Rnai agents for inhibiting expression of yellow fever virus (YFV) viral genome expression

Abstract

The present disclosure relates to RNAi agents, e.g., double stranded RNAi agents, able to inhibit Yellow Fever Virus (YFV) viral genome expression. Also disclosed are pharmaceutical compositions that include YFV RNAi agents and methods of use thereof. The YFV RNAi agents disclosed herein may be conjugated to targeting ligands, including ligands that comprise N-acetyl-galactosamine, to facilitate the delivery to hepatocyte cells. Delivery of the YFV RNAi agents in vivo provides for inhibition of YFV viral genome expression. The RNAi agents can be used in methods of treatment of diseases, disorders, or symptoms caused by YFV infection, such as liver failure.

Description

RNAi Agents for Inhibiting Expression of Yellow Fever Virus (YFV) Viral Genome Expression, Pharmaceutical Compositions Thereof, and Methods of Use CROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of priority to United States Provisional Patent Application Serial No. 63,677,705, filed on July 31, 2024, the contents of which are incorporated herein by reference in their entirety. FIELD OF THE INVENTION

[0002] The present disclosure relates to RNA interference (RNAi) agents, e.g., double stranded RNAi agents such as chemically modified small (or short) interfering RNA (siRNA), for inhibition yellow fever virus (YFV) viral genome expression, pharmaceutical compositions that include YFV RNAi agents, and methods of use thereof for the treatment of YFV infection, including severe infection. SEQUENCE LISTING

[0003] This application contains a Sequence Listing (in compliance with Standard ST26), which has been submitted in xml format and is hereby incorporated by reference in its entirety. The xml sequence listing file is named 30750-WO_SeqListing.xml, created July 22, 2025, and is 2,900,523 bytes in size. BACKGROUND

[0004] Yellow fever virus (YFV) is a mosquito-borne Flavivirus which is categorized under category B as a priority emerging pathogen by the National Institute of Allergy and Infectious Diseases (NIAID) in conjunction with the U.S Department of Homeland Security (DHS) and the Center for Disease Control (CDC). YFV is endemic in tropical areas of Africa (34 countries) and the Americas (13 countries) with 200,000 cases of disease and 30,000 deaths each year. YFV frequently causes an acute infection with a range of clinical manifestations varying from a febrile, nonspecific illness to a severe disease with hemorrhagic presentations, jaundice and bleeding with a deadly hepato-renal involvement and significant mortality (in the recent outbreak it was reported between 20 to 60%). According to the World HealthOrganization (WHO), the possibility exists for a viremic traveler to spread YFV from its current endemic range to new areas harboring significant vector populations and there are reports for infected travelers in China and US who came back from endemic regions.

[0005] YFV is an enveloped RNA virus (of the family Flaviviridae) that has a single open reading that encodes a polyprotein. Host proteases then cut the polyprotein into various structural and non-structural viral proteins. After transmission from a mosquito, the virus begins to replicate and eventually reaches and infects hepatocytes in the liver, which often leads to eosinophilic degradation and apoptosis of hepatic cells that can potentially cause liver failure.

[0006] Despite the availability of an effective vaccine, YFV remains a major public health problem and there is no known cure. The live attenuated Yellow Fever vaccine is not indicated for use in patients over 60 years of age, pregnant women, and immunocompromised individuals due to severe heath risks. Further, although the suggestion that YFV might be addressable by an RNAi mechanism has long been hypothesized (see, e.g., Pacca et al, 38 Virus Genes 224- 231 (2009)), there his been no advancement in or development of a viable RNAi therapeutic for targeting YFV and treating YFV infection. Additional therapeutics that are able to efficiently target YFV and treat YFV-infected patients are needed. SUMMARY

[0007] There exists a need for novel RNA interference (RNAi) agents (termed RNAi agents, RNAi triggers, or triggers), e.g., double stranded RNAi agents such as chemically modified siRNAs, that are able to selectively and efficiently inhibit YFV viral genome expression. Further, there exists a need for compositions of novel YFV-specific RNAi agents for use as a therapeutic or medicament for the treatment of YFV-related diseases or disorders, such as YFV infection and / or diseases, symptoms, or manifestations caused by YFV infection. In particular, severe YFV infection can cause liver failure in patients, and there exists a need for compositions of novel YFV-specific RNAi agents to treat such patients.

[0008] The nucleotide sequences and chemical modifications of the YFV RNAi agents disclosed herein differ from those previously disclosed or known in the art. The YFV RNAi agents disclosed herein provide for highly specific, potent, and efficient in vivo and / or in vitro inhibition of the expression of a YFV viral genome.

[0009] In some embodiments, the sense strand comprises a nucleotide sequence of at least 15 contiguous nucleotides differing by 0 or 1 nucleotides from 15 contiguous nucleotides of any one of the sense strand sequences of Table 2, Table 4, Table 5, or Table 6D, and wherein the sense strand has a region of at least 85% complementarity over the 15 contiguous nucleotides to the antisense strand.

[0010] In some embodiments, disclosed herein are RNAi agents for inhibiting expression of a YFV viral genome, comprising: an antisense strand wherein nucleotides 1-19 of the antisense strand comprise nucleotides 1-19 of the antisense strand sequences of Table 2, Table 3, or Table 6D, and a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand, wherein all or substantially all of the nucleotides of the antisense strand and / or the sense strand are modified nucleotides, and the RNAi agent is linked to a targeting ligand that comprises N-acetyl-galactosamine.

[0011] In some embodiments, disclosed herein are RNAi agents for inhibiting expression of a YFV viral genome, comprising a sense strand comprising a nucleotide sequence of at least 15 contiguous nucleotides differing by 0 or 1 nucleotides from 15 contiguous nucleotides of any one of the sense strand sequences of Table 2, Table 4, Table 5, or Table 6D, and wherein the sense strand has a region of at least 85% complementarity over the 15 contiguous nucleotides to the antisense strand.

[0012] In some embodiments, at least one nucleotide of the YFV RNAi agent includes a modified internucleoside linkage.

[0013] In some embodiments, the modified nucleotides of the YFV RNAi agents disclosed herein are selected from the group consisting of: 2′-O-methyl nucleotide, 2′-fluoro nucleotide (also referred to as a 2’-deoxy-2’-fluoro nucleotide), 2′-deoxy nucleotide, 2′,3′-seco nucleotide mimic, locked nucleotide, 2'-F-arabino nucleotide, 2′-methoxyethyl nucleotide, abasic nucleotide, ribitol, inverted nucleotide, inverted 2′-O-methyl nucleotide, inverted 2′-deoxy nucleotide, 2′-amino-modified nucleotide, 2′-alkyl-modified nucleotide, morpholine nucleotide, vinyl phosphonate-containing nucleotide, cyclopropyl phosphonate-containing nucleotide, and 3′-O-methyl nucleotide.

[0014] In other embodiments, all or substantially all of the modified nucleotides of the RNAi agents disclosed herein are 2′-O-methyl nucleotides, 2′-fluoro nucleotides, or combinations thereof.

[0015] In some embodiments, the antisense strand consists of, consists essentially of, or comprises the nucleotide sequence of any one of the modified antisense strand sequences of Table 3 or Table 6D.

[0016] In some embodiments, the sense strand consists of, consists essentially of, or comprises the nucleotide sequence of any of the modified sense strand sequences of Table 4, Table 5, or Table 6D.

[0017] In some embodiments, the antisense strand comprises the nucleotide sequence of any one of the modified sequences of Table 3 or Table 6D and the sense strand comprises the nucleotide sequence of any one of the modified sequences of Table 4 or Table 6D.

[0018] The RNAi agents disclosed herein are linked to a targeting ligand that comprises N-acetyl-galactosamine. In further embodiments, the targeting ligand is linked to the sense strand. In some embodiments, the targeting ligand is linked to the 5’ terminal end of the sense strand.

[0019] In some embodiments, the sense strand is between 15 and 30 nucleotides in length, and the antisense strand is between 18 and 30 nucleotides in length. In other embodiments, the sense strand and the antisense strand are each between 21 and 27 nucleotides in length. In other embodiments, the sense strand and the antisense strand are each between 21 and 24 nucleotides in length. In still other embodiments, sense strand and the antisense strand are each 21 nucleotides in length.

[0020] In some embodiments, the RNAi agents have two blunt ends.

[0021] In some embodiments, the sense strand comprises one or two terminal caps. In other embodiments, the sense strand comprises one or two inverted abasic residues.

[0022] In some embodiments, the RNAi agents are comprised of a sense strand and an antisense strand that form a duplex sequence of the duplex structures shown in Table 6A, 6B, 6C, or 6D.

[0023] In some embodiments, the sense strand further includes inverted abasic residues at the 3’ terminal end of the nucleotide sequence, at the 5’ end of the nucleotide sequence, or at both.

[0024] In further embodiments, the targeting ligand comprises or consists of:.

[0025] Also disclosed herein are compositions comprising the disclosed RNAi agents, wherein the compositions further comprise a pharmaceutically acceptable excipient.

[0026] Additionally, provided herein are methods for inhibiting expression of a YFV viral genome in a hepatocyte cell in a human subject in vivo, the methods comprising introducing into the subject an effective amount of the disclosed YFV RNAi agents or the disclosed compositions.

[0027] Further provided herein are methods of treating a YFV-related disease, disorder, or symptom, the methods comprising administering to a human subject in need thereof a therapeutically effective amount of the disclosed compositions.

[0028] In some embodiments, the disease is Yellow Fever, and / or other YFV-related disease or symptom such as liver failure caused by several Yellow Fever infection.

[0029] In some embodiments, the RNAi agents are administered at a dose of about 0.05 mg / kg to about 5.0 mg / kg of body weight of the human subject. In some embodiments, theYFV RNAi agents disclosed herein are administered in a fixed dose of a single injection containing about 50 mg, about 100 mg, about 150 mg, about 200 mg, about 250 mg, about 300 mg, or about 400 mg of YFV RNAi agent.

[0030] Also provided herein are usages of the disclosed RNAi agents or the disclosed compositions, for the treatment of a disease, disorder, or symptom that is mediated at least in part by YFV viral genome expression.

[0031] Further provided herein are usages of the disclosed RNAi agents or the disclosed compositions, for the preparation of a pharmaceutical compositions for treating a disease, disorder, or symptom that is mediated at least in part by YFV viral genome expression. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1A. Test animal survival rate after dosing with YFV RNAi agent, Ribavirin, or saline (see also Example 12 herein).

[0033] Figure 1B. Mean body weight change of test animals after dosing with YFV RNAi agent, Ribavirin, or saline (see also Example 12 herein).

[0034] Figure 1C. Serum alanine transaminase (ALT) levels of test animals after dosing with YFV RNAi agent, Ribavirin, or saline (see also Example 12 herein).

[0035] Figure 1D. Liver YFV viral titer of test animals after dosing with YFV RNAi agent, Ribavirin, or saline (see also Example 12 herein).

[0036] Figure 2A. Survival curves of YFV-infected Syrian golden hamsters after treatment with YFV RNAi agents (see also Example 13 herein). ****P<0.0001, ***P<0.001, **P<0.01, *P<0.05 as compared to vehicle treatment.

[0037] Figure 2B. Average percent weight change of animals infected with YFV virus and treated with YFV RNAi agents (see also Example 13 herein).

[0038] Figure 3A. Survival curves of YFV-infected Syrian golden hamsters after treatment with YFV RNAi agents (see also Example 17 herein). ****P<0.0001, ***P<0.001, **P<0.01, *P<0.05 as compared to vehicle treatment.

[0039] Figure 3B. Mean body weight change of test animals after dosing with YFV RNAi agent or saline (see also Example 17 herein).

[0040] Figure 3C. Mean body weight change of test animals after dosing with YFV RNAi agents or saline, between 2 and 9 days post infection (see also Example 17 herein). ****P<0.0001, ***P<0.001, **P<0.01, *P<0.05 as compared to vehicle treatment.

[0041] Figure 3D. Serum viral titer of test animals after dosing with YFV RNAi agent or saline (see also Example 17 herein). ****P<0.0001, ***P<0.001, **P<0.01, *P<0.05 as compared to vehicle treatment.

[0042] Figure 3E. Liver viral titer of test animals after dosing with YFV RNAi agent or saline (see also Example 17 herein). ****P<0.0001, ***P<0.001, **P<0.01, *P<0.05 as compared to vehicle treatment.

[0043] Figure 3F. Serum alanine transaminase (ALT) levels of test animals after dosing with YFV RNAi agent or saline (see also Example 17 herein). ****P<0.0001, ***P<0.001, **P<0.01, *P<0.05 as compared to vehicle treatment.

[0044] Figure 4A. Survival curves of YFV-infected Syrian golden hamsters after treatment with YFV RNAi agents (see also Example 18 herein). ****P<0.0001, ***P<0.001, **P<0.01, *P<0.05 as compared to vehicle treatment.

[0045] Figure 4B. Mean body weight change of test animals after dosing with YFV RNAi agent or saline (see also Example 18 herein).

[0046] Figure 4C. Mean body weight change of test animals after dosing with YFV RNAi agents or saline, between 4 and 7 days post infection (see also Example 18 herein).

[0047] Figure 4D. Serum viral titer of test animals after dosing with YFV RNAi agent or saline (see also Example 18 herein). ****P<0.0001, ***P<0.001, **P<0.01, *P<0.05 as compared to vehicle treatment.

[0048] Figure 4E. Liver viral titer of test animals after dosing with YFV RNAi agent or saline (see also Example 18 herein). ****P<0.0001, ***P<0.001, **P<0.01, *P<0.05 as compared to vehicle treatment.

[0049] Figure 4F. Serum alanine transaminase (ALT) levels of test animals after dosing with YFV RNAi agent or saline (see also Example 18 herein).

[0050] Figure 5A. Survival curves of YFV-infected Syrian golden hamsters after treatment with YFV RNAi agents (see also Example 19 herein). ****P<0.0001, ***P<0.001, **P<0.01, *P<0.05 as compared to vehicle treatment.

[0051] Figure 5B. Mean body weight change of test animals after dosing with YFV RNAi agent or saline (see also Example 19 herein).

[0052] Figure 5C. Mean body weight change of test animals after dosing with YFV RNAi agents or saline, between 4 and 7 days post infection (see also Example 19 herein). ****P<0.0001, ***P<0.001, **P<0.01, *P<0.05 as compared to vehicle treatment.

[0053] Figure 5D. Serum viral titer of test animals after dosing with YFV RNAi agent or saline (see also Example 19 herein). ****P<0.0001, ***P<0.001, **P<0.01, *P<0.05 as compared to vehicle treatment.

[0054] Figure 5E. Liver viral titer of test animals after dosing with YFV RNAi agent or saline (see also Example 19 herein).

[0055] Figure 5F. Serum alanine transaminase (ALT) levels of test animals after dosing with YFV RNAi agent or saline (see also Example 19 herein). ****P<0.0001, ***P<0.001, **P<0.01, *P<0.05 as compared to vehicle treatment. DETAILED DESCRIPTION

[0056] The disclosed YFV RNAi agents, compositions thereof, and methods of use disclosed herein may be understood more readily by reference to the following detailed description, which form a part of this disclosure. It is to be understood that the disclosure is not limited to what is specifically described and / or shown herein, and that the terminology used herein is for the purpose of describing particular embodiments by way of example only and is not intended to be limiting.

[0057] It is to be appreciated that while certain features of the disclosures included herein are, for clarity, described herein in the context of separate embodiments, they may also be provided in combination in a single embodiment. Conversely, various features of the disclosed methods that are, for brevity, described in the context of a single embodiment, may also be provided separately or in any subcombination.

[0058] Definitions

[0059] As used herein, an “RNAi agent” means a chemical composition that contains an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule that is capable of degrading or inhibiting (e.g., degrades or inhibits under appropriate conditions) translation of gene transcripts of a viral genomic target in a sequence specific manner. As used herein, RNAi agents may operate through the RNA interference mechanism (i.e., inducing RNA interference through interaction with the RNA interference pathway machinery (RNA-induced silencing complex or RISC) of mammalian cells), or by any alternative mechanism(s) or pathway(s). While it is believed that RNAi agents, as that term is used herein, operate primarily through the RNA interference mechanism, the disclosed RNAi agents are not bound by or limited to any particular pathway or mechanism of action. RNAi agents disclosed herein arecomprised of a sense strand and an antisense strand, and include, but are not limited to: small (or short) interfering RNAs (siRNAs), double stranded RNAs (dsRNA), micro RNAs (miRNAs), short hairpin RNAs (shRNA), and dicer substrates. The antisense strand of the RNAi agents described herein is at least partially complementary to the genomic transcript being targeted (YFV RNA). RNAi agents can include one or more modified nucleotides and / or one or more non-phosphodiester linkages.

[0060] As used herein, the terms “silence,” “reduce,” “inhibit,” “down-regulate,” or “knockdown” when referring to expression of a given gene or viral genome, mean that the expression of the gene or viral genome, as measured by the level of RNA transcribed from the gene or viral genome or the level of polypeptide, protein, or protein subunit translated from the genomic transcript in a cell, group of cells, tissue, organ, or subject in which the gene or viral genome is transcribed, is reduced when the cell, group of cells, tissue, organ, or subject is treated with the RNAi agents described herein as compared to a second cell, group of cells, tissue, organ, or subject that has not or have not been so treated.

[0061] As used herein, the terms “sequence” and “nucleotide sequence” mean a succession or order of nucleobases or nucleotides, described with a succession of letters using standard nomenclature. A nucleic acid molecule can comprise unmodified and / or modified nucleotides. A nucleotide sequence can comprise unmodified and / or modified nucleotides.

[0062] As used herein, a “base,” “nucleotide base,” or “nucleobase,” is a heterocyclic pyrimidine or purine compound that is a component of a nucleotide, and includes the primary purine bases adenine and guanine, and the primary pyrimidine bases cytosine, thymine, and uracil. A nucleobase may further be modified to include, without limitation, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. (See, e.g., Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley- VCH, 2008). The synthesis of such modified nucleobases (including phosphoramidite compounds that include modified nucleobases) is known in the art.

[0063] As used herein, the term “nucleotide” has the same meaning as commonly understood in the art. Thus, the term "nucleotide" as used herein, refers to a glycoside comprising a sugar moiety, a base moiety and a covalently linked group (linkage group), such as a phosphate, phosphorothioate, or phosphorodithioate internucleoside linkage group, and covers both naturally occurring nucleotides, such as DNA or RNA, and non-naturally occurring nucleotides comprising modified sugar and / or base moieties, which are also referred to as nucleotide analogs herein. Herein, a single nucleotide can be referred to as a monomer or unit.

[0064] As used herein, and unless otherwise indicated, the term “complementary,” when used to describe a first nucleobase or nucleotide sequence (e.g., RNAi agent sense strand or targeted genomic transcript) in relation to a second nucleobase or nucleotide sequence (e.g., RNAi agent antisense strand or a single-stranded antisense oligonucleotide), means the ability of an oligonucleotide or polynucleotide including the first nucleotide sequence to hybridize (form base pair hydrogen bonds under mammalian physiological conditions (or otherwise suitable in vivo or in vitro conditions)) and form a duplex or double helical structure under certain standard conditions with an oligonucleotide that includes the second nucleotide sequence. The person of ordinary skill in the art would be able to select the set of conditions most appropriate for a hybridization test. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs and include natural or modified nucleotides or nucleotide mimics, at least to the extent that the above hybridization requirements are fulfilled. Sequence identity or complementarity is independent of modification. For example, a and Af, as defined herein, are complementary to U (or T) and identical to A for the purposes of determining identity or complementarity.

[0065] As used herein, “perfectly complementary” or “fully complementary” means that in a hybridized pair of nucleobase or nucleotide sequence molecules, all (100%) of the bases in a contiguous sequence of a first oligonucleotide will hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence may comprise all or a part of a first or second nucleotide sequence.

[0066] As used herein, “partially complementary” means that in a hybridized pair of nucleobase or nucleotide sequence molecules, at least 70%, but not all, of the bases in a contiguous sequence of a first oligonucleotide will hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence may comprise all or a part of a first or second nucleotide sequence.

[0067] As used herein, “substantially complementary” means that in a hybridized pair of nucleobase or nucleotide sequence molecules, at least 85%, but not all, of the bases in a contiguous sequence of a first oligonucleotide will hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence may comprise all or a part of a first or second nucleotide sequence.

[0068] As used herein, the terms “complementary,” “fully complementary,” “partially complementary,” and “substantially complementary” are used with respect to the nucleobase or nucleotide matching between the sense strand and the antisense strand of an RNAi agent, or between the antisense strand of an RNAi agent and a sequence of a YFV genomic transcript.

[0069] As used herein, the term “substantially identical” or “substantial identity,” as applied to a nucleic acid sequence means the nucleotide sequence (or a portion of a nucleotide sequence) has at least about 85% sequence identity or more, e.g., at least 90%, at least 95%, or at least 99% identity, compared to a reference sequence. Percentage of sequence identity is determined by comparing two optimally aligned sequences over a comparison window. The percentage is calculated by determining the number of positions at which the same type of nucleic acid base occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity. The inventions disclosed herein encompass nucleotide sequences substantially identical to those disclosed herein.

[0070] As used herein, the terms “individual”, “patient” and “subject”, are used interchangeably to refer to a member of any animal species including, but not limited to, birds, humans and other primates, and other mammals including commercially relevant mammals or animal models such as mice, rats, monkeys, cattle, pigs, horses, sheep, cats, and dogs. Preferably, the subject is a human.

[0071] As used herein, the terms “treat,” “treatment,” and the like, mean the methods or steps taken to provide relief from or alleviation of the number, severity, and / or frequency of one or more symptoms of a disease in a subject. As used herein, “treat” and “treatment” may include the prevention, management, prophylactic treatment, and / or inhibition or reduction of the number, severity, and / or frequency of one or more symptoms of a disease in a subject.

[0072] As used herein, the phrase “introducing into a cell,” when referring to an RNAi agent, means functionally delivering the RNAi agent into a cell. The phrase “functional delivery,” means delivering the RNAi agent to the cell in a manner that enables the RNAi agent to have the expected biological activity, e.g., sequence-specific inhibition of gene or viral genome expression.

[0073] Unless stated otherwise, use of the symbol as used herein means that any group or groups may be linked thereto that is in accordance with the scope of the inventions described herein.

[0074] As used herein, the term “isomers” refers to compounds that have identical molecular formulae, but that differ in the nature or the sequence of bonding of their atoms or in the arrangement of their atoms in space. Isomers that differ in the arrangement of their atoms in space are termed “stereoisomers.” Stereoisomers that are not mirror images of one another aretermed “diastereoisomers,” and stereoisomers that are non-superimposable mirror images are termed “enantiomers,” or sometimes optical isomers. A carbon atom bonded to four non- identical substituents is termed a “chiral center.”

[0075] As used herein, unless specifically identified in a structure as having a particular conformation, for each structure in which asymmetric centers are present and thus give rise to enantiomers, diastereomers, or other stereoisomeric configurations, each structure disclosed herein is intended to represent all such possible isomers, including their optically pure and racemic forms. For example, the structures disclosed herein are intended to cover mixtures of diastereomers as well as single stereoisomers.

[0076] As used in a claim herein, the phrase “consisting of” excludes any element, step, or ingredient not specified in the claim. When used in a claim herein, the phrase “consisting essentially of” limits the scope of a claim to the specified materials or steps and those that do not materially affect the basic and novel characteristic(s) of the claimed invention.

[0077] The person of ordinary skill in the art would readily understand and appreciate that the compounds and compositions disclosed herein may have certain atoms (e.g., N, O, or S atoms) in a protonated or deprotonated state, depending upon the environment in which the compound or composition is placed. Accordingly, as used herein, the structures disclosed herein envisage that certain functional groups, such as, for example, OH, SH, or NH, may be protonated or deprotonated. The disclosure herein is intended to cover the disclosed compounds and compositions regardless of their state of protonation based on the environment (such as pH), as would be readily understood by the person of ordinary skill in the art. Correspondingly, compounds described herein with labile protons or basic atoms should also be understood to represent salt forms of the corresponding compound. Compounds described herein may be in a free acid, free base, or salt form. Pharmaceutically acceptable salts of the compounds described herein should be understood to be within the scope of the invention.

[0078] As used herein, the term “linked” or “conjugated” when referring to the connection between two compounds or molecules means that two compounds or molecules are joined by a covalent bond. Unless stated, the terms “linked” and “conjugated” as used herein may refer to the connection between a first compound and a second compound either with or without any intervening atoms or groups of atoms.

[0079] As used herein, the term “including” is used to herein mean, and is used interchangeably with, the phrase “including but not limited to.” The term “or” is used herein to mean, and is used interchangeably with, the term “and / or,” unless the context clearly indicates otherwise.

[0080] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

[0081] Where a value is explicitly recited, it is to be understood that values which are about the same quantity or amount as the recited value are also within the scope of the disclosure. Where a combination is disclosed, each sub-combination of the elements of that combination is also specifically disclosed and is within the scope of the disclosure. Conversely, where different elements or groups of elements are individually disclosed, combinations thereof are also disclosed. Where any element of a disclosure is disclosed as having a plurality of alternatives, examples of that disclosure in which each alternative is excluded singly or in any combination with the other alternatives are also hereby disclosed; more than one element of a disclosure can have such exclusions, and all combinations of elements having such exclusions are hereby disclosed.

[0082] Other objects, features, aspects, and advantages of the invention will be apparent from the following detailed description, accompanying figures, and from the claims. Detailed Description RNAi Agents

[0083] Described herein are RNAi agents for inhibiting expression of a YFV viral genome. Each YFV RNAi agent comprises a sense strand and an antisense strand. The sense strand can be 15 to 49 nucleotides in length. The antisense strand can be 18 to 49 nucleotides in length. The sense and antisense strands can be either the same length or they can be different lengths. In some embodiments, the sense and antisense strands are each independently 19 to 27 nucleotides in length. In some embodiments, both the sense and antisense strands are each 21- 26 nucleotides in length. In some embodiments, the sense and antisense strands are each 21-24 nucleotides in length. In some embodiments, the sense strand is about 19 nucleotides in length while the antisense strand is about 21 nucleotides in length. In some embodiments, the sense strand is about 21 nucleotides in length while the antisense strand is about 23 nucleotides in length. In some embodiments, a sense strand is 23 nucleotides in length and an antisense strandis 21 nucleotides in length. In some embodiments, both the sense and antisense strands are each 21 nucleotides in length. In some embodiments, the RNAi agent antisense strands are each independently 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the RNAi agent sense strands are each independently 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides in length. The sense and antisense strands are annealed to form a duplex, and in some embodiments, a double-stranded RNAi agent has a duplex length of about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides.

[0084] Examples of nucleotide sequences used in forming YFV RNAi agents are provided in Tables 2, 3, 4, and 5. Examples of RNAi agent duplexes, that include the sense strand and antisense strand sequences in Tables 2, 3, 4, and 5, are shown in Tables 6A, and 6B.

[0085] In some embodiments, the region of perfect, substantial, or partial complementarity between the sense strand and the antisense strand is 15-26 (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26) nucleotides in length and occurs at or near the 5′ end of the antisense strand (e.g., this region may be separated from the 5′ end of the antisense strand by 0, 1, 2, 3, or 4 nucleotides that are not perfectly, substantially, or partially complementary).

[0086] A sense strand of the YFV RNAi agents described herein includes at least 15 consecutive nucleotides that have at least 85% identity to a core stretch sequence (also referred to herein as a “core stretch” or “core sequence”) of the same number of nucleotides in a YFV genomic transcript. In some embodiments, a sense strand core stretch sequence is 100% (perfectly) complementary or at least about 85% (substantially) complementary to a core stretch sequence in the antisense strand, and thus the sense strand core stretch sequence is typically perfectly identical or at least about 85% identical to a nucleotide sequence of the same length (sometimes referred to, e.g., as a target sequence) present in the YFV genomic transcript target. In some embodiments, this sense strand core stretch is 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, this sense strand core stretch is 17 nucleotides in length. In some embodiments, this sense strand core stretch is 19 nucleotides in length. In some embodiments, this sense strand core stretch is 21 nucleotides in length.

[0087] An antisense strand of a YFV RNAi agent described herein includes at least 15 consecutive nucleotides that have at least 85% complementarity to a core stretch of the same number of nucleotides in a YFV genomic transcript and to a core stretch of the same number of nucleotides in the corresponding sense strand. In some embodiments, an antisense strand core stretch is 100% (perfectly) complementary or at least about 85% (substantially) complementary to a nucleotide sequence (e.g., target sequence) of the same length present inthe YFV genomic transcript target. In some embodiments, this antisense strand core stretch is 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, this antisense strand core stretch is 21 nucleotides in length. In some embodiments, this antisense strand core stretch is 19 nucleotides in length. A sense strand core stretch sequence can be the same length as a corresponding antisense core sequence or it can be a different length.

[0088] The YFV RNAi agent sense and antisense strands anneal to form a duplex. A sense strand and an antisense strand of a YFV RNAi agent can be partially, substantially, or fully complementary to each other. Within the complementary duplex region, the sense strand core stretch sequence is at least 85% complementary or 100% complementary to the antisense core stretch sequence. In some embodiments, the sense strand core stretch sequence contains a sequence of at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 nucleotides that is at least 85% or 100% complementary to a corresponding 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotide sequence of the antisense strand core stretch sequence (i.e., the sense and antisense core stretch sequences of a YFV RNAi agent have a region of at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 nucleotides that is at least 85% base paired or 100% base paired.)

[0089] In some embodiments, the antisense strand of a YFV RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2, or Table 3. In some embodiments, the sense strand of a YFV RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 2, Table 4, or Table 5.

[0090] In some embodiments, the sense strand and / or the antisense strand can optionally and independently contain an additional 1, 2, 3, 4, 5, or 6 nucleotides (extension) at the 3′ end, the 5′ end, or both the 3′ and 5′ ends of the core stretch sequences. The antisense strand additional nucleotides, if present, may or may not be complementary to the corresponding sequence in the YFV genomic transcript. The sense strand additional nucleotides, if present, may or may not be identical to the corresponding sequence in the YFV genomic transcript. The antisense strand additional nucleotides, if present, may or may not be complementary to the corresponding sense strand’s additional nucleotides, if present.

