Steatotic liver disease, mitochondrial bioenergetics reserve, and neurotensin signaling
By assessing mitochondrial bioenergetics reserve and using neurotensin inhibitors to regulate NTS signaling, the method addresses the challenge of MASLD and steatohepatitis, improving mitochondrial function and reducing lipid accumulation to prevent disease progression.
Patent Information
- Application Number
- PCT/US2025/037003
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-02-27
- Filing Date
- 2025-07-09
- Publication Date
- 2026-02-05
AI Technical Summary
There is a lack of effective tools for monitoring and treating metabolic dysfunction-associated steatotic liver disease (MASLD) and steatohepatitis, which is characterized by hepatic mitochondrial dysfunction and lipid accumulation, due to a lack of understanding of molecular drivers and the role of neurotensin (NTS) in liver lipid metabolism.
Monitoring and treating steatotic liver disease and steatohepatitis by assessing mitochondrial bioenergetics reserve in hepatocytes and administering neurotensin inhibitors, such as NTSR1 antagonists, to regulate NTS signaling and mitigate lipid uptake at the expense of mitochondrial bioenergetic reserve.
The method effectively monitors and treats steatotic liver disease and steatohepatitis by regulating NTS signaling, improving mitochondrial function and reducing lipid accumulation, thereby preventing progression to cirrhosis and hepatocellular carcinoma.
Smart Images

Figure US2025037003_05022026_PF_FP_ABST
Abstract
Description
STEATOTIC LIVER DISEASE, MITOCHONDRIAL BIOENERGETICS RESERVE, AND NEUROTENSIN SIGNALING Assignee: University of Kentucky Research Foundation Attorney Docket No.: 13177N / 2844WO RELATED APPLICATIONS
[0001] This application claims priority from U.S. Provisional Application Serial Nos.63 / 668,955 filed July 9, 2024 and 63 / 764,310 filed February 27, 2025, the entire disclosures of which are incorporated herein by this reference. GOVERNMENT INTEREST
[0002] This invention was made with government support under grant number DK112034DK048498, GM121327, CA133429, and CA177558 awarded by the National Institutes of Health. The government has certain rights in the invention. REFERENCE TO AN ELECTRONIC SEQUENCE LISTING
[0001] The contents of the electronic sequence listing (Evers UK 2844 SequenceListing.xml; Size: 52,011 bytes; and Date of Creation: July 9, 2025) is herein incorporated by reference in its entirety. TECHNICAL FIELD
[0003] The presently disclosed subject matter generally relates to effects of neurotensin(NTS) on mitochondrial function and hepatic steatosis, including metabolic dysfunction- associated steatotic liver disease (MASLD) and alcohol associated steatotic liver disease (ALD). In particular, certain embodiments of the presently disclosed subject matter relate tomonitoring and / or treating conditions characterized by hepatic steatosis, including prevention, attenuation, and beneficial impact on associated symptoms and conditions, such as steatohepatitis, liver fibrosis, liver cirrhosis, and liver cancer. INTRODUCTION
[0004] Metabolic dysfunction associated steatotic liver disease (MASLD) (previously knownas Nonalcoholic fatty liver disease (NAFLD)), affects nearly 25% of the global population and is expected to increase approximately 20% by 2030 due to the ongoing epidemic of obesity and metabolic diseases [1]. MASLD is characterized by accumulation of more than 5% fat in hepatocytes and can be accompanied with metabolic dysfunctions such as obesity, insulin resistance and dyslipidemia [2]. A subset of patients with MASLD can progress to metabolic dysfunction associated steatohepatitis (MASH) (previously known as nonalcoholic steatohepatitis (NASH)), manifested by liver inflammation and fibrosis, cirrhosis or hepatocellular carcinoma [3]. Although many factors, such as diet, obesity, and insulin resistance, have been proposed to play a role in MASLD pathogenesis, a lack of understanding of molecular drivers of MASLD has severely impeded the development of therapeutic strategies to attenuate this disease.
[0005] According to the “multiple hit hypothesis” in MASLD, increased supply of free fattyacids (FAs) from either the diet or adipose tissue lipolysis predisposes the liver to mitochondrial dysfunction and oxidative stress[3]. The liver is a highly adaptive organ and studies show that the hepatic mitochondria can initially adjust their ability to overcome the lipid overload conditions by upregulating FA metabolism pathways [4]. However, later stages of MASLD are characterized by hepatic mitochondrial dysfunction (i.e., alteration in expression or activity of oxidative phosphorylation (OXPHOS) complexes) [5], suggesting that dysregulated mitochondrial adaptation plays a significant role in MASLD pathogenesis [6].
[0006] Neurotensin (NTS), a tridecapeptide hormone localized to the central nervous systemand specialized enteroendocrine cells (N cells) in the small intestine [7], has three major receptors: NTSR1 and NTSR2 (high and low affinity G protein-coupled receptors, respectively) and the non-G protein-coupled NTSR3 / sortilin-1 [8]. Increased pro-NTS (a stable 117 amino acid precursor) levels in plasma correlate strongly with obesity, MASLD development, and increased risk of metabolic diseases in humans [9-11]. It has been reportedthat pro-NTS levels are the strongest independent predictor of MASLD prevalence in patients
[0012] . Moreover, it has been reported that global knockout of NTS in mice protects against high fat diet (HFD)-induced obesity, insulin resistance, and hepatic steatosis
[0013] .
[0007] Lipids are the most potent stimulus for NTS secretion from the gut into the portal vein[7]. Adipose tissue-associated lymphatic endothelial cells represent another important source for NTS availability in the liver [14, 15]. This suggests that conditions implicated in MASLD development, such as increased dietary lipids and adiposity, are conducive to peripheral NTS release. However, whether NTS directly affects liver lipid metabolism and storage is unknown.
[0008] Accordingly, there remains a need in the art for effective tools for monitoring,treating, and monitoring treatment of steatotic liver disease and / or steatohepatitis. SUMMARY
[0009] The presently disclosed subject matter meets some or all of the above-identifiedneeds, as will become evident to those of ordinary skill in the art after a study of information provided in this document.
[0010] This Summary describes several embodiments of the presently disclosed subjectmatter, and in many cases lists variations and permutations of these embodiments. This Summary is merely exemplary of the numerous and varied embodiments. Mention of one or more representative features of a given embodiment is likewise exemplary. Such an embodiment can typically exist with or without the feature(s) mentioned; likewise, those features can be applied to other embodiments of the presently disclosed subject matter, whether listed in this Summary or not. To avoid excessive repetition, this Summary does not list or suggest all possible combinations of such features.
[0011] As disclosed herein, neurotensin (NTS) signaling promotes lipid uptake at theexpense of mitochondrial bioenergetic reserve in hepatocytes. The presently disclosed subject matter includes method for monitoring, treating, and monitoring treatment of steatotic liver disease and / or steatohepatitis.
[0012] The presently disclosed subject matter includes a method of monitoring steatotic liverdisease and / or steatohepatitis in a subject, which comprises assessing mitochondrialbioenergetics reserve in hepatocytes from the subject, and determining the steatotic liver disease and / or steatohepatitis status of the subject by comparing mitochondrial bioenergetics reserve to a reference.
[0013] In some embodiments of the method, the reference is control data for mitochondrialbioenergetics reserve. In some embodiments, the steatotic liver disease and / or steatohepatitis status of the subject is determined to be present when compared to the control data. In some embodiments, the steatotic liver disease and / or steatohepatitis status of the subject is determined to be progressing when compared to the control data. In some embodiments, the steatotic liver disease and / or steatohepatitis status of the subject is determined to be regressing when compared to the control data.
[0014] In some embodiments of the method, the assessing mitochondrial bioenergeticsreserve in hepatocytes from the subject is conducted using a sample obtained from the subject at a first time point, and the reference is mitochondrial bioenergetics reserve assessment of a sample obtained from the subject at a second time point. In some embodiments, the steatotic liver disease and / or steatohepatitis status of the subject is determined to be progressing when compared to the sample obtained from the subject at a second time point. In some embodiments, the steatotic liver disease and / or steatohepatitis status of the subject is determined to be regressing when compared to the sample obtained from the subject at a second time point.
[0015] Some embodiments of the method further comprise administering a neurotensininhibitor to the subject. In some embodiments, the neurotensin inhibitor is an NTSR1 antagonist.
[0016] Some embodiments of the method further comprise assessing NTS signaling, whereinan increase in NTS signaling relative to a reference is associated with a presence or progression of steatotic liver disease and / or steatohepatitis. Some embodiments of the method further comprise administering a neurotensin inhibitor to the subject.
[0017] Some embodiments of the method further comprise assessing lipid update inhepatocytes, wherein an increase in lipid uptake is associated with a presence or progression of steatotic liver disease and / or steatohepatitis. Some embodiments of the method further comprise administering a neurotensin inhibitor to the subject.
[0018] Some embodiments of the method further comprise assessing presence and / or severityof fat accumulation in the liver, wherein fat accumulation is associated with a presence or progression of steatotic liver disease and / or steatohepatitis. Some embodiments of the method further comprise administering a neurotensin inhibitor to the subject.
[0019] Some embodiments of the method further comprise assessing liver stiffness, whereinincreasing liver stiffness is associated with a presence or progression of steatotic liver disease and / or steatohepatitis. Some embodiments of the method further comprise administering a neurotensin inhibitor to the subject.
[0020] The presently disclosed subject matter further includes a method of monitoringtreatment of steatotic liver disease and / or steatohepatitis in a subject, which comprises administering a neurotensin inhibitor to the subject, and determining that the steatotic liver disease and / or steatohepatitis status of the subject by comparing mitochondrial bioenergetics reserve to a reference.
[0021] In some embodiments of the method, the reference is control data for mitochondrialbioenergetics reserve. In some embodiments, the steatotic liver disease and / or steatohepatitis status of the subject is determined to be present when compared to the control data. In some embodiments, the steatotic liver disease and / or steatohepatitis status of the subject is determined to be progressing when compared to the control data. In some embodiments, the steatotic liver disease and / or steatohepatitis status of the subject is determined to be regressing when compared to the control data.
[0022] In some embodiments of the method, the assessing mitochondrial bioenergeticsreserve in hepatocytes from the subject is conducted using a sample obtained from the subject at a first time point, and the reference is mitochondrial bioenergetics reserve assessment of a sample obtained from the subject at a second time point. In some embodiments, the steatotic liver disease and / or steatohepatitis status of the subject is determined to be progressing when compared to the sample obtained from the subject at a second time point. In some embodiments, the steatotic liver disease and / or steatohepatitis status of the subject is determined to be regressing when compared to the sample obtained from the subject at a second time point.
[0023] In some embodiments of the method, the neurotensin inhibitor is an NTSR1antagonist.
[0024] Some embodiments of the method further comprise assessing NTS signaling, whereinan increase in NTS signaling relative to a reference is associated with a presence or progression of steatotic liver disease and / or steatohepatitis.
[0025] Some embodiments of the method further comprise assessing lipid update inhepatocytes, wherein an increase in lipid uptake is associated with a presence or progression of steatotic liver disease and / or steatohepatitis.
[0026] Some embodiments of the method further comprise assessing presence and / or severityof fat accumulation in the liver, wherein fat accumulation is associated with a presence or progression of steatotic liver disease and / or steatohepatitis.
[0027] Some embodiments of the method further comprise assessing liver stiffness, whereinincreasing liver stiffness is associated with a presence or progression of steatotic liver disease and / or steatohepatitis.
[0028] The presently disclosed subject matter further includes a method of treatment forsteatotic liver disease and / or steatohepatitis, which comprises identifying a subject at risk of or having steatotic liver disease and / or steatohepatitis, and administering a neurotensin inhibitor. In some embodiments of the method, the subject is identified as being at risk of or having steatotic liver disease and / or steatohepatitis by comparing mitochondrial bioenergetics reserve in hepatocytes from the subject to a reference.
[0029] In some embodiments of the method, the reference is control data for mitochondrialbioenergetics reserve. In some embodiments, the steatotic liver disease and / or steatohepatitis status of the subject is determined to be present when compared to the control data. In some embodiments, the steatotic liver disease and / or steatohepatitis status of the subject is determined to be progressing when compared to the control data. In some embodiments, the steatotic liver disease and / or steatohepatitis status of the subject is determined to be regressing when compared to the control data.
[0030] In some embodiments of the method, the assessing mitochondrial bioenergeticsreserve in hepatocytes from the subject is conducted using a sample obtained from the subject at a first time point, and the reference is mitochondrial bioenergetics reserve assessment of a sample obtained from the subject at a second time point. In some embodiments, the steatotic liver disease and / or steatohepatitis status of the subject is determined to be progressing whencompared to the sample obtained from the subject at a second time point. In some embodiments, the steatotic liver disease and / or steatohepatitis status of the subject is determined to be regressing when compared to the sample obtained from the subject at a second time point.
[0031] In some embodiments of the method, the neurotensin inhibitor is an NTSR1antagonist.
[0032] Some embodiments of the method further comprise assessing NTS signaling, whereinan increase in NTS signaling relative to a reference is associated with a presence or progression of steatotic liver disease and / or steatohepatitis.
[0033] Some embodiments of the method further comprise assessing lipid update inhepatocytes, wherein an increase in lipid uptake is associated with a presence or progression of steatotic liver disease and / or steatohepatitis.
[0034] Some embodiments of the method further comprise assessing presence and / or severityof fat accumulation in the liver, wherein fat accumulation is associated with a presence or progression of steatotic liver disease and / or steatohepatitis.
