Carbon nanodot compounds, methods of production, and methods of use

Carbon-nanodot compounds functionalized with PEI polymer address the stability and delivery challenges of nucleic acids in insect guts and plants, providing effective nuclease protection and enhanced RNAi efficacy.

WO2026027856A1PCT designated stage Publication Date: 2026-02-05CDOTBIO LTD
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
PCT/GB2025/051583
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-07-19
Filing Date
2025-07-17
Publication Date
2026-02-05

AI Technical Summary

Technical Problem

Existing nucleic acid-based pest management strategies face challenges in maintaining stability and effective delivery of nucleic acids, particularly in the harsh alkaline conditions of insect guts, due to nuclease degradation and membrane barriers, which limits the efficacy of RNAi methods.

Method used

Development of carbon-nanodot (CND) compounds functionalized with a polyethyleneimine (PEI) polymer, which provide enhanced nuclease protection and delivery of nucleic acids to insect and plant cells, even in alkaline environments.

Benefits of technology

The CND compounds effectively stabilize and deliver nucleic acids, such as dsRNA, to target cells, enhancing RNAi efficacy by protecting against nuclease degradation and improving cellular uptake, particularly in insect guts and plant tissues.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000002_0001
    Figure IMGF000002_0001
  • Figure IMGF000011_0001
    Figure IMGF000011_0001
  • Figure IMGF000012_0001
    Figure IMGF000012_0001
Patent Text Reader

Abstract

The present disclosure relates to carbon nanodot (CND) compounds comprising a CND core that is functionalized on the surface with a polyethyleneimine polymer, preferably a branched PEI. The present disclosure also relates to a method of making CND compounds and their use for protecting nucleic acids from degradation, particularly their use in protecting nucleic acids from nuclease degradation in an insect gut. The present disclosure also relates to their use in delivering nucleic acids to insect and / or plant cells. The present disclosure also relates to a CND nucleic acid complex.
Need to check novelty before this filing date? Find Prior Art

Description

Carbon Nanodot Compounds, Methods of Production, and Methods of UseThe present disclosure relates to carbon nanodots (CNDs) compounds comprising a carbon nanodot core that is functionalized on the surface with a polyethyleneimine polymer, their method of formation, their use for protecting nucleic acid from degradation, particularly from nuclease degradation in an insect gut, and their use in delivering nucleic acids to an insect, as well as plant cells. The present disclosure also relates to a CND nucleic acid complex.Climate change is fuelling pest problems by creating more favourable conditions for their survival and spread. Overuse of pesticides has resulted in pests developing resistance as well as environmental concerns. On average, pests account for 20-40% of yield losses worldwide, costing the global economy a combined $290 billion, according to the FAO. This has led to pesticides being less effective and many have been banned. This situation necessitates a shift towards integrated pest management strategies, which combine various approaches to minimize reliance on chemical pesticides while still effectively controlling pests. Alternative methods such as biopesticides and genetic control are being explored as more sustainable options, but widespread implementation faces challenges. Losses in crops due to lepidopteran (moths and butterflies) and hemipteran (bugs) pests are significant concerns for agriculture worldwide. Lepidopteran larvae feed on leaves, stems, flowers, and fruits, causing direct damage to plants and reducing yield. Examples include caterpillars of species like the corn earworm, cabbage looper, and armyworms. Hemipteran pests, such as aphids, leafhoppers, and stink bugs, also cause damage by sucking sap from plants, which can weaken them, transmit diseases, and reduce crop quality and yield. These pests pose ongoing challenges for farmers and can lead to substantial economic losses if not effectively managed. Examples of common insect pests include Termites, Aphids, Beetles, and Lepidoptera.Nucleic acid-based strategies, such as DNA or RNA, are increasingly being used for pest management. This includes RNA interference (RNAi) solutions where gene expression can be regulated. For example, RNAi molecules can act to suppress gene expression (i.e., by turning off a gene). Nucleic acid-based solutions for pest management, including RNAi, are promising because they leave no residues in the environment and are often highly selective, targeting specific genes in pests while sparing beneficial organisms. This precision allows for effective control with minimal ecological impact, offering a sustainable alternative to traditional pesticides. RNAi methods for pest management can be used to specifically target lethal genes in insects. Alternatively, RNAi methods may be used to target genes in plants, e.g., genes associated with improved resistance to pests.However, for such solutions to be effective, the nucleic acids must (i) remain stable in the environment and (ii) they must be effectively delivered to the target cell. Particularly, if the nucleic acid delivery is designed to be ingested by an insect or pest, the nucleic acid needs to survive the harsh gut environment and be released to target cells to exert their effects. Achieving this stability and delivery is crucial for the success of nucleic acid pest management strategies, including RNAi based pest management strategies.However, maintaining the stability of nucleic acids, particularly dsRNA, is challenging, particularly in the insect gut. Insects that primarily feed on plant material or detritus often have alkaline gut pH to aid in the digestion of cellulose and other plant components. For example, the pH of insect gut juice of the cabbage white caterpillar is measured to have a pH of ~10. These insects also possess nucleases, enzymes that break down nucleic acids.Indeed, most studied lepidopterans, including Bombyx mori, Manduca sexta, Spodoptera frugiperda, Heliothis virescens, and H. armigera, are shown to degrade dsRNA in the gastric caeca (GC) within <10 minutes. Various studies highlight a correlation between nucleic acid degradation and RNAi efficiency,where higher levels of degradation decrease RNAi efficiency. Nuclease activity and alkaline pH primarily drive nucleic acid degradation. While strategies like heating and EDTA have been used in an attempt to limit degradation, such solutions have thus far not been successful.Particle based technologies, such as clay nanosheets or AgroSpheres, have been tried for RNAi delivery. However, both of these technologies have some disadvantages.Clay nanosheets (BioClay) can deliver very small nucleic acids to the leaf surface which can then detach, enter the plant and move into the target cell. However, since the clay nanosheets remain on the leaf surface, delivery of larger nucleic acids such as those required for genome editing or novel protein biosynthesis would not be possible using this technology. It has previously been shown that clay nanosheets demonstrate some nuclease protection but only against one nuclease (RNAse A) and at neutral pH.AgroSpheres are aneucleated minicells derived from bacteria. While they have also demonstrated some nuclease protection of dsRNA, this is also limited to RNAse A at neutral pH. Other disadvantages of AgroSpheres for delivery of nucleic acids are:(i) their method of production is a long and complicated process which has cost and infrastructure implications;(ii) there are potential issues around their storage and application, since their cell membranes could be compromised, for example, by proteases found in the environment;(iii) they have been primarily designed and optimised to deliver liquids (e.g., essential oils or agrochemicals), rather than nucleic acids, by cellular degradation. The environment for cellular degradation could contribute to nucleic acid instability and / or degradation.(iv) they may be considered GMOs causing regulatory issues.It is therefore desirable to develop new strategies for improving nucleic acid delivery and stability, particularly for the purposes of controlling pests through RNAi. Specifically, it was an aim of the present inventions to develop strategies for improving the stability of nucleic acids to nuclease degradation, particularly in alkaline conditions and / or in the insect gut. It was also an aim of the present inventors to develop a novel delivery method to enable nucleic acids to be delivered to insect cells, as well as plant cells, particularly for the purposes of pest management.Summary of InventionIn a first aspect of the present invention, there is provided a carbon-nanodot (CND) compound, comprising a CND core that is functionalized on its surface with a polyethyleneimine (PEI) polymer. The CND compound may have a nitrogen content of at least 10%, wherein the nitrogen content is determined by x-ray photoelectron spectroscopy (XPS). In a preferred embodiment, the PEI polymer is a branched PEI polymer.In a second aspect of the present invention, there is provided a method of comprising a carbon-nanodot (CND) compound which is formed by(a) forming a CND core, and(b) functionalising the CND core with a polyethyleneimine (PEI) polymer.The method of the second aspect can be used to form the CND compound of the first aspect. Preferably, the CND core is formed by heating an amino-sugar and an amino acid to form the CND core. In a preferred embodiment, the PEI polymer is a branched PEI polymer.In a third aspect, there is provided a carbon-nanodot (CND) compound, which is formed by the method of the second aspect. The CND compound is formed by(a) forming a CND core, and(b) functionalising the CND core with a polyethyleneimine (PEI) polymer. In a preferred embodiment, the PEI polymer is a branched PEI polymer.The present inventors found that CNDs compounds disclosed herein can be used to more effectively bind, protect, and stabilize nucleic acids, particularly dsRNA or RNAi for the purposes of pest management. Notably, the CND compounds described herein are found to provide efficient protection of nucleic acids from degradation, particularly improved protection against nuclease degradation. Such nuclease protection is notably observed even in the presence of nucleases in harsh alkaline conditions, and in insect gut juice. Without wishing to be bound by theory, the present inventors attribute the success of the CND compounds disclosed herein with the particular surface properties of PEI and the high % of nitrogen on the CND compound surface after functionalisation. This enables effective binding of the nucleic acid with phosphate groups (e.g., of the phosphodiester backbone).Compared to different delivery platforms for RNAi, CND based delivery platforms are much smaller which helps membrane penetration and cellular uptake into plants and insects. Compared to other agrochemicals and other platforms, CNDs are non-toxic, eco-friendly and pose minimal contamination risks. CNDs can also be manufactured at low cost, are scalable, are easy to apply, and are water- soluble. In particular, compared to both clay nanosheets and agrospheres, the CND compounds of the disclosure are demonstrated to exhibit protection against a wide range of nucleases, and notably across a wider pH range, from pH 6-11 , which includes very harsh alkaline conditions representative of the insect gut. Further, compared to agrospheres, the methods of producing the CNDs of the invention are much less costly and less complicated.Different to the methods of forming CNDs in the prior art, the CND compounds of the present invention are formed by first creating a CND core (i.e. , in a heating and / or carbonisation process), and in a second step, the resultant CND core is functionalized with PEI, typically via a covalent bond. The CNDs compounds described herein may therefore be otherwise referred to as a “functionalized CND”, or a “CND nanocomposite”. The CND compounds may otherwise just bereferred to CNDs of the present disclosure or invention, or CNDs as disclosed or defined herein.The CNDs of the present invention can be reliably and consistently produced. This can be attributed to the second step of catalyzed functionalisation with PEI, i.e. , after formation of the CND core. This means the surface properties are more consistent from batch to batch. In processes where polymer and non-molecular precursors are used to produce the CND cores in a one-step process, the surface composition is instead highly affected by carbonisation and does not resemble that of the starting materials (e.g., PEI).Without wishing to be bound by theory, single-step processes of CND production often have unknown or ill-defined mechanisms of reaction. As a result, the produced materials typically do not have a homogenous structure and surface composition. Instead, their formation is highly dependent on the carbonization step, with functional groups on the surface typically deriving from the solvent used (e.g., -OH, COOOH, and C-O-C-).Notably, the CND compounds disclosed herein are found to perform better, for this purpose, than comparative CNDs representative of those previously described in the art. As noted in Hill & Galan (Beilstein J. Org. Chem., 2017, 13, 675-693) different methods formation of CNDs can result in different properties of the resultant CND product. Many CNDs previously described in the art comprise heating PEI and other organic molecules in a one-step carbonisation process, with no second separate functionalization step (i.e., to form a CND compound). In such processes, PEI is either heated alone or in combination with other small organic molecules (e.g., glucose, saccharose), at temperatures typically above 150 °C to form a CND. The result is that the majority of the PEI polymer is carbonised; in other words, the PEI itself contributes to the formation of, and acts as a carbon source, for the CND. Further, it is theorised that a large portion of the nitrogen is bound up in the CND core rather than being present on the CND surface. Further, it is theorised that the PEI may be itself subject todegradation when heated to form the CND. Instead, in the present invention, the entire PEI polymer is present on the surface of the CND, rather than being bound up within the CND core. This increases the % of nitrogen that is present on the surface, meaning that the CND can more effectively, bind, stabilize and protect nucleic acids. This may explain why the CNDs of the present invention perform better than CNDs described in the prior art. Indeed, it has been previously shown that CNDs formed by heating glucose or saccharose with PEI in a one-step process, provide no nuclease protection against RNAse A when complexed to a nucleic acid(see Int. J. Mol. Sei. 2022, 23(10), 338; https: / / doi.org / 10.3390 / ijms23105338).When the present inventors also attempted to generate CNDs in a one-pot process i.e. , by carbonising PEI to form a CND, (rather than functionalization of the CND with PEI after CND formation), the resultant CNDs performed poorly and demonstrated higher chemotoxicity (see Figure 9). Further analysis showed that the measured nitrogen content of these comparative CNDs was significantly lower at the surface than what was observed for CND compounds of the disclosure.The CND compounds disclosed herein are also distinct from previous functionalized CND compounds described in an earlier patent application: EP4012034. In this disclosure, a CND core is first formed (e.g., by heating glucosamine and 4, 7, 10-trioxa-1 , 13, tridecamine (TTDDA)). The CND core is either (i) reacted with a sugar, or (ii) the CND core is treated with succinic anhydride in a second step to form a CND-core comprising COOH groups, followed by functionalization in a third step with a polyethylene glycol polymer (PEG). Despite these CND compounds of the prior art also being formed in a multi-step process, the CNDs are functionalized with a different polymer and therefore have different surface properties. For example, the CND compounds have a lower nitrogen % content compared to those of the present invention (cf.