[0091] As used herein, an extension comprises 1, 2, 3, 4, 5, or 6 nucleotides at the 5' and / or 3' end of the sense strand core stretch sequence and / or antisense strand core stretch sequence. The extension nucleotides on a sense strand may or may not be complementary to nucleotides, either core stretch sequence nucleotides or extension nucleotides, in the correspondingantisense strand. Conversely, the extension nucleotides on an antisense strand may or may not be complementary to nucleotides, either core stretch nucleotides or extension nucleotides, in the corresponding sense strand. In some embodiments, both the sense strand and the antisense strand of an RNAi agent contain 3′ and 5′ extensions. In some embodiments, one or more of the 3′ extension nucleotides of one strand base pairs with one or more 5′ extension nucleotides of the other strand. In other embodiments, one or more of 3′ extension nucleotides of one strand do not base pair with one or more 5′ extension nucleotides of the other strand. In some embodiments, a YFV RNAi agent has an antisense strand having a 3′ extension and a sense strand having a 5′ extension. In some embodiments, the extension nucleotide(s) are unpaired and form an overhang. As used herein and in the art, an “overhang” refers to an extension of a stretch of one or more unpaired nucleotides located at a terminal end of either the sense strand or the antisense strand that does not form part of the hybridized or duplexed portion of an RNAi agent disclosed herein.

[0092] In some embodiments, a YFV RNAi agent comprises an antisense strand having a 3′ extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In other embodiments, a YFV RNAi agent comprises an antisense strand having a 3′ extension of 1, 2, or 3 nucleotides in length. In some embodiments, one or more of the antisense strand extension nucleotides comprise nucleotides that are complementary to the corresponding YFV genomic transcript sequence. In some embodiments, one or more of the antisense strand extension nucleotides comprise nucleotides that are not complementary to the corresponding YFV genomic transcript sequence.

[0093] In some embodiments, a YFV RNAi agent comprises a sense strand having a 3′ extension of 1, 2, 3, 4, or 5 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprises adenosine, uracil, or thymidine nucleotides, AT dinucleotide, or nucleotides that correspond to or are the identical to nucleotides in the YFV genomic transcript sequence. In some embodiments, the 3′ sense strand extension includes or consists of one of the following sequences, but is not limited to: T, UT, TT, UU, UUT, TTT, or TTTT (each listed 5′ to 3′).

[0094] A sense strand can have a 3′ extension and / or a 5' extension. In some embodiments, a YFV RNAi agent comprises a sense strand having a 5′ extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprise nucleotides that correspond to or are identical to nucleotides in the YFV genomic transcript sequence.

[0095] Examples of sequences used in forming YFV RNAi agents are provided in Tables 2, 3, 4, 5, and 6D. In some embodiments, a YFV RNAi agent antisense strand includes a sequence of any of the sequences in Tables 2, 3, or 6D. In certain embodiments, a YFV RNAi agent antisense strand comprises or consists of any one of the modified sequences in Table 3 or Table 6D. In some embodiments, a YFV RNAi agent antisense strand includes the sequence of nucleotides (from 5′ end ^ 3′ end) 1-17, 2-15, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1- 21, or 2-21, of any of the sequences in Tables 2, 3 or 6D. In some embodiments, a YFV RNAiagent sense strand sequence of any of the sequences in Tables 2, 4, 5, or 6D. In some embodiments, a YFV RNAi agent sense strand includes the sequence of nucleotides (from 5′ end ^ 3′ end) 1-18, 1-19, 1-20, 1-21, 2-19, 2-20, 2-21, 3-20, 3-21, or 4-21 of any of the in Tables 2, 4, 5, or 6D. In certain embodiments, a YFV RNAi agent sense strandcomprises or of a modified sequence of any one of the modified sequences in Table 4, 5 or 6D.

[0096] In some embodiments, the sense and antisense strands of the RNAi agents described herein contain the same number of nucleotides. In some embodiments, the sense and antisense strands of the RNAi agents described herein contain different numbers of nucleotides. In some embodiments, the sense strand 5′ end and the antisense strand 3′ end of an RNAi agent form a blunt end. In some embodiments, the sense strand 3′ end and the antisense strand 5′ end of an RNAi agent form a blunt end. In some embodiments, both ends of an RNAi agent form blunt ends. In some embodiments, neither end of an RNAi agent is blunt-ended. As used herein a “blunt end” refers to an end of a double stranded RNAi agent in which the terminal nucleotides of the two annealed strands are complementary (form a complementary base-pair).

[0097] In some embodiments, the sense strand 5′ end and the antisense strand 3′ end of an RNAi agent form a frayed end. In some embodiments, the sense strand 3′ end and the antisense strand 5′ end of an RNAi agent form a frayed end. In some embodiments, both ends of an RNAi agent form a frayed end. In some embodiments, neither end of an RNAi agent is a frayed end. As used herein a frayed end refers to an end of a double stranded RNAi agent in which the terminal nucleotides of the two annealed strands from a pair (i.e., do not form an overhang) but are not complementary (i.e. form a non-complementary pair). In some embodiments, one or more unpaired nucleotides at the end of one strand of a double stranded RNAi agent form an overhang. The unpaired nucleotides may be on the sense strand or the antisense strand, creating either 3' or 5' overhangs. In some embodiments, the RNAi agent contains: a blunt end and a frayed end, a blunt end and 5′ overhang end, a blunt end and a 3′ overhang end, a frayed end and a 5′ overhang end, a frayed end and a 3′ overhang end, two 5′ overhang ends, two 3′overhang ends, a 5′ overhang end and a 3′ overhang end, two frayed ends, or two blunt ends. Typically, when present, overhangs are located at the 3’ terminal ends of the sense strand, the antisense strand, or both the sense strand and the antisense strand.

[0098] The YFV RNAi agents disclosed herein may also be comprised of one or more modified nucleotides. In some embodiments, substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand of the YFV RNAi agent are modified nucleotides. The YFV RNAi agents disclosed herein may further be comprised of one or more modified internucleoside linkages, e.g., one or more phosphorothioate or phosphorodithioate linkages. In some embodiments, a YFV RNAi agent contains one or more modified nucleotides and one or more modified internucleoside linkages. In some embodiments, a 2′-modified nucleotide is combined with modified internucleoside linkage.

[0099] In some embodiments, a YFV RNAi agent is prepared or provided as a salt, mixed salt, or a free-acid. In some embodiments, a YFV RNAi agent is prepared as a pharmaceutically acceptable salt. In some embodiments, a YFV RNAi agent is prepared as a pharmaceutically acceptable sodium salt. Such forms that are well known in the art are within the scope of the inventions disclosed herein. Modified Nucleotides

[0100] Modified nucleotides, when used in various oligonucleotide constructs, can preserve activity of the compound in cells while at the same time increasing the serum stability of these compounds, and can also minimize the possibility of activating interferon activity in humans upon administering of the oligonucleotide construct.

[0101] In some embodiments, a YFV RNAi agent contains one or more modified nucleotides. As used herein, a “modified nucleotide” is a nucleotide other than a ribonucleotide (2′-hydroxyl nucleotide). In some embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%) of the nucleotides are modified nucleotides. As used herein, modified nucleotides can include, but are not limited to, deoxyribonucleotides, nucleotide mimics, abasic nucleotides, 2′-modified nucleotides, inverted nucleotides, modified nucleobase-comprising nucleotides, bridged nucleotides, peptide nucleic acids (PNAs), 2′,3′-seco nucleotide mimics (unlocked nucleobase analogues), locked nucleotides, 3′-O-methoxy (2′ internucleoside linked) nucleotides, 2'-F- Arabino nucleotides, 5'-Me, 2'-fluoro nucleotide, morpholine nucleotides, vinyl phosphonate deoxyribonucleotides, vinyl phosphonate containing nucleotides, and cyclopropyl phosphonate containing nucleotides. 2′-modified nucleotides (i.e., a nucleotide with a group other than ahydroxyl group at the 2′ position of the five-membered sugar ring) include, but are not limited to, 2′-O-methyl nucleotides (also referred to herein or in the art as 2′-methoxy nucleotides), 2′- fluoro nucleotides (also referred to herein or in the art as 2′-deoxy-2′-fluoro nucleotides), 2′- deoxy nucleotides, 2′-methoxyethyl (2′-O-2-methoxylethyl) nucleotides (also referred herein or in the art as 2′-MOE nucleotides), 2′-amino nucleotides, and 2′-alkyl nucleotides. It is not necessary for all positions in a given compound to be uniformly modified. Conversely, more than one modification can be incorporated in a single YFV RNAi agent or even in a single nucleotide thereof. The YFV RNAi agent sense strands and antisense strands can be synthesized and / or modified by methods known in the art. Modification at one nucleotide is independent of modification at another nucleotide.

[0102] Modified nucleobases include synthetic and natural nucleobases, such as 5- substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, (e.g., 2-aminopropyladenine, 5-propynyluracil, or 5-propynylcytosine), 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, inosine, xanthine, hypoxanthine, 2-aminoadenine, 6-alkyl (e.g., 6- methyl, 6-ethyl, 6-isopropyl, or 6-n-butyl) derivatives of adenine and guanine, 2-alkyl (e.g., 2- methyl, 2-ethyl, 2-isopropyl, or 2-n-butyl) and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 5-halouracil, cytosine, 5-propynyl uracil, 5-propynyl cytosine, 6-azo uracil, 6-azo cytosine, 6-azo thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-sulfhydryl, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo (e.g., 5-bromo), 5-trifluoromethyl, and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, and 3-deazaadenine.

[0103] In some embodiments, the 5’ and / or 3′ end of the antisense strand can include abasic residues (Ab), which can also be referred to as an “abasic site” or “abasic nucleotide.” An abasic residue (Ab) is a nucleotide or nucleoside that lacks a nucleobase at the 1′ position of the sugar moiety. In some embodiments, an abasic residue can be placed internally in a nucleotide sequence. In some embodiments, Ab or AbAb can be added to the 3′ end of the antisense strand. In some embodiments, the 5′ end of the sense strand can include one or more additional abasic residues (e.g., (Ab) or (AbAb)). In some embodiments, UUAb, UAb, or Ab are added to the 3′ end of the sense strand. In some embodiments, an abasic (deoxyribose) residue can be replaced with a ribitol (abasic ribose) residue.

[0104] In some embodiments, all or substantially all of the nucleotides of an RNAi agent are modified nucleotides. As used herein, an RNAi agent wherein substantially all of the nucleotides present are modified nucleotides is an RNAi agent having four or fewer (i.e., 0, 1,2, 3, or 4) nucleotides in both the sense strand and the antisense strand being ribonucleotides (i.e., unmodified). As used herein, a sense strand wherein substantially all of the nucleotides present are modified nucleotides is a sense strand having two or fewer (i.e., 0, 1, or 2) nucleotides in the sense strand being unmodified ribonucleotides. As used herein, an antisense strand wherein substantially all of the nucleotides present are modified nucleotides is an antisense strand having two or fewer (i.e., 0, 1, or 2) nucleotides in the antisense strand being unmodified ribonucleotides. In some embodiments, one or more nucleotides of an RNAi agent is an unmodified ribonucleotide. Chemical structures for certain modified nucleotides are set forth in Table 7 herein. Modified Internucleoside Linkages

[0105] In some embodiments, one or more nucleotides of a YFV RNAi agent are linked by non-standard linkages or backbones (i.e., modified internucleoside linkages or modified backbones). Modified internucleoside linkages or backbones include, but are not limited to, phosphorothioate groups (represented herein as a lower case “s”), phosphorodithioate groups (represented herein as lower case “ss”), chiral phosphorothioates, thiophosphates, phosphorodithioates, phosphotriesters, aminoalkyl-phosphotriesters, alkyl phosphonates (e.g., methyl phosphonates or 3′-alkylene phosphonates), chiral phosphonates, phosphinates, phosphoramidates (e.g., 3′-amino phosphoramidate, aminoalkylphosphoramidates, or thionophosphoramidates), thionoalkyl-phosphonates, thionoalkylphosphotriesters, morpholino linkages, boranophosphates having normal 3′-5′ linkages, 2′-5′ linked analogs of boranophosphates, or boranophosphates having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3′-5′ to 5′-3′ or 2′-5′ to 5′-2′. In some embodiments, a modified internucleoside linkage or backbone lacks a phosphorus atom. Modified internucleoside linkages lacking a phosphorus atom include, but are not limited to, short chain alkyl or cycloalkyl inter-sugar linkages, mixed heteroatom and alkyl or cycloalkyl inter-sugar linkages, or one or more short chain heteroatomic or heterocyclic inter-sugar linkages. In some embodiments, modified internucleoside backbones include, but are not limited to, siloxane backbones, sulfide backbones, sulfoxide backbones, sulfone backbones, formacetyl and thioformacetyl backbones, methylene formacetyl and thioformacetyl backbones, alkene- containing backbones, sulfamate backbones, methyleneimino and methylenehydrazino backbones, sulfonate and sulfonamide backbones, amide backbones, and other backbones having mixed N, O, S, and CH2components.

[0106] In some embodiments, a sense strand of a YFV RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate or phosphorodithioate linkages, an antisense strand of a YFV RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate or phosphorodithioate linkages, or both the sense strand and the antisense strand independently can contain 1, 2, 3, 4, 5, or 6 phosphorothioate or phosphorodithioate linkages. In some embodiments, a sense strand of a YFV RNAi agent can contain 1, 2, 3, or 4 phosphorothioate or phosphorodithioate linkages, an antisense strand of a YFV RNAi agent can contain 1, 2, 3, or 4 phosphorothioate or phosphorodithioate linkages, or both the sense strand and the antisense strand independently can contain 1, 2, 3, or 4 phosphorothioate or phosphorodithioate linkages.

[0107] In some embodiments, a YFV RNAi agent sense strand contains at least two phosphorothioate or phosphorodithioate internucleoside linkages. In some embodiments, the phosphorothioate or phosphorodithioate internucleoside linkages are between the nucleotides at positions 1-3 from the 3' end of the sense strand. In some embodiments, one phosphorothioate or phosphorodithioate internucleoside linkage is at the 5’ end of the sense strand nucleotide sequence, and another phosphorothioate or phosphorodithioate linkage is at the 3’ end of the sense strand nucleotide sequence. In some embodiments, two phosphorothioate or phosphorodithioate internucleoside linkages are located at the 5’ end of the sense strand, and another phosphorothioate or phosphorodithioate linkage is at the 3’ end of the sense strand. In some embodiments, the sense strand does not include any phosphorothioate or phosphorodithioate internucleoside linkages between the nucleotides, but contains one, two, or three phosphorothioate or phosphorodithioate linkages between the terminal nucleotides on both the 5’ and 3’ ends and the optionally present inverted abasic residue terminal caps. In some embodiments, the targeting ligand is linked to the sense strand via a phosphorothioate or phosphorodithioate linkage.

[0108] In some embodiments, a YFV RNAi agent antisense strand contains four phosphorothioate or phosphorodithioate internucleoside linkages. In some embodiments, the four phosphorothioate or phosphorodithioate internucleoside linkages are between the nucleotides at positions 1-3 from the 5' end of the antisense strand and between the nucleotides at positions 19-21, 20-22, 21-23, 22-24, 23-25, or 24-26 from the 5' end. In some embodiments, three phosphorothioate or phosphorodithioate internucleoside linkages are located between positions 1-4 from the 5’ end of the antisense strand, and a fourth phosphorothioate or phosphorodithioate internucleoside linkage is located between positions 20-21 from the 5’ end of the antisense strand. In some embodiments, a YFV RNAi agent contains at least three or four phosphorothioate or phosphorodithioate internucleoside linkages in the antisense strand.Capping Residues or Moieties

[0109] In some embodiments, the sense strand may include one or more capping residues or moieties, sometimes referred to in the art as a “cap,” a “terminal cap,” or a “capping residue.” As used herein, a “capping residue” is a non-nucleotide compound or other moiety that can be incorporated at one or more termini of a nucleotide sequence of an RNAi agent disclosed herein. A capping residue can provide the RNAi agent, in some instances, with certain beneficial properties, such as, for example, protection against exonuclease degradation. In some embodiments, inverted abasic residues (invAb) (also referred to in the art as “inverted abasic sites”) are added as capping residues. (See, e.g., F. Czauderna, Nucleic Acids Res., 2003, 31(11), 2705-16; U.S. Patent No.5,998,203). Capping residues are generally known in the art, and include, for example, inverted abasic residues as well as carbon chains such as a terminal C3H7 (propyl), C6H13 (hexyl), or C12H25 (dodecyl) groups. In some embodiments, a capping residue is present at either the 5′ terminal end, the 3′ terminal end, or both the 5′ and 3′ terminal ends of the sense strand. In some embodiments, the 5’ end and / or the 3′ end of the sense strand may include more than one inverted abasic deoxyribose moiety as a capping residue.

[0110] In some embodiments, one or more inverted abasic residues (invAb) are added to the 3′ end of the sense strand. In some embodiments, one or more inverted abasic residues (invAb) are added to the 5′ end of the sense strand. In some embodiments, one or more inverted abasic residues or inverted abasic sites are inserted between the targeting ligand and the nucleotide sequence of the sense strand of the RNAi agent. In some embodiments, the inclusion of one or more inverted abasic residues or inverted abasic sites at or near the terminal end or terminal ends of the sense strand of an RNAi agent allows for enhanced activity or other desired properties of an RNAi agent.

[0111] In some embodiments, one or more inverted abasic residues (invAb) are added to the 5′ end of the sense strand. In some embodiments, one or more inverted abasic residues can be inserted between the targeting ligand and the nucleotide sequence of the sense strand of the RNAi agent. The inverted abasic residues may be linked via phosphate, phosphorothioate or phosphorodithioate (e.g., shown herein as (invAb)s)), or other internucleoside linkages. In some embodiments, the inclusion of one or more inverted abasic residues at or near the terminal end or terminal ends of the sense strand of an RNAi agent may allow for enhanced activity or other desired properties of an RNAi agent. In some embodiments, an inverted abasic (deoxyribose) residue can be replaced with an inverted ribitol (abasic ribose) residue. In someembodiments, the 3′ end of the antisense strand core stretch sequence, or the 3′ end of the antisense strand sequence, may include an inverted abasic residue. The chemical structures for inverted abasic deoxyribose residues are shown in Table 7 below. YFV RNAi Agents

[0112] The YFV RNAi agents disclosed herein are designed to target specific positions on a YFV viral genome (e.g., SEQ ID NO:1). Primate (Minas Gerais, Nova Lima, Brazil), yellow fever virus (YFV) polyprotein gene, genomic RNA (SEQ ID NO: 1) (10164 bases), NCBI Reference Sequence: MK249066.1: 1 aaaaccctgg gcgtcaatat ggttcgacga ggagtccgct ccttgtcaag caaaataaaa 61 caaaaaacaa aacaaattgg aagtagacct ggaccttcaa gaggcgttca aggatttgtt 121 tttttctttt tgttcaacgt tttgactgga aagaagatta ctgctcatct gaagaaacta 181 tggagaatgc tggacccaag acagggctta gttgtcctga ggaaggttaa gagggtggtg 241 gcgagtctga tgagaggttt gtcctcgagg aaacgccgat cccaagatgt tttgactata 301 caatttttaa ttctgggaat gctgctgatg gttggtggag tgaccctggt acgcagaaac 361 agatggttac ttctgaatgt tacatctgag gaccttggga aaaccttctc cgttggcaca 421 ggcaactgca caaccaacat tctggaggcc aaatactggt gtccagattc catggaatac 481 aactgcccca atctcagtcc aagagaagag cctgatgaca tagactgttg gtgctatgga 541 gtggaaaatg tcagagtcgc ttatggcaag tgtgattcag cgggtaggtc aagaaggtcc 601 agaagggcca ttgacttacc cacacatgaa aatcatggct taaagacccg gcaagaaaag 661 tggatgactg gaagaatggg cgagagacag ctgcagaaaa ttgaaagatg gctggtgagg 721 aaccccttct ttgcggcaac agccttggcc attgcctacc tggtggggag caacatgacg 781 caacgagttg tcattgccct gctagtcttg gctgttggcc cagcctattc ggctcactgc 841 ataggaataa ccgacaggga tttcattgag ggggtgcatg ggggaacctg ggtttcagcc 901 accttggaac aggacaagtg tgtcactgtg atggcccccg acaagccttc actagacata 961 tcactagaaa cagttgccat tgatggacct gctgaggcaa ggaaggtgtg ctacagtgca 1021 gtcttgacca acgtgaagat caatgacaag tgccccagca ctggtgaagc ccacttggaa 1081 gaagaaaatg aaggagacaa tgcttgcaag cgaacttact ccgatagagg ttggggaaat 1141 ggttgtggct tgtttggaaa aggaagcatt gtggcatgtg ccaagtttac ctgtgccaaa 1201 tccatgagtc tatttgaggt tgatcagacc aaaattcagt atgtcattag ggcacagcta 1261 catgtcggag ccaagcagga gaactggaac actgacatca aaactctcaa gtttgatgcc 1321 ctgtcgggct ctcaggaagc tgagttcact ggatacggga gggccacact ggagtgccag 1381 gtgcagaccg cagtggactt cagtaacagt tacattgcag agatggagaa agagagctgg1441 attgtggata aacagtgggc ccaagacctg accctacctt ggcagagtgg aagtggcggc 1501 gtgtggagag agatgcatca tctcgtggaa tttgagcctc cacatgccgc aactatcaaa 1561 gtgttagccc ttggaaacca agaaggatcc ttgaagactg ctctcactgg tgcaatgcga 1621 gtcacaaaag acacaaacaa cagcaagctg tataagctgc atggggggca tgtcgcgtgt 1681 agggtgaagt tgtcagctct cacacttaag ggaacatcct acaagatgtg taccgacaaa 1741 atgtcctttg tcaagaaccc aactgacact ggacatggca ctgcagtgat gcaagtgaag 1801 gtgccaaaag gagcaccctg caggattcca gtaatggtcg ccgatgatct cacagcggca 1861 gtcaacaagg gcatcttggt cacagtcaat ccaatagcct ccaccaatga tgatgaagtg 1921 ttgatcgagg tgaatcctcc ctttggggat agttacatca tagttgggac aggggattca 1981 cgcctgactt accagtggca caaggaaggc agctcaatag ggaagttgtt tactcagacc 2041 atgaagggcg cagagcgtct ggccgtcatg ggagatgctg cctgggactt tggttctgct 2101 ggaggattct tcacatcagt cggaaaaggc atacacactg tgtttggctc tgccttccaa 2161 ggactgtttg gtggcttgag ctggataaca aaggtcatca tgggggtagt cctcatatgg 2221 gttggcatta acacaaggaa tatgacaatg tccatgagca tgatcctagt tggagtcatc 2281 atgatgttcc tgtccctagg agttggggcg gaccaaggat gtgcaataaa ctttggcaag 2341 agagaactca agtgtgggga tggcatcttc gtctttagag attcagatga ctggctgaac 2401 aagtattcat actatccaga ggacccagta aaacttgctt caatagtgaa agcttccttt 2461 gaggaaggga agtgtggcct gaactcagtc gactccctgg aacatgagat gtggagaagc 2521 agggcagatg agatcaatgc cattcttgag gaaaatgagg tagacatctc agtggtggtc 2581 caagactcaa aaagcattta tcagagaggg acacatccgt tttccagaat acgtgatggc 2641 ctacaatatg gctggaagac ttggggcaaa aaccttgtgt tctccccagg aagaaagaat 2701 ggaagcttca tcatagatgg gaagtccagg aaagagtgtc cgttctcaaa cagagtgtgg 2761 aattccttcc agatagaaga gtttgggaca ggagtgttca ccacccgagt gtacatggat 2821 gcagtctttg agtacactat ggattgtgat ggatccatcc tgggtgcagc agtgaatgga 2881 aagaagagcg cgcatgggtc cccaacattc tggatgggaa gccatgaggt gaatggaaca 2941 tggatgattc atactctaga gacactggac tacaaggaat gtgaatggcc gctgacacac 3001 acgattggaa catcagttga agagagtgac atgttcatgc cgaggtcaat tgggggtcca 3061 gttagctccc acaaccacat tccgggatat aaggtccaga caaacggacc ctggatgcag 3121 gtgccactag aggtgaaaag ggaagcttgc ccaggaacca gtgtggttgt tgacggaggc 3181 tgtgatgggc gtgggaagtc gaccagatcg accactgaca gcgggaagat cattcctgaa 3241 tggtgttgcc gctcatgcac aatgccacca gtgagcttcc acgggagtga tggttgctgg 3301 tatcctatgg agattagacc aaagaagaca catgacagcc acctggtccg ctcatgggta 3361 acggctggag agatccatgc aatccccttt gggttggtga gcatgatgat agccatggaa 3421 gtggtattga ggaagagaca gggacccaag caaatactgg ttgggggcat ggtgcttcta3481 ggagccatgc tagttggaca ggtgactatc ttggacttgc tgaagctcac agtggcggtt 3541 ggactgcact ttcatgagat gaataatgga ggggatgcca tgtatatggc cctgatcgct 3601 gctttctcaa tcagaccagg gctgctcatc ggctttggat tgaggacgct gtggagcccc 3661 cgagaacgcc tcgtgctgac cctgggggcc gccatggtgg agattgcttt gggtggcatg 3721 atgggaggtc tgtggaagta cctgaacgca gtgtcccttt gcatcctgac aataaacgct 3781 gttgcctcca gaaaagcatc aaatgtcatc ctgcccttga tggctctgtt aacacctgtg 3841 acaatggctg aggtgagact tgcaacaatg ctcttctgca ctgtggtcat catcggcgtt 3901 ctccatcaga actcaaagga cacttccatg cagaagacca tacccctggt ggccctcaca 3961 ctgacatcct acctgggact gacgcagccc ttcttgggct tgtgtgcctt catggcaacc 4021 cgaatattcg ggcgaaggag catcccagtg aatgaagcgc ttgcagctgc tggtctcgtg 4081 ggagtcttgg cagggctagc tttccaggag atggaaaatt ttctaggtcc agttgcagtt 4141 ggaggaatcc tgatgatgct ggtcagtgtg gctgggaggg tagatggact tgaactcagg 4201 aagcttgggg aagtttcttg ggaagaagaa gctgagatca gtggaagttc tgcccgttat 4261 gatgtaactc tcagtgagca aggggaattt aaactactct ctgaagagaa ggtgccatgg 4321 gatcaggttg tgatgacttc actggctttg gtcggagctg ccatccatcc atttgcactt 4381 ttattggtac atgctggctg gttgtatcac gtcaaaggag ccagaagaag tggggatgtc 4441 ctttgggaca ttcccacacc taaaatcatt gaggagtgtg aatatctagt gccttggagc 4501 gccagatttt tgacttcaaa ccgagctgcn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 4561 nnnntctccg atccgaagtg gctcgtcacg cgaggggcct ttctcgttag aaatggtaaa 4621 aagctggttc catcctgggc ctcagtcaag gaagaccttg ttgcttatgg cggctcatgg 4681 aagttggatg gtagatggga tggagaagag gaggttcagt tgatagcagc tgcccccgga 4741 aaaaacgtag tgaatgtcca aacaaagcca agcctattca aggttaagaa tggaggagaa 4801 attggggcgg ttgcccttga ctacccaagt ggcacttctg gttctcccat cgtcaacagg 4861 aatggtgagg taatagggct gtatggcaat ggaattcttg ttggtgacaa ctcttttgtg 4921 tctgccatat cccaaactga ggtgaaagag gaggggaaag aggagctaca ggaaatcccg 4981 acaatgttga agaaagggat gacaaccatt cttgatttcc atcctggagc tgggaaaaca 5041 agacgttttc ttcctcagat cctggctgaa tgcgcacgaa gacggttgcg cacacttgtg 5101 ctggctccta ctagagttgt cctttctgaa atgaaggaag cctttcacgg tttagatgtc 5161 aagtttcaca cacaggcttt ctccgctcac ggtagcggaa aagaggtcat tgacgccatg 5221 tgtcatgcca ccctgacata tagaatgttg gaaccaacca gagtggtcaa ttgggaagtg 5281 atcatcatgg acgaagcaca ttttttggat ccggctagca tagcagccag aggctgggcg 5341 gcacatagag ccagagcaaa tgaaagtgca acaatcttga tgactgctac ccctccggga 5401 accagtgatg aatttccaca ttcaaatggg gaaatagagg atgtccaaac ggacattcct 5461 agtgagcctt ggaacacagg tcatgactgg attttggcgg acaaaaggcc cacggcctgg5521 tttcttccat ccatcagggc agcaaatgtc atggcagcct ctttgcgcaa agctggaaag 5581 agtgtggtgg tgctaaacag gaaaaccttt gagaaagaat accccacaat taaacagaaa 5641 aaacctgatt tcatcttggc cactgacata gctgagatgg gagccaatct ctgcgtggag 5701 agagtgttgg attgtaggac ggctttcaaa cctgtgcttg tggatgaagg gagaaaggtg 5761 gcaataaaag ggccacttcg gatttcagct tcctccgctg cccaaaggag ggggcgcatt 5821 ggaaggaacc ctaacagaga cggggattca tactactact ctgagcccac aagtgaagac 5881 aatgcgcatc atgtctgctg gcttgaggcc tcaatgctcc tagacaacat ggaggtgaga 5941 ggtgggatgg ttgctccact ttatggcata gaaggaacaa agacaccagt ttccccaggt 6001 gaaatgaggc taagagatga ccagaggaga gtcttccgag agctggtgag gaattgtgac 6061 ctgcctgttt ggctctcatg gcaagtggct aaggctggat tgaagacgaa tgaccgaaag 6121 tggtgctttg agggtccaga agaacatgag atcttgaatg acagtggtga gacagtaaag 6181 tgcagagccc ctggaggagc caagaagcct ctgcgtccac ggtggtgcga tgaaagggtg 6241 tcgtctgacc agagtgcgct tgccgacttc ataaagtttg ctgagggcag gagaggggct 6301 gctgagatgc tggtcgtgct gagtgaactc ccagacttct tggccaagaa aggtggagag 6361 gcggtggata ctatcagcgt gctcttgcac tctgaggaag gttccagagc ttaccgcaat 6421 gcattgtcaa tgatgcctga ggcaatgaca acagtcatgc tgtttgttct ggccgggctg 6481 ctgacgtctg gaatggttat ctttttcatg tctcccaagg gtatcagcag aatgtctatg 6541 gcaatgggca cgatggctgg ttgtggatac ctcatgtttc ttggaggcgt caaacccacc 6601 cacatctctt acatcatgct aatattcttt gtcttgatgg tggttgtggt tccggagccg 6661 gggcagcaga gaaccattca ggacaaccaa gtggcttatc ttattattgg catcctgacg 6721 ctgatttctg tggtggcagc caatgaacta ggcatgctgg aaaagactaa ggaagacctc 6781 tttggaaaaa agaatttgat tccatctagt gccgcacctt ggagctggcc agattttgac 6841 ttgaaaccag gagctgcttg gactgtctat gttggcattg tcacaatgct ctccccaatg 6901 ctgcaccact ggatcaaggt tgagtatggt aatctgtctt tgtctggaat tgcacagtca 6961 gcctcagttt tgtcattcat ggacaagggc atcccgttta tgaagatgaa catctcggtc 7021 ataattctac tggtcagtgg ctggaattca ataacggtga tgcccctgct ttgtggcatt 7081 ggatgcgcca tgctacactg gactctcatc ctgcccggaa taaaagcgca gcagtcaaag 7141 ctggcacaga ggagggtgtt tcatggtgtt gctaagaatc cggtggttga tgggaatcca 7201 acagtcgaca ttgaggaagc cccggaaatg cctgccctct atgagaagaa gttggcattg 7261 tatcttctgc ttgcccttag cttggcctct gttgccatgt gtagaacacc cttctcactg 7321 gctgaaggca ttgtgctggc atcagcagcc ctgggaccac tcatcgaggg aaataccagc 7381 ctcttgtgga atggacccat ggctgtgtcc atgacaggag tcatgcgggg gaactactat 7441 gcttttgtgg gtgttatgta caatctctgg aagatgaaga ctggacgcag ggggagagcg 7501 aatgggaaga ccctgggtga ggtctggaaa agggagctga acctgctgga caaacagcag7561 tttgagctgt ataaacggac agacattgtg gaggtggacc gtgacacagc tcgccgacac 7621 ctggctgaag ggaaagtgga caccggagtg gccgtctcga gagggaccgc aaaattgaga 7681 tggttccatg aacgtggcta tgtcaagttg gaaggaagag tgactgacct gggatgtggg 7741 cgtggtggct ggtgctacta cgctgctgca cagagagaag tgagtggggt caggggattc 7801 acccttggaa aggaaggcca cgaaaagccc atgaatgtgc agagcctggg gtggaacatc 7861 atcaccttca aggacaagac tgatgtccat cgccttgagc cgataaagtg tgataccctg 7921 ctgtgcgaca ttggagagtc gtccccatca tcagtgaccg aaggggaaag aaccatgaga 7981 gttcttgaca ctgttgagaa atggttgagc tgtggtgttg aaagcttctg tgtgaaggtg 8041 ttggctccat acatgcctga tgtgcttgaa aagttagagt tgctccaaag gaggtttggt 8101 ggaacggtaa tcaggaatcc cctctctaga aattcaaccc acgagatgta ttatgtgtcg 8161 ggagcccgca gtaacatcac gttcactgtg aatcaaacat cccgcctctt aatgaggaga 8221 atgaggcgcc cgacaggcaa ggtgactctt gaagccgatg tcatcctccc aattggaaca 8281 cgcagtgtgg aaacagataa aggaccactt gatagggcag ccattgaaga gagggttgaa 8341 agaataaaat cagaatacac cgccacttgg ttccatgata gtgacaaccc ttacaggact 8401 tggcattatt gtggttccta cgtcacaaga acctcaggga gtgcagcaag catgattaac 8461 ggggtgatta agatcttgac atacccctgg gacaggatag aggaagtcac gagaatggca 8521 atgacagaca caactccttt tggacaacaa agagtgttca aggaaaaagt tgacaccaga 8581 gcaaaggatc caccagcagg gaccaggaaa atcatgaagg ttgtcaatag gtggctattc 8641 cgtcacctgg ccagagaaaa gaaccccagg ttgtgcacaa aggaggagtt tatagcaaaa 8701 gttcgcagtc atgcagccat cggagctttc ctggaagagc aagaacagtg gaagactgcc 8761 aatgaagctg tccaagatcc gaagttctgg gaattagtgg atgaagaacg acggctgcat 8821 cagcagggca ggtgccgaac ttgtgtgtac aacatgatgg ggaagagaga aaagaagctg 8881 tcagagtttg gaaaggcgaa gggaagccgt gccatctggt acatgtggct gggagcccga 8941 tatcttgagt ttgaagccct gggattcctg aatgaggacc actgggcatc cagggagaac 9001 tcagggggag gggttgaagg tatcggtcta caatatctag gctacgtgat cagggacctg 9061 gctgcactag agggtggtgg attctatgcg gatgacacag ctggatggga cacacgcata 9121 acagaggcgg atctggatga tgaacaggaa atcttgaact acatgagccc acaccatagg 9181 aagttggcgc tggctgtaat ggaaatgaca tacaaaaaca aagtggtgaa agtcctgagg 9241 ccagctccag gtgggaaagc ttacatggat gtcataagcc ggcgggacca gagaggatct 9301 gggcaggtgg tgacttacgc cttgaacacc atcaccaacc tgaaggttca actgattagg 9361 atggcggagg cagagatggt gatacaccac cagcatgtcc aggactgtga cgacacggtt 9421 ttgaccaagc ttgaagcatg gctcgctgag catggctgcg acaggcttaa gaggatggca 9481 gtgagtggag atgactgtgt tgtccgaccc attgatgaca ggtttggcct ggctctgtcc 9541 catctcaatg ccatgtcaaa ggtgcgaaaa gacatatctg aatggcagcc atcaaaagga9601 tgggatgact gnnnnnnnnn nnnnnnnnnn nnnnnnnnct ttcatgaact gcaattgaag 9661 gatggcagga gaattgtagt gccttgccgg gaccaagatg agctggttgg cagagggaga 9721 gtgtctccag ggaatggttg gatgatcaag gagacagcat gccttagcaa ggcctacgcc 9781 aacatgtggt cactgatgta ctttcacaag agggacatga ggctgctttc actggctgtt 9841 tcttctgctg ttcccacatc ttgggttcca cagggacgca ccacgtggtc tgttcatggg 9901 aagggagagt ggatgaccac agaagacatg cttgaggtgt ggaacagagt gtggataacc 9961 aacaatccac acatgcagga caaaacgacg gtgaaggagt ggcgagacat cccttacctg 10021 accaagagac aggacaagct ttgtggatca ctgattggga tgaccaacag agccacttgg 10081 gcatctcaca tccacttggt aatacaccgc atccggacac tgattgggaa agagagatac 10141 actgactacc tgacagtcat ggat

