of at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 100%.

[0307] URAT1 gene target-related diseases can encompass diseases known in the art caused by abnormal URAT1 gene expression.

[0308] In some embodiments, the disease caused by abnormal URAT1 gene expression is a disease caused by upregulation of URAT1 gene expression.

[0309] In some embodiments, the URAT1 gene target-related diseases are selected from one or more of the following groups:

[0310] High uric acid, high uric acid-related gout, hypertension, arteriosclerosis, insulin resistance, diabetes, renal hypouricemia, hyperuricemia, gout, kidney stones, uric acid kidney stones.

[0311] This application also provides a method for treating diseases related to the URAT1 gene target, comprising administering to a subject a therapeutically effective amount of an unmodified double-stranded RNA molecule or a modified double-stranded RNA molecule, or the above-described pharmaceutical composition.

[0312] This application also provides a method for inhibiting the expression of the URAT1 gene in cells, the method comprising:

[0313] The cells are brought into contact with the above-mentioned unmodified double-stranded RNA molecule or modified double-stranded RNA molecule, or the above-mentioned pharmaceutical composition;

[0314] Maintaining the cell for a sufficient period of time to allow for the degradation of the URAT1 gene mRNA transcript can suppress URAT1 gene expression in the cell.

[0315] In some embodiments, the cells are located inside the subject. In some embodiments, the cells are located outside the subject. The subject can be a mammal, including primates (e.g., humans or non-human primates, such as monkeys or chimpanzees) and non-primates (e.g., cattle, pigs, camels, llamas, horses, goats, rabbits, sheep, hamsters, guinea pigs, cats, dogs, rats, mice, horses, or whales). In some embodiments, the subject is a human.

[0316] In some embodiments, the subject suffers from a disease related to the URAT1 gene target. The URAT1 gene target-related disease is as described above.

[0317] Example

[0318] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0319] Unless otherwise specified, the quantitative experiments in the following examples were performed in triplicate, and the results were averaged.

[0320] In the following examples, A represents adenosine-3'-phosphate (adenine ribonucleotide). Af represents 2'-fluoroadenosine-3'-phosphate (2'-fluoro-modified adenine ribonucleotide). Afs represents 2'-fluoroadenosine-3'-thiophosphate (2'-fluoro and 3'-thiophosphate-modified adenine ribonucleotide). Am represents 2'-methoxyadenosine-3'-phosphate (2'-methoxy-modified adenine ribonucleotide). Ams represents 2'-methoxyadenosine-3'-thiophosphate (2'-methoxy-modified and 3'-thiophosphate-modified adenine ribonucleotide). C represents cytidine-3'-phosphate (cytosine ribonucleotide). Cf represents 2'-fluorocytidine-3'-phosphate (2'-fluoro-modified cytosine ribonucleotide). Cfs represents 2'-fluorocytidine-3'-thiophosphate (a cytosine ribonucleotide modified with 2'-fluorine and 3'-thiophosphate). Cm represents 2'-methoxycytidine-3'-phosphate (a cytosine ribonucleotide modified with 2'-methoxy). Cms represents 2'-methoxycytidine-3'-thiophosphate (a cytosine ribonucleotide modified with 2'-methoxy and 3'-thiophosphate). G represents guanosine-3'-phosphate (a guanine ribonucleotide). Gf represents 2'-fluoroguanosine-3'-phosphate (a guanine ribonucleotide modified with 2'-fluorine). Gfs represents 2'-fluoroguanosine-3'-thiophosphate (a guanine ribonucleotide modified with 2'-fluorine and 3'-thiophosphate). Gm represents 2'-methoxyguanosine-3'-phosphate (a guanine ribonucleotide modified with 2'-methoxy). Gms represents 2'-methoxyguanosine-3'-thiophosphate (a guanine ribonucleotide modified with 2'-methoxy and 3'-thiophosphate). T represents thymidine-3'-phosphate (thymine deoxyribonucleotide). U represents uridine-3'-phosphate (uracil ribonucleotide). Uf represents 2'-fluorouridine-3'-phosphate (a 2'-fluoro-modified uracil ribonucleotide). Ufs represents 2'-fluorouridine-3'-thiophosphate (a 2'-fluoro-modified and 3'-thiophosphate-modified uracil ribonucleotide). Um represents 2'-methoxyuridine-3'-phosphate (a 2'-methoxy-modified uracil ribonucleotide). Ums represents 2'-methoxyuridine-3'-thiophosphate (a 2'-methoxy-modified and 3'-thiophosphate-modified uracil ribonucleotide). GalNAc represents N-acetylgalactosamine. VP indicates (E)-vinyl phosphate modification.

[0321] Example 1: Double-stranded RNA molecules and their modified double-stranded RNA molecules

[0322] Human URAT1 (SLC22A12) mRNA refers to the sequence with GenBank accession number NM_144585.4, and references the cynomolgus monkey sequence with GenBank accession number XM_045372063.1. The siRNA designed based on the above gene transcripts was synthesized by Suzhou Gemma Gene Co., Ltd. using a solid-phase synthesis method known in the art.

[0323] Using the solid-phase synthesis method described above, unmodified siRNAs as shown in Tables 1 and 2 were synthesized.

[0324] Table 1

[0325] Modified siRNA

[0326] The siRNAs shown in Table 1 were modified according to the M1 and M1VP modification patterns, and the modified siRNAs were obtained by the solid-phase synthesis method known in the art.

[0327] M1 Modification Mode:

[0328] Chain of Justice 5'-3' ms-ms-mmmmfffmmmmmmmmmm

[0329] That is, the nucleotides at positions 1-6 and 10-19 of the positive chain are 2'-methoxy modified nucleotides, the nucleotides at positions 7-9 are 2'-fluorinated modified nucleotides, and the nucleotides at positions 1 and 2, as well as positions 2 and 3, are linked by thiophosphates.

[0330] antisense chain 5'-3' ms-fs-mmmfmmmmmmmfmfmm-ms-ms-m

[0331] That is, the nucleotides at positions 1, 3-5, 7-13, 15, and 17-21 of the antisense strand are 2'-methoxy modified nucleotides, the nucleotides at positions 2, 6, 14, and 16 are 2'-fluorinated modified nucleotides, and the nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 are linked by thiophosphates.

[0332] According to the M1 modification pattern, the unmodified siRNAs in Table 1 are modified to obtain M1-modified siRNAs. The name of the modified siRNA is the corresponding naked sequence name followed by M1. For example, the unmodified siRNA named URAT1-1 is modified by M1 to obtain the modified siRNA named URAT1-1M1.

[0333] M1VP Modification Mode:

[0334] Chain of Justice 5'-3' ms-ms-mmmmfffmmmmmmmmmm

[0335] That is, the nucleotides at positions 1-6 and 10-19 of the positive chain are 2'-methoxy modified nucleotides, the nucleotides at positions 7-9 are 2'-fluorinated modified nucleotides, and the nucleotides at positions 1 and 2, as well as positions 2 and 3, are linked by thiophosphates.

