AGT-targeting double-stranded sirna, conjugate thereof, and use thereof

Abstract

Provided are an AGT-targeting double-stranded siRNA, a conjugate thereof, and a use thereof. The double-stranded siRNA and the conjugate thereof can inhibit the expression of angiotensinogen (AGT), and can be used for preparing a drug for treating and / or preventing AGT-related diseases.

Description

Double-stranded siRNA targeting AGT, conjugates thereof and uses thereof TECHNICAL FIELD

[0001] The present invention belongs to the field of small nucleic acid drugs, and aims to provide a novel double-stranded siRNA, conjugates thereof and uses thereof. The double-stranded siRNA and conjugates thereof according to the present invention can be prepared for use in the treatment and / or prevention of angiotensinogen (AGT)-related diseases. BACKGROUND

[0002] The renin-angiotensin-aldosterone system (RAAS) plays a key role in blood pressure regulation. The RAAS cascade starts with the secretion of renin into the circulation by the juxtaglomerular cells of the kidney. Renin secretion is stimulated by several factors, including Na + load, beta-sympathetic nerve stimulation and / or reduced renal perfusion. Active renin in the plasma splits angiotensinogen (produced by the liver) into angiotensin I, which is subsequently converted to angiotensin II by circulating and locally expressed angiotensin-converting enzyme (ACE). Most of the effects of the RAAS are exerted by angiotensin II through its binding to the angiotensin II type 1 receptor (AT1R), leading to arterial vasoconstriction, tubular and glomerular effects, such as enhanced Na + reabsorption or regulation of glomerular filtration rate. In addition, together with other stimulators (such as adrenocorticotropic hormone, anti-diuretic hormone, catecholamines, endothelins, serotonin) and Mg 2+ and K + levels, AT1R stimulation leads to aldosterone release, which subsequently promotes Na + and K + excretion in the renal distal convoluted tubule.

[0003] Disregulation of the RAAS by excessive angiotensin II production and / or AT1R stimulation leads to hypertension which can result in, for example, increased oxidative stress, promotion of inflammation, hypertrophy and fibrosis in the heart, kidney and arteries, and leads to, for example, left ventricular fibrosis, arterial remodeling and renal glomerulosclerosis.

[0004] Angiotensinogen (AGT) is the common precursor of all angiotensins, and the liver is the main source of blood AGT. Multiple studies have confirmed that elevated blood AGT concentration is significantly positively correlated with hypertension, and reducing blood AGT concentration can inhibit the activity of the RAAS pathway and lead to a decrease in blood pressure. Intravenous infusion of AGT into rats can increase blood pressure, and this can be reversed by treatment with anti-AGT antibodies. AGT-knockout mice have reduced blood pressure, while AGT-overexpression leads to elevated blood pressure. Treating hypertension by regulating the level of AGT is a promising research target, but targeting AGT using traditional means encounters many difficulties.

[0005] RNA interference (RNAi) refers to a highly conserved phenomenon in evolution, which is induced by double-stranded small interference RNA (siRNA) to specifically degrade homologous mRNA. Therefore, it is of great significance to develop siRNA targeting AGT. SUMMARY

[0006] The present application provides a novel double-stranded siRNA, a conjugate thereof and use thereof, which can inhibit angiotensinogen (AGT) expression, and can be used for preparing a medicament for treating and / or preventing AGT-related diseases. The double-stranded siRNA and the conjugate thereof have higher in vivo delivery efficiency, better stability, higher AGT gene expression inhibition activity and / or lower toxicity.

[0007] In one aspect, the present application provides a double-stranded siRNA comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises one of the nucleotide sequences as shown in SEQ ID NO: 4, SEQ ID NO: 1-3 and SEQ ID NO: 5-13 (i.e., one of the sense strands in Table 1 of the specification of the present application), or a nucleotide sequence having no more than 5 nucleotide differences therefrom, and the detailed information of the nucleotide sequences of SEQ ID NO: 4, SEQ ID NO: 1-3 and SEQ ID NO: 5-13 is shown in Table 1 of the specification of the present application;

[0008] the antisense strand comprises one of the nucleotide sequences as shown in SEQ ID NO: 17, SEQ ID NO: 14-16 and SEQ ID NO: 18-26 (i.e., one of the antisense strands in Table 1 of the specification of the present application), or a nucleotide sequence having no more than 5 nucleotide differences therefrom, and the detailed information of the nucleotide sequences of SEQ ID NO: 17, SEQ ID NO: 14-16 and SEQ ID NO: 18-26 is shown in Table 1 of the specification of the present application;

[0009] all the nucleotides in the sense strand and the antisense strand are modified nucleotides, and the modified nucleotides are independently selected from at least one of the following:

[0010] 2'-methoxy modified nucleotides, 2'-fluoro modified nucleotides, 2'-methoxyethyl modified nucleotides, phosphorothioate linkage modified nucleotides, 2'-deoxy modified nucleotides, 2'-amino modified nucleotides, 2'-hydroxyl modified nucleotides, locked nucleic acid modified nucleotides, unlocked nucleic acid modified nucleotides, glycol nucleic acids, 5'-vinylphosphonate modified nucleotides, 5'-(E)-VP modified nucleic acids, cEt, D-replaced nucleotides, and InvB modifications.

[0011] In some embodiments of the double stranded siRNA described herein; the sense strand comprises CUCCCACCUUUUCUUCUAA, or a nucleotide sequence with no more than 5 nucleotide differences thereof; the antisense strand comprises UUAGAAGAAAAGGUGGGAGAC, or a nucleotide sequence with no more than 5 nucleotide differences thereof. In some embodiments of the double stranded siRNA described herein, the double stranded region is 14-23 nucleotide pairs long.

[0012] In some embodiments of the double stranded siRNA described herein, the modified nucleotides are each independently present at one or more positions selected from: the 1st, 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, 19th, 20th, and 21st nucleotides of the sense strand, counting the nucleotide at the 5' end as the first position.

[0013] In some embodiments of the double stranded siRNA described herein, the modified nucleotides are each independently present at one or more positions selected from: the 1st, 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, 19th, 20th, 21st, 22nd, and 23rd nucleotides of the antisense strand, counting the nucleotide at the 5' end as the first position.

[0014] In some embodiments of the double stranded siRNA described herein, the phosphorothioate linkage modification is present at one or more positions selected from:

[0015] the 5' end of the antisense strand is between positions 2-3, 3-4, 4-5, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, 17-18, 18-19, 19-20, 20-21, 21-22, and 22-23, counting from the start of the nucleotide.

[0016] In some embodiments of the double stranded siRNA described herein, the 2'-fluoro modified nucleotides are present at one or more positions selected from the group consisting of:

[0017] the 5' end of the antisense strand is between positions 2-3, 3-4, 4-5, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, 17-18, 18-19, 19-20, 20-21, 21-22, and 22-23, counting from the start of the nucleotide.

[0018] In some embodiments of the double stranded siRNA described herein, the 2'-fluoro modified nucleotides are present at one or more positions selected from the group consisting of:

[0019] the 5' end of the sense strand is at position 5, 7, 8, 9, 10, and 11, counting from the start of the nucleotide.

[0020] In some embodiments of the double stranded siRNA described herein, the 2'-fluoro modified nucleotides are present at one or more positions selected from the group consisting of:

[0021] the 5' end of the sense strand is at position 8, 10, 11, and 12, optionally further including position 5, counting from the start of the nucleotide.

[0022] In some embodiments of the double stranded siRNA described herein, the 2'-fluoro modified nucleotides are present at one or more positions selected from the group consisting of:

[0023] the 5' end of the antisense strand is at position 2, 6, 8, 9, 12, 14, and 16, counting from the start of the nucleotide.

[0024] In some embodiments of the double stranded siRNA described herein, the 2'-fluoro modified nucleotides are present at one or more positions selected from the group consisting of:

[0025] The 2'-fluoro-modified nucleotides are present at the 2nd, 6th, 14th and 16th positions from the 5' terminal nucleotide of the antisense strand;

[0026] In some embodiments of the double-stranded siRNA of the present application, the InvB modification is at the 5' terminal of the sense strand via a phosphorothioate or a phosphate group.

[0027] In some embodiments of the double-stranded siRNA of the present application, the InvB modification is at the 5' terminal of the sense strand via a phosphorothioate group.

[0028] In some embodiments of the double-stranded siRNA of the present application, the antisense strand comprises two consecutive phosphorothioate modifications at the 3' terminal and two consecutive phosphorothioate modifications at the 5' terminal.

[0029] In some embodiments of the double-stranded siRNA of the present application, the sense strand comprises two consecutive phosphorothioate modifications at the 3' terminal and two consecutive phosphorothioate modifications at the 5' terminal.

[0030] The "one or more positions" in "each independently optionally present at one or more positions selected from one or more positions" or "each independently present at one or more positions selected from one or more positions" in the present application refers to the presence of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or 23 positions of modification, wherein optionally, it means that the modification can be present or not present, i.e. 0 modification.

[0031] In some embodiments of the double-stranded siRNA of the present application, the sense strand comprises one of the nucleotide sequences as shown in SEQ ID NO: 41, SEQ ID NO: 27-40 and SEQ ID NO: 42-43 (i.e. one of the sense strands in Table 1-A of the specification of the present application); the antisense strand comprises one of the nucleotide sequences as shown in SEQ ID NO: 48, SEQ ID NO: 45-47 and SEQ ID NO: 49-583 (i.e. one of the antisense strands in Table 1-A of the specification of the present application);

[0032] The nucleotide sequences of SEQ ID NO: 41, SEQ ID NO: 27-40, SEQ ID NO: 42-43, SEQ ID NO: 45-47, SEQ ID NO: 48 and SEQ ID NO: 49-583 are shown in Table 1-A of the specification of the present application.

[0033] In some embodiments of the double stranded siRNA described herein, the sense strand comprises a nucleotide sequence as set forth in any one of SEQ ID NO: 73, SEQ ID NO: 59-72, and SEQ ID NO: 74-75; the nucleotide sequences of SEQ ID NO: 73, SEQ ID NO: 59-72, and SEQ ID NO: 74-75 are provided in Table 1-B of the specification.

[0034] In some embodiments of the double stranded siRNA described herein, the sense strand has a length of no more than 23 nucleotides, and the antisense strand has a length of no more than 23 nucleotides.

[0035] In some embodiments of the double stranded siRNA described herein, the sense strand comprises the nucleotide sequence 5'-InvBscsucccaCfcUfUfUfucuucuasa-3' and the antisense strand comprises the nucleotide sequence 5'-usUfsagaAfgaaaaggUfgGfgagsasc-3'.

[0036] In some embodiments of the double stranded siRNA described herein, the sense strand comprises the nucleotide sequence 5'-InvBscsucccaCfcUfUfUfucuucusasa-3' and the antisense strand comprises the nucleotide sequence 5'-usUfsagaAfgaaaaggUfgGfgagsasc-3'.

[0037] In some embodiments of the double stranded siRNA described herein, the sense strand comprises the nucleotide sequence 5'-InvBsgsuuuguGfaAfAfCfaaaaaagsa-3' and the antisense strand comprises the nucleotide sequence 5'-usCfsuuuUfuuguuucAfcAfaacsasa-3'.

[0038] In some embodiments of the double stranded siRNA described herein, the sense strand comprises the nucleotide sequence 5'-InvBsgsuuuguGfaAfAfCfaaaaaasgsa-3' and the antisense strand comprises the nucleotide sequence 5'-usCfsuuuUfuuguuucAfcAfaacsasa-3'. In still another aspect, the present application relates to a double stranded siRNA conjugate comprising a double stranded siRNA described herein and a conjugate group conjugated to the siRNA.

[0039] In some embodiments of the double-stranded siRNA conjugate described in the present application, in the double-stranded siRNA conjugate, the 3' end or 5' end of the sense strand or the antisense strand of the double-stranded siRNA is conjugated with the conjugation group, preferably, the 3' end of the sense strand of the double-stranded siRNA is conjugated with the conjugation group; wherein the 3' end or 5' end of the sense strand of the double-stranded siRNA is conjugated with the conjugation group through a phosphate group, a thiophosphate group or a phosphoric acid group.

[0040] In some embodiments of the double-stranded siRNA conjugate described in the present application, the conjugation group comprises GalNAc or a derivative thereof.

[0041] In some embodiments of the double-stranded siRNA conjugate described in the present application, the conjugation group is GalNAc or a derivative thereof connected by a bivalent, trivalent or tetravalent branched linker.

[0042] In some embodiments of the double-stranded siRNA conjugate described in the present application, the conjugation group is L-96 or DAW40007-4, wherein the structures of the conjugation groups L-96 and DAW40007-4 are respectively:

[0043] In some embodiments of the double-stranded siRNA conjugate described in the present application, the sense strand comprises a nucleotide sequence of 5'-InvBsgsuuuguGfaAfAfCfaaaaaagsasL96-3', and the antisense strand comprises a nucleotide sequence of 5'-usCfsuuuUfuuguuucAfcAfaacsasa-3'.

[0044] In some embodiments of the double-stranded siRNA conjugate described in the present application, the sense strand comprises a nucleotide sequence of 5'-InvBscsucccaCfcUfUfUfucuucuasasL96-3', and the antisense strand comprises a nucleotide sequence of 5'-usUfsagaAfgaaaaggUfgGfgagsasc-3'.

[0045] In another aspect, the present application relates to a pharmaceutical composition comprising the double-stranded siRNA or the double-stranded siRNA conjugate described in the present application, and a pharmaceutically acceptable carrier.

[0046] In another aspect, the present application relates to the use of the double-stranded siRNA and the siRNA conjugate or the pharmaceutical composition described in the present application in the preparation of a medicament for treating and / or preventing an AGT-related disease.

[0047] In some embodiments of the use described in the present application, the AGT-related disease is hypertension.

[0048] In some embodiments of the use according to the application, the hypertension is selected from borderline hypertension, essential hypertension, secondary hypertension, hypertensive crisis, hypertensive emergency, isolated systolic and diastolic hypertension, pregnancy-related hypertension, diabetic hypertension, resistant hypertension, refractory hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt's hypertension, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension and labile hypertension. BRIEF DESCRIPTION OF DRAWINGS

[0049] Figure 1 shows the relative remaining levels of AGT protein in serum of humanized mice treated with the double-stranded siRNA conjugate of ID NO: 2 according to the application, wherein PC is control 2.

