Regulation of plant autophagy to enhance recombinant protein accumulation

Abstract

The embodiments of the disclosure herein are directed to the compositions and methods herein that utilize RNAi technology, such as shRNA. The shRNA of the compositions and methods herein can be a single shRNA construct that leads to a single targeted approach or dual targeted approach for enhancing recombinant protein accumulation in plants through targeted suppression of autophagy pathways.

Description

INTERNATIONAL PATENT APPLICATIONPATENT COOPERATION TREATYRegulation of Plant Autophagy to Enhance Recombinant Protein AccumulationInventor: Cory Tobin, PhDAssignee: Mozza Foods, Inc. 1927 Zonal AvenueLos Angeles, CA 90033 a Delaware CorporationEntity: Small business concernRegulation of Plant Autophagy to Enhance Recombinant Protein AccumulationCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. Provisional Patent Application No. 63 / 678,024, filed on July 31, 2024; and U.S. Provisional Patent Application No. 63 / 762,622, filed on February 24, 2025. The entire contents of each of the foregoing applications are incorporated by reference herein for all purposes.REFERENCE TO SEQUENCE LISTING SUBMITTED ELECTRONICALLY

[0002] This application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled 713003003PCT_SEQLIST.xml, created on July 29, 2025. The information in the electronic format of the Sequence Listing is incorporated by reference in its entirety.TECHNICAL FIELD

[0003] The present disclosure relates to the field of plant molecular farming. More specifically, it provides methods and compositions that use RNA interference (RNAi) to suppress or regulate plant autophagy pathways, thereby enhancing the accumulation and yield of recombinant proteins.BACKGROUND

[0004] Recombinant protein production in plants has emerged as a promising platform for manufacturing valuable proteins, including pharmaceutical proteins, industrial enzymes, and nutritional supplements. Plants offer numerous advantages as protein production hosts, including scalability, low production costs, and a reduced risk of contamination with human pathogens. However, achieving commercially viable protein yields remains a significant challenge, particularly for complex proteins such as caseins, which may form aggregates or undergo rapid turnover in plant cells.

[0005] Within the plant cell, protein quality control and cellular homeostasis are maintained through multiple pathways, including autophagy. Plant autophagy contributes to cellular maintenance through both bulk and selective degradation pathways. Key components of these pathways include ATG5, which is essential for the formation of the autophagosome, and NBR1, a selective autophagy receptor that recognizes and targets protein aggregates for degradation. While these pathways are vital for plant health, particularly during stress responses, they may also limit the accumulation of heterologous proteins in transgenic plants by targeting them for removal.

[0006] Previous approaches to enhancing recombinant protein yields in plants have focused primarily on strategies such as transcriptional optimization, subcellular targeting, and the use of protein-stabilizing sequences. While these strategies have shown some success, they do not directly address the challenge of protein turnover through autophagy -mediated degradation. Studies of mutants, such as those with non-functional NBR1, have shown an increased accumulation of protein aggregates during heat stress, suggesting that targeted suppression of autophagy components could be a viable strategy to enhance recombinant protein yields. However, previous attempts to broadly modify autophagy pathways have often resulted in undesirable pleiotropic effects on plant growth, development, and stress tolerance. Therefore, a need remains for a precise and controlled intervention strategy that can suppress specific autophagy-mediated degradation of a target protein without compromising overall plant health and viability.SUMMARY OF DISCLOSURE

[0007] The present disclosure provides compositions and methods for enhancing the accumulation of heterologous proteins in plants by suppressing one or more endogenous genes involved in protein turnover. In certain embodiments, this is achieved by targeting genes within the autophagy pathway. The methods and compositions can utilize various gene suppression technologies, including RNA interference (RNAi), with exemplary embodiments using short hairpin RNA (shRNA) constructs, to specifically target and suppress the expression of key targetgenes, such as the autophagy -related genes ATG5 and NBR1, thereby reducing the degradation of the recombinant protein and increasing its overall yield.

[0008] In one aspect, the disclosure provides a method for increasing the accumulation of a heterologous protein in a plant or plant cell. The method comprises introducing into the plant or plant cell one or more nucleic acid molecules encoding an shRNA designed to suppress an autophagy -related gene. Suppression of the target gene reduces autophagy -mediated protein turnover, leading to enhanced accumulation of the co-expressed heterologous protein. The heterologous protein can be any protein of interest, including, but not limited to, nutritional proteins (such as a casein or an egg white protein), industrial enzymes, therapeutic proteins, vaccine antigens, or biomaterial proteins.

[0009] In another aspect, provided herein are nucleic acid molecules configured to suppress a target gene via RNA interference. In exemplary embodiments, the nucleic acid molecule encodes a functional shRNA, but other agents like artificial microRNAs (amiRNAs) or antisense constructs are also contemplated. In certain embodiments, the target gene is an autophagy -related gene, such as an ATG5 gene, an NBR1 gene, or orthologs thereof, such as the soybean genes Glyma.14G210200, Glyma.02G240700, Glyma.05G041600, or Glyma. l7G084700. In other embodiments, the target gene could be another component of the autophagy pathway (e.g., an ATG8 gene) or a different gene involved in protein degradation. In specific embodiments, the shRNA-encoding sequence may be at least 95% identical to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9. The nucleic acid molecules may be codon-optimized for expression in a particular plant species, such as soybean.