[0035] Some embodiments of the method further comprise assessing liver stiffness, whereinincreasing liver stiffness is associated with a presence or progression of steatotic liver disease and / or steatohepatitis. BRIEF DESCRIPTION OF THE DRAWINGS
[0036] The features of the invention are set forth with particularity in the appended claims. Abetter understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are used, and the accompanying drawings of which:
[0037] FIG. 1A-1I. NTS signaling promotes MASLD. (FIG. 1A) Expression of NTSR1and NTSR3 in normal, MASLD and MASH liver samples from human patients (western blot); N = 5 / group. Data were normalized to total protein expression (Brilliant blue stained gel). Quantitative analysis is shown on right. (FIG.1B) NTSR1 and NTSR3 gene expression (qPCR) in human normal, MASLD and MASH livers. Data were normalized to β-actin expression. (FIG.1C) Female Nts+ / +and Nts− / −mice were fed low-fat diet (LFD) or high-fatdiet (HFD) for 28 wks. MASLD was confirmed by H&E-stained representative liver sections (10× magnification, scale bar=100 µm). (FIG.1D) Liver weight, (FIG.1E) steatosis score, and (FIG.1F) NAS (NAFLD activity score) forNtsvsNtsmice fed HFD. (FIG.1G) Oxidative stress in livers was compared by measuring GSSG and GSH levels (ELISA). (FIG. 1H) Inflammatory gene expression (il1b and ifng) in liver (qPCR, normalized toβ-actin). (FIG.1I) Heatmap showing expression of significantly altered metabolic genes (qPCR) in livers (logfold changes, normalized toβ-actin).N= 5 mice / group for D–G and 4 mice / group for (FIG.1H, FIG.1I). Data are expressed as mean ± SD, andp ≤0.05 is considered significant.
[0038] FIG. 2A-2C. NTS promotes MASLD by regulating CD36 and PGC1αtranscription. (FIG.2A) Liver weight to body weight ratio of livers from Nts+ / +and Nts- / -female mice fed HFD for 28 wks. (FIG.2B) Time course of NTS-induced gene expression (qPCR) in isolated mouse hepatocytes; mRNA expression was normalized to ^- actin. N = 3 independent experiments. (FIG.2C) Time course of PA-induced gene expression (qPCR) in hepatocytes; mRNA expression was normalized to ^-actin. N = 3 independent experiments. Data are expressed as mean ± SD, and p ≤ 0.05 is considered as significant.
[0039] FIG. 3A-3E. Effect of NTS signaling on adipose tissue. (FIG. 3A) CD36 geneexpression (qPCR) in white adipose tissue (epididymal) and brown adipose tissue from 28 wks LFD or HFD fed Nts+ / +and Nts- / -mice (female). Data was normalized to ^-actin. N=4 mice / group. (FIG.3B) Comparison of body weight in mice fed HFD for 28 wks as in (A). N=5 mice / group. (FIG.3C) PGC1α gene expression(qPCR) in same group of mice as in (A). Data was normalized to ^-actin (FIG.3D & FIG.3E) Comparison of NTSR1 vs NTSR2 expression in white and brown fat in same group of mice as in (A), normalized to ^-actin. N=4 mice / group. Data are expressed as mean ± SD, and p ≤ 0.05 is considered as significant.
[0040] FIG. 4A-4G. NTS promotes lipid uptake by upregulating CD36 in hepatocytes.(FIG.4A) FA uptake (1μM) at 15 min (confocal) in primary hepatocytes stimulated with or without NTS (10 nM, 1 h). Lipids were stained with BODIPY and normalized to Hoechst (nuclear stain); N=6 independent experiments. (FIG.4B) Representative images showing colocalization of BODIPY-labeled PA (C16) with CD36 after 15 min uptake in primary hepatocytes, with or without NTS. (FIG.4C) Analyses of CD36 colocalization withBODIPY-C16 over a time course; normalized to Hoechst. N=40 cells / group. (FIG.4D) Lipid (BODIPY-labeled PA) uptake at 15 min was compared between control (NTC) and CD36 knockdown (KD1 and KD2) hepatocytes treated with or without NTS (10 nM, 1 h). N = 48 cells from two mice (2 independent experiments). NTC=non-targeted control, KD1 and KD2=CD36 knockdown using two different CD36 targeted shRNA (lentiviral). (FIG.4E, FIG.4F) NTS induced protein expression changes (western blot); total CD36 and PGC1α expression were normalized toβ-actin. N=4 independent experiments. (FIG.4G) Putative AP-1 binding motif in proximal promoter region of CD36 shows strong conservation with consensus sequence (top). ChIP assay (bottom) shows recruitment of pcJun 73 on the AP-1 motif in NTS-stimulated hepatocytes. Rabbit IgG and histone H3 antibodies were used as negative and positive controls, respectively. Hepatocytes isolated from C57 / BL6 male mice were used for all studies. Data are expressed as mean ± SD, and p≤0.05 is considered significant.
[0041] FIG. 5A-5E. Effect of NTS signaling on lipid uptake and metabolism. (FIG. 5A)Time-dependent BODIPY-C16 uptake in hepatocytes isolated from WT mice in the absence or presence of NTS (10 nM, 1 h). Data were analyzed by ImageJ and normalized to Hoechst (nuclear stain); N = 6 fields (each containing 20–30 cells). (FIG.5B) CD36 expression was transiently knocked down in hepatocytes isolated from 2 mice (C57 / BL6) using lentiviral shRNA. Efficiency of knockdown using two different shRNA (KD1 and KD2) was verified by qPCR and normalized against ^-actin. NTC= non-targeted control transfected hepatocytes, KD1 and KD2= CD36 knockdown hepatocytes. (FIG.5C) Representative western blots showing the effect of NTS stimulation on ERK signaling pathways. (FIG.5D) Densitometric quantification of pERK and pcJUN expression over a time course following NTS treatment; N = 3 independent experiments. (FIG.5E) Pathway enrichment analysis (RNAseq) of livers from female Nts- / -or Nts+ / +mice under normal chow fed conditions; NES=Normalized Enrichment Score. N = 3 mice / group. Data are expressed as mean ± SD, and p ≤ 0.05 is considered as significant.
[0042] FIG. 6A-6F. NTS compromises mitochondrial energy metabolism throughOXPHOS inhibition. (FIG.6A) Gene set enrichment analysis (RNAseq) showing the top 10 positively and negatively regulated pathways in fasted mouse livers (N= 3 mice / genotype). NES=Normalized Enrichment Score. (FIG.6B) GSEA enrichment plots showing upregulation of oxidative phosphorylation inNtsvsNtsmice livers. (FIG.6C) The PGC1α-regulated pathway (MOOTHA_PGC gene set) was positively enriched in liver from fasted Nts vs Nts mice. The upregulated genes from Nts mice within this gene set are categorized in the pie chart. The percentage of genes related to mitochondrial metabolism is labeled (red box). (FIG.6D) Representative OCR of hepatocytes isolated from Nts and Nts mice (mito stress test). Oligomycin (oligo), FCCP and rotenone + antimycin A (AA) were added as indicated. (FIG.6E) Relative mitochondrial parameters (mito stress test) of hepatocytes from 4 mice / genotype. (FIG.6F) Effect of NTS treatment (16 h) on OXPHOS complex expression (western blot) in mitochondrial fractions of hepatocytes isolated from C57 / BL6 male mice. TOM20 = mitochondrial fraction control, actin = cytoplasmic fraction control; expression levels were normalized to TOM20 expression and shown as fold of 0 nM NTS. Data are expressed as mean ± SD, and p ≤ 0.05 is considered significant.
[0043] FIG. 7A-7D. NTS inhibits oxidative metabolism genes. (FIG. 7A) Quantitativeanalysis of mitochondrial membrane permeability in hepatocytes treated overnight with NTS and / or PA as measured by JC-1 staining; N = 5 independent experiments. (FIG.7B) Effect of PGC1α overexpression (top) on expression of OXPHOS complexes (bottom) in the mitochondrial fraction of HepG2 (western blot). (FIG.7C) OXPHOS expression in (B) were normalized to TOM20. N=4 independent experiments. (FIG.7D) Effect of PGC1α knockdown (siRNA) on gene expression (qPCR) in HepG2 cells; mRNA expression normalized to ^-actin. NTC=non-targeted control, KD=PGC1α knockdown; N = 4 independent experiments. Data are expressed as mean ± SD, and p ≤ 0.05 is considered as significant.
[0044] FIG. 8A-8H. NTS regulates OXPHOS through PGC1α inhibition. (FIG. 8A)Effect of SR48692 (NTSR1 antagonist, 10μM) on NTS-induced PGC1αexpression in hepatocytes (C57 / BL6); normalized to actin. N = 4 independent experiments. (FIG.8B) Promoter activity of PGC1α(2 kb luciferase promoter) with NTS and PD98059 (MEK inhibitor, 1 µM) treatment in transfected HepG2 cells (Dual Glo Luciferase assay).N =3. (FIG.8C) Mito stress test in control (Hep-pcDNA) and PGC1α-overexpressing (Hep-PGC1α) clone 2 treated with NTS;N =16 datapoints from two independent experiments. (FIG.8D, FIG.8E) Effect of NTS (10 nM) and PA (100 μM) stimulation (16 h) on protein expression (western blot) in hepatocytes (C57 / BL6). PGC1αwas normalized to actin and pAMPK was normalized to AMPK. N = 3 independent experiments. (FIG.8F) Gene expression analyses inNtshepatocytes treated with NTS and PA treated as in (FIG.8D). Dashed line representsexpression levels in control group;N =4–5 mice; ns=not significant. (FIG.8G) Lipid utilization assay. Nts hepatocytes were incubated with 100 µM PA for 24 h in presence / absence of NTS (10 nM), washed extensively and then incubated in lipid-free media for another 24 h. Confocal images show amount of unmetabolized lipids (BODIPY) at 48 h after lipid addition. Hoechst=nuclear stain. Scale bar=50μm. Quantified data from 30 cells / group are shown on the right. (FIG.8H) Measurement of unmetabolized lipids by Ntsr1 andNtsr1hepatocytes at 48 h in 96-well plates (BODIPY staining was normalized to Hoechst). Representative data from two independent experiment is shown. Data are expressed as mean ± SD, and p ≤ 0.05 is considered significant.
[0045] FIG. 9A-9F. NTS attenuates the AMPK / PGC1α signaling axis. (FIG. 9A)Representative images of endogenous PGC1αlocalization in liver from Nts+ / +mice fed LFD (50 weeks). β-catenin = cell junction marker; Hoechst = nuclear stain. Scale bar = 50 μm. PGC1α cellular compartment distribution as normalized to nuclear or cytoplasmic area is presented on right. N=120 cells. (FIG.9B) Subcellular fractionation of NTS (10 nM) and PA (100 μM) treated Nts+ / +hepatocytes (16 h) showing PGC1α (detected using PGC1 antibody, Millipore), pAMPK and AMPK localization. Tubulin=cytosolic fraction marker; histone H3 = nuclear and chromatin fraction marker. (FIG.9C) Representative images of PGC1α and AMPK localization in primary hepatocytes treated with NTS, PA and AMPKi (AMPK inhibitor = C compound, 10 μM). Nuclear colocalization is shown in inset (scale bar= 20 µm). (FIG.9D) PGC1αcolocalization with Hoechst (nuclear stain) was analyzed in 50 cells per group by Pearson colocalization index in hepatocytes treated as in (FIG.9C). (FIG.9E) PGC1αcolocalization with AMPK at nucleus was analyzed by Pearson colocalization in 30 hepatocytes per group treated as in (FIG.9C). (FIG.9F) PGC1α was immunoprecipitated from the liver nuclear-chromatin fraction of mice fed LFD or HFD for 50 weeks and its phosphorylation was determined using an antibody that specifically identifies AMPK- mediated phosphorylation motifs. Immunoprecipitated proteins are shown on top and input on bottom. Data are expressed as mean ± SD, and p ≤ 0.05 is considered significant.
[0046] FIG. 10A-10H. NTS / NTSR1 signaling inhibits lipid catabolism in liver. (FIG. 10A)Measurement of octanoate (FA) catabolism capacity in livers of Nts and Nts male mice fed either LFD or HFD for 23 weeks; data were normalized to protein concentration.N =4–5 mice / group. (FIG.10B) Representative OCR of PA oxidation by Nts and Nts hepatocytes isolated from mice fed HFD for 50–60 wks. Activity was normalized to protein concentration. (FIG.10C) Basal,maximal respiration and ATP production from PA oxidation by hepatocytes from mice fed LFD or HFD for 50–60 weeks; N = 36 datapoints from 4 mice / group. (FIG. 10D) C57 / BL6 hepatocytes were treated with 10 nM NTS (16 h) and then 100μM PA (3 h), and MitoSOX dye uptake was measured by flow cytometry; N = 6 (2 repeats each from 3 independent experiments). (FIG. 10E) Hepatocytes isolated fromNtsr1andNtsr1mice were treated with NTS and PA (50 µM) for 16 h, and mitochondrial function was measured using mito stress test. Quantitated data of maximal respiration are shown;N =27 datapoints from 5 mice / genotype. (FIG.10F) OXPHOS complex V expression withNtsr1andNtsr1hepatocytes treated as in (FIG.10E) (western blot);N =5 mice / genotype. Data normalized to TOM20 expression. (FIG.10G) Confocal images of Ntsr1 andNtsr1hepatocytes stained for PGC1αand Hoechst (nuclear stain) on left. Inset shows nuclear colocalization of PGC1α; scale bar = 10 µm. Quantification of PGC1α colocalization with Hoechst on right.N =90 cells from 3 mice / genotype. (FIG.10H) Measurement of lipid utilization at 48 h by hepatocytes plated in 96-well plate. Unmetabolized lipids were labeled with BODIPY and normalized to Hoechst. Data are expressed as mean ± SD, andp ≤0.05 is considered significant.
[0047] FIG. 11A-11C. Effect of NTS knockout in livers of male mice fed LFD or HFDfor 23 wks. (FIG.11A, 11B) Comparison of liver weight and liver weight to body weight ratio in Nts+ / +and Nts- / -male mice fed HFD for 23 wks. N=5 mice / group. (FIG.11C) Gene expressionof livers from Nts+ / +and Nts- / -male mice fed LFD or HFD for 23 weeks, normalized to ^-actin; N = 4Data are expressed as mean ± SD, and p ≤ 0.05 is considered as significant.