[0050] Detailed description of the application

[0051] Definitions and general terms

[0052] In the present application, the term "comprising" or "including" is open-ended, i.e. it includes the indicated aspects of the application, but not excluding other aspects.

[0053] In the present application, the term "small interfering RNA" (siRNA) is a double-stranded RNA of 17 to 30 nucleotides in length, comprising a sense strand and an antisense strand. siRNA mediates the targeted cleavage of RNA transcripts of the RISC pathway by forming a silencing complex (RISC). Specifically, siRNA directs the specific degradation of mRNA sequences and inhibits the translation of mRNA into amino acids and conversion into proteins by the known process of RNA interference (RNAi).

[0054] The sense and antisense strands typically form a double-stranded siRNA ("dsRNA"), also referred to herein as an "RNAi agent". The double-stranded region of the RNAi agent can be 12-30 nucleotide pairs in length. For example, the duplex region can be 14-30, 17-30, 27-30, 17-23, 17-21, 17-19, 19-25, 19-23, 19-21, 21-25, or 21-23 nucleotide pairs in length. In another embodiment, the duplex region is selected from 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, and 27 nucleotides in length.

[0055] The terms "iRNA", "RNAi agent" "iRNA agent", "RNA interference agent" are used interchangeably herein and refer to an RNA agent as defined herein and which mediates the targeted cleavage of an RNA transcript by the RNA-induced silencing complex (RISC) pathway. iRNAs direct the sequence-specific degradation of mRNA through a process known as RNA interference (RNAi). iRNAs modulate, e.g., inhibit, the expression of AGT in a cell, such as a cell within a subject, such as a mammalian subject.

[0056] In the present application, the term "antisense strand (or guide strand)" includes a region that is substantially complementary to a target sequence. The "sense strand (or passenger strand)" refers to an RNA strand that contains a sequence that is substantially complementary to the antisense strand. The term "substantially complementary" means completely complementary or at least partially complementary, e.g., the antisense strand is completely complementary or at least partially complementary to the target sequence. In the case of partial complementarity, mismatches can exist within the interior of the molecule or within the terminal regions, with the most tolerated mismatches existing within the terminal regions, e.g., within 5, 4, 3, or 2 nucleotides of the 5'- and / or 3'-end of the RNAi.

[0057] It is noted that "at least partially substantially complementary" to an mRNA by an antisense strand means that the antisense strand has a polynucleotide that is substantially complementary to a contiguous portion of the mRNA of interest.

[0058] The term "nucleotide overhang" or "overhang" refers to at least one unpaired nucleotide overhanging the duplex structure of an iRNA (e.g., a dsRNA). A nucleotide overhang exists, for example, when the 3'-end of one strand of a dsRNA extends beyond the 5'-end of the other strand or vice versa. A dsRNA can include an overhang of at least one nucleotide; alternatively, the overhang can include at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 or more nucleotides. The nucleotide overhang can comprise or consist of nucleotides / nucleoside analogs, including deoxynucleotides / nucleosides. The overhang(s) can be on the sense strand, the antisense strand, or any combination thereof. Additionally, the nucleotide(s) of the overhang can be present on the 5' end, the 3' end, or both ends of the antisense or sense strand of the dsRNA.

[0059] The conjugate groups described herein include pharmaceutically acceptable conjugate groups, which generally comprise a pharmaceutically acceptable targeting molecule (or targeting ligand) and optionally a linker. In some embodiments of the present application, the conjugate group is GalNAc or a derivative thereof. Exemplary conjugate groups, linkers, classes of targeting molecules can be found in the disclosure of WO2015006740A2. Exemplary conjugate groups include, but are not limited to, L96 or DAW40007-4.

[0060] Unless otherwise indicated, "conjugated" refers to the linkage of two or more chemical moieties, each having a particular function, to one another by covalent linkage; correspondingly, "conjugate" refers to the compound formed by the covalent linkage of the respective chemical moieties.

[0061] The double-stranded siRNA conjugate of the present application is a compound formed by the linkage of a double-stranded siRNA and a pharmaceutically acceptable conjugating group, and the double-stranded siRNA and the pharmaceutically acceptable conjugating group are covalently linked.

[0062] The term "angiotensinogen-related disease" or "AGT-related disease" is a disease or disorder caused by activation of the renin-angiotensin-aldosterone system (RAAS) or is associated with the renin-angiotensin-aldosterone system (RAAS), or is a disease or disorder whose symptoms or whose progression correspond to inactivation of the RAAS. The term "angiotensinogen-related disease" includes a disease, disorder or condition that would benefit from a reduction in AGT expression. Such diseases are typically associated with hypertension. Non-limiting examples of angiotensinogen-related diseases include hypertension, e.g., borderline hypertension (also known as prehypertension), essential hypertension (also known as essential hypertension or idiopathic hypertension), inessential hypertension (also known as inessential hypertension), hypertensive crisis (also known as malignant hypertension), hypertensive emergency, isolated systolic or diastolic hypertension, pregnancy-related hypertension (e.g., preeclampsia, eclampsia, and postpartum pre-eclampsia), diabetic hypertension, resistant hypertension, refractory hypertension, paroxysmal hypertension, renovascular hypertension (also known as renal hypertension), Goldblatt hypertension, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, unstable hypertension; hypertensive heart disease, hypertensive nephropathy, atherosclerosis, arteriosclerosis, vascular disease (including peripheral vascular disease), diabetic nephropathy, diabetic retinopathy, chronic heart failure, cardiomyopathy, diabetic cardiomyopathy, glomerulosclerosis, coarctation of the aorta, aortic aneurysm, ventricular fibrosis, Cushing's syndrome and other glucocorticoid excess states (including chronic steroid treatment), pheochromocytoma, reninoma, secondary hyperaldosteronism and other mineralocorticoid excess states, sleep apnea, thyroid / parathyroid disease, heart failure (e.g., left ventricular systolic dysfunction), myocardial infarction, angina, stroke, diabetes (e.g., diabetic nephropathy), kidney disease (e.g., chronic kidney disease or diabetic nephropathy, optionally in a pregnancy setting), kidney failure (e.g., chronic kidney failure), cognitive impairment (e.g., Alzheimer's disease), and systemic sclerosis (e.g., scleroderma renal crisis). In particular embodiments, AGT-related diseases include intrauterine growth retardation (IUGR) and fetal growth restriction.

[0063] In the present application, "pharmaceutical composition" can refer to use in therapy of a disease, as well as use in in vitro culture experiments of cells. When used in therapy of a disease, the term "pharmaceutical composition" generally refers to a unit dosage form and can be prepared by any one of the methods well known in the pharmaceutical art. All methods include the step of bringing into association active ingredients with the carrier which constitutes one or more accessory ingredients. In general, the compositions are prepared by uniformly and intimately bringing into association the active siRNA with liquid carriers, fine solid carriers, or both, and then, if necessary, shaping the product.

[0064] In the present application, the term "pharmaceutically acceptable" means that the substance or composition must be chemically and / or toxicologically compatible with the other ingredients of the formulation and / or the mammal being treated with it. Preferably, "pharmaceutically acceptable" means approved or approvable by a regulatory agency or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.

[0065] In the present application, the term "pharmaceutically acceptable carrier" can include any and all solvents, solid diluents or other liquid excipients, etc. which are suitable for the particular target dosage form. The use of any of these carriers is contemplated to be within the scope of the present application except those which are incompatible due to any adverse effects which the carrier might have on the RNAi (e.g., siRNA) of the present application, such as any adverse biological effect or interaction with any other component of the pharmaceutically acceptable composition in a deleterious manner.

[0066] In some embodiments, the pharmaceutical composition according to the present application, wherein the pharmaceutically acceptable carrier can be various carriers conventionally used in the art, for example, can include at least one of a pH buffer, a protective agent, and an osmotic pressure adjusting agent. The pH buffer can be acetate, citrate, prolamine, carbonate, or phosphate, or any combination thereof. The pH buffer can be Tris-HCI buffer having a pH of 7.5-8.5 and / or phosphate buffer having a pH of 5.5-8.5, preferably phosphate buffer having a pH of 5.5-8.5. The protective agent can be at least one of inositol, sorbitol, and sucrose. The protective agent can be contained in an amount of 0.01-30% by weight (e.g., 0.01%, 0.05%, 0.1%, 0.5%, 1%, 5%, 10%, 15%, 20%, 25%, 30%, or any value between any two of the numerical values) based on the total weight of the pharmaceutical composition. The osmotic pressure adjusting agent can be sodium chloride and / or potassium chloride. The osmotic pressure adjusting agent can be contained in an amount such that the osmotic pressure of the pharmaceutical composition is 200-700 milliosmoles per kilogram. The content of the osmotic pressure adjusting agent can be determined by one skilled in the art according to the desired osmotic pressure

[0067] In the present application, the term "treatment" refers to obtaining a desired pharmacological and / or physiologic effect. The effect can be prophylactic in terms of completely or partially preventing a disease or symptom thereof and / or can be therapeutic in terms of a partial or complete cure for a disease and / or adverse effect attributable to the disease. "Treatment" as used herein covers the treatment of a disease in a mammal, particularly in a human, and includes: (a) preventing the disease or condition from occurring in an individual which can be predisposed to the disease but has not yet developed the disease; (b) inhibiting the disease, i.e., arresting its development; or (c) relieving the disease, i.e., causing the partial or complete regression of the disease. "Treatment" as used herein covers any use of a drug, RNAi agent or siRNA in a subject to treat, cure, relieve, alleviate, alter, remedy, improve, or inhibit a disease in a subject, including, but not limited to, administering a drug comprising an RNAi agent, siRNA or siRNA conjugate described herein to a subject in need thereof.

[0068] In the present application, the term "RNAi agent" refers to an agent comprising an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule capable of degrading or inhibiting the translation of a target messenger RNA (mRNA) in a sequence-specific manner. RNAi agents in the present application can operate through the RNA interference mechanism (i.e., by interacting with the RNA interference pathway machinery of a mammalian cell (the RNA-induced silencing complex or RISC) to induce RNA interference), or through any other mechanism or pathway. RNAi agents include, but are not limited to, single-stranded oligonucleotides, single-stranded antisense oligonucleotides, short interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), and Dicer substrates.

[0069] In the context of the present application, capital letters C, G, U, A represent the bases of natural nucleotides; lower case letters represent bases of nucleotides whose ribose 2-position is modified with a methoxy group, such as c, g, u, a representing 2'-OMe (2'-O-methyl) C, 2'-OMe G, 2'-OMe U, and 2'-OMe A, respectively; capital letters right of f represent bases of nucleotides whose ribose 2-position is modified with a fluoro group, such as Cf, Gf, Uf, Af representing 2'-F (2'-fluoro) C, 2'-F G, 2'-F U, and 2'-FA, respectively; "s" represents a phosphorothioate linkage between the two nucleotide residues adjacent to "s" on either side, such as "gsu" representing a phosphorothioate linkage between the g and u residues; Tgn represents a thymine-diol nucleotide residue, which has the structure Y in a double-stranded siRNA or oligonucleic acid represents

[0070] The TNA, PNA, D-FNA, ANA-5, HNA-5, FANA-5, ANA-6, HNA-6, FANA-6, bcDNA, tcDNA, S-MC, N-MC, 2'-F-NMC, cEt, D and InvAb of the present application are respectively as follows: wherein B is a base (including a natural base (A, U, G, C or T) or a modified base), each TNA, PNA, D-FNA, ANA-5, HNA-5, FANA-5, ANA-6, HNA-6, FANA-6, bcDNA, tcDNA, S-MC, N-MC, 2'-F-NMC is independently linked to the rest of the nucleotides and / or a conjugate group by a phosphate group or a phosphorothioate group, and stereoisomers thereof are also included.

[0071] The UNA structure of the present application is The GNA structure of the present application is B is a base (including a natural base (A, U, G, C or T) or a modified base).

[0072] In the present application, "phosphate group", "phosphate group", "phosphate bond" can be used interchangeably, including monophosphate, diphosphate or triphosphate. The "phosphate group" in "phosphorothioate group" also has the same meaning. Unless otherwise specified, the phosphate group between natural nucleotides is a diphosphate group.

[0073] In the present application, "deoxynucleotide" refers to a nucleotide in which the hydroxyl group of the pentose sugar of the nucleotide is deoxidized, which can be 2'-OH or 3'-OH.

[0074] In some optional embodiments of the present application, the deoxynucleotide includes 3'-deoxy modified nucleotide and 2'-deoxy modified nucleotide.

[0075] In the present application, "2'-deoxy modification" refers to the deoxidation of the hydroxyl group (2'-OH) of the pentose sugar of the nucleotide to hydrogen (2'-H), and "3'-deoxy modification" refers to the deoxidation of the hydroxyl group (3'-OH) of the pentose sugar of the nucleotide to hydrogen (3'-H).

[0076] In the present application, "2'-X modification" means that the hydroxyl group (2'-OH) in the pentose of a nucleotide is replaced by X (2'-X). For example, "2'-fluoro modification" means that the hydroxyl group (2'-OH) in the pentose of a nucleotide is replaced by fluorine (2'-F), "2'-amino modification" means that the hydroxyl group (2'-OH) in the pentose of a nucleotide is replaced by fluorine (2'-NH2), "2'-O-allyl modification" means that the hydroxyl group (2'-OH) in the pentose of a nucleotide is replaced by allyloxy (2'-OCH2CH=CH2), "2'-alkyl modification" means that the hydroxyl group (2'-OH) in the pentose of a nucleotide is replaced by alkyl (2'-alkyl), "2'-O-alkyl modification" means that the hydroxyl group (2'-OH) in the pentose of a nucleotide is replaced by alkoxy (2'-alkoxy), "2'-methoxy modification" means that the hydroxyl group (2'-OH) in the pentose of a nucleotide is replaced by methoxy (2'-OCH3), and "2'-methoxyethyl modification" means that the hydroxyl group (2'-OH) in the pentose of a nucleotide is replaced by methoxyethyl (2'-CH2CH2OCH3).

[0077] In the present application, "locked nucleotide" means a nucleotide obtained by modifying the 2' and 4' carbons of the pentose of a nucleotide to be linked together.