[0010] The disclosure also provides expression vectors, such as plasmids, for use in plant transformation. These vectors comprise one or more of the shRNA-encoding nucleic acid molecules described herein, operably linked to regulatory elements, such as a promoter, for expression in a plant cell. The promoter may be constitutive, inducible, or tissue-specific (e.g., a seed-specific promoter) to control the timing and location of autophagy suppression. In someembodiments, a single vector may be designed to express shRNAs targeting multiple autophagy genes simultaneously.

[0011] Further provided are transgenic plants, plant cells, and seeds comprising the nucleic acid molecules and vectors of the disclosure. These can be from a wide variety of plant species, including both monocotyledonous (e.g., corn, rice, wheat) and dicotyledonous (e.g., soybean, potato, tobacco) plants. Such transgenic plants are engineered to co-express a heterologous protein of interest and the autophagy-suppressing shRNA(s). This results in a plant that produces significantly higher levels of the heterologous protein compared to a plant expressing the protein alone. In some embodiments, the heterologous proteins are caseins (e.g., alpha-Sl, alpha-S2, beta, and kappa casein), which may assemble into micelles within the plant cells, particularly within the seeds.

[0012] In another aspect, the disclosure provides methods for producing a recombinant protein, including cultivating a transgenic plant as described herein and recovering the heterologous protein from the plant or a part thereof, such as the seeds.

[0013] Also provided are food products, such as dairy product substitutes, that are produced from the transgenic plants or the recombinant proteins recovered therefrom. These food products may comprise residual amounts of the nucleic acid molecules used for transformation.

[0014] Aspects of the disclosure are directed to isolated nucleic acid molecules configured to suppress expression of an autophagy-related gene in a plant cell. In some embodiments, a nucleic acid molecule comprises a nucleotide sequence encoding a functional short hairpin RNA (shRNA) that targets a gene selected from the group consisting of ATG5, NBR1, and their plant orthologs, such as the soybean genes Glyma.14G210200, Glyma.02G240700, Glyma.05G041600, and Glyma.17G084700. For example, the nucleic acid molecule may comprise a nucleotide sequence having at least 85%, 90%, 95%, or 99% sequence identity to a sequence selected from SEQ ID NOs: 22, 23, 24, and 25. In certain embodiments, SEQ ID NO: 22 or 23 may be used to target an NBR1 gene, and SEQ ID NO: 24 or 25 may be used to target an ATG5 gene. These nucleic acid molecules may be provided in an isolated and / or codon- optimized form for enhanced expression and function in a host plant cell.

[0015] The disclosure further provides transgenic plants, plant cells, and plant parts (such as seeds) that have been genetically modified with one or more of the nucleic acid molecules described herein. In some embodiments, a transgenic plant comprises a nucleic acid sequence selected from SEQ ID NOs: 22, 23, 24, or 25 integrated into its genome, and is capable of producing a heterologous casein protein that assembles into a micelle. The functional shRNA encoded by these sequences leads to a higher level of casein accumulation in, for example, a casein micelle, as compared to a control plant transformed with a non -functional or scrambled shRNA sequence (e.g., a sequence corresponding to SEQ ID NO: 26). In some embodiments, the suppression of autophagy pathways is localized to specific tissues, such as the seed, by using tissue-specific promoters (e.g., PfFAD3-l, Glycinin, or Lei). This results in a plant wherein the autophagy suppression and enhanced protein accumulation occur predominantly or solely within the seed tissue.

[0016] In another aspect, the disclosure provides methods for modifying a plant cell to increase the expression of a heterologous protein. Such methods can comprise steps of introducing one or more of the afore-mentioned isolated nucleic acid molecules into a plant cell, allowing for integration into the plant cell's genetic material, and cultivating the cell under conditions suitable for expression of both the shRNA and the heterologous protein. The resulting knockdown or silencing of the target autophagy gene suppresses its transcription and leads to an increased level of the heterologous protein, which may be a casein, a combination of caseins, or an egg white protein. This gene silencing may be achieved through various mechanisms, including but not limited to RNA interference mediated by the shRNA, or by incorporating the targeting sequences into other gene editing or silencing platforms such as CRISPR / Cas systems, VIGS, or antisense therapies.BRIEF DESCRIPTION OF DRAWINGS

[0017] The figures showing embodiments of the system are semi -diagrammatic, and not to scale and, particularly, some of the dimensions are for the clarity of presentation and are shown exaggerated in the figures. Similarly, although the views in the figures for ease of description generally show similar orientations, this depiction in the figures is arbitrary for the most part. Generally, the disclosure can be operated in any orientation.

[0018] The novel features of the disclosure are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present disclosure will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the disclosure are utilized, and the accompanying drawings of which:

[0019] FTG. 1 shows a flowchart depicting the sequential stages of autophagosome formation in plant cells, from initial membrane induction in the cytoplasm through phagophore formation and expansion, to final fusion with the vacuole, with key ATG proteins labeled at each stage.

