Sirna for inhibiting HSD17b13 gene expression, and modification and use thereof

Abstract

Provided are an siRNA for inhibiting HSD17B13 gene expression, and a modification and a use thereof, belonging to the technical field of biopharmaceuticals. The double-stranded RNA molecule is an siRNA, and the siRNA comprises a sense strand and an antisense strand at least partially forming a double-stranded region, the sense strand comprising a nucleotide sequence that is any odd-numbered sequence from sequences 1-394. The aforementioned siRNA can efficiently degrade HSD17B13 mRNA and significantly reduce HSD17B13 protein levels, and can be used to prepare a novel drug for treating diseases caused by abnormal HSD17B13 expression, including but not limited to fatty liver, NAFLD, and NASH.

Description

A siRNA for inhibiting HSD17B13 gene expression, its modifications, and applications.

[0001] Priority Statement

[0002] This disclosure claims priority to Chinese invention patent application CN2024110437795, filed on July 31, 2024, which is incorporated herein by reference in its entirety. Technical Field

[0003] This disclosure belongs to the field of biomedical technology, specifically relating to an siRNA for inhibiting HSD17B13 gene expression, its modifications, and applications. Background Technology

[0004] The 17B hydroxysteroid dehydrogenase 13 gene is located on the long arm of human chromosome 4, region 22 (4q22.1), containing 8 exons and 7 introns, encoding 17B hydroxysteroid dehydrogenase 13 (HSD17B13). There are 9 different isoforms, with the HSD17B13 isoform AH having a molecular weight between 22-33 kDa and belonging to the HSD17B (Hydroxysteroid dehydrogenases) family. Members of this family possess two conserved domains: a domain associated with NAD(P)(H) binding and a domain crucial for its catalytic activity. This structure determines that HSD17B13 possesses NAD(P)H / NAD(P)+ dependent oxidoreductase activity, capable of catalyzing the interconversion between 17-ketosteroids and 17-hydroxysteroids to maintain the balance between weak (17-keto) and strong (17B-hydroxy) forms of estrogen and androgen. Furthermore, it participates in fatty acid metabolism, cholesterol biosynthesis, and bile acid production.

[0005] This enzyme plays a crucial role in hepatocyte lipid homeostasis and inflammatory responses by regulating these metabolic processes in the liver. Studies have shown that loss-of-function mutations in HSD17B13 (e.g., rs72613567: T>A) can reduce the risk of NASH, cirrhosis, and alcoholic hepatitis (Luukkonen PK, Sakuma I, Gaspar RC, et al. Proceedings of the National Academy of Sciences, 2023, 120(4):e2217543120.), suggesting the importance of this gene in the development of liver pathology.

[0006] NASH (non-alcoholic steatohepatitis) is a severe form of non-alcoholic fatty liver disease (NAFLD). NAFLD refers to excessive fat accumulation in the liver; NAFLD can affect people who rarely or never drink alcohol. NASH is caused by excessive fat deposition in the liver, leading to liver swelling and damage, and can potentially progress to cirrhosis and even liver cancer. The exact cause of NASH is not fully understood, but it is closely related to metabolic syndromes such as obesity, insulin resistance, type 2 diabetes, and hyperlipidemia (e.g., high cholesterol and high triglycerides).

[0007] Currently, only one new NASH drug has been approved for marketing globally. The focus of treatment is on controlling and improving the condition through lifestyle changes, including a healthy diet, weight management, increased physical activity, and management of related metabolic diseases (such as diabetes and hyperlipidemia).

[0008] As a key target in NASH treatment, HSD17B13 has attracted numerous pharmaceutical companies both domestically and internationally to develop NASH-related small nucleic acid (siRNA) drugs. For example, two GalNAc-siRNA drugs from Alnylam Pharmaceuticals / Regeneron Pharmaceuticals and GlaxoSmithKline PLC (GSK) have entered Phase II clinical trials, while AstraZeneca's ASO drug is in Phase I. In China, two GalNAc-siRNA drugs from Viagene Biotech (Shanghai) Co., Ltd. and Suzhou Ribo Life Science Co., Ltd. are in Phase II and preclinical stages, respectively. Small nucleic acid drugs offer advantages such as high specificity, rapid development, potential for personalized treatment, long-lasting effects, and fewer potential side effects. Furthermore, there are currently no marketed drugs for treating NASH; therefore, developing small nucleic acid drugs targeting HSD17B13 has significant implications and market potential. Summary of the Invention

[0009] The technical problem to be solved by this disclosure is to provide siRNA that targets HSD17B13 mRNA, can efficiently degrade HSD17B13 mRNA, and significantly reduce HSD17B13 protein levels. The technical problem to be solved is not limited to the described technical subject matter; other technical subject matter not mentioned herein will be clearly understood by those skilled in the art through the following description.

[0010] To solve the above-mentioned technical problems, this disclosure provides the following technical solutions:

[0011] This disclosure provides a double-stranded RNA molecule, which is any one of 197 siRNAs, the siRNA comprising a sense strand and an antisense strand that at least partially form a double-stranded region, the sense strand comprising a nucleotide sequence represented by any odd number from 1 to 394.

[0012] In the above-mentioned double-stranded RNA molecules, the length of the double-stranded region is 15-30bp, 23-27bp, 21-23bp, 19-21bp, 17-25bp, or 17-23bp.

[0013] Furthermore, the length of the double-stranded region of the double-stranded RNA molecule is 17-21 bp, 19 bp, 20 bp, or 21 bp.

[0014] In the above-mentioned double-stranded RNA molecule, the length of the sense strand does not exceed 30 nucleotides, and / or the length of the antisense strand does not exceed 30 nucleotides.

[0015] In the above-mentioned double-stranded RNA molecule, the length of the sense strand does not exceed 21 nucleotides, and / or the length of the antisense strand does not exceed 21 nucleotides.

[0016] Optionally, the length of the sense strand is 21 nucleotides, and the length of the antisense strand is no more than 21 nucleotides; or, the length of the sense strand is 19 nucleotides, and the length of the antisense strand is no more than 21 nucleotides.

[0017] In the above-mentioned double-stranded RNA molecule, the sense strand and the antisense strand do not contain a 3' overhang, or at least one of the sense strand and the antisense strand contains a 3' overhang with at least one nucleotide, or at least one of the strands contains a 3' overhang with at least two nucleotides.

[0018] Optionally, the sense strand and the antisense strand are completely complementary double-stranded nucleotide sequences; for example, the sense strand and the antisense strand are completely complementary double-stranded nucleotide sequences of 21 bp in length.

[0019] Optionally, the antisense strand includes a 3' overhang of 2 nucleotides. For example, the length of the sense strand is 19 nucleotides, and the length of the antisense strand is no more than 21 nucleotides, with 2 nucleotides overhanging at the 3' end of the antisense strand.

[0020] In the above-mentioned double-stranded RNA molecule, the antisense strand includes a sequence whose nucleotide sequence is any even numbered sequence from 1 to 394.

[0021] In the above-mentioned double-stranded RNA molecules, the nucleotide sequences of the sense strand of the 197 siRNAs are either any odd-numbered sequence from Sequence 1 to 394 or sequences that have more than 90% identity with any odd-numbered sequence, and / or the nucleotide sequences of the antisense strands are either any even-numbered sequence from Sequence 1 to 394 or sequences that have more than 90% identity with any even-numbered sequence.

[0022] The nucleotide sequences of the sense strands of the 197 siRNAs are numbered n, and the nucleotide sequences of the antisense strands of the 197 siRNAs are numbered n+1, where n is any odd number from 1 to 394.

[0023] The nucleotide sequences of the positive strand of the 197 siRNAs also include sequences that have more than 90% identity with any of the sequences indicated by odd numbers in sequences 1-394;

[0024] The nucleotide sequences of the antisense strands of the 197 siRNAs also include sequences that have more than 90% identity with any of the even-numbered sequences shown in sequences 1-394.

[0025] This disclosure also provides double-stranded RNA molecule modifiers, which are compounds containing modified nucleotides obtained by modifying at least one nucleotide of the aforementioned double-stranded RNA molecule.

[0026] In the above-mentioned double-stranded RNA molecule modifications, at least one nucleotide in the sense strand or antisense strand of the double-stranded RNA molecule modification is a modified nucleotide.

[0027] In the above-mentioned double-stranded RNA molecule modifications, the modified nucleotide is a compound formed by replacing the 2' hydroxyl group of the ribosyl group of the nucleotide with other groups, or a compound formed by modifying the bases on the nucleotide.

[0028] In the above-mentioned double-stranded RNA molecule modification, the double-stranded RNA molecule modification further includes linking the modified nucleotides through thiophosphate groups.

[0029] In the above-mentioned double-stranded RNA molecule modifications, the modified nucleotide is selected from at least one of the following groups: 2'-methoxy-modified nucleotides, 2'-fluorine-modified nucleotides, nucleotides containing phosphate thioester groups, deoxy-nucleotides, 2'-deoxy-nucleotides, 3'-terminal deoxy-thymidine (dT) nucleotides, 2'-deoxy-modified nucleotides, locked nucleotides (LNA), non-locked nucleotides, configuration-restricted nucleotides, restricted ethyl nucleotides, base-free nucleotides, 2'-amino-modified nucleotides, 2'-O-allyl-modified nucleotides, etc. Nucleotides modified with 2'-C-alkyl, 2'-hydroxy, 2'-methoxyethyl, 2'-O-alkyl, morpholinonucleotides, nucleotides containing non-natural bases, tetrahydropyran-modified nucleotides, 1,5-dehydrohexyl-modified nucleotides, cyclohexenyl-modified nucleotides, glycerol nucleotides (GNA), open-ring nucleotides (UNA), nucleotides containing methylphosphonate groups, nucleotides containing 5'-phosphates, and nucleotides containing 5'-phosphate mimics.

[0030] In an optional embodiment, each nucleotide of the positive strand is independently selected from 2'-methoxy modified nucleotides, 2'-fluoro modified nucleotides, or deoxyribonucleotides, and at least 2-11 2'-fluoro modified nucleotides are present at positions 3-19 of the positive strand in the direction from the 5' end to the 3' end.

[0031] Optionally, the positive strand contains at least 2-5 2'-fluorinated nucleotides at positions 3-19, following the direction from the 5' end to the 3' end.