[0336] antisense chain 5'-3' VPms-fs-mmmfmmmmmmmfmfmm-ms-ms-m

[0337] That is, the nucleotide at position 1 of the antisense strand is a nucleotide modified with 2'-methoxy and 5'-(E)-vinyl phosphate, i.e., the modified nucleotide is The nucleotides at positions 3-5, 7-13, 15, and 17-21 are 2'-methoxy modified nucleotides, the nucleotides at positions 2, 6, 14, and 16 are 2'-fluorinated modified nucleotides, and the nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 are linked by thiophosphates.

[0338] Modify the unmodified siRNAs in Table 1 according to the M1VP modification pattern to obtain M1VP-modified siRNAs. The name of the modified siRNA is the corresponding naked sequence name followed by M1VP. For example, the unmodified siRNA named URAT1-1 is modified with M1VP to obtain the modified siRNA named URAT1-1M1VP.

[0339] The siRNAs shown in Table 2 were modified according to the M3 and M3VP modification modes to obtain modified siRNAs.

[0340] M3 Editing Mode:

[0341] Chain of Justice 5'-3' ms-ms-mmmmfmfffmmmmmmmmmm

[0342] That is, the nucleotides at positions 1-6, 8, and 12-21 of the positive chain are 2'-methoxy modified nucleotides, the nucleotides at positions 7 and 9-11 are 2'-fluorinated modified nucleotides, and the nucleotides at positions 1 and 2, as well as positions 2 and 3, are linked by thiophosphates.

[0343] antisense chain 5'-3' ms-fs-mmmfmmmmmmmfmfmmmm-ms-ms-m

[0344] That is, the nucleotides at positions 1, 3-5, 7-13, 15, and 17-23 of the antisense strand are 2'-methoxy modified nucleotides, the nucleotides at positions 2, 6, 14, and 16 are 2'-fluorinated modified nucleotides, and the nucleotides at positions 1 and 2, 2 and 3, 21 and 22, and 22 and 23 are linked by thiophosphates.

[0345] Following the M3 modification pattern, the unmodified siRNAs in Table 2 were modified to obtain M3-modified siRNAs. The name of the modified siRNA was the corresponding naked sequence name followed by M3. For example, the siRNA of URAT1(23)-214 modified according to the M3 pattern was numbered URAT1(23)-214M3, and its corresponding sense strand was: CmsCmsUmGmGmGmCfAmGfCfAfAmCmAmUmCmUmUmCmCmUm (SEQ ID NO.893), and its antisense strand was: AmsGfsGmAmAmGfAmUmGmUmUmGmCmUfGmCfCmCmAmGmGmsGmsCm (SEQ ID NO.894).

[0346] M3VP Modification Mode:

[0347] Chain of Justice 5'-3' ms-ms-mmmmfmfffmmmmmmmmmm

[0348] That is, the nucleotides at positions 1-6, 8, and 12-21 of the positive chain are 2'-methoxy modified nucleotides, the nucleotides at positions 7 and 9-11 are 2'-fluorinated modified nucleotides, and the nucleotides at positions 1 and 2, as well as positions 2 and 3, are linked by thiophosphates.

[0349] antisense chain 5'-3' VPms-fs-mmmfmmmmmmmfmfmmmm-ms-ms-m

[0350] That is, the nucleotide at position 1 of the antisense strand is a nucleotide modified with 2'-methoxy and 5'-(E)-vinyl phosphate, i.e., the modified nucleotide is The nucleotides at positions 3-5, 7-13, 15, and 17-23 are 2'-methoxy modified nucleotides, the nucleotides at positions 2, 6, 14, and 16 are 2'-fluorinated modified nucleotides, and the nucleotides at positions 1 and 2, 2 and 3, 21 and 22, and 22 and 23 are linked by thiophosphates.

[0351] Following the M3VP modification pattern, the unmodified siRNAs in Table 2 were modified to obtain M3VP-modified siRNAs. The name of the modified siRNA was the corresponding naked sequence name followed by M3VP. For example, the siRNA of URAT1(23)-214 modified according to the M3VP pattern was numbered URAT1(23)-214M3VP.

[0352] Furthermore, based on the M1, M1VP, M3, and M3VP modification patterns, L96 is coupled to the 3' end of the positive strand to obtain siRNAs modified with M1, M1VP, M3, and M3VP coupled with L96. The names of siRNAs coupled with L96 are the naked sequence name + M1G, M1GVP, M3G, and M3GVP. For example, the siRNA with the naked sequence number URAT1-1, modified with M1 and coupled with L96 at the 3' end of the positive strand, is numbered URAT1-1M1G; the siRNA with the naked sequence number URAT1, modified with M1VP and coupled with L96 at the 3' end of the positive strand, is numbered URAT1-1M1GVP. The siRNA with naked sequence number URAT1(23)-214 is modified with M3 and has L96 coupled to the 3' end of the positive strand, so its number is URAT1(23)-214M3G. The siRNA with naked sequence number URAT1(23)-214 is modified with M3VP and has L96 coupled to the 3' end of the positive strand, so its number is URAT1(23)-214M3GVP.

[0353] The structure of the siRNA after coupling with L96 is shown in the following formula:

[0354] For example, URAT1(23)-214 modified according to the M3 pattern and further conjugated with L96, the resulting siRNA is numbered URAT1(23)-214M3G, and its corresponding sense strand is: CmsCmsUmGmGmGmCfAmGfCfAfAmCmAmUmCmUmUmCmCmUm-–L96 (SEQ ID NO.893), and its antisense strand is: AmsGfsGmAmAmGfAmUmGmUmUmGmCmUfGmCfCmCmAmGmGmsGmsCm (SEQ ID NO.894).

[0355] In the above modification patterns M1, M1VP, M3, and M3VP, m indicates that the nucleotide is 2'-methoxy modified, f indicates that the nucleotide is 2'-F modified, s indicates that the two nucleotides are linked by a phosphate thioester, and VP indicates that the 5' end of the nucleotide is modified with (E)-vinyl phosphate.

[0356] Example 2: Detection of the on-target activity of modified siRNA used to inhibit URAT1

[0357] In dual-luciferase reporter assays, psiCHECK2, as a plasmid vector, can monitor changes in the expression of a target gene fused with a reporter gene. This vector uses Renilla luciferase as the primary reporter gene and Firefly luciferase as an internal control reporter gene for normalization. The target fragment is cloned into the multiple cloning site downstream of the translation stop codon of Renilla luciferase. RNA interference (RNAi) induced by exogenous siRNA targeting the target gene leads to the cleavage and degradation of the fusion mRNA. The relative change in the Renilla luciferase activity (R / F) normalized by Firefly luciferase can determine whether a targeting relationship exists between the siRNA and the target gene mRNA. Specifically, a lower R / F value indicates lower expression of the Renilla luciferase-target gene fusion gene, and a better effect of the siRNA on targeting the target gene mRNA.