[0052] of EP4012034). As discussed above, the high % nitrogen content of the CND compounds of the present invention is believed to contribute to the effectiveprotection and stabilization of nucleic acids, particularly against nuclease degradation. In any case, EP4012034 is primarily concerned with plants, more specifically, improving photosynthesis in plants. EP4012034 fails to point towards using CNDs for pest management or delivery to insect cells, let alone does EP4012034 suggest that CND compounds could be used to protect nucleic acids from nuclease degradation, particularly in the insect gut.In contrast, the present inventors demonstrate that the CND compounds disclosed herein can be used to effectively deliver nucleic acids, e.g., dsRNA to an insect, as well as showing protection from nuclease degradation in conditions representative of an insect gut (see, e.g., Figures 12-18 and Examples). Delivery of the dsRNA RNAi molecule is also demonstrated to insect cells, as shown in Figure 19 . These results are notable because, in addition to degradation of dsRNA by nucleases in a hostile high pH gut environment, RNAi by feeding in insects, including Lepidoptera, is also inefficient due to the membrane barriers that the dsRNA must cross in order to enter into the insect gut epithelial cells. In cultured insect gut cells the main barriers are cellular uptake and release into the cell environment. The CND compounds disclosed herein notably increased the speed of uptake into the cultured cells. This suggests that the CNDs compounds disclosed herein can reduce the time the dsRNA remains in the midgut, which further reduces the risk of enzymatic degradation. Even if cellular uptake is efficient, the dsRNA needs to be released from endosomes (where they accumulate after uptake) into the cytoplasm to be processed by the RNAi machinery. This release step can be a limiting factor with dsRNA trapped inside the endosomes. Further, it is also shown that the CND compounds disclosed herein increased the concentration of dsRNA outside the cell membrane. This is where the dsRNA would accumulate prior to cellular uptake.As well as being useful for nucleic acid delivery to insects, the CNDs disclosed herein can also be used to deliver nucleic acids, including nucleotides and dsRNA, to plant cells. In an example experiment demonstrating proof-of-concept, CND compounds of the present invention are used to deliver an dsRNA RNAimolecule which silences chlorophyll. In a visual proof of concept, bleaching of the leaf, indicating reduced chlorophyll is observed, as shown in Figure 20.In a further example experiment demonstrating proof-of-concept, the CND compounds of the present invention are used to deliver nucleotides to cut flowers. The delivery of nucleotides using the CNDs extended the lifetime of cut flowers, notably for up to 20 days. This was longer than current commercial flower food solutions, as shown in Figure 21 (e.g., Chrysal, a flower food containing sugar, organic acid and preservatives).Preferable features of the present invention will now be described which are applicable to all aspects of the present invention.In some embodiments, the CND compound comprises a nitrogen content of at least 15 %, more preferably between 15 % and 40 %. As indicated above, increased nitrogen content at the CND surface due to functionalization with PEI is believed to contribute to the improved properties of the CNDs.In preferred embodiments, the CND core is formed by heating an amino-sugar and an amino acid. A CND core formed in this way has particularly advantageous properties. A first advantage is that amino-sugars and amino acids are non-toxic, easy to source and are biocompatible. This is believed to negate or minimise any chemotoxicity compared to a CND formed using PEI alone. The amino sugar may be selected from glucosamine, galactosamine, mannosam ine. The amino acid may be an alpha or beta amino acid. The amino acid may be selected from alanine, glycine, glutamine, alanine, aspartic acid, serine, leucine, lysine, threonine, tyrosine, methionine, glutamic acid, tryptophan, arginine, cysteine, valine, isoleucine and leucine. In a preferred embodiment, the amino sugar is glucosamine and / or the amino acid is beta-alanine. Without wishing to be bound by theory, different to CND cores described in the prior art, heating an amino sugar and an amino acid in a carbonization process is believed to proceed, at least in part, via a different mechanism, namely via a deoxyfructosazineintermediate, resulting in a step of aromatization to form the CND core, with other mechanisms including the formation of iminium intermediates. This contrasts with other CND cores which are typically formed in a carbonization process. The resultant CND have COOH groups on the surface derived from the amino acid starting materials. The COOH groups can then be functionalized directly with PEI to form an amide bond via amide coupling (see Figure 3).In preferred embodiments, the CND core is not formed using polyethyleneimine (e.g., by heating PEI either alone or in combination with one or more other small organic molecules). This reflects the fact that the PEI is instead used to functionalize the surface of the CND core, rather than being used to form, and being bound up in the CND core itself.In embodiments, the PEI polymer is bonded to the CND core via a covalent bond, for example, wherein the CND compound has the following structure:any suitable number, typically wherein n is greater than 5, or greater than 10, or greater than 25, or greater than 50, or greater than 100. In some embodiments, n is less than 5000, or less than 2500, or less than 1000, or less than 500, or less than 250, or less than 200, or less than 175, or less than 150, or less than 150, or less than 125, or less than 100, or less than 75, or less than 50. In some embodiments, n is from 10 to 2500, or n is from 25 to 200, wherein L is selected from H or C2H4NRaRb, preferably wherein Raand Rb are each independently selected from H, C2H4NH2, or C2H4NRcRd, wherein Rcand Rd are each independently selected from H or C2H4NH2.In some embodiments, the PEI polymer is bonded to the CND core via a terminal nitrogen group, for example, wherein the CND compound has the following structure:, wherein Z represents the rest of the PEI polymer. In some embodiments, the PEI is a branched PEI, Preferably, the number of ethyleneimine monomers that has been used to form the branched PEI polymer is greater than 10, or greater than 50, or greater than 100. In some embodiments, the number of ethyleneimine monomers that has been used to form the branched PEI polymer is less than 5000, or less than 2500, or less than 1000, or less than 500, or less than 250, or less than 200, or less than 175, or less than 150, or less than 150, or less than 125. In some embodiments, the number of ethyleneimine monomers that has been used to form the branched PEI polymer is from 10 to 2500, or is from 50 to 200, or is from 75 to 150, or is from 100 to 140. In some embodiments, the branched PEI polymer comprises a random combination of one or more of the following repeating units.In some embodiments, the PEI polymer is bonded to the CND core via an amide bond, optionally wherein the CND compound has the following structure:wherein n is any suitable number, preferably wherein n is defined above, and wherein R is any suitable group, preferably wherein R is a) derived from one or more of alanine, glycine, glutamine, aspartic acid, serine, lysine, threonine, tyrosine, methionine, glutamic acid, tryptophan, arginine, cysteine, valine, isoleucine, and leucine, and / or b) selected from H, Ci-Cealkyl, Ci-6alkyl(=O)NH2, Ci-6alkyl(=O)OH, Ci-ealkyl-OH, Ci-C6alkyl-NH2, Ci-C6alkyl(OH)CH3, Ci-C6alkyl-phenyl, Ci-C6alkyl-SCH3, Ci- C6alkylC(=O)OH, Ci-C6alkyl-indole, Ci-C6alkyl(=N)NH2, CH(CH3)Ci-C6alkyl or Ci-C6alkyl(CH3)CH3, preferably selected from CH3, CH2CH2C(=O)NH, CH2C(=O)OH, CH3OH, CH2CH2CH2CH2NH2, CH(OH)CH3, CH2-phenyl, CH2CH2SCH3, CH2CH2C(=O)OH, CH2-indole, CH2CH2CH2NHC(=N)NH2, CH(CH3)CH2CH3, or CH2CH(CH3)CH3In some embodiments, the PEI polymer is bonded to the CND core via an amide bond, optionally wherein the CND compound has the following structure:, wherein Z and R are as defined above or elsewhere herein.In preferred embodiments, the polyethyleneimine polymer has a molecular weight of between 500 and 25000, preferably from 1000 to 10000, preferably from 2500 to 7500, for example, about 5000. The molecular weight is optionally determined by size exclusion chromatography, for example, gel permeation chromatography. Since the entire full-length polymer, of high molecular weight, is only appended to the surface of the CND core after carbonisation, this further contributes to the high nitrogen content present at the surface. Preferably, the polyethyleneimine polymer is a branched polyethyleneimine. Without wishing to be bound by theory, branched polyethyleneimine is preferred over linear PEI due to a higher density (by mass) of primary amines that can interact with cargo (e.g., nucleic acid cargo). In particular, primary amines are sterically less hindered and are more likely to protonate, promoting more extensive H bonding with the cargo. Branched PEI also behaves differently as a core reagent as compared to linear PEI. During functionalization, while linear PEI reacts with the CND core primarily at the ends of the polymer chain (via the terminal primary amino group), branched PEI instead reacts with the CND core at multiple sites along the polymer chain. This results in a CND compound with a fundamentally different structure.In some embodiments, the carbon-nanodot (CND) comprises(i) 10 to 25 % nitrogen content, preferably 15 to 25 % nitrogen content,(ii) less than 15 % oxygen content, preferably less than 10 % oxygen content, and(iii) 60 % to 80 % carbon content, preferably wherein the nitrogen content, oxygen content and carbon content are determined by x-ray photoelectronspectroscopy (XPS). The elemental composition of the CND compounds, as determined by XPS, is indicative of the methods used to make the CND compounds of the present invention, including their surface chemistry.In some embodiments, the CND compound has a particle size of 1 -120 nm, preferably 1 -50 nm, for example 5-20 nm as determined by Atomic Force Microscopy.In some embodiments, step a) of the method is carried out at a temperature of at least 150 °C, preferably at least 175 °C. This enables effective carbonisation and production of the CND core.In some embodiments, step b) of the method comprises forming an amide bond between a CND core and a polyethyleneimine polymer. In some embodiments, the functionalization of the core comprises and / or formation of an amide bond between the CND core and the PEI, comprises coupling the CND core with PEI in the presence of an amide coupling reagent, preferably wherein the amide coupling reagent is EDC (1 -ethyl-3-carbodiimide hydrochloride). In an embodiment, COOH groups present on the surface of CND core after step a), react with PEI leading to formation of an amide bond.In some embodiments, the CND compound is formed by a method comprising a) heating an amino-sugar and an amino acid to form a CND core, b) functionalising the CND core with a polyethyleneimine polymer.In a fourth aspect of the present invention, is a carbon-nanodot (CND) nucleic acid complex comprising i) the carbon-nanodot (CND) compound as disclosed herein (e.g., in accordance with the first or third aspect), and ii) a nucleic acid.As indicated above, the CND compounds of the present invention form stable complexes with nucleic acids, referred to herein as a CND nucleic acid complex, or CND-NA complex. The CND-NA complex can provide protection of the nucleic acid against degradation, e.g., nuclease degradation. The CND-NA complex can provide a way of delivering the nucleic acid to an insect or plant, preferably while simultaneously protecting the nucleic acid from nuclease degradation, particularly nuclease degradation at an alkaline pH.In some embodiments, the nucleic acid is RNA or DNA. In preferred embodiments, the nucleic acid is dsRNA or RNAi. Delivery and stabilization of dsRNA and RNAi is particularly important for pest management strategies.In some embodiments, the nucleic acid is a nucleotide. When the nucleic acid is a nucleotide, this may otherwise be described as a CND-nucleotide complex. As demonstrated herein, a CND-nucleotide complex can be used to effectively deliver nucleotides to post-harvest plants, e.g., cut flowers.In some embodiments, the nucleic acid is a chain of nucleotides having a length of from 2 to 1000 nucleotides, more preferably 15 to 500 nucleotides. In the application examples, protection of the nucleic acid against nuclease degradation is demonstrated for a wide range of different nucleic acids of different sizes.In some embodiments, the CND compound and the nucleic acid are in a ratio of 0.25:1 - 50:1 , preferably from 2:1 to 15:1 , for example 10:1. In some embodiments, the carbon-nanodot and the nucleic acid are in a ratio of >1 :1. Without wishing to be bound by theory, a higher relative amount of CND compound compared to nucleic acid may more effectively stabilize, encapsulate, or protect the nucleic acid from degradation.In a fifth aspect of the invention, there is provided the use of the CND compound disclosed herein (e.g., in accordance with the first or third aspect), for protecting a nucleic acid from degradation. In some embodiments, the nucleic acid is DNAor RNA, preferably dsRNA. In preferred embodiments, the degradation is nuclease degradation. In preferred embodiments, the CND compound provides protection, preferably nuclease protection, at pH > 6, preferably between 8 and 12. In some embodiments, the CND compound provides protection of the nucleic acid from one or more non-specific nucleases, for example, Benzonase, saltactive nuclease (SAN) and endonuclease from Serratia marcescens (commonly sold as Pierce Universal nuclease). In preferred embodiments, the CND compound provides protection in an insect gut, preferably wherein the insect gut comprises nucleases and / or has a pH > 6, further preferably between 8 and 12According to a sixth aspect of the present invention, is provided the use a CND compound disclosed herein (e.g., in accordance with the first or third aspect), delivering a nucleic acid to an insect, e.g., to an insect cell. In some embodiments, the insect cell is an insect gut cell, e.g., an insect gut epithelial cell. In some embodiments, the insect is a Lepidoptera, Hemiptera, Coleoptera, Orthoptera and Diptera, preferably wherein the insect is selected from a caterpillar, aphid, weevil, locust, mosquito or fruit fly. The nucleic acid may be any suitable nucleic acid disclosed herein. In preferred embodiments, the nucleic acid is dsRNA or RNAi.According to a seventh aspect of the present invention, is provided the use a CND compound disclosed herein (e.g., in accordance with the first or third aspect), for delivering a nucleic acid to a plant cell. The nucleic acid may be any suitable nucleic acid disclosed herein. In preferred embodiments, the nucleic acid is dsRNA or RNAi. In some embodiments, the plant or plant cell is a Viridiplantae. In some embodiments, the plant or plant cell is an algae (aquatic plant), or a land plant (e.g., hornworts, liverworts, mosses, lycophytes, fems, gymnosperms and angiosperms, preferably angiosperms, even further preferably wherein the angiosperm is selected from a basal angiosperm, magnoliid, monocot or dicot. In some embodiments, the plant or plant cell is a dicot plant. In some embodiments, the plant cell is optionally solanaceae, brassicas or cucurbits. Inpreferred embodiments, the plant cell is Nicotiana plant cell, for example, / V.Benthamiana.According to a seventh aspect of the present invention, is provided the use of a CND compound disclosed herein (e.g., in accordance with the first or third aspect), for delivering a nucleotide to a plant for one or more of (i) delaying senescence, (ii) prolonging shelf-life and / or (iii) preventing pests. In preferred embodiments, the plant is a post-harvest flower or post-harvest vegetable.Detailed DescriptionThe present disclosure relates to a carbon-nanodot (CND) compound, comprising a CND core that is functionalized on its surface with a polyethyleneimine (PEI) polymer. In a preferred embodiment, the PEI polymer is a branched PEI polymer. The CND compound may have a nitrogen content (i.e. , measured nitrogen content) of at least 10%, wherein the nitrogen content is determined by x-ray photoelectron spectroscopy (XPS).The present disclosure provides the aspects mentioned above. Optional and preferred features of the various aspects are described below. Unless otherwise stated, any optional or preferred feature may be combined with any other optional or preferred feature, and with any of the aspects of the invention mentioned herein.It is noted that when discussing the CND compound disclosed herein, methods of making the CND compound disclosed herein, CND-nucleic acid complexes disclosed herein, the use of the CND compounds disclosed herein, or methods comprising the CND compounds disclosed herein, each of these discussions can be considered applicable to other examples whether or not they are explicitly discussed in the context of that example. Thus, for example, in discussing a component related to the method, such disclosure is also relevant to and directly supported in context of the CND compound product, and vice versa. Furthermore,for example in discussing a component related to the method, such disclosure is also relevant to and directly supported in context of the use and methods, and vice versa. For any use of the CND compounds disclosed herein which involve a nucleic acid, the use of the corresponding CND-nucleic acid complex is also contemplated.Brief Description of FiguresExamples, embodiments and experiments illustrating the principles of the invention will now be discussed with reference to the accompanying figures in which:Figure 1 shows an exemplary compound of the present invention. The CND core (shown shaded) is functionalized on the surface by PEI. In this example, the PEI is covalently attached to the CND core by an amide bond.Figure 2 shows A) an exemplary synthesis of CND-core formed by heating an amino sugar and an amino acid. Amino sugars may be selected from glucosamine, galactosamine or mannosamine. The surface composition of CND- core comprises COOH functional groups on the surface, derived from amino acids (e.g., alanine, glycine, glutamine, aspartic acid, serine, leucine, lysine, threonine, tyrosine, methionine, glutamic acid, tryptophan, arginine, cysteine, valine, isoleucine or leucine). B) A proposed mechanism for the synthesis of an exemplary CND-core from glucosamine and valine. The mechanism involves the formation of iminium intermediates resulted from the reaction of amine groups (e.g., amine group in valine) and the aldehyde cation intermediate formed from ring-opening of the hemiacetal in the carbohydrate moiety. The iminium intermediate can follow multiple steps of oligomerisation, carbonisation and surface passivation to form a carbon nanoparticle with an CND sp2core structure and surface composition derived from the amine co-precursor (e.g., valine).Figure 3 shows an exemplary synthesis of CND compounds by conjugation of branched polyethyleneimine (PEI) to CND-core via EDC catalyzed amidecoupling. CND compounds have structural functionalities on the surface derived from selected amino acids (alanine, glycine, glutamine, aspartic acid, serine, leucine, lysine, threonine, tyrosine, methionine, glutamic acid, tryptophan, arginine, cysteine, valine, isoleucine or leucine) and surface characteristics derived from PEI molecule. Non-carbonised PEI is coupled on surface of the CND-core, maintaining its composition unreacted while covering the surface of the CND.Figure 4. shows a representative synthesis of comparative CNDs disclosed herein formed from heating branched polyethyleneimine (PEI). In H2O solution, PEI forms a quasi-sphere that is carbonised upon heating to form a carbon dots core. The surface composition of comparative CNDs is derived from the carbonised material.Figure 5 shows X-ray photoelectron spectroscopy (XPS) surveys of a) an exemplary CND-core formed by heating an amino acid and amino sugar, prior to functionalization, b) an exemplary CND compounds of the invention, functionalized with PEI and c) comparative CNDs disclosed herein for surface composition analysis (%) of C, N and 0 heteroatoms. The exemplary CND compounds have a 2-fold N:C content increment and a 4-fold O:C content decrease compared to the CND core (i.e. , starting material). Unlike the reported heteroatom composition of PEI molecules, dominated by N groups, the surface composition of the comparative CNDs is dominated by 0 and C groups.Figure 6 shows high-resolution X-ray photoelectron spectroscopy (XPS) spectra of an exemplary CND core (i.e., prior to functionalization) with deconvoluted bands for narrow a) C 1s, b) N 1s and c) 0 1s scans. Surface composition is dominated by amine, carboxyl and hydroxyl groups derived from amino acid surface passivation.Figure 7. shows high-resolution X-ray photoelectron spectroscopy (XPS) spectra of exemplary Carbon Nanodots (CNDs) compounds of the disclosure withdeconvoluted bands for narrow a) C 1 s, b) N 1 s and c) 0 1 s scans. Surface composition dominated by amine groups derived from PEI surface conjugation.Figure 8 shows high-resolution X-ray photoelectron spectroscopy (XPS) spectra of comparative CNDs with deconvoluted bands for narrow a) C 1 s and b) 0 1 s scans. Unlike the reported composition of PEI molecules, dominated by sp3hybridization, the composition of the comparative CNDs is dominated by sp2hybridization which suggests the aromatization and carbonisation of PEI precursor. Surface composition dominated by hydroxyl groups resulted from the carbonisation of PEI in H2O.Figure 9 shows the cytotoxicity assessment of both CND compounds of the disclosure and comparative CNDs on HeLa Cells Using AlamarBlue Assay. This figure presents the cytotoxicity of various CND on HeLa cells, as measured by AlamarBlue assays. The data, shown in panels A-D, includes results for exemplary CND compounds disclosed herein (Panel A), comparative CNDs (unfractionated (Panel B), fractionated Aliquot 1 (Panel C) (obtained by sizeexclusion), and fractionated Aliquot 2 (Panel D) (obtained by size-exclusion). Each carbon dot (CND) concentration was tested in sextuplicate, with minimum, maximum, and mean cell viability values plotted. The CND sample of the disclosure (Panel A) displayed minimal cytotoxicity across the tested concentrations, with average cell viability consistently above 60,000 RFU. At 100 pg / mL, the average cell viability decreased to 54,908 RFU, but remained higher than the control average. In contrast, the comparative CNDs, (i.e. , unfractionated (Panel B) and fractionated aliquots (Panels C and D)) exhibited higher cytotoxicity at concentrations of 25-100 pg / mL. Fractionated Aliquot 1 (Panel C) showed average cell viability below the control across all concentrations, with maximum data points dropping below the control above 12.5 pg / mL. The unfractionated comparative CNDs (Panel B) demonstrated the highest cytotoxicity at 100 pg / mL, with an average cell viability of 11.88%. In comparison, the CND compound of the disclosure at the same concentration had a cell viability of 78.11 %. Fractionated Aliquots 1 and 2 had average cell viabilities of 45.18% and 62.18%, respectively, at 100 pg / mL. This data highlights the significant differences incytotoxicity among various CND preparations, and shows that the CNDs of the disclosure have lower cytotoxicity. Figure 10 shows example of RNA binding and release assay using exemplary CND compounds of the disclosure. Agarose gelshift assays demonstrating the binding and release of 60 bp dsRNA using our carbon dot (CND) platform at optimal CND ratios. The release is triggered by heating to 95oC for 20 minutes with added SDS, which outcompetes the CND- RNA bond, allowing