[0032] Optionally, the positive strand contains at least 2, 3, 4, 5 or 10 2'-fluorinated nucleotides in positions 3-19, following the direction from the 5' end to the 3' end.

[0033] Optionally, the nucleotide site in the positive strand that is 2'-fluorinated is selected from one or more of the 3rd, 5th, 7th, 8th, 9th, 10th, 11th, 13th, 15th, 17th or 19th positions.

[0034] In an optional embodiment, each nucleotide of the sense strand and the antisense strand is independently selected from 2'-methoxy modified nucleotides, 2'-fluoro modified nucleotides, GNA modified nucleotides, or deoxyribonucleotides, and at least one 2'-fluoro modified nucleotide is present at position 7-9 of the sense strand in the direction from the 5' end to the 3' end.

[0035] Optionally, the 7th or 9th position of the positive strand is a nucleotide modified with 2'-fluorination.

[0036] Optionally, the positive strand contains two 2'-fluorinated nucleotides at positions 7-9.

[0037] Optionally, positions 7-9 of the positive strand are nucleotides modified with 2'-fluorination.

[0038] Further optionally, in addition to positions 7-9, the positive strand also includes at least one nucleotide with an odd-numbered position that is 2'-fluorinated.

[0039] Further optionally, at least one of the 3rd, 5th, 11th, 13th, 15th, 17th, and 19th positions of the positive strand is a 2'-fluorinated nucleotide.

[0040] In an optional implementation, the number of deoxyribonucleic acid molecules contained in the positive chain does not exceed three.

[0041] Optionally, the 7th to 9th positions of the positive strand contain at least one deoxyribonucleic acid, following the direction from the 5' end to the 3' end.

[0042] Optionally, the number of deoxyribonucleic acid molecules contained in the positive chain is 1.

[0043] Optionally, the 9th position of the justice chain is deoxyribonucleic acid (DNA).

[0044] In an optional embodiment, each nucleotide of the antisense strand is independently selected from 2'-methoxy modified nucleotides, 2'-fluoro modified nucleotides, GNA modified nucleotides, or deoxyribonucleotides, and the antisense strand contains at least 4-8 2'-fluoro modified nucleotides at positions 2-20 in the direction from the 5' end to the 3' end.

[0045] Optionally, the antisense strand contains at least 4, 5, 6, 7 or 8 2'-fluoro-modified nucleotides at positions 2-20.

[0046] Optionally, at least one even-numbered position in the antisense strand is a nucleotide modified with 2'-fluorination.

[0047] Optionally, the 2'-fluorinated nucleotide in the antisense strand is selected from one or more of the positions 2, 4, 6, 8, 9, 10, 12, 14, 16, 18, or 20.

[0048] In an optional embodiment, each nucleotide of the antisense strand is independently selected from 2'-methoxy modified nucleotides, 2'-fluoro modified nucleotides, GNA modified nucleotides, or deoxyribonucleotides, and at least one 2'-fluoro modified nucleotide is present at position 2, position 14, or position 16 of the antisense strand, in the direction from the 5' end to the 3' end.

[0049] Optionally, the antisense strand contains two or three 2'-fluorinated nucleotides at positions 2, 14, or 16.

[0050] Further optionally, in addition to positions 2, 14, and 16, the antisense strand also includes at least one nucleotide with an even number of 2'-fluorinated positions.

[0051] Further optionally, the antisense strand may contain at least one 2'-fluorinated nucleotide at positions 4, 6, 8, 9, 10, 12, 18, or 20.

[0052] In an optional implementation, the antisense strand contains no more than three deoxyribonucleic acids.

[0053] Optionally, the antisense strand contains at least one deoxyribonucleic acid at positions 5-7, following the direction from the 5' end to the 3' end.

[0054] Optionally, the antisense strand contains two deoxyribonucleic acid molecules.

[0055] Optionally, the 5th and 7th positions of the antisense strand are deoxyribonucleic acid.

[0056] In an optional implementation, the number of GNA-modified nucleotides in the antisense strand does not exceed three.

[0057] Optionally, the antisense strand contains at least one GNA-modified nucleotide at positions 5-7, following the direction from the 5' end to the 3' end.

[0058] Optionally, the antisense strand contains one GNA-modified nucleotide.

[0059] Optionally, the 7th position of the antisense strand is a GNA-modified nucleotide.

[0060] In an optional implementation, the length and nucleotide modifications of the positive strand, following the direction from the 5' end to the 3' end, are selected from any of the following:

[0061] (a1) The length of the positive strand is 19nt, and the modification method corresponding to each nucleotide is: mmmmmmfffmmmmmmmmmm;

[0062] (b1) The length of the positive strand is 19nt, and the modification method corresponding to each nucleotide is: mmmmfmfffmmmmmmmmmmmm;

[0063] (c1) The length of the positive strand is 19nt, and the modification of each nucleotide is: mmfmfmfffmfmfmfmfmf;

[0064] (d1) The length of the positive strand is 19nt, and the modification of each nucleotide is: mmmmfmfffmmmmmfmmmm;

[0065] (e1) The length of the positive strand is 19nt, and the modification of each nucleotide is: mmmmmmff-(d)-mmmmmmmmmm;

[0066] (g1) The length of the positive strand is 21nt, and the modification method corresponding to each nucleotide is: mmmmmmfmfmfmmmmmmmmmm;

[0067] (h1) The length of the positive strand is 21nt, and the modification of each nucleotide is: mmmmmmmmfffmmmmmmmmmm;

[0068] Where m is a 2'-methoxy modified nucleotide, f is a 2'-fluoro modified nucleotide, d is deoxyribonucleic acid, and GNA is a GNA modified nucleotide.

[0069] In an optional embodiment, the antisense strand is 21 nt in length, from the 5' end to the 3' end, and the nucleotide modification of the antisense strand is selected from any of the following: (a2)mfmmmfmmmmmmmfmfmmmmm; (b2)mfmmmfmffmmmmfmfmmmmm; (c2)mfmfmfmfmfmfmfmfmmmm; (d2)mfmmmfmfmmmmmfmfmmmmm; (e2)mfmm-(d)-m-(d)-mmfmfmfmfmfmfm; (f2)mfmmmmmmmmmfmfmmmmm; (g2)mfmm-(d)-m-(GNA)-mmfmfmfmfmfmfm;

[0070] Where m is a 2'-methoxy modified nucleotide, f is a 2'-fluoro modified nucleotide, d is deoxyribonucleic acid, and GNA is a GNA modified nucleotide.

[0071] In an optional embodiment, the double-stranded RNA molecule modification, oriented from the 5' end to the 3' end, contains the following optional combinations of sense and antisense strands:

[0072] (A) The length of the positive strand is 19nt, and the modification of each nucleotide is: mmmmmmfffmmmmmmmmmm;

[0073] The antisense strand is 21 nt in length, and the modification of each nucleotide is: mfmmmfmmmmmmmfmfmmmmm;

[0074] (B) The length of the positive strand is 19nt, and the modification of each nucleotide is: mmmmfmfffmmmmmmmmmmmm;

[0075] The antisense strand is 21 nt in length, and the modification of each nucleotide is: mfmmmfmffmmmmfmfmmmmm;

[0076] (C) The length of the positive strand is 19nt, and the modification of each nucleotide is: mmmmfmfffmmmmmmmmmmmm;

[0077] The antisense strand is 21 nt in length, and the modification of each nucleotide is: mfmmmfmmmmmmmfmfmmmmm;

[0078] (D) The length of the positive strand is 19nt, and the modification of each nucleotide is: mmfmfmfffmfmfmfmfmf;

[0079] The antisense strand is 21 nt in length, and the modification of each nucleotide is: mfmfmfmfmfmmmfmfmfmmm;

[0080] (E) The length of the positive strand is 19nt, and the modification of each nucleotide is: mmmmfmfffmmmmmfmmmm;

[0081] The antisense strand is 21 nt in length, and the modification of each nucleotide is: mfmmmfmfmmmmmfmfmmmmm;

[0082] (F) The length of the positive strand is 19nt, and the modification of each nucleotide is: mmmmmmff-(d)-mmmmmmmmmm;

[0083] The antisense strand is 21 nt in length, and the modification of each nucleotide is: mfmmmfmmmmmmmfmfmmmmm;

[0084] (G) The length of the positive strand is 19nt, and the modification of each nucleotide is: mmmmmmfffmmmmmmmmmm;

[0085] The antisense strand is 21 nt in length, and the modification of each nucleotide is: mfmm-(d)-m-(d)-mmfmfmfmfmfmfm;

[0086] (H) The length of the positive strand is 19nt, and the modification of each nucleotide is: mmmmmmfffmmmmmmmmmm;

[0087] The antisense strand is 21 nt in length, and the modification of each nucleotide is: mfmm-(d)-m-(GNA)-mmfmfmfmfmfmfm;

[0088] (I) The length of the positive strand is 21nt, and the modification of each nucleotide is: mmmmmmfmfmfmmmmmmmmmm;

[0089] The antisense strand is 21 nt in length, and the modification of each nucleotide is: mfmmmmmmmmmfmfmfmmmmm;

[0090] (J) The length of the positive strand is 21nt, and the modification of each nucleotide is: mmmmmmmmfffmmmmmmmmmm;

[0091] The antisense strand is 21 nt in length, and the modification of each nucleotide is: mfmm-(d)-m-(GNA)-mmfmfmfmfmfmfm;

[0092] Where m is a 2'-methoxy modified nucleotide, f is a 2'-fluoro modified nucleotide, d is deoxyribonucleic acid, and GNA is a GNA modified nucleotide.

[0093] In an optional embodiment, the 3'-terminal and / or 5'-terminal nucleotides of the antisense strand of the double-stranded RNA molecule modification contain phosphate esters or their derivatives.

[0094] Optionally, the phosphate ester or its derivative is selected from vinyl phosphate esters (such as (E)-vinyl phosphate ester), alkylated derivatives of vinyl phosphonates, arylated derivatives of vinyl phosphonates, halogenated derivatives of vinyl phosphonates, hydroxylated derivatives of vinyl phosphonates, aminated derivatives of vinyl phosphonates, carboxylated derivatives of vinyl phosphonates, thiolated derivatives of vinyl phosphonates, silanized derivatives of vinyl phosphonates, borated derivatives of vinyl phosphonates, or metal complex derivatives of vinyl phosphonates.