[0048] FIG. 12A-12D. Metabolomics and effect of PA on mitochondrial function. (FIG.12A) Results of 1D HSQC NMR analysis using13C6-Glucose as a tracer in Nts+ / +and Nts- / -hepatocytes. N = 1 mouse / genotype; arrows indicate an increase, and the green oval indicates a decrease of respectively labeled metabolites in Nts- / -livers. Schematic diagram (right) showing the positions of13C after glucose is metabolized through glycolysis and the first turn of Krebs cycle. Numbers refer to carbon positions. (FIG.12B) NTSR1 expression (qPCR) in isolated hepatocytes from Ntsr1+ / +and Ntsr1- / -mice. Data were normalized to β- actin. (FIG.12C) Primary hepatocytes (C57 / BL6) were treated with different concentrations of PA for 16 h, and Mito Stress test was performed to measure mitochondrial function. N = 5 wells / group. Representative data are shown; the experiment was repeated 3 times. (FIG. 12D) Effect of N-acetyl cysteine (NAC) treatment on PA-induced decrease in OXPHOS expression in hepatocyte mitochondrial fraction (protein expression was normalized toTOM20 and expressed as fold of Control). Data are expressed as mean ± SD, and p ≤ 0.05 is considered as significant.
[0049] FIG. 13A-13F. NTSR1 deficient hepatocytes show better mitochondrialadaptation than NTSR1 wild type hepatocytes. (FIG.13A, 13B) Hepatocytes were treated with NTS (10 nM), PA (50 µM) or NTS+PA for 16 h and mitochondrial respiration was measured by Seahorse mito stress test; basal respiration and spare respiratory capacity are shown. N = 27 datapoints from 5 mice / genotype. (FIG.13C–13F) OXPHOS complexes I, II and III / IV expression in NTS- and PA-treated hepatocytes were quantified by western blot and normalized to TOM20 expression; N = 4–5 mice / group. TOM20 was used as mitochondrial fraction control. Data are expressed as mean ± SD, and p ≤ 0.05 is considered as significant.
[0050] FIG. 14A-14F. NTS signaling inhibits AMPK and NTS signaling in humanlivers. (FIG.14A) Representative blot showing AMPK phosphorylation level in hepatocytes isolated from 3 pairs of Ntsr1+ / +and Ntsr1- / -mice. (FIG.14B) Quantitation of AMPK activation (pAMPK) in hepatocytes. Data were normalized to total AMPK. N=4 pairs of mice. (FIG.14C) Mito stress test showing mitochondrial function in Ntsr3+ / +or Ntsr3- / -hepatocytes treated with or without NTS. Data were analyzed from 30 datapoints of 3 mice / genotype. (FIG.14D) Representative western blot showing OXPHOS complexes expression in human livers. TOM20 = loading control; N = 5 / group. (FIG.14E) Correlation analyses of NTSR1 and OXPHOS complex V expression in liver samples from human patients. r = Spearman rho; 95% confidence interval lines are shown in red. (FIG.14F) Representative blot showing CD36 expression in human liver samples. Loading control = Brilliant Blue stained gel (same as FIG.1A); N = 5 / group.
[0051] FIG. 15A-15G. NTS signaling in human MASLD. (FIG. 15A) Gene expressiondata of PGC1α in liver biopsy samples from MASLD patients at different stages of the disease (Tukey’s HSD test) in EMBL-EBI database. (FIG.15B) OXPHOS complex expression in normal, MASLD and MASH human liver samples (western blot). Data were normalized to TOM20 expression. (FIG.15C) Correlation analyses of NTSR1 and OXPHOS complex I expression in liver samples from human patients. r = Spearman rho; 95% confidence interval lines are shown in red. (FIG.15D) Correlation analyses of NTSR1 and CD36 expression in human liver samples. r = Spearman rho, 95% confidence interval lines are shown in red. (FIG.15E) Regulation of CD36 and PGC1α expression (qPCR) by NTS inTHLE2- human hepatocyte cells, normalized to β-actin N = 4. (FIG.15F) NTS impairs mitochondrial function of THLE-2 cells (mito stress test). N = 10 datapoints from 2 independent experiments. (FIG.15G) Schematic diagram showing liver lipid metabolism in absence (left) and presence (right) of NTS signaling and its consequence on MASLD initiation. Data are expressed as mean ± SD, and p ≤ 0.05 is considered significant. DESCRIPTION OF EXEMPLARY EMBODIMENTS
[0052] The details of one or more embodiments of the presently disclosed subject matter areset forth in this document. Modifications to embodiments described in this document, and other embodiments, will be evident to those of ordinary skill in the art after a study of the information provided in this document. The information provided in this document, and particularly the specific details of the described exemplary embodiments, is provided primarily for clearness of understanding and no unnecessary limitations are to be understood therefrom. I n case of conflict, the specification of this document, including definitions, will control.
[0053] The presently disclosed subject matter includes method for monitoring, treating, andmonitoring treatment of steatotic liver disease and / or steatohepatitis.
[0054] Steatotic liver disease refers to the pathological accumulation of fat, typically about5% or more of hepatocytes, in the liver. It encompasses metabolic dysfunction-associated steatotic liver disease (MASLD), alcohol-associated liver disease (ALD), and mixtures thereof, sometimes referred to as MetALD, where both metabolic dysfunction and alcohol intake contribute to liver fat accumulation. MASLD is characterized by hepatic steatosis in individuals with metabolic risk factors such as obesity, insulin resistance, dyslipidemia, or type 2 diabetes 123. ALD is characterized by hepatic steatosis resulting from chronic and excessive alcohol consumption.
[0055] Steatohepatitis refers to a progressive form of steatotic liver disease characterized byhepatic steatosis accompanied by inflammation, hepatocyte ballooning, and varying degrees of fibrosis. It includes metabolic dysfunction-associated steatohepatitis (MASH), which arises in the context of MASLD and is marked by inflammatory damage and mitochondrial dysfunction in hepatocytes. Alcoholic steatohepatitis (ASH) occurs in individuals with chronic alcohol use and presents with similar histological features, including lobular inflammation and ballooning degeneration. As will be appreciated, steatohepatitis can arisedue to a combination of alcohol intake and metabolic dysfunction that is not tied to alcohol consumption. Steatohepatitus, including MASH and ASH, can progress to cirrhosis and hepatocellular carcinoma if left untreated.
[0056] In some embodiments of the presently disclosed subject matter, a method ofmonitoring steatotic liver disease and / or steatohepatitis in a subject is provided, which comprises assessing mitochondrial bioenergetics reserve in hepatocytes from the subject, and determining that the steatotic liver disease and / or steatohepatitis status of the subject by comparing mitochondrial bioenergetics reserve to a reference. In some embodiments, the method further comprise administering a neurotensin inhibitor to the subject.
[0057] In some embodiments of the presently disclosed subject matter, a method ofmonitoring treatment of steatotic liver disease and / or steatohepatitis in a subject is provided, which comprises administering a neurotensin inhibitor to the subject; and determining that the steatotic liver disease and / or steatohepatitis status of the subject by comparing mitochondrial bioenergetics reserve to a reference.
[0058] In some embodiments of the presently disclosed subject matter, a method ofprophylactic or therapeutic treatment of steatotic liver disease and / or steatohepatitis is provided, which comprises identifying a subject at risk of or having steatotic liver disease and / or steatohepatitis; and administering a neurotensin inhibitor. In some embodiments, the subject is identified as being at risk of or having steatotic liver disease and / or steatohepatitis by comparing mitochondrial bioenergetics reserve in hepatocytes from the subject to a reference.
[0059] A subject as referred to herein is animal, including a mammal, such as a human. Someembodiments of the methods disclosed herein involve obtaining a hepatocyte sample from the subject. In some embodiments, an isolated hepatocyte sample can be obtained from a liver tissue sample, which can be obtained by liver biopsy. In some embodiments of the methods disclosed herein, the subject has not previously been diagnosed with steatotic liver disease and / or steatohepatitis. In some embodiments, the subject has previously been diagnosed with steatotic liver disease and / or steatohepatitis.
[0060] Some embodiments of the methods disclosed herein involve assessing mitochondrialbioenergetics reserve in hepatocytes from the subject. Mitochondrial bioenergetics reserve is the capability of the mitochondria to adapt their metabolic parameters and mitigate thenutritional stress resulting from increased lipid supply. High mitochondrial bioenergetic reserve is associated with increased maximal respiration and spare respiratory capacity, indicating better mitochondrial adaptive function. Conversely, low mitochondrial bioenergetic reserve is associated with reduced mitochondrial function.
[0061] Measuring mitochondrial bioenergetics reserve can be achieved using variousmethods as will be appreciated by one of ordinary skill in the art upon study of this document. In some embodiments, the methods can be practiced using a sample from a subject such as isolated hepatocytes or liver tissue obtained from a liver biopsy. For example, a seahorse mito stress test can be used to measure basal respiration and spare respiratory capacity in hepatocytes. In some instances, this test involves measuring the oxygen consumption rate of hepatocytes under different conditions, such as the addition of oligomycin, FCCP, and rotenone plus antimycin A. For another example, expression of genes in hepatocytes isolated from a liver biopsy sample can be used to assess mitochondrial bioenergetics reserve. High mitochondrial bioenergetic reserve is indicated by the upregulation of particular genes as identified herein. For example, upregulation of one or more of the following genes is indicative of high mitochondrial bioenergetics reserves, while downregulation of these same genes is indicative of low mitochondrial bioenergetics reserves: PGC1α and its transcriptional targets; TFAM, which is involved in mitochondrial DNA replication and transcription; OXPHOS genes, which include various genes encoding components of the mitochondrial respiratory chain complexes, such as COX6C, COX7A2, COX7C, CYC1, NDUFA1, NDUFA9, NDUFS6, NDUFC1, NDUFA3, SDHA, SDHB, SDHC, SURF1, URCRB, UQCRH, UQCRC1; and β-oxidation genes, including genes involved in fatty acid oxidation, such as ACADL and HADHA. Gene expression can be determined using methods known to one of ordinary skill in the art, such as quantitative polymerase chain reaction (qPCR). For another example, JC-1 staining can be used to assess mitochondrial membrane potential, which is useful for determining mitochondrial bioenergetics reserve. The JC-1 dye is a cationic dye that accumulates in the mitochondria. When the mitochondrial membrane potential is high, JC-1 forms aggregates that emit red fluorescence. When the membrane potential is low, JC-1 remains in its monomeric form, emitting green fluorescence. This method allows for the quantification of mitochondrial membrane potential by measuring the ratio of red to green fluorescence, which reflects the health and functionality of the hepatic mitochondria. For another example, OXPHOS complex expression can be used, making use of Western blotting of mitochondrial fractions,normalized to TOM20. Low mitochondrial bioenergetic reserve is associated with decreased expression of oxidative phosphorylation (OXPHOS) complex proteins. For another example, metabolomics, including C6-glucose tracing and NMR, can be used to analyze metabolic flux through glycolysis and the Krebs cycle.
[0062] In some embodiments of the methods disclosed herein, determining steatotic liverdisease and / or steatohepatitis status and / or risk is conducted by comparing mitochondrial bioenergetics reserve to a reference.
[0063] In some embodiments, the reference can be mitochondrial bioenergetics reserveassessment of control data, such as data obtained from a biological sample of a subject of known steatotic liver disease status and / or known steatohepatitis status. For example, control data can be associated with a presence or severity of steatotic liver disease and / or steatohepatitis when obtained from samples of subjects known to have steatotic liver disease and / or steatohepatitis or a particular severity thereof. For another example, control data can be associated with an absence of steatotic liver disease and / or steatohepatitis when obtained from samples of subjects known not to have steatotic liver disease and / or steatohepatitis.
[0064] As will be appreciated by one of ordinary skill in the art upon study of this document,the steatotic liver disease and / or steatohepatitis status of the subject can be determined by comparison to control data. For example, if the mitochondrial bioenergetics reserve is aligned with control data associated with a presence or severity of steatotic liver disease and / or steatohepatitis, or if it is lower than control data associated with an absence of steatotic liver disease and / or steatohepatitis, then the status of the subject can be determined to be the presence or the severity of steatotic liver disease and / or steatohepatitis.
[0065] In some embodiments, the control data can comprise compilations of data, such asmay be contained in a table, chart, graph, or database, which provides mitochondrial bioenergetics reserve assessment data from a plurality of subjects of known steatotic liver disease status and / or known steatohepatitis status.
[0066] In some embodiments, the reference can be mitochondrial bioenergetics reserveassessment of a sample obtained from the subject at a distinct time point. For example, in some embodiments, data from a sample of the subject from an earlier time point can be referenced. In some embodiments, the sample is a baseline sample, to which subsequent samples from the subject will be compared. In some embodiments, the baseline sample isprior to onset of steatotic liver disease and / or steatohepatitis status. In some embodiments, the baseline sample is obtained at or around the time of an ultrasound identifying fat accumulation in the liver.
[0067] As will be appreciated by one of ordinary skill in the art upon study of this document,the steatotic liver disease and / or steatohepatitis status of the subject can be determined by comparison the sample obtained from the subject at a distinct time point. For example, if the mitochondrial bioenergetics reserve is decreasing over time, steatotic liver disease and / or steatohepatitis can be determined to be progressing. For another example, if the mitochondrial bioenergetics reserve is increasing over time, steatotic liver disease and / or steatohepatitis can be determined to be regressing. For another example, if the mitochondrial bioenergetics reserve is unchanged over time, steatotic liver disease and / or steatohepatitis status can be determined to be unchanged.
[0068] In connection with monitoring steatotic liver disease and / or steatohepatitis ortreatment thereof, treatment can be administered, continued, and / or altered. Treatments can include, as appropriate, prophylactic treatment (prior to diagnosis of condition or after diagnosis of an absence of condition) or therapeutic treatment (following diagnosis of condition). Such treatments can include, for example, preventing steatotic liver disease and / or steatohepatitis or the development of steatotic liver disease and / or steatohepatitis; inhibiting the progression of steatotic liver disease and / or steatohepatitis; arresting or preventing the development of steatotic liver disease and / or steatohepatitis; reducing the severity of steatotic liver disease and / or steatohepatitis; ameliorating or relieving symptoms associated with steatotic liver disease and / or steatohepatitis; and causing a regression of steatotic liver disease and / or steatohepatitis or one or more of the symptoms associated with steatotic liver disease and / or steatohepatitis. In some embodiments, treatments have a beneficial impact on associated symptoms and conditions, such as cirrhosis and cancer.