for the dsRNA to be released. The first and last lanes contain a dsRNA ladder for size reference. The second and third lanes show a band at 60 bp, representing control naked dsRNA (no CNDs) at pH 7; lane 2 is without a heat / SDS step and lane 3 is with a heat / SDS step. Lanes 4-9 alternately display RNA bound to CNDs (no heat / SDS step) and RNA released from the CNDs via a heat / SDS step, illustrating the effective binding and release mechanism of the CND platform. When bound to CNDs (lanes 4, 6, and 8) the dsRNA / CND complex remains in the well and the CNDs effectively quench the Sybr Gold fluorescence, so the RNA is barely visible. When released from the CNDs (lanes 5, 7, and 9) the RNA fluorescence reappears.Figure 11 shows protection of large dsRNA by exemplary CND compounds of the disclosure against alkaline degradation at pH 11 and at 90*C. Agarose gel nuclease protection assay demonstrating protection by CNDs of a 438 bp dsRNA against alkaline degradation at pH 11 and at 90*C. Lane 1 shows control of naked dsRNA at pH 7. Lane 2 shows complete degradation of free dsRNA by the drastic conditions (pH 11 and 90*C). Lane 3 shows the protection of the dsRNA that was bound to CNDs, treated with highly alkaline pH and heat, and subsequently released by heat / SDS. This gel demonstrates a high level of protection by CNDs from alkaline degradation.Figure 12 shows agarose gel nuclease protection assays demonstrate in triplicate the protection of 22 bp dsRNA using a carbon dot (CND) platform against Pierce™ Universal Nuclease at pH 10 incubated for 10 minutes at 37°C. The first and last lanes contain a dsRNA ladder as a size reference. Lanes 2-4 show a band at 22 bp representing control naked dsRNA (no CNDs). Lanes 5-7 show the 22 bp dsRNA bound by CNDs and released by heat / SDS. Lanes 8-10 revealcomplete degradation of naked dsRNA by nuclease at pH 10, with no 22 bp band visible. In contrast, lanes 11 -13 display a clear 22 bp band of dsRNA that was bound to CNDs during the nuclease step and released by heat / SDS indicating successful protection. The upper band in lanes 2-15 is an artifact caused by high SDS concentrations.Figure 13 shows agarose gel nuclease protection assays illustrate the protection of 22 bp dsRNA using an exemplary carbon dot (CND) compounds of the disclosure against Micrococcal nuclease (MNase) at various pHs. Samples were run in triplicate. (A.) The top half of the gel shows a dsRNA ladder in the first and last lanes for size reference. Lanes 2-4 display a 22 bp band of control naked dsRNA at pH 7 (no CNDs). Lanes 5-7 also show a 22 bp band for dsRNA at pH 7 bound by CNDs and released by heat / SDS. Lanes 8-10 reveal mostly degraded naked dsRNA by MNase at pH 7. Lanes 11 -13 contrast this with a clear bright 22 bp band of dsRNA incubated with CNDs at pH 7 during the nuclease step and released by heat / SDS, indicating successful protection. Lanes 14-16 demonstrate complete degradation of naked dsRNA by MNase at pH 8. Conversely, lanes 17-19 show a clear bright 22 bp band of dsRNA incubated with CNDs at pH 8 during the nuclease step and released by heat / SDS, confirming the protective effect of CNDs. (B.) The bottom half of the gel shows a dsRNA ladder in the first and last lanes for size reference. Lanes 2-4 reveal mostly degraded naked dsRNA by MNase at pH 9. Lanes 5-7 contrast this with a brighter 22 bp band of dsRNA incubated with CNDs at pH 9 during the nuclease step and released by heat / SDS, indicating successful protection. Lanes 8-10 demonstrate complete degradation of naked dsRNA by MNase at pH 10. Conversely, lanes 11 -13 show a clear bright 22 bp band of dsRNA incubated with CNDs at pH 10 during the nuclease step then released by heat / SDS, confirming the protective effect of CDs. Lanes 14-16 reveal mostly degraded naked dsRNA by MNase at pH 11 . Lanes 17-19 contrast this with a brighter 22 bp band of dsRNA incubated with CNDs at pH 11 during the nuclease step then released by heat / SDS, indicating successful protection.Figure 14 shows protection of 22 bp dsRNA by Carbon Dots (CNDs) Against Salt Active Nuclease (SAN) at Various pHs. Agarose gel nuclease protection assays illustrate the protection of 22 bp dsRNA using an exemplary carbon dot (CND) compound of the disclosure against Salt Active Nuclease (SAN) at various pHs. Samples were run in triplicate. (A.) The top half of the gel shows a dsRNA ladder in the first and last lanes for size reference. Lanes 2-4 display a 22 bp band of control naked dsRNA at pH 7 (no CNDs). Lanes 5-7 also show a 22 bp band for dsRNA at pH 7 bound by CNDs and released by heat / SDS. Lanes 8-10 reveal mostly degraded naked dsRNA by SAN at pH 7. Lanes 11 -13 contrast this with a clear bright 22 bp band of dsRNA incubated with CNDs at pH 7 during the nuclease step and released by heat / SDS, indicating successful protection. Lanes 14-16 demonstrate complete degradation of naked dsRNA by SAN at pH 8. Conversely, lanes 17-19 show a clear bright 22 bp band of dsRNA incubated with CNDs at pH 8 during the nuclease step and released by heat / SDS, confirming the protective effect of CNDs. (B.) The bottom half of the gel shows a dsRNA ladder in the first and last lanes for size reference. In lanes 2-4 (naked dsRNA) and 5-7 (CND bound and released dsRNA) the Salt Active Nuclease did not degrade the dsRNA; we have repeatedly found that in this particular pH 9 buffer, SAN is ineffective. However, lanes 8-10 demonstrate complete degradation of naked dsRNA by SAN at pH 10. Conversely, lanes 11 -13 show a clear bright 22 bp band of dsRNA incubated with CNDs at pH 10 during the nuclease step then released by heat / SDS, confirming the protective effect of CNDs. Lanes 14-16 reveal complete degradation of naked dsRNA by SAN at pH 11. Lanes 17-19 contrast this with a brighter 22 bp band of dsRNA incubated with CNDs at pH 11 during the nuclease step then released by heat / SDS, indicating successful protectionFigure 15 shows protection of 438 bp dsRNA by exemplary CND compounds of the disclosure against Pierce™ Universal Nuclease at pH 10. Agarose gel nuclease protection assay demonstrating protection by CNDs of a 438 bp dsRNA against Pierce™ Universal Nuclease (PUN) at pH 10. Lanes 1 and 6 show a 1 kb+ DNA ladder as a size reference. Lane 2 shows the free 438 bp dsRNA and lane3 shows almost complete degradation of free dsRNA by the nuclease. Lane 4 shows the dsRNA that was bound to CNDs and released using heat / SDS. Lane 5 shows the dsRNA that was bound to CNDs, treated with nuclease as for lane 3, and subsequently released by heat / SDS. This gel demonstrates a high level of protection by CNDs from nuclease degradation and increases the size range of dsRNA we can protect to over 400 bp.Figure 16 shows protection of 60 bp dsRNA by exemplary Carbon Dots (CNDs) of the disclosure against Degradation by Pieris brassicae caterpillar Gut Juice (Pb GJ). (A) The top image shows an adult Pieris brassicae butterfly, while the bottom image depicts the gut content (gut juice) of a Pieris brassicae caterpillar tested at pH 10 on litmus paper. (B) Agarose gel-shift assay demonstrating the protection of 60 bp dsRNA using a carbon dot (CND) platform against P. brassicae caterpillar gut juice. The first lane contains a dsRNA ladder as a size reference. The second lane displays a 60 bp band of control naked dsRNA at pH 10 (no CNDs). The 3rd and 5th lanes show that naked 60 bp dsRNA (no CNDs) is fully degraded by P. brassicae caterpillar gut juice, with no 60 bp bands visible. In contrast, the 4th and 6th lanes show clear 60 bp bands of dsRNA bound to CNDs during the digestion step and released by heat / SDS, demonstrating successful protection. The upper bands in lanes 3-6 are P. brassicae nucleic acids from the caterpillar gut juice.Figure 17 shows protection of 60 bp dsRNA by exemplary CNDS of the disclosure against Degradation by Noctua comes from Caterpillar Gut Juice. (A.) An image of an adult Noctua comes moth. (B.) A gut juice content protection assay showing protection of 60 bp dsRNA using a carbon dot (CND) compound disclosed herein against Noctua comes caterpillar gut juice. The first lane contains a dsRNA ladder as a size reference. The second lane shows a 60 bp band of control naked dsRNA at pH 10 (no CNDs). The 3rd and 4th lanes demonstrate that naked 60 bp dsRNA (no CNDs) is fully degraded by Noctua comes caterpillar gut juice, with no 60 bp bands visible. In contrast, the 5th and 6th lanes show clear 60 bp bands for dsRNA incubated with CDs during the digestion step and released by heat / SDS,indicating successful protection. Similarly, the 7th and 8th lanes show complete degradation of naked 60 bp dsRNA (no CNDs). The 9th and 10th lanes, however, show clear 60 bp bands for dsRNA incubated with CNDs during the digestion step and released by heat / SDS further demonstrating the protective effect of CDs against degradation by gut juice. The upper bands in lanes 7-10 represent Noctua comes nucleic acids from the caterpillar gut juice. Lanes 7-10 included extra SDS during the final release step; this was one of several parameters we were testing at the time.Figure 18 shows protection of 60 bp dsRNA by exemplary CNDs of the disclosure against Degradation by Galleria mellonella caterpillar Gut Juice. (A.) An image of an adult Galleria mellonella moth. (B.) A gut juice content protection assay showing the protection of 60 bp dsRNA using a carbon dot (CND) platform against Galleria mellonella caterpillar gut juice. The first lane contains a dsRNA ladder for size reference. The second lane shows a 60 bp band representing control naked dsRNA at pH 10. The third lane shows no band as the CNDs effectively bound the 60 bp dsRNA quenching the Sybr Gold fluorescence. The fourth lane shows no clear band at 60 bp due to degradation of the naked dsRNA in the presence of gut juice. The fifth lane again shows no band, as the CNDs effectively bound the 60 bp dsRNA in the presence of gut juice. The sixth lane shows that, after heat / SDS release, most of the 60 bp dsRNA bound to CNDs was protected from degradation by the gut juice. In lane 4 the Galleria mellonella nucleic acids are visible as a smear. Interestingly, the caterpillar nucleic acids are also bound by CNDs as can be seen in lane 5. Upon release there is less caterpillar nucleic acids visible but this may be due to the intense dsRNA band effectively quenching the Sybr Gold in that lane.Figure 19 shows confocal analysis of cellular uptake of an exemplary CND compound of the disclosure-complexed and free dsRNA in Spodoptera exiguous gut cells. Spodoptera exigua cultured gut cells were incubated for 60 min with either free Cy3-labeled dsRNA (A.) or CNDs:Cy3-labeled dsRNA (B.). In both figures, the nucleus is stained with Hoechst33342 (Hoechst). The images show an overlay consisting of the merged images of Hoechst and Cy3-labeled dsRNA.Figure 20 shows cellular Uptake of CD-Complexed dsRNA in Nicotiana Benthamiana. (A) and (C) show control leaves. (B) and (D) display leaf bleaching due to the RNAi effect after dsRNA delivery by exemplary CND compounds. This demonstrates the successful delivery and action of dsRNA facilitated by CNDs in Nicotiana Benthamiana.Figure 21 shows cellular Uptake of a CND-Nucleotide complex enhances Longevity in Cut Flowers. The cellular uptake of CND-nucleotide complex significantly reduced senescence in cut flowers. Panels (A) and (B) show the flowers before treatment. Panel (C) displays flowers after 20 days treated with a solution of CND- nucleotide complex, while panel (D) shows flowers after 20 days treated with a competitor's solution. The data indicates that CND-nucleotide complex greatly improves the quality and longevity of cut flower blooms compared to a commercially available flower care product.Figure 22 shows the % composition of N, C and 0 for an example CND compound of the disclosure, having 71.2% carbon, 20.7% nitrogen and 8.1 % oxygenFigure 23 shows A) the mortality of aphids feeding on the CND / dsRNA complex and B) the reduction in fecundity of aphids feeding on a CND / dsRNA complex. This data provides further evidence that the CND compounds of the present disclosure aid delivery of nucleic acids into insects.Figure 24 shows confocal microscopy images of various treatment samples incubated with Nicotiana benthamiana seedlings. A) Sample 1 - water control, B) Sample 2 - CND compound only control, C) Sample 3 - dsRNA only control and D) Sample 4 - CND compound + dsRNA.Figure 25 shows A) a gel showing plasmid bind and release to the CND compound, B) a gel showing mRNA bind and release to the CND compound, C) a gel demonstrating the binding efficiency of the plasmid with the CND compoundwith different ratios of CND: plasmid where #1 = 1 :8, #2 = 1 :4, #3 = 1 :2, #4 = 1 : 1 , #5 = 2: 1 , #6 - 4: 1 , #7 = 8.1 , D) a gel demonstrating the binding efficiency of the mRNA with the CND compound with different ratios of CND: mRNA where #1 = 1 :8, #2 = 1 :4, #3 = 1 :2, #4 = 1 :1 , #5 = 2:1 , #6 - 4:1 , #7 = 8.1 , and E) a gel demonstrating release of the plasmid from the CND compounds using an alternative release reagent (17.5 mM heparin at RT) and F) a gel demonstrating release of the mRNA from the CND compounds using an alternative release reagent (17.5 mM heparin at RT).Figure 26 shows the bind and release of siPOOL dsRNA with CND compounds. A) shows the gel and B) shows the conditionsFigure 27 shows siPOOL dsRNA binding efficiency with gradually increasing ratios of CNDs:siPOOL dsRNA. A) shows the conditions and B) shows the gel.Figure 28 shows siPOOL dsRNA release from CNDs using an alternative release reagent (17.5 mM heparin at RT): A) shows the gel, and B) shows the conditions.DefinitionsThe terms used in this specification generally have their ordinary meanings in the art, within the context of this disclosure and in the specific context where each term is used. Certain terms are discussed below, or elsewhere in the specification, to provide additional guidance in describing the compositions and methods of the disclosure and how to make and use them.As used herein, the terms “about” or “approximately” means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e. , the limitations of the measurement system. For example, “about” can mean within three or more than three standard deviations, per the practice in the art. Alternatively, “about” can mean a range of up to 20%, preferably up to 10%, morepreferably up to 5%, and more preferably still up to 1 % of a given value. Also, particularly with respect to systems or processes, the term can mean within an order of magnitude, preferably within five-fold, and more preferably within twofold, of a value.As used herein and the appended claims, the singular forms “a,” “an,” and “the” include plural references unless the content clearly dictates otherwise. wt.% herein, unless otherwise specified is w / w%.Percentage of an element in the CND compound as used herein is typically an atomic percentage (at.%), and is defined as the percentage of the number of atoms of an element in a sample relative to the total number of atoms in the sample, which is determined by XPS. For example, a CND comprising a nitrogen content of about 10 %, or 10 at.%, means a CND comprising 10 nitrogen atoms for every 100 atoms that constitute the CND.Various standard methods for measuring properties (e.g. ASTM, ISO, DIN, TAPPI) may be mentioned herein. Unless otherwise stated, the standard to be used is the most recent before the filing date of the present application.Carbon nanodot (CND) refers to a type of carbon-based nanoparticle or nanomaterial. It is generally understood that CNDs are formed of predominantly carbon atoms. It is well-known that CNDs can be prepared by heating organic small organic molecules at high temperatures, typically in a carbonisation process. In the present invention, the “CND core” refers to the part of the CND compound which has been formed in a heating or carbonisation process. In the present disclosure, the CND has been functionalised at its surface to form a CND compound (i.e., using PEI). CND may be referred to as CD or CDot elsewhere herein or in the state of the art.As used herein and as is understood in the art, the polyethyleneimine (PEI) polymer is a polymer with repeating units composed of an amine group and two carbon aliphatic CH2CH2 spacersAs used herein X-ray photo spectroscopy, or XPS, is a surface-sensitive quantitative spectroscopic technique that measures the topmost atoms, typically the topmost 0.01 pm of a particle surface. This typically corresponds to the outermost 200 atoms. XPS detects all elements other than hydrogen and helium.As used herein,represents an attachment point to the surface of the CND (i.e., CND core). The attachment may be any suitable attachment., typically via one or more covalent bonds. The one or more covalent bonds may comprise an, alkyl group (e.g.,is a C1-C3 alkyl, such as CH2 or a CHR group), an amide bond (e.g.,is C=O), or an amide bond derived from functionalization of an amino acid present on the surface of the CND core, (e.g., J'5'*'* is -CH(R)-C=O), or -CH2C(R)-C=O. R can be as defined elsewhere herein.Carbon nanodots (CNDs) compoundIn the present disclosure, the CND compound comprises a CND core that is functionalized on the surface with a polyethyleneimine (PEI) polymer.As used herein, functionalized on the surface can refer to any method that appends or PEI to the surface of the CND core. The resulting CND compound may be referred to as a “functionalized CND”, “a surface-modified CND”, or “CND composite”. The surface of the CND core refers to the outer layer of the CND core.As used herein, “a CND core that is functionalized on the surface with a polyethylene (PEI) polymer, may otherwise be phrased, or is synonymous with,“a CND core that has been modified by a polyethylene (PEI) polymer on the surface” and / or “a CND comprising polyethylene (PEI) polymer on the surface, and / or “a CND core, wherein the surface of the CND is appended to PEI”. Typically, functionalization occurs via formation of a covalent bond, typically a covalent bond. Therefore, in some embodiments, the CND compound may be described as a CND core which is covalently bound to PEI at its surface, and in preferred embodiments, via an amide bond.In some embodiments, the PEI is bonded to the CND core via one or more chemical bonds, and the CND compounds have the following structure,any suitable number, typically wherein n is greater than 5, or greater than 10, or greater than 25, or greater than 50, or greater than 100. In some embodiments, n is less than 5000, or less than 2500, or less than 1000, or less than 500, or less than 250, or less than 200, or less than 175, or less than 150, or less than 150, or less than 125, or less than 100, or less than 75, or less than 50. In some embodiments, n is from 10 to 2500, or n is from 50 to 200. , wherein L is selected from N or C2H4NRaRb, preferably wherein Raand Rb are each independently selected from H, C2H4NH2, or C2H4NRcRd, wherein Rcand Rd are each independently selected from H orC2H4NH2.In some embodiments, the PEI polymer is bonded to the CND core via an amide bond, optionally wherein the CND compound has the following structure:where n is any suitable number, preferably wherein n is defined above, preferably wherein R is any suitable group, preferably wherein R is a) derived from one or more of alanine, glycine, glutamine, aspartic acid, serine, lysine, threonine, tyrosine, methionine, glutamic acid, tryptophan, arginine, cysteine, valine, isoleucine, and leucine, and / or b) selected from H, Ci-Cealkyl, Ci-6alkyl(=O)NH2, Ci-6alkyl(=O)OH, Ci-ealkyl-OH, C1-C6 alkyl-NH2, Ci-C6alkyl(OH)CH3, Ci-C6alkyl-phenyl, Ci-C6alkyl-SCH3, C1- C6alkylC(=O)OH, Ci-C6alkyl-indole, Ci-C6alkyl(=N)NH2, CH(CH3)Ci-C6alkyl, or Ci-C6alkyl(CH3)CH3, preferably selected from CH3, CH2CH2C(=O)NH, CH2C(=O)OH, CH3OH, CH2CH2CH2CH2NH2, CH(OH)CH3, CH2-phenyl, CH2CH2SCH3, CH2CH2C(=O)OH, CH2-indole, CH2CH2CH2NHC(=N)NH2, CH(CH3)CH2CH3, or CH2CH(CH3)CH3.These CNDs may be formed by the methods as disclosed herein.The CND compounds and methods to produce the CND compounds as disclosed herein are notably distinct from a CND that is formed simply by heating PEI and / or other small organic molecules (i.e., in a carbonization process), with no second separate functionalization step. This is in at least because CND cores formed by heating PEI do not contain full-length polyethyleneimine polymer on the surface, wherein the PEI is instead partially carbonized and bound within the CND core. Instead, the PEI . This results in less nitrogen at the CND surface. The lower % nitrogen content can be demonstrated by XPS.Elemental composition and XPSThe CND compounds described herein may be characterized using XPS spectroscopy. XPS can be used to determine the elemental composition of a CND or CND compounds, particularly at their surface. As discussed above, CNDs prepared by different methods have different properties. XPS provides a further physical fingerprint of how the CND compounds disclosed herein, differ from CNDs disclosed in the prior art, which are formed using different methods. In some embodiments, the XPS comprises conventional XPS with imaging XPS. The XPS method used may in accordance with that as described herein, e.g., using a Kratos Axis Ultra DLD system. In some embodiments, the XPS method may use a monochromatic Al Ka X-ray source. In some embodiments, the XPS is high-resolution XPS. In some embodiments, the monochromatic Al Ka X-ray source is operated at 140 W power. In some embodiments, data is collected with pass energies of 20 eV with a step size of 0.1 eV. In some embodiments, the XPS used a combination of magnetic immersion and electrostatic lenses. In an example, the XPS was acquired over an area of about 300x700 pm2In some embodiments, the carbon nanodot described herein have a nitrogen content of at least 10 % as determined by x-ray photoelectron spectroscopy (XPS). As indicated above, the higher % nitrogen content of the CND disclosed herein is achieved via functionalization of the CND with PEI at the surface to form a CND compound.The CND compounds of the present disclosure comprise nitrogen at the surface. The carbon nanodot may have a nitrogen content as determined by XPS of at least about 10 %, optionally at least about 11 %, optionally at least about 12 %, optionally at least about 13 %, optionally at least about 14 %, optionally at least about 15 %, optionally at least about 16 %, optionally at least about 17 %, optionally at least about 18 %, optionally at least about 19 %, preferably at least about 20 %. The nitrogen content % of the CND compound may be determined by XPS. The % may otherwise be defined as the at.% of nitrogen relative to the total number of atoms in the CND compound as measured by XPS.The CND compound may have a nitrogen content between about 10 % and about 40 %, or between about 11 % and about 35 %, or between about 12 % and about 32 %, or between about 13 % and about 28 %, or between about 14 % and about 27 %, or between 14 % and 26%, preferably between about 15 % and about 25 %, or between about 17.5% and about 22.5%. The nitrogen content % of the CND compound may otherwise be defined as the at.% of nitrogen relative to the total number of atoms in the CND compound as measured by XPS.Without wishing to be bound a particular theory, the present inventors believe that a high % nitrogen content at the surface of the CND compound improves binding to nucleic acids and therefore provides improved protection of nucleic acids from degradation, particularly nuclease degradation, even in harsh alkaline conditions and / or in the gut juice of insects. The present inventors found that the CND compounds disclosed herein, which are functionalized with PEI at the surface, had a higher % nitrogen content as determined by XPS compared to CNDs which are not functionalized with PEI at the surface. This includes CNDs formed by heating PEI in combination with other small molecules to form a CND core, the CND prior to functionalization with PEI or CNDs functionalized with other polymers.In some embodiments, the CND compound comprises oxygen. The oxygen content may be determined by XPS. The carbon nanodot may have an oxygen content of less than about 20 %, or less than 15 %, or less than about 14 %, or less than about 13 %, or less than about 12 %, or less than about 11 %, preferably less than about 10 %. The carbon nanodot may have an oxygen content of greater than about 1 %, or greater than about 2 %, or greater than about 3%, or greater than about 4%, or greater than about 5%, or greater than about 6%, or greater than about 7%, or greater than or equal to about 8%. The oxygen content of the CND compound may be defined as the at.