[0095] Optionally, the 5'-terminal nucleotide of the antisense strand of the double-stranded RNA molecule modification contains 5'-(E) vinyl phosphate or a derivative thereof.

[0096] Optionally, the 3'-end and / or 5'-end of the positive strand of the double-stranded RNA molecule modification is further linked with an inverted abase-free nucleotide (invAb) (5'-5' linked or 3'-3' linked abase-free nucleotide).

[0097] Optionally, when invAb is attached to the 5' end of the justice chain, the structure is as follows: It can also be a thiophosphate modified (invAb)s: When invAb is connected at the 3' end of the justice chain, it is as follows:

[0098] In the above-mentioned double-stranded RNA molecule modifications, a ligand is also attached to any nucleotide at the 3'-end or 5'-end of the positive strand or in the middle of the positive strand.

[0099] In the above-mentioned double-stranded RNA molecule modifications, the ligand is a small molecule, antibody, polypeptide, protein, or aptamer.

[0100] In the above-mentioned double-stranded RNA molecule modifications, the small molecules include glycoligands, such as N-acetylgalactosamine (GalNAc) or its derivatives.

[0101] Optionally, the derivatives include, but are not limited to, sulfated, phosphorylated, acetylated, or alkylated forms of GalNAc.

[0102] Optionally, the glycoligand is a multivalent form of GalNAc, which is covalently linked to a small nucleic acid molecule via a multivalent linker arm.

[0103] Optionally, the multivalent connecting arm is selected from:

[0104] Optionally, the ligand is L96 as shown in the following formula:

[0105] Optionally, the ligand is attached to the 3'-terminus of the justice chain.

[0106] Optionally, when the 3'-end of the positive strand is attached with an inverse abase-free nucleotide (invAb), L96 and invAb are connected via a phosphate ester (invAb-L96: ) or thiophosphate ((invAb)s-L96: )connect.

[0107] Optionally, the double-stranded RNA molecule modification is linked to a ligand, with the structure shown below:

[0108] Where X is O or S.

[0109] Optionally, the double-stranded RNA molecule modification is linked to a ligand, with the structure shown below:

[0110] This disclosure also provides a composition for inhibiting the expression of the HSD17B13 gene, wherein the active ingredient of the composition is a double-stranded RNA molecule or a double-stranded RNA molecule modification as described in any of the foregoing embodiments.

[0111] The use of the double-stranded RNA molecule described in any of the foregoing embodiments, or the double-stranded RNA molecule modified according to any of the foregoing embodiments, or the composition described in any of the foregoing embodiments, in any of the following:

[0112] (D1) Application in the preparation of compositions that inhibit HSD17B13 gene expression;

[0113] (D2) Application in inhibiting HSD17B13 gene expression;

[0114] (D3) Application in the treatment of diseases related to the HSD17B13 gene target;

[0115] (D4) Application in the preparation of compositions for treating diseases related to the HSD17B13 gene target;

[0116] (D5) Application in the preparation of dimer siRNA.

[0117] This disclosure also provides a dimer siRNA comprising any one antisense strand of the double-stranded RNA molecule or double-stranded RNA molecule modification described in any of the above embodiments.

[0118] Optionally, the dimer siRNA further comprises a second siRNA, wherein the sense strand of the second siRNA is covalently linked to the sense strand of the siRNA in any embodiment of this disclosure.

[0119] Optionally, the dimer siRNA comprises any one antisense strand and a perfectly or partially complementary sense strand from any of the double-stranded RNA molecules or double-stranded RNA molecule modifications described in any of the above embodiments.

[0120] Optionally, the dimer siRNA comprises the double-stranded RNA molecule or double-stranded RNA molecule modification described in any of the above embodiments.

[0121] Optionally, the positive strand of the dimer siRNA is conjugated with at least one ligand.

[0122] Optionally, the ligand comprises N-acetylgalactosamine (GalNAc) or a derivative thereof.

[0123] Optionally, the ligand is one or more GalNAc derivatives attached via a monovalent, divalent, trivalent, or tetravalent ligand head.

[0124] Optionally, the ligand is L96.

[0125] Optionally, the ligand is conjugated to the 3' end of the positive strand of one of the siRNAs.

[0126] This disclosure also provides the application of the above-mentioned double-stranded RNA molecules or double-stranded RNA molecule modifications in the preparation of dimer siRNA.

[0127] This disclosure also provides a composition for inhibiting the expression of the HSD17B13 gene, wherein the active ingredient of the composition is the aforementioned double-stranded RNA molecule or the aforementioned double-stranded RNA molecule modification.

[0128] The above composition further includes a pharmaceutically acceptable carrier.

[0129] The composition may be a pharmaceutical composition or a kit.

[0130] The pharmaceutical composition described above also comprises an unbuffered solution.

[0131] The unbuffered solution in the pharmaceutical composition described above is physiological saline or water.

[0132] The pharmaceutical composition described above also includes a buffer solution.

[0133] The buffer solution in the pharmaceutical composition described above comprises acetate, citrate, alcohol-soluble gluten, carbonate, or phosphate, or any combination thereof.

[0134] The buffer solution in the drug composition described above is phosphate-buffered saline (PBS).

[0135] In the above compositions, the compositions comprise lipid formulations, nanoformulations, or lipid-containing vesicles.

[0136] In the above composition, the lipid formulation is an LNP formulation, the nano-formulation is polymer nanoparticles, and the lipid-containing vesicles are exosomes, preferably artificially modified exosomes.

[0137] This disclosure also provides a cell comprising the aforementioned double-stranded RNA molecule, the aforementioned double-stranded RNA molecule modification, and / or the aforementioned composition.

[0138] This disclosure also provides a method for inhibiting the expression of the HSD17B13 gene in cells, the method comprising:

[0139] (a) Contact the cells with the double-stranded RNA molecule described in any of the foregoing embodiments, the double-stranded RNA molecule modifier described in any of the foregoing embodiments, and / or the composition described in any of the foregoing embodiments.

[0140] (b) Maintain the cells produced in step (a) for a period of time sufficient to allow for the degradation of the HSD17B13 gene mRNA transcript, thereby suppressing HSD17B13 gene expression in the cells.

[0141] In the above method, the cells are 293T cells.

[0142] In the above method, the expression of the HSD17B13 gene is suppressed by at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 100%.

[0143] In this disclosure, the HSD17B13 gene target-related diseases can be diseases caused by abnormal expression of the HSD17B13 gene.

[0144] In this disclosure, the disease caused by abnormal HSD17B13 gene expression may be a disease caused by upregulation of HSD17B13 gene expression.

[0145] In this disclosure, diseases related to the HSD17B13 gene target or diseases caused by upregulation of HSD17B13 gene expression include, but are not limited to, liver disease, non-alcoholic fatty liver disease (NAFLD), simple fatty liver, non-alcoholic steatohepatitis (NASH), hepatitis, liver fibrosis, cirrhosis, alcoholic steatohepatitis (ASH), alcoholic fatty liver disease (ALD), HCV-related cirrhosis, drug-induced liver injury, hepatocellular necrosis, and chronic fibrositis-related liver disease.

[0146] Furthermore, the pharmaceutically acceptable carrier may be an excipient, stabilizer, suspending agent, or diluent, as is well known to those skilled in the art.

[0147] In this disclosure, "modified nucleotide" includes nucleotides or nucleotide analogs formed by replacing the 2'-hydroxyl group of the ribosyl group with another group, or nucleotides in which the bases on the nucleotide are modified bases. "Methoxy-modified nucleotide" refers to nucleotides formed by replacing the 2'-hydroxyl group of the ribosyl group with a methoxy group. "Fluoro-modified nucleotide" refers to nucleotides formed by replacing the 2'-hydroxyl group of the ribosyl group with fluorine.

[0148] In this disclosure, "nucleotide analogue" refers to a group that can replace a nucleotide in nucleic acids, but whose structure differs from that of adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide, or thymine deoxyribonucleotide. Examples include isonucleotides, bridged nucleic acids (BNAs), or acyclic nucleotides.

[0149] In this disclosure, "invAb" (inverted abasic) is a reverse-abasic nucleotide (or reverse-debasic nucleotide, or inverted abasic nucleotide) introduced into DNA or RNA. Specifically, invAb involves inserting a debasic nucleotide into a nucleic acid strand in an "inverted" manner (5'-5' linkage or 3'-3' linkage). Debasication refers to the removal of a base from the nucleotide, leaving only the deoxyribose or ribose portion. This inverted structure causes the 5' and 3' carbons of the sugar ring to be linked in the opposite direction to those of a normal nucleotide. The phosphate group remains linked to the 5' and 3' carbons of the sugar ring, but due to the inversion of the sugar ring, the phosphate backbone is oriented in the opposite direction to that of a normal nucleotide. When invAb is linked to the 5' end, the structure is as follows: It can also be a thiophosphate modified (invAb)s: When invAb is connected at the 3' end, it is as follows:

[0150] In one embodiment of this disclosure, a "fluorinated nucleotide" refers to a nucleotide formed by replacing the hydroxyl group at the 2' position of the ribosyl group with fluorine, having the structure shown in formula (1). The non-fluorinated nucleotide is independently selected from nucleotides or nucleotide analogs formed by replacing the hydroxyl group at the 2' position of the ribosyl group with a non-fluorinated group.

[0151] In one embodiment of this disclosure, the nucleotide formed by replacing the hydroxyl group at the 2' position of the ribosome with a non-fluorinated group is well known to those skilled in the art. These nucleotides may be selected from one of the following: 2'-alkoxy modified nucleotides, 2'-substituted alkoxy modified nucleotides, 2'-alkyl modified nucleotides, 2'-substituted alkyl modified nucleotides, 2'-amino modified nucleotides, 2'-substituted amino modified nucleotides, and 2'-deoxynucleotides.

[0152] In one embodiment of this disclosure, the 2'-alkoxy modified nucleotide is a 2'-methoxy (2'-OMe) modified nucleotide, as shown in Formula (2), i.e., methoxy modified; the 2'-substituted alkoxy modified nucleotide may be, for example, a 2'-O-methoxyethyl (2'-MOE) modified nucleotide, as shown in Formula (3); the 2'-amino (2'-NH2) modified nucleotide is shown in Formula (4); and the 2'-deoxynucleotide (DNA) is shown in Formula (5).