[0069] In some embodiments, a risk of or having steatotic liver disease and / or steatohepatitisis assessed. Prediction of a risk or increased risk refers to methods by which the skilled artisan can predict the course or outcome of the treatment for a condition in a subject. It does not refer to the ability to predict the course or outcome of a condition with 100% accuracy, or even that a given course or outcome is predictably more or less likely to occur. Instead, the skilled artisan will understand that the term refers to an increased probability that a certain course or outcome will occur; that is, that a course or outcome is more likely to occur in asubject exhibiting a given condition, when compared to those individuals not exhibiting the condition (e.g., control data). In certain embodiments, a prognosis is about a 5% chance of a given outcome, about a 7% chance, about a 10% chance, about a 12% chance, about a 15% chance, about a 20% chance, about a 25% chance, about a 30% chance, about a 40% chance, about a 50% chance, about a 60% chance, about a 75% chance, about a 90% chance, or about a 95% chance. Statistical significance is often determined by comparing two or more populations, and determining a confidence interval and / or a p value. See, e.g., Dowdy and Wearden, Statistics for Research, John Wiley & Sons, New York, 1983, incorporated herein by reference in its entirety. Preferred confidence intervals of the present subject matter are 90%, 95%, 97.5%, 98%, 99%, 99.5%, 99.9% and 99.99%, while preferred p values are 0.1, 0.05, 0.025, 0.02, 0.01, 0.005, 0.001, and 0.0001. In some embodiments of the presently- disclosed subject matter, a threshold degree of change in a prognostic or diagnostic indicator can be established, and the degree of change in the level of the indicator can simply be compared to the threshold degree of change in the indicator. An example of a threshold change is about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 50%, about 75%, about 100%, and about 150%.
[0070] In some embodiments of the methods disclosed herein, a neurotensin inhibitor isadministered to the subject. Neurotensin (NTS), a 13-amino acid peptide, or tridecapeptide, predominantly localized in specialized enteroendocrine (EE) cells of the small bowel and released by fat ingestion, facilitates fatty acid (FA) translocation in rat intestine, and stimulates growth of various cancers. NT, which is released from N-cells of the small bowel in response to intraluminal fats, facilitates free fatty acid (FFA) absorption from the intestinal lumen, stimulates pancreaticobiliary secretions, decreases gastric motility, and contributes to lipid metabolism and glucose control, although its precise role in these processes has not been previously delineated. The effects of NTS are mediated through three known NTS receptors (NTSR1, 2 and 3).
[0071] In some embodiments the neurotensin inhibitor can be an NTSR antagonist. As willbe appreciated by one or ordinary skill in the art upon study of this document, the neurotensin inhibitor including NTSR antagonists can be, for example, an RNA-based inhibitors. Examples of RNA interference (RNAi) molecules include small interfering RNA (siRNA), which is a double-stranded RNA molecules that guide the RNA-induced silencing complex (RISC) to degrade target mRNA (e.g., mRNA encoding NTSR), thereby preventingtranslation of the protein; antisense oligonucleotides (ASOs), which are single-stranded DNA or RNA molecules that bind complementary mRNA sequences (e.g., mRNA encoding NTSR), to block translation or induce degradation via RNase H; antibodies, including monoclonal antibodies that bind specifically to extracellular domains of receptors or other proteins, blocking ligand binding or inducing receptor internalization (e.g., NTS Receptors); small chemical molecules, which can bind to active or allosteric sites on a target protein (e.g., NTSR), inhibiting activity or altering conformation to prevent function; peptides and peptidomimetics, which include short amino acid sequences or synthetic analogs that mimic natural ligands or interaction motifs to competitively inhibit interactions (e.g., with NTSR); decoy receptors or ligands that sequester binding partners, preventing activation of the receptor (e.g., NTSR); and aptamers, which are short, structured nucleic acids that bind proteins with high specificity and affinity, functioning similarly to antibodies. Examples of specific inhibitors include, but are not limited to, the neurotensin antibodies described, for example, in Wu, et al.
[0047] . Another example is the NTSR1 antagonist known as SR 48692 (also known as meclinertant), having the following structure, and functional derivatives thereof: .
[0072] Some embodiments of the further comprise assessing NTSsignaling, wherein an increase in NTS signaling relative to a reference is associated with a presence or progression of steatotic liver disease and / or steatohepatitis. NTS signaling can be measured using various methods known in the art. For example, receptor expression can be measured, such as levels of NTSR1 and NTSR3 expression. Such measurements can be made, for example using qPCR (mRNA expression) or Western blotting (protein levels). For another example, downstream markers can be measured, such as assessing induction of CD36 (fatty acid transporter) as an earlier response and / or suppression of PGC1α and mitochondrial genes as a later response.
[0073] Some embodiments of the methods disclosed herein further comprise assessing lipiduptake in hepatocytes, wherein an increase in lipid uptake is associated with a presence orprogression of steatotic liver disease and / or steatohepatitis. Lipid uptake in hepatocytes can be measured using various methods known in the art. For example, a labeled fatty acid analog, such as a fluorescent fatty acid analog, can be employed. BODIPY-FL-C16 is an example of a fluorescently labeled long-chain fatty acid useful for visualizing and quantifying uptake. For another example, CD36 expression can be used to determined lipid uptake in hepatocytes. CD36 expression can be monitored, for example, by qPCR (mRNA expression) and Western blot (protein levels).
[0074] Some embodiments of the methods disclosed herein further comprise assessing fataccumulation in the liver, wherein fat accumulation is associated with a presence or progression of steatotic liver disease and / or steatohepatitis. Fat accumulation in the liver can be assessed using various methods known in the art. For example, a liver biopsy can be conducted by extracting a small sample of liver tissue for microscopic examination to determine the extent of fat accumulation, inflammation, and fibrosis. Ultrasound can be used to detect liver steatosis by measuring increased echogenicity and beam attenuation. CT scan is another imaging method that can be used to determine liver steatosis by measuring liver attenuation.
[0075] Some embodiments of the methods disclosed herein further comprise assessing liverstiffness, wherein increasing liver stiffness is associated with a presence or progression of steatotic liver disease and / or steatohepatitis. Liver stiffness can be assessed using various methods known in the art. For example, sonoelastography is a technique that can be used to assess liver stiffness, which is an important indicator of steatotic liver disease and steatohepatitis. This method measures the elasticity of liver tissue, helping to detect fibrosis and monitor the progression of liver diseases.
[0076] While the terms used herein are believed to be well understood by those of ordinaryskill in the art, certain definitions are set forth to facilitate explanation of the presently disclosed subject matter.
[0077] Unless defined otherwise, all technical and scientific terms used herein have the samemeaning as is commonly understood by one of skill in the art to which the invention(s) belong.
[0078] All patents, patent applications, published applications and publications, GenBanksequences, databases, websites and other published materials referred to throughout the entire disclosure herein, unless noted otherwise, are incorporated by reference in their entirety.
[0079] Where reference is made to a URL or other such identifier or address, it understoodthat such identifiers can change and particular information on the internet can come and go, but equivalent information can be found by searching the internet. Reference thereto evidences the availability and public dissemination of such information.
[0080] As used herein, the abbreviations for any protective groups, amino acids and othercompounds, are, unless indicated otherwise, in accord with their common usage, recognized abbreviations, or the IUPAC-IUBMB Joint Commission on Biochemical Nomenclature (See, iubmb.qmul.ac.uk / ).
[0081] Although any methods, devices, and materials similar or equivalent to those describedherein can be used in the practice or testing of the presently disclosed subject matter, representative methods, devices, and materials are described herein.
[0082] In certain instances, sequences disclosed herein are included in publicly-availabledatabases. Information including sequences and other information related to such nucleotides and polypeptides included in such publicly-available databases are expressly incorporated by reference. Unless otherwise indicated or apparent the references to such publicly-available databases are references to the most recent version of the database as of the filing date of this Application.
[0083] The present application can “comprise” (open ended) or “consist essentially of” thecomponents of the present invention as well as other ingredients or elements described herein. As used herein, “comprising” is open ended and means the elements recited, or their equivalent in structure or function, plus any other element or elements which are not recited. The terms “having” and “including” are also to be construed as open ended unless the context suggests otherwise.
[0084] Following long-standing patent law convention, the terms “a”, “an”, and “the” refer to“one or more” when used in this application, including the claims. Thus, for example, reference to “a cell” includes a plurality of such cells, and so forth.
[0085] Unless otherwise indicated, all numbers expressing quantities of ingredients,properties such as reaction conditions, and so forth used in the specification and claims are to be understood as being modified in all instances by the term “about”. Accordingly, unless indicated to the contrary, the numerical parameters set forth in this specification and claims are approximations that can vary depending upon the desired properties sought to be obtained by the presently disclosed subject matter.
[0086] As used herein, the term “about,” when referring to a value or to an amount of mass,weight, time, volume, concentration or percentage is meant to encompass variations of in some embodiments ±20%, in some embodiments ±10%, in some embodiments ±5%, in some embodiments ±1%, in some embodiments ±0.5%, in some embodiments ±0.1%, in some embodiments ±0.01%, and in some embodiments ±0.001% from the specified amount, as such variations are appropriate to perform the disclosed method.
[0087] As used herein, ranges can be expressed as from “about” one particular value, and / orto “about” another particular value. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself. For example, if the value “10” is disclosed, then “about 10” is also disclosed. I t is also understood that each unit between two particular units are also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed.
[0088] As used herein, “optional” or “optionally” means that the subsequently describedevent or circumstance does or does not occur and that the description includes instances where said event or circumstance occurs and instances where it does not. For example, an optionally variant portion means that the portion is variant or non-variant.
[0089] The presently disclosed subject matter is further illustrated by the following specificbut non-limiting examples. The following examples may include compilations of data that are representative of data gathered at various times during the course of development and experimentation related to the present invention. EXAMPLES
[0090] Example 1: NTS signaling promotes MASLD development
[0091] To determine the significance of NTS signaling in the pathogenesis of MASLD inhumans, NTSR (NTSR1, NTSR2 and NTSR3) expression in liver samples from patients with MASLD and MASH were compared with normal livers (patient characteristics are shown in Table 1). NTSR1 protein expression was significantly higher in MASLD and MASH livers (p = 0.0223 and p = 0.0029, respectively); NTSR3 expression was higher in MASLD livers but only reached significance in MASH samples (p < 0.0001) (FIG.1A). Gene expression analyses showed similar trends (FIG.1B), whereas NTSR2 expression was not detectable. Together, these data suggest that NTS signaling is upregulated in human steatotic livers. Table 1. Characteristics of patients from whom liver samples were obtained. Sample Sex AgeBMI Diabetes Diagnosisa Clinical feature(Years) sis ;
[0092] To identify the molecular drivers of NTS-mediated maladaptive fat metabolism in theliver, Nts+ / + and Nts− / − female mice were fed LFD or HFD for 28 weeks to induce MASLD. HFD significantly increased liver weight, liver weight to body weight ratio and induced steatosis, oxidative stress and inflammatory gene expression in the livers of Nts+ / +mice (FIG.1C-1H, FIG.2A). Livers harvested from Nts− / − mice were protected from the adverse effects of HFD as noted by significantly reduced lipid accumulation, oxidative stress and inflammation. Hierarchical clustering of gene expression showed that NTS signaling significantly upregulated hepatic lipid uptake and decreased mitochondrial energy metabolism under HFD conditions (FIG.1I). Cluster of differentiation 36 (CD36), a long- chain FA transporter, is weakly expressed in normal hepatocytes but is significantly increased in MASLD livers
[0017] . CD36 expression was increased in livers of Nts+ / +, but not Nts− / −, mice fed HFD. Expression of the mitochondrial biogenesis protein, PGC1α, was decreased in both genotypes under HFD conditions, although the effect was less severe in Nts− / − livers (~67% decrease in WT vs ~39% in KO). In accordance, PGC1α transcriptional targets, tfam, OXPHOS and β-oxidation genes (acadl and hadha) were significantly decreased in the livers of Nts+ / + mice fed HFD only (FIG.1I). Treatment of primary mouse hepatocytes with NTS over a time course revealed CD36 as an early response gene (1 h) and PGC1α as a late response gene (6 h) for NTS signaling (FIG.2B). FA stimulation had no effect on CD36 or PGC1α expression (FIG.2C). Together, these data suggest that NTS signaling promotes hepatic steatosis by inversely affecting two lipid metabolism pathways (i.e., lipid uptake and oxidative phosphorylation) in the liver.
[0093] Maladaptive energy metabolism in adipose tissue plays a significant role in steatosisdevelopment
[0018] ; therefore, the effects of NTS on adipose tissue lipid metabolism was examined. Although HFD increased CD36 expression across both genotypes, it was significantly higher in adipose tissue from Nts+ / + mice fed HFD (FIG.3A). This data is in accordance with their small but significantly increased body weight under the HFD condition in comparison with Nts− / − mice (FIG.3B). Consistent with the liver phenotype, PGC1α expression was decreased by HFD in white adipose tissue (FIG.3C), and the effect was less severe in Nts− / − adipose tissue (~90% decrease in WT vs 70% decrease in KO). The effect of NTS on brown adipose tissue lipid metabolism was comparatively smaller under HFD conditions (FIG.3A, 3C). Taken together these data imply a systemic effect of NTS on dysregulation of lipid metabolism.
[0094] Example 2: NTS promotes lipid uptake by transcriptionally increasing CD36expression
[0095] Increased CD36 expression is implicated in the onset of hepatic steatosis in MASLDby promoting FA uptake
[0019] . NTS stimulation strongly increased the uptake of several long-chain FAs such as palmitic acid (PA, C16:0, saturated), oleic acid (OA, C18:1, monounsaturated) and alpha linoleic acid (ALA, C18:3, polyunsaturated) in hepatocytes (FIG.4A) but not the absorption of medium-chain FA, lauric acid (LauA, C12:0, saturated); indicating that NTS could promote long-chain FA uptake through CD36. Because PA is a dominant source of dietary saturated FAs
[0020] , PA was selected for the subsequent studies.