[0020] FIG. 2 shows a flowchart illustrating the selective autophagy receptor system in plants, depicting the relationships between the core autophagy machinery (ATG8 / LC3), selective autophagy receptors (including NBR1, ATI1 / 2, CCT2, RHD3, and others), their specific cargo recognition targets (such as protein aggregates, ER components, and aquaporins), and the resulting cellular processes (including antiviral defense, organelle recycling, and drought response).

[0021] FIG. 3 is a graph indicating expression levels of casein in a plant cell transformed with functional autophagy-suppressing shRNA constructs compared to a control.

[0022] FIG. 4 is a diagram illustrating an exemplary mechanism by which casein expression is increased in a plant cell.

[0023] FIG. 5 is a table listing containing the nucleic acids of the short hairpin RNA.DETAILED DESCRIPTION

[0024] Below is a description of the embodiments and drawings to facilitate understanding of the disclosure by those skilled in the art. It is understood that other embodiments would be evident based on the present disclosure, and that system, process, or mechanical changes can be made without departing from the scope of an embodiment of the present disclosure.

[0025] In the following description, numerous specific details are given to provide a thorough understanding of the disclosure. However, it will be apparent that the disclosure can be practicedwithout these specific details. Tn order to avoid obscuring an embodiment of the present disclosure, some well-known techniques, system configurations, and process steps are not disclosed in detail. Throughout this disclosure, various publications, patents, and published patent specifications are referenced by an identifying citation. The disclosures of these publications, patents and published patent specifications are hereby incorporated by reference into the present disclosure.

[0026] The following detailed description presents various embodiments of the compositions and methods herein that utilize RNAi technology, such as short hairpin RNA (shRNA). The disclosed constructs and methods can employ a single shRNA to suppress one or more target genes, or multiple shRNAs to simultaneously suppress multiple distinct targets (i.e., two or more targets), thereby enhancing recombinant protein accumulation in plants through the targeted suppression of protein degradation pathways, such as autophagy.

[0027] The methods and compositions herein are provided for enhancing heterologous protein accumulation in plants by simultaneously suppressing two key autophagy components: the selective autophagy receptor NBR1 and the core autophagy machinery component ATG5. The approach can use shRNA constructs that target conserved regions of these genes, taking advantage of the presence of highly similar gene pairs in soybeans that allow efficient dual targeting with single constructs. Multiple vector systems can enable controlled expression of the suppression constructs, while maintaining plant viability. The methods can be particularly valuable for proteins that typically form aggregates or undergo rapid turnover, such as caseins and protein modification enzymes, and can be adapted for use across different plant species and protein targets. In exemplary embodiments, the disclosure provides nucleic acid molecules for the knockdown of autophagy -regulating genes, such as NBR1 and ATG5 (and their soybean orthologs), to increase the accumulation of a target protein like casein. Such nucleic acid molecules may be provided in an isolated form and can be codon-optimized for a desired host plant.

[0028] In particular, the compositions and methods herein are enhancing the accumulation of transgenic proteins in plants through targeted modification of autophagy pathways. For example,the targeted modification of autophagy pathways is increasing heterologous protein yields by using RNA interference to suppress key autophagy receptors and machinery components, thereby reducing protein turnover and enhancing the stability of recombinant proteins in transgenic plant tissues. The compositions enhance recombinant protein accumulation in plants through targeted modification of autophagy pathways while maintaining plant health and vigor. Such methods, including the targeted suppression approaches represented by SEQ ID NOs: 1-9, can enable more efficient production of valuable proteins in plant -based systems while reducing development time and costs.

[0029] While specific examples focus on bovine casein production in soybean, the principles and techniques described herein can be applied to other recombinant proteins and plant species. The description begins with methods for identifying and targeting key autophagy components, particularly ATG5 (SEQ ID NOs: 10-13) and NBR1 (SEQ ID NOs: 14-17), followed by approaches for designing effective shRNA constructs (SEQ ID NOs: 1-9, and SEQ ID NOs: 22- 25) that minimize impact on plant viability. Subsequent sections detail strategies for optimizing expression systems and validating protein accumulation levels. Throughout the description, particular attention is given to the dual targeting approach that addresses both general and selective autophagy pathways, leveraging the conservation between soybean and Arabidopsis components (SEQ ID NOs: 18-21). The examples provided illustrate specific implementations with bovine casein genes, demonstrating successful enhancement of heterologous protein accumulation through coordinated suppression of multiple autophagy components in transgenic soybean.

[0030] The present disclosure provides compositions and methods herein for enhancing recombinant protein production in plants through targeted suppression of autophagy pathways. The methods specifically target the selective autophagy receptor NBR1 (native sequences provided as SEQ ID NOs: 14-17) and the core autophagy component ATG5 (native sequences provided as SEQ ID NOs: 10-13), creating an environment conducive to heterologous protein accumulation while maintaining plant viability.