[0078] In the present application, "5'-X modification" means that the phosphate ester (5'-PO(OH)2) in the pentose of a nucleotide is replaced by X (5'-X). For example, "5'-phosphoramidate modification" means that the phosphate ester group (5'-PO(OH)2) in the pentose of a nucleotide is replaced by a phosphoramidate group, "5'-phosphorothioate group modification" means that the phosphate ester group (5'-PO(OH)2) in the pentose of a nucleotide is replaced by a phosphorothioate group, "5'-methylphosphonate group modification" means that the phosphate ester group (5'-PO(OH)2) in the pentose of a nucleotide is replaced by a methylphosphonate group, and "5'-phosphate mimic modification" means that the phosphate ester group (5'-PO(OH)2) in the pentose of a nucleotide is replaced by a phosphate mimic.

[0079] In the present application, "5'-methylated cytosine modification" or "5-methylcytosine modification" means methylation at the 5th carbon atom of cytosine; and "5'-methylated uracil modification" or "5-methyluracil modification" means methylation at the 5th carbon atom of uracil.

[0080] In the present application, "2'-fluoro modification" in the 2'-fluoro modified nucleotide, "2'-amino modification" in the 2'-amino modified nucleotide, "2'-O-allyl modification" in the 2'-O-allyl modified nucleotide, "2'-alkyl modification" in the 2'-alkyl modified nucleotide, "2'-O-alkyl modification" in the 2'-O-alkyl modified nucleotide, "2'-methoxyethyl modification" in the 2'-methoxyethyl modified nucleotide, and "2'-allyl modification" in the 2'-allyl modified nucleotide means that the 2 position of ribose is modified with the corresponding group

[0081] As used herein, "chemically modified" or "modification" means a structure that has a chemical difference when compared to the naturally occurring counterpart, including all changes by chemical means, such as the addition or removal of a chemical moiety, or the substitution of one chemical moiety for another.

[0082] The compounds of the present application can be asymmetric, e.g., having one or more stereocenters. Unless otherwise indicated, all stereoisomers, including enantiomers and diastereomers, are included within the scope of the present application. Compounds of the present application containing asymmetric carbon atoms can be isolated in optically active form or as racemic mixtures. Optically active forms can be obtained, for example, by resolution of a racemic mixture or by synthesis from an optically active starting material or reagent.

[0083] Optically active (R)- and (S)-isomers and D and L isomers can be prepared by chiral synthesis or chiral reagents or other conventional techniques. If one enantiomer of a compound of the present application is desired, it can be prepared by asymmetric synthesis or derivatization with a chiral auxiliary, wherein the resulting diastereomeric mixture is separated and the auxiliary group cleaved to provide the pure desired enantiomer. Alternatively, when a basic functional group (e.g., amino) or an acidic functional group (e.g., carboxyl) is present in the molecule, a diastereomeric salt form of the compound with an appropriate optically active acid or base can be formed, and the diastereomeric salt separated by conventional means, and the desired enantiomer recovered by treating with base or acid, as appropriate. Additionally, separation of the enantiomers and diastereomers is typically accomplished by chromatography using a chiral stationary phase, optionally in combination with chemical derivatization (e.g., formation of a carbamate from an amine).

[0084] The present application also includes isotopically-labelled compounds of the present application which are identical to those recited herein, but for the fact that one or more atoms are replaced by an atom having an atomic mass or mass number different from the atomic mass or mass number usually found in nature. Examples of isotopes that can be present in compounds of the present application include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorous, sulphur, fluorine, iodine, and chlorine, such as 2 H, 3 H, 11 C,13C, 14 C, 13 N, 15 N, 15 O, 17 O, 18 O, 31 P, 32 P, 35 S, 18 F, 123 I, 125 I and 36 Cl, and the like.

[0085] Unless otherwise indicated, when a position is designated specifically as deuterium (D), the position is understood to have deuterium in an abundance of at least 1000 times greater than the natural abundance of deuterium, which is 0.015% (i.e., at least 10% incorporation of deuterium). Exemplary compounds having deuterium in an abundance of at least 1000 times greater than the natural abundance of deuterium, at least 2000 times greater than the natural abundance of deuterium, at least 3000 times greater than the natural abundance of deuterium, at least 4000 times greater than the natural abundance of deuterium, at least 5000 times greater than the natural abundance of deuterium, at least 6000 times greater than the natural abundance of deuterium, or greater. The present application also includes various deuterated forms of the compounds of Formula (I). Each available hydrogen atom attached to a carbon atom can be independently replaced with a deuterium atom. Those skilled in the art are able to synthesize deuterated forms of the compounds of Formula (I) with reference to the relevant literature. Commercially available deuterated starting materials can be used in the preparation of deuterated forms of the compounds of Formula (I), or can be synthesized using conventional techniques employing deuterated reagents including, but not limited to, deuterated borane, tritritated borane in tetrahydrofuran solution, deuterated lithium aluminum hydride, deuterated iodoethane, and deuterated iodomethane, among others.

[0086] The conjugate groups described herein can enhance delivery of a therapeutic agent to a particular target location (e.g., a particular organ or tissue) within a subject, such as a human or an animal. In some embodiments of the present application, the conjugate groups can enhance targeted delivery of an expression inhibitory oligonucleotide. In some embodiments of the present application, the conjugate groups can enhance delivery of an expression inhibitory oligonucleotide to the liver.

[0087] The conjugate groups described herein can be attached directly or indirectly to a compound, such as a therapeutic agent, e.g., an expression inhibitory oligonucleotide, e.g., a 3' or 5' end of an expression inhibitory oligonucleotide. In some embodiments of the present application, the expression inhibitory oligonucleotide comprises one or more modified nucleotides. In some embodiments of the present application, the expression inhibitory oligonucleotide is an RNAi agent, such as a double-stranded RNAi agent comprising a sense strand and an antisense strand. In some embodiments of the present application, the conjugate groups disclosed herein are attached to the 3' end of the sense strand of a double-stranded RNAi agent. In some embodiments, the conjugate groups disclosed herein are attached to the expression inhibitory oligonucleotide agent at the 3' end of the sense strand of the double-stranded RNAi agent via a phosphate, phosphorothioate, or phosphonate group.

[0088] It is particularly noted that in the event of conflict or inconsistency between sequence information in the specification and sequence information in the Sequence Listing (ST26 Sequence Listing), the sequence information in the specification controls.

[0089] The use of the terms "stereochemically isomeric forms" is meant to encompass both enantiomeric forms and racemates. The definitions and conventions used in this application for describing the stereochemistry of compounds follow S. P. Parker, Ed., McGraw-Hill Dictionary of Chemical Terms (1984) McGraw-Hill Book Company, New York; and Eliel, E. and Wilen, S., "Stereochemistry of Organic Compounds", John Wiley & Sons, Inc., New York, 1994. The compounds of the present application can contain asymmetrically centers or chiral centers and therefore exist in different stereoisomers. All stereoisomers of the compounds of the present application, including but not limited to, diastereomeric, enantiomeric, atropisomeric, and their mixtures, such as racemates, form part of the present application. Many organic compounds exist in optically active forms, i.e. they have the ability to rotate the plane of plane-polarized light. In describing an optically active compound, the prefixes D, L or R, S are used to denote the absolute configuration of the molecule. The prefixes d and 1 or (+) and (-) are employed to designate the sign of the rotation of plane-polarized light by the compound, (-) or 1 meaning that the compound is levorotatory, and the prefix (+) or d meaning that the compound is dextrorotatory. The chemical structures of these stereoisomers are identical but their orientations in the solid state differ. A specific stereoisomer can be referred to as an enantiomer if its mirror image is not superimposable. A mixture of enantiomers is often referred to as an enantiomeric mixture. A 50:50 mixture of enantiomers is referred to as a racemic mixture or racemate, which can result from racemic synthesis or from resolution of a racemic compound. The terms "racemic mixture" and "racemate" refer to an equimolar mixture of two enantiomeric forms lacking optical activity.

[0090] The term "tautomer" or "tautomeric forms" refers to isomers of different energy which can interconvert by a low energy barrier. For example, prototropic tautomers (i.e. proton transfer tautomers) include tautomeric isomerization by proton migration, such as keto-enol and imine-enamine isomerization.

[0091] The term "composition" means a mixture of the compounds described herein or physiologically acceptable salts or prodrugs thereof with other chemical components, such as physiologically acceptable carriers and excipients. The purpose of a composition is to facilitate administration of the active ingredient to an organism.

[0092] The term "pharmaceutically acceptable carrier" or "pharmaceutically acceptable vehicle" includes, but is not limited to, any of the agents, excipients, glidants, sweeteners, diluents, preservatives, dyes / colorants, flavoring agents, surfactants, wetting agents, dispersing agents, suspending agents, stabilizers, isotonic agents, solvents, or emulsifiers that have been approved by the U.S. Food and Drug Administration for use in humans or domestic animals.

[0093] As used herein, "compound," "ligand," "nucleic acid conjugate," "double- stranded siRNA conjugate," "double-stranded siRNA," and "nucleic acid" of the present application can exist independently as a salt, a mixed salt, or a non-salt (e.g., free acid or free base), unless otherwise specified. When existing as a salt or a mixed salt, it can be a pharmaceutically acceptable salt.

[0094] As described herein, the compounds of the present application can optionally be substituted with one or more substituents, such as described above for the generic compounds, or as in specific examples, sub-generic classes, and generic classes of compounds encompassed by the present application. Unless otherwise indicated, the term "substituted" means that one or more hydrogen atoms have been replaced with a particular substituent. A moiety optionally substituted with one substituent can have a substituent at each substitutable position of the moiety. When a structure is presented wherein more than one position in the structure can be substituted with one or more substituents selected from a particular group, the substituents can be the same or different at each position.

[0095] The term "hydroxyl protecting group" refers to a labile chemical moiety that protects a hydroxyl group from undesired reactions during one or more synthetic procedures. The hydroxyl protecting group can be selectively removed after the one or more synthetic procedures. Hydroxyl protecting groups known in the art are generally described in T.H. Greene and P.G.M. Wuts, Protective Groups in Organic Synthesis, 3rdedition, John Wiley & Sons, New York (1999). Examples of hydroxyl protecting groups of the present application include, but are not limited to, C 1-10 alkylmethyl, benzyloxycarbonyl, 4-nitrobenzyloxycarbonyl, 4-bromobenzyloxycarbonyl, 4-methoxybenzyloxycarbonyl, methoxycarbonyl, tert-butoxycarbonyl, isopropoxy carbonyl, biphenylmethoxycarbonyl, 2,2,2-trichloroethoxycarbonyl, 2- (trimethylsilyl)ethoxycarbonyl, 2-furfuryloxycarbonyl, allyloxycarbonyl, acetyl (Ac or -C(O)CH3), formyl, chloroacetyl, trifluoroacetyl, methoxyacetyl, phenoxyacetyl, benzoyl (Bz or -C(O)C6H5), C 1-10alkyl (methyl, t-butyl, etc.), 2,2,2-trichloroethyl, 2-trimethylsilylethyl, 1,1-dimethyl-2-propenyl, 3-methyl-3-butenyl, allyl, C 6-10 aryl C 1-4 alkyl (e.g., benzyl, phenethyl, etc.), p-methoxybenzyl, benzhydryl, triphenylmethyl (triphenylmethyl or trityl), tetrahydrofuranyl, methoxymethyl, methylthiomethyl, benzyloxymethyl, 2,2,2-trichloroethoxymethyl, 2-(trimethylsilyl)ethoxymethyl, methylsulfonyl, p-toluenesulfonyl, C 1-10 silyl (e.g., trimethylsilyl (TMS or -Si(CH3)3), triethylsilyl, triisopropylsilyl, MMTr, DMTr, or 4',4',4'-trimethoxytrityl, etc.

[0096] The term "amino protecting group" refers to a labile chemical moiety that protects an amino group from undesirable reactions during a synthetic procedure. The amino protecting group, as described herein, can be selectively removed after the synthetic procedure(s). Amino protecting groups known in the art are generally described in T. H. Greene and P. G. M. Wuts, Protective Groups in Organic Synthesis, 3rdedition, John Wiley & Sons, New York (1999). Examples of amino protecting groups include, but are not limited to, acetyl, t-butoxy carbonyl, 9-fluorenylmethyloxycarbonyl, and benzyloxycarbonyl, among others.

[0097] The term "solid support" specifically refers to any particle, bead, or surface on which oligonucleotide synthesis can occur. For example, both inorganic and organic solid supports can be selected for use in embodiments of the present application. Inorganic solid supports are preferably selected from the group consisting of silica gel and controlled-pore glass (CPG). Organic solid supports are resins, preferably macroporous resins, more preferably highly cross-linked polystyrene, Tentagel (a graft copolymer consisting of a low-cross-linked polystyrene matrix onto which polyethylene glycol (PEG or POE) is grafted), polyvinyl acetate (PVA), Poros - a copolymer of polystyrene / divinylbenzene, aminopolyethylene glycol, and cellulose, among others. Preferred embodiments of the present application utilize CPG-based solid supports. Many other commercially available solid supports fall within the present application.

[0098] Detailed description of compounds of the present application

[0099] The present application provides a novel double-stranded siRNA and conjugate thereof, which can achieve RNA-induced silencing complex (RISC)-mediated cleavage of RNA transcript of angiotensinogen (AGT) gene. The AGT gene can be in a cell, for example, a cell in a subject (e.g., a human) in vivo. The present application also provides use of the double-stranded siRNA and conjugate thereof in preparation of a medicament for treating and / or preventing an AGT-related disease (e.g., hypertension), which can inhibit or reduce AGT gene expression by RNA-induced silencing complex (RISC)-mediated cleavage of RNA transcript of AGT gene to inhibit expression of AGT gene. The siRNA and conjugate thereof of the present application have higher in vivo delivery efficiency and better stability, and have higher gene expression inhibition activity on AGT and / or lower toxicity.

[0100] In one aspect, the present application provides a double-stranded siRNA comprising a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises one of the nucleotide sequences as set forth in SEQ ID NO: 4, SEQ ID NO: 1-3 and SEQ ID NO: 5-13 (i.e., one of the sense strands in Table 1 of the present specification), or a nucleotide sequence having 0, 1, 2, 3, 4 or 5 nucleotide differences therefrom, and the nucleotide sequences of SEQ ID NO: 4, SEQ ID NO: 1-3 and SEQ ID NO: 5-13 are detailed in Table 1 of the present specification;

[0101] the antisense strand comprises one of the nucleotide sequences as set forth in SEQ ID NO: 17, SEQ ID NO: 14-16 and SEQ ID NO: 18-26 (i.e., one of the antisense strands in Table 1 of the present specification), or a nucleotide sequence having 0, 1, 2, 3, 4 or 5 nucleotide differences therefrom, and the nucleotide sequences of SEQ ID NO: 17, SEQ ID NO: 14-16 and SEQ ID NO: 18-26 are detailed in Table 1 of the present specification;

[0102] all the nucleotides in the sense strand and the antisense strand are modified nucleotides, and the modified nucleotides are independently selected from at least one of the following:

[0103] 2'-methoxy modified nucleotides, 2'-fluoro modified nucleotides, 2'-methoxyethyl modified nucleotides, phosphorothioate linkage modified nucleotides, 2'-deoxy modified nucleotides, 2'-amino modified nucleotides, 2'-hydroxyl modified nucleotides, locked nucleic acid modified nucleotides, unlocked nucleic acid modified nucleotides, glycol nucleic acids, 5'-vinylphosphonate modified nucleotides, 5'-(E)-VP modified nucleic acids, cEt, D-replaced nucleotides, and InvB.