[0113] As defined herein, an antisense strand sequence is designed to target a YFV viral genome at a given position on the viral genome when the 5′ terminal nucleobase of the antisense strand is aligned with a position that is 21 nucleotides downstream (towards the 3′ end) from the position on the viral genome when base pairing to the viral genome. For example, as illustrated in Tables 1 and 2 herein, an antisense strand sequence designed to target a YFV viral genome at position 2249 requires that when base pairing to the viral genome, the 5′ terminal nucleobase of the antisense strand is aligned with position 2269 of the YFV viral genome.

[0114] As provided herein, a YFV RNAi agent does not require that the nucleobase at position 1 (5′ ^ 3′) of the antisense strand be complementary to the viral genome, provided that there is at least 85% complementarity (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity) of the antisense strand and the viral genome across a core stretch sequence of at least 15 consecutive nucleotides. For example, for a YFV RNAi agent disclosed herein that is designed to target position 2249 of a YFV viral genome, the 5′ terminal nucleobase of the antisense strand of the of the YFV RNAi agent must be aligned with position 2269 of the viral genome; however, the 5′ terminal nucleobase of the antisense strand may be, but is not required to be, complementary to position 2269 of a YFV viral genome, provided that there is at least 85% complementarity (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity) of the antisense strand and the viral genome across a core stretch sequence of at least 15 consecutive nucleotides. As shown by, among other things, the examples disclosed herein and as is well known in the art, the specific site of binding of the viral genome by the antisense strand of the YFV RNAi agent (e.g., whether the YFV RNAi agent is designed to target a YFV viral genome at position 2249, at position 3393, or at some other position) is important to the level of inhibition achieved by the YFV RNAi agentas well as the toxicity profile achieved by the molecule. (See, e.g., Kamola et al., The siRNA Non-seed Region and Its Target Sequences are Auxiliary Determinants of Off-Target Effects, PLOS Computational Biology, 11(12), Figure 1 (2015)).

[0115] In some embodiments, the YFV RNAi agents disclosed herein target a YFV viral genome at or near the positions of the YFV viral genome sequence shown in Table 1. In some embodiments, the antisense strand of a YFV RNAi agent disclosed herein includes a core stretch sequence that is fully, substantially, or at least partially complementary to a target YFV 19-mer sequence disclosed in Table 1. Table 1. YFV 19-mer genomic RNA Target Sequences (taken from primate YFV, genomic RNA, GenBank MK249066.1 (SEQ ID NO:1)) YFV 19-me Corresponding Targeted Viral SEQ ID r Tar et Se uences Positions of Genome PositionID YF Corresponding Targeted Viral SEQ V 19-mer Target Seque Positions of Genome Position N nces S n n SEQ ID ( r f rr d to, g ein position 19 of the antisense strand (5′^3′) is capable of forming a base pair with position 1 of a 19-mer target sequence disclosed in Table 1. In some embodiments, a YFV RNAi agent includes an antisense strand wherein position 1 of the antisense strand (5′^3′) is capable of forming a base pair with position 19 of the 19-mer target sequence disclosed in Table 1.

[0117] In some embodiments, a YFV RNAi agent includes an antisense strand wherein position 2 of the antisense strand (5′ ^ 3′) is capable of forming a base pair with position 18 of the 19-mer target sequencein Table 1. In some embodiments, a YFV RNAi agent includes an antisense strand wherein positions 2 through 18 of the antisense strand (5′ ^ 3′) are capable of forming base pairs with each of the respective complementary basesat positions 18 through 2 of the 19-mer target sequence disclosed in Table 1.

[0118] For the RNAi agents disclosed herein, the nucleotide at position 1 of the antisense strand (from 5′ end ^ 3′ end) can be perfectly complementary to the YFV viral genome, or can be non-complementary to the YFV viral genome. In some embodiments, the nucleotide at position 1 of the antisense strand (from 5′ end ^ 3′ end) is a U, A, or dT. In some embodiments, the nucleotide at position 1 of the antisense strand (from 5′ end ^ 3′ end) forms an A:U or U:A base pair with the sense strand.

[0119] In some embodiments, a YFV RNAi agent antisense strand comprises the sequence of nucleotides (from 5′ end ^ 3′ end) 2-18, 2-19, 2-20, or 2-21 of any of the antisense strand sequences in Table 2 or Table 3. In some embodiments, a YFV RNAi sense strand comprises the sequence of nucleotides (from 5′ end ^ 3′ end) 3-21, 2-21, 1-21, 3-20, 2-20, 1-20, 3-19, 2- 19, 1-19, 3-18, 2-18, or 1-18 of any of the sense strand sequences in Table 2, Table 4, Table 5, or Table 6D.

[0120] In some embodiments, a YFV RNAi agent antisense strand comprises the sequence of nucleotides (from 5′ end ^ 3′ end) 2-18, 2-19, 2-20, or 2-21 of any of the antisense strand sequences of Table 2, or Table 3. In some embodiments, a YFV RNAi sense strand comprises the sequence of nucleotides (from 5′ end ^ 3′ end) 3-21, 2-21, 1-21, 3-20, 2-20, 1-20, 3-19, 2- 19, 1-19, 3-18, 2-18, or 1-18 of any of the sense strand sequences of Table 2, Table 4, Table 5,or Table 6D.

[0121] In some embodiments, a YFV RNAi agent is comprised of (i) an antisense strand comprising the sequence of nucleotides (from 5′ end ^ 3′ end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2, Table 3, or Table 6D, and (ii) a sense strand comprising the sequence of nucleotides (from 5′ end ^ 3′ end) 3-21, 2-21, 1-21, 3-20, 2-20, 1-20, 3-19, 2- 19, 1-19, 3-18, 2-18, or 1-18 of any of the sense strand sequences in Table 2, Table 4, Table 5, or Table 6D.

[0122] In some embodiments, a YFV RNAi agent is comprised of (i) an antisense strand comprising the sequence of nucleotides (from 5′ end ^ 3′ end) 2-18 or 2-19 of any of the antisense strand sequences of Table 2, Table 3, or Table 6D, and (ii) a sense strand comprising the sequence of nucleotides (from 5′ end ^ 3′ end) 3-21, 2-21, 1-21, 3-20, 2-20, 1-20, 3-19, 2- 19, 1-19, 3-18, 2-18, or 1-18 of any of the sense strand sequences of Table 2, Table 4, Table 5, or Table 6D.

[0123] In some embodiments, the YFV RNAi agents include core 19-mer nucleotide sequences shown in the following Table 2.O W-0 d5 e7 t0 elen3 garrimooint1is 51151151 1 5 5 5 5 5 5 5 5 5 5 9 9 9 9272727151512424242424646464646448484848111111)esaboelcunyna= N(secneuqeS esaBhctertS eroC dnartSesneS dnaedu lcC C C C N A A A A N U U U U N G G G N C C C na qrteu N U U U U U C C C C C A A A A A U U G G G G G G G G G G G U U U G A A A A A U U U SSeesdeC C C C C C C C C U U U U U G G G G G U U U U A A A U U U U U G G G G G G na)′ ifi)eG G G G A G G G G C C C scA A A AU U U U U U U U U U U U U U A A A eB 3dsidoneA A A A AU U U U U A A A A A C C C C C C C t U U U U G G G G C C C C G G G nna →muU G C C C C C Ar ′tt 5( nq UeG G G G GG G G G G C C C C C C C C C G G G S A A A A AU U U U U U U U U U U U U U U U U nSC C C C C U U U U U U U U U A A A A U eegsnaG G G G GU U U G G G G G A A A A A A A A A C C C ansA A A A A U U U U A A A ies aU U U U U U A A A A n G G G G G A A A A G G G G G G A A A U U U U A G G G AitU A A A A A U U U U U U U U U A A A N n woA A A A AG G G G G U U U U U A A A A U U U R AhG G G G GA A A A A G G G G G A A A A G G G A A A A C C C C A A A A C C C C G G VS(A C A G F C U A N N C U A N N C U A N N U A N N A U N Y .2DI .e:l5 6 7 8 9 0 1 2bQO4 4 4 4 4 5 5 53545556575859506162636465666aESN TO W-0 d5 e7 tlen2 9 9 9 9 0 0 0 0 0 7 7 7 7 7 9 9 9 9 9 6 6 603gnidnopserroC neeulqcN C C C N C C C C N A A A A N G G G G N e u SNG C C C C U U U U U C C C C C U U U U U A A A C C C U U U U U U U U U U A A A A A G G G G G C C C e U U U U G G G G G G G G G U U U U U C C C s d a)B′eiA G 3fi)deC G G G G U U U U U U U U U U C C C C C A A A c A U U U U A A A A A U U U U U A A A A A A A A donC C C C C C G G G G G C neA A A A G G G G G C C G G G G G G G G G G U U U U U U U U U U C C C a→r′mut5nqeG G G G G A A A A A U U U U U U U U U U G G G U U U U S(USA A A A U U U U U G G G G G A A A A A U U G G G G G G G G G G A A A esnU U U naC G G G G G G G G G G G G G G G G G G G A A A A U U U U U U essiaU U U U U U U U U U U U U U U U U U U A U U C C C C U U U U U U U U U tnU U U C U U U U A U C C C C U U U U U G G G G G A A A A A G G G n w AoU U U U U A A A A A A A A A A U U U U U U U U h G A A A A C C C C C C C C C C C C C C C G G G S(G C C C C A A A A A U U U U U G G G G G U U U N A U N N C U A N N G U A N N G U A N N U A N DI .:QO7686960717273 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9EN7 7 7 7 7 7 7 8 8 8 8 8 8 8 8 8 8SO W-0 d5 e7 tlen6 9 9 9 9 9 0 0 0 0 3 3 3 3 3 7 7 7 7 4 4 4 403gnidnopserroC neeulqcN A A A A N G G G N A A A N C C C A A A N e u A N SNC G G G G G G G G G C C C C C A A A A G G G G C G G G G G U U U U U U U U G G G G esd C U A A A A U U U U U A A A A C C C C C C C C C C C C C a)B′ei3fi)deA A A A A A C C C C G G G G G C C C C A A A A cdonA C C C C C U U U U A A A A e C U U U U U U U U U U U U U C C C C C C C A A A A C U C C C C C G G G A A A A A C na →muG C C C C A A A A A r′t5nqeG C A A A G G G G G U U U U U U U U G G G G G G U U G G U U U U U A A A A A S(USA A A A A U U U U G G G G A A A A A C C C C G G G G e A A A A U U U U snnaA G C C C C C U U U U G G C C C C U G G G G G G G U U U U U A A A A essiaA A A A U U U U U U A A A A A A U U U G G G G U U U U A A A A U U U U tnG G G G G U G G G G G C C C C C C C C C A A A A n woU G G G G G A A A A A A A A U U U U U h G A A A A U U U A A A U U U U A A A A A A A A A G G G G S(U U U U U U C C C C C C C C C C C C C C C C C N C U A N N A U N N C U A N N A U N N A U N N DI .:QO0919293949596 7 8 900102030405060708090011121EN9 9 9 9 1 1 1 1 1 1 1 1 1 1 1 1 1SO W-0 d5 e7 tlen3 3 3 3 3 3 3 3 3 8 8 8 8 9 9 9 9 9 1 1 1 1 203gnidnopserroC neeulqcU U U N A A A N G G G N U U U U N C C C N A e u N U U U U A U U U U G G G G U U U U C C C C C C C C C G G G G C C C C A S s d U U U U U U U U U G C A A A A C C C ea)′eiC C C C C C C U U U U U A A A A C fi)eU U U U C U U U U A A A A C C C C A A A A C C C C A C C C C A B3dcnC C C C A A A A A A A A A A A A A A C C C C A A A A C C C C U U U U C dona →meuC C C C C C U C C C C C C C C C r′t5nqeU U U U U U U U U U U U U C C C U U U U U U U U U C C U U U U U G G G G G U U U U U U U U U U U U S(U esn SC C C C A A A A A U U C C C C U U U U naG G G G C G G G G G A A A A A C C C C C G G G G U U U U U G G G A A A A G C esU U U U U U U U U A A A A siaA U U U U U tnA A A A U U U U A A A A G G G G C C C C G G G G U G A n w U U U U G G G G G G G G G U U U U U A A A A C U U U U U U U U C C C C C U AoU A A A A h A A A A A A A A A C C C C A A A A A C C C C A S(G G G G C C C C C A A A A A A A A A U U U U U U A N N C U A N N A U N N C U A N N U A N N C DI .:QO3141151161171181191102122232425262728292031323334353EN1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1SO W-0 d5 e7 tlen2 2 2 2 3 3 3 3 3 4 4 4 4 4 8 8 8 8 9 9 9 9 903gnidnopserroC neeulqcA A A N A A A A N C C C C N U U U N C C C C N e u SNA A A A C C C C C C C C C C C C C C C C C C C s d C C C C C C C C C U U U U U U U U U U U U C C U U U U U U ea) eC C A A A A A G G G G G C C C C C U B′ i3fi)deA A A A C C C C C U U U C C C C C cdonC C C C U U U U U U U U U U C C C C C U U U U U U U U U U U U U C C C C C C C C C C C C C C U U na →meU U U u C C C C G G G G G A A A A A G G G G A A A A A r′t5nqeG G G G U U U U U C C C C C U U U U G G G G G U U U U S(U A A A U U U U U A A A A esn SA A G G G G G A A A A C C C C C G G G G G G G G G naC C C C U U U U U A A A A A A A A A A U U U U C C C C C U U U U esA A A A A U U U U U U U U siaU U U U U U tnA A A A C C C C C A A A C C C C A A U U U U A A A A A U U U U U n w U U U U G G G G G A A A A C C C C C A A A A A A A A A C C C C U AoU U U U h A A A A A U U U U U A A A A A A A A A A A A A A S(U U U U C C C C C C C C C C G G G G C C C C C U A N N G U A N N C U A N N U A N N G U A N N DI .:QO6371381391301411421434445464748494051525354555657585EN1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1SO W-0 d5 e7 tlen9 9 9 9 9 5 5 5 5 7 7 7 7 2 2 2 2 2 7 7 7 7 703gnidnopserroC neeulqcu C C C C N C C C N U U U N A A A A N U U U C C C C A A A A G G G G G U U U U N eNU U U U U U C C C C G G G C C C C C S C C C C C G G A A A U U U U U U U U U esd a)′eiC C C C C A U U U U U fi)eA A A A A C C C C G G G G U U U U U C C C C C U U U U U U U U U U U U U B3dcdonA A A A A U U U U U e G G G G G G G G G U U U U C C C C C G G G G G U U U U G G G G A A C C C C C A A A n→muU U U U U U U C C C C C C C C C ar ′t5nqeC C C C C U U G G G G C A A A A A A A A G G G G U U U U U U U U U S(U esn SA A A A A A A G G G G A A A A G G G G G A A A A A C C C C naC C C C C U U U U A A A A U U U U U C C C C C C U U U U A A A A G G G G A A A A A essiaU U U U U U tnA A A A A A A A A A A A A A A A A A A A A A A G G G G n w U U U U U G G G G A A A A G A A A A A C C C C C A C C C C G G G G C C C C AoA A A G C h G G G G G A A A A U U U U A A A A A A A A A A S(U U U U U C C C C A A A A U U U U U U U U U U C U A N N U A N N A U N N C U A N N C U A N N DI .:QO9501611621631641651666768696071727374757677787970818EN1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1SO W-0 d5 e7 tlen6 6 6 6 6 0 0 0 0 5 5 5 5 5 9 9 9 9 9 1 1 1 103gnidnopserroC neeulqcA A A A N G G G N G G G G N C C C C N G G G G e u SNC C C C C U U U U U U U U U G G C C C A A A A A G G C C C C C C U U U U esd a) eA A A A A A A A A A A A A A U U U U U C C C C C G G G G G A A A A A B′ i3fi)deA A A A G G G G C C C C C A A A A A C C C C cdonC C C C C U U U U U U U U U U U U U G G G G G U U U U U A A A A G G G G G G G C C C C na →meuA A A G G G A A C C C C A A A A r′t5nqeG G G G G G G G G A A A A A A U U U U C C C C C U U U U U C C C C G G G G G A A A A A A A A A A A S(U esn SA A A A A A A U U U U U C C C C G G G G G C C C C C A A A A naG G G G G A A A A A A A A A G G G G G G G G G esA A A A A A A A A A A A A A A A A siaU U U U U A tnA A A A A A A A A A A C C C C A A A A A A A A A A A A n w A A A A A C C C C C A A A A A C C C C U U U U A A A A A A A A A A U U U U AoU A A A A h A A A A A A A A A A A A A A C C C C C G G G G S(C C C C C G G G G C C C C C A A A A A U U U U C U A N N A U N N C U A N N C U A N N G U A N DI .:QO2831841851861871881898091929394959697989990010203040EN1 1 1 1 1 1 1 1 1 1 1 1 2 2 2 2 2SO W-0 d5 e7 tlen1 2 2 2 2 5 5 5 5 5 2 2 2 2 2 3 3 3 3 7 7 7 703gnidnopserroC neeulqcN C C C N C C C C N G G G G N A A A N U U U N e u SNG G G G G C C C C C U U U U G G G G G G U A U G G A A A C C C C G G G esd A A A A A C G A A A A a) eA A A A A C C C C C G G G G G A A A A A A A A A B′ i3fi)deC A A A A U U U U A A A A C C C cdonU G G G G U C A A A A A U U C A A A A U U A A A A A A A A C C C C C C U C C C C C A A A A C C C C na →meC C C u U C C C C C G G G G A A A A r′t5nqeC A A A A G C C C C G G G G G A C C C C U U U U U C C C C C C C C A A A A A A A U U U U A A A A S(U esn SA A A A A A A A C C C C G G G G G C C C C C G G G G U U U U naG U U U U G G G G G U U U U U U U U U G G G G A U U U U U A A A A U U U U U U U essiaU U U U A U tnA C A A A A A A A A A G G G G U U U U C C C C C C C C U U U U U A n w U U U U U U U U U U G G G G A A A A G G G G G U U U U U U U U AoU U U U U h G C C C C U U U U U G G G G G U U U U A A A A S(U A A A A A A A A A C C C C C C C C C C C C C N A U N N C U A N N C U A N N U A N N U A N N DI .:QO5062072082092002112121314151617181910212223242526272EN2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2SO W-0 d5 e7 tlen0 0 0 0 0 1 1 1 1 1 9 9 9 903gnidnopserroC esnae n G G G G G C C C C C A A A A SwU U U U U C C C C C C C C C o G G G G G A A A A A A A A A hSU U U U N G G G G N A A A N04(DI .:QO5262728292031 2 3 4 5 6 7 8ESN4 4 4 4 4 43434343434343434eedcinteoeulqcA A A A N C C C C N U U U N e u C C C C C U U U U U U U U U SNA A A A G G G s d A G G G G G G ea)B′eiC C C C C G G G G G U U U U 3fi)deA A A A A U U U U U c C C C C C A A A A U U U U C C C C donneA A A A A U C C C C C A A A A U U U U U G G G G C C a→r′muG C C t5nqeG G G G G A A A A A C C C C U U U U A A A S(U esn SU A A A A A A U U U U U C C C C C G G G G G G G G U U U naG U U U U U U essiaU U U U U U U U U U G G G G A A C C C C C tnA A A A A A A C C C C C G G G G G C C C C n w U U U U U U U U AoU U U U U U h A A A A A A A A A A A A A A S(C C C C C C C C C C C C C C C U A N N C U A N N A U N N DI .:QO8292031323334353637383930414EN2 2 2 2 2 2 2 2 2 2 2 2 2 2S

[0124] The YFV RNAi agent sense strands and antisense strands that comprise or consist of the sequences in Table 2 can be modified nucleotides or unmodified nucleotides. In some embodiments, the YFV RNAi agents having the sense and antisense strand sequences that comprise or consist of the sequences in Table 2 are all or substantially all modified nucleotides.

[0125] In some embodiments, the antisense strand of a YFV RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2. In some embodiments, the sense strand of a YFV RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 2.

[0126] As used herein, each N listed in a sequence disclosed in Table 2 may be independently selected from any and all nucleobases (including those found on both modified and unmodified nucleotides). In some embodiments, an N nucleotide listed in a sequence disclosed in Table 2 has a nucleobase that is complementary to the N nucleotide at the corresponding position on the other strand. In some embodiments, an N nucleotide listed in a sequence disclosed in Table 2 has a nucleobase that is not complementary to the N nucleotide at the corresponding position on the other strand. In some embodiments, an N nucleotide listed in a sequence disclosed in Table 2 has a nucleobase that is the same as the N nucleotide at the corresponding position on the other strand. In some embodiments, an N nucleotide listed in a sequence disclosed in Table 2 has a nucleobase that is different from the N nucleotide at the corresponding position on the other strand.

[0127] Certain modified YFV RNAi agent antisense strands, as well as their underlying unmodified nucleobase sequences, are provided in Table 3. Certain modified YFV RNAi agent sense strands, as well as their underlying unmodified nucleobase sequences, are provided in Table 4. In forming YFV RNAi agents, each of the nucleotides in each of the underlying base sequences listed in Tables 3 and 4, as well as in Table 2, above, can be a modified nucleotide.

[0128] The YFV RNAi agents described herein are formed by annealing an antisense strand with a sense strand. A sense strand containing a sequence listed in Table 2, Table 4, Table 5, or Table 6D, can be hybridized to any antisense strand containing a sequence listed in Table 2 or Table 3 or Table 6D, provided the two sequences have a region of at least 85% complementarity over a contiguous 15, 16, 17, 18, 19, 20, or 21 nucleotide sequence.

[0129] In some embodiments, a YFV RNAi agent antisense strand comprises a nucleotide sequence of any of the sequences in Table 2 or Table 3 or Table 6D.

[0130] In some embodiments, a YFV RNAi agent comprises or consists of a duplex having the nucleobase sequences of the sense strand and the antisense strand of any of the sequencesin Table 2, Table 3, Table 4, Table 5, or Table 6D. In some embodiments, a YFV RNAi agent comprises or consists of a duplex sequence prepared or provided as a sodium salt, mixed salt, or a free-acid.

[0131] Examples of antisense strands containing modified nucleotides are provided in Table 3 and Table 6D. Examples of sense strands containing modified nucleotides are provided in Table 4, Table 5, and Table 6D.