% of oxygen relative to the total number of atoms in the CND compound as may be determined by XPS.In some embodiments, the CND compound may have an oxygen of between about 1 % and about 15 %, or between about 1 .5 % and about 14 %, or between about 2 % and about 13 %, or between about 3 % and about 11 %, or between 4 % and 10 %, optionally between about 55 and about 9%. The oxygen content % of the CND compound may otherwise be defined as the at.% of oxygen relative to the total number of atoms in the CND compound, as may be determined by XPS.In some embodiments, the CND compound may have a carbon content of at least 40 %, or at least 45%, or at least 50 %, or at least 60%, or at least 65%, or at least 70%. In some embodiments, the CND compound may have a carbon content of less than about 90 %, or less than about 85 %, or less than about 80 %, or less than about 75 %, or less than or equal to 72.5%. The carbon content may be determined by XPS. The carbon content of the CND compound may be defined as the at.% of carbon relative to the total number of atoms in the CND compound as may be determined by XPS.In some embodiments, at least 50 % of the carbons are sp3hybridized, preferably at least 55%, or at least 60 %, preferably between 63 % and 93% of the carbons are sp3hybridized. In some embodiments, less than 50%, or less than 40%, or less than 25% of the carbons are sp2hybridized, or between 5 % and 30% of the carbons are sp2hybridized. This may be determined by XPSIn some embodiments, the CND compound may have a carbon content of between about 40 % and about 90 %, optionally between about 50 % and about 85 %, optionally between about 60 % and about 80 %. The carbon content may be determined by XPS. The carbon content of the CND compound may be defined as the at.% of carbon relative to the total number of atoms in the CND compound as may be determined by XPS.In some embodiments, the CND compound may comprise(i) a nitrogen content as determined by XPS of at least about 10 %, or at least about 11 %, or at least about 12 %, or at least about 13 %, or at least about 14 %, or at least about 15 %, or at least about 16 %, or at least about 17 %, or at least about 18 %, or at least about 19 %, or at least about 20 % and(ii) an oxygen content as determined by XPS of less than about 20 %, or less than about 15%, or less than about 10%, and(iii) a carbon content as determined by XPS of between about 40 and about 90%, or between about 50% and about 85%, or between about 60 and about 80%. The % content of each element may be determined by XPS. The % content of the CND compound may be defined as the at.% of that element relative to the total number of atoms in the CND compound as may be determined by XPS.In some embodiments, the CND compound may comprise(i) a nitrogen content of between about 10 % and about 25 %, or between about 15 % and about 25 %,(ii) an oxygen content of less than about 20%, or less than about 15%, preferably between about 1 % and about 15%, or between about 3 % and about 11 %, or between about 4 % and about 10% and(iii) a carbon content of between about 40 % and about 90 %, optionally between about 50 % and about 85 %, optionally between about 60 % and about 80 %., preferably wherein the CND compound comprise a nitrogen content of between about 15 % and about 25 %, an oxygen content of less than about 10 %, and a carbon content of between about 60 % and about 80 %.The nitrogen, oxygen and carbon content may be determined by XPS. The % content of each element may be determined by XPS. The % content of the CND compound may be defined as the at.% of that element relative to the total number of atoms in the CND compound as may be determined by XPS.The CND compounds of the present disclosure may comprise other elements, or a balance of other elements. The presence of the other elements may be determined by XPS. The “other elements” as defined herein refer to elements other than hydrogen, helium carbon, nitrogen, and oxygen.In some embodiments, the CND compounds may comprise a content of other elements (i.e., other than hydrogen, helium, carbon, nitrogen and oxygen) in an amount that is less 20 %, or less than about 18 %, or less than about 15 %, or less than about 14 %, or less than about 13 %, or less than about 12 %, less than about 11 %, more preferably less than about 10 %. This may be determined by XPS. The % content of other elements may be defined as the at.% of the other elements relative to the total number of atoms in the CND compound as may be determined by XPS.In some embodiments, the CND compound may comprise(i) a nitrogen content of between about 10 % and about 25 %, or a nitrogen content of between about 15% and about 25%,(ii) an oxygen content of less than about 15 %, or less than about 10%, preferably between about 1 % and about 15%, or between about 3 % and about 11 %, or between about 4 % and about 10% and(ii) a carbon content of between about 40 % and about 90 %, or between about 50% and about 85%, or between 60% and 80%, and(iv) a content of other elements of less than 15%, or less than 10%. This may be determined by XPS. The % content of other elements may be defined as the at.% of the other elements relative to the total number of atoms in the CND compound as may be determined by XPS.Carbon nanodot coreThe CND core may be formed by any suitable method, for example, by heating one or more organic molecules (i.e., in a carbonization process).In preferred embodiments, the CND core is formed using small organic i.e., organic molecules with a molecular weight of less than 500, preferably less than 200. In preferred embodiments, the CND core may not have been formed using a polymer. In preferred embodiments, the CND core may not be formed using PEI.In preferred embodiments, the carbon nanodot core may have a particle size of about 0.5 nm to about 25 nm, or from 1 nm to 20 nm, or from 1 to 10 nm, more preferably from 1 -6 nm. The carbon nanodot core may have a particle size of less than about 50 nm, optionally less than about 25 nm, optionally less than about 10 nm, optionally less than about 5 nm. In a preferred embodiment, the particle size can be determined by atomic force microscopy (AFM). An example method of determining the particle size is as determined by AFM, e.g., according to ASTM E2859-11 . In another embodiment, the particle size is determined by calculating the hydrodynamic radius using diffusion-ordered spectroscopy (DOSY NMR).In some embodiments, the CND core may have a spherical particle shape or a quasi-spherical shape.In preferred embodiments, the CND core is formed from heating an amino sugar and an amino acid.In some embodiments, an amino sugar is defined as a sugar in which at least one hydroxyl group of the sugar has been replaced with an amine group. The amino sugar may comprise one or more amines, optionally two or more amines, optionally three of more amines, optionally four or more amines. The amino sugar may comprise one amine, optionally two amines, optionally three amines, optionally four amines. The amine is preferably a primary amine (i.e., unfunctionalized). In some embodiments, the amine is a secondary amine, for example an acetylated amine. The amino sugar may be a salt of the amino sugar, for example a HCI salt of the amino sugar. The amino sugar may be a natural or un-natural amino sugar. An un-natural amino sugar may be defined as an amino sugar which does not occur in nature or has not been extracted from natural sources. An un-natural amino sugar may also be defined as a natural amino sugar which has undergone chemical derivatization, functionalization or modification. The amino sugar may comprise a mixture of natural and un-natural amino sugars. The amino sugar may be a D-amino sugar or an L-amino sugar. The amino sugar may comprise a mixture of D and L- amino sugars. The amino sugar may be a single anomer or may comprise a mixture of anomers.The amino sugar may be selected from a group consisting of a 4-carbon sugar, a 5-carbon sugar, a 6-carbon sugar, a 7-carbon sugar, and an 8-carbon sugar. The amino sugar is preferably a 6-carbon sugar. The amino sugar may be selected the group consisting of a tetrose, pentose, hexose, and heptose. The amino sugar is preferably a hexose. The amino sugar is preferably hexose wherein the amine group is at the C-2 position.In some embodiments, the amino sugar may be selected from the group consisting of glucosamine, galactosamine, mannosam ine. In preferred embodiments, the amino sugar is glucosamine.The amino acid may be a natural or un-natural amino acid. An un-natural amino acid may be defined as an amino acid which does not occur in nature or has not been extracted from natural sources. An un-natural amino acid may also be defined as a natural amino acid which has undergone chemical derivatisation, functionalization or modification. The amino acid may comprise a mixture of natural and un-natural amino acids. Preferably, the amino acid is a natural amino acid. The amino acid may be a D-amino acid or an L-amino acid, or a mixture of D and L-amino acids. The amino acid may be an a, (3, or y-amino acid. The amino acid may be selected from the group consisting of an L-a-amino acid, D-a-amino acid, L-[3-amino acid, and D-[3-amino acid. The amino acid may comprise a mixture of at least two amino acids. In some embodiments, the amino acid comprises or is a beta-amino acid.In some embodiments, the amino acid may be selected from the group consisting of alanine, glycine, glutamine, aspartic acid, serine, leucine, lysine, threonine, tyrosine, methionine, glutamic acid, tryptophan, arginine, cysteine, valine, isoleucine, and leucine, for example beta-alanine. In some embodiments, the amino acid may be selected from the group consisting of alanine, glycine, valine, leucine, isoleucine, leucine, and methionine. In some embodiments, the amino acid is alanine. In a preferred embodiment, the amino acid is beta-alanine.In a preferred embodiment, the CND core is formed by heating glucosamine and beta-alanine.Polyethyleneimine (PEI)The CND compounds disclosed herein comprise PEI, wherein CND core is functionalized on the surface with PEI. In other words, the PEI is present on the surface of the CND compound. In some embodiments, the PEI is appended to the surface of the CND core via a covalent bond, preferably an amide bond. Preferably, the PEI is appended to the surface of the CND core via one or more terminal amine groups, i.e. , to form one or more amide bonds.The PEI polymer may be linear or branched. In a linear PEI polymer, all the amine functional groups are secondary amines, except for terminating amines which may be primary amines. In a branched PEI, the amine functional groups may be a combination of primary, secondary, and / or tertiary amines. In an example, the PEI comprises a ratio of primary:secondary:tertiary amines in a 1 :1 :0.7 ratio. A branched PEI which comprises only primary and tertiary amines may be termed a dendrimeric PEI polymer. Branched PEI polymers may be synthesized by ring opening polymerization of aziridine. The PEI polymer is preferably a branched PEI polymer, preferably wherein the branched PEI polymer is not a dendrimeric PEI polymer (i.e., it comprises secondary amines).The PEI polymer may have a molecular weight of between about 500 and about 25000, optionally between about 750 and about 20000, optionally between about 900 and about 15000, optionally between about 1000 and about 10000, preferably between about 2500 and about 7500, for example about 5000. The PEI polymer may have a molecular weight of at least about 500, optionally at least about 600, optionally at least about 700, optionally at least about 750, optionally at least about 900, optionally at least about 1000, optionally at least about 1500, preferably at least about 2500. The PEI polymer may have amolecular weight of less than about 50000, optionally less than about 40000, optionally less than about 30000, optionally less than about 25000, optionally less than about 20000, optionally less than about 15000, optionally less than about 10000, optionally less than about 7500. The molecular weight may be an average (mean) molar mass and is measured in g / mol. The molecular weight may be a number average molecular weight (Mn). In some embodiments, the PEI polymer used is Lupasol G-100 from BASF.The molecular weight may be determined by size exclusion chromatographyThe molecular weight may be determined gel permeation chromatography (GPC). In an embodiment, the molecular weight may be determined according to ASTM D6474-20In some embodiments, all of the PEI polymer is on the surface of the CND compound and / or no PEI polymer is present within the CND core. In some embodiments the molecular weight of the PEI polymer on the surface of the CND core (i.e., the portion of the PEI polymer that extends outside of the core) corresponds to the molecular weight of the PEI as elsewhere defined herein, e.g., wherein the molecular weight is at least about 500, optionally at least about 750, optionally at least about 900, optionally at least about 1000, optionally at least about 1500, optionally at least about 2000, optionally at least about 2500. The present inventors found that having the CND core functionalised on the surface with PEI polymer resulted in a higher % nitrogen content on the surface of the CND when compared with CNDs with a core formed from PEI polymer without functionalization at the surface.Method of forming carbon nanodotsThe present invention also relates to a method of forming a carbon nanodot (CND) compound, the method comprising:a) forming a CND core, preferably comprising heating one or more small molecules to form the CND core, more preferably heating an amino sugar and an amino acid to form the CND core, and b) functionalizing the CND core with a polyethyleneimine polymer.The present inventors found that by forming the CND core in step a) (i.e., in a carbonization process), followed by functionalizing the surface of the CND core with PEI in a separate step b), they could produce CNDs / CND compounds with distinct properties. Different to methods where PEI is heated to form the CND core, the resulting PEI polymer is entirely on the surface of the core, is not bound within the core, and is not carbonized.The CND compounds of the present invention, i.e., with PEI present on the surface of the CND core, were found to perform better, and have higher affinity to nucleic acids, as compared to CNDs formed by heating PEI either or alone or in combination with other organic molecules, and without further functionalization.The inventors found that by functionalizing the surface of a CND with PEI polymer, (i.e., in a second step after forming the core), the CNDs can be produced in high yield and purity in an efficient process. By adding the PEI in a second functionalization step, the PEI is importantly not degraded or carbonized as compared to when PEI is included in the carbonization process (i.e., when PEI is used to form the CND core). The method results in more reproducible CND compounds with more consistent surface properties.The CND core is typically formed by heating one or more small organic molecules, typically wherein the organic molecules have a molecular weight of less than 200. Preferably, the CND core is formed by heating an aminosugar and an amino acid. The amino sugar and amino acid may be as defined elsewhere herein. The present inventors found that a CND core formed by heating an amino sugar and amino acid resulted in a more efficient reaction where CNDs are formed in high yield and / or high purity compared to prior methods. Use of thesespecific materials in formation of the CND core contributes both to the particularly useful properties of the CND compounds disclosed herein, as well as their elemental composition, e.g., as determined by XPS. The resultant CND core, after heating an amino sugar and amino acid in step a), may comprise COOH groups on the surface.In some embodiments, heating of the one or more small organic molecules (e.g., heating of the amino sugar and the amino acid) may be carried out at a temperature of at least 150 °C, or at least 160 °C, or at least 170 °C, or at least 175 °C. In some embodiments, heating of the one or more small organic molecules may be carried out at a temperature of less than 300 °C, or less than 275 °C, or less than 250 °C, or less than 225 °C, or less than 200 °C, or less than 190 °C, or less than 180 °C. In some embodiments, heating of the one or more small organic molecules (e.g., heating of the amino sugar and the amino acid) amino sugar and the amino acid is carried out at a temperature of between 150 °C and 200 °C, or between 160 °C and 190 °C, or between 170 °C and 180 °C. It is known that sugars can create very different products based on the temperature of the reaction. The present inventors found that heating at elevated temperatures of at least 150 °C, preferably of at least 170 °C, more preferably at least or equal to 175 °C, resulted in a CND core with the most optimal properties.In some embodiments, formation of the CND core (e.g., when heating an amino sugar and amino acid) proceeds via a deoxyfructosazine intermediate, e.g., having the following structure.In some embodiments, at least 50 % of the carbons are sp2hybridized on the surface of the CND core as determined by XPS analysis, for example, between 10 and 38 % of the carbons are sp2hybridized in the CND core.The heating may be carried out for any suitable time. In some embodiments, the heating may be carried out for at least 1 minute, or at least 10 minutes, or at least 30 minutes, or at least 1 hour, or at least 1 .5 hours, or at least 2 hours, or at least 3 hours. In some embodiments, the heating may be carried for less than 100 hours, or less than 72 hours, or less than 48 hours, or less than 24 hours, or less than 12 hours, or less than 6 hours, or less than 4 hours. .The heating may be carried out using any suitable heating method.In some embodiments, the heating is by thermal conduction (e.g., “normal” or conventional heating). In some embodiments, the heating by thermal conduction is carried out for between 1 hour and 100 hours, or between 1 and 10 hours, or between 1 .5 and 5 hours, or between 2 and 5 hours.In some embodiments, the heating is by microwave heating. Microwave heating is typically quicker that heating by thermal conduction. In some embodiments, microwave heating is carried out for between 1 minute and 3 hours.In some embodiments, the heating is performed in an aqueous solution, for example in water, preferably distilled water. This avoids the use of chlorinated or other toxic organic solvents. In preferred embodiments, the heating step does not comprise organic solvents.Preferably, an amino sugar and amino acid is heated to form the CND core. The amino sugar and amino acid may be as defined elsewhere herein. In some embodiments, the amino sugar and amino acid may be heated a molar ratio of amino sugar to amino acid of about 1 :0.5 to about 1 :5, or about 1 :0.75 to about 1 :3, or about 1 :1 to about 1 :2, or about 1 :1 to about 1 :1.5, or about 1 :1.2. Theamino acid and amino sugar may be heated a molar ratio of amino acid to amino sugar is 1 :>0.5, or 1 : >0.6, or 1 : >0.8, or 1 : >1 , or 1 : >1.1.In some embodiments, the CND core may be purified prior to functionalization with PEI (i.e. , in step b). The CND core may be purified by any method known to those skilled in the art. In some embodiments, the CND core may be purified by filtration. In some embodiments, the CND core may be purified by size-exclusion chromatography. In some embodiments, the CND core may be purified by centrifuge filtration (e.g., using centrifuge tubes). In some embodiments, the CND core may be purified by fractionation (e.g., by gravity). In some embodiments, the CND core may be purified by induced gravity or centrifugal force. In some embodiments, the CND core may be purified by dialysis, e.g., in water or through a dialysis membrane. In some embodiments, the CND core may be purified using a combination of techniques, e.g., as disclosed above.In step b), the CND core is functionalized with PEI. In some embodiments, the functionalization step occurs without heating. In some embodiments, the functionalization step occurs at a temperature of between 0 °C and 75 °C, more preferably between 12 °C and 30 °C, or between 15 °C and 25 °C.In some embodiments, in step b), the CND core is functionalized with PEI to form the following structure.any suitable number, typically wherein n is greater than 5, or greater than 10, or greater than 25, or greater than 50, or greater than 100. In some embodiments, n is less than 5000, or less than 2500, or less than 1000, or less than 500, or less than 250, or less than 200, or less than 175, or less than 150, or less than 150, or less than 125, or less than 100, or less than 75, or less than 50. In some embodiments, n is from 10 to 2500, or n is from 50 to 200. In some embodiments, L is selected from H or C2H4NRaRb,preferably wherein Raand Rbare each independently selected from H, C2H4NH2, or C2H4NRcRd, wherein Rcand Rd are each independently selected from H orC2H4NH2.In some embodiments, in step b), the CND core is functionalized with PEI to form the following structure,wherein Z and R are as defined above.In some embodiments, functionalization of the CND core may comprise coupling a CND core with a PEI polymer to form a covalent bond. In some embodiments, the CNDs are formed by forming a CND core, said CND core having carboxylic acid (COOH) groups on the surface of the core, and reacting the carboxylic acid groups, with PEI. The carboxylic acid groups can react with a primary amine group of PEI to form an amide bond, e.g., in accordance with the following reaction scheme.n, L and R are as defined above and elsewhere herein.In some embodiments, a CND core having carboxylic groups on the surface of the core may have been formed by heating an amino sugar and an amino acid in step a).In some embodiments, functionalizing the CND-core with PEI polymer is carried out in the presence of an amide coupling reagent. Any amide coupling reagent known to those skilled in the art may be used. Any conditions for amide coupling reactions known to those skilled in the art may be used to affect the coupling. In some embodiments, the amide coupling reagent may be selected from the group consisting of dicyclohexylcarbodiimide (DCC), diispropylcarbodiimide (DIC), 1- ethyl-3-carbodiimide hydrochloride (EDC), benzotriazole-1 -yl-oxy-tris- (dimethylamino)-phosphonium hexafluorophosphate (BOP), 1 -[(1 -(Cyano-2- ethoxy-2-oxoethylideneaminooxy) dimethylaminomorpholino)] uranium hexafluorophosphate (COMII), HATLI, and HBTLI, PyBOP.In some embodiments, the amide coupling reagent may be a carbodiimide coupling reagent. The amide couple reagent may be selected from a group consisting of dicyclohexylcarbodiimide (DCC), diispropylcarbodiimide (DIC), and 1 -ethyl-3-carbodiimide hydrochloride (EDC). In some examples, the amide coupling reagent is EDC.In some embodiments, the amide coupling reagent may be used in an amount of at least about 1 molar equivalents (eq.) relative to the CND core, optionally at least about 1.2 eq., optionally at least 1.5 eq., optionally at least 1.75 eq., optionally at least or equal to 2 eq.The CND compound (i.e., after functionalization with PEI in step b)) may be purified by any method known to those skilled in the art. In some embodiments, the CND compound may be purified by filtration. In some embodiments, the CND compound may be