[0096] Immunostaining (FIG. 4B-4C; FIG. 5A) showed that NTS stimulation significantlypromotes FA (BODIPY-labeled PA) uptake during the first 15–30 min of the lipid absorption phase. CD36 knockdown abolished NTS-stimulated FA uptake in hepatocytes (FIG.4D, FIG.5B), confirming CD36 to be the mediator of NTS’s effect on lipid absorption in the liver. NTS-induced CD36 upregulation was associated with activation of ERK signaling and its transcriptional effector, cJun (FIG.4E-4F; FIG.5C-5D), whereas PGC1α expression was significantly decreased. Subsequently, a conserved AP-1 binding motif was identified at 1061 bp upstream of the CD36 transcription start site in the mouse genome and show that NTS stimulation promotes pcJun73 binding at the identified AP-1 motif via ChIP assay (FIG. 4G). Notably, this sequence is conserved in the human CD36 promoter. Taken together, these data suggest a novel role for NTS signaling in increasing CD36 expression in steatotic livers.
[0097] Example 3: NTS inhibits mitochondrial energy metabolism
[0098] Given that NTS inhibits PGC1α expression, it was next determined whether NTSdeficiency improves hepatic mitochondrial function. Because NTS has a robust effect on intestinal lipid absorption
[0013] , young adult mice were fed a normal chow diet for mitochondrial activity comparisons. Livers from fasted (22 h) and fed (ad libitum) Nts+ / +and Nts− / −female mice were collected for RNAseq analysis. Gene set enrichment analysis revealed the upregulation of metabolic pathways related to mitochondrial bioenergetics, OXPHOS complex and TCA cycle in livers from Nts− / −mice under fasted, but not fed, conditions (FIG.5E; FIG.6A, B), which is consistent with the role of PGC1α in regulating lipid metabolism in fasted livers
[0021] . In accordance, PGC1α-regulated metabolic pathway (Mootha_PGC) was significantly enriched in livers from NTS-deficient mice and 40% of the upregulated genes were related to mitochondrial metabolism (FIG.6C).
[0099] Mitochondrial function analysis (mito stress test) showed that Nts− / − hepatocytes havesignificantly increased maximal respiration and spare respiratory capacity compared with Nts+ / +hepatocytes (FIG.6D, 6E), indicating that NTS deficiency improves mitochondrialadaptive function. Spare respiratory capacity is determined by the activity of the mitochondrial respiratory chain complexes
[0016] . NTS treatment (16 h) decreased the expression of OXPHOS complex proteins in hepatocyte mitochondrial fractions (FIG.6F).
[0100] Mitochondrial membrane potential, assessed by JC-1 dye aggregation ratio, isanother determinant of spare respiratory capacity. NTS stimulation did not alter JC-1 ratio (FIG.7A) in hepatocytes, suggesting that NTS signaling does not affect mitochondrial membrane potential. Taken together, these data suggest that NTS specifically decreases OXPHOS expression and activity leading to decreased mitochondrial adaptive function in the liver.
[0101] Example 4: NTS regulates mitochondrial OXPHOS function throughPGC1α inhibition
[0102] To functionally connect NTS signaling with PGC1α inhibition and OXPHOSmodifications, an NTSR1 specific antagonist, SR48692, was used
[0022] . SR48692 treatment reversed the NTS-induced decrease in PGC1α expression in primary hepatocytes (FIG.8A). NTS-mediated ERK signaling is further shown to regulate PGC1α at the transcriptional level since NTS treatment significantly decreased PGC1α promoter activity, which was reversed by treatment with PD98059, an MEK inhibitor (FIG.8B)
[0023] .
[0103] PGC1α overexpression increased OXPHOS expression (FIG. 7B, 7C) inHepG2 cells. NTS decreased mitochondrial function in control (Hep-pcDNA), but not in cells that overexpress PGC1α as noted by mito stress test (FIG.8C). Conversely, PGC1α knockdown decreased the expression of several OXPHOS genes (FIG.7D). Therefore, these studies demonstrate a role for NTS / NTSR1 signaling in the regulation of mitochondrial bioenergetics through PGC1α inhibition.
[0104] Next, the physiological significance of PGC1α inhibition by NTS in the liverunder HFD conditions was evaluated. Lipid (PA) stimulation induced AMPK phosphorylation and significantly increased the expression of PGC1α and its target, TFAM, along with OXPHOS and 13 oxidation genes in hepatocytes (FIG.8D-8F), suggesting that hepatocytes can activate oxidative metabolism pathways through the AMPK / PGC1α axis to respond to the excess lipid influx during MASLD. This adaptive response is attenuated by NTS signaling. It was next examined whether NTS-induced defects in oxidative metabolism could promote accumulation of lipid droplets in hepatocytes by inhibiting their catabolism.Hepatocytes from Nts+ / + mice were treated with exogenous PA for 24 h and then cultured in lipid-free media for another 24 h to allow for utilization of absorbed lipids as substrate. NTS significantly increased lipid droplet accumulation in PA-treated hepatocytes at 48 h (FIG. 8G), suggesting impaired degradation of FAs in the presence of NTS signaling. In accordance with this finding, lipid accumulation was significantly increased in hepatocytes isolated from Ntsr1+ / +mice (FIG.8H), but not in Ntsr1− / − hepatocytes.
[0105] NTS inhibits PGC1α, which acts as a lipid sensor in the liver Collectively, thedata indicate that PGC1α acts as a lipid sensor in the liver. To address this, in livers and primary hepatocytes from LFD-fed Nts+ / +mice, it is shown that PGC1α expression is predominantly localized in the cytosolic region (FIG.9A, 9B). Lipid (PA) stimulation shifts PGC1α to the nuclear fraction of hepatocytes, where it can activate lipid catabolism-related genes. NTS, as well as treatment with an AMPK inhibitor (i.e., C compound) blocked PA- induced nuclear localization of PGC1α (FIG.9B-9E) supporting the notion that NTS inhibits AMPK-mediated PGC1α activation and its nuclear translocation. More-over, immunoprecipitation analyses of PGC1α from nuclear fractions of livers from mice fed either LFD or HFD for 50 weeks (FIG.9F) showed that HFD promotes PGC1α phosphorylation by AMPK in Nts− / − liver, which was attenuated in the livers of Nts+ / + mice. Notably, AMPK- mediated phosphorylation is required for PGC1α activation and self-transcription using a feed forward loop in skeletal muscle
[0024] . Taken together, these data suggest that NTS signaling diminishes lipid catabolism capacity by inhibiting the lipid-induced AMPK / PGC1α signaling axis in liver.
[0106] Example 5: NTS signaling inhibits lipid catabolism in the liver
[0107] β oxidation, Krebs (TCA) cycle and oxidative phosphorylation represent thethree intricately related components of efficient lipid catabolism. Comparison of FAO activity in livers from Nts+ / + and Nts− / − male mice fed LFD or HFD for 23 weeks (FIG. 10A) showed that HFD significantly decreased FAO capacity in livers from Nts+ / + mice in comparison with Nts− / − livers, which was consistent with increased liver weight and downregulated PGC1α-related genes in livers of HFD-fed Nts+ / + mice (FIG.11A-11C). In accordance, PA oxidation assay indicated that long-term HFD feeding (50–60 weeks) strongly decreases mitochondrial OCR in the hepatocytes from male WT mice but not NTS- deficient mice (FIG.10B, C).
[0108] Next, Krebs cycle activity was measured in hepatocytes isolated from Nts+ / +and Nts− / − mice fed HFD for 23 weeks using 13C6-glucose as a tracer in stable isotope resolved metabolomics (SIRM) analysis. Results from 1D HSQC NMR analysis showed increased 13C incorporation into glutamate, aspartate and glutathione (GSH + GSSG) in hepatocytes of Nts− / − mice (arrows) relative to those of Nts+ / +mice (FIG.12A), which is consistent with increased Krebs cycle activity and glutathione synthesis. In addition, NTS deficiency led to increased 13C incorporation into the ribose moiety of adenine, guanine and uracil nucleotides and NAD+ (FIG.12A, arrows), suggesting enhanced nucleotide biosynthesis via the pentose phosphate pathway, which provides the ribose precursor. These data confirm that NTS deficiency improves mitochondrial 13 oxidation and Krebs cycle rate and may also improve cellular redox homeostasis as the pentose phosphate pathway produces NADPH for regenerating reduced glutathione, which plays an important role in cellular antioxidant defense.
[0109] Mitochondrial ROS generated during 13 oxidation of FA can serve as anindicator of oxidative phosphorylation capacity
[0025] . NTS attenuated mitochondrial ROS generated during PA catabolism in hepatocytes as measured using MitoSOX Red dye staining (FIG.10D).
[0110] Example 6: NTSR1 is the major NTS receptor in liver
[0111] To delineate the direct effect of NTS signaling in the liver, Ntsr1 expression inmouse liver was confirmed using hepatocytes isolated from Ntsr1+ / +and Ntsr1− / − mice (FIG.12B). Next, the effect of NTS and PA treatment on mitochondrial function of hepatocytes isolated from Ntsr1+ / +and Ntsr1− / −mice was compared. PA increased basal respiration and ATP production in hepatocytes but decreased their spare respiratory capacity (FIG.12C). The PA-induced inhibition of OXPHOS expression was reversed by treatment with N-acetyl cysteine (NAC, an antioxidant) (FIG.12D), suggesting that PA-induced oxidative stress inhibits the OXPHOS function of hepatocytes.
[0112] The lowest concentration of PA was selected for the combination studies. NTSpotentiated the inhibitory effect of PA on spare respiratory capacity in hepatocytes from Ntsr1+ / +mice; whereas Ntsr1− / − hepatocytes were resistant to NTS- and / or PA-induced decrease in OXPHOS function (FIG.10E; FIG.13A, 13B). Analysis of hepatocyte mitochondrial fractions showed that NTS and PA treatment synergistically decreased theexpression of OXPHOS protein complexes in hepatocytes from Ntsr1+ / +mice (FIG.10F, FIG.13C-13F). Together, these data suggest that NTS signaling predisposes the liver to oxidative phosphorylation defects, which is exacerbated in the presence of lipids.
[0113] The expression of OXPHOS complex proteins was comparatively lower atbasal level in hepatocytes from NTSR1-deficient mice but significantly increased with combination treatment (FIG.10F, FIG.13C-13F). To clarify this, it was shown that in Ntsr1− / − hepatocytes, PGC1α is mostly localized in the nucleus (FIG.10G), which is likely due to their increased AMPK phosphorylation levels (FIG.14A, 14B). These data are therefore consistent with NTS signaling inhibiting AMPK / PGC1α signaling axis and associated mitochondrial lipid metabolism capacity of liver.
[0114] NTSR3 deletion partially rescued mitochondrial dysfunction induced by NTStreatment, and the effects were less robust than those noted with deletion of NTSR1 (FIG. 14C). Analysis of lipid utilization rate using escalating doses of PA (FIG.10H) showed significant accumulation of unmetabolized lipid in wild type hepatocytes (Ntsr1+ / + and Ntsr3+ / +). No significant lipid accumulation was observed in hepatocytes isolated from Ntsr1−‘− mice, confirming their increased metabolic rate; hepatocytes isolated from Ntsr3−’ − mice failed to metabolize the excess lipid at higher PA concentrations. These data suggest that NTS signaling through NTSR1 is the major mediator of maladaptive fat metabolism in MASLD, whereas NTSR3 most likely plays a supportive role.
[0115] Example 7: Association of NTS signaling with mitochondrial dysfunctionin human fatty liver samples
[0116] It was next examined whether NTS-induced mitochondrial dysfunction couldbe associated with MASLD in humans. Database analyses (FIG.15A) showed that PGC1α expression is significantly decreased in the advanced stage of MASLD (Group 3 / 4 / 5 vs Group 0, p = 0.043; EMBL-EBI database, Accession No. E-MTAB-4856). Comparison of human liver samples (FIG.14D; FIG.15B) showed that expression of OXPHOS complex I, III and V was decreased in MASLD and MASH samples, although significance was only achieved for complex V (p = 0.0273 and p = 0.0165, respectively). Importantly, the expression of OXPHOS complexes I and V was significantly and inversely correlated with NTSR1 expression in human liver, whereas CD36 was positively correlated with NTSR1 expression (FIG.14D-14F; FIG.15C, 15D).
[0117] To further confirm the findings, THLE2 cells were used, which are modelhepatocyte cell line derived from adult human liver. NTS consistently increased CD36 but decreased PGC1α expression in THLE2 cells (FIG.15E). Moreover, NTS significantly compromised mitochondrial function in THLE2 cells (FIG.15F), thereby establishing a multifaceted and consequential role of NTS signaling in the initiation of MASLD in humans.
[0118] Example 8: NTS signaling regulates of hepatic lipid metabolism andmitochondrial dysfunction in fatty liver disease
[0119] The studies described in these examples investigated the mechanism by whichNTS / NTSR1 / NTSR3 signaling can promote hepatic steatosis under HFD conditions in mice. It was shown that NTS signaling promotes lipid uptake at the expense of mitochondrial bioenergetic reserve in hepatocytes. It was also demonstrated that the association of this signaling pathway with steatosis in human livers and indicating that targeting NTS signaling has utility in treatment of SLD.
[0120] Under obese conditions, the liver is overwhelmed with excess lipid influx, andincreased mitochondrial catabolism is required for efficient disposal of the fat overload
[0026] . Disruption in this energy homeostasis mechanism is central for onset of MASLD. Here, a unique role for NTS signaling is demonstrated in the initiation of steatosis by promoting lipid uptake through CD36 at the expense of bioenergetic capacity of hepatocytes. NTS signaling is shown to oppositely regulates two critical drivers of lipid metabolism: CD36 and PGC1α. This compromises the liver’s ability to efficiently catabolize lipids, resulting in steatosis. The first evidence that NTS signaling is significantly upregulated in livers of patients with MASLD and MASH is provided herein, making this pathway an attractive target for therapeutic intervention.
[0121] CD36, a high-affinity receptor for free FAs, is implicated in the onset ofsteatosis in MASLD
[0017] . It was demonstrated that NTS-induced ERK signaling rapidly upregulates hepatic CD36 expression to promote lipid uptake, as opposed to the well- established mechanism of nuclear receptor-mediated transcription which requires a longer time for activation
[0027] . It is plausible that NTS signaling evolved to promote rapid lipid absorption in gastrointestinal tissues to compensate for poor dietary lipid availability. In the presence of excess lipid, this mechanism can promote steatosis only if mitochondrial function becomes compromised, as NTS confers an advantage during the initial period of lipid uptake.Thus, NTS-mediated mitochondrial dysfunction is found to play a predominant role in amplifying the deleterious effects of excess lipid ingestion.