[0104] In some embodiments of the double-stranded siRNA described herein, the double-stranded siRNA comprises one of the double-stranded siRNA ID NO: 1 to 14, wherein the length of the sense strand is no more than 23 nucleotides, the length of the antisense strand is no more than 25 nucleotides, and the sequence information of the double-stranded siRNA ID NO: 1 to 14 is shown in Table 1 of the specification.

[0105] In some embodiments of the double-stranded siRNA described herein, the sense strand comprises CUCCCACCUUUUCUUCUAA, or a nucleotide sequence with no more than 5 nucleotide differences therefrom, and the antisense strand comprises UUAGAAGAAAAGGUGGGAGAC, or a nucleotide sequence with no more than 5 nucleotide differences therefrom. In some embodiments of the double-stranded siRNA described herein, the double-stranded region is 14-23 nucleotide pairs long.

[0106] In some embodiments of the double-stranded siRNA described herein, the double-stranded region is 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotide pairs long.

[0107] In some embodiments of the double-stranded siRNA described herein, the modified nucleotides are each independently present at one or more positions selected from the group consisting of: the 1st, 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, 19th, 20th, and 21st positions of the nucleotides at the 5' end of the sense strand as the starting point.

[0108] In some embodiments of the double-stranded siRNA described herein, the modified nucleotides are each independently present at one or more positions selected from the group consisting of: the 1st, 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, 19th, 20th, 21st, 22nd, and 23rd positions of the nucleotides at the 5' end of the antisense strand as the starting point.

[0109] In some embodiments of the double stranded siRNA of the application, the phosphorothioate linkage modification is present at one or more positions selected from the group consisting of:

[0110] the 5' terminal nucleotide of the sense strand is between positions 1-2, 2-3, 3-4, 4-5, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, 17-18, 18-19, 19-20, and 20-21 from the start point.

[0111] In some embodiments of the double stranded siRNA of the application, the phosphorothioate linkage modification is present at one or more positions selected from the group consisting of:

[0112] the 5' terminal nucleotide of the antisense strand is between positions 1-2, 2-3, 3-4, 4-5, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, 17-18, 18-19, 19-20, 20-21, 21-22, and 22-23 from the start point.

[0113] In some embodiments of the double stranded siRNA of the application, the 2'-fluoro modified nucleotide is present at one or more positions selected from the group consisting of:

[0114] the 5' terminal nucleotide of the sense strand is positions 5, 7, 8, 9, 10, and 11 from the start point.

[0115] In some embodiments of the double stranded siRNA of the application, the 2'-fluoro modified nucleotide is present at one or more positions selected from the group consisting of:

[0116] the 5' terminal nucleotide of the sense strand is positions 8, 10, 11, and 12, optionally further including position 5, from the start point.

[0117] In some embodiments of the double stranded siRNA of the application, the 2'-fluoro modified nucleotide is present at one or more positions selected from the group consisting of:

[0118] the 5' terminal nucleotide of the antisense strand is positions 2, 6, 8, 9, 12, 14, and 16 from the start point.

[0119] In some embodiments of the double-stranded siRNA of the present application, the 2'-fluoro-modified nucleotides are present at one or more positions selected from the group consisting of:

[0120] The 2'-fluoro-modified nucleotides are present at the 2nd, 6th, 14th and 16th positions from the 5' terminal nucleotide of the antisense strand as the starting point;

[0121] In some embodiments of the double-stranded siRNA of the present application, the InvB modification is connected to the 5' terminal or 3' terminal of the sense strand by a phosphorothioate group or a phosphate group.

[0122] In some embodiments of the double-stranded siRNA of the present application, the antisense strand comprises two consecutive phosphorothioate modifications at the 3' terminal and two consecutive phosphorothioate modifications at the 5' terminal.

[0123] In some embodiments of the double-stranded siRNA of the present application, the sense strand comprises two consecutive phosphorothioate modifications at the 3' terminal and two consecutive phosphorothioate modifications at the 5' terminal.

[0124] The "one or more positions" in "each independently optionally present at one or more positions selected from the group consisting of" or "each independently present at one or more positions selected from the group consisting of" in the present application refers to the presence of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or 23 positions of modification, wherein the optional indicates that the modification can be present or not present, i.e. 0 modification.

[0125] In some embodiments of the double-stranded siRNA of the present application, the sense strand comprises one of the nucleotide sequences as shown in SEQ ID NO: 41, SEQ ID NO: 27-40 and SEQ ID NO: 42 (i.e. one of the sense strands in Table 1-A of the specification of the present application); the antisense strand comprises one of the nucleotide sequences as shown in SEQ ID NO: 48, SEQ ID NO: 45-47 and SEQ ID NO: 49-58 (i.e. one of the antisense strands in Table 1-A of the specification of the present application);

[0126] The nucleotide sequences of SEQ ID NO: 41, SEQ ID NO: 27-40, SEQ ID NO: 42-43, SEQ ID NO: 45-47, SEQ ID NO: 48 and SEQ ID NO: 49-58 are shown in Table 1-A of the specification of the present application.

[0127] In some embodiments of the double-stranded siRNA described in the application, the sense strand comprises one of the nucleotide sequences shown in SEQ ID NO: 73, SEQ ID NO: 59-72, and SEQ ID NO: 74-75; the nucleotide sequences of SEQ ID NO: 73, SEQ ID NO: 59-72, and SEQ ID NO: 74-75 are shown in Table 1-B of the specification.

[0128] In some embodiments of the double-stranded siRNA described in the application, the double-stranded siRNA comprises one of the double-stranded siRNA ID NO: B-1 to B-18, wherein the length of the sense strand is no more than 23 nucleotides, and the length of the antisense strand is no more than 25 nucleotides; the sequence information of the double-stranded siRNA ID NO: B-1 to B-18 is shown in Table 1-B of the specification.

[0129] In some embodiments of the double-stranded siRNA described in the application, the length of the sense strand is no more than 23 nucleotides, and the length of the antisense strand is no more than 23 nucleotides.

[0130] In some embodiments of the double-stranded siRNA described in the application, the length of the sense strand is 19, 20, 21, 22, or 23 nucleotides.

[0131] In some embodiments of the double-stranded siRNA described in the application, the length of the antisense strand is 19, 20, 21, 22, or 23 nucleotides.

[0132] In some embodiments of the double-stranded siRNA described in the application, the length of the sense strand is no more than 21 nucleotides, and the length of the antisense strand is no more than 23 nucleotides.

[0133] In some embodiments of the double-stranded siRNA described in the application, the antisense strand comprises a 3' overhang and / or a 5' overhang, and the 3' overhang or 5' overhang comprises 1, 2, or 3 nucleotides.

[0134] In some embodiments of the double-stranded siRNA described in the application, the sense strand comprises the nucleotide sequence of 5'-InvBscsucccaCfcUfUfUfucuucuasa-3', and the antisense strand comprises the nucleotide sequence of 5'-usUfsagaAfgaaaaggUfgGfgagsasc-3'.

[0135] In some embodiments of the double stranded siRNA described herein, the sense strand comprises a nucleotide sequence of 5'-InvBscsucccaCfcUfUfUfucuucusasa-3' and the antisense strand comprises a nucleotide sequence of 5'-usUfsagaAfgaaaaggUfgGfgagsasc-3'.

[0136] In some embodiments of the double stranded siRNA described herein, the sense strand comprises a nucleotide sequence of 5'-InvBsgsuuuguGfaAfAfCfaaaaaagsa-3' and the antisense strand comprises a nucleotide sequence of 5'-usCfsuuuUfuuguuucAfcAfaacsasa-3'.

[0137] In some embodiments of the double stranded siRNA described herein, the sense strand comprises a nucleotide sequence of 5'-InvBsgsuuuguGfaAfAfCfaaaaaagsa-3' and the antisense strand comprises a nucleotide sequence of 5'-usCfsuuuUfuuguuucAfcAfaacsasa-3'. In still another aspect, the present application relates to a double stranded siRNA conjugate comprising a double stranded siRNA described herein and a conjugate group conjugated to the siRNA.

[0138] In some embodiments of the double stranded siRNA conjugate described herein, the 3' end or 5' end of the sense strand or the antisense strand of the double stranded siRNA in the double stranded siRNA conjugate is conjugated to the conjugate group, preferably, the 3' end of the sense strand of the double stranded siRNA is conjugated to the conjugate group; wherein the 3' end or 5' end of the sense strand of the double stranded siRNA is conjugated to the conjugate group through a phosphate group, a thiophosphate group or a phosphoric acid group.

[0139] In some embodiments of the double stranded siRNA conjugate described herein, the conjugate group comprises GalNAc or a derivative thereof.

[0140] In some embodiments of the double stranded siRNA conjugate described herein, the conjugate group is GalNAc or a derivative thereof linked by a bivalent, trivalent or tetravalent branched linker.

[0141] In some embodiments of the double stranded siRNA conjugate described herein, the conjugate group is L-96 or DAW40007-4, wherein the structures of the conjugate groups L-96 and DAW40007-4 are respectively:

[0142] In some embodiments of the double stranded siRNA conjugate of the present application, the sense strand comprises a nucleotide sequence of 5'-InvBscucccaCfcUfUfUfucuucuasasL96-3' and the antisense strand comprises a nucleotide sequence of 5'-usUfsagaAfgaaaaggUfgGfgagsasc-3'.

[0143] In some embodiments of the double stranded siRNA conjugate of the present application, the sense strand comprises a nucleotide sequence of 5'-InvBscucccaCfcUfUfUfucuucuasasL96-3' and the antisense strand comprises a nucleotide sequence of 5'-usUfsagaAfgaaaaggUfgGfgagsasc-3'.

[0144] The double stranded siRNA and siRNA conjugate of the present application also include (R)- and (S)-enantiomers, diastereomers, and / or racemic mixtures thereof.

[0145] In another aspect, the present application provides a pharmaceutical composition comprising the double stranded siRNA or double stranded siRNA conjugate of the present application, and a pharmaceutically acceptable carrier.

[0146] In some embodiments, the pharmaceutical composition of the present application can be an injection solution.

[0147] In some embodiments, the injection solution of the present application can be used for subcutaneous, intramuscular, or intravenous injection.

[0148] In some embodiments, the pharmaceutical composition of the present application further comprises another therapeutic agent, wherein the another therapeutic agent is selected from a diuretic, an angiotensin-converting enzyme (ACE) inhibitor, an angiotensin II receptor antagonist, a beta-blocker, a vasodilator, a calcium channel blocker, an aldosterone antagonist, an alpha2-agonist, a renin inhibitor, an alpha-blocker, a peripherally acting adrenergic agent, a selective Dl receptor partial agonist, a nonselective alpha-adrenergic antagonist, a synthetic steroidal antimineralocorticoid agent, or any combination of the foregoing, and a hypertension treatment agent formulated in a pharmaceutical combination.

[0149] In another aspect, the present application provides a method of inhibiting the expression of an AGT gene in a patient, comprising administering to the patient a double stranded siRNA or double stranded siRNA conjugate of the present application or a composition thereof (i.e., a double stranded RNAi agent), which can be in a therapeutically effective amount.

[0150] In some embodiments, wherein the double stranded RNAi agent is administered at a dose of 0.01 mg / kg to 10 mg / kg, or 0.5 mg / kg to 50 mg / kg, or at a dose of 10 mg / kg to 30 mg / kg, or at a dose of 3 mg / kg, or at a dose of 10 mg / kg.

[0151] In some embodiments, wherein the double stranded RNAi agent is administered at a dose of 0.5 mg / kg twice a week, or at a dose of 10 mg / kg every other week, or at a dose of 0.5-1 mg / kg once a week.

[0152] In some embodiments, wherein the double stranded RNAi agent is administered subcutaneously or intravenously.

[0153] In some embodiments, wherein the double stranded RNAi agent is administered in two or more doses.

[0154] In another aspect, the present application relates to the use of a double stranded siRNA and siRNA conjugate or pharmaceutical composition according to the present application for the preparation of a medicament for the treatment and / or prevention of an AGT related disease.

[0155] In some embodiments of the use according to the present application, the AGT related disease is hypertension.

[0156] In some embodiments of the use according to the present application, the hypertension is selected from borderline hypertension, essential hypertension, secondary hypertension, hypertensive crisis, hypertensive emergency, isolated systolic and diastolic hypertension, pregnancy-related hypertension, diabetic hypertension, resistant hypertension, refractory hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt's hypertension, pulmonary arterial hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, and labile hypertension.

[0157] Nucleic acid conjugates, compositions, formulations, methods of administration and methods of treating diseases of the present application

[0158] The effective amount of a nucleic acid conjugate (e.g. siRNA conjugate or pharmaceutical composition) according to the present application can vary according to the mode of administration and the severity of the disease to be treated, etc. The selection of an optimal effective amount can be made by one of ordinary skill in the art (e.g. by clinical trials) according to various factors. Such factors include, but are not limited to: pharmacokinetic parameters of the active ingredient(s) such as bioavailability, metabolism, half-life, etc.; the severity of the disease to be treated; the body weight of the patient; the immune status of the patient; the route of administration, etc.