[0358] Step 1: Construct the detection plasmid URAT1-psiCHECK2

[0359] The detection plasmid was constructed using the psiCHECKTM-2 (PromegaTM) plasmid. The detection plasmid contains the insertion sequences shown in the table below. A single copy of the sequence was cloned into the Xho I / Not I site of the psiCHECKTM-2 plasmid to obtain the detection plasmid URAT1-psiCHECK2.

[0360] Step 2: Cell Culture and Transfection

[0361] HEK 293T cells were digested with trypsin using conventional culture medium. The cells were resuspended in complete culture medium and the cell concentration was adjusted to 4 × 10⁶ cells / year. 5 Cells / mL, used for cell transfection.

[0362] In the test group, siRNA was added to each well of a 96-well plate at a rate of 5 μL per well, Opti-MEM containing 20 ng URAT1-psiCHECK2 detection plasmid was added at a rate of 12.5 μL per well, Opti-MEM (Gibco) was added at a rate of 32.5 μL per well, and Lipofectamine 2000 (purchased from Invitrogen, catalog number 11668-019) was added at a rate of 0.3 μL per well. The mixture was then incubated at room temperature (22°C) for 15 minutes to obtain a final mixture. Then, 4 × 10⁻⁶ nitric acid was added to each well of the final mixture. 5 293T cells per mL were cultured in DMEM complete medium (purchased from Transgen Biotech, catalog number FI101-01) at 37°C for 24 h for subsequent dual-luciferase assays. The final siRNA concentrations in each well were 1 nM, 0.1 nM, and 0.01 nM. The mock group was operated similarly to the test group, except that no siRNA was added and an equal volume of water was used instead. The positive control group was operated similarly to the test group, except that the siRNA added to the positive control group was as shown in NC in section 1.2.

[0363] Step 3: Dual-luciferase assay

[0364] Dilute the 5× lysis buffer in the Dual Luciferase Assay Kit (Promega, catalog number E2940) with water to a 1× lysis buffer. Take the cells obtained from step two, discard the supernatant, dilute each well with PBS buffer (purchased from Hyclone, catalog number SH30256.01) and wash twice. Add 50 μL of 1× lysis buffer to each well of each cell plate and lyse at room temperature (25℃) for 20 min to obtain lysed cell plates. Take 30 μL / well of lysis buffer from each lysed cell plate and add it to an opaque 96-well detection plate. Take the dual-luciferase assay kit, prepare substrate 1 and substrate 2 according to the instructions, and add 30 μL of each substrate to each well of the opaque 96-well detection plate. After each addition of substrate, use a multi-mode microplate reader to detect the values ​​of firefly luciferase and Renilla luciferase.

[0365] The luminescence ratio of each well in the ELISA plate is calculated as Renilla / Firefly. The luminescence ratio of each test group or control group is the average of the luminescence ratios of the three culture wells. Using the luminescence ratio of the control group as a baseline, the luminescence ratios of each test group are normalized to obtain the ratio R of luminescence ratio (test) / luminescence ratio (control). This ratio represents the expression level of the Renilla reporter gene, i.e., its relative residual activity. The inhibition rate of siRNA is (1-R)×100%. In the above formula, the control group is the Mock group.

[0366] The target activity results of M1-modified siRNA are shown in the table below.

[0367] Table 2-1: Inhibition rate results of siRNA psiCHECK (1 nM, 0.1 nM, 0.01 nM)

[0368] Example 3: Cell line screening

[0369] 3.1 Construction of stable cell lines

[0370] HEK293T cells were purchased from the Chinese Academy of Sciences Cell Bank and cultured under the following conditions: DMEM + 10% FBS + 1% P.S + 1% sodium pyruvate. 293T cells were transfected with LV6-hURAT1-CDS + 3'UTR. Transfected cells were selected using puromycin, and resistant cells were marked as P1. hURAT1 expression levels were detected by qPCR.

[0371] 3.2 Cell transfection experiment

[0372] The subjects were divided into an experimental group and a control group. The procedures for the experimental group were as follows:

[0373] After culturing the above-mentioned HEK293T hURAT1 stable transgenic strain for 48 hours, it was subjected to routine trypsin digestion and resuspended at a concentration of 5.0*10⁻⁶. 5Cells / mL, seeded at 50 μL per well in a 96-well plate (equivalent to 25,000 cells per well) for transfection experiments. Lipofectamine RNAiMAX was used for transfection of siRNA. The transfection complex was prepared according to the manufacturer's instructions: siRNA and 0.25 μL of Lipofectamine RNAiMAX transfection reagent were diluted in each well with 25 μL of opti-MEM, resulting in final siRNA concentrations of 1 nM, 0.1 nM, 0.01 nM or 10 nM, 1 nM, 0.1 nM, 0.01 nM. After 48 h of transfection, the cell supernatant was discarded, and 50 μL of cell lysis buffer (Germage product) was added to each well. After lysis was completed by incubation for 5 min, 5 μL of stop solution was added to each well to obtain the final lysis product.

[0374] The control group followed the same procedure as the experimental group, except that the siRNA was replaced with an equal volume of water.

[0375] 3.3 RT-qPCR detection

[0376] The cell lysis products were treated with DNase I to remove genomic DNA, yielding an RNA template. The RT-qPCR probe reaction system shown in the table below was prepared, and the RNA was subjected to quantitative real-time PCR on an LC480 using the reaction system and procedure shown in the table.

[0377] The primer sequences are shown below (5' to 3').

[0378] URAT1-F5:TGCCCGACACCATCCAAGAT(SEQ ID NO.904)

[0379] URAT1-R5: GGTTCCCCAGGAGGCTAAAACT (SEQ ID NO.905);

[0380] URAT1-P5.1: ACCAGGCAGTAAAGAAGGCAACACA(HEX)(SEQ ID NO.906);

[0381] hGAPDH-F: CATGAGAAGTATGACAACAGCCT (SEQ ID NO.907);

[0382] hGAPDH-R: AGTCCTTCCACGATACCAAAGT (SEQ ID NO.908);

[0383] hGAPDH-P: CAATGCCTCCTGCACCACCAA (FAM) (SEQ ID NO. 909).