purified by size-exclusion chromatography. In some embodiments, the CND core may be purified by induced gravity or centrifugal force. In some embodiments, the CND compound may be purified by filtration.In some embodiments, the CND compound may be purified by dialysis, e.g., in water or . using a dialysis membrane.The present inventors found that the method of the present disclosure resulted in the formation of fewer impurities than comprative CNDs disclosed herein formed in a one-pot process. The resulting CND compounds had lower overall chemotoxicity compared to comparative CNDs described herein (see examples). The methods are also reproducible and provide consistent results.The present inventors further found that the CND compounds formed by the methods disclosed herein may comprise a higher % nitrogen content, and a lower % content of other elements (i.e. , elements other than nitrogen, carbon, oxygen, helium or hydrogen) as determined by XPS compared to comparative CNDs disclosed herein (see examples).In some embodiments, the CND core is not formed from a polymer. In some embodiments, the CND core is not formed with a PEI polymer. If the CND is not formed with PEI polymer, this is advantageous as the PEI polymer is not degraded by the heating during core formation, nor is the PEI polymer bound within the CND core.In some embodiments, the CND is typically free of PEG polymer. Distinct from other prior art methods, the method does not comprise any functionalization or passivation with a PEG polymer.Carbon nanodot nucleic acid complexIn another aspect of the present invention, there is provided a carbon nanodot (CND) nucleic acid complex, comprising the CND compound as disclosed herein (e.g., accordance to the first or third aspect) and a nucleic acid.The present inventors found that CND compounds of the present disclosure could bind to effectively nucleic acids and protect them from degradation. The CNDs could also be used to deliver nucleic acids to plant cells and insect cells.As defined herein, the term nucleic acid encompasses a single nucleotide or a chain of nucleotides. In some embodiments, the nucleic acid may be a single nucleotide and the resultant complex is a CND nucleotide complex.In an alternative embodiment, the nucleic acid is a chain of at least two nucleotides. In some embodiments, the nucleic acid comprises a chain of nucleotides having a length of from about 2 nucleotides to about 1000 nucleotides, optionally from about 3 nucleotides to about 900 nucleotides, optionally from about 4 nucleotides to about 800 nucleotides, optionally from about 5 nucleotides to about 750 nucleotides, optionally from about 8 nucleotides to about 650 nucleotides, optionally from about 10 nucleotides to about 600 nucleotides, preferably from about 15 nucleotides to about 500 nucleotides. In some embodiments, the nucleic acid comprises at least 2 nucleotides, or at least 3 nucleotides, or at least 5 or at least 10 nucleotides, or at least 15 nucleotides, or at least 20 nucleotides, or at least 30 nucleotides, or at least 50 nucleotides, or at least 100 nucleotides, or at least 250 nucleotides. The nucleic acid may be a chain of nucleotides having a length of less than 1500 nucleotides, optionally less than 1250 nucleotides, optionally less than 1000 nucleotides, optionally less than 900 nucleotides, optionally less than 750 nucleotides, preferably less than 500 nucleotides.Nucleotides defined herein may be natural or un-natural nucleotides, or a mixture of natural and un-natural nucleotides. An un-natural nucleotide may be defined as a nucleotide which does not occur in nature or has not been extracted from natural sources. An un-natural nucleotide may also be defined as a natural nucleotide which has undergone chemical derivatisation, functionalization or modification. The nucleotide may be a chemically synthesized nucleotide. An unnatural nucleotide may also be termed an artificial nucleotide. In someembodiments, the nucleic acid comprises one or more RNA nucleotides: A, II, G or C. In some embodiments, the nucleic acid comprises one or more DNA nucleotides, A, T, G or C. In some embodiments, the nucleic acid comprises one or more modified RNA nucleotides, such as, 2-OMe RNA, 2-F RNA, or 2-MOE RNA. In some embodiments, the nucleic acid comprises one or more LNA or PNA nucleotides.Preferably, the nucleic acid has a phosphodiester backbone. In some embodiments, the nucleic acid may have a phosphorothioate backbone.The nucleotides may comprise a nucleobase (for example a nitrogenous base), a sugar, and at least one phosphate group. A modified nucleotide may comprise a modified nucleobase, a modified sugar, or a modified phosphate group. The nucleobases may be naturally occurring nucleobases. The naturally occurring nucleobases may be selected from the group consisting of cytosine, guanine, adenine, thymine, and uracil. The nucleobases may be un-natural nucleobases. Un-natural nucleobases may be defined as a nucleobase which does not occur in nature or has not been extracted from natural sources. An un-natural nucleobase may also be defined as a natural nucleobase which has undergone chemical derivatisation, functionalization or modification.The nucleic acid may be single stranded (ss) or double stranded (ds). The nucleic acid may be deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), preferably RNA. The nucleic acid may be ssDNA or dsDNA. The nucleic acid may be ssRNA or dsRNA.In some embodiments, the nucleic acid may be a RNAi molecule, otherwise referred to herein as “RNAi”. In other words, the nucleic acid may be a nucleic acid which triggers RNA interference (RNAi), typically wherein the RNA is dsRNA. In some embodiments, the RNA may be siRNA. The RNA may be a modified RNA or non-modified RNA. In some embodiments, the RNA may be an mRNA.In some embodiments, the nucleic acid may be a plasmid. In some embodiments, the nucleic acid may comprise a mixture of nucleic acids. In some embodiments, the nucleic acid may be a mixture of siRNAs.The CND nucleic acid complex may comprise a ratio of CND to nucleic acid of about 0.25:1 to about 50:1 , optionally from about 0.5:1 to about 45:1 , preferably from about 1 :1 to about 40:1 , more preferably from about 1.5:1 to about 30:1 , most preferably from about 2:1 to about 20:1 , or from 7.5:1 to 15:1 , for example about 10:1. The CND nucleic acid complex may comprise a ratio of CND to nucleic acid of >0.25:1 , or at least about >0.5:1 , or > 0.75:1 , . The present inventors found that the binding of the CND to the nucleic acid was particularly effective at a ratio of >1 :1 , or >2:1 , or > 3:1 , or > 4:1 , or > 5:1 , or >7.5:1 , or >10:1. In some embodiments, the ratio of CND:nucleic acid may be between 1 :1 to 3:1 (e.g., where the nucleic acid is a plasmid). In some embodiments, the ratio of CND:nucleic acid is between 1 :2 to 2:1 (e.g., where the nucleic acid is an mRNA). In some embodiments, the ratio of CND:mRNA is between 2:1 to 4:1 (e.g., where the nucleic acid is an siPOOL dsRNA)Without wishing to be bound to a particular theory, the present inventors believe that a ratio of CND compound to nucleic acid of >1 :1 to about 40:1 , more preferably from about 1.5:1 to about 30:1 , most preferably from about 2:1 to about 20:1 , or from 7.5:1 to 15:1 , for example about 10:1 , particularly for nucleic acids, e.g., dsRNA, having lengths of at least 50, or at least 80, or at least 150 nucleotides, results in improved binding and association of the CND to the nucleic acid whilst also resulting in the nucleic acid being encapsulated by the CNDs to a great extent since the CNDs may more effectively surround or shield the nucleic acids from degradation. This may result in an improved protection of the nucleic acid to degradation.Also disclosed herein is a method of making a CND nucleic acid complex disclosed herein, said method comprising(i) providing a CND compound as disclosed herein (i.e. , according to the first or third aspect), and(ii) contacting the CND compound with a nucleic acid as disclosed herein. The CND and the nucleic acid may be contacted in a suitable ratio as disclosed above.The contacting step may occur at any suitable temperature. In some embodiments, the contacting step occurs at a temperature between 0 °C and 40 °C, or between 15 °C and 25 °C. The contacting step may occur for any suitable length of time. In some embodiments, the contacting step may occur for at least 1 minute, or at least 5 minutes, or at least 30 minutes, or at least or equal to 40 minutes. In some embodiments, the contacting step occurs for less than a day, or less than 120 minutes, or less than 60 minutes. In preferred embodiments, the contacting step occurs in an aqueous solvent. In some embodiments, the aqueous solvent is pure water. In some embodiments, the aqueous solution comprises a buffer (e.g., MES). In some embodiments, the aqueous solution comprises an additive, e.g., glycerol.Protection of nucleic acids with carbon nanodots, particularly in the insect gutIn another aspect of the present invention, there is provided a use of the CND compound as disclosed herein, or a CND-NA complex as disclosed herein, for protecting a nucleic acid from degradation. The nucleic acid may be as otherwise disclosed herein.Defined in another way, also disclosed herein, is a method of protecting a nucleic acid from degradation, said method comprising contacting a CND disclosed herein (e.g., as defined in the first and third aspect) with a nucleic acid. The nucleic acid may be as otherwise disclosed herein.Degradation may be defined as the chemical decomposition, chemical breakdown, or structural modification of a substance. For example, degradationof a nucleic acid may be the breaking of chemical bonds, particularly, the phosphodiester backbone, within the nucleic acid. Protection of a nucleic acid from degradation may be defined as decreasing the amount degradation of the nucleic acid or preventing the degradation of the nucleic acid. Protection of a nucleic acid from degradation may also be defined as preventing or reducing the decrease in the efficacy of the nucleic acid. Alternatively, protection may be defined as the prevention or reduction of structural changes to the nucleic acid.In some embodiments, the degradation of the nucleic acid may be pH degradation, UV degradation, photodegradation, temperature degradation, or nuclease degradation, or a combination thereof.In some embodiments, the CND compounds protect the nucleic acid against nuclease degradation. Nucleases may be enzymes that degrade nucleic acids. Nucleases may be hydrolase enzymes. Nucleases may specifically target the phosphodiester bonds between the nucleotides in the nucleic acids, resulting in the breakdown of the nucleic acid structure.The nuclease may be an exonuclease or an endonuclease. The nuclease may be a non-specific nuclease. Non-specific nucleases may degrade both DNA and RNA without exhibiting pronounced base preference. The nuclease may be a non-specific nuclease which degrades both DNA and RNA. The nuclease may degrade both DNA and RNA. The nuclease may degrade both single and double stranded DNA and RNA. The nuclease may be a non-specific endonuclease which degrades both DNA and RNA. The nuclease may be a broad-spectrum nuclease. A broad-spectrum nuclease may degrade all forms of DNA and RNA. The nuclease may be a broad-spectrum endonuclease. The nuclease may be a non-specific nuclease, for example Benzonase, salt-active nuclease (SAN), and endonuclease from Serratia marcescens. The nuclease may be a nuclease found in the insect gut (e.g., of any insect disclosed herein). The nuclease may be any nuclease found in a plant cell (e.g., of any plant cell disclosed herein).The protection from degradation may be protection from multiple different nucleases. In some embodiments or examples, the nucleases may be selected from the group consisting of micrococcal nuclease (MNase), SAN, Benzonase, ribonuclease (RNase), deoxyribonuclease (DNase), salt-tolerant DNA and RNA nuclease, an endonuclease from Serratia marcescens, and a genetically engineered endonuclease from Serratia marcescens.The protection of the nucleic acid may be protection from pH degradation. The CND compounds may provide protection of nucleic acids to degradation at any pH, including an acidic or alkaline pH. Preferably, the CND compounds provide protection to degradation at alkaline pH. In some embodiments, the pH is greater than about 6, optionally greater than about 6.5, optionally greater than about 7, preferably greater than about 8, or greater than about 9, or greater than or equal to about 10. The CND compounds may provide protection of nucleic acids to degradation at an alkaline pH. The CND compounds may provide protection of nucleic acids to degradation at a pH of between about 6 to about 14, optionally about 7 to about 13, preferably about 8 to about 12. In some embodiments, the nucleic acid is protected from pH degradation in the presence of a cation, e.g., Mg2+and / or protected from pH degradation at elevated temperatures (e.g., a temperature above 50 °C, or above 75 °C, or between 50 °C and 150 °C, e.g., or between 70 °C and 125 °C, or between 75°C and 120 °C, e.g., about 95 °C) CND compounds of the disclosure were found to protect nucleic acids from RNA hydrolysis even in very harsh conditions (i.e., at an alkaline pH, in the presence of Mg2+, and at a temperature of 95°C )The CND compounds may provide protection of the nucleic acid from degradation in an insect, e.g., in the insect gut. The protection may be in an insect gut. The CND compounds may provide protection of the nucleic acid from nuclease degradation in an insect. The CND compounds may provide protection of the nucleic acid from nuclease degradation in an insect gut. The nuclease may be an insect nuclease. The nuclease may be an insect gut nuclease.The present inventors found that the CND compounds of the present disclosure were particularly effective at protecting nucleic acid from nuclease degradation at a pH of greater than 6, optionally at an alkaline pH. When using nucleic acids for RNAi for pest management, the nucleic acids may be ingested by insects and enter the gut of an insect which contains an alkaline solution and nucleases. Protection of nucleic acids to nuclease degradation at alkaline pH is therefore important for RNAi pest management. The CND compounds of the present disclosure were found to protect the nucleic acids from degradation, even in the presence of nucleases at an alkaline pH.The CND compounds may provide protection of nucleic acids to degradation by nucleases at a pH of greater than about 6, optionally greater than about 6.5, optionally greater than about 7, preferably greater than about 8. The CNDs may provide protection of nucleic acids to degradation at a pH of between about 6 to about 14, optionally about 7 to about 13, preferably about 8 to about 12. The CNDs may provide protection of nucleic acids to degradation at a pH of less than about 14, optionally less than about 13.5, optionally less than about 13, optionally less than about 12.5, optionally less than about 12, optionally less than about 11 .5, optionally less than about 11 , optionally less than about 10.5, optionally less than about 10.The CND compounds may provide protection of nucleic acids to degradation by nucleases in the insect gut. The insect gut may be at a pH of greater than about 6, optionally greater than about 6.5, optionally greater than about 7, preferably greater than about 8. The insect gut juice may be at a pH of between about 6 to about 14, optionally about 7 to about 13, preferably about 8 to about 12. The insect gut may be at a pH of less than about 14, or less than about 13.5, or less than about 13, or less than about 12.5, or less than about 12, or less than about 11 .5, or less than about 11 , or less than about 10.5, or less than about 10.The insect may be an Apterygote or a Pterygote. The insect may be selected from the group consisting of Lepidoptera, Hemiptera, Coleoptera, Orthoptera,Diptera, Megaloptera, Trichoptera, Siphonaptera, Neuroptera, Isoptera, Blattodea, Hymenoptera, Psocoptera, Dermaptera, and Acari. The insect is preferably selected from the group consisting of a Lepidoptera, Hemiptera, Coleoptera, Orthoptera, Hymenoptera, Acari, and Diptera. The insect is most preferably a Lepidoptera or Hemiptera.In some embodiments, the insect is of the superfamily Aleyrodoidea. In some embodiments, the insect is of the family Aleyrodidae.In some embodiments, the insect may be of the genus selected from Alhalia, Anopheles, Apis, Bactericerca, Bactrocera, Blatella, Bombyx, Culex, Diabrotica, Epiphyas, Galleria, Glossina, Gryllus, Helicoverpa, Heliothis, Locusta, Manduca, Monochamus, Myzus, Nezara, Nilaparvata, Noctua, Oncoeltus, Ostrinia, Periplaneta, Pieris, Phyllotreta, Plutella, Reticulitermes, Rhodnius, Schistocerca, Spodoptera a, Tribolium or Zophobas.The insect may be selected from the group consisting of Alhalia rosae, Anopheles gambiae, Apis mellifera, Bactericerca cockerelli, Bactrocera dorsalis, Blatella germanica, Bombyx mori, Culex pipiens quinquefasciatus, Diabrotica virgifera, Epiphyas postvittana, Galleria mellonella, Glossina morsitans, Gryllus bimaculatus, Helicoverpa armigera, Heliothis virescens, Locusta migratoria, Manduca sexta, Monochamus alternatus, Myzus persicae, Nezara viridula, Nilaparvata lugens, Noctua comes, Oncoeltus fasciatus, Ostrinia furnacalis, Periplaneta americana, Pieris brassicae, Pieris rapae, Phyllotreta striolata, Plutella xylostella, Reticulitermes flavipes, Rhodnius prolixus, Schistocerca americana, Schistocerca g regaria, Spodoptera exigua, Spodoptera frugiperda, Spodoptera littoralis, Spodoptera litura, Tribolium castaneum, and Zophobas atratus.The insect may be selected from the group consisting of a caterpillar, aphid, weevil, locust, mosquito, fruit fly, moth (e.g., wax moth, diamondback moth or lesser yellow underwing moth), butterfly (e.g, cabbage white butterfly, forexample, a large white butterfly or a small cabbage white butterfly), wheat stem sawfly, wheat curl mite, sunflower headclipping weevil, cotton boll weevil, stalk borers, spider mites, pale western cutworm, grasshopper, false chinch bug, corn earworm, European corn borer, black grass bug, armyworm, army cutworm, amauromyza karli, alfalfa weevil, cockroach, turnup sawfly, swede midge, saddle gall midge, wheat bulb fly, yellow cereal fly, pea midge, orange wheat blossom midge, onion fly, fruit fly, gout fly, leatherjackets, carrot fly, cabbage root fly, brassica pod midge, bean seed fly, beet leaf miner, brassica leaf miner, bruchid beetle, cabbage seed weevil, cabbage stem flea beetle, leafhopper, stink bug, cabbage stem weevil, chafer grub, Colorado beetle, pygmy beetle, pea and bean weevil, pollen beetle, rape winter stem weevil, wireworms, bird-cherry oat aphid, black bean aphid, buckthorn-potato aphid, current-lettuce aphid, grain aphid, lettuce root aphid, pea aphid, peach-potato aphid, cabbage moth, cutworm moth, garden pebble moth, pea moth, and swift moth. The insect may be selected from the group consisting of a caterpillar, aphid, whitefly, weevil, locust, mosquito, and fruit fly.In some embodiments, degradation of the nucleic acid may be UV degradation or photodegradation.In some embodiments, the protection from degradation of the nucleic acid may be temperature degradation. In some embodiments, the nucleic acid is protected from degradation at temperature above 50 °C, or above 75 °C, or between 50 °C and 150 °C, e.g., or between 70 °C and 125 °C, or between 75°C and 120 °C, e.g., about 95 °C.Delivery of nucleic acids to insectsIn another aspect of the present invention, there is provided a use of a CND compound as disclosed herein (e.g., in accordance with the first or third aspect), or a CND-NA disclosed herein, for delivering a nucleic acid to an insect, e.g., an insect cell, more preferably an insect gut epithelial cell. In some embodiments,this is achieved by feeding the insect a CND-NA complex as disclosed herein. In other words, the insect ingests the CND-NA complex.Defined in another way, also disclosed herein is a method of delivering a nucleic acid to an insect, said method comprising feeding an insect with a CND-NA complex as disclosed herein.The nucleic acid may be as disclosed elsewhere herein, e.g., a dsRNA or RNAi. This is useful for pest management. The insect may be as disclosed elsewhere herein.For both the method and use, the CND-NA complex may be delivered to the insect gut, e.g., into an insect gut cell, more preferably an insect gut epithelial cell. For both the method and the use, the CND-NA complex may be taken up into an insect cell. In some embodiments, the CND-NA complex may be applied to a plant, wherein the insect then ingests the CND nucleic acid complex and / or the plant. In some embodiments, the CND-NA complex is applied to the leaf, wherein the insect ingests the leaf. In some embodiments, the CND-NA complex is applied to the root and / or by foliar uptake into the plant phloem sap, wherein the insect ingests the phloem sap. The method may be an in-vitro method or in- vivo method. In some embodiments, the method is a non-therapeutic method.Delivery of nucleic acids to plantsIn another aspect of the present invention, there is provided a use of a CND compound as disclosed herein, or a CND-NA complex as disclosed herein, for delivering a nucleic acid to a plant cell. The nucleic acid may be as disclosed elsewhere herein.Also disclosed herein is a method of delivering a nucleic acid to a plant cell, said method comprising contacting a plant cell with a CND-NA complex as disclosed herein.Also disclosed herein is a method of delivering a nucleic acid to a plant cell, said method comprising providing a CND compound as disclosed herein. contacting the CND compound with a nucleic acid as disclosed herein to form a CND nucleic acid complex, and contacting the CND nucleic acid complex with a plant cell.The plant cell may be any suitable plant cell. In some embodiments, the plant cell is a plant root cell (e.g., a plant root cell of a seedling).In some embodiments, the contacting is by any suitable method. In some embodiments, the contacting is by spraying the CND nucleic acid complex onto the leaf of a plant (e.g., with a solution or suspension that comprises the CND nucleic acid complex). In other embodiments, the contacting is by dipping the plant into a solution or suspension that comprises the CND nucleic acid complex. In other embodiments, the contacting is contacting the roots of a plant with a solution or suspension that comprises the CND nucleic acid complex.In some embodiments, the plant cell may be a plant cell from a flowering plant. The plant cell may be an Angiosperm. The plant cell may be a Dicotyledon plant cell. Dicotyledons may also be termed Dicots, Dicotyls or Eudicots. The plant cell may be a Asterid or a Rosid.The plant cell may be of the order selected from the group consisting of Alismatales, Ranunculales, Proteales, Trochodendrales, Buxales, Gunnerales, Dilleniales, Saxifragales, Vitales, Fabales, Sosales, Fagales, Cucurbitales, Oxalidales, Malpighiales, Celastrales, Zygophyllales, Geraniales, Myrtales, Crossosomatales, Picramniales, Malvales, Brassicales, Huerteales, Sapindales, Berberidopsidales, Santalales, Caryophyllales, Cornales, Ericales, Aquifoliales, Asterales, Escalloniales, Bruniales, Apiales, Dipsacales, Paracryphiales,Solanales, Lamiales, Vahliales, Gentianales, Boraginales, Garryales, Metteniusales, and Icacinales.The plant cell may be of the family selected from the group consisting of Araceae, Solanaceae, Brassicaceae, Cucurbitaceae, Asteraceae, Liliaceae, Boraginaceae, Caryophyllaceae, Iridaceae, Ericaceae, Ranunculaceae, and Campanulaceae. The plant cell is preferably of the family selected from the group consisting of Araceae, Solanaceae, Brassicaceae, and Cucurbitaceae. The plant cell may be a Solanaceae plant cell. The plant cell may be a Brassicaceae plant cell. The plant cell may be a Cucurbitaceae plant cell. The plant cell may be of the genus Brassica, for example a Brassica napus. The plant cell may of the