[0132] As used in Tables 3, 4, and 5, the following notations are used to indicate modified nucleotides and linking groups: A = adenosine-3′-phosphate; C = cytidine-3′-phosphate; G = guanosine-3′-phosphate; U = uridine-3′-phosphate I = inosine-3′-phosphate a = 2′-O-methyladenosine-3′-phosphate as = 2′-O-methyladenosine-3′-phosphorothioate c = 2′-O-methylcytidine-3′-phosphate cs = 2′-O-methylcytidine-3′-phosphorothioate g = 2′-O-methylguanosine-3′-phosphate gs = 2′-O-methylguanosine-3′-phosphorothioate t = 2′-O-methyl-5-methyluridine-3′-phosphate ts = 2′-O-methyl-5-methyluridine-3′-phosphorothioate u = 2′-O-methyluridine-3′-phosphate us = 2′-O-methyluridine-3′-phosphorothioate i = 2′-O-methylinosine-3′-phosphate is = 2′-O-methylinosine-3′-phosphorothioate Af = 2′-fluoroadenosine-3′-phosphate Afs = 2′-fluoroadenosine-3′-phosporothioate Cf = 2′-fluorocytidine-3′-phosphate Cfs = 2′-fluorocytidine-3′-phosphorothioate Gf = 2′-fluoroguanosine-3′-phosphate Gfs = 2′-fluoroguanosine-3′-phosphorothioate Tf = 2′-fluoro-5′-methyluridine-3′-phosphate Tfs = 2′-fluoro-5′-methyluridine-3′-phosphorothioate Uf = 2′-fluorouridine-3′-phosphate Ufs = 2′-fluorouridine-3′-phosphorothioate AUNA = 2′,3′-seco-adenosine-3′-phosphate, see Table 7 AUNAs = 2′,3′-seco-adenosine-3′-phosphorothioate, see Table 7 CUNA = 2′,3′-seco-cytidine-3′-phosphate, see Table 7CUNAs = 2′,3′-seco-cytidine-3′-phosphorothioate, see Table 7 GUNA= 2′,3′-seco-guanosine-3′-phosphate, see Table 7 GUNAs = 2′,3′-seco-guanosine-3′-phosphorothioate, see Table 7 UUNA= 2′,3′-seco-uridine-3′-phosphate, see Table 7 UUNAs = 2′,3′-seco-uridine-3′-phosphorothioate, see Table 7 a_2N = 2′-O-methyl-2-aminoadenosine-3′-phosphate, see Table 7 a_2Ns = 2′-O-methyl-2-aminoadenosine-3′-phosphorothioate, see Table 7 (invAb) = inverted abasic deoxyribonucleotide, see Table 7 (invAb)s = inverted abasic deoxyribonucleotide-5′- phosphorothioate, see Table 7 cPrpa = 5’-cyclopropyl phosphonate-2′-O-methyladenosine-3′-phosphate (see Table 7) cPrpas = 5’-cyclopropyl phosphonate-2′-O-methyladenosine-3′- phosphorothioate (see Table 7) cPrpu = 5’-cyclopropyl phosphonate-2′-O-methyluridine-3′-phosphate (see Table 7) cPrpus = 5’-cyclopropyl phosphonate-2′-O-methyluridine-3′- phosphorothioate (see Table 7) s = phosphorothioate linkage ss = phosphorodithioate linkage

[0133] As the person of ordinary skill in the art would readily understand, unless otherwise indicated by the sequence (such as, for example, by a phosphorothioate linkage “s” or a phosphorodithioate linage “ss”), when present in an oligonucleotide, the nucleotide monomers are mutually linked by 5’-3’-phosphodiester bonds. As the person of ordinary skill in the art would clearly understand, the inclusion of a phosphorothioate or phosphorodithioate linkage as shown in the modified nucleotide sequences disclosed herein replaces the phosphodiester linkage typically present in oligonucleotides. Further, the person of ordinary skill in the art would readily understand that the terminal nucleotide at the 3’ end of a given oligonucleotide sequence would typically have a hydroxyl (-OH) group at the respective 3’ position of the given monomer instead of a phosphate moiety ex vivo. Additionally, for the embodiments disclosed herein, when viewing the respective strand 5’ ^ 3’, the inverted abasic residues are inserted such that the 3’ position of the deoxyribose is linked at the 3’ end of the preceding monomer on the respective strand (see, e.g., Table 7). Moreover, as the person of ordinary skill would readily understand and appreciate, while the phosphorothioate or phosphorodithioate chemical structures depicted herein typically show the anion on the sulfur atom, the inventions disclosedherein encompass all phosphorothioate or phosphorodithioate tautomers and resonance structures (e.g., where the sulfur atom has a double-bond and the anion is on an oxygen atom). Unless expressly indicated otherwise herein, such understandings of the person of ordinary skill in the art are used when describing the YFV RNAi agents and compositions of YFV RNAi agents disclosed herein.

[0134] Certain examples of targeting ligands, targeting groups, and linking groups used with the YFV RNAi agents disclosed herein are provided below in Table 7. More specifically, targeting groups and linking groups (which together can form a targeting ligand) include (NAG37) and (NAG37)s, for which their chemical structures are provided below in Table 7. Each sense strand and / or antisense strand can have any targeting ligands, targeting groups, or linking groups listed herein, as well as other groups, conjugated to the 5′ and / or 3′ end of the sequence.O.W- O0N57D03I7589 01 2 345 67 8901 2 345 67 8 901 2 365656666666666666666666667676767676767676767686868686euqdU en uC fgfAafGcG fuC fuU fuC fafUgfCcG fgfCuAG fafgU fcfCuU fgG fcU fafAcCC fcfuC fufCuUC fcfufAcfSarCuUgGUAU GuGuUcCUCCCUCCUACAGUCCAcU dntaSf fgAUfg cUf fgf f fafarAfAUAAfg c aCf f fuAfc uAf faAfc a c u u c afgAfCfCf fCfUfUfAUfU tes a u aU Sn fc cUa g cfg c uUaUc a cAc a c u uUc c c u g g uUfGfCf f f fGUfUfCf f f f f f f f f f f f f f f f fesesnitgagucuCcGgG ugaauuguagC ugCAAC uuag gguUC uuacC uuUCGA ugug u cGAUU uuag cauG ggesncgu uua u u g g g a a gua u c c u g auaac g gga a guait A af guauf aac g u gug aucug g c gac g u g c u a u c cuu ad Gf fafu uf fuf f fa u ufufufafu ufa u u ufa gAGGAfCUUUAfUf fUAUAGfCAfCfAf fAfAfnAetifiufa u u aUc u g a g g cAc a g g g u a c u gUaAc u gAaAf fUf fUf fAf f fUf f f f f f f f f f f f f f fCf fnd sGsA gsU AUs sGsAUUUsUUCsAsUsAsACsUsAC eo gsa sa gsa gs scsc c g asas sasasc a c a usa asgs si Mfs sAfCfs sas s s s s s sasgs s s s s s s s s sas sasusAfCf f fAfUfGfUfUf f f f f f f f f f f f f f f fss s sGCs s s sCsCCGsCsAAsUsUsCCsGsCsUCsA A Nu u u usasa u usu u u usasa u usa u u usu u u usu usaR VDISSS SSS SSSSSSSSSSSSSSSS SSSSS FdA- A- A- A- A- AAAA- A- A- A- A- A- A- AAAAAAAAAAAA Y.n3ar123252729-21-33-3537393143454749-41-53-55-57-59- - - - - - -516365676961737etlS0800 000 000b1818181818181818018000000018181818188808080808080808080808a S1 1 1 1 1 1 1 1 1 1 1 1 1MMMMMMMMMMMMMMMMMMMM T A MMMMMMM A A A A A A A A A A A A A A A A A A A A A A A A A A AO.W- O0N5703dn gafurUfcfcfafufufafafcfgfafafgfgf g g ggcaUaf fufac aaccf u gcfA tuCAaAgCcGaAcAgCafGuAaAcCaGguUfgUf f gU UUgfCafAccfAccfA f AcfafAuafcfSfuf f f f f f fAf f f f fafafafafufCfc cfUcC e U s CCUUU UAcUAaACaUC Ua C ufUfAc cf fAc ufngfa gesCf fa g gAf f fcfcf fcCf fcGCf fc aCCCf gcAUf fufufufCu Cg fUcf fU C UcfG uf fCUitcuCaagCA gg cA auU acA acagauacucagG uaC acaC C Cguf acfuG auaG cfGuuacU uf guangAuc uac g c a c g c g u u c ggugu u C c cua G a ugaf cugaaaaugagaf uuguf uau gfufuguuuugacacfAgu UagfUuaf cuuacufufAaUgggufU deiAf f f f ffigAfAAGf f f f ufAaAAAA fafcfcfafcfCcfufufuU fgAC fcfgfAc af c acg agf cu Ac f agcf fUaua fsUasgGAa gf c fAcuaUc faad G osC asUsAsAsAsUsAsGsUsUGsUsUsUUggsggsgsagfUfUAusascuuauufaCaUsccafU Msf asUf asasascsf gsf csusf gsusasassassasasf asf asga susu ususaufCsu csac sus Ufs Cf fs GCsAsUfAAf f f f f f f fpsCCCsCCsCUsUsUsUrpr fCfCf ss Cs sfpr fUfpsUsru u usa u ususa ususu usu usa u u usuPcPcsa u uUPc u uPcDISSSSSS SSSSSSSSSSSSSSSSSSSS SSS dnA a - AAAAAAAAAAAAAAAAAAAAAAAAAAAA r5- t77-9-1- - - - - - - - - - - - - - - - - - - - - - - - -S07807083085087089081 35 7 91 31 2 367 801 45 6 1 2 30909090909005 5 5 5 5 5 62 2 2 2 2 2 2181818181818181818181801 1 0181818100200200020200200020202020303030S2 2 2 2 2 2 2 2 2A MMMMMMMMMMMMMMMMMMMMMMMMMMMMM A A A A A A A A A A A A A A A A A A A A A A A A A A A A AO.W- O0N5703DI 94949494940505000000001 1 1 1 1 14Q5 5 5 5 5 5 5 5 5 5 5 5 5 5E S )'3→′uu5ssgsuusg csgsasu u ccscs sa csg gususg csc u ausccscsuscsssus(sgcusgcuguug c acaaaccguuaa gggua a u u c g ggcagc g cagcua u g ucu c udnuaagc afgf fc a uUf f f fcGf fcUfgCf fcUfufuf fafcfafrf uC CCA U C UGAGAAA t AaScfAu afa a c gfg cfafaAcf f fufg a c ufc c cAAf fCfAUfAAAUf f fUfCf fC efcCa csCufCuf fCfCu a c aUc g c a cUuUgUc c uUc uCf f f fCf fUfCf f f f f f f f fnefsitU ugfU UgcuuuCugUugGugucu Cc u gAgGuG A UcGuU G Uau gua u u ua uaagu g aguua a aguuagugaau g a c agcua c anug ggf fcfgfcf faf f fcfufa gf fg ufgAagfuaAU A U U A U A U U U UfGfAA AfUAfU dgefN Ua g aiU ca aagug uaugu u a a acauc c cfcgiaUcUcuuccaucu uuu ua acacaa u uaauaaadacaaaaf faAf ua g gaa c gug a u c g g c u cUfCf fAfCf f f f f f f f f f fo f c cAs s sGs sGsUsCGsAAsUsCsUsCsU MUsssfsfsafUpu u usa u u u usa usa u u u u usus UsrpPrpPrpPrpPrpPrpPrpPrpPrpPrp p p p p p p pPrPrPrPrPrPrPr rUu u c c c c c c c c c c c c c c c cPcPcDISSS dnAA a -r4- A 26-272203804 5 67 8901 2 345 61 1 68080808080808181 1 1 1 1 1 41 4t 333444 444444848484848484165 0S 000S000 000000662 2 2MMM0A0A0000000001A0A0A0A0A0A0A0A00000009A AAAAAAAA A A A C C C C C C C C C C C C C C C C C CO W-0D5 I.7O001020304050607080900111213141516171819102122232420Q3N7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7cne Sguu afu afcuuu gaagaaaaaaauaauuaagaafaauacugauaguua ua uauauesCac u g c a c c u g c c g g c a c guaguaa g gqf aGf u a a c ccc uau c u aAf g a c ua uc c u uenSea a afu afufa u afc ufa a af fafu cfufdS Af fGCf fGCf fn d ar e UfC U AffAfCffCffAfCffC GffAf f ffG AfCfCfAfGffA CfGft ifu fUa CacfGCffCffCfAfAfGfGfGfUfUG fuaAffG GfAfGfCfUffC UfAfSidgafAacufGaGuUaCuGaCuGuAgUaGaUaugGfu U GuAgAgGaGfg GAaCues o agna cauag cagucaacacg u u c g uaua g a g g ga gugaguaguugg aagugcaagguge MNc g a2g N2c ca agg aggc g cuacg ca u cNa c g uug u c 2 g a c a uugauga a ggg ggaStn_ueacca_aaaggugagguguugaggu guacau _gacau cgacaa gccacagguguauccugugagAiL N L N L N L N L N L N L N L N L N L N L N L N L L L NN NL L NNL L NNL N L N L N L N L L A N- - - - - - - - - - - -N NDRIS- - - - - - - - - - - - -dS S - S SS SS S S S S S S S S S S S S S S S S S S S S S 0 -2-4- S 6 - S 8 - S 0 - S S S S S S S S S S S S S S S S S S 2 -4-6-8- - - - -8- - - - - - - - - -Vn 2 2 2 2 2 3 3 3 3 3042444640 2 4 6 8 0 2 4 6 8Fa 0 0 0 0 0 0 0 0 0 0 0 0 0 04050505 5 5 6 6 6 6 6Y.rt84S181818181818181818181818181818180180180180 0 0 0 018181818181elM MM M M M MM M M MM M M MM M M MM M M MM M b A A A A A A A A A A A A A A A A A A A A A A A A A a TO W-0D5 I. 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 0 0 2 3 0 0 0 0 8703Su u u ugu u g u a u u u c cfg ges uacuu aguc uf auuc uf aaau ccuaaaacaicauac agaguauaA Uuaua gacncu acuacaguac Cf cugu Gf gucugucaauaagauc fUuagugc aug c fGgufe f f f f fGf fAf f f f f f fufaf f fa g ufU SA C G U CfG AfG C A G G C UfCA Ag agfAafdefif AfCf f fi fG G U Ua fUfUGa fUfGfCfGfUfAfGCfG Cg gf fCfuCf fAcUcfCadCfAf f fcfC U CuCfCgu f fGGf f f fG U GUfGf fA AgfGfA Gcfgf fG GaffA oagacaagagugaacgauacc ucuuaauuugguaU agugu fUagagCsGs agGggMuaaggacg ugu ca g agucaaauugucgucuugucca acacacuaua usf usfuguguugaagugggag N u N c g a c c g a cuguga2 cg_aggug2 g g cg_aaaaagu aucaau g a ucuccccG UguguaggucuuccguguugugsusgugugcaL N L L L L N L N L L L N L N L N L L N L N L N L L L N L N L N L N L L L L L -N-N-N- - -N-N- - - -N- - - -N N N N N N NDS S S S S S S S S S S S S S S -S- - - - - - - - - -IdS- S S S S S S S S S SS SS SS SS SS SS S SS SS 0 - S 2 - S 4 -6-8- S 0 - S 2 - S 4 -6-8- S 0 -2-4-6- S 8 - S 0 -2- -S 5- - -4- - - -n 7 7 7 7 7 8 8 8 8 8 9 9 9 9 9 0 045 5951 6 2 3 5a 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 0 0 06 818 2 2 2rtS818181818181818181818181818181818102020020201 2 2 3202020202M MM M M MM M M MM M M MM M M M MM M M MM M M A A A A A A A A A A A A A A A A A A A A A A A A A AO W-0D5 I. 8 8 6 7 9 9 4 2 3 8 9 3 8 0 2 6 2 3 6 0 8703)3asa )e→ g′f n5Uauaiaso( ufdnG aa aa uuauaaaugu ccaa agacaaugaaaga acuua cuaguaga ngaia(erftCgu gaug au ccS uefug gagau auuugacac cagu ua ugagguu uccaaua gu nihs Aacuac uauauu aaa ufc aaaa uauagagu uauucuu uuauugu ugtanancea cuafcuaacgucaaguaGfuuccuugacuag aacuucfgGfagafcfxoSagAfafaf faCfaCfa uC Gf f fafcCfaCfuCfAufafufAfufGufUafpydgefCGfAf f f fifUaiudf fG G GfA C UaGfAf fAGfUfAfCAfCfACfAU Ga fCAhcCa =Af fU G Af fco AgU sggu u gGcGuf f f f f fCG CG U A Gaf f fgf f fIG A CuaGGaA;eMgsfua u uug a guugguua acuguauu ggu g gu aaacaauccc aacggugditCacagcguugacgac ggcuu gaa g a a g guu osg c a u gNgc a g c a g g u a N a g a elacaaccagugucg2u_caacauugaugag uccauagcacgggg2g_c u gaguugcacunenLisND- L I SNL N L N L N L N L N L N L N L N LoNL N L N L N L N L L L L L Lned S- -2-1-3-7-7-7-3-5-5-7-5-5-9-N3-N1-N3-N5-N N1-7-8dan8a2415 or695395399 2 2 2 3 3 4 5 5 6 7 8 8 9 6 4393939393939 9 9 9 9 9 9 9 9 9 0 nit 3S02001S91S91S91S91S91S91S913S913S913S913S913S913 3 3 3 5 6S91S91S91S91 1 1 mS9S9S9Sa- M C C C C C C C C C C C C C C C C C C C C2A=N)2A(O W-0D5 I.70QO001 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 43E N7070707070707070707171717171717171717172727272727euSq e agCfccGf fCfCf fAf f fGf fUf aafGfGf f f f fCf f fe sSneaaAauuGaGuU C G C Ggacuaaau uA U Gug a aUgu ga GuUuGuAgAgGuaGgga GaAaCguudS gacaa cn cg aguaa c cga guacg guagga u gu g u cag gadca a u c g c a ugc N agcag u g g aaa a grteNgN i Sf 2i_u 2cc gg aaca_aaagg ggugaguagucg cguugaug u c 2 g a c a uggu guacau _gacau c a g ug ggaca c c guugg g auacguggeds s s s s s s s s s s s s s s scsasasgsgsuscsusaso)nb)e M Ab) )S vAb b) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) )s)vAvAbv Abv Abv Abv Abv Abv Abv Ab b b b b b b b b b b b b bv AvAvAvAvA A A AA A A AA A tn n n n n n n n n n n n n n nvnvnvnvnvnvnvnvnvnvni(es i(s i(i(s i(s i(s i(i(s i(s i(s i(s i(s i(i(s i(s i(s i(i(i(i(i(i(i(i( ni(g )7)s) ) ) )s) ) ) ) ) )s) ) ) )s)s)s)s)s s s s s37 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7)7)7)7)7)7AG3G3G3G3G3G3G3G3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3iG G GG G G GG G G GG G G GG G A A AA A A A AA A A AA A A AA A A AA A A AA A N N(N(N(N(N(N(N(N(N(N(N(N N N N N N N N N N N(N N N R( ( ( ( ( ( ( ( ( ( ( ( (V S S S FIS S S SS S SS SS SS SS SS SS S S SS S S S S S S S S S S D -0- S 2 - S 4 -6- S 8 -0-2-4-6-8-0- S 2 - S 4 -6- S 8 - S 0 - S S S S S S S S 2 -4-6-8-0-2-4- -Y 2 2 2 2 2 3 3 3 3 3 4 4 46 8.d0 0 04 4 5 5 5 5 5 6 6 6 6 65enla 8brt18180180180180180180180 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0181818181818181818181818181818181a SM MM M M M MM M M MM M M MM M M MM M M MM M T A A A A A A A A A A A A A A A A A A A A A A A A AO W-0D5 I.703Se AfCfGsC AfGCfUUf aCcuUfUCf aCguUfGGfCGfGGfUUfAGfCUfG gGf f fCU AAgfCGfcfGGGaafafGfA Afne a a a g gga a aac u u a u u g a g g f a a ag Gg gUuSgucaaaaa ucg ug cagguca cacuugacuuguugaucc uauaU g gcacu u ugug ggu uagdeggif guacaugaguNu2ucagNu u g2ci ggg ac ucc caguacga cucaucacccgugu u cua a adaggguggag_agugg_aagaaaguc a u uac g g u u u ugcgccao s)sb)su a g c u c u u g g g g a a cb)sAb)s)s s s s s s s s s s s s s s s s s s s s sAb b)Ab) )Ab b)Ab) )Ab b)Ab) )Ab b) ) ) ) ) ) ) ) ) ) ) )AbAbAbAbAbAb b b b b b bM Av v vAv v vAv v vAv v vAv v v v v vA A A AA A A ni( nsi)( nsinininininininininininininininvinv v vinininvinvinvinvini)(s) (s) (s) (s) (s) (s) (s) (s) (s) (s) (s(s(s(s(s(s(s(s(s(s(s(s(s(s7 7 7 7 7 7 7 7 7 7 7 7)7)7)7)7)7) ) ) ) ) ) ) ) )3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 373737373737 7 7 7G GG G G GG G G GG G G GG G G G GG G G3G3G3G3G A AA A A AA A A AA A A AA A A A AA A A AA A A N(N(N(N(N(N(N(N(N(N(N(N(N(N(N(N(N(N(N(N(N(N(N(N( N(N(S S S S S S S S S S S S S S S S DIS- S- S- S- S- S- S- S- S- S- S- S- S- S- S- S S - S S - S S - S S - S S S - S- S S - S S - S- 2415d0n72a074076078070 2 4 6 8 0 2 4 6 8 0 2 4 5 9 1 2 3 50808080808 9 9 9 9 9 0 0 5 5 5 6 2 2 2 1693r8t18181818181818180180180180180 0 1 1 0 0 0 0 2 2 3181818181020202020202020019SS S M MM M M MM M M MM M M MM M M M MM M M MM C C A A A A A A A A A A A A A A A A A A A A A A A AO W-0D5 I.703)b)b) )Av ) ) ) ) ) )Ab b) ) v ) ) )di 3AbAnibAb bAb b)AAb b bA Ani( b bA AbAto5Avnvini v(ni v(( nsA i( av v vAv v vuninininininA (i(vnvinvinsi( aa vnvini(venlicu)('s s3auasaascguc a(as(as(s(s s sgacaaugaaag(s(as scuua cua(gs sa (snuag gaa)e→uguauaca ca u gacacaguauu agguu caauguni′a g5uguuu uaua u cau ugag gu u uu cu auagu so( cu aga uafcuaa au aa a ua aauc uuf u ua ga nidanc ucagaGfuucc ugacu gacuucgGfag fcf (eaarfafafatAfG afufafcfafufu afufA ufGuUniSfCfCfCf fG AfCfCfCfAf fACfAf fAfafhteG GfAfCfUa fGA GfU A Cf fCC U Ga fC AcfCa nas fnG A U G cce u guguug ufuGfaCuGfUfAGf fGAfCgu fGGfAxoguuuuggaga acau ac aaaggg pS ua ggguua agca acggg u ug aa agca ca cgugu yhdgei c ufug cgNgc acgc uuc a gaug uaagNacguua=iacaguu g2_ca u au gga c uac g g2_ g ugcI;do s) gscsusasasgs scsasgscsgsgsasusgsas eb)b)b) ) )b)b)b)b)b) )b) )b)b)b)b) diM AvA nvAb bi( nvA nvA nvA nvA nvAvA AbA AbA AA A AbAtoes i ininvinvnvnvnv v v v v vin n nin n n lc)(s i7) (s i)(s i)(s) (s) (s) (s i)(s i)(s i)(s) (s i)(s i)(s) (s i)(s i)(s i)(su)n37373737373737373737373737373737 7 enG GG G G GG G G GG G G GG G3G3GisA AA A A AA A A AA AoN(N(N(N(N(N(N(N(N(N(N(NA (NA (NA (NA (NA (NA (Nn(edaDI 3d57 7 7 3 5 5 7o959992929293935 5 9 3 1 3 5 1 7 8 ni94959596979898999694mn3131313131313131313131313 3 3 3 506 a-at9 9 9 9 9 9 9 9 91 1 1 1 1 12rSS S S S S S S S S9S9S9S9S9S9S9S9S9S=)C C C C C C C C C C C C C C C C C CN2A(

[0135] The YFV RNAi agents described herein are formed by annealing an antisense strand with a sense strand. A sense strand containing a sequence listed in Table 2, Table 4, or Table 5 can be hybridized to any antisense strand containing a sequence listed in Table 2, or Table 3 provided the two sequences have a region of at least 85% complementarity over a contiguous 15, 16, 17, 18, 19, 20, or 21 nucleotide sequence.

[0136] In some embodiments, the antisense strand of a YFV RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 3. In some embodiments, the sense strand of a YFV RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 4 or Table 5.

[0137] In some embodiments, a YFV RNAi agent antisense strand comprises a nucleotide sequence of any of the sequences in Table 2, or Table 3. In some embodiments, a YFV RNAi agent antisense strand comprises the sequence of nucleotides (from 5′ end ^ 3′ end) 1-17, 2- 17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, or 2-21, of any of the sequences in Table 2 or Table 3. In certain embodiments, a YFV RNAi agent antisense strand comprises or consists of a modified sequence of any one of the modified sequences in Table 3.

[0138] In some embodiments, a YFV RNAi agent sense strand comprises the nucleotide sequence of any of the sequences in Table 2, Table 4, or Table 5. In some embodiments, a YFV RNAi agent sense strand comprises the sequence of nucleotides (from 5′ end ^ 3′ end) 1-17, 2-17, 3-17, 4-17, 1-18, 2-18, 3-18, 4-18, 1-19, 2-19, 3-19, 4-19, 1-20, 2-20, 4-20, 1-21, 2-21, 3-21, or 4-21, of any of the sequences in Table 2, Table 4, or Table 5. In certain embodiments, a YFV RNAi agent sense strand comprises or consists of a modified sequence of any one of the modified sequences in Table 4 or Table 5.

[0139] For the YFV RNAi agents disclosed herein, the nucleotide at position 1 of the antisense strand (from 5′ end ^ 3′ end) can be perfectly complementary to a YFV viral genome, or can be non-complementary to a YFV viral genome. In some embodiments, the nucleotide at position 1 of the antisense strand (from 5′ end ^ 3′ end) is a U, A, or dT (or a modified version thereof). In some embodiments, theat position 1 of the antisense strand (from 5′ end ^ 3′ end) forms an A:U or U:A base pair with the sense strand. A sense strand containing a sequence listed in Table 2, Table 4, or Table 5 can be hybridized to any antisense strand containing a sequence listed in Table 2, or Table 3 provided the two sequences have a region of at least 85% complementarity over a contiguous 15, 16, 17, 18, 19, 20, or 21 nucleotide sequence. In some embodiments, the YFV RNAi agent has a sense strand consisting of the modified sequence of any of the modified sequences in Table 4 or Table 5, and an antisense strand consisting of the modified sequence of any of the modified sequencesin Table 3. Certain representative sequence pairings are exemplified by the Duplex ID Nos. shown in Tables 6A or 6B.

[0141] In some embodiments, a YFV RNAi agent comprises, consists of, or consists essentially of a duplex represented by any one of the Duplex ID Nos. presented herein. In some embodiments, a YFV RNAi agent comprises the sense strand and antisense strand nucleotide sequences of any of the duplexes represented by any of the Duplex ID Nos. presented herein. In some embodiments, a YFV RNAi agent comprises the sense strand and antisense strand nucleotide sequences of any of the duplexes represented by any of the Duplex ID Nos. presented herein and a targeting group and / or linking group wherein the targeting group and / or linking group is covalently linked (i.e., conjugated) to the sense strand or the antisense strand. In some embodiments, a YFV RNAi agent includes the sense strand and antisense strand modified nucleotide sequences of any of the Duplex ID Nos. presented herein. In some embodiments, a YFV RNAi agent comprises the sense strand and antisense strand modified nucleotide sequences of any of the Duplex ID Nos. presented herein and a targeting group and / or linking group, wherein the targeting group and / or linking group is covalently linked to the sense strand or the antisense strand.

[0142] In some embodiments, a YFV RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences of any of the antisense strand / sense strand duplexes of Table 2 or Tables 6A and 6B, and further comprises a targeting group or targeting ligand. In some embodiments, a YFV RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences of any of the antisense strand / sense strand duplexes of Table 2 or Tables 6A and 6B, and further comprises an asialoglycoprotein receptor ligand targeting group.

[0143] A targeting group, with or without a linker, can be linked to the 5′ or 3′ end of any of the sense and / or antisense strands disclosed in Tables 2, 3, 4, or 5. A linker, with or without a targeting group, can be attached to the 5′ or 3′ end of any of the sense and / or antisense strands disclosed in Tables 2, 3, 4, and 5.

[0144] In some embodiments, a YFV RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences of any of the antisense strand / sense strand duplexes of Table 2, Table 6A, or Table 6B, and further comprises a targeting ligand selected from the group consisting of: (NAG37) and (NAG37)s, each as defined in Table 7.

[0145] In some embodiments, a YFV RNAi agent comprises an antisense strand and a sense strand having the modified nucleotide sequence of any of the antisense strand and / or sense strand nucleotide sequences in Table 3, Table 4, or Table 5.

[0146] In some embodiments, a YFV RNAi agent comprises an antisense strand and a sense strand having a modified nucleotide sequence of any of the antisense strand and / or sense strand nucleotide sequences of any of the duplexes Tables 6A and 6B, and further comprises an asialoglycoprotein receptor ligand targeting group.