[0384] Table 2-2 RT-qPCR probe method reaction system

[0385] On-machine testing

[0386] The following procedure was used to perform quantitative real-time PCR on an LC480:

[0387] Table 2-3 RT-qPCR reaction procedure

[0388] 3.4 Calculation and Data Processing of hURAT1 mRNA Expression Levels

[0389] The relative quantitative calculation of the expression level of the target gene URAT1 in each test group and control group was performed using the comparative Ct(ΔΔCt) method. The calculation method is as follows: ΔCt(test group) = Ct(target gene in test group) – Ct(internal reference gene in test group), ΔCt(control group) = Ct(target gene in control group) – Ct(internal reference gene in control group), ΔΔCt(test group) = ΔCt(test group) - ΔCt(average in control group), ΔΔCt(control group) = ΔCt(control group) - ΔCt(average in control group). Wherein, each test group consists of cells treated with each siRNA, and the control group consists of cells not treated with siRNA. ΔCt(average in control group) is the arithmetic mean of ΔCt(control group) values ​​from the three culture wells in the control group. Therefore, each culture well in both the test and control groups corresponds to a ΔΔCt value. Using the control group as a baseline, the expression level of hURAT1 mRNA in the test group was normalized. The URAT1 mRNA expression level in the control group was defined as 100%, and the relative expression level of URAT1 mRNA in the test group was defined as 2. ^-ΔΔCt (Test group) × 100%. For the same test group siRNA, the average relative expression level of URAT1 mRNA at each concentration was the arithmetic mean of the relative expression levels in three culture wells at that concentration. The inhibition rate of siRNA on URAT1 mRNA expression was calculated using the following equation: Inhibition rate = (1 - relative expression level of URAT1 mRNA in the test group) × 100%. Statistical analysis was performed using GraphPad Prism statistical analysis software, employing multiple linear regression. The results are shown in the table below.

[0390] Table 2-4 Results of sequence inhibition rates of hURAT1 mRNA in HEK293T hURAT1 cell line (1 nM, 0.1 nM, 0.01 nM) (cell viability of stable transfected cells)

[0391] Table 2-5 Results of sequence inhibition of hURAT1 mRNA in HEK293T hURAT1 cell line (10 nM, 1 nM, 0.1 nM, 0.01 nM) (cell viability of stable transfected cells).

[0392] Example 4: In vivo evaluation of modified siRNA in animals

[0393] 4.1. In vivo screening of AAV models using URAT1 siRNA leader sequence

[0394] AAV Construction: The amino acid coding region and 3'UTR region of the human URAT1 transcript NM_144585.4 were inserted into the HindIII and XbaI sites of the AAV expression vector. URAT1 expression is driven by the CMV promoter, which includes a pre-Kozak and post-SV40 polyA sequence. AAV viral particles were packaged into the AAV9 serotype by transfection of HEK293 cells with the vector DNA for in vivo infection experiments in mice.

[0395] The constructed AAV sequence is shown below:

[0396] Six- to eight-week-old female C57BL / 6 mice were intravenously injected with 1.6 x 10^12 VG of AAV viral particles carrying the human URAT1 sequence. Fourteen days post-AAV injection, mice were subcutaneously injected with L96-conjugated siRNA at a dose of 3 mg / kg or with saline (n=2 per group). Mice were sacrificed 14 days after siRNA or saline injection, and liver tissue was harvested to assess the knockdown level of human mRNA. siRNA activity was expressed as a percentage of human URAT1 knockdown in the liver compared to URAT1 levels in the saline group. URAT1 expression levels were normalized to mouse Gapdh mRNA levels and viral load (viral DNA levels) in the corresponding tissues. Results are shown in the table below, where data are expressed as the percentage of remaining mRNA relative to the saline control group.

[0397] Table 3.2, In vivo activity study of URAT1 siRNA (AAV model)

[0398] 4.2, In vivo dosage study of URAT1 siRNA leader sequence in AAV model

[0399] Six- to eight-week-old female C57BL / 6 mice were intravenously injected with 1.6 x 10^12 VG of AAV virus particles carrying the human URAT1 sequence. Fourteen days post-AAV injection, mice were subcutaneously injected with L96-conjugated siRNA at doses of 3 mg / kg, 9 mpk / kg, or saline (n=3 per group). Mice were sacrificed 14 days after siRNA or saline injection, and liver tissue was harvested to assess the knockdown level of human mRNA. siRNA activity was expressed as a percentage of human URAT1 knockdown in the liver compared to URAT1 levels in the saline group. URAT1 expression levels were normalized to mouse Gapdh mRNA levels. Results are shown in the table below, where data are expressed as the percentage of remaining mRNA relative to the saline control group.

[0400] Table 3.3 In vivo dose study of URAT1 (AAV model)

[0401] Example 5: URAT1 siRNA modified sequence in vitro cell line IC 50 Measurement

[0402] The cell line used in this experiment was the stable HEK293T-hURAT1 transfectant. First, after culturing for 48 hours, the cells were digested with routine trypsin digestion and resuspended at 5.0*10^5 cells / mL. 50 μL of the resuspended cells were seeded into each well of a 96-well plate (equivalent to 25,000 cells per well) for transfection experiments. siRNA was transfected using Lipofectamine RNAiMAX. siRNA and Lipofectamine RNAiMAX transfection reagent were diluted in 25 μL of Opti-MEM to each well, resulting in final siRNA concentrations of 10 nM, 1 nM, 0.33 nM, 0.11 nM, 0.037 nM, 0.0123 nM, 0.0041 nM, 0.0014 nM, 0.0005 nM, and 0.0002 nM. After 48 h of transfection, the cell supernatant was discarded, and 50 μL of cell lysis buffer (Germage product) was added to each well. After lysis for 5 min, 5 μL of stop solution was added to each well to obtain the final lysis product. The control group followed the same procedure as the experimental group, except that the siRNA was replaced with an equal volume of water. The cell lysis products were then treated with DNase I to remove genomic DNA, yielding the RNA template. Prepare the RT-qPCR probe method reaction system as shown in the table below. Perform quantitative real-time PCR on an LC480 using the reaction system and procedure shown in the table. Detection data were plotted using GraphPad Prism to calculate IC50. 50 Values. The results are shown in the table below.

[0403] Table 3.5 URAT1 siRNA Modification Sequence in In Vitro Cell Lines IC50 50 Value (nM)

Claims

1. A double-stranded RNA molecule, wherein the double-stranded RNA molecule comprises a sense strand and an antisense strand forming at least in part a double-stranded region, the antisense strand comprising a contiguous 15-19 nucleotides, such as a contiguous 16, 17, or 18 nucleotides, of the nucleotide sequence of any even-numbered one of SEQ ID NO. 1-774, the sense strand comprising a contiguous 15-19 nucleotides, such as a contiguous 16, 17, or 18 nucleotides, of the nucleotide sequence of any odd-numbered one of SEQ ID NO. 1-774.

2. The double-stranded RNA molecule according to claim 1, wherein the length of the sense strand is not more than 30 nucleotides, and / or the length of the antisense strand is not more than 30 nucleotides, preferably the length of the sense strand is not more than 23 nucleotides, and / or the length of the antisense strand is not more than 25 nucleotides, more preferably the length of the sense strand is not more than 21 nucleotides, and / or the length of the antisense strand is not more than 23 nucleotides.

3. The double-stranded RNA molecule of claim 1 or 2, wherein the sense strand and the antisense strand are fully or partially complementary, the complementary region having a length of 15, 16, 17, 18, 19, 20, or 21 nucleotides.