[0159] In some embodiments, the present application provides pharmaceutical compositions comprising an iRNA as described herein and a pharmaceutically acceptable carrier. Pharmaceutical compositions comprising an iRNA can be used to treat a disease or disorder associated with expression or activity of an AGT gene. Such pharmaceutical compositions are formulated based on the mode of delivery. One example is a composition formulated for systemic administration by parenteral delivery, e.g., by subcutaneous (SC) or intravenous (IV) delivery. Another example is a composition formulated for direct delivery to the brain parenchyma, e.g., by infusion into the brain, e.g., by continuous pump infusion. Pharmaceutical compositions of the present application can be administered in a dose sufficient to inhibit expression of an AGT gene. Typically, a suitable dose of an iRNA of the present application is in the range of about 0.001 to about 200.0 milligrams per kilogram of body weight of the recipient per day, typically in the range of about 1 to 50 mg per kilogram of body weight per day. For example, a dsRNA can be administered at about 0.01 mg / kg, about 0.05 mg / kg, about 0.5 mg / kg, about 1 mg / kg, about 1.5 mg / kg, about 2 mg / kg, about 3 mg / kg, about 10 mg / kg, about 20 mg / kg, about 30 mg / kg, about 40 mg / kg, or about 50 mg / kg per single dose.

[0160] For example, a dsRNA can be administered at a dose of about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, or about 10 mg / kg. Intermediate values and ranges between these cited values are also intended to be part of this application.

[0161] In other embodiments, the dsRNA is administered at a dose of about 0.1 to about 50 mg / kg, about 0.25 to about 50 mg / kg, about 0.5 to about 50 mg / kg, about 0.75 to about 50 mg / kg, about 1 to about 50 mg / kg, about 1.5 to about 50 mg / kg, about 2 to about 50 mg / kg, about 2.5 to about 50 mg / kg, about 3 to about 50 mg / kg, about 3.5 to about 50 mg / kg, about 4 to about 50 mg / kg, about 4.5 to about 50 mg / kg, about 5 to about 50 mg / kg, about 7.5 to about 50 mg / kg, about 10 to about 50 mg / kg, about 15 to about 50 mg / kg, about 20 to about 50 mg / kg, about 20 to about 50 mg / kg, about 25 to about 50 mg / kg, about 25 to about 50 mg / kg, about 30 to about 50 mg / kg, about 35 to about 50 mg / kg, about 40 to about 50 mg / kg, about 45 to about 50 mg / kg, about 0.1 to about 45 mg / kg, about 0.25 to about 45 mg / kg, about 0.5 to about 45 mg / kg, about 0.75 to about 45 mg / kg, about 1 to about 45 mg / kg, about 1.5 to about 45 mg / kg, about 2 to about 45 mg / kg, about 2.5 to about 45 mg / kg, about 3 to about 45 mg / kg, about 3.5 to about 45 mg / kg, about 4 to about 45 mg / kg, about 4.5 to about 45 mg / kg, about 5 to about 45 mg / kg, about 7.5 to about 45 mg / kg, about 10 to about 45 mg / kg, about 15 to about 45 mg / kg, about 20 to about 45 mg / kg, about 20 to about 45 mg / kg, about 25 to about 45 mg / kg, about 25 to about 45 mg / kg, about 30 to about 45 mg / kg, about 35 to about 45 mg / kg, about 40 to about 45 mg / kg, about 0.1 to about 40 mg / kg, about 0.25 to about 40 mg / kg, about 0.5 to about 40 mg / kg, about 0.75 to about 40 mg / kg, about 1 to about 40 mg / kg, about 1.5 to about 40 mg / kg, about 2 to about 40 mg / kg, about 2.5 to about 40 mg / kg, about 3 to about 40 mg / kg, about 3.5 to about 40 mg / kg, about 4 to about 40 mg / kg, about 4.5 to about 40 mg / kg, about 5 to about 40 mg / kg, about 7.5 to about 40 mg / kg, about 10 to about 40 mg / kg, about 15 to about 40 mg / kg, about 20 to about 40 mg / kg, about 20 to about 40 mg / kg, about 25 to about 40 mg / kg, about 25 to about 40 mg / kg, about 30 to about 40 mg / kg, about 35 to about 40 mg / kg, about 0.1 to about 30 mg / kg, about 0.25 to about 30 mg / kg, about 0.5 to about 30 mg / kg, about 0.75 to about 30 mg / kg, about 1 to about 30 mg / kg, about 1.5 to about 30 mg / kg, about 2 to about 30 mg / kg, about 2.5 to about 30 mg / kg, about 3 to about 30 mg / kg, about 3.5 to about 30 mg / kg, about 4 to about 30 mg / kg, about 4.5 to about 30 mg / kg, about 5 to about 30 mg / kg, about 7.5 to about 30 mg / kg, about 10 to about 30 mg / kg, about 15 to about 30 mg / kg, about 20 to about 30 mg / kg, about 20 to about 30 mg / kg, about 25 to about 30 mg / kg, about 25 to about 30 mg / kg, about 30 to about 30 mg / kg, about 0.1 to about 25 mg / kg, about 0.25 to about 25 mg / kg, about 0.5 to about 25 mg / kg, about 0.75 to about 25 mg / kg, about 1 to about 25 mg / kg, about 1.5 to about 25 mg / kg, about 2 to about 25 mg / kg, about 2.5 to about 25 mg / kg, about 3 to about 25 mg / kg, about 3.5 to about 25 mg / kg, about 4 to about 25 mg / kg, about 4.5 to about 25 mg / kg, about 5 to about 25 mg / kg, about 7.5 to about 25 mg / kg, about 10 to about 25 mg / kg, about 15 to about 25 mg / kg, about 20 to about 25 mg / kg, about 20 to about 25 mg / kg, about 25 to about 25 mg / kg, about 0.1 to about 20 mg / kg, about 0.25 to about 20 mg / kg, about 0.5 to about 20 mg / kg, about 0.75 to about 20 mg / kg, about 1 to about 20 mg / kg, about 1.5 to about 20 mg / kg, about 2 to about 20 mg / kg, about 2.5 to about 20 mg / kg, about 3 to about 20 mg / kg, about 3.5 to about 20 mg / kg, about 4 to about 20 mg / kg, about 4.5 to about 20 mg / kg, about 5 to about 20 mg / kg, about 7.5 to about 20 mg / kg, about 10 to about 20 mg / kg, about 15 to about 20 mg / kg, about 20 to about 20 mg / kg, about 0.1 to about 15 mg / kg, about 0.25 to about 15 mg / kg, about 0.5 to about 15 mg / kg, about 0.75 to about 15 mg / kg, about 1 to about 15 mg / kg, about 1.5 to about 15 mg / kg, about 2 to about 15 mg / kg, about 2.5 to about 15 mg / kg, about 3 to about 15 mg / kg, about 3.5 to about 15 mg / kg, about 4 to about 15 mg / kg, about 4.5 to about 15 mg / kg, about 5 to about 15 mg / kg, about 7.5 to about 15 mg / kg, about 10 to about 15 mg / kg, about 15 to about 15 mg / kg, about 0.1 to about 10 mg / kg, about 0.25 to about 10 mg / kg, about 0.5 to about 10 mg / kg, about 0.75 to about 10 mg / kg, about 1 to about 10 mg / kg, about 1.5 to about 10 mg / kg, about 2 to about 10 mg / kg, about 2.5 to about 10 mg / kg, about 3 to about 10 mg / kg, about 3.5 to about 10 mg / kg, about 4 to about 10 mg / kg, about 4.5 to about 10 mg / kg, about 5 to about 10 mg / kg, about 7.5 to about 10 mg / kg, about 10 to about 10 mg / kg, about 0.1 to about 7.5 mg / kg, about 0.25 to about 7.5 mg / kg, about 0.5 to about 7.5 mg / kg, about 0.75 to about 7.5 mg / kg, about 1 to about 7.5 mg / kg, about 1.5 to about 7.5 mg / kg, about 2 to about 7.5 mg / kg, about 2.5 to about 7.5 mg / kg, about 3 to about 7.5 mg / kg, about 3.5 to about 7.5 mg / kg, about 4 to about 7.5 mg / kg, about 4.5 to about 7.5 mg / kg, about 5 to about 7.5 mg / kg, about 7.5 to about 7.5 mg / kg, about 0.1 to about 5 mg / kg, about 0.25 to about 5 mg / kg, about 0.5 to about 5 mg / kg, about 0.75 to about 5 mg / kg, about 1 to about 5 mg / kg, about 1.5 to about 5 mg / kg, about 2 to about 5 mg / kg, about 2.5 to about 5 mg / kg, about 3 to about 5 mg / kg, about 3.5 to about 5 mg / kg, about 4 to about 5 mg / kg, about 4.5 to about 5 mg / kg75 to about 30 mg / kg, about 1 to about 30 mg / kg, about 1.5 to about 30 mg / kg, about 2 to about 30 mg / kg, about 2.5 to about 30 mg / kg, about 3 to about 30 mg / kg, about 3.5 to about 30 mg / kg, about 4 to about 30 mg / kg, about 4.5 to about 30 mg / kg, about 5 to about 30 mg / kg, about 7.5 to about 30 mg / kg, about 10 to about 30 mg / kg, about 15 to about 30 mg / kg, about 20 to about 30 mg / kg, about 20 to about 30 mg / kg, about 25 to about 30 mg / kg, about 0.1 to about 20 mg / kg, about 0.25 to about 20 mg / kg, about 0.5 to about 20 mg / kg, about 0.75 to about 20 mg / kg, about 1 to about 20 mg / kg, about 1.5 to about 20 mg / kg, about 2 to about 20 mg / kg, about 2.5 to about 20 mg / kg, about 3 to about 20 mg / kg, about 3.5 to about 20 mg / kg, about 4 to about 20 mg / kg, about 4.5 to about 20 mg / kg, about 5 to about 20 mg / kg, about 7.5 to about 20 mg / kg, about 10 to about 20 mg / kg, or about 15 to about 20 mg / kg. Intermediate values and ranges between these cited values are also intended to be part of the application.

[0162] The subject can be administered by any suitable route known in the art, including, but not limited to, oral or parenteral routes, including intravenous administration, intramuscular administration, subcutaneous administration, transdermal administration, airway administration (aerosol), pulmonary administration, nasal administration, rectal administration, and topical administration (including buccal administration and sublingual administration), preferably intravenous injection.

[0163] In some embodiments, the pharmaceutical composition can be administered by intravenous infusion over a period of time, such as over a 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, and 21, 22, 23, 24, or about 25 minute period. For example, administration can be repeated regularly, such as weekly, biweekly (i.e., every two weeks), for a month, two months, three months, four months, or longer. After an initial treatment regimen, treatment can be given less frequently. For example, after administration weekly or biweekly for three months, administration can be repeated monthly for six months or a year or longer.

[0164] In some embodiments, the pharmaceutical composition can be administered by subcutaneous administration. The pharmaceutical composition can be administered once daily, or the iRNA can be administered in two, three or more sub-doses at appropriate intervals throughout the day, or even delivered using continuous infusion or by controlled release formulations. In such cases, the iRNA contained in each sub-dose must be accordingly less so as to deliver an overall daily dose. Composite dosage units can also be used for delivery over several days, for example, using conventional sustained release formulations that provide a sustained release of iRNA over a period of several days. Sustained release formulations are well known in the art and are particularly useful for delivering agents over a specific period, as can be used with the agents of the present application. In this embodiment, the dosage unit contains a corresponding multiple of the daily dose. An initial higher dose (i.e., a loading dose) can be administered, followed by a lower dose for a sustained period of time.

[0165] In some embodiments, a single dose of the pharmaceutical composition can be long acting, such that subsequent doses are administered at intervals of no more than 3, 4 or 5 days, or no more than 1, 2, 3 or 4 weeks. In some embodiments of the present application, a single dose of the pharmaceutical composition of the present application is administered once a week. In other embodiments of the present application, a single dose of the pharmaceutical composition of the present application is administered every two months. In particular embodiments, the iRNA is administered from about once a month to about once a quarter (i.e., about once every three months).

[0166] The pharmaceutical compositions of the present application include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions can be generated from a variety of components that include, but are not limited to, preformed liquids, self- emulsifying solids and self-emulsifying semisolids. Particularly preferred are formulations that target the liver when treating liver disorders, such as liver cancer.

[0167] The pharmaceutical formulations of the present application, which can conveniently be presented in unit dosage form, can be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general, the preparations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.

[0168] The compositions of the present application can be formulated into any of a number of possible dosage forms, such as, but not limited to, tablets, capsules, gelcaps, liquid suspensions, soft gels, suppositories, and enemas. The compositions of the present application can also be formulated as suspensions in aqueous, non-aqueous, or mixed media. The aqueous suspensions can further comprise a viscosifying substance, such substances including, for example, sodium carboxymethyl cellulose, sorbitol, and / or dextran. The suspensions can also comprise a stabilizing agent.

[0169] The pharmaceutical compositions disclosed herein include formulations suitable for parenteral administration. The formulations can conveniently be presented in unit dosage form and can be prepared by any methods well known in the art of pharmacy. The amount of active ingredient that can be combined with auxiliary agent material to produce a single dose form will generally be that amount of siRNA which produces a therapeutic effect. In general, this amount will range from about 1% to about 99% of the dosage unit, preferably from about 5% to about 70%, most preferably from about 10% to about 30% by weight of the active ingredient.

[0170] In one aspect, the present application provides a method of treating a subject having a disorder that would benefit from a reduction in AGT expression, e.g., an AGT-associated disease, e.g., hypertension, e.g., borderline hypertension (also known as prehypertension), essential hypertension (also known as primary hypertension or idiopathic hypertension), secondary hypertension (also known as non-essential hypertension), hypertensive crisis (also known as malignant hypertension), hypertensive emergency, isolated systolic or diastolic hypertension, pregnancy-associated hypertension (e.g., preeclampsia, eclampsia, and postpartum pre-eclampsia), diabetic hypertension, resistant hypertension, refractory hypertension, paroxysmal hypertension, renovascular hypertension (also known as renal hypertension), Goldblatt's hypertension, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, unstable hypertension; hypertensive heart disease, hypertensive nephropathy, atherosclerosis, arteriosclerosis, vascular disease (including peripheral vascular disease), diabetic nephropathy, diabetic retinopathy, chronic heart failure, cardiomyopathy, diabetic cardiomyopathy, glomerulosclerosis, coarctation of the aorta, aortic aneurysm, ventricular fibrosis, Cushing's syndrome and other glucocorticoid excess states (including chronic steroid treatment), pheochromocytoma, reninoma, secondary hyperaldosteronism and other mineralocorticoid excess states, sleep apnea, thyroid / parathyroid disease, heart failure (e.g., left ventricular systolic dysfunction), myocardial infarction, angina, stroke, diabetes (e.g., diabetic nephropathy), kidney disease (e.g., chronic kidney disease or diabetic nephropathy, optionally in the context of pregnancy), kidney failure (e.g., chronic kidney failure), cognitive dysfunction (e.g., Alzheimer's disease), and systemic sclerosis (e.g., scleroderma renal crisis). In particular embodiments, the AGT-associated disease includes intrauterine growth restriction (IUGR) and fetal growth restriction. The treatment methods (and uses) of the present application include administering to a subject, e.g., a human, a therapeutically effective amount of an iRNA agent targeted to an AGT gene or a pharmaceutical composition comprising an iRNA agent targeted to an AGT gene, thereby treating a subject having a disorder that would benefit from a reduction in AGT expression.