[0153] In one embodiment of this disclosure, the nucleotide analogue refers to a group that can replace a nucleotide in a nucleic acid, but whose structure differs from that of adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide, or thymine deoxyribonucleotide.

[0154] In one embodiment of this disclosure, the nucleotide analog may be an isonucleotide, a bridged nucleotide, or an acyclic nucleotide.

[0155] In one embodiment of this disclosure, the bridged nucleic acid (BNA) refers to a restricted or inaccessible nucleotide. The BNA may contain a bridging structure with a "fixed" C3'-endoglucan condensation of a five-membered, six-membered, or seven-membered ring. Typically, the bridge is incorporated into the 2'-, 4'-position of the ribose to provide a 2',4'-BNA nucleotide.

[0156] In one embodiment of this disclosure, the BNA may be LNA, ENA, cET BNA, etc., wherein LNA is as shown in formula (6), ENA is as shown in formula (7), and cET BNA is as shown in formula (8).

[0157] In one embodiment of this disclosure, the phosphate group having the modifying group is a thiophosphate group having the structure shown in formula (9). In one embodiment of this disclosure, the nucleotide linked to the thiophosphate group is shown in formula (10).

[0158] In one embodiment of this disclosure, the VP-modified nucleotide is a vinyl phosphate ester modified. In one embodiment of this disclosure, the VP-modified and methoxy-modified nucleotide, namely the nucleotide modified with 5'-(E)-vinyl-2'-methoxy-modified phosphonate group (5'-(E)-VP-2'-OMe), is as shown in formula (11).

[0159] VPAms are shown in Equation (12), VPUms are shown in Equation (13), VPGms are shown in Equation (14), and VPCms are shown in Equation (15):

[0160] In one embodiment of this disclosure, GNA represents diol nucleic acid. The structure of A(GNA) is shown in Equation (16), the structure of G(GNA) is shown in Equation (17), the structure of C(GNA) is shown in Equation (18), the structure of U(GNA) is shown in Equation (19), and the structure of T(GNA) is shown in Equation (20).

[0161] The advantage of this disclosure is that it provides siRNAs that are highly efficient at degrading HSD17B13 mRNA and significantly reducing HSD17B13 protein levels, screened with HSD17B13 mRNA as the target. This will enable the development of novel drugs for treating diseases caused by abnormal HSD17B13 expression, including but not limited to liver diseases, non-alcoholic fatty liver disease (NAFLD), simple fatty liver, non-alcoholic steatohepatitis (NASH), hepatitis, liver fibrosis, cirrhosis, alcoholic steatohepatitis (ASH), alcoholic fatty liver disease (ALD), HCV-related cirrhosis, drug-induced liver injury, hepatocellular necrosis, and chronic fibrositis. Detailed Implementation

[0162] The present disclosure will now be described in further detail with reference to specific embodiments. The embodiments given are merely illustrative of the present disclosure and are not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the present disclosure in any way.

[0163] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0164] Table 1 shows the experimental reagents, consumables, and instruments used in the following examples.

[0165] In the methods for preparing siRNA as described in this disclosure, unless otherwise specified, nucleoside monomer refers to the modified or unmodified RNA phosphoramidites (sometimes also called nucleoside phosphoramidites) used in phosphoramidite solid-phase synthesis, depending on the type and sequence of nucleotides in the desired siRNA. Phosphoramidite solid-phase synthesis is a method known to those skilled in the art for the synthesis of siRNA. All nucleoside monomers used in this disclosure are commercially available.

[0166] It is worth noting that the raw materials used in this disclosure are all commercially available products, and their sources are not specifically limited.

[0167] The following sources of raw materials are provided as examples:

[0168] The abbreviations for nucleotide monomers used in nucleic acid sequence listings are shown in the table below.

[0169] Table 3 Nucleotide Monomer Table

[0170] In the quantitative experiments in the following examples, three replicate experiments were set up, and the average value of the results was taken.

[0171] The following examples involve five positive control siRNA products derived from the five siRNAs shown in Table 13 on page 256 of patent document WO2019183164A1: PC1: AD-288917 (the modified positive and antisense strand sequences are 4486 and 4487, respectively), PC2: AD-288996 (the modified positive and antisense strand sequences are 4488 and 4489, respectively), PC3: AD-413639 (the modified positive and antisense strand sequences are 4490 and 4491, respectively), PC4: AD-413644 (the modified positive and antisense strand sequences are 4492 and 4493, respectively), and PC5: AD-413669 (the modified positive and antisense strand sequences are 4494 and 4495, respectively).

[0172] The following examples use GraphPad Prism statistical software to process the data, and the experimental results are expressed as mean ± standard deviation.

[0173] Example 1: Design and Modification of siRNA

[0174] HSD17B13 mRNA refers to mRNA with the sequence shown in GeneBank accession numbers NM_001136230.3 or NM_178135.5.

[0175] In this embodiment, siRNA was designed using the mRNA with the sequence shown in NM_001136230.3 (submission date: 06-APR-2024, URL: https: / / www.ncbi.nlm.nih.gov / nuccore / NM_001136230.3 / ). The siRNA is a double-stranded RNA composed of a sense strand and an antisense strand. Specific information is shown in the table below.

[0176] The siRNA used in the experiment was synthesized by Suzhou GeneGene Co., Ltd., and stored at -20℃.

[0177] Table 4 Unmodified siRNA sequences

[0178] In Table 4, the first column is the siRNA number (where "HSD-number" indicates the siRNA sequence number and UM indicates unmodified), the second column is the siRNA positive strand (19 nucleotides in length), the third column is the siRNA positive strand sequence number, the fourth column is the siRNA negative strand (21 nucleotides in length), and the fifth column is the siRNA negative strand sequence number.

[0179] Based on the siRNAs shown in Table 4, this disclosure obtained modified siRNAs with different modifications through different modification modes. The specific modification methods of the M1 modification mode are as follows:

[0180] M1 Modification Mode:

[0181] The 19 nucleotides in the 5'-3' of the positive strand are modified as follows: ms-ms-mmmmfffmmmmmmmmmm;

[0182] That is, the nucleotides at positions 1-6 and 10-19 of the positive chain are 2'-methoxy modified nucleotides, the nucleotides at positions 7-9 are 2'-fluorinated modified nucleotides, and the nucleotides at positions 1 and 2, as well as positions 2 and 3, are linked by thiophosphate groups.

[0183] The antisense strand 5'-3', consisting of 21 nucleotides, contains the following modifications: ms-fs-mmmfmmmmmmmfmfmm-ms-ms-m;

[0184] That is, the nucleotides at positions 1, 3-5, 7-13, 15, and 17-21 of the antisense strand are nucleotides modified with 2'-methoxy groups, the nucleotides at positions 2, 6, 14, and 16 are nucleotides modified with 2'-fluoride groups, and the nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 are linked by thiophosphate groups.

[0185] The naming convention for modified siRNA is "siRNA number before modification" + "modification pattern". For example, the modified HSD-52UM obtained by modifying the sense and antisense strands of HSD-52UM with M1 is named "HSD-52M1" or simply "52M1".

[0186] Example 2: Detection of the on-target activity of modified siRNA used to inhibit HSD17B13

[0187] The experimental procedure is as follows:

[0188] Step 1: Construct the detection plasmid HSD17B13-psiCHECK2

[0189] Using psiCHECK TM -2(Promega TM The detection plasmid was constructed, containing the insertion sequences C1, C2, C3, and C4 as shown in Table 5. A single copy of the sequence was cloned into psiCHECK. TM -2 Xho I / Not I sites of plasmid were used to obtain detection plasmids HSD17B13-psiCHECK2-C1, HSD17B13-psiCHECK2-C2, HSD17B13-psiCHECK2-C3 and HSD17B13-psiCHECK2-C4.

[0190] Table 5. Target gene sequence of psiCHECK2 plasmid

[0191] Step 2: Cell Culture and Transfection

[0192] Experimental group: siRNA was added to each well of a 96-well plate at a rate of 5 μL per well (three final concentrations were set for each siRNA molecule: 1 nM, 0.1 nM, and 0.01 nM). 20 ng of the above-mentioned detection plasmids (HSD17B13-psiCHECK2-C1, HSD17B13-psiCHECK2-C2, HSD17B13-psiCHECK2-C3, and HSD17B13-psiCHECK2-C4) was added to each well at a rate of 12.5 μL per well. Opti-MEM was added to each well at a rate of 32.5 μL per well. TM Furthermore, Lipofectamine was added at a rate of 0.3 μL per well. TM 2000 (purchased from) After incubating the sample (product number 11668-019) at room temperature (23°C) for 15 minutes, a mixture was obtained. A solution containing 1×10⁻⁶ ppm was added to the mixture at a rate of 50 μL per well. 4 DMEM complete medium for 293T cells (purchased from Transgen) The sample (product number FI101-01) was incubated at 37℃ for 24 hours and used for subsequent dual-luciferase assay.

[0193] MOCK group (i.e., Mock Treatment Group): This group only received transfection reagents and no siRNA.

[0194] BLANK group (also known as Blank Control Group): This group consists of only cells.

[0195] Table 6. Correspondence between psiCHECK2 plasmid and siRNA

[0196] Step 3: Dual-luciferase assay

[0197] The dual-luciferase assay kit (purchased from Prometheus) was used. Dilute the 5× lysis buffer (product number E2940) with water to a final 1× lysis buffer. Take the cells obtained from step two, discard the supernatant, and irrigate each well with PBS buffer (purchased from [unspecified source]). After diluting and washing twice, 1× lysis buffer (product code SH30256.01) was added to each well of the cell plate at a rate of 50 μL per well. The cells were lysed at room temperature (23℃) for 20 min to obtain lysed cell plates. 30 μL of lysis buffer per well was then added to each well of an opaque 96-well detection plate. The dual-luciferase assay kit was prepared according to the instructions, and substrate 1 and substrate 2 were added to each well of the opaque 96-well detection plate at a rate of 30 μL per well. After each addition of substrate, the results were obtained using a multi-functional microplate reader to measure the luciferase levels of firefly and Renilla luciferase.