4. The double-stranded RNA molecule according to any one of claims 1-3, wherein the sense strand and the antisense strand of the double-stranded RNA molecule comprise or are any combination selected from: the sense strand of nucleotide sequence number n and the antisense strand of nucleotide sequence number n+1, wherein n is an odd number from 1-774.

5. The double-stranded RNA molecule according to claim 4, wherein the sense strand and the antisense strand of the double-stranded RNA molecule comprise or are any combination selected from: the sense strand of SEQ ID NO. 259 and the antisense strand of SEQ ID NO. 260; the sense strand of SEQ ID NO. 269 and the antisense strand of SEQ ID NO. 270; the sense strand of SEQ ID NO. 271 and the antisense strand of SEQ ID NO. 272; the sense strand of SEQ ID NO. 291 and the antisense strand of SEQ ID NO. 292; the sense strand of SEQ ID NO. 309 and the antisense strand of SEQ ID NO. 310; the sense strand of SEQ ID NO. 337 and the antisense strand of SEQ ID NO. 338; the sense strand of SEQ ID NO. 339 and the antisense strand of SEQ ID NO. 340; the sense strand of SEQ ID NO. 341 and the antisense strand of SEQ ID NO. 342; the sense strand of SEQ ID NO. 345 and the antisense strand of SEQ ID NO. 346; the sense strand of SEQ ID NO. 347 and the antisense strand of SEQ ID NO. 348; the sense strand of SEQ ID NO. 359 and the antisense strand of SEQ ID NO. 360; the sense strand of SEQ ID NO. 361 and the antisense strand of SEQ ID NO. 362; the sense strand of SEQ ID NO. 363 and the antisense strand of SEQ ID NO. 364; the sense strand of SEQ ID NO. 365 and the antisense strand of SEQ ID NO. 366; the sense strand of SEQ ID NO. 367 and the antisense strand of SEQ ID NO. 368; the sense strand of SEQ ID NO. 369 and the antisense strand of SEQ ID NO. 370; the sense strand of SEQ ID NO. 371 and the antisense strand of SEQ ID NO. 372; the sense strand of SEQ ID NO. 373 and the antisense strand of SEQ ID NO. 374; the sense strand of SEQ ID NO. 375 and the antisense strand of SEQ ID NO. 376; the sense strand of SEQ ID NO. 377 and the antisense strand of SEQ ID NO. 378; the sense strand of SEQ ID NO. 379 and the antisense strand of SEQ ID NO. 380; the sense strand of SEQ ID NO. 381 and the antisense strand of SEQ ID NO. 382; the sense strand of SEQ ID NO. 383 and the antisense strand of SEQ ID NO. 384; the sense strand of SEQ ID NO. 385 and the antisense strand of SEQ ID NO. 386; the sense strand of SEQ ID NO. 387 and the antisense strand of SEQ ID NO. 388; the sense strand of SEQ ID NO. 389 and the antisense strand of SEQ ID NO. 390; the sense strand of SEQ ID NO. 391 and the antisense strand of SEQ ID NO. 392; the sense strand of SEQ ID NO. 393 and the antisense strand of SEQ ID NO. 394; the sense strand of SEQ ID NO. 395 and the antisense strand of SEQ ID NO. 396; the sense strand of SEQ ID NO. 397 and the antisense strand of SEQ ID NO. 398; the sense strand of SEQ ID NO. 399 and the antisense strand of SEQ ID NO. 400; the sense strand of SEQ ID NO. 401 and the antisense strand of SEQ ID NO. 402; the sense strand of SEQ ID NO. 403 and the antisense strand of SEQ ID NO. 404; the sense strand of SEQ ID NO. 405 and the antisense strand of SEQ ID NO. 406; the sense strand of SEQ ID NO. 407 and the antisense strand of SEQ ID NO. 408; the sense strand of SEQ ID NO. 409 and the antisense strand of SEQ ID NO. 410; the sense strand of SEQ ID NO. 411 and the antisense strand of SEQ ID NO. 412; the sense strand of SEQ ID NO. 413 and the antisense strand of SEQ ID NO. 414; the sense strand of SEQ ID NO. 415 and the antisense strand of SEQ ID NO. 416; the sense strand of SEQ ID NO. 417 and the antisense strand of SEQ ID NO. 418; the sense strand of SEQ ID NO. 419 and the antisense strand of SEQ ID NO. 420; the sense strand of SEQ ID NO. 421 and the antisense strand of SEQ ID NO. 422; the sense strand of SEQ ID NO. 423 and the antisense strand of SEQ ID NO. 424; the sense strand of SEQ ID NO. 425 and the antisense strand of SEQ ID NO. 426; the sense strand of SEQ ID NO. 427 and the antisense strand of SEQ ID NO. 428; the sense strand of SEQ ID NO. 429 and the antisense strand of SEQ ID NO. 430; the sense strand of SEQ ID NO. 431 and the antisense strand of SEQ ID NO. 432; the sense strand of SEQ ID NO. 433 and the antisense strand of SEQ ID NO. 434; the sense strand of SEQ ID NO. 435 and the antisense strand of SEQ ID NO. 436; the sense strand of SEQ ID NO. 437 and the antisense strand of SEQ ID NO. 438; the sense strand of SEQ ID NO. 439 and the antisense strand of SEQ ID NO. 440; the sense strand of SEQ ID NO. 441 and the antisense strand of SEQ ID NO. 442; the sense strand of SEQ ID NO. 443 and the antisense strand of SEQ ID NO. 444; the sense strand of SEQ ID NO. 445 and the antisense strand of SEQ ID NO. 446; the sense strand of SEQ ID NO. 447 and the antisense strand of SEQ ID NO. 448; the sense strand of SEQ ID NO. 449 and the antisense strand of SEQ ID NO. 450; the sense strand of SEQ ID NO. 451 and the antisense strand of SEQ ID NO. 452; the sense strand of SEQ ID NO. 453 and the antisense strand of SEQ ID NO. 454; the sense strand of SEQ ID NO. 455 and the antisense strand of SEQ ID NO. 456; the sense strand of SEQ ID NO. 457 and the antisense strand of SEQ ID NO. 458; the sense strand of SEQ ID NO. 459 and the antisense strand of SEQ ID NO. 460; the sense strand of SEQ ID NO. 461 and the antisense strand of SEQ ID NO. 462; the sense strand of SEQ ID NO. 463 and the antisense strand of SEQ ID NO. 464; the sense strand of SEQ ID NO. 465 and the antisense strand of SEQ ID NO. 466; the sense strand of SEQ ID NO. 467 and the antisense strand of SEQ ID NO. 468; the sense strand of SEQ ID NO. 469 and the antisense strand of SEQ ID NO. 470; the sense strand of SEQ ID NO. 471 and the antisense strand of SEQ ID NO. 472; the sense strand of SEQ ID NO. 473 and the antisense strand of SEQ ID NO. 474; the sense strand of SEQ ID NO. 475 and the antisense strand of SEQ ID NO. 476; the sense strand of SEQ ID NO. 477 and the antisense strand of SEQ ID ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ the sense strand set forth in SEQ ID NO. 389 and the antisense strand set forth in SEQ ID NO. 390; the sense strand set forth in SEQ ID NO. 403 and the antisense strand set forth in SEQ ID NO. 404; the sense strand set forth in SEQ ID NO. 427 and the antisense strand set forth in SEQ ID NO. 428; the sense strand set forth in SEQ ID NO. 433 and the antisense strand set forth in SEQ ID NO. 434; the sense strand set forth in SEQ ID NO. 439 and the antisense strand set forth in SEQ ID NO. 440; the sense strand set forth in SEQ ID NO. 607 and the antisense strand set forth in SEQ ID NO. 608; the sense strand set forth in SEQ ID NO. 609 and the antisense strand set forth in SEQ ID NO. 610; the sense strand set forth in SEQ ID NO. 611 and the antisense strand set forth in SEQ ID NO. 612; the sense strand set forth in SEQ ID NO. 621 and the antisense strand set forth in SEQ ID NO. 622; the sense strand set forth in SEQ ID NO. 623 and the antisense strand set forth in SEQ ID NO. 624; the sense strand set forth in SEQ ID NO. 625 and the antisense strand set forth in SEQ ID NO. 626; the sense strand set forth in SEQ ID NO. 633 and the antisense strand set forth in SEQ ID NO. 634; the sense strand set forth in SEQ ID NO. 637 and the antisense strand set forth in SEQ ID NO. 638; the sense strand set forth in SEQ ID NO. 649 and the antisense strand set forth in SEQ ID NO. 650; the sense strand set forth in SEQ ID NO. 663 and the antisense strand set forth in SEQ ID NO. 664; the sense strand set forth in SEQ ID NO. 665 and the antisense strand set forth in SEQ ID NO. 666; the sense strand set forth in SEQ ID NO. 677 and the antisense strand set forth in SEQ ID NO. 678; the sense strand set forth in SEQ ID NO. 701 and the antisense strand set forth in SEQ ID NO. 702; the sense strand set forth in SEQ ID NO. 703 and the antisense strand set forth in SEQ ID NO. 704; the sense strand set forth in SEQ ID NO. 707 and the antisense strand set forth in SEQ ID NO. 708; the sense strand set forth in SEQ ID NO. 711 and the antisense strand set forth in SEQ ID NO. 712; the sense strand set forth in SEQ ID NO. 719 and the antisense strand set forth in SEQ ID NO. 720; the sense strand set forth in SEQ ID NO. 763 and the antisense strand set forth in SEQ ID NO. 764; the sense strand set forth in SEQ ID NO. 765 and the antisense strand set forth in SEQ ID NO. 766; the