[0031] In the compositions herein, shRNA constructs can simultaneously suppress both NBR1 and ATG5 expression. The NBR1 suppression constructs (SEQ ID NOs: 1, 2, 5, 6, and 9) target a selective autophagy receptor that recognizes and targets protein aggregates, while the ATG5 suppression constructs (SEQ ID NOs: 3, 4. 7, and 8) target a component that participates in autophagosome elongation and closure. The dual targeting approach addresses both selective and general autophagy pathways that may limit recombinant protein accumulation (vector 4026).

[0032] In the compositions herein, specific characteristics of soybean gene architecture, particularly the presence of two highly similar ATG5 orthologs (Glyma. l4G210200 and Glyma.02G240700, represented by SEQ ID NOs: 10-13) can be targeted with a single shRNA construct. Similarly, the approach targets two soybean NBR1 orthologs (Glyma.05G041600 and Glyma. l7G084700, represented by SEQ ID NOs: 14-17) that function in protein aggregate recognition and clearance.

[0033] In the compositions herein, the disclosure encompasses multiple vector systems for shRNA expression, including constructs based on vectors 2437 (SEQ ID NOs: 1 -4), 3259 (SEQ ID NOs: 5-7), and 4026 (SEQ ID NOs: 8-9). These systems provide options for constitutive, inducible, or tissue-specific expression of the shRNA macro-molecules. The vectors incorporate specific regulatory elements that control the timing and location of autophagy suppression.

[0034] In the compositions herein, specific embodiments of the disclosure include defined nucleic acid sequences encoding shRNAs targeting conserved regions of the ATG5 and NBR1 genes. Multiple variants of these suppression constructs are provided, including NBR1 variants A and B (SEQ ID NOs: 1, 2, 5, 6, and 9) and ATG5 variants A and B (SEQ ID NOs: 3, 4, 7, and 8), allowing flexibility in targeting strategy.

[0035] In the compositions herein, specific embodiments include approaches for expressing heterologous proteins, such as bovine caseins, in conjunction with autophagy suppression. This system employs separate expression constructs for the protein of interest and the suppression constructs (SEQ ID NOs: 1-9 and 22-25), allowing independent optimization of both components.

[0036] In the compositions herein, the autophagy suppression constructs and the heterologous protein expression constructs can be provided to a plant cell in several configurations. In some embodiments, the constructs are located on separate vectors and are introduced into the plant cell simultaneously or sequentially. In other embodiments, both the shRNA expression cassette and the heterologous protein expression cassette are combined onto a single vector for co-delivery and coordinated expression. Furthermore, a single vector may comprise multiple, distinct shRNA expression cassettes designed to target different genes (e.g., one for ATG5 and one for NBR1), or multiple shRNA cassettes targeting different regions of the same gene to enhance suppression efficacy.

[0037] In the compositions herein, the disclosure provides protocols for generating transgenic plants incorporating both the suppression constructs and heterologous protein expression systems. The targeting sequences and methodology were developed with reference to both soybean and Arabidopsis sequences (Arabidopsis sequences provided as SEQ ID NOs: 18-21), enabling broad application across plant species.

[0038] In the compositions herein, technical aspects of the disclosure encompass specific sequence information for target genes, shRNA constructs, and expression vectors, as detailed in the sequence listing. This information enables reproduction of the suppression constructs and their implementation in plant transformation systems.

[0039] In the compositions herein, the disclosure described herein may be adapted to target additional autophagy components beyond ATG5 (SEQ ID NOs: 10-13) and NBR1 (SEQ ID NOs: 14-17). Other potential targets include components of the ATG8 conjugation system, which functions in autophagosome expansion and closure. The shRNA design approach exemplified by SEQ ID NOs: 1-9 may be modified to target conserved regions of these additional autophagy-related genes.

[0040] In the compositions herein, the vector systems described for shRNA expression may be modified to incorporate different regulatory elements. While the embodiments detailed above utilize specific vectors (2437 with SEQ ID NOs: 1-4, 3259 with SEQ ID NOs: 5-7, and 4026 with SEQ ID NOs: 8-9), the shRNA expression cassettes may be adapted for use with other planttransformation vectors. Alternative promoter systems may be employed, including tissue-specific promoters for targeted expression in seed tissues, stress-inducible promoters for controlled activation, or developmental stage-specific promoters.

[0041] In the compositions herein, the suppression system may be combined with various heterologous proteins beyond bovine caseins. The approach may be particularly suitable for proteins that tend to form aggregates or those subject to rapid turnover in plant cells. This could include other milk proteins, industrial enzymes, pharmaceutical proteins, or vaccine antigens.

[0042] In the compositions herein, the methodology may be adapted for use in plant species beyond soybean. While the specific sequences described target soybean ATG5 and NBR1 orthologs, the approach could be modified for use in other crop species, including corn, rice, or tobacco, by targeting the corresponding orthologs in these species. The high degree of conservation in autophagy components across plant species facilitates such adaptation.

[0043] In the compositions herein, alternative RNA interference approaches may be employed beyond shRNA. These could include artificial microRNAs (amiRNAs) or hairpin RNA constructs. The targeting sequences identified for ATG5 and NBR1 could be adapted for use in these alternative silencing formats while maintaining targeting specificity.