[0198] The renin luminescence values ​​in each well were normalized using firefly luminescence values, with the formula R = renin luminescence / firefly luminescence. The luminescence ratio for each experimental or control group was the average of the luminescence ratios from its three culture wells. Compared to the control group, the degree of inhibition of HSD17B13 mRNA levels by each siRNA was expressed as a percentage, with inhibition rate % = (1 - R). 实验组 / R MOCK组 )×100%.

[0199] The target activity results of 195 siRNAs are shown in the table below.

[0200] Table 7. Target activity results (R value) of modified siRNAs.

[0201] Example 3: Detection of the on-target activity of modified siRNA for inhibiting HSD17B13 in HepG2-HSD17B13 cells.

[0202] Experimental principle: siRNA was transfected into selected cell lines, where it interfered with and silenced the target HSD17B13-mRNA. The relative expression levels of the HSD17B13 target gene in the cells were determined using relative quantification methods; the activity of silencing HSD17B13-mRNA at each sequence was analyzed.

[0203] Step 1: Cell Culture and Transfection

[0204] HepG2 HSD17B13 cells cultured in 10cm dishes were routinely trypsinized after 48 hours of passage. The cells were resuspended in complete culture medium and diluted to 3×10⁻⁶. 5 50 μL / well was seeded into a 96-well plate for subsequent experiments.

[0205] This embodiment, based on Example 2, selected a portion of siRNA as the experimental group, and MOCK and BLANK as control groups. The MOCK group was the group that only added interference reagent without any sequence; the BLANK group was the group with only cells. siRNA concentration gradients were set up for transfection: 1 nM, 0.1 nM, and 0.01 nM. After accounting for loss, the transfection complex was prepared by diluting siRNA and 0.25 μL of Lipofectamine RNAiMAX in each well with 25 μL opti-MEM. After the transfection reagent has stood for 5 minutes, mix the two components and let stand for 20 minutes. After standing for 20 minutes, add 50 μL of the transfection complex to each well, making a final volume of 100 μL per well. Approximately 6 hours after transfection, discard the transfection complex, add 100 μL of complete culture medium to each well, and continue culturing. 48 hours after transfection, discard the cell supernatant. For adherent cells, slowly add an equal volume of pre-chilled 1×PBS to wash, slowly remove the PBS, and place on ice for later use.

[0206] Step 2: Cell Sample Processing

[0207] Preparation of lysis buffer:

[0208] Table 8. Cell lysis reaction system

[0209] Add 50 μL of the prepared lysis buffer to each well of the cell culture plate, gently pipette 8-10 times to mix thoroughly, and let stand at room temperature for 5 minutes to lyse the cells.

[0210] After lysis, add 5 μL of stop solution to each well of the cell culture plate, gently pipette 8-10 times to mix, and let stand at room temperature for 2 minutes to terminate the reaction.

[0211] Step 3: RT-qPCR

[0212] RNA template preparation: 50 μL of cell lysis buffer was diluted with 150 μL of DEPC H2O.

[0213] Table 9. Reaction system for one-step RT-qPCR probe method

[0214] Dispense 9.75 μL of the prepared PCR reaction solution into each well of a 384-well plate, add 3.25 μL of RNA template to each well, and finally add 3 μL of paraffin oil. After sealing the plate with a sealing film, centrifuge at 3000 rpm for 1 min.

[0215] Detection on the instrument: Perform real-time PCR on an LC480, the procedure is as follows:

[0216] Table 10. RT-qPCR reaction procedure

[0217] Step 4: Statistical Analysis

[0218] The expression levels of the target gene HSD17B13 in each experimental group and the control group were relatively quantitatively calculated using the Ct(ΔΔCt) method. The calculation method is as follows: ΔCt(experimental group) = Ct(target gene in experimental group) – Ct(internal reference gene in experimental group, GAPDH); ΔCt(control group) = Ct(target gene in control group) – Ct(internal reference gene in control group, GAPDH); ΔΔCt(experimental group) = ΔCt(experimental group) - ΔCt(average in control group); ΔΔCt(control group) = ΔCt(control group) - ΔCt(average in control group).

[0219] In this study, each experimental group consisted of cells treated with a specific siRNA, while the control group consisted of cells not treated with siRNA. ΔCt (control group average) was the arithmetic mean of the ΔCt (control group) values ​​from the three culture wells in the control group. Therefore, each culture well in both the experimental and control groups corresponded to a single ΔCt value.

[0220] Using the control group as a baseline, the expression level of HSD17B13 mRNA in the experimental group was normalized. The expression level of HSD17B13 mRNA in the control group was defined as 100%, and the relative expression level of HSD17B13 mRNA in the experimental group was defined as 2 - ΔΔCt(experimental group) × 100%.

[0221] For the same experimental group of siRNA, the average relative expression level of HSD17B13 mRNA at each concentration is the arithmetic mean of the relative expression levels of the three culture wells at that concentration.

[0222] The inhibition rate of siRNA on HSD17B13 mRNA expression was calculated using the following equation: Inhibition rate = (1 - relative expression level of HSD17B13 mRNA in the experimental group) × 100%.

[0223] The target activity results are shown in the table below.

[0224] Table 11. Target activity results of modified siRNA (R value)

[0225] Example 4: In vivo screening of modified siRNA for inhibiting HSD17B13 in animals.

[0226] Based on the in vitro screening results of each siRNA in Tables 7 and 11, some M1-modified siRNAs were selected, and L96 was conjugated to the 3' end of the positive strand to obtain L96-conjugated M1-modified siRNAs. The name of the L96-conjugated siRNA is the naked sequence number + M1G. For example, the siRNA with the naked sequence number HSD-52UM, which is modified with M1 and has L96 conjugated to the 3' end of the positive strand, is then numbered HSD-52M1G.

[0227] Animal screening was performed on siRNA conjugated with L96, with 3 C57BL / 6J-HSD17B13 animals in each group. + / - Female human HSD17B13 transgenic mice, 6-8 weeks old, purchased from Biocytogen (Beijing) Pharmaceutical Technology Co., Ltd., catalog number 112658, were administered a single subcutaneous dose of 3 mg / kg, with a saline control group as the standard. The administration volume was 200 μL per mouse. On day 14 post-administration, the mice were sacrificed, liver samples were collected, liver mRNA was extracted, and analyzed using RT-qPCR. The RT-qPCR detection steps are as follows.

[0228] Step 1: RNA extraction

[0229] (1) Take 10-20 mg of mouse liver tissue, place it in RNA protection solution, incubate overnight at 4°C, then discard the RNA protection solution and add 1 mL of Trizol Lysis Buffer (purchased from Life). After lysing the tissue (product number 410701) at low temperature, transfer the thoroughly ground tissue to an RNase-free 1.5ml centrifuge tube; shake vigorously for about 10-15 seconds to fully lyse the tissue cells, and let stand at room temperature for 3-5 minutes.

[0230] (2) Add 200 μL of chloroform (purchased from Shanghai Lingfeng Chemical Reagent Co., Ltd., catalog number 20140925); shake vigorously for 15-20 seconds, let stand at room temperature for 2-3 minutes; centrifuge at 12000×g for 20 minutes at 4℃.

[0231] (3) After centrifugation, remove the centrifuge tubes and place them on the centrifuge tube rack. Transfer the supernatant to a new 2.0 mL centrifuge tube and add 1.5 times the volume of anhydrous ethanol (purchased from Jiangsu Qiangsheng Functional Chemical Co., Ltd., product number 20210802) to the supernatant. Mix well.

[0232] (4) Take a purification column with a collection tube (purchased from Hangzhou Laifeng Biotechnology Co., Ltd., catalog number 11822AG0627), add 700 μL of the mixture from step (3), let stand for 2 min; centrifuge at 4℃, 10000×g for 1 min, and discard the filtrate; repeat the above steps with the remaining mixture.

[0233] (5) Add 700 μL of 80% ethanol to the purification column, centrifuge at 10000×g for 1 min at 4℃, and discard the filtrate;

[0234] (6) Centrifuge the purification column at 4℃, 10000×g for 2 min;

[0235] (7) After centrifugation, remove the purification column with the collection tube, discard the collection tube, put the purification column into a new 1.5 mL centrifuge tube, add 100 μL of DEPC water to the purification column, let it stand at room temperature for 2 min; centrifuge at 4℃, 10000×g for 1 min, and collect RNA.

[0236] Step 2: Preparation of qPCR reaction system

[0237] For each qPCR reaction system, take 3.25 μL of the solution containing the sample RNA as a template and use AccurSTART U. + One Step RT-qPCR Probe Kit (FOR FAST) (purchased from [website name]) Using the reagents provided (product number Q231), prepare a 20 μL RT-qPCR reaction system on an ice box according to Table 14. Primer 1 and Primer 2 are the PCR primer sequences for amplifying the target gene hHSD17B13 and the internal reference gene mGAPDH, respectively. Place each qPCR reaction system on a LightCycler 480 II Real-Time PCR instrument and perform amplification using the one-step method. The RT-qPCR reaction program for HSD17B13 is shown in Table 13. Obtain product W containing amplified target gene hHSD17B13 and internal reference gene mGAPDH. Collect the Ct values ​​of target gene hHSD17B13 and internal reference gene mGAPDH in product W at 72℃ using a real-time fluorescence quantitative PCR instrument.

[0238] Table 12. RNA amplification reaction system

[0239] Table 13. RT-qPCR reaction procedure (hHSD17B13)

[0240] The relative quantification of the target gene hHSD17B13 in each experimental group was performed using the comparative Ct (ΔΔCt) method. The calculation method is as follows: ΔCt(experimental group) = Ct(target gene in experimental group) – Ct(internal reference gene in experimental group); ΔCt(control group) = Ct(target gene in control group) – Ct(internal reference gene in control group); ΔΔCt(experimental group) = ΔCt(experimental group) - ΔCt(average in control group); ΔΔCt(control group) = ΔCt(control group) - ΔCt(average in control group);

[0241] Wherein, ΔCt (control group mean) is the arithmetic mean of ΔCt (control group) for each sample in the control group; thus, each sample in the experimental group and the control group corresponds to a ΔCt value.

[0242] In the above formula, the control group refers to the saline group.

[0243] Using the control group as a baseline, the expression level of hHSD17B13 mRNA in the experimental group was normalized, and the expression level of hHSD17B13 mRNA in the control group was defined as 100%. The relative expression level of hHSD17B13 mRNA in the experimental group = 2^(-ΔΔCT)(experimental group) × 100%.