[0171] In another aspect, the present application provides the use of a therapeutically effective amount of an iRNA agent of the present application for treating a subject, e.g., a subject that would benefit from a reduction and / or inhibition of AGT expression.

[0172] In a further aspect, the present application provides the use of an iRNA agent (e.g., a dsRNA) of the present application targeting the AGT gene or a pharmaceutical composition comprising an iRNA agent targeting the AGT gene in the manufacture of a medicament for treating a subject, e.g., a subject that would benefit from a reduction and / or inhibition of AGT expression, such as a subject having a disorder that would benefit from a reduction in AGT expression, e.g., an AGT-associated disease, e.g., hypertension, e.g., borderline hypertension (also known as prehypertension), essential hypertension (also known as primary hypertension or idiopathic hypertension), secondary hypertension (also known as non-essential hypertension), hypertensive crisis (also known as malignant hypertension), hypertensive emergency, isolated systolic or diastolic hypertension, pregnancy-related hypertension (e.g., preeclampsia, eclampsia, and postpartum pre-eclampsia), diabetic hypertension, resistant hypertension, refractory hypertension, paroxysmal hypertension, renovascular hypertension (also known as renal hypertension), Goldblatt hypertension, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, unstable hypertension; hypertensive heart disease, hypertensive nephropathy, atherosclerosis, arteriosclerosis, vascular disease (including peripheral vascular disease), diabetic nephropathy, diabetic retinopathy, chronic heart failure, cardiomyopathy, diabetic cardiomyopathy, glomerulosclerosis, coarctation of the aorta, aortic aneurysm, ventricular fibrosis, Cushing's syndrome and other glucocorticoid excess states (including chronic steroid treatment), pheochromocytoma, reninoma, secondary aldosterone excess and other mineralocorticoid excess states, sleep apnea, thyroid / parathyroid disease, heart failure (e.g., left ventricular systolic dysfunction), myocardial infarction, angina, stroke, diabetes (e.g., diabetic nephropathy), kidney disease (e.g., chronic kidney disease or diabetic nephropathy, optionally in a pregnancy setting), kidney failure (e.g., chronic kidney failure), cognitive impairment (e.g., Alzheimer's disease), and systemic sclerosis (e.g., scleroderma renal crisis). In particular embodiments, the AGT-associated disease comprises intrauterine growth restriction (IUGR) and fetal growth restriction.

[0173] In another aspect, the present application provides the use of an iRNA (e.g., dsRNA) of the present application for preventing at least one symptom in a subject having a disorder that would benefit from a reduction and / or inhibition of AGT expression, e.g., an AGT-associated disease, e.g., hypertension, e.g., borderline hypertension (also known as prehypertension), essential hypertension (also known as primary hypertension or idiopathic hypertension), secondary hypertension (also known as non-essential hypertension), hypertensive crisis (also known as malignant hypertension), hypertensive emergency, isolated systolic or diastolic hypertension, pregnancy-related hypertension (e.g., preeclampsia, eclampsia, and postpartum pre-eclampsia), diabetic hypertension, resistant hypertension, refractory hypertension, paroxysmal hypertension, renovascular hypertension (also known as renal hypertension), Goldblatt hypertension, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, unstable hypertension; hypertensive heart disease, hypertensive nephropathy, atherosclerosis, arteriosclerosis, vascular disease (including peripheral vascular disease), diabetic nephropathy, diabetic retinopathy, chronic heart failure, cardiomyopathy, diabetic cardiomyopathy, glomerulosclerosis, coarctation of the aorta, aortic aneurysm, ventricular fibrosis, Cushing's syndrome and other glucocorticoid excess states (including chronic steroid treatment), pheochromocytoma, reninoma, secondary aldosterone excess and other mineralocorticoid excess states, sleep apnea, thyroid / parathyroid disease, heart failure (e.g., left ventricular systolic dysfunction), myocardial infarction, angina, stroke, diabetes (e.g., diabetic nephropathy), kidney disease (e.g., chronic kidney disease or diabetic nephropathy, optionally in a pregnancy setting), kidney failure (e.g., chronic kidney failure), cognitive impairment (e.g., Alzheimer's disease), and systemic sclerosis (e.g., scleroderma renal crisis). In particular embodiments, the AGT-associated disease comprises intrauterine growth restriction (IUGR) and fetal growth restriction.

[0174] In a further aspect, the present application provides the use of an iRNA agent of the present application in the manufacture of a medicament for preventing at least one symptom in a subject having a disorder that would benefit from a reduction in AGT expression and / or inhibition, such as an AGT-associated disease, for example, hypertension, for example, borderline hypertension (also known as prehypertension), essential hypertension (also known as primary hypertension or idiopathic hypertension), secondary hypertension (also known as non-essential hypertension), hypertensive crisis (also known as malignant hypertension), hypertensive emergency, isolated systolic or diastolic hypertension, pregnancy-related hypertension (e.g., preeclampsia, eclampsia, and postpartum pre-eclampsia), diabetic hypertension, resistant hypertension, refractory hypertension, paroxysmal hypertension, renovascular hypertension (also known as renal hypertension), Goldblatt's hypertension, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, unstable hypertension; hypertensive heart disease, hypertensive nephropathy, atherosclerosis, arteriosclerosis, vascular disease (including peripheral vascular disease), diabetic nephropathy, diabetic retinopathy, chronic heart failure, cardiomyopathy, diabetic cardiomyopathy, glomerulosclerosis, coarctation of the aorta, aortic aneurysm, ventricular fibrosis, Cushing's syndrome and other glucocorticoid excess states (including chronic steroid treatment), pheochromocytoma, reninoma, secondary hyperaldosteronism and other mineralocorticoid excess states, sleep apnea, thyroid / parathyroid disease, heart failure (e.g., left ventricular systolic dysfunction), myocardial infarction, angina, stroke, diabetes (e.g., diabetic nephropathy), kidney disease (e.g., chronic kidney disease or diabetic nephropathy, optionally in a pregnancy setting), kidney failure (e.g., chronic kidney failure), cognitive impairment (e.g., Alzheimer's disease), and systemic sclerosis (e.g., scleroderma renal crisis). In particular embodiments, the AGT-associated disease comprises intrauterine growth restriction (IUGR) and fetal growth restriction.

[0175] General synthetic methods for the compounds, double-stranded siRNAs, double-stranded siRNA conjugates of the present application

[0176] Generally, the compounds, nucleic acid conjugates of the present application can be prepared by the methods described herein. The following reaction schemes and examples are intended to further illustrate the present application.

[0177] The following examples are described below, all temperatures are set at degrees Celsius (°C) unless otherwise indicated. The chromatography column uses silica gel column, silica gel (200-300 mesh) is purchased from Qingdao Haoyang Chemical Factory, NH2CPG is purchased from Hebei Dinaxingke. Nuclear magnetic resonance spectrum is measured in CDC13, DMSO-d6, CD3OD or acetone-d6 as solvent (in ppm), using TMS (0 ppm) or chloroform (7.25 ppm) as reference standard. When multiple peaks appear, the following abbreviations will be used: s (singlet), d (doublet), t (triplet), m (multiplet), br (broadened), dd (doublet of doublets), dt (doublet of triplets), br.s (broadened singlet), q (quartet). The coupling constant J is expressed in hertz (Hz).

[0178] Low resolution mass spectrometry (MS) data is determined by a spectrometer equipped with G1312A binary pump and a G1316A TCC (column temperature is kept at 30°C) of Agilent 6320 series LC-MS, G1329A autosampler and G1315B DAD detector are applied to analysis, ESI source is applied to LC-MS spectrometer.

[0179] High resolution mass spectrometry (MS) data is determined by a spectrometer equipped with G1311A quaternary pump and G1316A TCC (column temperature is kept at 30°C) of Agilent 6130 series LC-MS, G1329A autosampler and G1315D DAD detector are applied to analysis, ESI source is applied to HR-MS spectrometer.

[0180] The following abbreviations are used throughout the present invention: DETAILED DESCRIPTION

[0181] The scheme of the present application will be explained below in combination with examples. Those skilled in the art will understand that the following examples are only for illustration of the present application, and should not be regarded as limiting the scope of the present application. In particular, the synthesis of small nucleic acids and the synthesis of nucleic acid conjugates can be synthesized according to the examples of the present application or the conventional adjustment in the art. The specific techniques or conditions not mentioned in the examples are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions. The reagents or instruments not mentioned by the manufacturer are all conventional products that can be obtained by purchase.

[0182] Preparation examples

[0183] In the following preparation examples, the inventors describe in detail the preparation process of the compounds of the present application using some of the compounds of the present application as examples, wherein, CPG.

[0184] Example 1: Synthesis of compound DAW40007-3

[0185] Step 1: Synthesis of compound 2-2

[0186] Compound 2-1 (2.50 g, 28.05 mmol) and triethylamine (7.8 mL, 56.1 mmol) were dissolved in DCM (120 mL), and benzyl chloroformate (9.57 g, 56.1 mmol) was added dropwise at 0 °C. After the addition was completed, the reaction mixture was stirred at room temperature for 20 h, diluted with saturated ammonium chloride solution (50 mL), and separated. The aqueous phase was discarded, and the organic phase was concentrated. The obtained residue was purified by silica gel column chromatography (MeOH / DCM (V / V) = 1 / 30) to obtain compound 2-2 (2.96 g, 47.2%) as a white solid.

[0187] MS (ESI, pos.ion) m / z: 224.2 [M+H] + ;

[0188] 1 H NMR (400 MHz, CDCl3) δ 7.37 (d, J = 4.2 Hz, 5H), 5.11 (s, 2H), 5.00 (s, 1H), 4.19-4.14 (m, 1H), 3.70-3.64 (m, 2H), 3.24 (t, J = 6.4 Hz, 2H), 3.15 (q, J = 4.6 Hz, 1H), 1.90 (dq, J = 14.2, 5.0, 4.3 Hz, 2H), 1.77-1.71 (m, 1H).

[0189] Step 2: Synthesis of compound 2-4

[0190] Compound 2-3 (1.5 g, 4.56 mmol) and compound 2-2 (1.22 g, 5.47 mmol) were dissolved in 1,2-dichloroethane (30 mL), and 3A molecular sieves (2.0 g) were added, and stirred at room temperature for 10 min. TMSOTf (0.51 g, 2.28 mmol) was added, and the reaction mixture was stirred at room temperature for 18 h. The reaction solution was poured into saturated sodium bicarbonate solution (100 mL), and then extracted with DCM (100 mL), washed with saturated brine (100 mL), dried over anhydrous sodium sulfate, and the solvent was evaporated under reduced pressure. The residue was purified by silica gel column chromatography (PE / EA (V / V) = 2 / 1 to 0 / 1) to obtain compound 2-4 (1.8 g, 71.51%) as a light brown oil. MS (ESI, pos.ion) m / z: 553.3 [M+H] + .

[0191] Step 3: Synthesis of compound 2-5

[0192] Compound 2-4 (0.57 g, 1.03 mmol) and palladium on carbon (0.11 g, 0.1 mmol, 10%) were added to THF (10 mL), and TFA (0.12 g, 1.03 mmol) was added, followed by hydrogen replacement three times, and then stirred at room temperature for 19 h under a hydrogen atmosphere. After the reaction was completed, the reaction solution was filtered through diatomite, and the solvent was evaporated under reduced pressure to obtain compound 2-5 (0.55 g, 100.32%) as a light brown oil. MS (ESI, pos.ion) m / z: 419.3 [M-TFA+H] + .

[0193] Step 4: Synthesis of compound 2-7

[0194] Compound 2-6 (0.46 g, 2.29 mmol, purchased from Shanghai Bide Pharmaceutical Technology Co., Ltd.) and compound 2-5 (1.16 g, 2.18 mmol) were dissolved in DCM (30 mL), and HOBT (0.46 g, 3.44 mmol), HBTU (1.30 g, 3.44 mmol), and DIPEA (2.66 mL, 16.03 mmol) were added in sequence. The reaction mixture was reacted at room temperature for 16 h. After the reaction was completed, water (20 mL) and DCM (50 mL x 2) were added in sequence, and the organic phase was washed with saturated sodium bicarbonate solution (30 mL) and saturated brine (20 mL) in sequence, and the solvent was evaporated under reduced pressure. The residue was purified by silica gel column chromatography (MeOH / EA (v / v) = 1 / 20) to obtain compound 2-7 (1.0 g, yield 72.7%) as a white solid.

[0195] MS (ESI, pos.ion) m / z: 602.3 [M+H] + ;

[0196] 1 H NMR (400 MHz, CD3OD) δ 5.39 - 5.33 (m, 1H), 5.07 (dd, J = 11.2, 3.4 Hz, 1H), 4.58 (d, J = 8.4 Hz, 1H), 4.21 - 4.09 (m, 3H), 4.04 (t, J = 6.7 Hz, 1H), 3.89 (dt, J = 10.4, 5.1 Hz, 1H), 3.60 - 3.50 (m, 1H), 3.30 - 3.13 (m, 2H), 2.16 (s, 3H), 2.04 (s, 3H), 1.97 (s, 3H), 1.94 (s, 3H), 1.67 - 1.56 (m, 4H), 1.48 (s, 9H), 1.41 - 1.37 (m, 2H), 1.02 - 0.98 (m, 2H).

[0197] Step 5: Synthesis of compound 2-8

[0198] Compound 2-7 (0.72 g, 1.17 mmol) was dissolved in DCM (8 mL), then TFA (0.87 mL, 11.7 mmol) was added, the reaction mixture was stirred at 25 °C for 16 h, the solvent was concentrated to give compound 2-8 (0.74 g, 103.1%) as brown oil.