sense strand set forth in SEQ ID NO. 767 and the antisense strand set forth in SEQ ID NO. 768; the sense strand set forth in SEQ ID NO. 767 and the antisense strand set forth in SEQ ID NO. 768; the sense strand set forth in SEQ ID NO. 769 and the antisense strand set forth in SEQ ID NO. 770; the sense strand set forth in SEQ ID NO. 771 and the antisense strand set forth in SEQ ID NO. 772; the sense strand set forth in SEQ ID NO. 773 and the antisense strand set forth in SEQ ID NO. 774; the sense strand set forth in SEQ ID NO. 245 and the antisense strand set forth in SEQ ID NO. 246; the sense strand set forth in SEQ ID NO. 249 and the antisense strand set forth in SEQ ID NO. 250; the sense strand set forth in SEQ ID NO. 251 and the antisense strand set forth in SEQ ID NO. 252; the sense strand set forth in SEQ ID NO. 323 and the antisense strand set forth in SEQ ID NO. 324; the sense strand set forth in SEQ ID NO. 327 and the antisense strand set forth in SEQ ID NO. 328; the sense strand set forth in SEQ ID NO. 329 and the antisense strand set forth in SEQ ID NO. 330; the sense strand set forth in SEQ ID NO. 331 and the antisense strand set forth in SEQ ID NO. 332; the sense strand set forth in SEQ ID NO. 333 and the antisense strand set forth in SEQ ID NO. 334; the sense strand set forth in SEQ ID NO. 335 and the antisense strand set forth in SEQ ID NO. 336; the sense strand set forth in SEQ ID NO. 343 and the antisense strand set forth in SEQ ID NO. 344; the sense strand set forth in SEQ ID NO. 369 and the antisense strand set forth in SEQ ID NO. 370; the sense strand set forth in SEQ ID NO. 387 and the antisense strand set forth in SEQ ID NO. 388; the sense strand set forth in SEQ ID NO. 401 and the antisense strand set forth in SEQ ID NO. 402; the sense strand set forth in SEQ ID NO. 405 and the antisense strand set forth in SEQ ID NO. 406; the sense strand set forth in SEQ ID NO. 613 and the antisense strand set forth in SEQ ID NO. 614; the sense strand set forth in SEQ ID NO. 615 and the antisense strand set forth in SEQ ID NO. 616; the sense strand set forth in SEQ ID NO. 635 and the antisense strand set forth in SEQ ID NO. 636; the sense strand set forth in SEQ ID NO. 651 and the antisense strand set forth in SEQ ID NO. 652; the sense strand set forth in SEQ ID NO. 669 and the antisense strand set forth in SEQ ID NO. 670; the sense strand set forth in SEQ ID NO. 679 and the antisense strand set forth in SEQ ID NO. 680; the sense strand set forth in SEQ ID NO. 775 and the antisense strand set forth in SEQ ID NO. 776; the sense strand set forth in SEQ ID NO. 777 and the antisense strand set forth in SEQ ID NO. 778; the sense strand set forth in SEQ ID NO. 779 and the antisense strand set forth in SEQ ID NO. 780; the sense strand set forth in SEQ ID NO. 781 and the antisense strand set forth in SEQ ID NO. 782; the sense strand set forth in SEQ ID NO. 783 and the antisense strand set forth in SEQ ID NO. 784; the sense strand set forth in SEQ ID NO. 785 and the antisense strand set forth in SEQ ID NO. 786; the sense strand set forth in SEQ ID NO. 787 and the antisense strand set forth in SEQ ID NO. 788; the sense strand set forth in SEQ ID NO. 789 and the antisense strand set forth in SEQ ID NO. 790; the sense strand set forth in SEQ ID NO. 791 and the antisense strand set forth in SEQ ID NO. 792; the sense strand set forth in SEQ ID NO. 793 and the antisense strand set forth in SEQ ID NO. 794; the sense strand set forth in SEQ ID NO. 795 and the antisense strand set forth in SEQ ID NO. 796; the sense strand set forth in SEQ ID NO. 797 and the antisense strand set forth in SEQ ID NO. 798; the sense strand set forth in SEQ ID NO. 799 and the antisense strand set forth in SEQ ID NO. 800; the sense strand set forth in SEQ ID NO. 801 and the antisense strand set forth in SEQ ID NO. 802; the sense strand set forth in SEQ ID NO. 803 and the antisense strand set forth in SEQ ID NO. 804; the sense strand set forth in SEQ ID NO. 805 and the antisense strand set forth in SEQ ID NO. 806; the sense strand set forth in SEQ ID NO. 807 and the antisense strand set forth in SEQ ID NO. 808; the sense strand set forth in SEQ ID NO. 809 and the antisense strand set forth in SEQ ID NO. 810; the sense strand set forth in SEQ ID NO. 811 and the antisense strand set forth in SEQ ID NO. 812; the sense strand set forth in SEQ ID NO. 813 and the antisense strand set forth in SEQ ID NO. 814; the sense strand set forth in SEQ ID NO. 815 and the antisense strand set forth in SEQ ID NO. 816; the sense strand set forth in SEQ ID NO. 817 and the antisense strand set forth in SEQ ID NO. 818; the sense strand set forth in SEQ ID NO. 819 and the antisense strand set forth in SEQ ID NO. 820; the sense strand set forth in SEQ ID NO. 821 and the antisense strand set forth in SEQ ID NO. 822; the sense strand set forth in SEQ ID NO. 823 and the antisense strand set forth in SEQ ID NO. 824; the sense strand set forth in SEQ ID NO. 825 and the antisense strand set forth in SEQ ID NO. 826; the sense strand set forth in SEQ ID NO. 827 and the antisense strand set forth in SEQ ID NO. 828; the sense strand set forth in SEQ ID NO. 827 and the antisense strand set forth in SEQ ID NO. 828; the sense strand set forth in SEQ ID NO. 829 and the antisense strand set forth in SEQ ID NO. 830; the sense strand set forth in SEQ ID NO. 831 and the antisense strand set forth in SEQ ID NO. 832; the sense strand set forth in SEQ ID NO. 833 and the antisense strand set forth in SEQ ID NO. 834; the sense strand set forth in SEQ ID NO. 835 and the antisense strand set forth in SEQ ID NO. 836; the sense strand set forth in SEQ ID NO. 837 and the antisense strand set forth in SEQ ID NO. 838; the sense strand set forth in SEQ ID NO. 839 and the antisense strand set forth in SEQ ID NO. 840; the sense strand set forth in SEQ ID NO. 841 and the antisense strand set forth in SEQ ID NO. 842; the sense strand set forth in SEQ ID NO. 843 and the antisense strand set forth in SEQ ID NO. 844; the sense strand set forth in SEQ ID NO. 845 and the antisense strand set forth in SEQ ID NO. 846; the sense strand set forth in SEQ ID NO. 847 and the antisense strand set forth in SEQ ID NO. 848; the sense strand set forth in SEQ ID NO. 849 and the antisense strand set forth in SEQ ID NO. 850; the sense strand set forth in SEQ ID NO. 851 and the antisense strand set forth in SEQ ID NO. 852; the sense strand set forth in SEQ ID NO. 853 and the antisense strand set forth in SEQ ID NO. 854; the sense strand set forth in SEQ ID NO. 855 and the antisense strand set forth in SEQ ID NO. 856; the sense strand set forth in SEQ ID NO. 857 and the antisense strand set forth in SEQ ID NO. 858; the sense strand set forth in SEQ ID NO. 859 and the antisense strand set forth in SEQ ID NO. 860; the sense strand set forth in SEQ ID NO. 861 and the antisense strand set forth in SEQ ID NO. 862; the sense strand set forth in SEQ ID NO. 863 and the antisense strand set forth in SEQ ID NO. 864; the sense strand set forth in SEQ ID NO. 865 and the antisense strand set forth in SEQ ID NO. 866; the sense strand set forth in SEQ ID NO. 867 and the antisense strand set forth in SEQ ID NO. 868; the sense strand set forth in SEQ ID NO. 869 and the antisense strand set forth in SEQ ID NO. 870; the sense strand set forth in SEQ ID NO. 871 and the antisense strand set forth in SEQ ID NO. 872; the sense strand set forth in SEQ ID NO. 873 and the antisense strand set forth in SEQ ID NO. 874; the sense strand set forth in SEQ ID NO. 875 and the antisense strand set forth in SEQ ID NO. 876; the sense strand set forth in SEQ ID NO. 877 and the antisense strand set forth in SEQ ID NO. 878; the sense strand set forth in SEQ ID NO. 879 and the antisense strand set forth in SEQ ID NO. 880; the sense strand as shown in SEQ ID NO. 879 and the antisense strand as shown in SEQ ID NO. 880; the sense strand as shown in SEQ ID NO. 881 and the antisense strand as shown in SEQ ID NO. 882; the sense strand as shown in SEQ ID NO. 883 and the antisense strand as shown in SEQ ID NO. 884; the sense strand as shown in SEQ ID NO. 885 and the antisense strand as shown in SEQ ID NO. 886; the sense strand as shown in SEQ ID NO. 887 and the antisense strand as shown in SEQ ID NO. 888; the sense strand as shown in SEQ ID NO. 889 and the antisense strand as shown in SEQ ID NO. 890; the sense strand as shown in SEQ ID NO. 891 and the antisense strand as shown in SEQ ID NO.