[0244] The hHSD17B13 mRNA level was compared with the internal reference gene mGAPDH, and the value was normalized to the mean of the saline control group. The data were expressed as a percentage relative to the saline control group.

[0245] The relative expression levels of siRNA and hHSD17B13 mRNA used in this embodiment are shown in Table 14.

[0246] Table 14. Relative expression levels (%) of siRNA and hHSD17B13 mRNA

[0247] Example 5: In vivo screening (dose-effect) of modified siRNA for inhibiting HSD17B13 in animals.

[0248] Based on the in vivo screening results of each siRNA in Table 14, some siRNAs were selected and modified using the following M1VP modification mode to obtain M1VP modified siRNAs.

[0249] M1VP Modification Mode:

[0250] The 19 nucleotides at 5'-3' of the positive strand contain the following modifications: ms-ms-mmmmfffmmmmmmmmmm

[0251] That is, the nucleotides at positions 1-6 and 10-19 of the positive chain are 2'-methoxy modified nucleotides, the nucleotides at positions 7-9 are 2'-fluorinated modified nucleotides, and the nucleotides at positions 1 and 2, as well as positions 2 and 3, are linked by thiophosphate groups.

[0252] The antisense strand 5'-3', consisting of 21 nucleotides, contains the following modifications: VPms-fs-mmmfmmmmmmmfmfmm-ms-ms-m

[0253] That is, the nucleotide at position 1 of the antisense strand is a nucleotide modified with 2'-methoxy and 5'-(E)-vinyl phosphate, i.e., the modified nucleotide is The nucleotides at positions 3-5, 7-13, 15, and 17-21 are nucleotides modified with 2'-methoxy groups, the nucleotides at positions 2, 6, 14, and 16 are nucleotides modified with 2'-fluoride groups, and the nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 are linked by thiophosphate groups.

[0254] Modify the unmodified siRNAs in Table 4 according to the M1VP modification mode to obtain M1VP modified siRNAs. The name of the modified siRNA is "siRNA number before modification" + "modification mode". For example, the unmodified siRNA named HSD-52UM is modified by M1VP and the name of the modified siRNA is HSD-52M1VP.

[0255] Furthermore, for M1VP-modified siRNA, L96 is conjugated to the 3' end of the positive strand to obtain L96-conjugated M1VP-modified siRNA. The name of the L96-conjugated siRNA is "pre-modification siRNA number" + "M1GVP". For example, if the pre-modification siRNA is HSD-52UM, after M1VP modification and L96 conjugation to the 3' end of the positive strand, it is named HSD-52M1GVP.

[0256] In vivo screening of siRNAs coupled with L96 and M1VP modifications was performed on 3 C57BL / 6J-HSD17B13 mice in each group. + / - Black mice (human HSD17B13 transgenic mice, male or female, 6-8 weeks old) were administered a single subcutaneous dose of 3 mg / kg (mpk) and 1 mg / kg (mpk), with physiological saline as a control. The administration volume was 200 μL per mouse. On day 14 after administration, the mice were sacrificed, liver samples were collected, liver mRNA was extracted, and analyzed by RT-qPCR. The RT-qPCR detection procedure was as described in Example 4. The results are shown in Table 15.

[0257] Table 15. Relative expression level of hHSD17B13 mRNA (%)

[0258] Example 6: In vivo screening of modified siRNA for inhibiting HSD17B13 in animals.

[0259] Based on the in vivo screening results of each siRNA in Table 15, a selection of siRNAs were used as positive controls for in vivo long-acting experiments in animals, with 3 animals per group (one on Day 14) using C57BL / 6J-HSD17B13. + / - Black mice (human HSD17B13 transgenic mice, male or female, 6-8 weeks old) were administered a single subcutaneous dose of 3 mg / kg GalNAc and either VP-modified siRNA or saline as a control group, with a drug volume of 200 μL per mouse. On days 14, 21, 28, 35, and 42 post-administration, the mice were sacrificed, liver samples were collected, liver mRNA was extracted, and analyzed using RT-qPCR. The RT-qPCR detection procedure was as described in Example 4. The results are shown in Table 16.

[0260] Table 16. Relative expression level of hHSD17B13 mRNA (%)

[0261] Example 7: Detection of the target activity of different modified siRNAs for inhibiting HSD17B13 in HepG2-HSD17B13 cells.

[0262] The siRNAs in Table 4 were modified using the following different modification patterns, as detailed below:

[0263] M2 Modification Mode:

[0264] The modifications of the 19 nucleotides in the 5'-3' strand of the positive chain are as follows:

[0265] The nucleotides at positions 1-4, 6, and 10-19 of the positive chain are 2'-methoxy modified nucleotides, and the nucleotides at positions 5 and 7-9 are 2'-fluorinated modified nucleotides. The nucleotides at positions 1 and 2, and positions 2 and 3 are linked by thiophosphate groups.

[0266] The antisense strand, from 5' to 3', contains the following modifications across its 21 nucleotides: ms-fs-mmmfmffmmmmfmfmm-ms-ms-m

[0267] That is, the nucleotides at positions 1, 3-5, 7, 10-13, 15, and 17-21 of the antisense strand are nucleotides modified with 2'-methoxy groups, the nucleotides at positions 2, 6, 8, 9, 14, and 16 are nucleotides modified with 2'-fluoride groups, and the nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 are linked by thiophosphate groups.

[0268] M3 Editing Mode:

[0269] The 19 nucleotides from 5' to 3' of the positive strand contain the following modifications: ms-ms-mmfmfffmmmmmmmmmm

[0270] That is, the nucleotides at positions 1-4, 6 and 10-19 of the positive chain are 2'-methoxy modified nucleotides, the nucleotides at positions 5 and 7-9 are 2'-fluorinated modified nucleotides, and the nucleotides at positions 1 and 2, and positions 2 and 3 are linked by thiophosphate groups.

[0271] The antisense strand 5'-3', consisting of 21 nucleotides, contains the following modifications: ms-fs-mmmfmmmmmmmfmfmm-ms-ms-m

[0272] That is, the nucleotides at positions 1, 3-5, 7-13, 15, and 17-21 of the antisense strand are nucleotides modified with 2'-methoxy groups, the nucleotides at positions 2, 6, 14, and 16 are nucleotides modified with 2'-fluoride groups, and the nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 are linked by thiophosphate groups.

[0273] M4 Editing Mode:

[0274] The 19 nucleotides from 5' to 3' of the positive strand contain the following modifications: ms-ms-fmfmfffmfmfmfmfmf

[0275] That is, the nucleotides at positions 1-2, 4, 6, 10, 12, 14, 16, and 18 of the positive chain are 2'-methoxy modified nucleotides, the nucleotides at positions 3, 5, 7-9, 11, 13, 15, 17, and 19 are 2'-fluorinated modified nucleotides, and the nucleotides at positions 1 and 2, as well as positions 2 and 3, are linked by thiophosphate groups.

[0276] The antisense strand, from 5' to 3', contains the following modifications across its 21 nucleotides: ms-fs-mfmfmfmfmmmfmfmf-ms-ms-m

[0277] That is, the nucleotides at positions 1, 3, 5, 7, 9, 11-13, 15, 17, and 19-21 of the antisense strand are nucleotides modified with 2'-methoxy groups, the nucleotides at positions 2, 4, 6, 8, 10, 14, 16, and 18 are nucleotides modified with 2'-fluoride groups, and the nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 are linked by thiophosphate groups.

[0278] M5 Editing Mode:

[0279] The 19 nucleotides from 5' to 3' of the positive strand contain the following modifications: ms-ms-mmfmfffmmmmmfmmmm

[0280] That is, the nucleotides at positions 1-4, 6, 10-14, and 16-19 of the positive chain are 2'-methoxy modified nucleotides, the nucleotides at positions 5, 7-9, and 15 are 2'-fluorinated modified nucleotides, and the nucleotides at positions 1 and 2, as well as positions 2 and 3, are linked by thiophosphate groups.

[0281] The antisense strand, from 5' to 3', contains the following modifications across its 21 nucleotides: ms-fs-mmmfmfmmmmmfmfmm-ms-ms-m

[0282] That is, the nucleotides at positions 1, 3-5, 7, 9-13, 15, and 17-21 of the antisense strand are nucleotides modified with 2'-methoxy groups, the nucleotides at positions 2, 6, 8, 14, and 16 are nucleotides modified with 2'-fluoride groups, and the nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 are linked by thiophosphate groups.

[0283] M6 Modification Mode:

[0284] The 19 nucleotides at 5'-3' of the positive strand contain the following modifications: ms-ms-mmmmff-(d)-mmmmmmmmmm

[0285] That is, the nucleotides at positions 1-6 and 10-19 of the positive chain are 2'-methoxy modified nucleotides, the nucleotides at positions 7 and 8 are 2'-fluorinated modified nucleotides, the nucleotide at position 9 is a deoxyribonucleotide, and the nucleotides at positions 1 and 2, as well as the nucleotides at positions 2 and 3, are linked by thiophosphate groups.

[0286] The antisense strand 5'-3', consisting of 21 nucleotides, contains the following modifications: ms-fs-mmmfmmmmmmmfmfmm-ms-ms-m

[0287] That is, the nucleotides at positions 1, 3-5, 7-13, 15, and 17-21 of the antisense strand are nucleotides modified with 2'-methoxy groups, the nucleotides at positions 2, 6, 14, and 16 are nucleotides modified with 2'-fluoride groups, and the nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 are linked by thiophosphate groups.

[0288] M7 Modification Mode:

[0289] The 19 nucleotides at 5'-3' of the positive strand contain the following modifications: ms-ms-mmmmfffmmmmmmmmmm

[0290] That is, the nucleotides at positions 1-6 and 10-19 of the positive chain are 2'-methoxy modified nucleotides, the nucleotides at positions 7-9 are 2'-fluorinated modified nucleotides, and the nucleotides at positions 1 and 2, as well as positions 2 and 3, are linked by thiophosphate groups.