[0199] MS (ESI, pos.ion) m / z: 502.2 [M+H] + ;

[0200] 1 H NMR (400 MHz, CD3OD) δ 5.36 (d, J = 3.3 Hz, 1H), 5.08 (dd, J = 11.3, 3.3 Hz, 1H), 4.58 (d, J = 8.4 Hz, 1H), 4.16 - 4.10 (m, 3H), 4.08 - 4.02 (m, 1H), 3.92 - 3.85 (m, 1H), 3.58 - 3.50 (m, 1H), 3.26 - 3.20 (m, 2H), 2.16 (s, 3H), 2.04 (d, J = 5.2 Hz, 6H), 1.98 (s, 3H), 1.97 (s, 3H), 1.61 - 1.56 (m, 4H), 1.54 - 1.52 (m, 2H), 1.42 - 1.38 (m, 2H).

[0201] Step 6: Synthesis of compound 2-10

[0202] Compound 2-9 (0.19 g, 0.30 mmol) and compound 2-8 (0.50 g, 0.99 mmol) were dissolved in DCM (30 mL), then HOBT (0.17 g, 1.26 mmol), HBTU (0.48 g, 1.26 mmol) and DIPEA (0.5 mL, 3.0 mmol) were added successively, and the reaction mixture was stirred at 30 °C for 3 h. After the reaction was completed, the reaction was quenched by adding water (20 mL), and then extracted with DCM (100 mL x 2), and the combined organic phase was washed successively with saturated sodium bicarbonate solution (40 mL) and saturated sodium chloride solution (40 mL), dried over anhydrous sodium sulfate, and the solvent was evaporated under reduced pressure. The obtained residue was separated and purified by silica gel column chromatography (DCM / MeOH (v / v) = 10 / 1) to obtain compound 2-10 (0.23 g, yield 37%) as a white solid. MS (ESI, pos.ion) m / z: 1046.3 [M / 2+H] + ;

[0203] 1 H NMR (400 MHz, CD3OD) δ 7.78 (t, J = 5.8 Hz, 2H), 7.38 - 7.36 (m, 3H), 5.36 (d, J = 3.4 Hz, 3H), 5.13 (s, 2H), 5.08 (dd, J = 11.2, 3.4 Hz, 3H), 4.58 (d, J = 8.4 Hz, 3H), 4.21 - 4.08 (m, 9H), 4.04 (t, J = 6.7 Hz, 3H), 3.93 - 3.82 (m, 3H), 3.73 - 3.66 (m, 12H), 3.60 - 3.52 (m, 3H), 3.29 - 3.18 (m, 6H), 2.52 (t, J = 6.0 Hz, 6H), 2.38 (t, J = 7.4 Hz, 2H), 2.20 (t, J = 7.7 Hz, 2H), 2.16 (s, 9H), 2.04 (s, 9H), 1.97 (s, 9H), 1.95 (s, 9H), 1.62 - 1.56 (m, 12H), 1.50 - 1.42 (m, 6H), 1.35 - 1.27 (m, 16H), 1.04 - 0.97 (m, 6H).

[0204] Step 7: Synthesis of compound 2-11

[0205] Compound 2-10 (0.20 g, 0.094 mmol) was dissolved in methanol (10 mL), then Pd / C (10 mg, 10%) was added, and the reaction mixture was stirred under hydrogen atmosphere at room temperature for 11 h. After the reaction was completed, the reaction mixture was filtered through celite, and the obtained filtrate was evaporated under reduced pressure to obtain compound 2-11 (0.19 g, 100%) as a white solid.

[0206] MS (ESI, pos. ion) m / z: 1001.1 [M / 2+H] + .

[0207] Step 8: Synthesis of compound DAW40007-1

[0208] Compound 2-11 (0.28 g, 0.14 mmol) was dissolved in DCM (20 mL), HOBT (0.038 g, 0.28 mmol), HBTU (0.080 g, 0.21 mmol), DIPEA (0.054 g, 0.42 mmol) and compound 13 (0.068 g, 0.16 mmol) were added successively, the reaction mixture was stirred at room temperature for 13 h, after the reaction was completed, the reaction was quenched by adding water (10 mL), extracted with DCM (20 mL), the organic phase was washed with saturated sodium bicarbonate solution (10 mL), the solvent was evaporated under reduced pressure, the obtained residue was dissolved in acetonitrile (10 mL), separated by reversed-phase preparative column (acetonitrile / water solution (v / v) = 43% to 60%, 50 min), the solution containing the product after preparative separation was saturated by adding salt, the organic phase was separated, the aqueous phase was extracted with acetonitrile (100 mL x 2), the combined organic phase was dried over anhydrous sodium sulfate, the solvent was evaporated under reduced pressure, the residue was added to acetonitrile (30 mL) and dried over sodium sulfate again, filtered, the filtrate was concentrated under reduced pressure to obtain compound DAW40007-1 (0.080 g, yield 24%) as a light yellow solid.

[0209] MS (ESI, neg. ion) m / z: 2400.18 [M-H] - ;

[0210] 1H NMR (400 MHz, DMSO-d6) δ 8.31 (s, 3H), 7.81 (d, J = 9.2 Hz, 3H), 7.57 (t, J = 6.0 Hz, 3H), 7.35 - 7.26 (m, 4H), 7.20 (td, J = 8.9, 3.0 Hz, 5H), 6.95 (s, 1H), 6.88 (ddd, J = 8.8, 5.8, 2.2 Hz, 4H), 5.22 (d, J = 3.4 Hz, 3H), 4.97 (dd, J = 11.2, 3.5 Hz, 4H), 4.49 (d, J = 8.5 Hz, 3H), 4.40 (d, J = 4.8 Hz, 1H), 4.15 (s, 1H), 4.07 - 4.00 (m, 9H), 3.88 (dt, J = 11.2, 8.8 Hz, 3H), 3.74 (s, 9H), 3.59 - 3.48 (m, 12H), 3.17 (dd, J = 8.8, 5.0 Hz, 1H), 3.10 - 2.95 (m, 8H), 2.35 (t, J = 6.3 Hz, 6H), 2.10 (s, 9H), 2.08 (s, 3H), 2.04 (d, J = 4.7 Hz, 2H), 2.00 (s, 9H), 1.89 (s, 9H), 1.78 (s, 9H), 1.40 (d, J = 12.2 Hz, 17H), 1.31 - 1.16 (m, 18H), 0.79 (q, J = 3.2 Hz, 6H).

[0211] Step 9: Synthesis of compound DAW40007-2

[0212] Compound DAW40007-1 (0.080 g, 0.033 mmol) was dissolved in DCM (10 mL), DIPEA (0.029 mL, 0.17 mmol), succinic anhydride (0.008 g, 0.083 mmol) and DMAP (0.014 g, 0.12 mmol) were added, stirred at 40 °C for 5 h, succinic anhydride (10 mg) was added, continued to react for 16 h, then succinic anhydride (10 mg), DIPEA (0.05 mL) and DCM (10 mL) were added, continued to stir for 9 h, then succinic anhydride (10 mg) was added, reacted for another 10 h, then diluted with DCM (20 mL), washed with saturated sodium bicarbonate solution (10 mL), the aqueous phase was discarded, the organic phase was dried over anhydrous sodium sulfate, the solvent was concentrated under reduced pressure, and white solid compound DAW40007-2 (0.08 g, 96.07%) was obtained. MS (ESI, neg. ion) m / z: 2500.12 [M-H] - .

[0213] Step 10: Synthesis of compound DAW40007-3

[0214] Compound DAW40007-2 (0.08 g, 0.032 mmol), HBTU (0.015 g, 0.04 mmol) and DIPEA (0.011 mL, 0.064 mmol) were dissolved in ACN (5 mL) and stirred at room temperature for 5 min. Then transferred to a solid phase synthesizer containing 0.35 g H2N-CPG (purchased from Hebei Dinaxingke) and shaken for 22.5 h. The filter cake was washed with DCM / MeOH (V / V = 9 / 1, 10 mL) and DCM (10 mL) and dried, the obtained filter cake was diluted in 25% Ac2O / Py solution (5 mL) and stirred for 3 h, filtered, the filter cake was washed with DCM / MeOH (V / V = 9 / 1, 10 mL) and DCM (10 mL) in turn, and dried under reduced pressure to obtain white solid DAW40007-3 (0.357 g) with a loading of 14.95 μmol / g.

[0215] Synthesis of compound L96-DMTr-CPG

[0216] Compound L96-DMTr-CPG was prepared according to the method described in patent application WO2014025805A1.

[0217] Compound L96-DMTr-CPG was prepared according to the method described in patent application WO2014025805A1.

[0218] Example 2: Synthesis of double-stranded siRNA and double-stranded siRNA conjugate

[0219] 1. Synthesis of double-stranded siRNA without conjugated groups

[0220] The synthesis steps of the siRNA sense and antisense strands according to the present application are as follows:

[0221] The synthesis of 1 umol scale was completed according to the theoretical yield. All the RNA phosphoramidite monomers (i.e. nucleotide monomers) and auxiliary reagents of 1 umol scale were commercially available. All the phosphoramidite monomers were provided in 0.1 M anhydrous acetonitrile solution. For the phosphothioate backbone modified oligonucleotide, 0.1 M DDTT solution was used as the thio reagent. 5-ethylthio-1H-tetrazole acetonitrile solution (0.25 M) was used as the activator, 0.02 M iodine in pyridine / water solution was used as the oxidant, and 3% trichloroacetic acid in dichloromethane solution was used as the deprotection reagent. The corresponding reagents were placed in the designated positions of the DNA / RNA automatic synthesizer. The synthesis program was set and the designated oligonucleotide base sequence was input. After checking for no errors, the cyclic oligonucleotide synthesis was started. The coupling time of each step was 6 minutes, and the sulfurization time was 6 minutes. After automatic cycling, the oligonucleotide containing the solid-phase support CPG was obtained.

[0222] The nucleotide containing the solid-phase support CPG was transferred to a 2 mL EP tube, and 28% ammonia solution (1.8 mL) was added, and heated at 55°C for 5-18 hours. Filtration was performed, the filter cake was washed with water (0.5 mL), the filtrates were combined, and concentrated under reduced pressure to obtain a white or yellow gummy solid. After reverse phase preparative purification, the preparation liquid was concentrated and passed through a gel column to remove excess salt to obtain the oligonucleotide. The concentration of the obtained oligonucleotide was determined by a micro-UV spectrophotometer (SPECTRO stat Nano). Mass spectrometry detection and analysis were completed on an Agilent 6530 LC-MS Q-Tof system. After primary scanning, the nucleic acid molecular weight was calculated after deconvolution.

[0223] Annealing step:

[0224] The double-stranded siRNA sense strand obtained by the above synthesis was mixed with the antisense strand obtained by the above synthesis in an equimolar amount, heated to 95°C, and then slowly reduced to room temperature after temperature control for 10 min. Then the target double-stranded siRNA was obtained by freeze-drying.

[0225] 2. Synthesis of siRNA conjugate:

[0226] The synthesis of the antisense strand was carried out by reverse phase preparative purification according to the synthesis method of the above GalNAc-unbound sense strand and antisense strand.

[0227] The synthesis of the sense strand: the general solid-phase support CPG was replaced by GalNAc solid-phase support (such as compound L96-DMTr-CPG), and the sense strand of the double-stranded siRNA conjugate of the application was obtained by reverse phase preparative purification according to the synthesis method of the antisense strand.

[0228] Annealing step:

[0229] The above-synthesized double-stranded siRNA conjugate sense strand is mixed with the above-synthesized antisense strand in an equal molar amount, heated to 95°C, and controlled at 10 min, then slowly reduced to room temperature. Then freeze-dried to obtain the target siRNA conjugate.

[0230] The unmodified double-stranded siRNA synthesized by the above method is shown in Table 1; the modified siRNA synthesized by the above method is shown in Table 1-A and Table 1-B; the double-stranded siRNA conjugate synthesized by the above method is shown in Table 2.

[0231] Table 1: Unmodified double-stranded siRNA synthesized by the present application

[0232] Table 1-A: Modified siRNA synthesized by the present application

[0233] In a preferred embodiment of the present application, the 3' end and 5' end of the sense strand of the double-stranded siRNA are each modified with two consecutive thio backbone modifications, which are beneficial to improve the stability of the drug. When the 3' end and 5' end of the double-stranded siRNA are connected with a ligand, and the ligand is connected to the 3' end and 5' end by a phosphorothioate (as shown in Table 3, the ligand is connected to the 3' end by a phosphorothioate), the phosphorothioate between the ligand and the nucleotide is counted as one of the two thio backbone modifications. In addition, it is also pointed out that in the present application, when invB is connected to the 5' end by a phosphorothioate, the phosphorothioate between invB and the nucleotide is also counted as one of the two thio backbone modifications. According to the prior art (also verified by the inventors in the pharmacological experiments herein), when the 3' end of the sense strand of the double-stranded siRNA in Table 1-A is connected to a ligand by a phosphorothioate, the in vitro knockdown activity of the mRNA of the double-stranded siRNA NO 29 is basically the same as that of the siRNA conjugate 2 obtained by connecting the ligand to the mRNA, therefore, those skilled in the art can select appropriate ligands such as L96 and DAW40007-4 GalNAc or its derivatives from Table 1-A according to the technical knowledge in the art, to obtain double-stranded siRNA conjugates containing ligands with similar activity. It is also pointed out that when the 3' end of the sense strand in Table 1-A is connected to a ligand, the second phosphorothioate at the 3' end which is not originally connected to a ligand is replaced by a phosphate, which is to maintain only two thio backbone modifications at the 3' end of the sense strand.

[0234] Table 1-B: Double-stranded siRNA of the present application

[0235] Table 2: Double-stranded siRNA conjugate synthesized by the present application

[0236] In the context of the present application, capital letters C, G, U, A, T represent the bases of natural nucleotides; small letters c, g, u, a represent the bases of nucleotides whose ribose 2-position is modified by methoxy, such as c, g, u, a represent 2'-OMe (2'-O-methyl) C, 2'-OMe G, 2'-OMe U and 2'-OMe A, respectively; capital letters plus right f represent the bases of nucleotides whose ribose 2-position is modified by fluoro, such as Cf, Gf, Uf, Af represent 2'-F (2'-fluoro) C, 2'-F G, 2'-F U and 2'-FA, respectively; "s" represents a phosphorothioate linkage between the two nucleotide residues adjacent to "s" on the left and right, for example, "gsu" represents a phosphorothioate linkage between g and u residues; if there is no s between nucleotides, it is by default that the nucleotides are linked by natural phosphate; Tgn represents a thymine-diol nucleotide residue, whose structure is InvB linked at 5' represents D is Example 3: Cell activity and cytotoxicity test of siRNA or conjugate thereof of the present application

[0237] Test method:

[0238] HepG2 cells were cultured in DMEM medium containing 10% fetal bovine serum in a 5% CO2, 37°C constant temperature incubator. When the cells were in the logarithmic growth phase and in good condition (70% confluence), transfection was performed using transfection reagent. The cell concentration was adjusted to 2.5 x 10 5 / mL, 2 x 10 4 cells were inoculated in each well of a 96-well plate, and different concentrations of test siRNA and negative control were transfected according to the instructions of lipofectamine RNAiMAX transfection reagent.