[0044] In the compositions herein, the system (such as the vector) may be modified to incorporate regulated suppression of autophagy components. This could include chemically inducible promoters, allowing external control of suppression timing, or feedback-regulated systems that modulate suppression levels based on protein accumulation or cellular stress indicators.

[0045] In the compositions herein, multiple suppression constructs may be combined in various arrangements. While the described embodiments target ATG5 and NBR1 independently, single constructs expressing multiple shRNAs may be developed. Such combined constructs could target different regions of the same gene or multiple autophagy components simultaneously.

[0046] In the compositions herein, the approaches described may be combined with other protein accumulation enhancement strategies. These could include the co-expression of chaperoneproteins, the use of protein body-forming fusion tags, or the incorporation of subcellular targeting sequences. Such combinations may provide synergistic effects on protein accumulation.

[0047] In the compositions herein, methods for selecting transformed plants may be modified to incorporate various selection markers or screening approaches. This could include the use of alternative antibiotic or herbicide resistance markers, visual markers, or direct screening for protein accumulation levels.

[0048] In the compositions herein, the suppression system may be adapted for temporary expression through viral vectors or transient expression systems. While stable transformation provides consistent expression, temporary suppression may be useful for certain applications or for rapid testing of protein production capabilities.

[0049] In some embodiments of the compositions herein, the sequence identity between the shRNA targeting sequence (i.e., the stem region) and its target mRNA sequence is at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or is 100%. Perfect identity is often preferred, but in certain embodiments, the targeting sequence may contain 1, 2, 3, or up to 4 mismatches with the target mRNA while maintaining effective suppression. These mismatches may be strategically placed to, for example, avoid silencing of a non-target gene family member or to modulate the degree of suppression.

[0050] In some embodiments of the compositions herein, the length of the shRNA targeting sequence may vary in different embodiments. In some instances, the targeting sequence may be between 19 and 25 nucleotides. In particular embodiments, the targeting sequence may be 21, 22, or 23 nucleotides in length. In other embodiments, longer targeting sequences of 26 to 30 nucleotides may be employed.

[0051] In the compositions herein, the degree of suppression of the target genes may vary across embodiments. In some instances, the expression level of ATG5 (SEQ ID NOs: 10 and 12) may be reduced by at least 50%, at least 75%, or at least 90% compared to wild-type levels. Similarly, NBR1 expression (SEQ ID NOs: 14 and 16) may be reduced by at least 40%, at least 60%, or at least 80%.

[0052] In various embodiments of the compositions herein, the degree of sequence similarity between the two soybean ATG5 orthologs (SEQ ID NOs: 10 and 12) in the targeting region may range from 85% to 100%. In particular instances, the similarity may be at least 90%, at least 95%, or at least 98%, enabling effective targeting of both genes with a single shRNA construct.

[0053] In the compositions herein, the timing of transgene expression may vary across embodiments. In some instances, the suppression constructs may be induced when the heterologous protein reaches between 0.1% and 5% of total soluble protein. In particular embodiments, induction may occur at 0.5%, 1%, or 2% of total soluble protein.

[0054] In certain embodiments of the compositions herein, protein accumulation enhancement may range from 1.5-fold to 10-fold compared to controls without autophagy suppression. In particular instances, the enhancement may be at least 2-fold, at least 3-fold, or at least 5-fold. Under optimal conditions, enhancement may exceed 7-fold.

[0055] In the compositions herein, the effectiveness of the autophagy suppression can be assessed by measuring the reduction in the transcript level of the target gene (e.g., ATG5 or NBR1) or by measuring the level of a marker protein associated with the pathway. For example, in some embodiments, the level of the target gene transcript is reduced by at least 25%, 50%, 70%, 80%, 90%, or 95% compared to a control plant. In other embodiments, the accumulation of an autophagy marker, such as ATG8-PE, is measurably reduced.

[0056] While the exemplary embodiments focus on soybean, the methods described herein may be applied to a broad range of plant species. In some embodiments, the disclosure may be implemented in other legume species, including but not limited to Medicago sativa (alfalfa), Pisum sativum (pea), Phaseolus vulgaris (common bean), or Cicer arietinum (chickpea). The high degree of conservation in ATG5 and NBR1 sequences across legume species facilitates such applications.

[0057] In other embodiments of the compositions herein, the disclosure may be adapted for use in cereal crops. The methods may be particularly useful in Oryza sativa (rice), Zea mays (corn), Triticum aestivum (wheat), or Plordeum vulgare (barley). In such embodiments, the shRNAconstructs may be modified to target the corresponding ATG5 and NBR1 orthologs in these species while maintaining the targeting strategy demonstrated for soybean.

[0058] In the compositions herein, the disclosure may also be implemented in oilseed crops beyond soybean, including Brassica napus (canola), Helianthus annuus (sunflower), or Gossypium hirsutum (cotton). In some instances, these plants may be particularly suitable for protein production due to their robust seed storage protein synthesis machinery.