[0122] PGC1α, the transcriptional coactivator, is implicated in exercise-and fasting-induced improvements in metabolic adaptation of the liver
[0028] . It was shown that PGC1α acts as a lipid sensor and transcriptionally activates genes involved in lipid catabolism, particularly β oxidation and oxidative phosphorylation genes. Interestingly, livers from NTS- or NTSR1-deficient mice expressed less OXPHOS proteins but showed higher fat metabolism capacity. To clarify, it was shown that NTS deletion promotes PGC1α nuclear translocation through an AMPK-dependent manner, allowing for rapid transcription of oxidative metabolism genes in response to nutritional stress cues. This enhanced capability to respond to the nutritional cues
[0029] represents the adaptive function of the liver and is compromised by NTS signaling. Thus, when challenged with HFD conditions, NTS / NTSR1- deficient hepatocytes demonstrate better mitochondrial adaptive response. Accordingly, NTS deletion improves the FAO rate in mouse livers, whereas HFD feeding induces a progressive decline in FAO capacity in livers of Nts+ / + mice, with an approximate 50% reduction in hepatic FAO capacity of mice fed HFD for a longer time. Similarly, Li et al.
[0015] reported that NTS secreted from the lymphatic system inhibits adaptive thermogenesis in brown adipose tissue, although a direct mechanism was not identified.
[0123] In this study NTS is identified as a major regulator of PGC1α-mediatedmitochondrial adaptive function in the liver and established the importance of this signaling mechanism in the pathogenesis of steatosis in mice. In human liver samples, NTS signaling and its receptors are strongly associated with increased lipid intake but compromised oxidative phosphorylation. Koliaki et al.
[0030] reported impaired mitochondrial biogenesis in livers of obese MASLD patients and suggested that loss of mitochondrial bioenergetic capacity facilitates MASLD progression to MASH; interestingly, oxidative damage was not noted prior to the development of MASH. Notably, PGC1α is also responsible for maintaining redox balance in tissues
[0031] and liver-specific PGC1α deletion exacerbates MASH phenotype in mice fed a Western diet
[0032] . This suggests that impaired mitochondrial biogenesis is crucial in MASLD initiation and progression to MASH in humans. NTS deletion likely improved redox homeostasis in liver, as shown by SIRM analysis, and reduced oxidative stress in livers of HFD-fed Nts− / − mice (see FIG.1H). Improved redoxhomeostasis also clarifies why Ntsr1− / − hepatocytes were resistant to PA-induced oxidative damage (see FIG.10E, 10F).
[0124] In MASLD, “metabolic inflexibility” of the adipose tissue is one of theprimary factors leading to lipid overload conditions in the liver
[0018] . It was found that NTS signaling likely encourages a similar state of metabolic deregulation in white adipose tissue by inversely affecting CD36 and PGC1α expression. It is noteworthy that CD36 is required for long chain FA mobilization in adipocytes
[0033] , and increased CD36 expression was recently associated with white adipose tissue dysfunction and systemic inflammation in fasting obese individuals
[0034] . Interestingly, the low affinity NTS receptor, NTSR2 appears to be dominant in adipose tissue (~100-fold increase of NTSR2 mRNA expression compared with the expression of NTSR1 in white adipose tissue) (FIG.3D, 3E). This suggests that the liver, which only expresses the high affinity receptor, NTSR1, would be more susceptible to metabolic fluctuations by peripheral NTS signaling. Accordingly, Li et al.
[0015] noted that significantly larger doses of NTS (micromolar concentrations) were required to exert its anti- thermogenic effect in brown adipose tissue.
[0125] Free FAs from adipose tissue and dietary sources are estimated to account forabout 60% and 15% of liver triacylglycerols in MASLD patients, respectively, under postprandial conditions
[0035] . Dietary overconsumption and ensuing adiposity is suggested to stimulates excess NTS release, which promotes hepatic lipid uptake but reduces the bioenergetic capacity of hepatocytes (FIG.15G). This results in impaired fat catabolism and steatosis. Importantly, a direct effect of NTS on steatosis development is shown and the NTS / NTSR1 signaling axis represent a novel therapeutic target for MASLD. This supposition is corroborated by epidemiological data [10, 11] and findings by Wu et al.
[0036] , who showed significant reduction in liver and body weight in HFD-fed mice when treated with a pro-NTS targeted monoclonal antibody.
[0126] Adipose tissue-liver crosstalk plays a significant role in MASLDdevelopment. Given the well-established role of adipokines like leptin and adiponectin in MASLD development, it is possible that either of these hormones was altered in the presence of NTS signaling. Specifically, the anorectic hormone leptin has been shown to modulate NTS secretion in rodent brain and to regulate feeding behavior
[0037] . Nevertheless, the findings disclosed herein provide evidence for NTS contributing a direct effect on the maladaptive lipid metabolism in the liver as noted with MASLD.
[0127] Example 9: Materials
[0128] PGC1α (2178), phospho-p44 / 42 ERK / MAPK(Thr202 / Tyr204) (4370),phospho-cJUN (3270), TOM20 (42406), histone H3 (4499) antibodies were from Cell Signaling Technology (Danvers, MA). OXPHOS rodent antibody cocktail (45-8099) was purchased from ThermoFisher Scientific (Waltham, MA). CD36 (NB400-144) antibody was from Novus Biologicals (Centennial, CO). PGC1 (AB3242) antibody was from Millipore (Burlington, MA). BODIPY FL (D2184), BODIPY FL-C16 (D3821) and Hoechst 33342 (H1399) dyes were from ThermoFisher Scientific. PD98059 was from Selleck Chemicals (Houston, TX). SR48692 was from Tocris (Minneapolis, MN). NTS and Liberase (5401020001) were from Sigma-Aldrich (St. Louis, MO). HepG2 and THLE-2 cells were purchased from ATCC (Manassas, VA) and cultured in Minimal Essential Media (GIBCO, 110985-080) with 10% FBS + 1% Penicillin / Streptomycin (for HepG2) and Bronchial epithelial growth media (Lonza, CC-3170) with 5 ng / ml epidermal growth factor, 70 ng / ml phosphoethanolamine, 10% FBS and 1% Penicillin / Streptomycin (for THLE-2), according to ATCC recommendations.
[0129] Example 10: Plasmids and shRNA
[0130] PGC1α promoter 2kb luciferase (plasmid #8887) and pcDNA 3.1 Flag-PGC1-α1 (plasmid #45501) were obtained from Addgene (Watertown, MA)
[0038] , and were transfected into HepG2 cells using Lipofectamine 3000 reagent (ThermoFisher Scientific). PGC1α and NTSR1 expression in HepG2 and THLE2 cells were knocked down using shRNA; RCN0000357674 for NTSR1 and TRCN0000001168 for PGC1α (Sigma-Aldrich). Protein overexpression and knockdown were verified by qPCR. PGC1α promoter activity was measured 6 h after NTS treatment using Dual Glo Luciferase Assay (Promega, E2920). CD36 expression in isolated mouse hepatocytes(C57 / BL6) was transiently knocked down using two lentiviral shRNA; TRCN0000066520 and TRCN0000066522 from Sigma-Aldrich. A non-targeted control vector (shC016VN) was used as a transfection control. Briefly, hepatocytes plated on coverslips were transfected with non-targeted control or CD36 knockdown lentiviral shRNA for 16 h, allowed to recover for 24h and then utilized for lipid uptake assay. CD36 knockdown was verified by qPCR.
[0131] Example 11: Mice
[0132] All protocols were performed according to ethical guidelines of theInstitutional Animal Care and Use Committee at the University of Kentucky. Nts+ / +and Nts- / -(whole body) mice
[0039] were bred from Nts+ / -mice and maintained in 14 h light / 10 h dark cycle with ad libitum access to food and water. Ntsr1+ / +and Ntsr1- / -(whole body) were bred from heterozygous B6.129P2-Ntsr1 tmDgen / J mice (The Jackson Laboratory, Bar Harbor, MI) and housed similarly. Ntsr3+ / +and Ntsr3- / -mice (whole body; Taconic Biosciences, Cambridge City, IN)
[0040] were bred and housed similarly. Mice were placed on low-fat diet (LFD; 10% kCal from fat, 70% kCal from carbohydrate, 20% kCal from protein containing 0.0018% cholesterol (w / w); D12450B, Research Diets, New Brunswick, NJ), HFD (60% kCal from fat, 20% kCal from carbohydrate, 20% kCal from protein containing 0.03% cholesterol (w / w); D12492, Research Diets), or normal chow diet at weaning. Age- and sex-matched littermates were used for all studies. In addition, male C57 / BL6 mice (The Jackson Laboratory) fed normal chow were used for hepatocyte isolation and some mechanistic studies.
[0133] Example 12: Hepatocyte isolation
[0134] Primary hepatocytes were isolated by a two-step collagenase perfusiontechnique
[0041] . Briefly, mice were anesthetized with ketamine / xylazine and livers were perfused by retrograde perfusion into the vena cava. Following Liberase digestion and Percoll (15–40%) gradient centrifugation, viable hepatocytes were plated on collagen-coated dishes at 80% confluency for 3 h in DMEM + 10% FBS + 1% penicillin / streptomycin (plating) media and then in William’s E media + 2 mM glutamine + 1% penicillin / streptomycin (maintenance media). All experiments were performed within 48 h of isolation, except for lipid utilization assays and CD36 knockdown assays which required 72 h.
[0135] Example 13: Mitochondrial fractionation
[0136] Cytosolic / mitochondrial fractionation was performed by the sucrose densitygradient method
[0042] . Briefly, hepatocytes were washed with PBS, homogenized in sucrose buffer and centrifuged at 1000 g for 10 min at 4°C to remove cell debris and nuclei. Supernatants were then centrifuged at 13000 g for 20 min to separate cytosolic (supernatant) and mitochondrial (pellet) fractions. TOM20 was used as a mitochondrial marker, whereas actin or tubulin was used as a cytoplasmic marker.
[0137] Example 14: Mito stress test
[0138] Mito stress test was performed using Seahorse XF96 extracellular fluxanalyzer. Briefly, 5000 hepatocytes were plated on collagen-coated XF96-well plates, and at indicated timepoints, oligomycin (1 µM), FCCP (1 µM) or rotenone + antimycin A (0.5 µM) was added. Oxygen consumption rate (OCR) measurements were normalized to cell count. For THLE2, 10000 cells / well were tested with similar drug concentrations. For HepG2, 15000 cells / well were plated and oligomycin (1.5 µM), FCCP (1 µM) or rotenone + antimycin A (1 µM) was used for mito stress test. Data were quantified from 2–5 independent experiments and at least 5 wells / group.
[0139] Example 15: Lipid utilization assays
[0140] Isolated hepatocytes in dark 96-well plates (8000 cells / well) were incubatedwith palmitic acid (PA) for 24 h. Cells were washed extensively and incubated in lipid-free media for another 24 h. Unmetabolized lipids were measured by BODIPY staining (neutral and nonpolar lipid stain) and counterstaining with Hoechst 33342 (nuclear stain). Fluorescence intensity of BODIPY was measured by spectrophotometer (Varioskan LUX microplate reader) and normalized to Hoechst as described previously
[0042] . Hepatocytes plated on coverslips were treated similarly for immunofluorescence staining with BODIPY (neutral lipid stain) and Hoechst.
[0141] Example 16: Bioinformatics
[0142] Normalized whole-transcriptomic profiling array data were downloaded fromthe EMBL-EBI database
[0043] . Disease stages 3, 4, 5 were combined into a single group to account for the relatively small samples in these groups. ANOVA with post-hoc Tukey’s HSD test was applied to the log2-transformed expressions of the gene of interest, PPARGC1A, to test the difference among the four disease stages (0, 1, 2 and 3 / 4 / 5). Data processing and analyses were performed using R (v.4.0.0).
[0143] Example 17: Human samples
[0144] Fresh-frozen human liver samples (100 mg) were obtained from the LiverCenter Biorepository at the University of Kansas Medical Center. Samples were obtained from rejected donor organs, and disease status (normal, MASLD, MASH) was determinedhistologically from H&E-stained sections. Liver samples were ground in liquid nitrogen for protein and RNA extraction.
[0145] Example 18: Statistical analyses
[0146] Descriptive statistics (mean and standard deviation) and bar graphs weregenerated to summarize biological and molecular markers for each genotype, diet and other experimental parameters. One-way ANOVA for multiple groups or multiple doses, or two- way ANOVA with interaction for genotype and diet experiments was utilized. Pairwise comparisons between groups were performed within the ANOVA models with adjustment for multiple testing using the Holm’s p-value adjustment. Linear mixed models were employed to model repeat measurements over time in Seahorse, Mito stress and other experiments. Two-sample t-tests were employed for two-group experiments. Assessment of normality assumptions and model fit were performed and appropriate data transformations or model fit adjustments were utilized. Statistical analyses were performed using SAS 9.4.
[0147] Example 19: GSH:GSSG ELISA
[0148] For measurement of oxidative stress, reduced (GSH) vs oxidized (GSSG)glutathione levels were assessed from snap frozen liver tissue using GSH / GSSG ratio detection kit II (Fluorometric) from Abcam (ab205811; Cambridge, United Kingdom) using the manufacturer’s recommended protocol. Data were normalized to protein concentration measured using Bradford assay.
[0149] Example 20: RNAseq analyses and gene set enrichment analyses
[0150] Total RNA was extracted from snap frozen liver tissues and RNAseq and geneset enrichment analyses were performed as previously described
[0044] . RNAseq data is available through the Gene Expression Omnibus (NCBI NIH) under accession number GSE290723.
[0151] Example 21: Histology
[0152] Livers were fixed in 10% neutral-buffered formalin, embedded in paraffin,sectioned and H&E staining was performed. Evaluation of steatosis and NAS (NAFLD activity score) was performed by a pathologist blinded to treatment conditions andsubsequently scored according to the NASH Clinical Research Network Scoring System as described by Kleiner et al.