genus Cucurbita, for example a Cucurbita pepo. The plant cell may of the genus Nicotiana (e.g., a tobacco plant cell), for example, a Nicotiana benthamiana plant cell.In some embodiments, the plant may be a vegetable or a crop. In some embodiments, the plant may be a tobacco plant or duckweed.In some embodiments, the plant is a seedling.In some embodiments, the plant or plant cell is a Viridiplantae. In some embodiments, the plant or plant cell is an algae (aquatic plant), or a land plant (e.g., hornworts, liverworts, mosses, lycophytes, fems, gymnosperms and angiosperms, preferably angiosperms, even further preferably wherein the angiosperm is selected from a basal angiosperm, magnoliid, monocot or dicot.In another aspect of the present invention, there is provided a use of a carbon nanodot for delivering a nucleic acid to a plant cell, optionally wherein: a) The nucleic acid is dsRNA or RNAi and / or b) The plant cell is a Dicot plant, optionally Solanaceae, Brassicas or Cucurbits, for example Nicotiana benthamiana, or the plant cell is a monocot.The present inventors found that CND compounds disclosed herein could be used to deliver nucleic acids, such as RNAi, efficiently to a plant cell.Also disclosed herein is the use of a CND compound for delivery of a nucleic acid to a post-harvest flower or post-harvest vegetable, preferably wherein the nucleic acid is a nucleotide. Post-harvest flower or post-harvest vegetable may otherwise be referred to in the art as a cut or picked flower, or a cut or picked vegetable. The CND compounds disclosed herein may be used for delivery of a nucleotide for one or more of (i) delayed senescence, (ii) prolonged shelf-life, and / or (iii) prevention of pests. This is beneficial as post-harvest flowers or postharvest vegetables may be stored for longer periods of time, may have a more attractive appearance for longer (e.g., due to delayed senescence).Also disclosed herein is a method of delivering a nucleotide to a post-harvest flower or post-harvest vegetable, said method comprising contacting a plant cell with a CND nucleotide complex as disclosed herein, and contacting the CND nucleotide complex with a post-harvest flower or post-harvest vegetable.In both the use and the method as defined above, the CND nucleotide complex may be added to water that is fed to the post-harvest flower or post-harvest vegetable. In some embodiments, the CND nucleotide complex is added to the water at a concentration of 0.01 mg / mL to 50 mg / ml, more preferably between 0.025 mg / ml to 10 mg / ml, more preferably from 0.03 mg / ml to 5 mg / ml, more preferably from 0.05 mg / ml to 0.5 mg / ml, e.g., 0.15 mg / ml. In some embodiments, the ratio of CND to nucleotides to form the CND nucleotide complex is between 0.25:1 to 50:1 , or from 0.25:1 to 5:1 , or from 0.5:1 to 2:1 , for example, 1 :1 .In some embodiments, the amount of water fed to the post-harvest flower or postharvest vegetable is from 50 ml to 1 L, or from 100 ml to 500 ml, e.g., 300 ml. The nucleotides may be DNA or RNA nucleotides. In some embodiments, the nucleotide is selected from GTP, ATP, UTP, CTP or TTP, for example, ATP.ExamplesCND core and CND compounds - Synthesis and AnalysisSynthesis of the CND-coreAn amino sugar (5.58 mmol) selected from glucosamine, galactosamine or mannosamine (e.g., 1 g of glucosamine) was dissolved in distilled H2O (20 mL) in a 100 mL round flask. An amino acid (6.97 mmol) selected from alanine, glycine, glutamine, aspartic acid, serine, leucine, lysine, threonine, tyrosine, methionine, glutamic acid, tryptophan, arginine, cysteine, valine, isoleucine or leucine (e.g., 0.62 g of beta-alanine) was then added to the solution and stirred at 300 rpm for 30 min to ensure homogeneity. The solution was reacted in reflux, connecting a glass condenser column and placing the flask in an oil bath at 175° Celsius for 4 hours. After the reflux synthesis, a viscous brown residue was obtained which was taken up in distilled H2O (10 mL). The crude solution was purified via centrifuge filtration (10 kDa MWCO spin filter, GE Healthcare Life Sciences VIVASPIN, 4500 rpm, 30 min). The supernatant was concentrated in vacuo to yield a viscous brown syrup. The sample was then dialysed in distilled H2O for 24 hours employing 500 Da dialysis membranes. The resulting solution was concentrated in vacuo.PEI-functionalizationSynthesis of the CND compound was possible via conjugation of branched polyethyleneimine (PEI) on the CND core by carbodiimide coupling. CND core (1 g) was dissolved in H2O (25 mL) using a 100 mL round bottom flask and then, 440 mg of 1 -ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, 2.88 mmol) was added to the solution and sonicated for 30 min. The solution was stirred at 300 rpm, 1 g of lyophilized PEI with a molecular weight of between 500 and 25000 (e.g., 5,000 Mw - Lupasol G100 from BASF) was added and the solution wasreacted overnight at room temperature. The sample was then dialyzed in distilled H2O for 24 hours employing 500 Da dialysis membranes. The resulting solution was concentrated in vacuo.The CND compounds can be generated reproducibly and easily. This is attributed to the functionalization of the PEI after carbonisation such that the surface properties of the CND compounds are consistent from batch to batch. Advantageously, the CND compounds are non-toxic (e.g., made from non-toxic starting materials), are eco-friendly and pose minimal contamination risks. The CND compounds can be manufactured at low cost, are scalable, are easy to apply, and are water-soluble.Synthesis of comparative CNDsComparative CNDs were formed in a one-pot synthesis according to the following method: CNDs were prepared by heating branched PEI (Mw - 5000) in a solution of chloroform and methanol and heated to 155 °C using microwave irradiation. In the comparative method, there was no further second functionalization step of the CND coreCharacterizationSurface Analysis by XPSThe CND compounds of the disclosure have a unique surface analysis as demonstrated by XPS. The nitrogen, oxygen and carbon content of an exemplary CND compound, determined by XPS, is shown in Figure 22. The high nitrogen content at the surface of the CND compound is believed to contribute to improved affinity, binding and nuclease protection of nucleic acids to the CND compound. As shown in Figure 7, the surface composition dominated by amine groups derived from PEI surface conjugation.For the CND core, (i.e., prior to functionalization), the surface is dominated by amine, carboxyl and hydroxyl groups. This reflects the amino acid precursors used to make the CND core in combination with an amino sugar. This is demonstrated in Figure 6.A comparative CND formed by heating PEI in a one-pot process has different surface characteristics as demonstrated by XPS. Unlike the example CND compounds which are dominated by sp3hybridization at the surface due to functionalization with PEI, the composition of the comparative CNDs is dominated by sp2hybridization indicating both aromatization and carbonisation of PEI precursor. Surface composition was dominated by hydroxyl groups resulted from the carbonisation of PEI when heated in solvent (see Figure 8, Bottom).CytotoxicityCND compounds of the invention, e.g., formed using the methods above, were found to be more viable and less cytotoxic than the comparative CNDs (see Figure 9 and related Figure caption).Examples - Biological Applications and ResultsBiological importance- backgroundAs mentioned in the background, many insect pests have physiological barriers that hinder the use of RNAi and are extremely challenging to overcome. The most common barriers are the presence of non-specific nucleases that are particularly active in the typical alkaline pH found in the gut content of these insects. This includes, but not limited to, some of the worst pests currently affecting our crops such as Lepidoptera and Hemiptera. Typical pH found in the gut is between 8- 11. Despite this might vary depending on the order, Lepidoptera pests tend to conserve a pH ~10 across species, to mention potentially the most problematic insect pest spread in Europe .CND-dsRNA bind and releaseThe CND compound and nucleic acid formulation, i.e., to form a CND-NA complex, can be optimised based on the RNA seguence, length, and type to maximize binding capacity. In Figure 10, we show some examples of CD:RNA ratios that can be usedThe CND compounds of the disclosure were also found to be compatible withdifferent RNA molecules of different types and lengths.Example CND compounds were also shown to bind to a GFP plasmid and mRNA expressing GFP, provided by KeyGene N.V. It was found that the CND compounds could bind the plasmid and mRNA with similar efficiency to a control plasmid and 22bp dsRNA. Figure 25 shows A) a gel showing the GFP-plasmid bind and release to the CND compounds, B) a gel showing mRNA bind and release to the CND compounds; C) a gel demonstrating the binding efficiency of the plasmid with the CND compound with different ratios of CND: plasmid where #1 = 1 :8, #2 = 1 :4, #3 = 1 :2, #4 = 1 :1 , #5 = 2:1 , #6 - 4:1 , #7 = 8.1 ; D) a gel demonstrating the binding efficiency of the mRNA with the CND compound with different ratios of CND: mRNA where #1 = 1 :8, #2 = 1 :4, #3 = 1 :2, #4 = 1 :1 , #5 = 2:1 , #6 - 4:1 , #7 = 8.1 ; E) a gel demonstrating release of the plasmid from the CND compounds using an alternative release reagent (17.5 mM heparin at RT) and F) a gel demonstrating release of the mRNA from the CND compounds using an alternative release reagent (17.5 mM heparin at RT). From these results, an optimal ratio of CND:plasmid between 1 :1 to 3:1 , and an optional ratio of CND:mRNA between 1 :2 to 2:1 , was identified.It was similarly demonstrated that CNDs could also bind and release siPOOLs with similar efficiency to 22bp dsRNA. The siPOOL used was a commercially available siPOOL against the human GAPDH gene containing around 30 predefined siRNAs. The siPOOL was sourced from siTOOLs Biotech. The bind and release of the siPOOL to the CND compound is demonstrated in Figure 26 (A - showing gel and B - showing conditions). Once bound to the CNDs, the fluorescent from SYBR gold gel stain is quenched and the siPOOL dsRNA “disappears” but reappears after release using a verified release reagent and heat treatment. Figure 27 (A -conditions and B - gel) shows binding consequent gel retardation of siPOOL dsRNA as the ratio of CND / RNA increases and Figure 28 (A -gel and B - conditions) shows the release of the siPOOL dsRNA without heat with the alternative release reagent heparin (17.5 mM) at room temperature, both at a low (1 :1 ) and high (1 :8) ratio of CND / siPOOL RNA. From these results, an optimal ratio of CND:siPOOL ratio between 2:1 to 4:1 was identified.Nuclease ProtectionThe present inventors demonstrated protection of 22bp, 60 bp, and 438bp dsRNA using example CND compounds in the presence of the three commercial nucleases (Pierce, Micrococcal, and SAN nucleases) from pH 7 to 11. In particular, we proved that our carbon-nanodot (CND) compound provides protection of the nucleic acid from one or more non-specific nucleases, thermostable, and pH persistent e.g., Pierce nucleases, Micrococcal Nuclease (MNase). In Figure 13 , we show that our CDs can bind 93.9% of the naked RNA and can protect 83.4% of the RNA bound for a total of 78.3% of the naked RNA (quantification made via Image J and based on the average of the triplicates).In particular, we show protection against the Pierce™ Universal Nuclease (PUN) (Figure 12 and 15) which is a highly pure endonuclease typically used during cell lysis that degrades all forms of DNA and RNA, enhancing protein extraction by reducing lysate viscosity. It has 100-fold greater activity than DNase I, is effective across a wide range of temperatures and pH levels, and is free of protease activity. These results are indicative of nucleases that a biopesticide would encounter in the real environment.Nuclease Protection in Lepidoptera gutEncouraged by the results using non-specific in vitro nucleases we focused on the demonstration of protection of 60 bp dsRNA using our CND compound platform in the presence of alkaline gut contents, of three Lepidoptera species (Pieris Brassicae, Noctua Comes and Galleria Mellonella) which naturally contains non-specific nucleases. An agarose gel-shift assay image is shown for Pieris brassicae (Figure 16), Noctua comes (Figure 17) and Galleria mellonella (Figure 18). In Figure 16, we show how we can protect between 43 and 47.5% of the free RNA against Pieris brassicae gut content; in Figure 17 we show that we can protect between 56 and 69% of the free RNA against Noctua comes gut content. We also show protection against Galleria Mellonella gut (GmG) content .showing that it is possible to tune the formulation for an optimal outcome (e.g.,optimising the CNDs-NA binding) (Figure 18).Results: Delivery to insect cellsFurthermore we have tested the delivery of RNAi using our CND compounds into Lepidoptera cells These preliminary results indicate that the dsRNA in the presence of CND compounds can enter lepidoptera cells effectively. This result represents a major step forward for RNA-based biopesticide applications.Spodoptera exigua is one of the best-known agricultural pest insects, also known as beet armyworm. We tested the delivery / cellular uptake of a 60 bp dsRNA into Spodoptera exigua cells. In the control group, where the cells were incubated only with fluorescently labeled dsRNA, negligible dsRNA delivery occurred without the CND compounds (Figure 19). However, in the presence of CND compounds, dsRNA was successfully delivered into the cells. These results suggest that the CND compounds can significantly enhance the cellular uptake of dsRNA in pest insects. This indicates that our CND compound can protect RNA from degradation by nucleases and pH variations, ensuring successful delivery.Results: Delivery of dsRNA to plant cellsThe present inventors demonstrate proof-of-concept of dsRNA delivery to plant cells using example CND compounds disclosed herein. Figure 20 shows that chlorophyll production can be silenced (i.e., as shown by white patches after application of CNDs) through expression of dsRNA which is delivered inside the plant cell.Results: Delivery of dsRNA into Hemiptera insects (aphids)A CND / RNAi complex was fed to aphids. Figure 23 shows A) the mortality of aphids feeding on the CND / dsRNA complex and B) the reduction in fecundity of aphids feeding on a CND / dsRNA complex. This data provides further evidence that CND compounds of the disclosure aid delivery of nucleic acids into insects.Results: Cellular uptake of nucleotides in cut flowers, to prolong shelf life (reduce senescence), and boost blooming.The study investigated the cellular uptake of nucleotides in cut flowers to prolong shelf life and enhance blooming. The solution of CND compounds at 0.15 mg / mL and ATP at 0.213 mg / mL significantly boosted blooming and extended the life of roses and spray carnations up to three weeks. The data indicated that CND- nucleotide complex greatly improve the guality and longevity of cut flower blooms compared to a commercially available flower care product (see Figure 21 ).Results: Delivery of dsRNA into seedling rootsThe CND compounds of the disclosure are shown to aid uptake of dsRNA (fluorescent labelled Cy3 labelled NbMbCHLH 22bp dsRNA) into Nicotiana benthamiana seedling roots. The treatment groups were as follows:Sample 1 - Water only (negative control)Sample 2 - CNDs onlySample 3 - dsRNA onlySample 4 - CNDs + dsRNAThe seedlings were immersed in the treatment sample and then imaged using confocal microscopy.The results are shown in Figure 24. A) shows the confocal microscopy image of Sample 1 - water control, B) shows the confocal microscopy image of Sample 2 - CND only control, C) shows the confocal microscopy image of Sample 3 - dsRNA only control and D) shows the confocal microscopy image of Sample 4 - CND + dsRNA.Samples 1 and 2 had no signal, ruling out autofluorescence or CND fluorescence as potential sources. Sample 3 showed fluorescence only on the surface, indicating limited or no uptake without CNDs. Sample 4 showed strong internalfluorescence, signifying that the CND compounds of the disclosure facilitated uptake of the dsRNA into the root tissues.Although Cy3 is known to emit in the orange-red spectrum, the observed green signal was a result of software pseudo coloring. The emission was collected from 570 nm onward which is consistent with Cy3’s emission range.All samples were imaged used the same gain, laser power and exposure to allow for direct comparison.Autofluorescence, often caused by chlorophyll or plant phenolics, was not detected in any control sample, likely due to the lack of chloroplasts in root tissues and the unsuitable excitation / emission range used for lignin or flavonoids. In the study, CNDs were effective in aiding dsRNA internalization without requiring direct visualization of the CNDs themselves.In summary, the CND compounds of the present invention appear to significantly improved the uptake of Cy3-labelled dsRNA into Nicotiana benthamiana roots. Confocal microscopy confirmed the internal localization of the labelled dsRNA only in the presence of CND compounds, while the controls confirmed the absence of autofluorescence and a non-specific signal. This study further supports the use of the CND compounds of the disclosure in a plant RNA delivery system. This can be used for gene-silencing or functional assays.Conclusions, Impact on Innovation and Technological AdvancementsThese novel findings have profound implications for biotechnology and the market. In the realm of biotechnology, the ability to protect and effectively deliver dsRNA using CNDs represents a significant breakthrough. This advancement opens up new avenues for RNA interference (RNAi)-based biopesticide applications. By overcoming the physiological barriers posed by insect pests, such as non-specific nucleases and alkaline gut environments, our technology can enhance the precision and efficiency of pest management strategies. Thiscan lead to the development of more targeted and sustainable biopesticides, reducing the ecological impact associated with traditional chemical pesticides.From a market perspective, the successful protection and delivery of dsRNA using our CD platform can revolutionize the agricultural sector. Farmers and agricultural companies are constantly seeking effective and sustainable solutions to manage pest populations and protect crops. Our technology offers a competitive edge by providing a robust and environmentally friendly alternative to chemical pesticides. The potential for broad-spectrum applicability across various pest species, including Lepidoptera and Hemiptera, makes it an attractive option for diverse agricultural markets.Furthermore, the versatility of our CND compound platform in protecting different RNA sequences, lengths, and types ensures that it can be customized for various agricultural needs. This adaptability can lead to the development of tailored biopesticide solutions for specific crops and pests, enhancing crop yield and quality. The reduction in reliance on chemical pesticides not only aligns with increasing regulatory pressures for safer agricultural practices but also meets consumer demand for sustainably produced food.Overall, our findings position the applicant as a leader in the biopesticide market, with the potential to drive significant innovation and technological advancements in agricultural biotechnology. The scalability and effectiveness of the CND compounds described herein make the widespread adoption of RNAi-based biopesticides more likely, fostering a more sustainable and productive agricultural industry.Materials and Methods - Surface analysis by XPSChemicals were purchased and used without further purification. Concentration centrifugation tubes were GE Healthcare Life Sciences VIVASPIN 20 with a 10 kDa molecular-weight cut off (MWCO) filter. 0.5-01 kDa MWCO Biotech Cellulose Ester membranes were used for dialysis. Extracts were concentrated under reduced pressure using both a Buchi rotary evaporator at a pressure of 15 mmHgat 35° Celsius. X-ray photoelectron spectroscopy (XPS) was performed using a Kratos Axis Ultra DLD system, using a monochromatic Al Ka X-ray source operating at 140 W power (10 mA x 14 kV). Data was collected with pass energies of 160 eV for survey spectra, and 20 eV for the high-resolution scans with step sizes of 1 eV and 0.1 eV, respectively. Samples were either pressed onto doubled sided Scotch tape (type 665) or for viscous samples, spread onto a UV cleaned Si wafer. The system was operated in the Hybrid mode, using a combination of magnetic immersion and electrostatic lenses, and acquired over an area of approximately 300x700 pm2. A magnetically confined charge compensation system was used to minimize charging of the sample surface, and all spectra were taken with a 90° take of angle. A base pressure of ~ 1 '1 O’9Torr was maintained during the collection of the spectra. Data were analysed using CasaXPS (v2.3.23) after subtraction of a Shirley background and using modified Wagner sensitivity factors as supplied by the manufacturer.Materials and Methods - CND compounds vs comparative CNDs unfractionated and fractionated nanoparticles - Cytotoxicity assayFractionation of Comparative CNDsComparative CNDs were fractionated using size exclusion chromatography to prepare fractionated aliquots 1 and 2. The crude solution was dialysed in distilled H2O for 24 hours employing 500 Da dialysis membranes and concentrated in vacuo. The solution was then passed through a size exclusion column (20 cm long, 1 cm wide) using Sephadex G25 resin and the first and second milliliter of fractionated material were collected and labeled aliquot 1 and 2, respectively. Aliquots were reduced in vacuo.Materials and Methods - Cytotoxicity AssayMammalian cellsHeLa Mammalian cells are cultured in vitro. They are then incubated with cell media with various concentrations of CNDs (both example and comparativeexample CNDs) and stained with AlamarBlue / Calcein to detect and measure toxicity (2 days + desired incubation time).Preparation of HeLa Cells for Cytotoxicity AssayOn day 1 , prior to the cytotoxicity assay, HeLa cells were prepared. The cell media was warmed in a water bath at 37°C for at least 20 minutes before starting. The volume of cell solution and cell media required to achieve the desired concentration was calculated (e.g., 20,000 cells per well in a 96-well plate equated to 200,000 cells per mL). The cell solution and media were mixed to prepare a 10 mL solution at the correct concentration. Using a reagent reservoir and a multichannel pipette, 100 pL of the prepared cell solution was added to each well of a 96-well plate. The plate was then incubated at 37°C with 5% CO2 for 24 hours. Any remaining cell solution was transferred to a new flask, topped up with fresh media, and incubated for future use, ensuring at least 24 hours before reuse.Incubation of HeLa Cells with CNDs for Cytotoxicity AssayOn day 2, The cell media and PBS were warmed in a water bath at 37°C for at least 20 minutes before starting.CND solutions (Example CNDs compounds and comparative CND fractionated and unfractionated aliquots) and cell media were transferred into 12 Eppendorf tubes to 50x desired working concentrations using serial dilutions (50x because final wells will contain 2 pL of CD solution and 98 pL of cell media). Example for 12 different concentrations spanning 0.049-100 pg / mL using a CD stock solution of 50 mg / mL:~10 mL of cell media were poured into a reagent reservoir and 98 pL were added into each well of the 96-well plate. Then, 2 pL of working solutions (or cell media for controls) into the corresponding wells (including repeats).Example plate set-up with 6 repeats per sample and 12 controls (S = sample):The 96-well plate was covered and incubated at 37°C, 5% CC for 24 hours.Staining and Measuring CytotoxicityOn day 3, prior to starting the staining procedure, the PBS buffer and cell media (without FBS) were pre-warmed in a