[0147] In some embodiments, a YFV RNAi agent comprises, consists of, or consists essentially of any of the duplexes of Tables 6A and 6B. Table 6A. YFV RNAi Agents Duplexes with Corresponding Sense and Antisense Strand ID Numbers and Sequence ID numbers for the modified and unmodified nucleotide sequences. AS mo AS SS modified SS AS ID dified SE ID NO unmodified SS ID SEQ ID unmodified O:AS m AS SS modified SS AS ID odified SEQ ID NO: unmodified SS ID SEQ ID unmodified O:AS AS SS modified SS AS ID modified SEQ ID NO: unmodified SS ID SEQ ID unmodified O:Table 6B. YFV RNAi Agents Duplexes with Corresponding Sense and Antisense Strand ID Numbers and Sequence ID numbers for the modified and unmodified nucleotide sequences. AS AS SS SS modified unmodified modified unmodifiedAS AS SS SS Duplex AS ID modified unmodified modified unmodified SEQ ID SEQ ID SS ID SEQ ID SEQ IDAS AS SS SS Duplex AS ID modified unmodified modified unmodified SEQ ID SEQ ID SS ID SEQ ID SEQ IDTable 6C. YFV RNAi Agents Duplexes with Corresponding Sense and Antisense Strand ID Numbers Referencing Position Targeted on YFV Viral genome (SEQ ID NO:1) Targeted YFV Viral Duplex ID Antisense Strand ID Sense Strand ID Genome Position (Of SEQ ID NO:1)Targeted YFV Viral Duplex ID Antisense Strand ID Sense Strand ID Genome Position (Of SEQ ID NO:1)Targeted YFV Viral Duplex ID Antisense Strand ID Sense Strand ID Genome Position (Of SEQ ID NO:1)O W- D0I.57QO889 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 90N58595959595959595959595060606060606060606063ESwg ao nU C Af f fU C Uf f fcf f faf f f fafaf fh aSr ufgfafGcGuC fufufafgfCcG fgfCuAaGgU fcfCuUgG U fcfafAcCcCufs teSC xe uUgGfefgUgAcUgGuG U fufcCaUfa Cfg CcCaUfu CcCuUaAfc Cfa AcGuls fn AaUf f f fu UaU AcU AgUfc Af fg AcCf f f f f f f fu U U AaA A A A CfCfUfC pu esDitfUfGfcCf faf f f fGf fa cfcfc afcfufu c cG G U U C Cf fA CfC C UfCf fG A tng g cCc g g a u u g gCuAg g uUu c u g g u cneAag dcu ugu uu u a u gga uau a u g u a u u u u a uag aa u u guaacag uugguguaaucg a u cug g c gcacuugg a a c guuag cuuaaAeiiffui Gf f f fuf f f f fa u uA G G Af f f f f fuf f fufU C U U U AfUfA U A U A G C A C A Adoufa uAf fu aUf fc u g a gfg c c a g g g u a c u gUf fAf fUfGf f f fUf f f fAfUf fNsGsAs sUsAsUs s sA U UsU U Cs s sAsA R Mgsa g a gsc c c g asas sasasc a c a usaVsfs sAfCfs sas sAfCf f fsAfs s s sasgs s s s s s s s sUfGfUfUfCf f f f f f f f f fFs s s sG Cs s s s s sC C GsCsA AsUsUsC C Yu u u usasa u u u u u usasa u usa u u usus.: uD6DIelx910 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0be 72727272 2 2 2 2 2 2 3 3 3 3 3 3 3 3 3 3 4alp2u12D12D127D127D127D127 7 7 7 7 7 7 7 7 7 7 7 7 7 7D12D12D12D12D12D12D12 2 2 2 2 2 2 2 2D1D1D1D1D1 1 1 1 1T D D D D D D A A A A A A A A A A A A A A A A A A A A A AO W- D0I.5O0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 8 871 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 2 2803du anfc c carCf fuf fa g g cfg c c gf fu a c u s s sCfC A Guf fCf fUfGf fC U Gf f f f c c ctufuU fcfufcfgfCu cfUcA fafufufGafafcfgfGafCaU fgfUg a a afg g gS U esuC C A U Ufnfc a cfg ufCuAaAgCcGaAcA C gafGuAafAcCaGuUgafgUfgfU U e Uf fsicUuAgUfg UuUf fg C Cf f f f fg U U UgU A Afc UcAf fa AcCf faaU CfafafC tfGfAf fU Uf fafa gG Cf f fcfcC AfA A Uf fCf fG Cf fcA UfaGfC C Cufufufnu g c u g c a gCg c u cAc gau cuc g a c C C CAa g aag u uga g a a a aaagac gauu a a g g gdgeuaiucucguuaaaguc u c gacugaaaacugagcau guuauugu c g u u uuguuuu a a ffi fd Uf f fA A Af fA AfAfAfAf f fuA A Af f f f f f fgfc cfAoafc u cC A A G U A C AuafUcuM Cf fg a gsU Cf fCfa a c c afc ufuGfCf f f fA UfGfuUfg c g ca aUf f f fG g ggassf asA sgssf assussasU sf asA A sf assassasscsA sgsscssussgsU U U Ugsussas ssasas sgsasassassasGfC UfCfU UfCf fCfAfUf f f f f f f f f f fss s sAs s sGs s sA AsCsCsCsCsC C U U U uu u usa u u usa u u usa u u u u ususasus s:u uDIx1e42 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 0 1 2l7474747474 4 4 4 5 5 5 5 5 5 5 5 5 5 6 6 6 6p2 2 2 2 27272727 7 7 7 7 7 7 7 7 7 7 7 2 2 2u1D1D1D1D1D1D1D12D12D12D12D12D12D12 2 2 2 2 2 4 4 4D1D1D1D1D1 1 1 1 1D D D D D D A A A A A A A A A A A A A A A A A A A A A A AO W- D0I.5O0 1 8 8 8 2 3 8 4 5 8 8 8 4 4 6 6 6 6 6 6 6 8703dn s s a g gc c cs a a s s c s cu ggacrtacgaas gf g f fsUgfG Gasaasaaacsaaccc afcfagcusuag ufc a sgcu ugS gg cefgfagafUufuf ccc c a cfcfcfacccfA Acf uagfcuuAaffAcuaf fC s U naUgfCu affA CcA fcfA A AcfAccfcUfA UcAc afcfC AccfaCfA AcfufA efasiCfU CafCt unfuCfC CgufUcUccfcUfcUfAfUcfUcfcf fUfA Ccfuf fCufcfCufafuuaCg fGfGcfcfcfUccfG G cGuauafuGfCU uug fUCCUgufUgcuAgdugufCcfuaucaucaG G Gcu fau uGuacucuuUag fuUagguuag Ug uaugeaicacgu Ua ffi fg Uuaufaf caucaucuuacuf f cufA A uf aggufUagfUua gAfUd UfUacf gsagf f f co aga gG GA A A ufAc ccuauaAf acU gf caf cgaUcaa fN Uaggg Uaasfafgfgf cuc cauauaAcuaufufua ca UccfaacfUcUuacacfMsgas gU U AsAs s s s u uC Cuas aUcUa asf asgfafsusu usususf usf usa ffu C susu fCcsafcfsu fUsu csf csA fsaUsU Uprpr f fCf ss prpr ss pr ss prUprususuPcPC csC asasC usC usC usu fP PfUsUs PfPUs s P: Uc cUu u cUc u u cDI 5x3e64l265266 7 8 9 7 8 9 0 1 2 3 4 7 8 9 0 1 2 3 92626262621 1 1 2 2 2 2 2 0 0 0 1 1 1 1 8p4 4 4 4 4 4 44444444 4 4 4 4 5 5 5 5 5 5 5 3u1D1D1D1D1D1D1D1D1D14D14D14D14D14D14 4 4 4 4 4 4 0D1D1D1D1 1 1 1 0D D D D D C A A A A A A A A A A A A A A A A A A A A A A AO W- D0I.5O9 074142434445464740 1 2 3 4 847 6 7 94503)′x3op→y′5 u u u h(us c =dg csgsasucsc uscusa csg gususg csc ucscsausc ssu s s scsgsgs s s s I;nuag crc aaaaccgu g guaag ua a u u c g g c cgcgcagcaaa ecg cua u g ucu u u u c c ditfc aSUf f fcf fgf fcfufuf fafafafa c cta CfC A GfU U C C U U G A G A A AfAfAfAoeefa a csnAf fCfgfg cfafaA UfA Afu g a c u c c c c c c lcAfUf f f fUfCfCfCfCf fuecCu a c aUc g c a cUuUgUc c u u u uUcUcnsfit Cf fUf fCf fUfCf f f f f f f f f f f f gnnuCugugGugucu CcuuagAugGguG A Uag uacGauU U U U G Gagugugug uauainiAgduf acu u uefg cfaf aag afgfaf ucgufuf aacgagcfuf agagaugagcucfu atniAfi gUfaUaAaUgA U U U UfGfAA AfUfUfUfAfAoduocc ug u ugu u a a aca c c cUc c cc- auc afaf uauguu agf aaucua afgugcaacafuacuu a a a a u u efgufgacafcafcafcauauniM AsUfusCf f f f f f f f f ns G AsCsGsU C G A A U C UsUsUsUsC Cedpu usa u u ususasusasususu u u u us s arp prprprp prp prprp p p p p p p pupupoPrP P P PrP PrP P PrPrPrPrPr r r r r rni: c c c c c c c c c c c c c cPcPcPcPcPcPcmaDI 6x9798999001 2 3 4 5 6 7 8 9 3 4 5 6 1 2-2e8 8 8 8 90909090909090909099 9 9 9 3 3= l3 3 3 3 3 3 3 3 3 3 3 3 3 3949494943535 )p00000000000 0 0 0 0 0 0 0 0 0 0 0 0 0 0 N2u C C C C C0C0C0C0C0C0C0C0 0 0 0 0 0 0 0AD C C C C C C C C A A A A A A A A A A A A A A A A A A A A(

[0148] In some embodiments, a YFV RNAi agent is prepared or provided as a salt, mixed salt, or a free-acid. In some embodiments, a YFV RNAi agent is prepared as a pharmaceutically acceptable salt, where in the salt is a sodium salt. In some embodiments, a YFV RNAi agent is prepared as a pharmaceutically acceptable salt, where in the salt is a potassium salt. The RNAi agents described herein, upon delivery to a cell expressing a YFV viral genome, inhibit or knockdown expression of one or more YFV viral genomes in vivo and / or in vitro. Targeting Ligands or Groups, Linking Groups, and Delivery Vehicles

[0149] In some embodiments, a YFV RNAi agent is conjugated to one or more non-nucleotide groups including, but not limited to, a targeting group, a linking group, a targeting ligand, a delivery polymer, or a delivery vehicle. The non-nucleotide group can enhance targeting, delivery or attachment of the RNAi agent. Examples of targeting groups and linking groups are provided in Table 7. The non-nucleotide group can be covalently linked to the 3′ and / or 5′ end of either the sense strand and / or the antisense strand. In some embodiments, a YFV RNAi agent contains a non-nucleotide group linked to the 3′ and / or 5′ end of the sense strand. In some embodiments, a non-nucleotide group is linked to the 5′ end of a YFV RNAi agent sense strand. A non-nucleotide group may be linked directly or indirectly to the RNAi agent via a linker / linking group. In some embodiments, a non-nucleotide group is linked to the RNAi agent via a labile, cleavable, or reversible bond or linker.

[0150] In some embodiments, a non-nucleotide group enhances the pharmacokinetic or biodistribution properties of an RNAi agent or conjugate to which it is attached to improve cell- or tissue-specific distribution and cell-specific uptake of the RNAi agent or conjugate. In some embodiments, a non-nucleotide group enhances endocytosis of the RNAi agent.

[0151] Targeting groups or targeting moieties enhance the pharmacokinetic or biodistribution properties of a conjugate or RNAi agent to which they are attached to improve cell-specific (including, in some cases, organ specific) distribution and cell-specific (or organ specific) uptake of the conjugate or RNAi agent. A targeting group can be monovalent, divalent, trivalent, tetravalent, or have higher valency for the target to which it is directed. Representative targeting groups include, without limitation, compounds with affinity to cell surface molecules, cell receptor ligands, haptens, antibodies, monoclonal antibodies, antibody fragments, and antibody mimics with affinity to cell surface molecules.

[0152] In some embodiments, a targeting group is linked to an RNAi agent using a linker, such as a PEG linker or one, two, or three abasic and / or ribitol (abasic ribose) residues, which can in some instances serve as linkers. In some embodiments, a targeting ligand comprises a galactose-derivative cluster.

[0153] The YFV RNAi agents described herein can be synthesized having a reactive group, such as an amino group (also referred to herein as an amine), at the 5′-terminus and / or the 3′- terminus. The reactive group can be used subsequently to attach a targeting moiety using methods typical in the art.

[0154] In some embodiments, a targeting group comprises an asialoglycoprotein receptor ligand. As used herein, an asialoglycoprotein receptor ligand is a ligand that contains a moiety having affinity for the asialoglycoprotein receptor. As noted herein, the asialoglycoprotein receptor is highly expressed on hepatocytes. In some embodiments, an asialoglycoprotein receptor ligand includes or consists of one or more galactose derivatives. As used herein, the term galactose derivative includes both galactose and derivatives of galactose having affinity for the asialoglycoprotein receptor that is equal to or greater than that of galactose. Galactose derivatives include, but are not limited to: galactose, galactosamine, N-formylgalactosamine, N-acetyl-galactosamine, N-propionyl-galactosamine, N-n-butanoyl-galactosamine, and N-iso- butanoylgalactos-amine (see for example: S.T. Iobst and K. Drickamer, J.B.C., 1996, 271, 6686). Galactose derivatives, and clusters of galactose derivatives, that are useful for in vivo targeting of oligonucleotides and other molecules to the liver are known in the art (see, for example, Baenziger and Fiete, 1980, Cell, 22, 611-620; Connolly et al., 1982, J. Biol. Chem., 257, 939-945).

[0155] Galactose derivatives have been used to target molecules to hepatocytes in vivo through their binding to the asialoglycoprotein receptor expressed on the surface of hepatocytes. Binding of asialoglycoprotein receptor ligands to the asialoglycoprotein receptor(s) facilitates cell-specific targeting to hepatocytes and endocytosis of the molecule into hepatocytes. Asialoglycoprotein receptor ligands can be monomeric (e.g., having a single galactose derivative, also referred to as monovalent or monodentate) or multimeric (e.g., having multiple galactose derivatives). The galactose derivative or galactose derivative cluster can be attached to the 3′ or 5′ end of the sense or antisense strand of the RNAi agent using methods known in the art.

[0156] The preparation of targeting ligands, such as galactose derivative clusters, is described in, for example, International Patent Application Publication No. WO 2018 / 044350 toArrowhead Pharmaceuticals, Inc., and International Patent Application Publication No. WO 2017 / 156012 to Arrowhead Pharmaceuticals, Inc., the contents of both of which are incorporated by reference herein in their entirety.

[0157] As used herein, a galactose derivative cluster comprises a molecule having two to four terminal galactose derivatives. A terminal galactose derivative is attached to a molecule through its C-1 carbon. In some embodiments, the galactose derivative cluster is a galactose derivative trimer (also referred to as tri-antennary galactose derivative or tri-valent galactose derivative). In some embodiments, the galactose derivative cluster comprises N-acetyl- galactosamine moieties. In some embodiments, the galactose derivative cluster comprises three N-acetyl-galactosamine moieties. In some embodiments, the galactose derivative cluster is a galactose derivative tetramer (also referred to as tetra-antennary galactose derivative or tetra- valent galactose derivative). In some embodiments, the galactose derivative cluster comprises four N-acetyl-galactosamine moieties.

[0158] As used herein, a galactose derivative trimer contains three galactose derivatives, each linked to a central branch point. As used herein, a galactose derivative tetramer contains four galactose derivatives, each linked to a central branch point. The galactose derivatives can be attached to the central branch point through the C-1 carbons of the saccharides. In some embodiments, the galactose derivatives are linked to the branch point via linkers or spacers. In some embodiments, the linker or spacer is a flexible hydrophilic spacer, such as a PEG group (see, e.g., U.S. Patent No.5,885,968; Biessen et al. J. Med. Chem.1995 Vol.39 p.1538-1546). In some embodiments, the PEG spacer is a PEG3spacer. The branch point can be any small molecule which permits attachment of three galactose derivatives and further permits attachment of the branch point to the RNAi agent. An example of branch point group is a di- lysine or di-glutamate. Attachment of the branch point to the RNAi agent can occur through a linker or spacer. In some embodiments, the linker or spacer comprises a flexible hydrophilic spacer, such as, but not limited to, a PEG spacer. In some embodiments, the linker comprises a rigid linker, such as a cyclic group. In some embodiments, a galactose derivative comprises or consists of N-acetyl-galactosamine. In some embodiments, the galactose derivative cluster is comprised of a galactose derivative tetramer, which can be, for example, an N-acetyl- galactosamine tetramer.

[0159] Embodiments of the present disclosure include pharmaceutical compositions for delivering a YFV RNAi agent to a liver cell in vivo. Such pharmaceutical compositions can include, for example, a YFV RNAi agent conjugated to a galactose derivative cluster. In someembodiments, the galactose derivative cluster is comprised of a galactose derivative trimer, which can be, for example, an N-acetyl-galactosamine trimer, or galactose derivative tetramer, which can be, for example, an N-acetyl-galactosamine tetramer.

[0160] A targeting ligand or targeting group can be linked to the 3′ or 5′ end of a sense strand or an antisense strand of a YFV RNAi agent disclosed herein.

[0161] Targeting ligands include, but are not limited to (NAG37) and (NAG37)s as defined in Table 7. Other targeting groups and targeting ligands, including galactose cluster targeting ligands, are known in the art.

[0162] In some embodiments, a linking group is conjugated to the RNAi agent. The linking group facilitates covalent linkage of the agent to a targeting group, delivery polymer, or delivery vehicle. The linking group can be linked to the 3′ and / or the 5′ end of the RNAi agent sense strand or antisense strand. In some embodiments, the linking group is linked to the RNAi agent sense strand. In some embodiments, the linking group is conjugated to the 5′ or 3′ end of an RNAi agent sense strand. In some embodiments, a linking group is conjugated to the 5′ end of an RNAi agent sense strand. Examples of linking groups, can include, but are not limited to: reactive groups such a primary amines and alkynes, alkyl groups, abasic nucleotides, ribitol (abasic ribose), and / or PEG groups.

[0163] In some embodiments, a targeting group is linked internally to a nucleotide on the sense strand and / or the antisense strand of the RNAi agent. In some embodiments, a targeting group is linked to the RNAi agent via a linker.

[0164] A linker or linking group is a connection between two atoms that links one chemical group (such as an RNAi agent) or segment of interest to another chemical group (such as a targeting group or delivery polymer) or segment of interest via one or more covalent bonds. A labile linkage contains a labile bond. A linkage can optionally include a spacer that increases the distance between the two joined atoms. A spacer can further add flexibility and / or length to the linkage. Spacers include, but are not be limited to, alkyl groups, alkenyl groups, alkynyl groups, aryl groups, aralkyl groups, aralkenyl groups, and aralkynyl groups; each of which can contain one or more heteroatoms, heterocycles, amino acids, nucleotides, and saccharides. Spacer groups are well known in the art and the preceding list is not meant to limit the scope of the description.

[0165] In some embodiments, when two or more RNAi agents are included in a single composition, each of the RNAi agents may be linked to the same targeting group or two a different targeting groups (i.e., targeting groups having different chemical structure). In someembodiments, targeting groups are linked to the YFV RNAi agents disclosed herein without the use of an additional linker. In some embodiments, the targeting group itself is designed having a linker or other site to facilitate conjugation readily present. In some embodiments, when two or more YFV RNAi agents are included in a single molecule, each of the RNAi agents may utilize the same linker or different linkers (i.e., linkers having different chemical structures).

[0166] Any of the YFV RNAi agent nucleotide sequences listed in Tables 2, 3, 4, 5, or 6D, whether modified or unmodified, can contain 3′ and / or 5′ targeting group(s) or linking group(s). Any of the YFV RNAi agent sequences listed in Table 3, 4, or 6D, or are otherwise described herein, which contain a 3′ or 5′ targeting group or linking group, can alternatively contain no 3′ or 5′ targeting group or linking group, or can contain a different 3′ or 5′ targeting group or linking group including, but not limited to, those depicted in Table 7. Any of the YFV RNAi agent duplexes listed in Tables 6A, 6B, 6C, or 6D, whether modified or unmodified, can further comprise a targeting group or linking group, including, but not limited to, those depicted in Table 7, and the targeting group or linking group can be attached to the 3′ or 5′ terminus of either the sense strand or the antisense strand of the YFV RNAi agent duplex.

[0167] Examples of targeting groups and linking groups (which when combined can form targeting ligands) are provided in Table 7. Table 5 and Table 6D provide certain embodiments of YFV RNAi agent sense strands having a targeting group or linking group linked to the 5′ or 3′ end. Table 7. Structures Representing Various Modified Nucleotides, Targeting Ligands or Targeting Groups, Capping Residues, and Linking GroupsWhen positioned internally:tyl- her galactose derivative that has affinity for the asialoglycoprotein receptor present on hepatocytes, as would be understood by a person of ordinary skill in the art to be attached in view of the structures above and description provided herein. Other linking groups known in the art may be used.

[0169] In some embodiments, a delivery vehicle can be used to deliver an RNAi agent to a cell or tissue. A delivery vehicle is a compound that improves delivery of the RNAi agent to a cell or tissue. A delivery vehicle can include, or consist of, but is not limited to: a polymer, such as an amphipathic polymer, a membrane active polymer, a peptide, a melittin peptide, a melittin-like peptide (MLP), a lipid, a reversibly modified polymer or peptide, or a reversibly modified membrane active polyamine. In some embodiments, the RNAi agents can becombined with lipids, nanoparticles, polymers, liposomes, micelles, DPCs or other delivery systems available in the art. The RNAi agents can also be chemically conjugated to targeting groups, lipids (including, but not limited to cholesterol and cholesteryl derivatives), nanoparticles, polymers, liposomes, micelles, DPCs (see, for example WO 2000 / 053722, WO 2008 / 0022309, WO 2011 / 104169, and WO 2012 / 083185, WO 2013 / 032829, WO 2013 / 158141, each of which is incorporated herein by reference), hydrogels, cyclodextrins, biodegradable nanocapsules, and bioadhesive microspheres, proteinaceous vectors, or other delivery systems suitable for nucleic acid or oligonucleotide delivery as known and available in the art. Pharmaceutical Compositions

[0170] The YFV RNAi agents disclosed herein can be prepared as pharmaceutical compositions or formulations (also referred to herein as “medicaments”). In some embodiments, pharmaceutical compositions include at least one YFV RNAi agent. These pharmaceutical compositions are particularly useful in the inhibition of the expression of the target virus in a target cell, a group of cells, a tissue, or an organism.

[0171] The pharmaceutical compositions can be used to treat a subject having a disease, disorder, or condition that would benefit from reduction in the level of the target YFV genomic transcript, or inhibition in expression of the YFV viral genome. The pharmaceutical compositions can be used to treat a subject at risk of developing a disease, disorder, symptom, or condition that would benefit from reduction of the level of the YFV genomic transcript and / or an inhibition in expression the YFV viral genome. In one embodiment, the method includes administering a YFV RNAi agent that is to a targeting ligand as described herein, to a subject to be treated. In some embodiments, one or more pharmaceutically acceptable excipients (including vehicles, carriers, diluents, and / or delivery polymers) are added to the pharmaceutical compositions that include a YFV RNAi agent, thereby forming a pharmaceutical formulation or medicament suitable for in vivo delivery to a subject, including a human.

[0172] The pharmaceutical compositions that include a YFV RNAi agent and methods disclosed herein decrease the level of the target gene transcript in a cell, group of cells, group of cells, tissue, organ, or subject, including by administering to the subject a therapeutically effective amount of a herein described YFV RNAi agent, thereby inhibiting the expression or translation of YFV genomic transcript in the subject and reducing the amount of YFVpolypeptide and related YFV proteins. In some embodiments, the subject has been previously identified as having YFV present in hepatocytes. In some embodiments, the subject has been previously identified or diagnosed as having yellow fever virus infection and / or symptoms or diseases caused by YFV infection. In some embodiments, the subject would benefit from a reduction of YFV viral genome expression in the subject’s liver.

[0173] In some embodiments, the described pharmaceutical compositions including a YFV RNAi agent are used for treating or managing clinical presentations associated YFV infection and / or YFV-related diseases or symptoms. In some embodiments, a therapeutically (including prophylactically) effective amount of one or more of pharmaceutical compositions is administered to a subject in need of such treatment. In some embodiments, administration of any of the disclosed YFV RNAi agents can be used to decrease the number, severity, and / or frequency of symptoms of a disease in a subject.

[0174] The described pharmaceutical compositions that include a YFV RNAi agent can be used to treat at least one symptom in a subject having a disease or disorder that would benefit from reduction or inhibition in expression of YFV genomic transcript and / or a reduction in YFV protein levels. Measuring YFV levels can be conducted in accordance with established methods known in the art.

[0175] In some embodiments, the subject is administered a therapeutically effective amount of one or more pharmaceutical compositions that include a YFV RNAi agent thereby treating the symptom. In other embodiments, the subject is administered a prophylactically effective amount of one or more YFV RNAi agents, thereby preventing or inhibiting the at least one symptom.

[0176] The route of administration is the path by which a YFV RNAi agent is brought into contact with the body. In general, methods of administering drugs and oligonucleotides and nucleic acids for treatment of a mammal are well known in the art and can be applied to administration of the compositions described herein. The YFV RNAi agents disclosed herein can be administered via any suitable route in a preparation appropriately tailored to the particular route. Thus, herein described pharmaceutical compositions can be administered by injection, for example, intravenously, intramuscularly, intracutaneously, subcutaneously, intraarticularly, or intraperitoneally. In some embodiments, the herein described pharmaceutical compositions are administered via subcutaneous injection.

[0177] The pharmaceutical compositions including a YFV RNAi agent described herein can be delivered to a cell, group of cells, tissue, or subject using oligonucleotide deliverytechnologies known in the art. In general, any suitable method recognized in the art for delivering a nucleic acid molecule (in vitro or in vivo) can be adapted for use with the compositions described herein. For example, delivery can be by local administration, (e.g., direct injection, implantation, or topical administering), systemic administration, or subcutaneous, intravenous, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal and intrathecal), intramuscular, transdermal, airway (aerosol), nasal, oral, rectal, or topical (including buccal and sublingual) administration. In certain embodiments, the compositions are administered by subcutaneous or intravenous infusion or injection.

[0178] In some embodiments, the pharmaceutical compositions described herein comprise one or more pharmaceutically acceptable excipients. The pharmaceutical compositions described herein are formulated for administration to a subject.

[0179] As used herein, a pharmaceutical composition or medicament includes a pharmacologically effective amount of at least one of the described therapeutic compounds and one or more pharmaceutically acceptable excipients. Pharmaceutically acceptable excipients (excipients) are substances other than the Active Pharmaceutical Ingredient (API, therapeutic product, e.g., YFV RNAi agent) that are intentionally included in the drug delivery system. Excipients do not exert or are not intended to exert a therapeutic effect at the intended dosage. Excipients can act to a) aid in processing of the drug delivery system during manufacture, b) protect, support or enhance stability, bioavailability or patient acceptability of the API, c) assist in product identification, and / or d) enhance any other attribute of the overall safety, effectiveness, of delivery of the API during storage or use. A pharmaceutically acceptable excipient may or may not be an inert substance.

[0180] Excipients include, but are not limited to: absorption enhancers, anti-adherents, anti-foaming agents, anti-oxidants, binders, buffering agents, carriers, coating agents, colors, delivery enhancers, delivery polymers, detergents, dextran, dextrose, diluents, disintegrants, emulsifiers, extenders, fillers, flavors, glidants, humectants, lubricants, oils, polymers, preservatives, saline, salts, solvents, sugars, surfactants, suspending agents, sustained release matrices, sweeteners, thickening agents, tonicity agents, vehicles, water-repelling agents, and wetting agents.

[0181] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water-soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration,suitable carriers include physiological saline, bacteriostatic water, Cremophor® ELTM (BASF, Parsippany, NJ) or phosphate buffered saline (PBS). Suitable carriers should be stable under the conditions of manufacture and storage and should be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, and sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.

[0182] Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filter sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle, which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, methods of preparation include vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.

[0183] In some embodiments, pharmaceutical formulations that include the YFV RNAi agents disclosed herein suitable for subcutaneous administration can be prepared in an aqueous sodium phosphate buffer (e.g., the YFV RNAi agent formulated in 0.5 mM sodium phosphate monobasic, 0.5 mM sodium phosphate dibasic, in water). In some embodiments, pharmaceutical formulations that include the YFV RNAi agents disclosed herein suitable for subcutaneous administration can be prepared in water for injection (sterile water). YFV RNAi agents disclosed herein suitable for subcutaneous administration can be prepared in isotonic saline (0.9%).

[0184] Formulations suitable for intra-articular administration can be in the form of a sterile aqueous preparation of the drug that can be in microcrystalline form, for example, in the form of an aqueous microcrystalline suspension. Liposomal formulations or biodegradable polymer systems can also be used to present the drug for both intra-articular and ophthalmic administration.

[0185] Formulations suitable for oral administration of the YFV RNAi agents disclosed herein can also be prepared. In some embodiments, the YFV RNAi agents disclosed herein are administered orally. In some embodiments, the YFV RNAi agents disclosed herein are formulated in a capsule for oral administration.

[0186] The active compounds can be prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. Liposomal suspensions can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Patent No.4,522,811.

[0187] The YFV RNAi agents can be formulated in compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the dosage unit forms of the disclosure are dictated by and directly dependent on the unique characteristics of the active compound and the therapeutic effect to be achieved, and the limitations inherent in the art of compounding such an active compound for the treatment of individuals.

[0188] A pharmaceutical composition can contain other additional components commonly found in pharmaceutical compositions. Such additional components include, but are not limited to: anti-pruritics, astringents, local anesthetics, analgesics, antihistamines, or anti- inflammatory agents (e.g., acetaminophen, NSAIDs, diphenhydramine, etc.). It is also envisioned that cells, tissues, or isolated organs that express or comprise the herein defined RNAi agents may be used as “pharmaceutical compositions.” As used herein, “pharmacologically effective amount,” “therapeutically effective amount,” or simply “effective amount” refers to that amount of an RNAi agent to produce a pharmacological, therapeutic, or preventive result.

[0189] In some embodiments, the methods disclosed herein further comprise the step of administering a second therapeutic or treatment in addition to administering an RNAi agent disclosed herein. In some embodiments, the second therapeutic is another YFV RNAi agent (e.g., a YFV RNAi agent that targets a different sequence within the YFV genomic transcripttarget). In other embodiments, the second therapeutic can be a small molecule drug, an antibody, an antibody fragment, or an aptamer.

[0190] In some embodiments, the described YFV RNAi agent(s) are optionally combined with one or more additional therapeutics. The YFV RNAi agent and additional therapeutic(s) can be administered in a single composition or they can be administered separately. In some embodiments, the one or more additional therapeutics is administered separately in separate dosage forms from the RNAi agent (e.g., the YFV RNAi agent is administered by subcutaneous injection, while the additional therapeutic involved in the method of treatment dosing regimen is administered orally). In some embodiments, the described YFV RNAi agent(s) are administered to a subject in need thereof via subcutaneous injection, and the one or more optional additional therapeutics are administered orally, which together provide for a treatment regimen for diseases and conditions associated with YFV infection and / or a YFV-related disease. In some embodiments, the described YFV RNAi agent(s) are administered to a subject in need thereof via subcutaneous injection, and the one or more optional additional therapeutics are administered via a separate subcutaneous injection. In some embodiments, the YFV RNAi agent and one or more additional therapeutics are combined into a single dosage form (e.g., a “cocktail” formulated into a single composition for subcutaneous injection). The YFV RNAi agents, with or without the one or more additional therapeutics, can be combined with one or more excipients to form pharmaceutical compositions.