[0045] .
[00153] Example 22: Western blot
[0154] Protein was extracted from snap frozen liver tissues or cells with RIPA buffer,and an equal volume of protein was separated in 4–12% NuPAGE Bis Tris gels (ThermoFisher Scientific), and western blots were performed as described by Xiong et al.
[0042] .
[00155] Example 23: Real time PCR
[0156] Total RNA was isolated from snap frozen liver tissues or cells using theRNeasy Mini kit (Qiagen, Germantown, MD). Based upon purity, RNA from 4 mouse livers / genotype were used for cDNA synthesis and real-time PCR reactions were performed using mouse specific primers as described previously
[0013] . Similar protocol was used for human primers. Primer sequences used in this study are shown in Tables 2-4. All values were normalized to β-actin. Hierarchical clustering of gene expression change was made using Heatmapper software. RNeasy lipid tissue minikit (Qiagen #74804) was used for RNA isolation from snap frozen adipose tissues and RNA from 4 mouse adipose tissue were used for cDNA synthesis and real-time PCR as described above. Table 2. qPCR Primers - TaqMan Primers Gene Species TaqMan Probe Company PPARA Mouse Mm00440939_m1 ThermoFisher ScientificTable 3. qPCR Primers - SYBR Green Primers Gene Species Forward Primer SEQ ID NO: Reverse Primer SEQ ID NO: (5’ – 3’) (5’ – 3’) ACADM Mouse AACACTTACTATGCCTCG 1 CCATAGCCTCCGAAAATC 2Table 4. qPCR Primers - ChIP Mouse Primers (SYBR Green) Forward Primer (5’ – 3’)TGCTATCAGCTGTGTATGGGT SEQ ID NO: 57Reverse Primer (5’ – 3’) GCACTGCTCTGACTAGGCAA SEQ ID NO:
[0157] Example 24: Immunostaining
[0158] For PGC1α localization, hepatocytes were plated on collagen-coatedcoverslips and fixed with 4% paraformaldehyde / PBS after either NTS or PA treatment. Following blocking and permeabilization, cells were immunostained with PGC1α antibody (Cell Signaling Technology, 2178), AMPKɑ2 antibody (Santa Cruz, sc-19391), anti-rabbit Alexa Fluor 488 secondary antibody (ThermoFisher Scientific, 11008) and anti-goat Alexa Fluor 594 antibody (ThermoFisher Scientific, ab150132). Hoechst 33342 was used to stain nuclei. CD36 immunostaining (ab23680) was performed in a similar manner after fixation with ice cold methanol. Confocal images were obtained using an Olympus FV1000 microscope fitted with a camera. Data were analyzed using ImageJ Fiji software (NIH) and raw values were normalized to Hoechst staining. Formalin-fixed liver sections were blocked (10% donkey serum + 1% BSA), immunostained with anti-PGC1 (Millipore, ab3242) and β- catenin (Santa Cruz, sc-1496), respectively, after deparaffinization and antigen retrieval (citrate buffer) steps. Sections were then counterstained with anti-rabbit Alexa Fluor 594, anti-goat Alexa Fluor 488 antibodies and Hoechst (nuclear stain). Slides were washed with 10 mM CuSO4 and 50 mM NH4Cl solution to reduce autofluorescence and confocal images were taken after mounting with Prolong Gold Antifade reagent. PGC1 nuclear or cytoplasmic distribution in liver sections was analyzed by Cyt / Nuc macro in ImageJ and fluorescence intensity was normalized to respective nuclear or cytoplasmic areas from 4 images.
[0159] Example 25: JC-1 staining
[0160] Mitochondrial membrane potential was measured by a JC-1 membranepotential assay kit (Abcam, ab113850) in a 96-well plate format using the manufacturer’s recommended protocol.
[0161] Example 26: Cytosolic and nuclear-chromatin fractionation andimmunoprecipitation
[0162] NE-PER nuclear and cytoplasmic extraction kit (ThermoFisher, #78833) wereused for fractionation of hepatocytes and fresh liver. Chromatin pellet was homogenized with a probe sonicator (4 min) to extract chromatin-bound proteins. Tubulin was used as cytosolic marker and histone H3 expression was used as nuclear and chromatin fraction marker. Livers were collected from mice after cervical dislocation, homogenized and nuclear fractions were isolated by NE-PER kit. Nuclear fractions were further sonicated with a probe sonicator (4 min) and resulting nuclear and chromatin proteins were immunoprecipitated with PGC1 antibody (1:100 dilution, Millipore, ab3242) overnight. Next day, antibody was pulled down with protein A / G agarose resin for 4 h and then immunoprecipitated proteins were resolved by western blot for detection of AMPK-specific phosphorylation using antibody (Cell Signaling, #5759). Blots were further probed for total PGC1α (Cell Signaling, #2178).
[0163] Example 27: CHIP assay
[0164] Hepatocytes were plated in two 10 cc dishes, treated and then crosslinked withformaldehyde for 10 min, quenched with glycine and lysed in CHIP lysis buffer according to X-CHIP protocol (Abcam). Proteins were precipitated (16 h) from sonicated chromatin using pcJUN73 antibody (Cell Signaling, #3270), rabbit IgG control antibody (Cell Signaling, #2729) or histone H3 antibody (Cell Signaling, #4620) at 1:50 ratio. Antibodies were precipitated with protein A / G agarose resin, washed extensively, reverse crosslinked with RNase A and proteinase K enzymes in elution buffer (1% SDS, 100 mM NaHCO3). After purification, bound DNA fragments were analyzed by qPCR using primers spanning the entire promoter region (+100 to –1500 bp). Primers were designed from University of California Santa Cruz genome browser (genome.ucsc.edu) using the mouse genomic DNA sequence (GRCm39 / mm39) as reference.
[0165] Example 28: Flow cytometry
[0166] Hepatocytes were treated overnight with or without NTS (10 nM), and then100 µM PA for 3 h. Cells were washed extensively and labeled with MitoSOX Red (1 µM) in warm media for 30 min in cell culture incubator. Cells were then washed extensively and MitoSOX uptake was measured within 1 h (BD FACSymphony A3 Cell Analyzer) using the BB630 channel.
[0167] Example 29: FAO assay
[0168] Octanoate β oxidation assay was performed in liver tissues using the fatty acidoxidation assay kit (Biomedical Research Service, University of Buffalo, Buffalo, NY, E- 141) according to the manufacturer’s recommendation. Palmitate oxidation assay (Seahorse XF96) was performed using 200 µM PA, 4 µM etomoxir or BSA (control) in the presence of oligomycin (1 µM), FCCP (1 µM) or rotenone + antimycin A (0.5 µM) according to the manufacturer’s recommended protocol. Data were normalized to protein concentration.
[0169] Example 30: BODIPY-C16 uptake
[0170] Hepatocytes were plated on collagen-coated coverslips and pretreated withNTS for 1 h. Next, BODIPY-C16 (1 µM) was added directly to the media; at indicated timepoints, coverslips were washed and fixed with 4% paraformaldehyde in PBS. Coverslips were stained with Hoechst and mounted using Prolong Gold anti-fade reagent (ThermoFisher Scientific). Images were obtained using FV1000 Olympus confocal microscope using 20 × or 40 × (oil) objective. Data were quantified by ImageJ Fiji software (NIH) and normalized to Hoechst staining.
[0171] Example 31: Metabolomics
[0172] Analysis of Krebs cycle activity in hepatocytes via 1D HSQC NMR wasperformed using13C6-Glucose as tracer as previously described
[0046] .
[0173] All publications, patents, and patent applications mentioned in thisspecification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference, including the references set forth in the following list: REFERENCES 1. Estes C, Razavi H, Loomba R, Younossi Z, Sanyal AJ. Modeling the epidemic ofnonalcoholic fatty liver disease demonstrates an exponential increase in burden of disease. Hepatology.2018;67:123–33. 2. Hsu CL, Loomba R. From NAFLD to MASLD: implications of the new nomenclaturefor preclinical and clinical research. Nat Metab.2024;6:600–2. 3. Peng C, Stewart AG, Woodman OL, Ritchie RH, Qin CX. Non-alcoholicsteatohepatitis: a review of its mechanism, models and medical treatments. Front Pharmacol.2020;11:603926.Begriche K, Massart J, Robin MA, Bonnet F, Fromenty B. Mitochondrial adaptationsand dysfunctions in nonalcoholic fatty liver disease. Hepatology.2013;58:1497–507. Perez-Carreras M, Del Hoyo P, Martin MA, Rubio JC, Martin A, Castellano G, et al.Defective hepatic mitochondrial respiratory chain in patients with nonalcoholic steatohepatitis. Hepatology.2003;38:999–1007. Fromenty B, Roden M. Mitochondrial alterations in fatty liver diseases. J Hepatol.2023;78:415–29. Ferris CF, Hammer RA, Leeman SE. Elevation of plasma neurotensin during lipidperfusion of rat small intestine. Peptides.1981;2:263–6. Nikolaou S, Qiu S, Fiorentino F, Simillis C, Rasheed S, Tekkis P, et al. The role ofNeurotensin and its receptors in non-gastrointestinal cancers: a review. Cell Commun Signal.2020;18:68. Barchetta I, Cimini FA, Leonetti F, Capoccia D, Di Cristofano C, Silecchia G, et al.Increased plasma proneurotensin levels identify NAFLD in adults with and without type 2 diabetes. J Clin Endocrinol Metab.2018;103:2253–60. .Mohamed AA, Abo-Elmatty DM, Ezzat O, Mesbah NM, Ali NS, Abd El Fatah AS, etal. Pro-neurotensin as a potential novel diagnostic biomarker for detection of nonalcoholic fatty liver disease. Diabetes Metab Syndr Obes.2022;15:1935–43. .Villar B, Bertran L, Aguilar C, Binetti J, Martinez S, Sabench F, et al. Circulatinglevels of pro-neurotensin and its relationship with nonalcoholic steatohepatitis and hepatic lipid metabolism. Metabolites.2021;11:373. .De Vito F, Cassano V, Mancuso E, Succurro E, Hribal ML, Sciacqua A, et al. Highercirculating levels of proneurotensin are associated with increased risk of incident NAFLD. J Intern Med.2023;294:336–46. .Li J, Song J, Zaytseva YY, Liu Y, Rychahou P, Jiang K, et al. An obligatory role forneurotensin in high-fat-diet-induced obesity. Nature.2016;533:411–5. .Liu C, Yi C, Fu W, Xiong X, Li J. Metabolitin regulates intestinal fat absorption vialymphatic endothelial cells derived neurotensin. J Hepatol.2023;79:e37–e9. .Li J, Li E, Czepielewski RS, Chi J, Guo X, Han YH, et al. Neurotensin is an anti-thermogenic peptide produced by lymphatic endothelial cells. Cell Metab.2021;33:1449– 65.e6. .Marchetti P, Fovez Q, Germain N, Khamari R, Kluza J. Mitochondrial sparerespiratory capacity: mechanisms, regulation, and significance in non-transformed and cancer cells. FASEB J.2020;34:13106–24.. Miquilena-Colina ME, Lima-Cabello E, Sanchez-Campos S, Garcia-Mediavilla MV,Fernandez-Bermejo M, Lozano-Rodriguez T, et al. Hepatic fatty acid translocase CD36 upregulation is associated with insulin resistance, hyperinsulinaemia and increased steatosis in non-alcoholic steatohepatitis and chronic hepatitis C. Gut.2011;60:1394–402. .Lee E, Korf H, Vidal-Puig A. An adipocentric perspective on the development andprogression of non-alcoholic fatty liver disease. J Hepatol.2023;78:1048–62. .Wilson CG, Tran JL, Erion DM, Vera NB, Febbraio M, Weiss EJ. Hepatocyte-specificdisruption of CD36 attenuates fatty liver and improves insulin sensitivity in HFD-fed mice. Endocrinology.2016;157:570–85. .Annevelink CE, Sapp PA, Petersen KS, Shearer GC, Kris-Etherton PM. Diet-derived anddiet-related endogenously produced palmitic acid: effects on metabolic regulation and cardiovascular disease risk. J Clin Lipido.2023;17:577–86. .Finck BN. Kelly DP. PGC-1 coactivators: inducible regulators of energy metabolismin health and disease. J Clin Investig.2006;116:615–22. .Gully D, Canton M, Boigegrain R, Jeanjean F, Molimard JC, Poncelet M, et al.Biochemical and pharmacological profile of a potent and selective nonpep-tide antagonist of the neurotensin receptor. Proc Natl Acad Sci USA. 1993;90:65–9. .Alessi DR, Cuenda A, Cohen P, Dudley DT, Saltiel AR. PD 098059 is a specificinhibitor of the activation of mitogen-activated protein kinase in vitro and in vivo. J Biol Chem.1995;270:27489–94. .Jager S, Handschin C, St-Pierre J, Spiegelman BM. AMP-activated protein kinase(AMPK) action in skeletal muscle via direct phosphorylation of PGC-1alpha. Proc Natl Acad Sci USA.2007;104:12017–22. .Rosca MG, Vazquez EJ, Chen Q, Kerner J, Kern TS, Hoppel CL. Oxidation of fatty acidsis the source of increased mitochondrial reactive oxygen species production in kidney cortical tubules in early diabetes. Diabetes.2012;61:2074–83. .Nassir F, Ibdah JA. Role of mitochondria in nonalcoholic fatty liver disease. Int J MolSci.2014;15:8713–42. .Zhou J, Febbraio M, Wada T, Zhai Y, Kuruba R, He J, et al. Hepatic fatty acidtransporter Cd36 is a common target of LXR, PXR, and PPARgamma in promoting steatosis. Gastroenterology.2008;134:556–67. .Haase TN, Ringholm S, Leick L, Bienso RS, Kiilerich K, Johansen S, et al. Role ofPGC-1alpha in exercise and fasting-induced adaptations in mouse liver. Am J Physiol Regul Integr Comp Physiol.2011;301:R1501–9.. Fabbrini E, Sullivan S, Klein S. Obesity and nonalcoholic fatty liver disease: bio-chemical, metabolic, and clinical implications. Hepatology.2010;51:679–89. .Koliaki C, Szendroedi J, Kaul K, Jelenik T, Nowotny P, Jankowiak F, et al. Adap-tation of hepatic mitochondrial function in humans with non-alcoholic fatty liver is lost in steatohepatitis. Cell Metab.2015;21:739–46. .St-Pierre J, Drori S, Uldry M, Silvaggi JM, Rhee J, Jager S, et al. Suppression of reactiveoxygen species and neurodegeneration by the PGC-1 transcriptional coactivators. Cell. 2006;127:397–408. .Arconzo M, Piccinin E, Pasculli E, Cariello M, Loiseau N, Bertrand-Michel J.Hepatic-specific Pgc-1alpha ablation drives fibrosis in a MASH model. Liver Int. 2024;44:2738–52. .Daquinag AC, Gao Z, Fussell C, Immaraj L, Pasqualini R, Arap W, et al. Fatty acidmobilization from adipose tissue is mediated by CD36 posttranslational modifications and intracellular trafficking. JCI Insight.2021;6:e147057. .Cyr Y, Bissonnette S, Lamantia V, Wassef H, Loizon E, Ngo Sock ET, et al. Whiteadipose tissue surface expression of LDLR and CD36 is associated with risk factors for type 2 diabetes in adults with obesity. Obesity.2020;28:2357–67. .Donnelly KL, Smith CI, Schwarzenberg SJ, Jessurun J, Boldt MD, Parks EJ. Sources offatty acids stored in liver and secreted via lipoproteins in patients with non-alcoholic fatty