892.

6. A modified double-stranded RNA molecule comprising the double-stranded RNA molecule of any one of claims 1 to 5, and wherein at least one nucleotide is chemically modified, preferably the chemical modification comprises substitution of the ribosyl 2' position hydroxyl group of the nucleotide with another group, and / or modification of the base on the nucleotide, and / or substitution of the ribosyl 5' position hydroxyl group of the nucleotide with another group, further preferably the chemically modified nucleotide is selected from at least one of the group consisting of: 2'-methoxy modified nucleotide, 2'-fluoro modified nucleotide, 5'-(E)-vinyl phosphonate modified nucleotide, 2'-methyl modified nucleotide, deoxy-nucleotide, 2'-deoxy-nucleotide, 3'-terminal deoxy-thymine (dT) nucleotide, 2'-deoxy-modified nucleotide, locked nucleotide, unlocked nucleotide, configuration restricted nucleotide, restricted ethyl nucleotide, abasic nucleotide, 2'-amino-modified nucleotide, 2'-0-allyl-modified nucleotide, 2'-C 1-22 alkyl modified nucleotide, 2'-C 16 alkyl modified nucleotide, 2'-C 22 alkyl modified nucleotide, 2'-hydroxyl-modified nucleotide, 2'-methoxyethyl modified nucleotide, 2'-0-alkyl-modified nucleotide, morpholino nucleotide, nucleotide comprising a non-natural base, tetrahydropyran modified nucleotide, 1,5-anhydrohexitol modified nucleotide, cyclohexenyl modified nucleotide, glycerol nucleotide (GNA), unlocked nucleotide acid (UNA), nucleotide comprising a methylphosphonate group, nucleotide comprising a 5'-phosphate, and nucleotide comprising a 5'-phosphate mimic, more preferably the chemically modified nucleotide is selected from at least one of the group consisting of: 2'-methoxy modified nucleotide, 2'-fluoro modified nucleotide, 5'-(E)-vinyl phosphonate modified nucleotide.