[0191] Generally, an effective amount of a YFV RNAi agent will be in the range of from about 0.1 to about 100 mg / kg of body weight / dose, e.g., from about 1.0 to about 50 mg / kg of body weight / dose. In some embodiments, an effective amount of an active compound will be in the range of from about 0.25 to about 5 mg / kg of body weight per dose. In some embodiments, an effective amount of an active ingredient will be in the range of from about 0.5 to about 4 mg / kg of body weight per dose. In some embodiments, an effective amount of a YFV RNAi agent may be a fixed dose. In some embodiments, the fixed dose is in the range of from about 5 mg to about 1,000 mg of YFV RNAi agent. In some embodiments, the fixed does is in the range of 10 to 400 mg of YFV RNAi agent. In some embodiments, the fixed does is in the range of 50 to 400 mg of YFV RNAi agent. Dosing may be weekly, bi-weekly, monthly, quarterly, semi-annually, or at any other interval depending on the dose of YFV RNAi agent administered, the activity level of the particular YFV RNAi agent, and the desired level of inhibition for the particular subject. The Examples herein show suitable levels for inhibition in certain animal species. The amount administered will depend on such variables as the overallhealth status of the patient or subject, the relative biological efficacy of the compound delivered, the formulation of the drug, the presence and types of excipients in the formulation, and the route of administration. Also, it is to be understood that the initial dosage administered can be increased beyond the above upper level to rapidly achieve the desired blood-level or tissue level, or the initial dosage can be smaller than the optimum.

[0192] For treatment of disease or for formation of a medicament or composition for treatment of a disease, the pharmaceutical compositions described herein including a YFV RNAi agent can be combined with an excipient or with a second therapeutic agent or treatment including, but not limited to: a second or other RNAi agent, a small molecule drug, an antibody, an antibody fragment, peptide and / or an aptamer.

[0193] The described YFV RNAi agents, when added to pharmaceutically acceptable excipients or adjuvants, can be packaged into kits, containers, packs, or dispensers. The pharmaceutical compositions described herein may be packaged in pre-filled syringes, pen injectors, autoinjectors, infusion bags / devices, or vials. Methods of Treatment and Inhibition of Expression

[0194] The YFV RNAi agents disclosed herein can be used to treat a subject (e.g., a human or other mammal) having a disease or disorder that would benefit from administration of the RNAi agent. In some embodiments, the RNAi agents disclosed herein can be used to treat a subject (e.g., a human) that would benefit from reduction and / or inhibition in expression of YFV genomic transcript and / or YFV protein levels, for example, a subject that has been diagnosed with or is suffering from symptoms related to YFV infection.

[0195] In some embodiments, the subject is administered a therapeutically effective amount of any one or more YFV RNAi agents. Treatment of a subject can include therapeutic and / or prophylactic treatment. The subject is administered a therapeutically effective amount of any one or more YFV RNAi agents described herein. The subject may be an adult, adolescent, child, or infant. Administration of a pharmaceutical composition described herein can be to a human being or animal.

[0196] The YFV RNAi agents described herein can be used to treat at least one symptom in a subject having a YFV-related disease or disorder, or having a disease or disorder that is mediated at least in part by YFV viral genome expression. In some embodiments, the YFV RNAi agents are used to treat or manage a clinical presentation of a subject with a disease or disorder that would benefit from or be mediated at least in part by a reduction in YFV genomictranscript or YFV protein levels. The subject is administered a therapeutically effective amount of one or more of the YFV RNAi agents or YFV RNAi agent-containing compositions described herein. In some embodiments, the methods disclosed herein comprise administering a composition comprising a YFV RNAi agent described herein to a subject to be treated. In some embodiments, the subject is administered a prophylactically effective amount of any one or more of the described YFV RNAi agents, thereby treating the subject by preventing or inhibiting the at least one symptom.

[0197] In certain embodiments, the present disclosure provides methods for treatment of diseases, disorders, conditions, or pathological states mediated at least in part by YFV viral genome expression, in a patient in need thereof, wherein the methods include administering to the patient any of the YFV RNAi agents described herein.

[0198] In some embodiments, the viral genomic transcript level of a YFV viral genome in a subject to whom a described YFV RNAi agent is administered is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 95%, 96%, 97%, 98%, 99%, or greater than 99% relative to the subject prior to being administered the YFV RNAi agent or to a subject not receiving the YFV RNAi agent. The YFV RNA level in the subject may be reduced in a cell, group of cells, and / or tissue of the subject. In some embodiments, the YFV viral genome expression is inhibited by at least about 30%, 35%, 40%, 45% 50%, 55%, 60%, 65%, or greater than 65% in hepatocytes relative to the subject prior to being administered the YFV RNAi agent or to a subject not receiving the YFV RNAi agent.

[0199] In some embodiments, the YFV protein level in a subject to whom a described YFV RNAi agent has been administered is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99% relative to the subject prior to being administered the YFV RNAi agent or to a subject not receiving the YFV RNAi agent. The protein level in the subject may be reduced in a cell, group of cells, tissue, blood, and / or other fluid of the subject.

[0200] A reduction in YFV RNA or genome expression levels and YFV protein levels can be assessed by any methods known in the art. As used herein, a reduction or decrease in YFV genome expression level and / or protein level (including polyprotein and / or the various structural or non-structural proteins thereof) are collectively referred to herein as a reduction or decrease in YFV or inhibiting or reducing the viral genome expression of YFV. The Examples set forth herein illustrate known methods for assessing inhibition of YFV viralgenome expression. The person of ordinary skill in the art would further know suitable methods for assessing inhibition of YFV viral genome expression in vivo and / or in vitro.

[0201] In some embodiments, disclosed herein are methods of treatment (including prophylactic or preventative treatment) of diseases, disorders, or symptoms caused by caused by YFV infection, wherein the methods include administering to a subject in need thereof a therapeutically effective amount of a YFV RNAi agent that includes an antisense strand that is at least partially complementary to the portion of the YFV genome transcript having the sequence in Table 1. In some embodiments, disclosed herein are methods of treatment (including prophylactic or preventative treatment) of diseases or symptoms caused by YFV infection, wherein the methods include administering to a subject in need thereof a therapeutically effective amount of a YFV RNAi agent that includes an antisense strand comprising the sequence of any of the sequences in Tables 2, 3, or 6D, and a sense strand that comprises any of the sequences in Tables 2, 4, 5, or 6D, that is at least partially complementary to the antisense strand. In some embodiments, disclosed herein are methods of treatment (including prophylactic or preventative treatment) of diseases or symptoms caused by YFV infection, wherein the methods include administering to a subject in need thereof a therapeutically effective amount of a YFV RNAi agent that includes a sense strand that comprises any of the sequences in Tables 2, 4, 5, or 6D, and an antisense strand comprising the sequence of any of the sequences in Tables 2, 3, or 6D that is at least partially complementary to the sense strand.

[0202] In some embodiments, disclosed herein are methods for inhibiting expression of a YFV viral genome in a cell, wherein the methods include administering to the cell a YFV RNAi agent that includes an antisense strand that is at least partially complementary to the portion of the YFV genome transcript having the sequence in Table 1. In some embodiments, disclosed herein are methods of inhibiting expression of a YFV viral genome in a cell, wherein the methods include administering to a cell a YFV RNAi agent that includes an antisense strand comprising the sequence of any of the sequences in Tables 2, 3, or 6D, and a sense strand that comprises any of the sequences in Tables 2, 4, 5, or 6D that is at least partially complementary to the antisense strand. In some embodiments, disclosed herein are methods of inhibiting expression of a YFV viral genome in a cell, wherein the methods include administering a YFV RNAi agent that includes a sense strand that comprises any of the sequences in Tables 2, 4, 5, or 6D, and an antisense strand that includes the sequence of any of the sequences in Tables 2, 3, or 6D that is at least partially complementary to the sense strand.

[0203] The use of YFV RNAi agents provides methods for therapeutic (including prophylactic) treatment of diseases / disorders associated with YFV infection. The described YFV RNAi agents mediate RNA interference to inhibit the expression of one or more viral genomes necessary for production of YFV polyprotein and its various sub- structural and non- structural proteins. YFV RNAi agents can also be used to treat or prevent various diseases, disorders, or conditions, including liver disease caused by several YFV infection. Compositions for delivery of YFV RNAi agents to liver cells, and specifically to hepatocytes, in vivo, are described. Cells, Tissues, Organs, and Non-Human Organisms

[0204] Cells, tissues, organs, and non-human organisms that include at least one of the YFV RNAi agents described herein are contemplated. The cell, tissue, organ, or non-human organism is made by delivering the RNAi agent to the cell, tissue, organ or non-human organism. Additional Illustrative Embodiments

[0205] Provided here are certain additional illustrative embodiments of the disclosed invention. These embodiments are illustrative only and do not limit the scope of the present disclosure or of the claims attached hereto. 1. An RNAi agent for inhibiting expression of a Yellow Fever Virus (YFV) viral genome, comprising: an antisense strand comprising a nucleotide sequence of at least 15 contiguous nucleotides differing by 0 or 1 nucleotides from 15 contiguous nucleotides of any one of the antisense strand sequences of Table 2, Table 3, or Table 6D; and a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand. 2. The RNAi agent of Embodiment 1, wherein the antisense strand comprises nucleotides 2- 18 of any one of the sequences provided in Table 2, Table 3, or Table 6D. 3. The RNAi agent of Embodiment 1 or Embodiment 2, wherein the sense strand comprises a nucleotide sequence of at least 15 contiguous nucleotides differing by 0 or 1 nucleotides from 15 contiguous nucleotides of any one of the sense strand sequences of Table 2, Table4, Table 5, or Table 6D, and wherein the sense strand has a region of at least 85% complementarity over at least 15 contiguous nucleotides to the antisense strand. The RNAi agent of any one of Embodiments 1-3, wherein at least one nucleotide of the RNAi agent includes a modified internucleoside linkage. The RNAi agent of any one of Embodiments 1-4, wherein all or substantially all of the nucleotides are modified nucleotides. The RNAi agent of any one of Embodiments 4-5, wherein the modified nucleotides are independently selected from the group consisting of: 2’-O-methyl nucleotide, 2’-fluoro nucleotide, 2’-deoxy nucleotide, 2’,3’-seco nucleotide mimic, locked nucleotide, 2'-F- arabino nucleotide, 2’-methoxyethyl nucleotide, abasic nucleotide, ribitol, inverted nucleotide, inverted 2’-O-methyl nucleotide, inverted 2’-deoxy nucleotide, 2’-amino- modified nucleotide, 2’-alkyl-modified nucleotide, morpholino nucleotide, vinyl phosphonate-containing nucleotide, cyclopropyl phosphonate-containing nucleotide, and 3’-O-methyl nucleotide. The RNAi agent of Embodiment 5, wherein all or substantially all of the modified nucleotides are 2’-O-methyl nucleotides, 2’-fluoro nucleotides, or combinations thereof. The RNAi agent of any one of Embodiments 1-7, wherein the antisense strand consists of or consists essentially of the nucleotide sequence of any one of the modified antisense strand sequences of Table 3. The RNAi agent of any one of Embodiments 1-8 wherein the sense strand consists of, consists essentially of, or comprises the nucleotide sequence of any of the modified sense strand sequences of Table 4, Table 5, or Table 6D. The RNAi agent of Embodiment 1, wherein the antisense strand comprises the nucleotide sequence of any one of the modified sequences of Table 3 or Table 6D, and the sense strand comprises the nucleotide sequence of any one of the modified sequences of Table 4, Table 5, or Table 6D. The RNAi agent of any one of Embodiments 1-10, wherein the sense strand is between 18 and 30 nucleotides in length, and the antisense strand is between 18 and 30 nucleotides in length. The RNAi agent of Embodiment 11, wherein the sense strand and the antisense strand are each between 18 and 27 nucleotides in length. The RNAi agent of Embodiment 12, wherein the sense strand and the antisense strand are each between 18 and 24 nucleotides in length.The RNAi agent of Embodiment 13, wherein the sense strand and the antisense strand are each 21 nucleotides in length. The RNAi agent of Embodiment 14, wherein the RNAi agent has two blunt ends. The RNAi agent of any one of Embodiments 1-15, wherein the sense strand comprises one or two terminal caps. The RNAi agent of any one of Embodiments 1-16, wherein the sense strand comprises one or two inverted abasic residues. The RNAi agent of Embodiment 1, wherein the RNAi agent is comprised of a sense strand and an antisense strand that form a duplex having the structure of any one of the duplexes in Table 6B. The RNAi agent of Embodiment 1, wherein the antisense strand consists of, consists essentially of, or comprises a nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5′ ^ 3′): UUCAACUGAUGUUCCAAUCGU (SEQ ID NO: 675); or UCUAUCAUCAUGCUCACCAAC (SEQ ID NO: 677). The RNAi agent of any one of Embodiments 1-19, wherein the nucleotides of the antisense strand located at position 2 and position 14 from the 5’-end are 2’-fluoro modified nucleotides. The RNAi agent of Embodiment 20, wherein the nucleotide of the antisense strand at position 2 is a 2’-fluoro uridine, and the nucleotide of the antisense strand at position 14 is a 2’-fluoro cytidine. The RNAi agent of any one of Embodiments 19-21, wherein the antisense strand comprises at least 1 phosphorothioate or phosphorodithioate internucleoside linkage. The RNAi agent of any one of Embodiments 1-22, wherein the sense strand consists of, consists essentially of, or comprises a nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5′ ^ 3′): ACGAUUGGAACAUCAGUUGAA (SEQ ID NO: 718); or GUUGGUGAGCAUGAUGAUAGA (SEQ ID NO: 720). The RNAi agent of any one of Embodiments 19-23, wherein all or substantially all of the nucleotides are modified nucleotides.The RNAi agent of Embodiment 1, comprising an antisense strand that comprises, consists of, or consists essentially of a modified nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5′ ^ 3′): cPrpusUfcaacUfgaugUfuCfcAfaucgsu (SEQ ID NO: 494); cPrpusUfcaacUfgaugUfuCfcAfaucgssu (SEQ ID NO: 513); or cPrpusCfuaucAfucauGfcUfcAfccaassc (SEQ ID NO: 514), wherein a represents 2′-O-methyl adenosine, c represents 2′-O-methyl cytidine, g represents 2′-O-methyl guanosine, and u represents 2′-O-methyl uridine; Af, represents 2′-fluoro adenosine, Cf represents 2′-fluoro cytidine, Gf represents 2′-fluoro guanosine, and Uf represents 2′-fluoro uridine; cPrpu represents a 5’-cyclopropyl phosphonate-2’-O- methyl uridine; s represents a phosphorothioate linkage; ss represents a phosphorodithioate linkage; and wherein all or substantially all of the nucleotides on the sense strand are modified nucleotides. The RNAi agent of Embodiment 1, wherein the sense strand comprises, consists of, or consists essentially of a modified nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5′ ^ 3′): acgauuggAfAfCfaucaguugaa (SEQ ID NO: 534); or guuggugaGfCfAfugaugauaga (SEQ ID NO: 536), wherein a represents 2′-O-methyl adenosine, c represents 2′-O-methyl cytidine, g represents 2′-O-methyl guanosine, and u represents 2′-O-methyl uridine; Af, represents 2′-fluoro adenosine, Cf represents 2′-fluoro cytidine, Gf represents 2′- fluoro guanosine, and Uf represents 2′-fluoro uridine; and wherein all or substantially all of the nucleotides on the antisense strand are modified nucleotides. The RNAi agent of any one of Embodiments 19-26, wherein the sense strand further includes inverted abasic residues at the 3’ terminal end of the nucleotide sequence, at the 5’ end of the nucleotide sequence, or at both. The RNAi agent of any one of Embodiments 1-27, wherein the RNAi agent is linked to a targeting ligand. The RNAi agent of Embodiment 28, wherein the targeting ligand comprises:or The RNAi agent of any one of Embodiments 28-29, wherein the targeting ligand is linked to the sense strand. The RNAi agent of Embodiment 30, wherein the targeting ligand is linked to the 5’ terminal end of the sense strand. A composition comprising the RNAi agent of any one of Embodiments 1-31, wherein the composition further comprises a pharmaceutically acceptable excipient. The composition of Embodiment 32, further comprising a second RNAi agent capable of inhibiting the expression of a YFV viral genome. The composition of any one of Embodiments 32-33, further comprising one or more additional therapeutics. The composition of any one of Embodiments 32-34, wherein the composition is formulated for administration.The composition of Embodiment 35, wherein the composition is delivered by subcutaneous injection. The composition of any one of Embodiment 32-36, wherein the pharmaceutically acceptable excipient is a sodium phosphate buffer. The composition of any one of Embodiment 32-36, wherein the pharmaceutically acceptable excipient is isotonic saline or water for injection. A method for inhibiting expression of a YFV viral genome in a hepatocyte cell, the method comprising introducing into a cell of a subject an effective amount of an RNAi agent of any one of Embodiments 1-31 or the composition of any one of Embodiments 32-38. The method of Embodiment 39, wherein the subject is a human subject. The method of any one of Embodiments 39-40, wherein the YFV genome transcript levels are reduced by at least about 50% in the hepatocyte cell or in the subject. The method of any one of Embodiments 39-41, wherein the YFV protein levels are reduced by at least about 50% in the hepatocyte cell or in the subject. A method of treating a YFV-related disease, disorder, or symptom, the method comprising administering to a human subject in need thereof a therapeutically effective amount of the composition of any one of Embodiments 32-38. The method of Embodiment 43, wherein the disease, disorder, or symptom is liver failure caused by YFV infection. The method of any one of Embodiments 39-44, wherein the level of YFV protein is decreased in the subject. The method of any one of Embodiments 39-45, wherein the RNAi agent is administered to a human subject at a dose of about 0.05 mg / kg to about 5.0 mg / kg of body weight of the human subject. Use of the RNAi agent of any one of Embodiments 1-31 or the composition according to any one of Embodiments 32-38, for the treatment of a disease, disorder, or symptom that is mediated at least in part by a reduction in YFV viral genome expression. Use according to Embodiment 47, wherein the disease, disorder, or symptom is liver failure caused by YFV infection. Use of the RNAi agent of any one of Embodiments 1-31 or the composition according to any one of Embodiments 32-38, for the preparation of a pharmaceutical composition for treating a disease, disorder, or symptom that is mediated at least in part by a reduction in YFV viral genome expression.

[0206] The above provided embodiments and items are now illustrated with the following, non-limiting examples.EXAMPLES Example 1. Synthesis of YFV RNAi Agents.

[0207] YFV RNAi agent duplexes shown in Tables 6A and 6B above, were synthesized in accordance with the following general procedures: A. Synthesis.

[0208] The sense and antisense strands of the RNAi agents were synthesized according to phosphoramidite technology on solid phase used in oligonucleotide synthesis. Such standard synthesis is generally known in the art. Depending on the scale, either a MerMade96E® (Bioautomation), a MerMade12® (Bioautomation), or an OP Pilot 100 (GE Healthcare) was used. Syntheses were performed on a solid support made of controlled pore glass (CPG, 500 Å or 600Å, obtained from Prime Synthesis, Aston, PA, USA). The monomer positioned at the 3’ end of the respective strand was attached to the solid support as a starting point for synthesis. All RNA and 2′-modified RNA phosphoramidites were purchased from Thermo Fisher Scientific (Milwaukee, WI, USA) or Hongene Biotech (Shanghai, PRC). The 2′-O-methyl phosphoramidites included the following: (5′-O-dimethoxytrityl-N6-(benzoyl)-2′-O-methyl- adenosine-3′-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, 5′-O-dimethoxy-trityl- N4-(acetyl)-2′-O-methyl-cytidine-3′-O-(2-cyanoethyl-N,N-diisopropyl-amino) phosphoramidite, (5′-O-dimethoxytrityl-N2-(isobutyryl)-2′-O-methyl-guanosine-3′-O-(2- cyanoethyl-N,N-diisopropylamino) phosphoramidite, and 5′-O-dimethoxytrityl-2′-O- methyl-uridine-3′-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite. The 2′-deoxy-2′- fluoro-phosphoramidites carried the same protecting groups as the 2′-O-methyl amidites. 5′- (4,4′-Dimethoxytrityl)-2′,3′-seco-uridine, 2′-benzoyl-3′-[(2- cyanoethyl)-(N,N- diisopropyl)]- phosphoramidite was also purchased from Thermo Fisher Scientific or Hongene Biotech. 5′- dimethoxytrityl-2′-O-methyl-inosine-3′-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidites were purchased from Glen Research (Virginia) or Hongene Biotech. The cyclopropyl phosphonate phosphoramidites were synthesized in accordance with International Patent Application Publication No. WO 2017 / 214112 (see also Altenhofer et. al., Chem. Communications (Royal Soc. Chem.), 57(55):6808-6811 (July 2021)). The inverted abasic (3′- O-dimethoxytrityl-2′-deoxyribose-5′-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidites were purchased from ChemGenes (Wilmington, MA, USA) or SAFC (St Louis, MO, USA). 5’-O-dimethoxytrityl-N2,N6-(phenoxyacetate)-2’-O-methyl-diaminopurine-3′-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidites were obtained from ChemGenes or Hongene Biotech.

[0209] Targeting ligand-containing phosphoramidites were dissolved in anhydrous dichloromethane or anhydrous acetonitrile (50 mM), while all other amidites were dissolved in anhydrous acetonitrile (50 mM), or anhydrous dimethylformamide and molecular sieves (3Å) were added. 5-Benzylthio-1H-tetrazole (BTT, 250 mM in acetonitrile), 5-Ethylthio-1H- tetrazole (ETT, 250 mM in acetonitrile), or 4,5-dicyanoimidazole (DCI) was used as activator solution. Coupling times were 12 min (RNA), 15 min (targeting ligand), 90 sec (2′OMe), and 60 sec (2′F). In order to introduce phosphorothioate linkages, a 100 mM solution of 3-phenyl 1,2,4-dithiazoline-5-one (POS, obtained from PolyOrg, Inc., Leominster, MA, USA) in anhydrous Acetonitrile was employed. Each of the YFV RNAi agent duplexes synthesized and tested in the following Examples utilized N-acetyl-galactosamine as “NAG” in the targeting ligand chemical structures represented in Table 7. (NAG37) and (NAG37)s targeting ligand phosphoramidite compounds can be synthesized in accordance with International Patent Application Publication No. WO 2018 / 044350 to Arrowhead Pharmaceuticals, Inc. B. Cleavage and deprotection of support bound oligomer.

[0210] After finalization of the solid phase synthesis, the dried solid support was treated with a 1:1 volume solution of 40 wt. % methylamine in water and 28% ammonium hydroxide solution (Aldrich) for 1.5 hours at 30°C. The solution was evaporated and the solid residue was reconstituted in water (see below). C. Purification.

[0211] Crude oligomers were purified by anionic exchange HPLC using a TSKgel SuperQ- 5PW 13µm column and Shimadzu LC-8 system. Buffer A was 20 mM Tris, 5 mM EDTA, pH 9.0 and contained 20% Acetonitrile and buffer B was the same as buffer A with the addition of 1.5 M sodium chloride. UV traces at 260 nm were recorded. Appropriate fractions were pooled then run on size exclusion HPLC using a GE Healthcare XK 26 / 40 column packed with Sephadex G-25 fine with a running buffer of filtered DI water or 100mM ammonium bicarbonate, pH 6.7 and 20% Acetonitrile. D. Annealing.

[0212] Complementary strands were mixed by combining equimolar RNA solutions (sense and antisense) in 1×Phosphate-Buffered Saline (Corning, Cellgro) to form the RNAi agents. Some RNAi agents were lyophilized and stored at −15 to −25°C. Duplex concentration was determined by measuring the solution absorbance on a UV-Vis spectrometer in 1× Phosphate-Buffered Saline. The solution absorbance at 260 nm was then multiplied by a conversion factor and the dilution factor to determine the duplex concentration. The conversion factor used was either 0.050 mg / (mL∙cm) or was calculated from an experimentally determined extinction coefficient. Example 2. In Vitro Testing of YFV RNAi Agents in Yellow Fever Virus, 17D.

[0213] In vitro anti-viral activity of the YFV RNAi agents was studied using Yellow Fever Virus, 17D. All procedures were performed in accordance with the best recommended virology practices in BSL2+ facility. Huh-7 cell line was prepared and propagated to reach 60-70% confluency in 10% FBS. The YFV RNAi agents were prepared, via dilutions in concentrations of 1.5 µM, 30 nM, 15 nM, 7.5 nM, and 3.5 nM formulated in PBS. The YFV RNAi agent was delivered to the Huh7 cells via transfection using LipofectamineTMRNAiMAX (Invitrogen Catalog #13778150) in Opti-MEMTM(Gibco Catalog #31985062) media. The Huh-7 cell + YFV RNAi agent mix was incubated 24 hours at 37°C with 5% CO2. The Huh-7 cell + YFV RNAi agent mix was then infected with Yellow Fever Virus, 17D (BEI Resources; Catalog No. NR-116); YFV 17D was propagated in VERO cell line and titrated using TCID50. Viral infection was incubated for 72 hours, and supernatant subsequently collected for qRTPCR for quantification of % viral inhibition by the YFV RNAi agent. Each transfection and viral infection was performed in triplicates. The results are shown in the following Tables 8A, 8B, 8C, and 8D. Negative inhibition values denotes the lack of YFV viral genome inhibition.

[0214] Table 8A. Percent viral inhibition of YFV 17D by YFV RNAi agents, of Example 2; screen 1. YFV RNAi Agent YFV Virus YFV RNAi Agent Dose Concentration % Inhibition

[0215] Table 8B. Percent viral inhibition of YFV 17D by YFV RNAi agents, of Example 2; screen 2. YFV RNAi Agent YFV Virus YFV RNAi Agent Dose Concentration % Inhibition AD127 YFV 17D M 4ple 2; screen 3. YFV RNAi Agent YFV Virus YFV RNAi Agent Dose Concentration % Inhibition

[0217] Table 8D. Percent viral inhibition of YFV 17D by YFV RNAi agents, of Example 2; screen 4. YFV RNAi Agent YFV Virus YFV RNAi Agent % InhibitionAD12733 YFV 17D 30 nM 48.13 AD12733 YFV 17D 15 nM 63.79 AD12733 YFV 17D 75 M 6526

[0218] To evaluate YFV RNAi agents in vivo, a YFV-SEAP mouse model was used. C57bl6 / Albino female mice were transiently transfected in vivo with plasmid by hydrodynamic tail vein (HTV) injection. Mice were injected, via hydrodynamic tail vein (HTV) injection, with plasmid pMIR1031 or pMIR1034 containing the regions interest (in concatemer of the partial segments of the YFV viral genome) of the YFV cDNA sequence (NCBI Reference Sequence: MK249066.1 (Seq ID No.1)) inserted into the 3’ UTR of the SEAP (secreted human placental alkaline phosphatase) reporter gene. 20 µg of the plasmid containing the YFV viral genome in Ringer’s solution in a total volume of 10% of the animal’s body weight was injected, via HTV, to create YFV-SEAP model mice. Following transfection with YFV-SEAP, the mice were subsequently administered YFV RNAi agents. Inhibition of YFV viral genome expression by YFV RNAi agent results in concomitant inhibition of SEAP expression. SEAP expression levels were measured by Phospha-Light™ SEAP Reporter Gene Assay System (ThermoFisher Cat #T1016). Prior to treatment, SEAP expression levels in serum were measured and the mice were grouped according to average SEAP levels.

[0219] Analyses: SEAP levels may be measured at various times, both before and after administration of YFV RNAi agents.

[0220] i) Serum collection: Mice were anesthetized with 2-3% isoflurane and blood samples were collected from the submandibular area into serum separation tubes (Sarstedt AG & Co., Nümbrecht, Germany). Blood was allowed to coagulate at ambient temperature for 20 min. The tubes were centrifuged at 8,000 ×g for 3 min to separate the serum and stored at 4°C.

[0221] ii) Serum SEAP levels: Serum was collected and measured by the Phospha-Light™ SEAP Reporter Gene Assay System (ThermoFisher) according to the manufacturer’s instructions. Serum SEAP levels for each animal was normalized to the control group of miceinjected with saline in order to account for the non-treatment related decline in YFV sequence expression with this model. First, the SEAP level for each animal at a time point was divided by the pre-treatment level of expression in that animal (“pre-treatment”) in order to determine the ratio of expression “normalized to pre-treatment”. Expression at a specific time point was then normalized to the control group by dividing the “normalized to pre-treatment” ratio for an individual animal by the average “normalized to pre-treatment” ratio of all mice in the normal saline control group. Alternatively, in some Examples set forth herein, the serum SEAP levels for each animal were assessed by normalizing to pre-treatment levels only. Example 4. In vivo administration of YFV RNAi agents in YFV-SEAP mice.

[0222] The YFV-SEAP model described in Example 3, above, was used. On Day 1, four (n=4) female C57bl / 6 albino mice were dosed with either isotonic saline or RNAi agents formulated in saline (at 3 mg / kg), via subcutaneous (SQ) injection, at 200 µL per 20 g (10 mL / kg) body weight injection volume. The dosing regimen is in accordance with Table 9 below.

[0223] Table 9. Dosing for mice of Example 4. Targeted Position of Group Dose (RNAi Agent) Dosing Route

[0224] Serum was collected on Day -7, 1, 8, 15, and 22. SEAP expression levels were determined pursuant to the procedure set forth in Example 3, above. Data from the experiment are shown in the following Table 10, with average SEAP reflecting the normalized average value of SEAP.

[0225] Table 10. Average SEAP normalized to pre-treatment and saline control in YFV-SEAP mice of Example 4. Day 8 Day 15 Day 22 Group ID Avg Std Avg Std Avg Std 800787894965

[0226] Groups 3-12 showed reduction in SEAP-YFV at Day 8 and Day 15 compared to the saline control Group 1. Groups 3-7 and 10-12 showed reduction in SEAP-YFV at Day 22 compared to the saline control Group 1. More specifically, on Day 22 AD12729 achieved ~89% inhibition after a single subcutaneous administration of 3 mg / kg. Example 5. In vivo administration of YFV RNAi agents in YFV-SEAP mice.

[0227] The YFV-SEAP model described in Example 3, above, was used. On Day 1, four (n=4) female C57bl / 6 albino mice were dosed with either isotonic saline or RNAi agents formulated in saline (at 3 mg / kg), via subcutaneous (SQ) injection, at 200 µL per 20 g (10 mL / kg) body weight injection volume. The dosing regimen is in accordance with Table 11 below.

[0228] Table 11. Dosing for mice of Example 5.Targeted Position of Group Dose (RNAi Agent) Dosing Route YFV (Seq ID No.1)eu as coece o ay -, , , , a . epesso ees ee ee ned pursuant to the procedure set forth in Example 3, above. Data from the experiment are shown in the following Table 12, with average SEAP reflecting the normalized average value of SEAP.