[0059] In the compositions herein, alternative embodiments include application in tobacco species (Nicotiana tabacum or Nicotiana benlhamiana), which are widely used in molecular farming applications. The rapid growth and high biomass production of tobacco makes it particularly suitable for certain protein production applications.

[0060] In some embodiments of the compositions herein, the disclosure may be adapted for use in fruit or vegetable crops, including Solanum lycopersicum (tomato), Solatium tuberosum (potato), or Cucumis sativus (cucumber). These species may be particularly suitable for production of proteins intended for oral delivery or dietary supplementation.

[0061] In the compositions herein, the methods may also be applied to model plant species beyond Arabidopsis thaliana, such as Brachypodium distachyon or Setaria viridis, which serve as important research platforms for monocot species. Such implementations may be valuable for proof-of-concept studies and optimization of the system for related crop species.

[0062] In preferred embodiments of the compositions herein, the disclosure enhances accumulation of bovine milk proteins, particularly the casein family. The methods are especially effective for alpha SI casein, alpha S2 casein, beta casein, and kappa casein production. In some instances, multiple casein proteins may be co-expressed to facilitate micelle formation. The disclosure is particularly valuable for caseins due to their tendency to form protein bodies and their susceptibility to autophagy -mediated turnover.

[0063] In the compositions herein, the methods may be applied to other milk proteins beyond caseins, including whey proteins such as beta-lactoglobulin, alpha-lactalbumin, and lactoferrin.The disclosure may also enhance accumulation of other dairy -derived proteins including immunoglobulins and milk enzymes.

[0064] In broader embodiments of the compositions herein, the disclosure may enhance production of various industrial enzymes. These may include hydrolases (such as amylases, cellulases, or proteases), oxidoreductases (such as peroxidases or laccases), or other industrial biocatalysts. The methods are particularly valuable for enzymes that tend to form inclusion bodies or exhibit poor stability in plant expression systems. Peroxidases and proteases, when expressed in recombinant hosts, can catalyse degradative oxidation and degradative hydrolysis of casein proteins. In the disclosure, peroxidases and proteases can be expressed without or minimally interacting with casein, thereby avoiding degradative oxidation and hydrolysis of casein. Without being beholden to a theory or mechanism, the plasmids herein can express proteins, such as caseins, in a micelle that targets endoplasmic reticulum and enzymes, such as peroxidases and proteases in other organelles, besides endoplasmic reticulum, via respective signaling sequences. Peroxidases and proteases have a high affinity for casein, which leads to the aforementioned degradation reactions. The combination of (1) signaling sequences which target and in turn transport peroxidases and proteases to organelles besides endoplasmic reticulum via (2) the vectors disclosed herein, which also express SEQ ID NO: 1-9, is a process that is substantially favored kinetically in the recombinant plant, over the interaction of peroxidases and proteases with casein, in the recombinant plant. Thus, the aforementioned degradation reactions are avoided, leading to increased accumulation and eventual isolation of casein proteins.

[0065] In some embodiments of the compositions herein, where enzymes like peroxidases or proteases are co-expressed, a differential subcellular targeting strategy may be employed to mitigate degradation of the protein of interest. The heterologous protein of interest (e.g., casein) may be targeted for retention in the endoplasmic reticulum (ER) lumen using a retention signal such as HDEL or KDEL. In contrast, the potentially degradative enzyme may be targeted to a different compartment, such as the apoplast (via a secretion signal) or the vacuole. This spatial separation minimizes undesirable interactions, ensuring that the accumulated protein is not degraded by the co-expressed enzyme. The reduction in interaction can be such that thedegradation rate of the protein of interest is reduced by at least 50%, 75%, 90%, or 99% compared to a scenario without differential targeting.

[0066] In the compositions herein, the disclosure may be applied to maintain some of the folding patterns associated with the three-dimensional structures of bovine casein within a micelle, despite being recombinantly expressed in a plant via shRNA that target the corresponding ATG5 and NBR1 . While phosphorylation of casein is not immediately achieved when introducing the vectors herein comprises nucleotide sequences for expressing bovine casein and shRNA that target corresponding ATG5 and NBR1, structural orientations that would impede phosphorylation or glycosylation associated with phosphorylation, of recombinantly expressed caseins, are not imposed by the shRNA that target corresponding ATG5 and NBR1.

[0067] In the compositions herein, the disclosure may be applied to pharmaceutical proteins, including therapeutic antibodies, cytokines, growth factors, and blood factors. Specific examples include monoclonal antibodies, interferon-alpha, erythropoietin, and human serum albumin. The methods may be especially valuable for therapeutic proteins that are typically difficult to produce in plant systems due to protein turnover.

[0068] In the compositions herein, alternative embodiments include production of vaccine antigens, particularly those forming virus-like particles or other multimeric structures. These may include antigens from viral, bacterial, or parasitic pathogens. The autophagy suppression approach may be particularly beneficial for stabilizing assembled particle structures.

[0069] In the compositions herein, the methodology may enhance production of structural proteins, including collagens, elastin, silk proteins, and other fibrous proteins. In some embodiments, the disclosure may facilitate accumulation of spider silk proteins or other biomaterials that typically show poor accumulation in heterologous expression systems.