7. The modified double-stranded RNA molecule of claim 6, further comprising modification of phosphodiester between nucleotides, preferably the modification of phosphodiester is phosphorothioate modification.

8. The modified double-stranded RNA molecule of claim 6 or 7, wherein the modified double-stranded RNA molecule is obtained by modifying the double-stranded RNA molecule of any one of claims 1-5 according to any one of the following modification patterns: (1) in the direction from 5' end to 3' end, the nucleotides at positions 1-6, 10-19 of the sense strand are 2'-methoxy modified nucleotides, the nucleotides at positions 7-9 are 2'-fluoro modified nucleotides, the nucleotides at positions 1 and 2 and 2 and 3 are linked by phosphorothioate; the nucleotides at positions 1, 3-5, 7-13, 15, 17-21 of the antisense strand are 2'-methoxy modified nucleotides, the nucleotides at positions 2, 6, 14, 16 are 2'-fluoro modified nucleotides, the nucleotides at positions 1 and 2, 2 and 3, 19 and 20, 20 and 21 are linked by phosphorothioate; (2) in the direction from 5' end to 3' end, the nucleotides at positions 1-6, 10-19 of the sense strand are 2'-methoxy modified nucleotides, the nucleotides at positions 7-9 are 2'-fluoro modified nucleotides, the nucleotides at positions 1 and 2 and 2 and 3 are linked by phosphorothioate; the nucleotide at position 1 of the antisense strand is 2'-methoxy modified and 5'-(E)-vinyl phosphate modified nucleotide, the nucleotides at positions 3-5, 7-13, 15, 17-21 of the antisense strand are 2'-methoxy modified nucleotides, the nucleotides at positions 2, 6, 14, 16 are 2'-fluoro modified nucleotides, the nucleotides at positions 1 and 2, 2 and 3, 19 and 20, 20 and 21 are linked by phosphorothioate; (3) in the direction from 5' end to 3' end, the nucleotides at positions 1-6, 10-19 of the sense strand are 2'-methoxy modified nucleotides, the nucleotides at positions 7-9 are 2'-fluoro modified nucleotides, the nucleotides at positions 1 and 2 and 2 and 3 are linked by phosphorothioate; the nucleotides at positions 1, 3-5, 7-13, 15, 17-21 of the antisense strand are 2'-methoxy modified nucleotides, the nucleotides at positions 2, 6, 14, 16 are 2'-fluoro modified nucleotides, the nucleotides at positions 1 and 2, 2 and 3, 19 and 20, 20 and 21 are linked by phosphorothioate; (4) in the direction from 5' end to 3' end, the nucleotides at positions 1-6, 10-19 of the sense strand are 2'-methoxy modified nucleotides, the nucleotides at positions 7-9 are 2'-fluoro modified nucleotides, the nucleotides at positions 1 and 2 and 2 and 3 are linked by phosphorothioate; the nucleotide at position 1 of the antisense strand is 2'-methoxy modified and 5'-(E)-vinyl phosphate modified nucleotide, the nucleotides at positions 3-5, 7-13, 15, 17-21 of the antisense strand are 2'-methoxy modified nucleotides, the nucleotides at positions 2, 6, 14, 16 are 2'-fluoro modified nucleotides, the nucleotides at positions 1 and 2, 2 and 3, 19 and 20, 20 and 21 are linked by phosphorothioate. ​ ​ (3) in the direction from 5' end to 3' end, the nucleotides at positions 7, 9-11 of the sense strand are 2'-fluoro-modified nucleotides, the nucleotides at other positions are 2'-methoxy-modified nucleotides, the nucleotides at positions 1 and 2 and positions 2 and 3 are connected by phosphorothioate linkage; the nucleotides at positions 2, 6, 14, 16 of the antisense strand are 2'-fluoro-modified nucleotides, the nucleotides at other positions are 2'-methoxy-modified nucleotides, the nucleotides at positions 1 and 2 and positions 2 and 3 are connected by phosphorothioate linkage; (4) in the direction from 5' end to 3' end, the nucleotides at positions 7, 9-11 of the sense strand are 2'-fluoro-modified nucleotides, the nucleotides at other positions are 2'-methoxy-modified nucleotides, the nucleotides at positions 1 and 2 and positions 2 and 3 are connected by phosphorothioate linkage; the nucleotide at position 1 of the antisense strand is 2'-methoxy-modified and 5'-(E)-vinylphosphonate-modified nucleotide, the nucleotides at positions 2, 6, 14, 16 are 2'-fluoro-modified nucleotides, the nucleotides at other positions are 2'-methoxy-modified nucleotides, the nucleotides at positions 1 and 2 and positions 2 and 3 are connected by phosphorothioate linkage.

9. The double-stranded RNA molecule according to any one of claims 1-5, or the modified double-stranded RNA molecule according to any one of claims 6-8, which is further conjugated with a ligand, preferably the ligand is selected from one or more of small molecule compounds, polypeptides, short peptides, proteins, antibodies.

10. A pharmaceutical composition comprising the double-stranded RNA molecule according to any one of claims 1-5 or the modified double-stranded RNA molecule according to any one of claims 5-9, and a pharmaceutically acceptable carrier.

11. Use of the double-stranded RNA molecule according to any one of claims 1-5 or the modified double-stranded RNA molecule according to any one of claims 6-9 or the pharmaceutical composition according to claim 10 in any one of: D1) the manufacture of a medicament for inhibiting the expression of URAT1 gene; D2) the inhibition of the expression of URAT1 gene; D3) the treatment of a disease related to URAT1 gene target; D4) the manufacture of a medicament for the treatment of a disease related to URAT1 gene target.

12. A method for treating a disease related to URAT1 gene target, comprising administering to a subject a therapeutically effective amount of the double-stranded RNA molecule according to any one of claims 1-5 or the modified double-stranded RNA molecule according to any one of claims 6-9 or the pharmaceutical composition according to claim 10.

13. A method for inhibiting the expression of URAT1 gene in a cell, the method comprising: contacting the cell with the double-stranded RNA molecule according to any one of claims 1-5 or the modified double-stranded RNA molecule according to any one of claims 6-9 or the pharmaceutical composition according to claim 10. maintaining the cell for a time sufficient to achieve degradation of the mRNA transcript of the URAT1 gene to inhibit expression of the URAT1 gene in the cell, preferably, the cell is in a subject or in vitro, more preferably, the subject is afflicted with a URAT1 gene target related disease.

14. Use according to claim 11, or method according to claim 12 or 13, wherein the URAT1 gene target related disease is selected from one or more of the group consisting of hyperuricemia, hyperuricemia related gout, hypertension, atherosclerosis, insulin resistance, diabetes, renal hypo-uricemia, hyperuricemia, gout, kidney stones, uric acid kidney stones.

Images