[0230] Table 12. Average SEAP normalized to pre-treatment and saline control in YFV-SEAP mice of Example 5. Day 8 Day 15 Day 26 Avg Std Avg Std Avg Std 01209038510. 3 mg / kg AD127410.387 0.099 0.278 0.200 0.495 0.35011. 3 mg / kg AD127380.482 0.112 0.278 0.115 0.415 0.14711ne control Group 1, Groups 2-5 and 7-13 showed reduction in SEAP-YFV at Day 15 compared to the saline control Group 1. Groups 2-13 showed reduction in SEAP-YFV at Day 26 compared to the saline control Group 1. More specifically, a single administration of at 3 mg / kg of YFV RNAi agent AD12729 achieved ~84% inhibition on Day 15. Example 6. In vivo administration of YFV RNAi agents in YFV-SEAP mice.

[0232] The YFV-SEAP model described in Example 3, above, was used. On Day 1, four (n=4) female C57bl / 6 albino mice were dosed with either isotonic saline or RNAi agents formulated in saline (at 3 mg / kg), via subcutaneous (SQ) injection, at 250 µL per 25 g (10 mL / kg) body weight injection volume. The dosing regimen is in accordance with Table 13 below.

[0233] Table 13. Dosing for mice of Example 6. Targeted Position of Group Dose (RNAi Agent) Dosing Route

[0234] Serum was collected on Day -7, 1, 8, 15, and 22. SEAP expression levels were determined pursuant to the procedure set forth in Example 3, above. Data from the experiment are shown in the following Table 14, with average SEAP reflecting the normalized average value of SEAP.

[0235] Table 14. Average SEAP normalized to pre-treatment and saline control in YFV-SEAP mice of Example 6. Day 8 Day 15 Day 22 Group ID Avg Std Avg Std Avg Std 4 4 6 5 7 0 7 4 6 5 3 5

[0236] Groups 2-12 showed reduction in SEAP-YFV at Day 8 and Day 15 compared to the saline control Group 1. Groups 2, 3, 5-7, and 9-12 showed reduction in SEAP-YFV at Day 22 compared to the saline control Group 1. More specifically, AD12729 achieved ~71% inhibition on Day 15. Example 7. In vivo administration of YFV RNAi agents in YFV-SEAP mice.

[0237] The YFV-SEAP model described in Example 3, above, was used. On Day 1, four (n=4) female C57bl / 6 albino mice were dosed with either isotonic saline or RNAi agents formulated in saline (at 3 mg / kg), via subcutaneous (SQ) injection, at 250 µL per 25 g (10 mL / kg) body weight injection volume. The dosing regimen is in accordance with Table 15 below.

[0238] Table 15. Dosing for mice of Example 7. Targeted Position of Grou Dose (RNAi A ent) Dosin Route1 Saline N / A Day 1 SQ Injection 2 3 mg / kg AD12729 2249 Day 1 SQ Injection, , , , . ed pursuant to the procedure set forth in Example 3, above. Data from the experiment are shown in the following Table 16, with average SEAP reflecting the normalized average value of SEAP.

[0240] Table 16. Average SEAP normalized to pre-treatment and saline control in YFV-SEAP mice of Example 7. Day 8 Day 15 Day 22 Avg Std Avg Std Avg Std 1 6 0 3 6 4 8 5 5 8 2 3

[0241] Groups 2-12 showed reduction in SEAP-YFV at all time points (Days 8, 15, and 22) compared to the saline control of Group 1. More specifically, AD12729 achieved ~76% inhibition on Day 15. Example 8. In vivo administration of YFV RNAi agents in YFV-SEAP mice.

[0242] The YFV-SEAP model described in Example 3, above, was used. On Day 1, six (n=6) female C57bl / 6 albino mice were dosed with saline, four (n=4) female C57bl / 6 albino mice were dosed with RNAi agents formulated in saline (at 3 mg / kg), via subcutaneous (SQ) injection, at 250 µL per 25 g (10 mL / kg) body weight injection volume. The dosing regimen is in accordance with Table 17 below.

[0243] Table 17. Dosing for mice of Example 8. Targeted Position of Group Dose (RNAi Agent) Dosing Route YFV (Se ID No 1)

[0244] Serum was collected on Day -7, 1, 8, 15, and 22. SEAP expression levels were determined pursuant to the procedure set forth in Example 3, above. Data from the experiment are shown in the following Table 18, with average SEAP reflecting the normalized average value of SEAP.

[0245] Table 18. Average SEAP normalized to pre-treatment and saline control in YFV-SEAP mice of Example 8. Day 8 Day 15 Day 221. Saline 1.000 0.183 1.000 0.274 1.000 0.216 2.3 mg / kg AD12739 0.751 0.337 0.907 0.617 1.146 0.985 1 3 2 3 4 6 2 5 4ne control Group 1. Groups 2, 4-6, and 8-12 showed reduction in SEAP-YFV at Day 15 compared to the saline control Group 1. Groups 4-6, 8-10, and 12 showed reduction in SEAP-YFV at Day 22 compared to the saline control Group 1. More specifically, AD14423 achieved ~60% inhibition on Day 15. Example 9. In vivo administration of YFV RNAi agents in YFV-SEAP mice.

[0247] The YFV-SEAP model described in Example 3, above, was used. On Day 1, six (n=6) female C57bl / 6 albino mice were dosed with saline, four (n=4) female C57bl / 6 albino mice were dosed with RNAi agents formulated in saline (at 3 mg / kg), via subcutaneous (SQ) injection, at 250 µL per 25 g (10 mL / kg) body weight injection volume. The dosing regimen is in accordance with Table 19 below.

[0248] Table 19. Dosing for mice of Example 9. Targeted Position of Group Dose (RNAi Agent) Dosing Route7 3 mg / kg AD14511 3001 Day 1 SQ Injection 8 3 mg / kg AD14512 3001 Day 1 SQ Injectionse strand from RISC-loading and thus prevent RNAi initiation, which served as a negative control.

[0250] Serum was collected on Day -7, 1, 8, 15, and 22. SEAP expression levels were determined pursuant to the procedure set forth in Example 3, above. Data from the experiment are shown in the following Table 20, with average SEAP reflecting the normalized average value of SEAP.

[0251] Table 20. Average SEAP normalized to pre-treatment and saline control in YFV-SEAP mice of Example 9. Day 8 Day 15 Day 22 ID Avg Std Avg Std Avg Std 1 6 0 3 6 4 8 5 5 8 2

[0252] Groups 2-12 showed reduction in SEAP-YFV at all time points (Days 8, 15, and 22) compared to the saline control Group 1. More specifically, AD12737 achieved ~76% inhibition on Day 15. Example 10. In vivo administration of YFV RNAi agents in YFV-SEAP mice.

[0253] The YFV-SEAP model described in Example 3, above, was used. On Day 1, eight (n=8) female C57bl / 6 albino mice were dosed with saline, four (n=4) female C57bl / 6 albino mice were dosed with RNAi agents formulated in saline (at 3 mg / kg), via subcutaneous (SQ) injection, at 250 µL per 25 g (10 mL / kg) body weight injection volume. The dosing regimen is in accordance with Table 21 below.

[0254] Table 21. Dosing for mice of Example 10. Targeted Position of Group Dose (RNAi Agent) Dosing Route YFV (Seq ID No.1)

[0255] RNAi agent AD14384 employed specific chemical modifications to block the antisense strand from RISC-loading and thus prevent RNAi initiation, which served as a negative control.

[0256] Serum was collected on Day -7, 1, 8, 15, and 22. SEAP expression levels were determined pursuant to the procedure set forth in Example 3, above. Data from the experiment are shown in the following Table 22, with average SEAP reflecting the normalized average value of SEAP.

[0257] Table 22. Average SEAP normalized to pre-treatment and saline control in YFV-SEAP mice of Example 10. Day 8 Day 15 Day 22 42. 3 mg / kg AD127290.344 0.046 0.286 0.027 0.235 0.0793. 3 mg / kg AD143841.050 0.148 1.143 0.151 1.220 0.224679908246, , 2) compared to the saline control Group 1. More specifically, AD14267 achieved ~96% inhibition on Day 22. Example 11. In vivo administration of YFV RNAi agents in YFV-SEAP mice.

[0259] The YFV-SEAP model described in Example 3, above, was used. On Day 1, eight (n=8) female C57bl / 6 albino mice were dosed with saline, four (n=4) female C57bl / 6 albino mice were dosed with RNAi agents formulated in saline (at 3 mg / kg), via subcutaneous (SQ) injection, at 250 µL per 25 g (10 mL / kg) body weight injection volume. The dosing regimen is in accordance with Table 23 below.

[0260] Table 23. Dosing for mice of Example 11. Targeted Position of Group Dose (RNAi Agent) Dosing Route8 3 mg / kg AD14507 3001 Day 1 SQ Injection 9 3 mg / kg AD14510 3001 Day 1 SQ Injectioned pursuant to the procedure set forth in Example 3, above. Data from the experiment are shown in the following Table 24, with average SEAP reflecting the normalized average value of SEAP.

[0262] Table 24. Average SEAP normalized to pre-treatment and saline control in YFV-SEAP mice of Example 11. Day 8 Day 15 Day 22 Grou ID Avg Std Avg Std Avg Std 253673216360

[0263] Groups 2-12 showed reduction in SEAP-YFV at Day 8 compared to the saline control Group 1. Groups 2-4 and 6-12 showed reduction in SEAP-YFV at Day 15 and Day 22 compared to the saline control Group 1. More specifically, AD14267 achieved ~89% inhibition on Day 22. Example 12. In vivo administration of YFV RNAi agents in hamsters prior to Yellow Fever Virus infection.

[0264] In vivo anti-viral activity of the YFV RNAi agents was also studied in Syrian golden hamsters (LVG / LAK). The test animal hamsters were first dosed with YFV RNAi agent (via subcutaneous SQ injection), Ribavarin (via intraperitoneal IP injection), or placebo (via oral PO administration), and subsequently infected with Yellow Fever Virus. On Day -4 (4 days prior to infection with Yellow Fever Virus), test animals (Groups 1-6) were administered a single dose of YFV RNAi agents. On Day 1, 4 hours before infection with Yellow Fever Virus, test animals (Groups 7-8) were administered a single dose of Ribavarin or placebo, and additionally administered 2 doses of Ribavarin or placebo per day every day for 7 days post viral infection. The dosing schedule is shown in the following Table 25.

[0265] The placebo test group hamster animals received PO administration placebo. The Yellow Fever Virus strain used was of Jiminez hamster-adapted strain V#2653. Viral dose was quantified in units of 50% cell culture infectious dose (CCID50). The YFV dose of 200 CCID50 per hamster (approximately 6x the LD50 in hamsters) was administered via bilateral IP injection of 0.1 mL.O W-sl0 apu5 o 57m0i r 13nG =35n=1n=35n=1n=3n=35 5n=1 5n=n=1n=nla i nononononono efmdefmnmnii i it i it i inia nidoinmtcadej ctec ctctc lOl atctnjejejejejasA InInInInInI rivPariPI ejnIeteyrlecQS QS QS QS QS QSer no a videyr nadQS tistr eleleleolelelfe ta rre opfe oitraep elmAg g g g g g bahts nininininini r tsi x beS S S S S S h ni2rrt:h si xn2g:niSrofT:4: : : : : 4-4-4-4-4-4-,1 md7-41, i71 m-:14eluay y y a y yd-y y y y a y A yDaDaDaDa a aOa aPa / adD D D P D D eID N D hcs denoV gteini gtF1s riasoY01f 00330933393 333933933 A / A A A3 N / N / N / N o T PoD.527e3739393585n8 oiril)bs 72727272343 be vaa# elci 1 1 1 1 141 calbiT putrD A D A D A D A D A D AP RorAgkgkgkg gkg gkg / k / e]6Gts6e / 2Tg / k kmg / / / / g g enimgmgmgmgm m mnil la0([60 0 aS. 6 6 6 6 6 5 5 S.1.2.3.4.5.6.7.8.901

[0267] RNAi agent AD14385 employed specific chemical modifications to block the antisense strand from RISC-loading and thus prevent RNAi initiation, which served as a negative control.

[0268] The hamster test animals were monitored for survival. Survival is determined based on animal mortality. The test animal survival rates are shown in Figure 1A. AD12737 and AD12739 achieved 100% survival out to 21 days post dose and YFV infection, showing improvement over ~50% survival of the test animals treated with saline and the RISC-blocked AD14385 at 21 days post dose and YFV infection, as well as improvement over the ~60% survival rate of the test animals treated with Ribavirin and YFV infection.

[0269] The hamster test animals were monitored for weight change. The individual animal weight was monitored and recorded for pre-infection and for 21 days post infection. The test animal weight changes are shown in Figure 1B. At 18 days post-virus infection, AD12737 and AD12739 both showed approximately +22-23% body weight change. This is an improvement compared to the test animals (infected with YFV) treated with the RISC-blocked AD14385 (~+5% body weight change), Ribavirin (~+17% body weight change), and saline (~+9% body weight change).

[0270] Serum was collected from the test animals and evaluated for alanine aminotransferase (ALT) via serum ALT assay. ALT levels were quantified via enzyme-linked immunosorbent assay (ELISA) (Teco Diagnostics, Anaheim CA) in accordance with manufacturer’s instructions. Test animal serum ALT levels are shown in Figure 1C. Test animals treated with AD12737 and AD12739 showed improved reduced ALT levels, indicating reduced liver damage compared to test animals treated with the RISC-blocked AD14385 and saline.

[0271] Liver samples were collected from 5 animals of each test group on Day 6 post infection, and evaluated for virus titration. Viral titer was determined via plaque forming assay unit (PFU) assay. Test animal viral titer is shown in Figure 1D. AD12737 achieved approximately 2 log10 less viral titer than the test animals (infected with YFV) dosed with saline; test animals dosed AD12737 and infected with YFV showed viral titer similar to that of test animals that were not infected with YFV. Example 13. In vivo administration of YFV RNAi agents in hamsters prior to Yellow Fever Virus infection.

[0272] In vivo anti-viral activity of the YFV RNAi agents was studied in Syrian golden hamsters (LVG / LAK). The test animal hamsters were first dosed with YFV RNAi agent (via subcutaneous SQ injection), Ribavarin (via intraperitoneal IP injection), or vehicle control, and subsequently infected with Yellow Fever Virus. On Day -4 (4 days prior to infection with Yellow Fever Virus), test animals (Groups 1-7, 9, and 10) were administered a single dose of YFV RNAi agents or vehicle control. On Day 14 hours before infection with Yellow Fever Virus via intraperitoneal IP injection, test animals (Group 8) were administered a single dose of Ribavarin, and additionally administered 2 doses of Ribavarin per day every day for 7 days after viral infection. The dosing schedule is shown in the following Table 26.

[0273] The Yellow Fever Virus strain used was of Jiminez hamster-adapted strain V#2653. Viral dose was quantified in units of 50% cell culture infectious dose (CCID50). The YFV dose of 200 CCID50 per hamster (approximately 6x the LD50 in hamsters) was administered via bilateral IP injection of 0.1 mL on Day 1.O W-sl0 apu5 o 0 0 0 0 0 0 0 0 0 07mi r 1=1=1=1=1=1=1 1 1 10nG= = = nn n=3 n n n n n n nmaex nEoilla ylif th ao ar c dsltasimnnon n n n nsioioioioioinuxoi ri 2n noinoiii tnmcta dej ctenj ctectectectec v oe VnnjnjnjnjnjFoiitt ttacrt ej cejtsA I I I I I InI Yartsi nInIetelcQS Q Q Q Q Q QersiniQQre iteS e S e S e S S SofnimSSts rm Algl l lelelel eangngngngngng b drmdaelelPg ghtsieSi:Si i i inih a I nini:S: S: S: S: S: 4P:7 S: SrofT4-4-4-4-4-4-4-,1 Ieel -14:-4- ly y y y y y y y g y yuaDaDaDaDa a a a nia ayadD D D DsD D D ehcs degt neoiV t F10398999102904A A Ani gsriasoYf 0333929203338 / 8N / N / N o T PoD.65 6 7 8 n2 )73229898909898irilelbs 7a# el2443 3 543 3valo orc1 10000 10000birt tnT piutorD AAD gAC gAC D C CR no oCg Ag Ag Ag Ag gkC / e la]r t k4Gs7e / k / k / k / k / k / k / g lcm 2Tg(mgmgmgmgmgmgm mi5h reoN0[6. 6 6 6 6 6 6 2 V.1.2.3.4.5.6.7.8.901

[0275] Serum ALT was quantified by alanine aminotransferase ALT assays. Serum was collected via ocular sinus bleed on Day 6 post viral infection. ALT (SPGT) reagent (Teco Diagnostics, Anaheim, CA) was used in a protocol altered for use in 96-well plates. Briefly, 50 µl aminotransferase substrate was placed in each well of a 96-well plate, and 15 µl of sample was added at timed intervals which were also used for each of the following steps. The samples were incubated at 37˚C for 30 minutes, after which 50 µl color reagent was added to each sample and incubated for 10 minutes as above. A volume of 200 µl of color developer was then added to each well and incubated for 5 minutes. The absorbance of each well at 505 nm was determined with a spectrophotometer and alanine aminotransferase concentrations in IU / L were determined per manufacturer’s instructions.

[0276] Hamsters were monitored for mortality twice daily from 4 days prior to virus challenge to 21 days post viral infection. Individual weights were recorded 4 days prior to virus challenge and daily from 0 to 21 post viral infection. Serum was collected on 4 and 6 dpi for analysis of virus titer and ALT, respectively.

[0277] Survival data were analyzed using the Wilcoxon log-rank survival analysis and all other statistical analyses were completed using one-way ANOVA using a Dunnett multiple comparison (Prism 9.5.1, GraphPad Software, Inc). The results from the aforementioned procedures are shown in the following Table 27.O W-045. *75 *1* 60d.5.. *7*03..7 7.2 ** 2.*36*07.3T5L± 31621± 211 8 .± ±81 3A41.6± ±3. ±3.2. ±±9±1 0.4.740 6. 0 70..27.148 9 1972151776118 .syca1i0. 132*2. 3*28585. 6* * a*2. 6344* d. 7.*0yrom 2.e1 1.2.1 1 2.1 2 0. dut fri±0 ± ±0 ± ± ± ± ± ± 0 ssyliV0. 747.52. 731. 0883.62. 520 59±ia3.5 8.2.476h.t d- 1niehcbtiweiwtgna * * * * * ** 2**e g*g niuhc D.S1.* *t73.6. 4.*39.*1. .6 0.63.5 *n8. anhitnw±±2 3 2±7 ±±19 ±01±9.± ±92c.± t o0 - gc(-. 6-8-. dn2D e M laegpm ±i)lnelmaxDS***** * * * * * * xlam / aEf±0.0 0*.0 0*.0 0*.0*.0. *0*.0. 4.*0.m 05 hcsoa0 0 0s D±l 0 ±0 ±0 ± 0 010 g0 ±0 ±0 ± ±0±±nDiI utCriva D.1. . . . .021 1 1 1 1.0.13.80.1 neCs( .rDot 61miM n >2>2>2>2>2>1 2>2>er etS r1ape it otr s± ir.tsleattroett / 0 euse 10 / 1010 000000grLni / pvUIsrnuem v0 / 10 / 110 / 110 / 110 / 1011 / 19 / 011 / 13 / 0 e1llnaaneaoehta4erm ilahAhcmm se egt rni elcno suu st riVF VF VF VF VrrF VF VF VF VF- iav s aes neniiheY Y Y Y Y - -t ulul gevneV Y Y Y Ys b otg oapaVaV. di tAn.eg sey. . p.i ean n l rdoioiampN mn d d d b t tm Rta oit 4-4-4d-4d-4d-4d-4-,d / 7 c cdefef1.0 ocVeFrt a,iti ,g, , , , , ,g n nkg g g g g gk / a intit de saYf es ni / koo g / kg / kg / kg / kg / kg / g ged4 4n soso vie 50tcD m e6m 6 m 6 m 6 m 6 m 6 mmh - 6054- ,- - - -op pthsys c.y er 0< ff giadadslP Ea*.7 72t325 6 7 8 neiw4 6dm,i10729489 938309 958383riv l lo .hndeetetna .0l2 4 0 0 4 0 0a ort tae c cd< enbe 1 1 0 0 1 0b rtnewelel ePa m TtD aAD A C A C A D A C0A CiAR no oCdfte lbolcotcae*r*,erg gkgkgkgkg g gkC / ella oy ec sasat-n10]T / g / g / g / kg / kg / kg / g gmanw wi 0.mci8m h ro derri 0726 m6 m6 m6 m6 m6 m652e neV N.ae fmfi umruvra< bP0 . . . . . . . . . 0[1 2 3 4 5 6 7 8 9 1 aMbDe ecSdSi *eR**

[0279] Prophylactic administration of all siRNAs evaluated in this study resulted in significant improvement in survival as compared with vehicle treatment. No mortality was observed in animals treated with AD12737, AD14422, AC003895, AC003896, AD14509, or AC003897 as compared with 70% mortality in vehicle-treated animals. 90% of animals treated with AC003898 survived infection. Ribavirin was used as a positive control and significantly improved survival as compared with vehicle (Figure 2A, Table 27).

[0280] Animals receiving AD12737, AD14422, AC003895, AC003896, or AC003897 demonstrated consistent average weight gain similar to that of uninfected control animals, with the exception of a small amount of weight loss around 4 days post infection which was resolved by 7 days post infection (Figure 2B). Animals treated with AD14509 demonstrated similar average weight gain until approximately 12 days post infection, after which weight gain in these animals slowed and diverged from the other groups (Figure 2B). Average weight change of animals in the group treated with AC003898 were similar to that of vehicle-treated infected animals, with precipitous weigh loss beginning 4 days post infection and continuing until animals began slowly gaining weight about 8 days post infection. Significant improvements in weight change between 4 and 7 dpi, representing peak weight loss in the vehicle control group, was observed in animals receiving AD12737, AD14422, AC003895, AC003896, AD14509, and AC003897 as compared with vehicle (Table 27). Ribavirin-treated animals also demonstrated significantly improved weight change between 4 and 7 days post infection as compared with vehicle-treated animals followed by weight gain for the remainder of the study (Figure 2B, Table 27).

[0281] Serum was collected 4 days post infection for measurement of virus titer. Serum viremia in animals treated with AD14422, AD14509 or ribavirin was significantly reduced as compared with vehicle (Table 27).

[0282] Serum was also collected 6 days post infection for measurement of alanine aminotransferase (ALT) concentrations as a measure of liver damage due to YFV infection. ALT concentrations in animals receiving AD14422, AC003895, AD14509, or Ribavirin were significantly decreased as compared with vehicle (Table 27). Overall, it appears as though AD14422, AC003895, AC003896, AD14509 and AC003897 reduce liver damage during YFV infection, which is consistent with improved survival and mean weight change after administration of these siRNAs in the study. Example 14. In vivo administration of YFV RNAi agents in YFV-SEAP mice.

[0283] The YFV-SEAP model described in Example 3, above, was used. On Day 1, eight (n=8) female C57 albino mice were dosed with saline, four (n=4) female C57 albino mice were dosed with RNAi agents formulated in saline (at 3 mg / kg), via subcutaneous (SQ) injection, at 250 µL per 25 g (10 mL / kg) body weight injection volume. The dosing regimen is in accordance with Table 28 below.

[0284] Table 28. Dosing for mice of Example 14. Group Dose (RNAi Agent) Dosing Route 1 Saline Day 1 SQ Injection

[0285] Serum was collected on Day -7, 1, 8, 15, and 22. SEAP expression levels were determined pursuant to the procedure set forth in Example 3, above. Data from the experiment are shown in the following Table 29, with average SEAP reflecting the normalized average value of SEAP.

[0286] Table 29. Average SEAP normalized to pre-treatment and saline control in YFV-SEAP mice of Example 14. Day 8 Day 15 Day 22 A t A t A t 34955. 3 mg / kg AD145090.272 0.075 0.260 0.136 0.267 0.1556. 3 mg / kg AC0038970.383 0.157 0.343 0.171 0.439 0.24542144ne control Group 1. More specifically, AC003900 achieved ~90% inhibition on Day 22. Example 15. In vivo administration of YFV RNAi agents in YFV-SEAP mice.

[0288] The YFV-SEAP model described in Example 3, above, was used. On Day 1, eight (n=8) female C57 albino mice were dosed with saline, four (n=4) female C57 albino mice were dosed with RNAi agents formulated in saline (at 3 mg / kg), via subcutaneous (SQ) injection, at 250 µL per 25 g (10 mL / kg) body weight injection volume. The dosing regimen is in accordance with Table 30 below.

[0289] Table 30. Dosing for mice of Example 15. Group Dose (RNAi Agent) Dosing Route

[0290] Serum was collected on Day -7, 1, 8, 15, and 22. SEAP expression levels were determined pursuant to the procedure set forth in Example 3, above. Data from the experiment are shown in the following Table 31, with average SEAP reflecting the normalized average value of SEAP.

[0291] Table 31. Average SEAP normalized to pre-treatment and saline control in YFV-SEAP mice of Example 15. Day 8 Day 15 Day 22 Group ID Avg Std Avg Std Avg Std 81668827394

[0292] Groups 2-11 showed reduction in SEAP-YFV at Day 8, 15, and 22 compared to the saline control Group 1. More specifically, AC003905 achieved ~92% inhibition on Day 22. Example 16. In vivo administration of YFV RNAi agents in YFV-SEAP mice.

[0293] The YFV-SEAP model described in Example 3, above, was used. On Day 1, four (n=4) female C57 albino mice were dosed with saline, four (n=4) female C57 albino mice were dosed with RNAi agents formulated in saline (at 3 mg / kg), via subcutaneous (SQ) injection, at 250 µL per 25 g (10 mL / kg) body weight injection volume. The dosing regimen is in accordance with Table 32 below.

[0294] Table 32. Dosing for mice of Example 16. Group Dose (RNAi Agent) Dosing Route2 3 mg / kg AD12737 Day 1 SQ Injection 3 3 mg / kg AD14509 Day 1 SQ Injection, , , , . ession levels were determined pursuant to the procedure set forth in Example 3, above. Data from the experiment are shown in the following Table 33, with average SEAP reflecting the normalized average value of SEAP.

[0296] Table 33. Average SEAP normalized to pre-treatment and saline control in YFV-SEAP mice of Example 16. Day 8 Day 15 Day 22 Avg Std Avg Std Avg Std 303106459931

[0297] Groups 2-12 showed reduction in SEAP-YFV at Day 8, 15, and 22 compared to the saline control Group 1. More specifically, AC003901 achieved ~93% inhibition on Day 22. Example 17. In vivo administration of YFV RNAi agents in hamsters prior to Yellow Fever Virus infection.

[0298] In vivo anti-viral activity of the YFV RNAi agents was also studied in Syrian golden hamsters (LVG / LAK). The test animal hamsters were first dosed with YFV RNAi agent (via subcutaneous SQ injection) or saline, and subsequently infected with Yellow Fever Virus. On Day -28 or Day -14 (28 or 14 days prior to infection with Yellow Fever Virus), test animals were administered a single dose of YFV RNAi agents (Groups 1-8) or saline (Groups 9-10). On Day 1, test animals (Groups 1-9) were administered a single dose of YFV virus (via intraperitoneal IP injection); Group 10 was not administered YFV virus. The dosing schedule is shown in the following Table 34.

[0299] The Yellow Fever Virus strain used was of Jiminez hamster-adapted strain V#2653. Viral dose was quantified in units of 50% cell culture infectious dose (CCID50). The YFV dose of 200 CCID50 per hamster (approximately 6x the LD50 in hamsters) was administered via bilateral IP injection of 0.1 mL.OsWlp-au0o5 mi r010 0 0 0 0 0 0 0 0=1=1=1=1=1=1 1 1 170n G3Ar n n n n n n=n=n=n=na00000000000000000r 2 2 2 2 2 2 20 o. i2 27V N VF VF VF V V V VF V V 1 F F F F F elY Y Y Y Y Y Y Y Y p3m2a1xEfon solinton nit on n n n n nc it oit oit oit oit oit oit oita amrececececececececenitjnsainnjInjInjInjInjInj j jInInInIoitcti esQ e m S QS QS QS QS QS QS QS QSjt dele nle e e e e e eIreAtseglnglglglglglglglgQ ininininininininiS mcait Shr :S8:S8:S8:S8:S S S Sel4:4:4:4:4gnrA2 io t-2-2-2-1-1-1-1-1-y y y y y yS fsa a a a ay y yeeD D D Da a a aluT D D D D D dehcsgn) )i” ”sssol loorD ) rt tn.sno o4el 2591 5 1 C3 # ci298 00922989009 C lelptbu aor 4rA43 5t 10D043 4C10D043 5 3el aC10D04100cim hroT GseA A A A AC A D A C AeV N“T g g g g g g g g “(]( k0 / kg / k / k / k / k / k / k (e en03mgmgmgmgmgmg / mgnmililaaS0[6. 6 6 6 6 6 6 6 S.1.2.3.4.5.6.7.8.901

[0301] Serum ALT was quantified by alanine aminotransferase ALT assays. Serum was collected via ocular sinus bleed on Day 6 post viral infection. ALT (SPGT) reagent (Teco Diagnostics, Anaheim, CA) was used in a protocol altered for use in 96-well plates. Briefly, 50 µl aminotransferase substrate was placed in each well of a 96-well plate, and 15 µl of sample was added at timed intervals which were also used for each of the following steps. The samples were incubated at 37˚C for 30 minutes, after which 50 µl color reagent was added to each sample and incubated for 10 minutes as above. A volume of 200 µl of color developer was then added to each well and incubated for 5 minutes. The absorbance of each well at 505 nm was determined with a spectrophotometer and alanine aminotransferase concentrations in IU / L were determined per manufacturer’s instructions.

[0302] Serum was collected via ocular sinus bleed 4 days post-infection (dpi). Virus titer was quantified by infectious cell culture assay where 50 µl serum was added to the first tube of a series of dilution tubes. Serial log10 dilutions were prepared and added to Vero 76 cells in 96-well plates. Ten days later, cytopathic effect (CPE) was used to identify the endpoint of infection. Four replicates were used to calculate the 50% cell culture infectious dose (CCID50) per ml of serum.

[0303] Hamsters were monitored for mortality twice daily from 4 days prior to virus challenge to 21 days post viral infection. Individual weights were recorded 4 days prior to virus challenge and daily from 0 to 21 post viral infection. Serum was collected on 6 days post infection for analysis of virus titer and ALT, respectively.