[0070] In the compositions herein, the disclosure may also be applied to enhance production of nutritional proteins, including essential amino acid-enriched storage proteins, biofortified crop proteins, or alternative protein sources for food applications. These may include modified seed storage proteins, synthetic proteins optimized for nutritional content, or alternative meat proteins.

[0071] In certain embodiments of the compositions herein, the methods may enhance production of reporter proteins or selectable markers, including fluorescent proteins, luciferases, or antibiotic resistance proteins. While not typically produced for isolation, stable accumulation of these proteins is crucial for research applications and selection of transformed plants.

[0072] In the compositions herein, the disclosure may also be applied to metabolic pathway enzymes involved in production of valuable secondary metabolites, where stable enzyme accumulation is required for pathway efficiency. This may include enzymes involved in terpenoid biosynthesis, flavonoid production, or other high-value metabolite pathways.

[0073] In the compositions herein, the disclosure may be particularly valuable for production of protein kinases and other post-translational modification enzymes that are typically difficult to express in heterologous systems. Of particular interest is FAM20C (Family with Sequence Similarity 20C), a secreted kinase that phosphorylates S-x-E / pS motifs in many secreted proteins including caseins. The co-expression of FAM20C with its target proteins may be especially beneficial as this kinase is crucial for proper modification of many secreted proteins, particularly those involved in biomineralization.

[0074] Related embodiments of the compositions herein may include other members of the FAM20 family, including FAM20A and FAM20B, which regulate protein secretion and modification. The methods described herein may enhance the accumulation of these typically hard-to-express regulatory enzymes.

[0075] In the compositions herein, the disclosure may also be applied to other protein modification enzymes including protein kinases, glycosyltransferases, and proteases that are important for proper post-translational processing of recombinant proteins. These may include Golgi-resident kinases, glycosyltransferases involved in protein maturation, or specific proteases used or for proper protein processing.

[0076] In the compositions herein, the disclosure may be used to enhance production of complete post-translational modification systems, where multiple enzymes are co-expressed to achieve proper protein modification. This approach may be particularly valuable when producingproteins whose function depends on specific post-translational modifications, such as properly phosphorylated caseins or glycosylated therapeutic proteins.

[0077] In the compositions herein, nucleotide sequences can be obtained, isolated, and codon optimized, which are at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NO: 22, which can be transcribed from pMOZ3307 or pMOZ3307 as a nucleotide sequence containing functional short hairpin RNA; SEQ ID NO: 23, which can be transcribed from pMOZ3308 or pMOZ3308 as a nucleotide sequence containing functional short hairpin RNA; SEQ ID NO: 24, which can be transcribed from pMOZ3309 or pMOZ3309 as a nucleotide containing functional short hairpin RNA; SEQ ID NO: 25, which can be transcribed from pMOZ3310 or pMOZ33010 as a nucleotide containing functional short hairpin RNA; and SEQ ID NO: 26, which can be transcribed from pMOZ3303 containing nonfunctional short hairpin RNA.

[0078] In the compositions herein, the incorporation of SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25 and SEQ ID NO: 26 into a plant cell (z.e., integration of SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, and / or SEQ ID NO: 26 into the plant genome) can lead to expression of casein proteins in the plant cell, wherein the expressed casein proteins reside within micelles (z.e., a colloid containing dispersed particles that are insoluble in a liquid phase medium which be modulated into a supramolecular assembly containing non- covalent interactions between the dispersed particles and liquid phase); and wherein the plant cell is: (i) an in vitro environment; or (ii) within the seeds, leaf, stems, roots, or other parts of the plant, such as a soybean plant.

[0079] In the compositions herein, the expressed casein protein and calcium phosphate can be the dispersed particles in liquid-state water in the micelle that forms in the plant cells. Prior to the integration of SSEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, and / or SEQ ID NO: 26 into the genome of the plant cell, the plant cells are absent of the capability of expressing casein protein, whereas the integration of SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, and / or SEQ ID NO: 26 into the genome of the plant cell, the micelle can form in the plant cell, wherein the micelle contains casein proteins.

[0080] In the compositions herein, a plasmid, vector, or other type of delivery vehicle, with optional excipient components (e.g., encapsulation, micelles, emulsions, or liquid phase solutions) can provide a structural framework for delivering SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24; SEQ ID NO: 25, or SEQ ID NO: 26 into the plant cell, which modifies properties of the plant cell, thereby incorporating EQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24; SEQ ID NO: 25, or SEQ ID NO: 26 into the plant cell. The structural framework can be a cargo system that releases EQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24; SEQ ID NO: 25, or SEQ ID NO: 26 into the plant cell via: (i) physical changes (e.g., dissolution of an emulsion); (ii) biochemical conversions (e.g., transcription of circular DNA molecule); or (iii) chemical reactions (e.g., formation of peptide bonds, cleavage of peptide bonds, organo -catalysis, and transition metal mediated processes). When released from the structural framework, EQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24; SEQ ID NO: 25, or SEQ ID NO: 26, can be inserted into the plant cell to modify properties of the plant cell, such as increasing expression levels of casein.