liver disease. Journal Clin Investig.2005;115:1343–51. .Wu Z, Stadler N, Abbaci A, Liu J, Boullier A, Marie N, et al. Effect of monoclonalantibody blockade of long fragment neurotensin on weight loss, behavior, and metabolic traits after high-fat diet induced obesity. Front Endocrinol.2021;12: 739287. .Leinninger GM, Opland DM, Jo YH, Faouzi M, Christensen L, Cappellucci LA, et al.Leptin action via neurotensin neurons controls orexin, the mesolimbic dopamine system and energy balance. Cell Metab.2011;14:313–23. .Handschin C, Rhee J, Lin J, Tarr PT, Spiegelman BM. An autoregulatory loopcontrols peroxisome proliferator-activated receptor gamma coactivator 1alpha expression in muscle. Proc Natl Acad Sci U S A 2003, 100(12): 7111-7116. .Dobner PR, Fadel J, Deitemeyer N, Carraway RE, Deutch AY. Neurotensin-deficientmice show altered responses to antipsychotic drugs. Proc Natl Acad Sci U S A 2001, 98(14): 8048-8053. .Li J, Wang Y, Matye DJ, Chavan H, Krishnamurthy P, Li F, et al. Sortilin 1Modulates Hepatic Cholesterol Lipotoxicity in Mice via Functional Interaction with Liver Carboxylesterase 1. J Biol Chem 2017, 292(1): 146-160.. Charni-Natan M, Goldstein I. Protocol for Primary Mouse Hepatocyte Isolation.STAR Protoc 2020, 1(2): 100086. .Xiong X, Hasani S, Young LEA, Rivas DR, Skaggs AT, Martinez R, et al. Activationof Drp1 promotes fatty acids-induced metabolic reprograming to potentiate Wnt signaling in colon cancer. Cell Death Differ 2022, 29(10): 1913-1927. .Hoyles L, Fernandez-Real JM, Federici M, Serino M, Abbott J, Charpentier J, et al.Molecular phenomics and metagenomics of hepatic steatosis in non-diabetic obese women. Nat Med 2018, 24(7): 1070-1080. .Rock SA, Jiang K, Wu Y, Liu Y, Li J, Weiss HL, et al. Neurotensin RegulatesProliferation and Stem Cell Function in the Small Intestine in a Nutrient-Dependent Manner. Cell Mol Gastroenterol Hepatol 2022, 13(2): 501-516. .Kleiner DE, Brunt EM, Van Natta M, Behling C, Contos MJ, Cummings OW, et al.Design and validation of a histological scoring system for nonalcoholic fatty liver disease. Hepatology 2005, 41(6): 1313-1321. .Reyes-Caballero H, Rao X, Sun Q, Warmoes MO, Lin P, Sussan TE, et al. Airpollution-derived particulate matter dysregulates hepatic Krebs cycle, glucose and lipid metabolism in mice. Sci Rep 2019, 9(1): 17423. .Wu Z, Fournel L, Stadler N, Liu J, Boullier A, Hoyeau N, Fléjou JF, Duchatelle V,Djebrani-Oussedik N, Agopiantz M, Ségal-Bendirdjian E, Gompel A, Alifano M, Melander O, Trédaniel J, Forgez P. Modulation of lung cancer cell plasticity and heterogeneity with the restoration of cisplatin sensitivity by neurotensin antibody. Cancer Lett.2019 Mar 1;444:147-161. doi: 10.1016 / j.canlet.2018.12.007. .Li, J., et al. Neurotensin inhibits AMPK activity and concurrently enhances FABP1expression in small intestinal epithelial cells associated with obesity and aging. Exp Mol Med (2025). doi.org / 10.1038 / s12276-025-01461-w. .Banerjee, et al. Neurotensin promotes hepatic steatosis by regulating lipid uptake andmitochondrial adaptation in hepatocytes. Cell Death Dis 16, 347 (2025) doi.org / 10.1038 / s41419-025-07664-3. .Barchetta, I., Beyond the liver: The role of neurotensin in nonalcoholic fatty liverdisease. J Intern Med (2023) 294(3), doi.org / 10.1111 / joim.13675. .De Vito, F., et al. Higher circulating levels of proneurotensin areassociated withincreased risk of incident NAFLD. J Intern Med (2023) 294: 336–346, doi.org / 10.1111 / joim.13651. .Evers, M., et al. U.S. Patent No. 10,473,670 for Method of Predicting ObesityComprising Measuring Neurotensin, issued November 12, 2019.It will be understood that various details of the presently disclosed subject matter can be changed without departing from the scope of the subject matter disclosed herein. Furthermore, the foregoing description is for the purpose of illustration only, and not for the purpose of limitation.
Claims
CLAIMS What is claimed is:
1. A method of monitoring steatotic liver disease and / or steatohepatitis in a subject, comprising: (a) assessing mitochondrial bioenergetics reserve in hepatocytes from the subject; and (b) determining the steatotic liver disease and / or steatohepatitis status of the subject by comparing mitochondrial bioenergetics reserve to a reference.
2. The method of claim 1, wherein the reference is control data for mitochondrial bioenergetics reserve.
3. The method of claim 2, wherein the steatotic liver disease and / or steatohepatitis status of the subject is determined to be present when compared to the control data.
4. The method of claim 2, wherein the steatotic liver disease and / or steatohepatitis status of the subject is determined to be progressing when compared to the control data.
5. The method of claim 2, wherein the steatotic liver disease and / or steatohepatitis status of the subject is determined to be regressing when compared to the control data.
6. The method of claim 1, wherein the assessing mitochondrial bioenergetics reserve in hepatocytes from the subject is conducted using a sample obtained from the subject at a first time point, and the reference is mitochondrial bioenergetics reserve assessment of a sample obtained from the subject at a second time point.
7. The method of claim 6, wherein the steatotic liver disease and / or steatohepatitis status of the subject is determined to be progressing when compared to the sample obtained from the subject at a second time point.
8. The method of claim 6, wherein the steatotic liver disease and / or steatohepatitis status of the subject is determined to be regressing when compared to the sample obtained from the subject at a second time point.
9. The method of claim any one of claims 3-5, 7, and 8, and further comprising administering a neurotensin inhibitor to the subject.
10. The method of claim 10, wherein the neurotensin inhibitor is an NTSR1 antagonist.
11. The method of any one of claims 1-8, and further comprising assessing neurotensin (NTS) signaling, wherein an increase in NTS signaling relative to a reference is associated with a presence or progression of steatotic liver disease and / or steatohepatitis.
12. The method of any one of claims 3-5, 7, and 8, and further comprising assessing neurotensin (NTS) signaling, wherein an increase in NTS signaling relative to a reference is associated with a presence or progression of steatotic liver disease and / or steatohepatitis; and further comprising administering a neurotensin inhibitor to the subject.
13. The method of any one of claims 1-8, and further comprising assessing lipid update in hepatocytes, wherein an increase in lipid uptake is associated with a presence or progression of steatotic liver disease and / or steatohepatitis.
14. The method of any one of claims 3-5, 7, and 8, and further comprising assessing lipid update in hepatocytes, wherein an increase in lipid uptake is associated with a presence or progression of steatotic liver disease and / or steatohepatitis; and further comprising administering a neurotensin inhibitor to the subject.
15. The method of any one of claims 1-8, and further comprising assessing presence and / or severity of fat accumulation in the liver, wherein fat accumulation is associated with a presence or progression of steatotic liver disease and / or steatohepatitis.
16. The method of any one of claims 3-5, 7, and 8, and further comprising assessing presence and / or severity of fat accumulation in the liver, wherein fat accumulation is associated with a presence or progression of steatotic liver disease and / or steatohepatitis; and further comprising administering a neurotensin inhibitor to the subject.
17. The method of any one of claims 1-8, and further comprising assessing liver stiffness, wherein increasing liver stiffness is associated with a presence or progression of steatotic liver disease and / or steatohepatitis.
18. The method of any one of claims 3-5, 7, and 8, and further comprising assessing liver stiffness, wherein increasing liver stiffness is associated with a presence or progression of steatotic liver disease and / or steatohepatitis; and further comprising administering a neurotensin inhibitor to the subject.
19. A method of monitoring treatment of steatotic liver disease and / or steatohepatitis in a subject, comprising: (a) administering a neurotensin inhibitor to the subject; and (b) determining that the steatotic liver disease and / or steatohepatitis status of the subject by comparing mitochondrial bioenergetics reserve to a reference.
20. The method of claim 19, wherein the reference is control data for mitochondrial bioenergetics reserve.
21. The method of claim 20, wherein the steatotic liver disease and / or steatohepatitis status of the subject is determined to be present when compared to the control data.
22. The method of claim 20, wherein the steatotic liver disease and / or steatohepatitis status of the subject is determined to be progressing when compared to the control data.
23. The method of claim 20, wherein the steatotic liver disease and / or steatohepatitis status of the subject is determined to be regressing when compared to the control data.
24. The method of claim 19, wherein the assessing mitochondrial bioenergetics reserve in hepatocytes from the subject is conducted using a sample obtained from the subject at a first time point, and the reference is mitochondrial bioenergetics reserve assessment of a sample obtained from the subject at a second time point.
25. The method of claim 24, wherein the steatotic liver disease and / or steatohepatitis status of the subject is determined to be progressing when compared to the sample obtained from the subject at a second time point.
26. The method of claim 24, wherein the steatotic liver disease and / or steatohepatitis status of the subject is determined to be regressing when compared to the sample obtained from the subject at a second time point.
27. The method of claim 19, wherein the neurotensin inhibitor is an NTSR1 antagonist.
28. The method of any one of claims 19-27, and further comprising assessing neurotensin (NTS) signaling, wherein an increase in NTS signaling relative to a reference is associated with a presence or progression of steatotic liver disease and / or steatohepatitis.
29. The method of any one of claims 19-27, and further comprising assessing lipid update in hepatocytes, wherein an increase in lipid uptake is associated with a presence or progression of steatotic liver disease and / or steatohepatitis.
30. The method of any one of claims 19-27, and further comprising assessing presence and / or severity of fat accumulation in the liver, wherein fat accumulation is associated with a presence or progression of steatotic liver disease and / or steatohepatitis.
31. The method of any one of claims 19-27, and further comprising assessing liver stiffness, wherein increasing liver stiffness is associated with a presence or progression of steatotic liver disease and / or steatohepatitis.
32. A method of treatment for steatotic liver disease and / or steatohepatitis, comprising: (a) identifying a subject at risk of or having steatotic liver disease and / or steatohepatitis; and (b) administering a neurotensin inhibitor.
33. The method of claim 32, wherein the subject is identified as being at risk of or having steatotic liver disease and / or steatohepatitis by comparing mitochondrial bioenergetics reserve in hepatocytes from the subject to a reference.
34. The method of claim 33, wherein the reference is control data for mitochondrial bioenergetics reserve.
35. The method of claim 34, wherein the steatotic liver disease and / or steatohepatitis status of the subject is determined to be present when compared to the control data.
36. The method of claim 34, wherein the steatotic liver disease and / or steatohepatitis status of the subject is determined to be progressing when compared to the control data.
37. The method of claim 34, wherein the steatotic liver disease and / or steatohepatitis status of the subject is determined to be regressing when compared to the control data.
38. The method of claim 33, wherein the assessing mitochondrial bioenergetics reserve in hepatocytes from the subject is conducted using a sample obtained from the subject at a first time point, and the reference is mitochondrial bioenergetics reserve assessment of a sample obtained from the subject at a second time point.
39. The method of claim 38, wherein the steatotic liver disease and / or steatohepatitis status of the subject is determined to be progressing when compared to the sample obtained from the subject at a second time point.
40. The method of claim 38, wherein the steatotic liver disease and / or steatohepatitis status of the subject is determined to be regressing when compared to the sample obtained from the subject at a second time point.
41. The method of claim 32, wherein the neurotensin inhibitor is an NTSR1 antagonist.
42. The method of any one of claims 32-41, and further comprising assessing neurotensin (NTS) signaling, wherein an increase in NTS signaling relative to a reference is associated with a presence or progression of steatotic liver disease and / or steatohepatitis.
43. The method of any one of claims 32-41, and further comprising assessing lipid update in hepatocytes, wherein an increase in lipid uptake is associated with a presence or progression of steatotic liver disease and / or steatohepatitis.
44. The method of any one of claims 32-41, and further comprising assessing presence and / or severity of fat accumulation in the liver, wherein fat accumulation is associated with a presence or progression of steatotic liver disease and / or steatohepatitis.
45. The method of any one of claims 32-41, and further comprising assessing liver stiffness, wherein increasing liver stiffness is associated with a presence or progression of steatotic liver disease and / or steatohepatitis.