water bath set to 37°C for at least 20 minutes. The staining solution was prepared by pipetting 9.47 mL of cell media (without FBS) using an electronic pipette, 500 pL of AlamarBlue using a P1000, and 29.8 pL of Calcein solution using a P200 into a 15 mL Falcon tube. The well plate was then removed from the incubator, and the media from each well was aspirated. Using a multichannel pipette and reagent reservoir, 100 pL of PBS was added to each well and then aspirated away. Subsequently, 100 pL of the prepared staining solution was pipetted into each well, and the plate was incubated at 37°C with 5% CO2 for 2 hours. After incubation, the multiwell plate was taken to the microplate reader. The plate’s lid was removed, and the plate was placed into the reader, ensuring correct orientation. The ‘Shyam’ program was initiated, and the wells containing samples and controls were highlighted. The program ran for approximately 2 minutes. The resulting data were exported to Excel, with the first table containing data for AlamarBlue followed by the table for Calcein solution. Further analysis was required to express the results as a percentage of the average control and as a percentage of the highest value,normalized to 100% maximum. Means for each concentration sample and the controls were calculated, excluding anomalies, to determine cell viability as a percentage of the control average.Materials and Methods - In vitro Nuclease protection assays Nuclease protection assays (carbon dot protection of nucleic acids from commercial nuclease degradation) consist of binding nucleic acids to carbon dots, treating with commercial nucleases, releasing the nucleic acids and visualizing by agarose gel electrophoresis.Samples and reagent preparation for nuclease protection assayThe CND compounds and nucleic acids were diluted to the required working stock concentration (e.g. CDs @ 1.25ug / uL and nucleic acids @ 125ng / uL for a 10:1 ratio of CNDs:nucleic acids) using filter sterile molecular biology grade ddH2O in sterilised Eppendorf tubes.Nucleases were diluted to 0.25 units / uL using the nuclease dilution buffer specific for each nuclease and kept on ice. EDTA was diluted to 50mM using ddFhO.2uL CNDs, 2uL nucleic acids and 2uL ddF were added to the side of each tube as appropriate, substituting extra ddF for reagents in control tubes so that each tube has the same volume (6uL) and concentration of reagents. Tubes were briefly spun down, vortexed, spun down again and incubated at room temperature for 40 minutes to allow binding (10:1 CNDs:dsRNA ratio).Induced Nuclease degradationAfter incubation 2uL of the correspondent pH buffer (e.g., pH 7-11 ) was added to the tube followed by 2uL 0.25 units / uL nuclease, 2uL Proteinase K (concentrated stock) and 2uL ddH2<D substituting extra ddH2<D for controls as above. After mixing, the tubes were incubated @ 37 °C for 10 minutes then 55 °C for 20 minutes. Tubes were quenched on ice once incubation was completed.Release of bound and protected dsRNA2 pL of 50mM EDTA was added to the tubes. The tubes were mixed and incubated on ice for 2 minutes. Then, at room temperature, 2uL 0.4% SDS and 4uL loading dye + SDS were added to the tubes. The tubes were mixed and Incubated at 95 °C for 20 minutes. Tubes were quenched on ice once incubation was completed.Materials and Methods - In vitro Nuclease protection assays for long RNAAt high pH and high temperature the longer dsRNAs were more prone to degradation by chemical hydrolysis during the final heat / SDS detachment step. To minimise this from happening, after the high pH / nuclease treatment the samples were neutralized by the addition of 0.75 ul of 0.5M HCI before proceeding to the EDTA treatment and the final heat / SDS detachment step.In vitro transcription of long dsRNATo create the 438 bp long dsRNA for RNAi targeting Pieris brassicae caterpillars, genomic DNA is first extracted from Pieris brassicae tissue using a commercially available DNA extraction kit, such as the Qiagen DNeasy Blood & Tissue Kit, following the manufacturer’s protocol. The target sequence is amplified via PCR using primers designed with T7 promoter sequences on both ends. The PCR product is then purified using a PCR purification kit, such as the QIAquick PCR Purification Kit.The purified PCR product serves as a template for in vitro transcription using a kit like the MEG Asch pt™ T7 Transcription Kit from Thermo Fisher Scientific. The transcription reaction is carried out according to the manufacturer’s instructions to produce RNA strands. These RNA strands are treated with RNase-free DNase I to remove the DNA template, followed by ethanol precipitation using lithium chloride or ammonium acetate for RNA purification.The purified RNA is resuspended in nuclease-free water, quantified using a spectrophotometer, and mixed in equimolar amounts for annealing by heating to 95°C for 5 minutes and then slowly cooling to room temperature. The resulting dsRNA is verified by agarose gel electrophoresis for integrity and size, and subsequently stored at -80°C until use.In vitro Nuclease protection assays for long dsRNAIn vitro Nuclease protection assays for 438 long dsRNA were performed as described above for general Nuclease protection assay with a 10:1 CNDs:dsRNA ratio, against Pierce Universal nuclease at pH 10.Materials and Methods - In vitro Alkaline environment protection assays for long dsRNARNA is prone to chemical hydrolysis at high pH and high temperature. To demonstrate CND protection against this physical degradation we performed a protection assay similar to the nuclease protection. dsRNA was bound to CNDs as before and then pH 10 buffer was added. The samples were heated to 95°C for 20 minutes to chemically degrade the free RNA controls then quenched on ice. The samples were then neutralized by the addition of 0.75ul of 0.5M HCI to prevent degradation during the subsequent heat / SDS step.Samples and reagent preparation for alkaline environment protection assayThe CNDs and nucleic acids were diluted to the required working stock concentration (e.g. CDs @ 1.25ug / uL and nucleic acids @ 125ng / uL for a 10:1 ratio of CNDs:nucleic acids) using filter sterile molecular biology grade ddF in sterilised Eppendorf tubes.Long dsRNA degradation at pH 112uL CNDs, 2uL nucleic acids and 2uL ddF were added to the side of each tube as appropriate, substituting extra ddF for reagents in control tubes so that each tube has the same volume (6uL) and concentration of reagents. Tubes were briefly spun down, vortexed, spun down again and incubated at room temperature for 40 minutes to allow binding (10:1 CNDs:dsRNA ratio).After incubation, 2uL of pH 11 buffer was added to the tube and followed by 6uL ddH2O substituting extra ddH2O for controls as above. After mixing, the tubes were incubated at 37 °C for 10 minutes then 90 °C for 20 minutes. Tubes were quenched on ice once incubation was completed.Release of bound and protected dsRNA2 pL of 50mM EDTA was added to the tubes. The tubes were mixed and incubated on ice for 2 minutes. Then, at room temperature, 2uL 0.4% SDS and 4uL loading dye + SDS were added to the tubes. The tubes were mixed and Incubated at 95 °C for 20 minutes. Tubes were quenched on ice once incubation was completed.Materials and Methods - dsRNA protection against Caterpillar gut content using CNDsCaterpillar gut content protection assays (carbon dot protection of nucleic acids from Lepidoptera gut content) consist of binding nucleic acids to carbon dots, treating with Lepidoptera gut content (e.g. Pieris brassicae, Noctua comes, andGalleria mellonella), releasing the nucleic acids and visualizing by agarose gel electrophoresis.Extracting Caterpillar gut contentA method for dissecting a caterpillar and isolating gut juice for in vitro testing involves placing a cabbage white caterpillar (Pieris brassicae) into a -20°C freezer for 10 minutes to anesthetize it. The caterpillar is then placed on a tissue, its body length and head width measured, and its head removed with spring scissors. The caterpillar is pinned to a wax-layered petri dish using a needle, and its cuticle is cut without piercing the gut, using dissection spring scissors under a stereomicroscope. The gut is separated from the cuticle and placed into an Eppendorf tube, where it is mashed with a pestle. 100 pL of RNase-free water is added, and the tube is centrifuged at 15000x g for 10 minutes. The supernatant is then transferred to a fresh Eppendorf tube, resulting in isolated gut juice. This juice, stored at -20°C, simulates the hostile environment of the caterpillar's gut for testing RNA protection by the CND compounds before whole insect trials.In vitro Caterpillar gut content protection assaysA method was developed to investigate CND protection from caterpillar gut juice using Proteinase K and to explore the effect of SDS. Initially, 12 PCR tubes were labeled to represent each sample. Each tube received 2 pL of 60 bp dsRNA, followed by 2 pL of CNDs in the designated tubes. Sterile water was added to each tube as specified. The tubes were spun in a microfuge to mix, and the RNA complex was allowed to form at room temperature for 30 minutes. Subsequently, 8.5 pL of pH buffer or gut juice was added to the relevant tubes, followed by a 1 - hour incubation at room temperature. Next, 2 pL of Proteinase K was added to each tube and incubated at 37°C for 10 minutes. For tubes requiring SDS, 3.5 pL of SDS was added, and the mixture was incubated at 37°C for an additional 10 minutes. The samples were then processed according to standard operating procedures for running an electrophoresis gel, imaging the gel, and analyzing thegel image. This protocol enabled the assessment of CND protection in a gut juice environment and the role of SDS in RNA release.Materials and Methods - Running samples on gel-shift assayAll samples were run on a TBE 2% agarose gel at 100V for ~40min. The ladder used as reference was either the dsRNA ladder or the 1 Kb+ ladder from NEB, used according to manufacturer guidelines. Gels were imaged on the UVP Biospectrum Imaging System.Quantification of protection done via image JFiji (Imaged) was used for the guantification of protection in gel-shift assay images. The images were adjusted vertically oriented and the selected lane was analysed using the tool Gels / Plot Lanes. A baseline was used to remove the noise from the background of the scanned gel. Areas were calculated for each peak using the wand tool and compared to image control (first peak) for guantification.Materials and Methods- Delivery to insect cellsThe method used is that described in Martinez et al., 2021 , https: / / doi.Org / 10.1016 / i.pestbp.2O21 .104853 which is incorporated by reference herein in its entirety.Fluorescently labeling dsRNA60 bp dsRNA was designed by CDotBio and synthesized by Integrated DNA Technologies B.V., Belgium. 2ug of dsRNA was fluorescently labeled using the Silencer™ siRNA Labeling Kit with Cy™3 dye (Ambion) according to the manufacturer’s protocol for labeling longer dsRNAs.(Spodoptera exigua) Lepidoptera cells inoculationLabeled samples were kept in the dark and stored as a 150 ng / pl stock at -20 °C. About 1 x 106Spodoptera exigua cells in 100 pl medium were incubated for 60 minutes @ 27 °C with complexed or free labeled dsRNA. For the CND- complexed dsRNA, 750 ng of Cy3-labeled dsRNA was mixed with 750 ng CNDs 40 min prior to the cell assay at a concentration of 150 ng / ul (both dsRNA and CNDs). Free labeled dsRNA (750 ng) was mixed with the same volume of water as the CND-complexed sample and all incubation steps were the same for both complexed and free samples.Lepidoptera cell nucleus stainingAfter inoculation, cells were collected by centrifugation at 900 rpm for 5 min. To stain the nucleus, cells were resuspended in 30 pl diluted (1 :2000 in PBS) Hoechst33342 solution (Thermo Fisher Scientific, Waltham, MA) and incubated for 30 min at 27 °C.Confocal microscopyAfter staining, the samples were centrifuged for 5 min at 1000 rpm and washed with PBS before resuspending the cells in growth medium. Confocal microscopy was performed on a Nikon A1 R confocal microscope system with NIS-elements AR4.51.00 software (Nikon, Tokyo, Japan). Hoechst33342 was excited by the 352 nm laser and emission detected at 450 / 50 nm, Cy3 was excited by the 549 nm laser and emission detected at 595 / 50 nm.Image processingFiji (Imaged) was used to process the images. The saturation of images (red and blue channels) was adjusted and the colors changed to the gray scale. The two channels were merged using the Color / Merge Channels tool.Materials and Methods - Nucleic acid delivery to plant cellsExample a: Infiltration of dsRNA-CNDs into Nicotiana benthamianaPreparing Nicotiana Benthamiana Plants for Infiltration o INicotiana benthamiana seeds were sown thinly on damp Levingtons F2 + S Seed and Cuttings compost. The seeds were germinated at 24°C with a 16 / 8 light / dark regime in a controlled environment greenhouse. After 10 days, seedlings were pricked out into individual 9 cm diameter pots containing a 3:1 mix of Sinclair All Purpose potting compost and perlite, supplemented with Osmocote controlled- release fertilizer at 4 g / L. The plants were grown under the same conditions as the seed germination and watered twice weekly. Once the plants had 4-5 developing true leaves (approximately 5 weeks old from sowing), they were ready for treatment. Each leaf was infiltrated with 250 pL of 0.0002% Silwet and left to dry for at least 1 .5 hours before CNDs-RNA infiltration.Preparing the RNA for Infiltration22 bp Magnesium Chelatase-targeting dsRNA was synthesized by IDT and resuspended in RNase-free water. dsRNA was heated at 95°C for 1 minute and then gradually cooled to room temperature. In a glass vial, dsRNA was dissolved in MES buffer ((2-(N-Morpholino)ethanesulfonic acid)) to a concentration of 14 ng / pL.Preparing the CNDs for InfiltrationThe starting CND compounds stock concentration is I rng / mL. Stock CNDs were achieved by mixing CNDs in 20mM glycerol. In a 1.5 mL tube CNDs were dissolved in 20mM Glycerol in a 1 :8 ratio (e.g., 19.2pL CNDs:80.8pL Glycerol) to a molar concentration equal to the dsRNA for a 1 : 1 molar ratio experiment.Preparing the CND-dsRNA Complex for InfiltrationCND compounds and dsRNA were mixed at a 1 :1 ratio and incubated at room temperature for 30 minutes to allow the formation of CND-dsRNA complexes. For infiltration, prepare tubes with the following volumes:• 100 pL of RNA in MES at pH 5.7• 100 pL of CNDs in 20mM glycerolPreparing the Control / Blank solution for Infiltration100 pL MES buffer + 100 pL Glycerol were mixed.Infiltration of CND-dsRNA Complex into Leaves.Each leaf was infiltrated with a 200 pL of either the prepared CND-dsRNA solution or a control solution. The infiltrated leaves were left to dry for approximately 1 hour.Results were observed after 3-5 days from the infiltration.Example b: Cellular uptake of nucleotides in cut flowersAll pots containing cut flowers were placed under uniform lighting and in the same area to ensure consistent environmental conditions. A solution of 300 mL water, mixed with either CND- nucleotide complex(es) or Chrysal, was administered to each pot. The CND compounds were mixed with nucleotides at a 1 :1 molar ratio, ensuring an even distribution of compounds. Both treatments were provided at a concentration of 0.15 mg / mL to assess their impact on flower longevity. The water in each pot was changed every 7 days to maintain freshness and efficacy. Four flower species were used in this study: Germini / Gerbera, Santini, Red Roses, and Spray Carnations. Flowers were monitored over 20 days.Materials and Methods - Nucleic acid delivery to Hemiptera insects (aphids)Myzus persicae (peach potato aphids) were obtained from the insectary at Harper Adams agricultural university and maintained in a fine mesh BugDorm insect cage on trays of 3 week old Pak Choi plants. The Pak Choi trays were replaced weekly. The plants were grown under plant grow lights with a 16 / 8 light / dark regime at 22°C in pop up grow tents. The BugDorm was maintained under plant grow lights with a 16 / 8h light / dark regime. For the feeding experiments the aphids were acclimatised to an artificial diet in a tube feeding system as follows. Diet was prepared using the following recipe, filter sterilized and stored in 10ml aliquots at -20.Perspex tube sections 3cm long and 3cm in diameter with 3mm walls were used as the artificial diet acclimatisation aphid nursery. A parafilm square was stretched over one end of the tubing and 400ul of artificial diet was pipetted into the centre of the parafilm. A second square was stretched over the top to create a bubble of artificial diet under pressure to mimic plant phloem sap. Batches of tubes were prepared and frozen at -20. To acclimatise aphids to the diet, a pak choi leaf carrying several aphids was placed into a defrosted tube, the bottom sealed with a square of miracloth and an elastic band and the tubes were then placed feed side up in a plastic box covered with two layers of shade cloth under plant grow lights with a 16 / 8 light / dark regime at 22°C. The aphids would then seek out fresh food as the leaf dried out by walking up to the artificial diet bubble and piercing the stretched parafilm using their feeding stylet. After 2 days the miracloth and old leaf were removed and a fresh tube taped to the bottom of the old tube using micropore tape. The tube system was inverted and the old feed drained by piercing the outer layer of parafilm with a needle. The aphids would then move up to the fresh feed in the new tube now at the top. Thereafter the tubes were changed three times per week. Aphids reproduce parthenogenically, giving birth to live young so each tube is an enclosed self-propagating aphid colony.For the mortality of aphids feeding studies smaller feed tubes (2cm long, 2cm diameter with 3mm thick walls) were prepared using 100ul artificial diet and the following additions.The mixes were prepared in a total volume of 50ul in water, the CDots and dsRNA (and all controls) allowed to bind for 40 mins at r / t and then 50ul of a 2x concentrated stock of artificial diet added to each. The feed tubes were then prepared as for the larger nursery tubes.8 x 5th instar aphids were moved from nursery tubes using a fine paintbrush and deposited into each tube. Each condition had two replicates (two individual tubes each containing 8 aphids). The experiment was repeated 3 times.The tubes were maintained as for the nursery tubes and after 3 days the number of dead / alive aphids were recorded.The dsRNA sequence information: dsRNA against the Myzus persicae actin gene (XM_022309797.1) and a GFP control was prepared by RNAissance Inc using their proprietary method (not disclosed) and provided to CDotBio Ltd.Actin dsRNA sequence: (SEQ ID NO: 1)UGGACUUGGCUGGUCGUGACUUGACCGACUACUUGAUGAAGAUCUUAACCGAA AGAGGUUACAGCUUCACCACCACCGCUGAGCGAGAAAUCGUCCGUGACAUCAA GGAAAAAUUGUGCUAUGUCGCUUUGGACUUCGAACAGGAAAUGGCUACCGCCG CCGCUUCCACCUCAUUGGAGAAAUCCUAUGAAUUACCUGACGGACAGGUCAUC ACCAUCGGAAACGAACGUUUCCGUUGCCCAGAAGCCUUGUUCCAACCUUCAUU CUUGGGAAUGGAAUCUUGCGGUAUCCACGAAACCGUAUACAACUCCAUCAUGA AGUGCGAUGUUGACAUCAGAAAGGACUUGUACGCCAACACUGUACUUUCCGGA GGUACCACCAUGUACCCAGGUAUUGCCGACAGAAUGCAAAAGGAAAUCACCGFP control sequence: (SEQ ID NO: 2)AUGGUGAGCAAGGGCGAGGAGCUGUUCACCGGGGUGGUGCCCAUCCUGGUCGGGGCGAUGCCACCUACGGCAAGCUGACCCUGAAGUUCAUCUGCACCACCGGCAAGCUGCCCGUGCCCUGGCCCACCCUCGUGACCACCCUGACCUACGGCGUGCAGUGCUUCAGCCGCUACCCCGACCACAUGAAGCAGCACGACUUCUUCAAGUCUGCCAUGCCCGAAGGCUACGUCCAGGAGCGCACCAUCUUCFor the aphid reproduction experiment (counting neonates) the following mixes were prepared:The mixes were prepared in a total volume of 50ul in water, the CDots and dsRNA (and all controls) allowed to bind for 40 mins at r / t and then 50ul of a 2x concentrated stock of artificial diet added to each. The feed tubes were then prepared as for the larger nursery tubes.8 x 5th instar aphids were moved from nursery tubes using a fine paintbrush and deposited into each tube. Each condition had two replicates (two individual tubes each containing 8 aphids). The experiment was repeated 3 times.The tubes were maintained as for the nursery tubes and after 7 days the total number of neonates born throughout the experiment was recorded. The tubes including the CDots and dsRNA were replaced every two days during the experiment with fresh tubes to prevent oxidation of the feed over a long period. dsRNA against the Myzus persicae proteasome gene (XM_022318706.1) was prepared by RNAissance Inc using their proprietary method (not disclosed) and provided to CDotBio Ltd.Proteasome dsRNA sequence (SEQ ID NO: 3)UAGCUGGUGGUGCAGCUGAUUGUGUUUACUGGGAUCGUGUUCUCUCAAAACAA UGCAGACUACAUGAGUUAAGGAACAAAGAACGCAUUAGUGUUACAGCUGCUUC CAAAAUUAUGUCAAACAUGAUUUAUUACUAUAAAGGAUAUGGAUUAUCUAUUGG AAUGAUGUUAGCGGGAUAUGAUAAAAACGGUCCAUCUCUAUUUUACAUUGACAA UGAUGGUUCCAGAACACCAGGUAAAGUGUUUUCGGUAGGUUCCGGGUCAAUAUAUGCAUUUGGUGUUCUUGAUUCUGGCUAUAAAUGGGAUCUAACUGAUGAAGAA GCUCAAAAACUUGGUCAAAGAGCUAUCUUCCAUGCUACUCAUCGAGAUGCUUAC AGUGGUGGCAUUGUUCGAGUGUAUCACAUCACUAAAGAUGGAUGGAAACAUAUMaterials and Methods - siPOOL dsRNA binding and release assays siPOOLs of the human GAPDH gene were provided by siTOOLs Biotech GmbH. The method of synthesis is proprietary information but the pools are predicted to consist of a selection of 22bp dsRNAs. As a control we included a 22bp siRNA (dsRNA) to the Nicotiana benthamiana Magnesium Chelatase subunit H gene (NbMgCHLH) synthesised by Integrated DNA Technologies.Mixes were made for standard bind and release as follows (in ul)The total amount of dsRNA in each sample was 50ng and the CDot / RNA ratio where appropriate was 10:1 (500ng CDots). Mixes were made as per the table above and left for binding for 40 minutes at r / t. Then samples 3 and 4 “bound” had water and Loading Dye (no SDS - Life Technologies) added as per the table above and were placed on ice while samples 1, 2, 5 and 6 had water and SDS Loading Dye (Life Technologies) added as per the table and were incubated at 95oC for 20 minutes. All samples were briefly spun down before loading onto a 3% agarose gel containing a 1 / 20,000 dilution of Sybr Gold. The gel was run at 90 volts for 40 minutes. dsRNA ladder from NEB was loaded at each side of the gel.For the gel looking at binding ratios mixes were set up as follows:Each sample contained a total of 50ng dsRNA but CDots from 6.25ng to 400ng in total. Samples were allowed to bind for 40 mins at r / t then water and Loading Dye (no SDS) was added and the gel run as before.For the alternative release reagent gel mixes were prepared as below:Mixes were incubated for 40 mins at r / t then heparin or water as appropriate was added and the mixes incubated for a further 20 mins at r / t before being run on a gel as before. A total of 50ng dsRNA was used per sample and CDots either 50ng or 400ng per sample where appropriate. Heparin final concentration was 17.5mM.Materials and Methods: DNA plasmid binding and release assaysA 4.5kb plasmid expressing the GFP gene was provided by KeyGene N.V. No sequence information was provided. As a control we used a 4.5kb plasmid expressing basta resistance built by CDotBio. All conditions for binding and release, binding ratios and the alternative release reagent were as described for the siPOOLs above. Gels were 1% and the ladder used was the 1kb+ DNA ladder (Life Technologies).The binding ratios are as follows:Plasmid amount in each sample was constant (50ng) and CDot amount was varied from 6.25ng to 400ng in total.Materials and Methods: mRNA binding and release assaysA 750bp mRNA for the GFP gene was provided by KeyGene .N.V. No sequence information was provided. As a control we used a dsRNA of approximately the same length as we do not currently hold any mRNAs in the lab. All conditions for binding and release, binding ratios and the alternative release reagent were as described for thesiPOOLs and the GFP plasmid above. Gels were 1.5% and the ladder used was either the 1 kb+ DNA ladder (Life T echnologies) or the low range ssRNA ladder from N EB.Materials and Methods: CND facilitated uptake of dsRNA in Nicotiana benthamiana seedlings