[0291] The antisense strand 5'-3', consisting of 21 nucleotides, contains the following modifications: ms-fs-mm-(d)-m-(d)-mmfmfmfmfmf-ms-fs-m

[0292] Specifically, the nucleotides at positions 1, 3-4, 6, 8-9, 11, 13, 15, 17, 19, and 21 of the antisense strand are nucleotides modified with 2'-methoxy groups; the nucleotides at positions 2, 10, 12, 14, 16, 18, and 20 are nucleotides modified with 2'-fluoride groups; the nucleotides at positions 5 and 7 are deoxyribonucleotides; and the nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 are linked by thiophosphate groups.

[0293] M8 Modification Mode:

[0294] The 19 nucleotides at 5'-3' of the positive strand contain the following modifications: ms-ms-mmmmfffmmmmmmmmmm

[0295] That is, the nucleotides at positions 1-6 and 10-19 of the positive chain are 2'-methoxy modified nucleotides, the nucleotides at positions 7-9 are 2'-fluorinated modified nucleotides, and the nucleotides at positions 1 and 2, as well as positions 2 and 3, are linked by thiophosphate groups.

[0296] The antisense strand 5'-3', consisting of 21 nucleotides, contains the following modifications: ms-fs-mm-(d)-m-(GNA)-mmfmfmfmfmf-ms-fs-m

[0297] Specifically, the nucleotides at positions 1, 3-4, 6, 8-9, 11, 13, 15, 17, 19, and 21 of the antisense strand are nucleotides modified with 2'-methoxy groups; the nucleotides at positions 2, 10, 12, 14, 16, 18, and 20 are nucleotides modified with 2'-fluoride groups; the nucleotide at position 5 is a deoxyribonucleotide; and the nucleotide at position 7 is a GNA-modified nucleotide. The nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 are linked by thiophosphate groups.

[0298] M9 Modification Mode:

[0299] For each siRNA in Table 4, firstly, using the antisense strand as a template, two complementary nucleotides were added to the 5' end of the sense strand to obtain a complementary double-stranded RNA of 21 bp in length. Then, the sense and antisense strands were modified as follows:

[0300] The 21 nucleotides from 5' to 3' of the positive strand are modified as follows: (invAb)smmmmmmfmfmfmmmmmmmmm-ms-(invAb)

[0301] That is, the nucleotides at positions 1-6, 8, 10, and 12-21 of the positive strand are nucleotides modified with 2'-methoxy groups, and the nucleotides at positions 7, 9, and 11 are nucleotides modified with 2'-fluoride groups. Here, invAb indicates a base-free nucleotide with a reverse linkage (5'-5' or 3'-3' linkage), and (invAb)s at the 5' end indicates... invAb at the 3' end represents

[0302] The antisense strand, from 5' to 3', contains the following modifications across its 21 nucleotides: ms-fs-ms-mmmmmmmmfmfmfmmm-ms-m

[0303] That is, the nucleotides at positions 1, 3-11, 13, 15 and 17-21 of the antisense strand are nucleotides modified with 2'-methoxy groups, the nucleotides at positions 2, 12, 14 and 16 are nucleotides modified with 2'-fluoride groups, and the nucleotides at positions 1 and 2, 2 and 3, and 20 and 21 are linked by thiophosphate groups.

[0304] M10 Editing Mode:

[0305] For each siRNA in Table 4, firstly, using the antisense strand as a template, two complementary nucleotides were added to the 5' end of the sense strand to obtain a complementary double-stranded RNA of 21 bp in length. Then, the sense and antisense strands were modified as follows:

[0306] The 21 nucleotides from 5' to 3' of the positive strand are modified as follows: (invAb)smmmmmmmmfffmmmmmmmmm-ms(invAb)

[0307] That is, the nucleotides at positions 1-8 and 12-21 of the positive strand are 2'-methoxy modified nucleotides, and the nucleotides at positions 9-11 are 2'-fluorinated modified nucleotides. Here, invAb indicates a base-free nucleotide with a reverse linkage (5'-5' linkage or 3'-3' linkage), and (invAb)s at the 5' end indicates... invAb at the 3' end represents

[0308] The antisense strand 5'-3', consisting of 21 nucleotides, contains the following modifications: ms-fs-mm-(d)-m-(GNA)-mmfmfmfmfmf-ms-fs-m

[0309] Specifically, the nucleotides at positions 1, 3-4, 6, 8-9, 11, 13, 15, 17, 19, and 21 of the antisense strand are nucleotides modified with 2'-methoxy groups; the nucleotides at positions 2, 10, 12, 14, 16, 18, and 20 are nucleotides modified with 2'-fluoride groups; the nucleotide at position 5 is a deoxynucleotide; the nucleotide at position 7 is a GNA-modified nucleotide; and the nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 are linked by thiophosphate groups.

[0310] Examples of M2-M10 modified siRNAs are shown in the table below:

[0311] Table 17. Examples of exemplary modified siRNAs

[0312] Furthermore, based on the M2-M10 modification, 5'-(E)-VP((E)-vinyl phosphate) is added to the 5' end of the antisense chain: Modification yields nucleotides with 5'-terminal nucleotides modified by 5'(E)-VP and 2'-methoxy groups. The siRNA modified with antisense strand 5' end 5'-(E)-VP is numbered by adding VP to the corresponding modified siRNA number. That is, the siRNA using the M2-M10 modification mode is further modified with antisense strand 5' end 5'-(E)-VP and the corresponding number is M2VP-M10VP. For example, the siRNA numbered HSD-52M2 is further modified with antisense strand 5' end 5'-(E)-VP and the number is HSD-52M2VP.

[0313] The exemplary M2-M10 modified siRNA sequences after further 5' end 5'-(E)-VP modification are shown in the table below:

[0314] After L96 is conjugated to the 3' end of the positive strand of the modified siRNA, L96-conjugated siRNAs are obtained. The siRNAs conjugated with L96 are numbered by adding G after the corresponding modification number. For example, the siRNA numbered HSD-52M2 is numbered HSD-52M2G after L96 is conjugated to the 3' end of the positive strand, and the siRNA numbered HSD-52M2VP is numbered HSD-52M2VPG after L96 is conjugated to the 3' end of the positive strand.

[0315] Examples of siRNAs with different L96 modification patterns coupled to the 3' end of the positive strand are as follows:

[0316] Table 18. Examples of siRNAs coupled with L96 under different modification modes.

[0317] Experimental Methods: The transfection and detection methods were the same as in Example 3, with PC-2, PC-3, MOCK, and BLANK as controls. The MOCK group received only the interfering reagent without any sequence; the BLANK group contained only cells. siRNA concentration gradients were set as follows: 10 nM, 1 nM, 0.333 nM, 0.111 nM, 0.037 nM, 0.012 nM, 0.004 nM, 0.001 nM, and 0.0005 nM. Using Grapdhpad software, the X-axis was set to log(concentration), and the Y-axis to the inhibition rate. The IC50 was fitted using nonlinear regression. 50 The curve, whose equation is "Y = Bottom + (Top - Bottom) / (1 + 10^(LogIC)". 50 -X)×HillSlope))”. In the formula, Bottom is the minimum inhibition rate, Top is the maximum inhibition rate, HillSlope is the slope of the curve, and LogIC50 is the IC. 50 The logarithm of (half-inhibitory concentration).

[0318] IC50 of some siRNAs 50 The test results are shown in the table below:

[0319] Table 19. IC50 of various modified siRNAs 50 (pM)

[0320] Example 8: In vivo screening of modified siRNA for inhibiting HSD17B13 in animals (long-lasting)

[0321] Selected siRNAs from Example 7: HSD155M7VPG, HSD155M9VPG, HSD-157M2VPG, and HSD-162M2VPG, with PC-3 as a positive control, were used in each group of 3 animals (one on Day 14) C57BL / 6J-HSD17B13 + / - Male human HSD17B13 transgenic mice, aged 6-8 weeks, were administered a single subcutaneous dose of 3 mg / kg L96 and either VP-modified siRNA or saline as a control. The drug volume was 200 μL per mouse. Liver samples were collected from the mice on days 14, 21, 28, 35, and 42 post-administration. Liver mRNA was extracted and analyzed by RT-qPCR, following the steps described in Example 4. The results are shown in Table 20.

[0322] Table 20. Relative expression level of hHSD17B13 mRNA (%)

[0323] The present disclosure has been described in detail above. Those skilled in the art will recognize that the present disclosure can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experimentation. While specific embodiments are given in this disclosure, it should be understood that further modifications can be made to the present disclosure. In summary, in accordance with the principles of this disclosure, it is intended to include any changes, uses, or improvements to the present disclosure, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. A double-stranded RNA molecule, in which, The double-stranded RNA molecule is siRNA, which includes a sense strand and an antisense strand that at least partially form the double-stranded region. The sense strand includes a nucleotide sequence whose nucleotide sequence is any odd-numbered sequence from 1 to 394, and the antisense strand includes a nucleotide sequence whose nucleotide sequence is any even-numbered sequence from 1 to 394.

2. The double-stranded RNA molecule according to claim 1, wherein, The double-stranded RNA molecule comprises a sense strand and an antisense strand selected from any of the following groups: (1) Chain of Justice: AUGCAGAAUAUUCAAUUUGAA (SEQ ID NO:393), Antonym chain: UUCAAAUUGAAUAUUCUGCAU (SEQ ID NO:394); (2) Chain of Justice: GCAGAAUAUUCAAUUUGAA (SEQ ID NO:309), Antonym chain: UUCAAAUUGAAUAUUCUGCAU (SEQ ID NO:310); (3) Chain of Justice: CAAAAUCAAAAUGAAAUGAAU (SEQ ID NO:391), Antonym chain: AUUCAUUUCAUUUUGAUUUUG (SEQ ID NO:392); (4) Chain of Justice: AGCACCAAGGAUGAAGAGAUU (SEQ ID NO:389), Antonym chain: AAUCUCUUCAUCCUUGGUGCU (SEQ ID NO:390); (5) Chain of Justice: GAAUAUUCAAUUUGAAGCAGU (SEQ ID NO:387), Antonym chain: ACUGCUUCAAAUUGAAUAUUC (SEQ ID NO:388); (6) Chain of Justice: CACCAAGGAUGAAGAGAUU (SEQ ID NO:103), Antonym chain: AAUCUCUUCAUCCUUGGUGCU (SEQ ID NO:104); (7) Chain of Justice: AAAUCAAAAUGAAAUGAAU (SEQ ID NO:323), Antonyms: AUUCAUUUCAUUUUGAUUUUG (SEQ ID NO:324); or (8) Chain of Justice: AUAUUCAAUUUGAAGCAGU (SEQ ID NO:313); Antonym chain: ACUGCUUCAAAUUGAAUAUUC (SEQ ID NO:314).