[0239] 1) After 24h incubation at 37°C, 5% CO2, the cells were collected, and the mRNA expression levels of AGT and GAPDH were detected using QuickEasy Cell Direct RT-qPCR kit (Taqman). The expression of AGT gene in each sample was calculated by relative quantification method, and finally the inhibition rate % = (relative quantification of control - relative quantification of sample) / relative quantification of control x 100%, or four-parameter fitting was calculated IC 50 .

[0240] 2) After 72h incubation at 37°C, 5% CO2, the cell supernatant was collected and AGT expression was detected using AGT Elisa kit, and cell toxicity was detected by CCK8.

[0241] The experimental results show that the double-stranded siRNA and the conjugate thereof have good knockdown effect on AGT mRNA, and the experimental results of the inhibition rate of AGT of part of the double-stranded siRNA are shown in Table A.

[0242] Table A: Inhibition rate of AGT of part of the double-stranded siRNA of the present application

[0243] Example 4: Evaluation of the knockdown activity of AGT double-stranded siRNA conjugate by using hAGT transgenic mice

[0244] To evaluate the in vivo activity of the AGT double-stranded siRNA conjugate, the AGT humanized mouse model (Jisuiyao Kang Biotechnology, NO.T054372 or T058351) is used for evaluation. Before the experiment, the mice are randomly grouped according to the body weight, serum AGT and serum ALT levels, so that there is no statistical difference in the baseline levels of each group, and each group has 4-5 mice. The mice are subcutaneously injected with 1 mg / kg of GalNAc-siRNA or vehicle normal saline on the back of the neck, and the single administration is performed, and the day of administration is defined as day 0. After the animals are fasted overnight, blood sampling is performed on day -1 (before administration) and days 4, 7, 14, 21, 28, 35, 42 after administration. The prepared serum is used to determine the human AGT protein content by using Human AGT ELISA Kit (ab287170). By comparing with the baseline level of serum AGT of the mice on day -1 (before administration), the percentage change after administration is calculated to reflect the inhibition activity of the double-stranded siRNA conjugate of the present application on the expression of AGT protein. In Table 2, the experimental results of the relative residual level of serum AGT protein of the humanized mice treated by the double-stranded siRNA conjugate with ID NO 2 (i.e. corresponding to compound 2 in FIG. 1) of the double-stranded siRNA conjugate of the present application are shown in FIG. 1, wherein PC in FIG. 1 is control 2 (i.e. the double-stranded siRNA conjugate with ID NO 1 of the double-stranded siRNA conjugate in Table 1).

[0245] The experimental results show that the double-stranded siRNA conjugate of the present application (especially the double-stranded siRNA conjugate with ID NO 2) has good inhibition activity on the expression of AGT protein in mice.

[0246] Example 5: Evaluation of the knockdown activity of AGT siRNA agent by using cynomolgus monkeys

[0247] To evaluate the in vivo activity of AGT siRNA conjugate, healthy male cynomolgus monkeys (2.5-3 years old, 3-5 kg in weight) were used. Before the experiment, the monkeys were randomly grouped according to their weight, so that there was no statistically significant difference in weight among the groups, and each group contained 3 monkeys. The monkeys were subcutaneously injected with 2 mg / kg of GalNAc-siRNA, and a single administration was performed. The day of administration was defined as day 1, and blood samples were collected from the monkeys on day -7 (before administration), day 1 (before administration), and days 8, 15, 22, 29, 43, 57, 71, 85, 99, and 113 after administration, after the monkeys were fasted overnight. The serum AGT protein content was determined using a Human AGT ELISA Kit (IBL-Japan #27412, which cross-reacts with cynomolgus monkeys). The inhibitory activity of the double-stranded siRNA agent on AGT was reflected by calculating the percentage change in AGT content after administration, compared with the average AGT content in the serum samples collected on day -7 (before administration) and day 1 (before administration).

[0248] The experimental results show that the siRNA conjugate of the present application has good inhibitory activity on AGT protein expression in cynomolgus monkeys.

[0249] According to the technical knowledge in the art, the siRNA conjugate of the present application is obtained by conjugating an siRNA drug with a GalNAc or derivative thereof conjugation group, wherein the conjugation group mainly has a delivery effect. In the case that the siRNA has good activity, the siRNA conjugate connected with the conjugation group can be expected to have AGT inhibitory activity similar to or better than that of the siRNA. A person skilled in the art can select a suitable conjugation group according to the technical knowledge in the art, such as L96 and DAW40007-4 GalNAc or derivatives thereof.

[0250] Although the present application has been described in detail in the foregoing general description, specific embodiments and experiments, modifications or improvements can be made to the present application on the basis of the present application, which will be apparent to those skilled in the art. Therefore, these modifications or improvements made on the basis of the spirit of the present application are within the scope of the present application.

Claims

1. A double stranded siRNA comprising a sense strand and an antisense strand forming a double stranded region, wherein, the sense strand comprises one of the nucleotide sequences set forth in SEQ ID NO: 4, SEQ ID NO: 1-3, and SEQ ID NO: 5-13, or a nucleotide sequence with no more than 5 nucleotide differences thereto; the antisense strand comprises one of the nucleotide sequences set forth in SEQ ID NO: 17, SEQ ID NO: 14-16, and SEQ ID NO: 18-26, or a nucleotide sequence with no more than 5 nucleotide differences thereto; Preferably; the sense strand comprises CUCCCACCUUUUCUUCUAA, or a nucleotide sequence with no more than 5 nucleotide differences thereto; the antisense strand comprises UUAGAAGAAAAGGUGGGAGAC, or a nucleotide sequence with no more than 5 nucleotide differences thereto; all nucleotides in the sense strand and the antisense strand are modified nucleotides, the modified nucleotides are independently selected from at least one of the following: 2'-methoxy modified nucleotide, 2'-fluoro modified nucleotide, 2'-methoxyethyl modified nucleotide, phosphorothioate linkage modified nucleotide, 2'-deoxy modified nucleotide, 2'-amino modified nucleotide, 2'-hydroxyl modified nucleotide, locked nucleic acid modified nucleotide, unlocked nucleic acid modified nucleotide, glycol nucleic acid, 5'-vinylphosphonate modified nucleotide, 5'-(E)-VP modified nucleic acid, cEt, D-replaced nucleotide, and InvB modification.

2. The double-stranded siRNA of claim 1, each of the modified nucleotides is independently present at one or more positions selected from: the nucleotides at the 5' end of the sense strand are positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, and 21 from the start; and / or the nucleotides at the 5' end of the antisense strand are positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, and 23 from the start; and / or each of the phosphorothioate linkage modifications is independently present at one or more positions selected from: the nucleotides at the 5' end of the sense strand are positions 1-2, 2-3, 3-4, 4-5, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, 17-18, 18-19, 19-20, and 20-21 from the start; and / or the nucleotides at the 5' end of the antisense strand are positions 1-2, 2-3, 3-4, 4-5, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, 17-18, 18-19, 19-20, 20-21, 21-22, and 22-23 from the start; and / or each of the phosphorothioate linkage modifications is independently present at one or more positions selected from: the 5'-terminal nucleotides of the antisense strand are positions 2-3, 3-4, 4-5, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, 17-18, 18-19, 19-20, 20-21, 21-22, and 22-23 from the start point.

3. The double-stranded siRNA of claim 1 or 2, wherein the 2'-fluoro-modified nucleotides are present at one or more positions selected from the group consisting of: the 5'-terminal nucleotides of the sense strand are positions 5, 7, 8, 9, 10, and 11 from the start point; preferably, the 2'-fluoro-modified nucleotides are present at the 5'-terminal nucleotides of the sense strand are positions 8, 10, 11, and 12, optionally further including position 5, from the start point; and or the 5'-terminal nucleotides of the antisense strand are positions 2, 6, 8, 9, 12, 14, and 16 from the start point; preferably, the 2'-fluoro-modified nucleotides are present at the 5'-terminal nucleotides of the antisense strand are positions 2, 6, 14, and 16 from the start point; optionally, the InvB modification is linked at the 5'-terminal or 3'-terminal of the sense strand via a phosphorothioate group or a phosphate group; optionally, the antisense strand comprises two consecutive 3' terminal phosphorothioate modifications and two consecutive 5' terminal phosphorothioate modifications; the sense strand comprises two consecutive 3' terminal phosphorothioate modifications and two consecutive 5' terminal phosphorothioate modifications.

4. The double-stranded siRNA of any one of claims 1-3, wherein the sense strand comprises one of the nucleotide sequences set forth in SEQ ID NO: 41, SEQ ID NO: 27-40, and SEQ ID NO: 42-43; or, the sense strand comprises one of the nucleotide sequences set forth in SEQ ID NO: 73, SEQ ID NO: 59-72, and SEQ ID NO: 74-75; the antisense strand comprises one of the nucleotide sequences set forth in SEQ ID NO: 48, SEQ ID NO: 45-47, and SEQ ID NO: 49-58; optionally, the length of the sense strand is no more than 23 nucleotides, and the length of the antisense strand is no more than 23 nucleotides.

5. The double-stranded siRNA of any one of claims 1-4, wherein, the sense strand comprises the nucleotide sequence of 5'-InvBscsucccaCfcUfUfUfucuucuasa-3', and the antisense strand comprises the nucleotide sequence of 5'-usUfsagaAfgaaaaggUfgGfgagsasc-3'; or the sense strand comprises the nucleotide sequence of 5'-InvBscsucccaCfcUfUfUfucuucuasa-3', and the antisense strand comprises the nucleotide sequence of 5'-usUfsagaAfgaaaaggUfgGfgagsasc-3'; or the antisense strand comprises the nucleotide sequence of 5'- usUfsagaAfgaaaaggUfgGfgagsasc-3'; or the sense strand comprises the nucleotide sequence of 5'- InvBsgsuuuguGfaAfAfCfaaaaaagsa-3', and the antisense strand comprises the nucleotide sequence of 5'- usCfsuuuUfuuguuucAfcAfaacsasa-3'; or the sense strand comprises the nucleotide sequence of 5'- InvBsgsuuuguGfaAfAfCfaaaaaagsa-3', and the antisense strand comprises the nucleotide sequence of 5'- usCfsuuuUfuuguuucAfcAfaacsasa-3'.

6. A double-stranded siRNA conjugate comprising the double-stranded siRNA of any one of claims 1-5 and a conjugate group conjugated to the siRNA.

7. The double stranded siRNA conjugate according to claim 6, wherein the 3' or 5' end of the sense strand or the antisense strand of the double stranded siRNA is conjugated to the conjugate group, preferably the 3' end of the sense strand of the double stranded siRNA is conjugated to the conjugate group; wherein, the 3' end or the 5' end of the sense strand of the double-stranded siRNA is conjugated to the conjugate group via a phosphate group, a thiophosphate group or a phosphonate group.

8. The double stranded siRNA conjugate of claim 6 or 7, said conjugate group comprising GalNAc or a derivative thereof; preferably, said conjugate group is GalNAc or a derivative thereof linked by a bivalent, trivalent or tetravalent branched linker; more preferably, said conjugate group is L-96 or DAW40007-4, wherein, The conjugating groups L-96 and DAW40007-4 structures are respectively:

9. The double-stranded siRNA conjugate of any one of claims 6-8, the sense strand comprises the nucleotide sequence of 5'- InvBscsucccaCfcUfUfUfucuucuasasL96-3', and the antisense strand comprises the nucleotide sequence of 5'- usUfsagaAfgaaaaggUfgGfgagsasc-3'; or the sense strand comprises the nucleotide sequence of 5'- InvBsgsuuuguGfaAfAfCfaaaaaagsasL96-3', and the antisense strand comprises the nucleotide sequence of 5'- usCfsuuuUfuuguuucAfcAfaacsasa-3'.

10. A pharmaceutical composition comprising the double-stranded siRNA of any one of claims 1-5, the double-stranded siRNA conjugate of any one of claims 6-9, and a pharmaceutically acceptable carrier.

11. Use of the double-stranded siRNA of any one of claims 1-5, the double-stranded siRNA conjugate of any one of claims 6-9 or the pharmaceutical composition of claim 10 for the manufacture of a medicament for the treatment and / or prevention of an AGT-related disease.

12. The use according to claim 11, wherein, the AGT-related disease is hypertension, preferably the AGT-related disease is selected from the group consisting of borderline hypertension, essential hypertension, secondary hypertension, hypertensive crisis, hypertensive emergency, isolated systolic and diastolic hypertension, pregnancy-related hypertension, diabetic hypertension, resistant hypertension, refractory hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt's hypertension, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension and labile hypertension.

13. The double-stranded siRNA according to any one of claims 1 to 5, the siRNA conjugate according to any one of claims 6 to 9 or the pharmaceutical composition according to claim 10 for use in the treatment and / or prevention of an AGT-related disease in a patient.

14. The double stranded siRNA, siRNA conjugate or pharmaceutical composition according to claim 13, wherein, The AGT-related disease is hypertension; Preferably, the hypertension is selected from borderline hypertension, essential hypertension, secondary hypertension, hypertensive crisis, hypertensive emergency, isolated systolic and diastolic hypertension, pregnancy-related hypertension, diabetic hypertension, resistant hypertension, refractory hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt hypertension, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension and labile hypertension.

15. A method of preventing, managing, treating or alleviating an AGT-related disease in a patient, comprising administering to the patient a therapeutically effective amount of the double-stranded siRNA according to any one of claims 1 to 5, the double-stranded siRNA conjugate according to any one of claims 6 to 9 or the pharmaceutical composition according to claim 10.

16. The method of claim 15, wherein, The AGT-related disease is hypertension; Preferably, the hypertension is selected from borderline hypertension, essential hypertension, secondary hypertension, hypertensive crisis, hypertensive emergency, isolated systolic and diastolic hypertension, pregnancy-related hypertension, diabetic hypertension, resistant hypertension, refractory hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt hypertension, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension and labile hypertension.

Images