Claims

Claims1. A carbon-nanodot (CND) compound comprising a carbon nanodot core that is functionalised on the surface with a polyethyleneimine polymer, wherein the CND compound has a nitrogen content of at least 10 %, optionally wherein the nitrogen content is determined by x-ray photoelectron spectroscopy (XPS).

2. The carbon-nanodot (CND) compound of claim 1 , comprising a nitrogen content of at least 15 %, more preferably between 15 % and 40 %3. The carbon-nanodot (CND) compound of any preceding claim, wherein the carbon-nanodot core is formed from heating an amino-sugar and an amino acid.

4. The carbon-nanodot (CND) compound of claim 3, wherein the amino sugar is glucosamine, galactosamine or mannosamine, for example, glucosamine.

5. The carbon-nanodot (CND) compound of claims 3 or 4, wherein the amino acid is an alpha or beta amino acid, preferably wherein the amino acid is selected from alanine, glycine, glutamine, alanine, aspartic acid, serine, leucine, lysine, threonine, tyrosine, methionine, glutamic acid, tryptophan, arginine, cysteine, valine, isoleucine, and leucine, for example, beta-alanine6. The carbon-nanodot (CND) compound of any preceding claim, wherein the carbon-nanodot core is not formed using polyethyleneimine.

7. The carbon-nanodot (CND) compound of any preceding claim, wherein the polyethyleneimine polymer has a molecular weight of between 500 and 25000, or from 1000 to 10000, preferably from 2500 to 7500, for example, about 5000, which is optionally determined by size exclusion chromatography, forexample, gel permeation chromatography wherein the molecular weight is an average molar mass and measured in g / mol.

8. The carbon-nanodot (CND) compound of any preceding claim, wherein the polyethyleneimine polymer is a branched polyethyleneimine.

9. The carbon-nanodot (CND) compound of any preceding claim, comprising 10 to 25 % nitrogen content, preferably 15 to 25 % nitrogen content, less than 15 % oxygen content, preferably less than 10 % oxygen content, and 60 % to 80 % carbon content, wherein the nitrogen content, oxygen content and carbon content is determined by x-ray photoelectron spectroscopy (XPS)10. The carbon-nanodot (CND) compound of any preceding claim, with a particle size of 1 -120 nm, preferably 3-50 nm, for example 5-20 nm as determined by Atomic Force Microscopy.

11. A method of forming the carbon-nanodot (CND) compound, the method comprising a) heating one or more organic molecules to form a CND core, preferably wherein the one or more organic molecules comprise an amino sugar and an amino acid, and b) functionalizing the CND core with a polyethyleneimine polymer.

12. The method of any one of claim 11 , wherein the step a) is carried out at a temperature of at least 150 °C, preferably at least 175 °C.

13. The method of any one of claims 11 -12, wherein in step b) the functionalization of the core comprises coupling the carbon nanodot core with the polyethyleneimine polymer in the presence of an amide coupling reagent, preferably wherein the amide coupling reagent is EDC (1 -ethyl-3-carbodiimide hydrochloride).

14. A carbon-nanodot (CND) nucleic acid complex, comprising the carbon- nanodot (CND) compound of claims 1 -10 and a nucleic acid.

15. The carbon-nanodot (CND) nucleic acid complex of claim 14, wherein the nucleic acid is RNA or DNA, preferably dsRNA or RNAi.

16. The carbon-nanodot (CND) nucleic acid complex of any one of claims 14-15, wherein the nucleic acid is a nucleotide or a chain of nucleotides having a length of from 2 to 1000 nucleotides, more preferably 15 to 500 nucleotides.

17. The carbon-nanodot (CND) nucleic acid complex of any one of claims 14-16, wherein the CND compound and the nucleic acid are in a ratio of 0.25: 1 - 50: 1 , preferably from 2:1 to 15:1 , for example 10:1 .

18. Use of the carbon-nanodot (CND) compound of claims 1 -10, for protecting a nucleic acid from degradation.

19. Use of the carbon-nanodot (CND) compound of claim 18, wherein the nucleic acid is DNA or RNA, preferably dsRNA.

20. Use of the carbon-nanodot (CND) compound of claim 18 or claim 19, wherein the degradation is nuclease degradation.

21. Use of the carbon-nanodot (CND) compound according to any one of claims 18-21 , wherein the carbon-nanodot (CND) provides protection at pH > 6, preferably between 8 and 12.

22. Use of the carbon-nanodot (CND) compound according to any one of claims 20-21 , wherein the carbon-nanodot (CND) provides protection of the nucleic acid from one or more non-specific nucleases, for example, Benzonase, salt-active nuclease (SAN) and endonuclease from Serratia marcescens23. Use of the carbon-nanodot (CND) compound according to any one of claims 20-22, wherein the carbon-nanodot (CND) provides protection in an insect gut.

24. Use of carbon-nanodot (CND) compound of claims 1 -10, for delivering a nucleic acid to an insect cell25. Use of the carbon-nanodot (CND) compound according to any one of claims 23-24, wherein the insect is a Lepidoptera, Hemiptera, Coleoptera, Orthoptera and Diptera, preferably wherein the insect is selected from a caterpillar, aphid, weevil, locust, mosquito or fruit fly.

26. Use of the carbon-nanodot (CND) compound of any one of claims 1 -10, for delivering a nucleic acid to a plant cell, optionally, wherein a) the nucleic acid is dsRNA or RNAi and / or b) the plant is a dicot plant, optionally wherein the dicot is solanaceae, brassicas or cucurbits, for example, N. Benthamiana, or wherein the plant is a monocot plant.

27. Use of carbon-nanodot (CND) compound of any one of claims 1 -10 for delivery of a nucleotide to a post-harvest flower or post-harvest vegetable for one or more of (i) delaying senescence, (ii) prolonging shelf-life and / or (iii) preventing pests

Citation Information

Patent Citations

  • Compositions and methods for delivery of nucleic acid to plant cells

    EP4012034A1

  • Functionalized carbon quantum dot and preparation method thereof

    CN112521942A

  • Carbon-based nano material serving as nucleic acid carrier to deliver dsRNA (double-stranded ribonucleic acid) as well as preparation method and application of carbon-based nano material

    CN115812699A

  • CDs-based small nucleic acid plant delivery system and preparation method and application thereof

    CN118186011A