3. Double-stranded RNA molecule modifications, among which, The double-stranded RNA molecule modifier is a compound containing a modified nucleotide obtained by modifying at least one nucleotide of the double-stranded RNA molecule according to claim 1 or 2.

4. The double-stranded RNA molecule modification according to claim 3, wherein, The modified nucleotide is selected from at least one of the following groups: 2'-methoxy-modified nucleotides, 2'-fluorine-modified nucleotides, deoxy-nucleotides, 2'-deoxy-nucleotides, 3'-terminal deoxy-thymidine (dT) nucleotides, 2'-deoxy-modified nucleotides, locked nucleotides (LNA), unlocked nucleotides, configuration-restricted nucleotides, restricted ethyl nucleotides, base-free nucleotides, 2'-amino-modified nucleotides, 2'-O-allyl-modified nucleotides, 2'-C-alkyl-modified nucleotides, 2'-hydroxy-modified nucleotides, 2'-methoxyethyl-modified nucleotides, 2'-O-alkyl-modified nucleotides, morpholinyl nucleotides, nucleotides containing non-natural bases, tetrahydropyran-modified nucleotides, 1,5-dehydrohexyl-modified nucleotides, cyclohexenyl-modified nucleotides, glycerol nucleotides (GNA), open-ring nucleotides (UNA), nucleotides containing methylphosphonate groups, nucleotides containing 5'-phosphate esters, and nucleotides containing 5'-phosphate ester mimics.

5. The double-stranded RNA molecule modification according to claim 3 or 4, wherein, The double-stranded RNA molecule modification, following the direction from the 5' end to the 3' end, contains the following optional combinations of sense and antisense strands: (A) The length of the positive strand is 19nt, and the modification of each nucleotide is: mmmmmmfffmmmmmmmmmmmm; The antisense strand is 21 nt in length, and the modification of each nucleotide is: mfmmmfmmmmmmmfmfmmmmm; (B) The length of the positive strand is 19nt, and the modification of each nucleotide is: mmmmfmfffmmmmmmmmmmmm; The antisense strand is 21 nt in length, and the modification of each nucleotide is: mfmmmfmffmmmmfmfmmmmm; (C) The length of the positive strand is 19nt, and the modification of each nucleotide is: mmmmfmfffmmmmmmmmmmmm; The antisense strand is 21 nt in length, and the modification of each nucleotide is: mfmmmfmmmmmmmfmfmmmmm; (D) The length of the positive strand is 19nt, and the modification of each nucleotide is: mmfmfmfffmfmfmfmfmfmf; The antisense strand is 21 nt in length, and the modification of each nucleotide is: mfmfmfmfmfmmmfmfmfmmm; (E) The length of the positive strand is 19nt, and the modification of each nucleotide is: mmmmfmfffmmmmmfmmmm; The antisense strand is 21 nt in length, and the modification of each nucleotide is: mfmmmfmfmmmmmfmfmmmmm; (F) The length of the positive strand is 19nt, and the modification of each nucleotide is: mmmmmmff-(d)-mmmmmmmmmm; The antisense strand is 21 nt in length, and the modification of each nucleotide is: mfmmmfmmmmmmmfmfmmmmm; (G) The length of the positive strand is 19nt, and the modification of each nucleotide is: mmmmmmfffmmmmmmmmmmmm; The antisense strand is 21 nt in length, and the modification of each nucleotide is: mfmm-(d)-m-(d)-mmfmfmfmfmfmfm; (H) The length of the positive strand is 19nt, and the modification of each nucleotide is: mmmmmmfffmmmmmmmmmmmm; The antisense strand is 21 nt in length, and the modification of each nucleotide is: mfmm-(d)-m-(GNA)-mmfmfmfmfmfmfm; (I) The length of the positive strand is 21nt, and the modification of each nucleotide is: mmmmmmfmfmfmmmmmmmmmm; The antisense strand is 21 nt in length, and the modification of each nucleotide is: mfmmmmmmmmmfmfmfmmmmm; (J) The length of the positive strand is 21nt, and the modification of each nucleotide is: mmmmmmmmfffmmmmmmmmmm; The antisense strand is 21 nt in length, and the modification of each nucleotide is: mfmm-(d)-m-(GNA)-mmfmfmfmfmfmfm; Where m is a 2'-methoxy modified nucleotide, f is a 2'-fluoro modified nucleotide, d is deoxyribonucleic acid, and GNA is a GNA modified nucleotide.

6. The double-stranded RNA molecule modification according to any one of claims 3-5, wherein, The 5'-terminal nucleotide of the antisense strand of the double-stranded RNA molecule modification is a nucleotide modified with 5'-phosphate or its derivative; Optionally, the phosphate ester or its derivative is selected from vinyl phosphate esters, alkylated derivatives of vinyl phosphonates, arylized derivatives of vinyl phosphonates, halogenated derivatives of vinyl phosphonates, hydroxylated derivatives of vinyl phosphonates, aminated derivatives of vinyl phosphonates, carboxylated derivatives of vinyl phosphonates, thiolated derivatives of vinyl phosphonates, silanized derivatives of vinyl phosphonates, borated derivatives of vinyl phosphonates, or metal complex derivatives of vinyl phosphonates. Optionally, the phosphate ester or its derivative is selected from (E)-vinyl phosphate esters.

7. The double-stranded RNA molecule modification according to any one of claims 3-6, wherein, The 3'-end and / or 5'-end of the positive strand of the double-stranded RNA molecule modification is optionally linked with an inverted abase-free nucleotide.

8. The double-stranded RNA molecule modification according to any one of claims 3-7, selected from any one of the following groups of sense and antisense strands: (1) Chain of Justice: (invAb)sAmUmGmCmAmGmAfAmUfAmUfUmCmAmAmUmUmUmGmAmAms(invAb) (SEQ ID NO:403), Antonym chain: VPUmsUfsCmsAmAmAmUmUmGmAmAmUfAmUfUmCfUmGmCmAmsUm(SEQ ID NO:415); (2) Justice Chain: AmsAmsAmUmCfAmAfAfAfUmGmAmAmAmUmGmAmAmAmUm(SEQ ID NO:399), Antisense strand: VPAmsUfsUmCmAmUfUmUfCfAmUmUmUmUfGmAfUmUmUmsUmsGm (SEQ ID NO: 413); (3) Justice Chain: AmsUmsAmUmUfCmAfAfUfUmUmGmAmAmGmCmAmGmUm(SEQ ID NO:405), Antonym chain: VPAmsCfsUmGmCmUfUmCfAfAmAmUmUmGfAmAfUmAmUmsUmsCm (SEQ ID NO:416); (4) Justice Chain: GmsCmsAmGmAmAmUfAfUfUmCmAmAmUmUmUmGmAmAm(SEQ ID NO:401), Antonym chain: VPUmsUfsCmAmA(d)AmT(d)UmGmAfAmUfAmUfUmCfUmGfCmsAfsUm(SEQ ID NO:414); (5) Chain of Justice: (invAb)sAmUmGmCmAmGmAfAmUfAmUfUmCmAmAmUmUmUmGmAmAms(invAb) (SEQ ID NO:403), Antonym chain: UmsUfsCmsAmAmAmUmUmGmAmAmUfAmUfUmCfUmGmCmAmsUm(SEQ ID NO:404); (6) Justice Chain: AmsAmsAmUmCfAmAfAfAfUmGmAmAmAmUmGmAmAmAmUm(SEQ ID NO:399), Antonym chain: AmsUfsUmCmAmUfUmUfCfAmUmUmUmUfGmAfUmUmUmsUmsGm(SEQ ID NO:400); (7) Chain of Justice: AmsUmsAmUmUfCmAfAfUfUmUmGmAmAmGmCmAmGmUm(SEQ ID NO:405), Antonyms: AmsCfsUmGmCmUfUmCfAfAmAmUmUmGfAmAfUmAmUmsUmsCm (SEQ ID NO:406); or (8) Justice Chain: GmsCmsAmGmAmAmUfAfUfUmCmAmAmUmUmUmGmAmAm(SEQ ID NO:401), Antonym chain: UmsUfsCmAmA(d)AmT(d)UmGmAfAmUfAmUfUmCfUmGfCmsAfsUm(SEQ ID NO:402).

9. The double-stranded RNA molecule modification according to any one of claims 3-8, wherein, A ligand is also attached to the nucleotide at the 3'-terminus or 5'-terminus of the positive strand; optionally, the ligand includes a sugar ligand, such as N-acetylgalactosamine (GalNAc) or a derivative thereof. Optionally, the glycoligand is in the multivalent form of GalNAc, which is covalently linked to a small nucleic acid molecule via a multivalent linker arm; Optionally, the ligand is selected from L96 as shown in the following formula:

10. A composition for inhibiting HSD17B13 gene expression, wherein, The active ingredient of the composition is the double-stranded RNA molecule as described in claim 1 or 2, or the double-stranded RNA molecule modification as described in any one of claims 3-9.

11. The use of the double-stranded RNA molecule of claim 1 or 2, or the modified double-stranded RNA molecule of any one of claims 3-9, or the composition of claim 10, in any of the following: (D1) Application in the preparation of compositions that inhibit HSD17B13 gene expression; (D2) Application in inhibiting HSD17B13 gene expression; (D3) Application in the treatment of diseases related to the HSD17B13 gene target; (D4) Application in the preparation of compositions for treating diseases related to the HSD17B13 gene target; (D5) Application in the preparation of dimer siRNA.

12. The application according to claim 11, wherein, The diseases associated with the HSD17B13 gene target include liver disease; Optionally, the liver disease includes non-alcoholic fatty liver disease (NAFLD), simple fatty liver, non-alcoholic steatohepatitis (NASH), hepatitis, liver fibrosis, cirrhosis, alcoholic steatohepatitis (ASH), alcoholic fatty liver disease (ALD), HCV-related cirrhosis, drug-induced liver injury, and hepatocellular necrosis or chronic fibrotic liver disease.

Images