[0304] Survival data were analyzed using the Wilcoxon log-rank survival analysis and all other statistical analyses were completed using one-way ANOVA using a Dunnett multiple comparison (Prism 9.5.1, GraphPad Software, Inc).

[0305] The results from the aforementioned procedures are shown in the following Table 35.er*i** *** * * *Oet- t**55 *2 5 ** *9*** 8**W0s7 .4.* * * 3.*5ur0i4.0 4±.0 04±0.1.122. 73.00±0.73v 1re± 0 ± 0 1 ± 1 1 3 008. 09 8. ± ± ±4 3902. ±vi 2 5.44 5 1.24 076 776L. . .3.2.1** ***** 1 *** *8. 62 ** . * * * 8 .*6. *d 2 8 * 0 * 2 0 .84*T.L03 8±.9 .01.8±2 81.±± 2 .A1± 4.± 1± ±4±. 8.3. 5. 1 yd4.7092.5.5. 90 7938±1 8 uts7879757 1 9 1 .37siht* * * * nc*a************ * ***** * ihi*4* *** * * ***09. ** tiw me7r. 09.56 29. 90804356 000ei0 0 .00.0.1.0.0 ±.00 gnV± ± ± ± ± ± ± ±11. 934.0. 42. 96. 14. 67. 780. ± ah.376. c.2 2 2 2 1 2 1 2 1 thD g.71.t * * * ** i Se±b* * * *********3 ** w )lelwepnagDnS ***a ± 6. **6 0. ** * * * *.80. *53. *46. *36. *2. *5 4 *l.am±5. / 02 mi 5maeh)xMcg3 3 2( ± ± ± ± ± ± ± ± 0. ± xaDI.tE5.f8 3.5 6.6 2.5 3.5 6.5 4.1 8 1.92-1.0 mCng C( em o1 nsilt raD********** *****n ettei ast . esDrt52mi S± 0.* 000..00.00.00.0 *00.04.10.0er urS ei ±lci 1natasD±0.± ± ± ±0±0±±per v)lhe. ±0.0.0.0. ±040e na m vetD reM102.81 1 1 10..1 .9 .1 ge / 0 ot>2>2>2>2>9 2>2 n>e5 tlm sl Ddma erICera / hael 0 .a1 00101000000 c seDC( phnvilatoo / 01 / / / 1 / 1 / 11 / 11 / s90 0 0 0 / 0 / 0 ur ul Srem tocsAt 1 1 1 1 1 9 1 3 1itv a-V ±L it sne stg uV V V V V so.)n / Usura5a ri FYFYFYFYFVYFVYFV V - po IiYFYFY -s it nav 0n.0iVyA N Rtn 8e28 8 8 4 a cdefenmae<P*-2-2-2-14-14-14-1-9it erm,1VFmtnaoyayayayaydsayayayana o a erps 0.eitD D D D D D D D ea 0f- -2sulse< Yrotai , , , , , , , , - - n yaa ul P*t,cetiges ni kg / kg / kg / kg / kg / kg g / k / k / ot d( V. aV*,fo g g g g g g g gfD m m m m m m m mhgipip .i10E6 6 6 6 6 6 6 6ied dpd0..w4 65) . ndede60< tdP 3”)el shl ”s ta eetceceetc**bolatTn rored wt llloloell *,e tm5 ntn foebcs cso1c00t2 9 910 259 910 o o y ea2 8 0 9 2 8 0 9 CeC ca as0lad nw wa.0]e6r 443 50 T10043 410043 510 4310eenlcinila nere mm wr<P 3 D0 0 il hamr a0[AC .AD A C D C D Ca eSe ffurure. o i e evi***1. A A A A A SV N 2.3.4.5.6.7.8.9“(01“( aMbDcSdSeL*

[0307] All of the tested RNAi agents provided significant protection when administered via a single treatment 28 or 14 days prior to virus challenge (Figure 3A, Table 35). One animal each succumbed to virus challenge on 8 or 9 dpi in groups treated with AC003895 at Day -28 or with AD14509 at Day -14 prior to virus challenge, respectively. The virus infected, placebo- treated control group had a 70% mortality rate (Figure 3A, Table 35). This shows the administered YFV RNAi agents are protective after prophylactic treatment with a single dose administered up to 28 days prior to virus challenge.

[0308] Animals tended to gain weight consistently after virus challenge (Figure 3B). There was a slight weight loss between day 6 and 8 in animals treated with AC003895 or AD14509 administered 28 days prior to virus challenge, with a subsequent rebound thereafter. Virus infected, saline-treated animals tended to have a loss in average weight beginning 6 dpi and continuing through 11 dpi, after which a rebound was observed in surviving animals (Figure 3B). Weight change in all other treatment groups was similar to that of normal control animals. This is reflected in the significant improvement (P<0.0001) in weights between 2 and 9 dpi of animals treated with all of the YFV RNAi agents as compared with placebo treatment (Figure 3C).

[0309] Serum viremia on 4 dpi was also significantly reduced in all treatment groups as compared with saline-treated controls (Figure 3D). Serum viremia in animals treated with AD14422 and AD14509 administered 14 days prior to virus challenge was reduced to baseline in all but one animal, while other groups had a few to several animals that had detectable titers (Figure 3D, Table 35). Viral titers in liver samples collected 6 dpi was significantly reduced in all treatment groups, except for those treated with AC003895 or AC003901 administered 28 days prior to virus challenge (Figure 3E, Table 35). There was, however, a trend towards reduced liver titers (>1 Log10 reduction) associated with all treatment groups (Table 35).

[0310] There was a trend towards reduced serum ALT in all treatment groups (Figure 3F). Significant reduction, with values at baseline, was observed in animals treated with AD14422, AD14509 or AC003901 administered 28 days prior, or in AD14422 and AC003901 administered 14 days prior (Figure 3F, Table 35). The most consistent reductions were observed in animals treated with AD14422 and AC003901 with significant reductions in ALT at either treatment timepoint.

[0311] Prophylactic treatment with YFV RNAi agents appear to offer protective effects in the aforementioned disease parameters.Example 18. In vivo administration of YFV RNAi agents in hamsters subsequent to Yellow Fever Virus infection.

[0312] In vivo anti-viral activity of the YFV RNAi agents was also studied in Syrian golden hamsters (LVG / LAK). On Day 1, test animals (Groups 1-8) were administered a single dose of YFV virus (via intraperitoneal IP injection); Group 9 was not administered YFV virus. Twenty-four (24) hours after the YFV virus infection challenge, the test animal hamsters were dosed with YFV RNAi agent (via subcutaneous SQ injection) or saline; test animals were administered a single dose of YFV RNAi agents (Groups 1-7) or saline (Groups 8-9). The dosing schedule is shown in the following Table 36.

[0313] The Yellow Fever Virus strain used was of Jiminez hamster-adapted strain V#2653. Viral dose was quantified in units of 50% cell culture infectious dose (CCID50). The YFV dose of 200 CCID50 per hamster (approximately 6x the LD50 in hamsters) was administered via bilateral IP injection of 0.1 mL.OslWap-0m5i reuo 010 0 0 0 0 0 07np r=1=1=1=1=1=1=1=2=0An n n n n n n n n#G3.n8onion n n n n nioioio o o o1 tctctctc itc itc itc iteleje e e e e ecep njnj j j j j jnI InInInInInInI8m2a oitQS QS QS QS QS QS QS QS1xEa efrots lelelelelelelel nsi gngngngng g g g oitlani iSiSiSininininicem m:i de:S S S S Se: : : : : :jnn ge e e e e e Ia A ngtese l ng g g g g gel neneneneneneQS eltclirt alha llllllllllllhahahahahahah elge rc c c c c c c ctsAtV V V V Vnis F Y F Y F Y F V V V S Y F F F F ma eh TtrstooststsYt Yt Yt Ytfporporposr pos s sr porporporpelh h h h h h hrhud4 4 4 4 4 4 4 4e2 2 2 2 2 2 2 2hcsg )ni”)ssl ”so olrt orD ).sel 2132 nt3 7 9395ono63 # cilt 243 3 370 999 Ce Clepur45050 2544040lcbi aaorA Gt 1s D0A C0A C1D1D0C0Chm eroTeA A A A AV T(gkg “N“ / kgkgkgkgkgk (]g / g / g / g / g / g / g e (4nei1m m m m m m m l nil30 6 6 6 6 6 6 6aSaS[.1.2.3.4.5.6.7.8.9

[0315] Serum ALT was quantified by alanine aminotransferase ALT assays. Serum was collected via ocular sinus bleed on Day 6 post viral infection. ALT (SPGT) reagent (Teco Diagnostics, Anaheim, CA) was used in a protocol altered for use in 96-well plates. Briefly, 50 µl aminotransferase substrate was placed in each well of a 96-well plate, and 15 µl of sample was added at timed intervals which were also used for each of the following steps. The samples were incubated at 37˚C for 30 minutes, after which 50 µl color reagent was added to each sample and incubated for 10 minutes as above. A volume of 200 µl of color developer was then added to each well and incubated for 5 minutes. The absorbance of each well at 505 nm was determined with a spectrophotometer and alanine aminotransferase concentrations in IU / L were determined per manufacturer’s instructions.

[0316] Serum was collected via ocular sinus bleed 4 days post-infection (dpi). Serum Virus titer was quantified by infectious cell culture assay where 50 µl serum was added to the first tube of a series of dilution tubes. Serial log10 dilutions were prepared and added to Vero 76 cells in 96-well plates. Ten days later, cytopathic effect (CPE) was used to identify the endpoint of infection. Four replicates were used to calculate the 50% cell culture infectious dose (CCID50) per ml of serum.

[0317] Hamsters were monitored for mortality twice daily from 4 days prior to virus challenge to 21 days post viral infection. Individual weights were recorded 4 days prior to virus challenge and daily from 0 to 21 post viral infection. Serum was collected on 6 days post infection for analysis of virus titer and ALT, respectively.

[0318] Survival data were analyzed using the Wilcoxon log-rank survival analysis and all other statistical analyses were completed using one-way ANOVA using a Dunnett multiple comparison (Prism 9.5.1, GraphPad Software, Inc).

[0319] The results from the aforementioned procedures are shown in the following Table 37.

[0320] O W- ** *05e **** * *4***54* 6 6 070 a3 i 38 2. 00.2 *050.1 8.31.1osMh 9lc - .4- -5-6-.23- -.5 t . . eraneDSt De03msier ± Sl)± ci 1naD* * * *ptsS **±7. 0.**7.5. 0. *0. *7*. 2e. 0. r l)lheem / 0 m / vet a 00±0 1±0 0± ± 57±0± gn 505otretD±sD5. 0. ±5 20 ±.0.090.elD91 .6.61 1.2 .71 lIaCDI deCCramaM2 2 2 1 2hc ( .Cph > > > >s reD(rm nur titS± etoco / te 0 00 0iv sit ssn villat 1 / 88 / 8 10 / 11 / 1 / 9 8 / 60 0 / 371 / 2 / 2-ts urLi / Usaur5egAot 1 1 4 o v Ii0.a pis sV V V V V Vy naaneave n 0a <P AurF F V V -dmme*NiF F F F F F - R V Y Y Y Y Y Y Y Y7 ererm,1Vdna a e 0Ftna sesra.0ueu se< Yf e h4h4h4h4h4h4h44omnlala ul P*t t noc ae it2a+2,+2,+2,+2,+2 2,+,+,o V Va*- -t,h.i.i V. 1ef rf t, itg g g g g g g- - gEe ink / kg / k / k / k / k / k / ipedpd i4 6p0d0.0.s7o i g g g g g gm m m m m m m.w 3 D6 6 6 6 6 6 6het nd d 6<P la eee etewctel cdeelt **lce *ba tdfte lo o ll,1Tne 21323 7 93959 o becs csoc00m2t4345305307025944904e0llc]a i sla yca as0.msl ad ne w waw0< 1e12rD0C0C1D1D0C0Chor rorn re mmrP 3 TAe t.A. A. A. A. A. A. V. no toN. noae ffi uruereevi**0[ 1 2 3 4 5 6 7 8C9CaMbDcSdSeL** .

[0322] Complete survival was observed after treatment with AC005331, AD14509 and AC004993 (Figure 4A, Table 37). Two animals succumbed to disease in groups treated with AD14422, AC005332, or AC004995 (Figure 4A, Table 37). AD12737 treated animals showed 60% survival rate (Figure 4A, Table 37). Saline-treated, infected controls had a 30% survival rate.

[0323] Weight loss between 4 and 7 dpi is shown in Figure 4B. Weight loss between days 4 and 7 post infection is shown in Figure 4C and Table 37. AC004993 showed improved weight change in comparison with vehicle controls.

[0324] Viremia was assessed from serum collected on 4 dpi. Significant reduction was observed in animals treated with AC004993 (Figure 4D, Table 37). Liver samples taken 6 dpi were titered for virus. Significant reduction of liver virus titer was observed in all treatment groups, except for those treated with AC004993 and AD12737, though AC004993 and AD12737 still showed ~2 log10 reduction in virus titer compared to vehicle controls (Figure 4E, Table 37).

[0325] Serum collected on 6 dpi was analyzed for ALT. A trend towards reduction was seen in animals treated with AC004993 (Figure 4F, Table 37), which is consistent with the serum viremia, survival, and trend towards improved weights.

[0326] Following YFV infection of hamster animals, treatment with YFV RNAi agents appeared to be effective in reducing most disease parameters, either statistically or a strong trend towards reduction. Example 19. In vivo administration of YFV RNAi agents in hamsters subsequent to Yellow Fever Virus infection.

[0327] In vivo anti-viral activity of the YFV RNAi agents was also studied in Syrian golden hamsters (LVG / LAK). On Day 1, test animals (Groups 1-9) were administered a single dose of YFV virus (via intraperitoneal IP injection); Group 10 was not administered YFV virus. Four (4) or twenty-four (24) hours after the YFV virus infection challenge, the test animal hamsters were dosed with YFV RNAi agent (via subcutaneous SQ injection) or saline; test animals were administered a single dose of YFV RNAi agents (Groups 1-8) or saline (Groups 9-10). The dosing schedule is shown in the following Table 38.

[0328] The Yellow Fever Virus strain used was of Jiminez hamster-adapted strain V#2653. Viral dose was quantified in units of 50% cell culture infectious dose (CCID50). The YFV doseof 200 CCID50 per hamster (approximately 6x the LD50 in hamsters) was administered via bilateral IP injection of 0.1 mL.OslWap- mr u0 0 0 0 0 0 0 0 0 00 ie o1=1=1=1=1=1=1 1 1 157n0Ap r n n n n n n=n=n=n=n#G3.9o1it oio o o oioioi itectlepj c ititit tectctc cnj cej cece ejejejejInj jInIn n nInInInI3m nI Ia oiQ Q Q Q Q QS QS Q Q3S1xtEfaS ortsseS leS e S e Se eS eelngl l lel lglglg goi lianingingngngn nSiSiSiSiSinSinSinSiSt:cei: : : : : : :e jm m n de:aAgegegegegege engngng nnIQ tnseel el nlel nlel nlel nlelelll ell elellltc a Serit a a a a a ahahah hclgetr h h h h hc c cs Ac c c c cVnit VF VF VF VF V VF VF VF FSmasheYrTtYF stYtYtYtYt Yt Y Yttsosos s ssososooof pelr po o orp p ppr pr prpsuh hrhrhrhhd4 h4 hy4ade4 4 4 4 4 2 2 2h 4cs )g )ni” ”slssloorortD)t.sn noo8C3 # elcelpiC lab utrelcm aoirr A T GthseT25 6 1 1e o(2940989809229009V N ““(45430303 44543 (e en]9 12 D1D00C0 0 1 100nilila30 AC C D D CaS[. A A A A A A A S.1.2.3.4.5.6.7.8.901

[0330] Serum ALT was quantified by alanine aminotransferase ALT assays. Serum was collected via ocular sinus bleed on Day 6 post viral infection. ALT (SPGT) reagent (Teco Diagnostics, Anaheim, CA) was used in a protocol altered for use in 96-well plates. Briefly, 50 µl aminotransferase substrate was placed in each well of a 96-well plate, and 15 µl of sample was added at timed intervals which were also used for each of the following steps. The samples were incubated at 37˚C for 30 minutes, after which 50 µl color reagent was added to each sample and incubated for 10 minutes as above. A volume of 200 µl of color developer was then added to each well and incubated for 5 minutes. The absorbance of each well at 505 nm was determined with a spectrophotometer and alanine aminotransferase concentrations in IU / L were determined per manufacturer’s instructions.

[0331] Serum was collected via ocular sinus bleed 4 days post-infection (dpi). Serum Virus titer was quantified by infectious cell culture assay where 50 µl serum was added to the first tube of a series of dilution tubes. Serial log10 dilutions were prepared and added to Vero 76 cells in 96-well plates. Ten days later, cytopathic effect (CPE) was used to identify the endpoint of infection. Four replicates were used to calculate the 50% cell culture infectious dose (CCID50) per ml of serum.

[0332] Hamsters were monitored for mortality twice daily from 4 days prior to virus challenge to 21 days post viral infection. Individual weights were recorded 4 days prior to virus challenge and daily from 0 to 21 post viral infection. Serum was collected on 6 days post infection for analysis of virus titer and ALT, respectively.

[0333] Survival data were analyzed using the Wilcoxon log-rank survival analysis and all other statistical analyses were completed using one-way ANOVA using a Dunnett multiple comparison (Prism 9.5.1, GraphPad Software, Inc).

[0334] The results from the aforementioned procedures are shown in the following Table 39.

[0335] O W-00 d0*412 3**4341812 *1**5 T1 8 1 7 4 1 1 1 1± ± ±4± ± ±3.7 L ± ±3 02 05±2 81 4 450A59 1494 6 3 ±xEl mfaoto 0 0 000gnst i.l / ae 1 / 1vi 0 / 010101 / 118 / 9 / 10 / 01011 / 8011t8 / 8 / 2 / 0 n1esDS53mil enArp±)1ael. trsetsV V V V Vemg / 0t5neruerF F F F F VF VF VF VF -- nD mtisV Y Y Y Y Y Y Y Y YellI tmaCaerahcC( .t htnns reDeltS cio e h hhusmnh h h h h 4 4 4ri it± hettnaeeoit4+4 4 4 4 2 2 2 v,+,+,+,+,+,+,+,-t ssurLi / vogrtaa, itigkg g g g g g goi es ni / kg / kg / kg / kg / kg / kg / kg / gd4pvUI tsy nan deAom m m m m m m m+eae raD6 6 6 ,- - admmpN6 6 6 6 6 - - e em R7Vdr r ona a cFa s s s4eueuaYfo) )”nlala50.t”cslsloortV V0h.i.i< efofEtrt tnn ngoip pP ed d *4 6,.e oCw 93mC lta . nded 1e eaelt0.0le c hi mrta eetcecel<PbraThe o ewll l*T229596910 2 910V Ndt“eo o*(fo bc c ,14058 8 9 2 0 9 “( e y ec sasa04 4303030445430enianw w0.]1 1 0 0 0 1 1 0ni6Dl la dnere mm0< 33AD C C C D D CaS.ae ffurur P0 . A. A. A. A. A. A. A. S. 0i e e *[ 1 2 3 4 5 6 7 8 9 1 aMbDcSdS**

[0337] All of the YFV RNAi agents significantly (P<0.01) improved survival regardless of the time of treatment initiation (Figure 5A, Table 39). Some mortality was observed in groups treated with AC003895 or AC003896 when administered 4 h post, or with AD14509 when administered 24 h post. Vehicle-treated infection controls had an 80% mortality rate.

[0338] In general, animals treated with the YFV RNAi agents gained weight over time, aside from some average weight loss between 4 and 7 days, except for in the group treated with AC003901 beginning 4 h after virus challenge (Figure 5B). More pronounced weight loss was observed in the AD14422 (24 h) and AC003895 (+4h) groups, which occurred after 4 days post-virus inoculation (dpi) (Figure 5B). No significant differences in weight change between 4 and 7 dpi were observed with any treatment groups as compared with vehicle (Figure 5C, Table 39). Normal control animals had a significant (P<0.01) improvement in weight gain during this time (Figure 5C).

[0339] Viremia titers of serum collected 4 dpi were significant reduced in groups of hamsters treated with AD14509 (+4 h), AC003901 (+4 h), and AD14509 (+24 h), suggesting treatment with AD14509 was effective at reducing virus even when administered as late as 24 h after virus challenge (Figure 5D). No virus was observed in the serum of normal control animals. No significant differences in virus titer of liver samples collected 6 dpi were observed (Figure 5E).

[0340] Serum ALT evaluated from samples collected on 6 dpi were significantly reduced in groups treated with AD14509 (+4 h) and AC003901 (+4 h) (Figure 5F), which confirmed the protection observed with viremia. No elevation in ALT was observed in normal control animals. OTHER EMBODIMENTS

[0341] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

1. CLAIMS:

1. An RNAi agent for inhibiting expression of a Yellow Fever Virus (YFV) viral genome, comprising: an antisense strand comprising a nucleotide sequence of at least 15 contiguous nucleotides differing by 0 or 1 nucleotides from 15 contiguous nucleotides of any one of the antisense strand sequences of Table 2, Table 3, or Table 6D; and a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand.

2. The RNAi agent of Claim 1, wherein the antisense strand comprises nucleotides 2-18 of any one of the sequences provided in Table 2, Table 3, or Table 6D.

3. The RNAi agent of Claim 1 or Claim 2, wherein the sense strand comprises a nucleotide sequence of at least 15 contiguous nucleotides differing by 0 or 1 nucleotides from 15 contiguous nucleotides of any one of the sense strand sequences of Table 2, Table 4, Table 5, or Table 6D, and wherein the sense strand has a region of at least 85% complementarity over at least 15 contiguous nucleotides to the antisense strand.

4. The RNAi agent of any one of Claims 1-3, wherein at least one nucleotide of the RNAi agent includes a modified internucleoside linkage.

5. The RNAi agent of any one of Claims 1-4, wherein all or substantially all of the nucleotides are modified nucleotides.

6. The RNAi agent of any one of Claims 4-5, wherein the modified nucleotides are independently selected from the group consisting of: 2’-O-methyl nucleotide, 2’-fluoro nucleotide, 2’-deoxy nucleotide, 2’,3’-seco nucleotide mimic, locked nucleotide, 2'-F- arabino nucleotide, 2’-methoxyethyl nucleotide, abasic nucleotide, ribitol, inverted nucleotide, inverted 2’-O-methyl nucleotide, inverted 2’-deoxy nucleotide, 2’-amino- modified nucleotide, 2’-alkyl-modified nucleotide, morpholino nucleotide, vinyl phosphonate-containing nucleotide, cyclopropyl phosphonate-containing nucleotide, and 3’-O-methyl nucleotide.

7. The RNAi agent of Claim 5, wherein all or substantially all of the modified nucleotides are 2’-O-methyl nucleotides, 2’-fluoro nucleotides, or combinations thereof.

8. The RNAi agent of any one of Claims 1-7, wherein the antisense strand consists of or consists essentially of the nucleotide sequence of any one of the modified antisense strand sequences of Table 3.

9. The RNAi agent of any one of Claims 1-8 wherein the sense strand consists of, consists essentially of, or comprises the nucleotide sequence of any of the modified sense strand sequences of Table 4, Table 5, or Table 6D.

10. The RNAi agent of Claim 1, wherein the antisense strand comprises the nucleotide sequence of any one of the modified sequences of Table 3 or Table 6D, and the sense strand comprises the nucleotide sequence of any one of the modified sequences of Table 4, Table 5, or Table 6D.

11. The RNAi agent of any one of Claims 1-10, wherein the sense strand is between 18 and 30 nucleotides in length, and the antisense strand is between 18 and 30 nucleotides in length.

12. The RNAi agent of Claim 11, wherein the sense strand and the antisense strand are each between 18 and 27 nucleotides in length.

13. The RNAi agent of Claim 12, wherein the sense strand and the antisense strand are each between 18 and 24 nucleotides in length.

14. The RNAi agent of Claim 13, wherein the sense strand and the antisense strand are each 21 nucleotides in length.

15. The RNAi agent of Claim 14, wherein the RNAi agent has two blunt ends.

16. The RNAi agent of any one of Claims 1-15, wherein the sense strand comprises one or two terminal caps.

17. The RNAi agent of any one of Claims 1-16, wherein the sense strand comprises one or two inverted abasic residues.

18. The RNAi agent of Claim 1, wherein the RNAi agent is comprised of a sense strand and an antisense strand that form a duplex having the structure of any one of the duplexes in Table 6B.

19. The RNAi agent of Claim 1, wherein the antisense strand consists of, consists essentially of, or comprises a nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5′ ^ 3′): UUCAACUGAUGUUCCAAUCGU (SEQ ID NO: 675); or UCUAUCAUCAUGCUCACCAAC (SEQ ID NO: 677).

20. The RNAi agent of any one of Claims 1-19, wherein the nucleotides of the antisense strand located at position 2 and position 14 from the 5’-end are 2’-fluoro modified nucleotides.

21. The RNAi agent of Claim 20, wherein the nucleotide of the antisense strand at position 2 is a 2’-fluoro uridine, and the nucleotide of the antisense strand at position 14 is a 2’-fluoro cytidine.

22. The RNAi agent of any one of Claims 19-21, wherein the antisense strand comprises at least 1 phosphorothioate or phosphorodithioate internucleoside linkage.

23. The RNAi agent of any one of Claims 1-22, wherein the sense strand consists of, consists essentially of, or comprises a nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5′ ^ 3′): ACGAUUGGAACAUCAGUUGAA (SEQ ID NO: 718); or GUUGGUGAGCAUGAUGAUAGA (SEQ ID NO: 720).

24. The RNAi agent of any one of Claims 19-23, wherein all or substantially all of the nucleotides are modified nucleotides.

25. The RNAi agent of Claim 1, comprising an antisense strand that comprises, consists of, or consists essentially of a modified nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5′ ^ 3′): cPrpusUfcaacUfgaugUfuCfcAfaucgsu (SEQ ID NO: 494); cPrpusUfcaacUfgaugUfuCfcAfaucgssu (SEQ ID NO: 513); or cPrpusCfuaucAfucauGfcUfcAfccaassc (SEQ ID NO: 514), wherein a represents 2′-O-methyl adenosine, c represents 2′-O-methyl cytidine, g represents 2′-O-methyl guanosine, and u represents 2′-O-methyl uridine; Af, represents 2′-fluoro adenosine, Cf represents 2′-fluoro cytidine, Gf represents 2′-fluoro guanosine, and Uf represents 2′-fluoro uridine; cPrpu represents a 5’-cyclopropyl phosphonate-2’-O- methyl uridine; s represents a phosphorothioate linkage; ss represents a phosphorodithioate linkage; and wherein all or substantially all of the nucleotides on the sense strand are modified nucleotides.

26. The RNAi agent of Claim 1, wherein the sense strand comprises, consists of, or consists essentially of a modified nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5′ ^ 3′): acgauuggAfAfCfaucaguugaa (SEQ ID NO: 534); or guuggugaGfCfAfugaugauaga (SEQ ID NO: 536), wherein a represents 2′-O-methyl adenosine, c represents 2′-O-methyl cytidine, g represents 2′-O-methyl guanosine, and u represents 2′-O-methyl uridine; Af, represents 2′-fluoro adenosine, Cf represents 2′-fluoro cytidine, Gf represents 2′-fluoro guanosine, and Uf represents 2′-fluoro uridine; and wherein all or substantially all of the nucleotides on the antisense strand are modified nucleotides.

27. The RNAi agent of any one of Claims 19-26, wherein the sense strand further includes inverted abasic residues at the 3’ terminal end of the nucleotide sequence, at the 5’ end of the nucleotide sequence, or at both.

28. The RNAi agent of any one of Claims 1-27, wherein the RNAi agent is linked to a targeting ligand.

29. The RNAi agent of Claim 28, wherein the targeting ligand comprises: or30. The RNAi agent of any one of Claims 28-29, wherein the targeting ligand is linked to the sense strand.

31. The RNAi agent of Claim 30, wherein the targeting ligand is linked to the 5’ terminal end of the sense strand.

32. A composition comprising the RNAi agent of any one of Claims 1-31, wherein the composition further comprises a pharmaceutically acceptable excipient.

33. The composition of Claim 32, further comprising a second RNAi agent capable of inhibiting the expression of a YFV viral genome.

34. The composition of any one of Claims 32-33, further comprising one or more additional therapeutics.

35. The composition of any one of Claims 32-34, wherein the composition is formulated for administration.

36. The composition of Claim 35, wherein the composition is delivered by subcutaneous injection.

37. The composition of any one of Claim 32-36, wherein the pharmaceutically acceptable excipient is a sodium phosphate buffer.

38. The composition of any one of Claim 32-36, wherein the pharmaceutically acceptable excipient is isotonic saline or water for injection.

39. A method for inhibiting expression of a YFV viral genome in a hepatocyte cell, the method comprising introducing into a cell of a subject an effective amount of an RNAi agent of any one of Claims 1-31 or the composition of any one of Claims 32-38.

40. The method of Claim 39, wherein the subject is a human subject.

41. The method of any one of Claims 39-40, wherein the YFV genome transcript levels are reduced by at least about 50% in the hepatocyte cell or in the subject.

42. The method of any one of Claims 39-41, wherein the YFV protein levels are reduced by at least about 50% in the hepatocyte cell or in the subject.

43. A method of treating a YFV-related disease, disorder, or symptom, the method comprising administering to a human subject in need thereof a therapeutically effective amount of the composition of any one of Claims 32-38.

44. The method of Claim 43, wherein the disease, disorder, or symptom is liver failure caused by YFV infection.

45. The method of any one of Claims 39-44, wherein the level of YFV protein is decreased in the subject.

46. The method of any one of Claims 39-45, wherein the RNAi agent is administered to a human subject at a dose of about 0.05 mg / kg to about 5.0 mg / kg of body weight of the human subject.

47. Use of the RNAi agent of any one of Claims 1-31 or the composition according to any one of Claims 32-38, for the treatment of a disease, disorder, or symptom that is mediated at least in part by a reduction in YFV viral genome expression.

48. Use according to Claim 47, wherein the disease, disorder, or symptom is liver failure caused by YFV infection.

49. Use of the RNAi agent of any one of Claims 1-31 or the composition according to any one of Claims 32-38, for the preparation of a pharmaceutical composition for treating a disease, disorder, or symptom that is mediated at least in part by a reduction in YFV viral genome expression.

Images