[0081] In the compositions herein, the nucleotide sequence that is released into the plant cell can be at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of: SSEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25 and SEQ ID NO: 26, wherein SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25 can interact with genetic contents of the cell upon insertion into the plant cell, to make contact with genes regulating autophagy, or involved in the regulation of autophagy (G1 in Fig. 2) in, for example, soybeans, during knockdown, instead of genes that do not regulate autophagy, or not involved in autophagy (G2-G4 in Fig. 2) in, for example, soybeans. Stated another way, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25 can selectively target genes regulating autophagy, over genes that do not regulate autophagy, during knockdown, thereby SEQ ID NO:22, SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25 provide a first level of selectivity. G1 - G4 represent genes than can be expressed for the synthesis of a functional gene product, P1-P4, respectively, that can produce: proteins, non-coding RNA, and other products that ultimately affect a phenotype in, for example, the plant cell. By contacting SEQ ID NO: 22, SEQ ID NO:23, SEQ ID NO: 24, or SEQ ID NO: 25, with Gl, during knockdown, the expression of G1 ismodified. More particularly, the synthesis of proteins (e g., transcription of G1 and subsequent translation) produced during autophagy (e.g., Pl in Fig. 2), from the expression of, for example, NBR1 and ATG5, or the soybean homologues thereof (e.g., Glyma.l4G210200 and Glyma.02G240700 for NBRI, and Glyma.05G041600 and Glyma.l7G084700 for ATG5) can be eliminated or substantially reduced , during knockdown of, for example, NBR1 and ATG5, by: SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25. Stated another way, autophagy, which is the degradation of the cell that removes unnecessary or dysfunctional components through a lysosome-dependent regulated mechanism and processes, transcription of genes involved in regulating mechanisms, and subsequent translation of transcribed products, can be suppressed by knockdown of NBR1 or ATG5, via SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25 binding to NBR1 or ATG5. More particularly, the binding of SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25 to NBRI or ATG5 can form a complex that suppresses transcription of NBR1 or ATG5, during knockdown of NBR1 or ATG5.

[0082] In the compositions herein, knockdown of a gene, such as NBRI or ATG5, can be an experimental technique that reduces expression of NBRI or ATG5 in a plant, yeast, or bacterium. The reduction in expression of the one or more genes, such as NBRI or ATG5, can occur either through genetic modification or by treatment with a reagent, such as a circular DNA, short DNA, or RNA oligonucleotide, wherein the circular DNA, short DNA, or RNA oligonucleotide is SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25, that has a sequence complementary to either gene or an mRNA transcript. SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25 can be stably integrated into the genome of the organism, in which SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25 is inserted into.

[0083] In the compositions herein, knockdown can be an experimental technique used for silencing genes. The silencing of the genes can be achieved by CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) techniques, such as: CRISPR interference (CRISPRi), which is a dead Cas9 nuclease (dCas9) and single-guide RNA (sgRNA) to block RNA polymerase and inhibit gene transcription; DNA double strand break (DSB) repair, which can directly silence genes by inserting or deleting a few nucleotides, which are then repaired by non-homologous end join (EHEJ); CRTSPR / Cas genome editing, which can replace undesirable genes or overexpress genes using a DNA donor and homologue-directed repair (HDR); and translational repression (CRISPR8), which can silence genes through translational repression, that is independent of RNA degradation.

[0084] In the compositions, silencing genes can be achieved via other experimental techniques, other than knockdown of genes or CRISPR, such as: virus-induced gene silencing (VIGS), which can carry a gene fragment of the target gene, such as viral vectors like tobacco rattle virus (TRV); antisense oligonucleotide therapy, which uses antisense RNA to bind to mRNA and to prevent translation into proteins that cause diseases; genomic imprinting, which silences a gene inherited from either parent; and RNA-directed DNA methylation, which can be an epigenetic gene silencing phenomenon that uses siRNAs to transactivate RISC, wherein RISC regulates gene silencing through homologous DNA methylation.

[0085] In the compositions herein, the nucleotides sequence selected from at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25, which can be in an isolated and codon optimized state, can knockdown a first set of genes that regulate autophagy, without knockdown of a second set of genes that regulate autophagy in a plant, yeast, or bacterium; wherein the first set of genes are NBR1, Glyma.14G210200, Glyma.02G240700, ATG5, Glyma.05G041600 and Glyma.17G084700; and wherein the second set of genes comprise: ALR, ATG9, ATG1, ATG2, ATG3, ATG7, PLEKHM1, EPG5 and RAB7. Stated another way, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25, can selectively target particular genes, NBR1 and ATG5 in the first set of genes, regulating autophagy, during knockdown, over other genes regulating autophagy, thereby SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25 provide a second level of selectivity, wherein: NBR1 is a yeast / human homolog of Glyma.14G210200 and Glyma.02G240700 genes in soybeans, and ATG5 is a yeast / human homolog of Glyma.05G041600 and Glyma.17G084700 genes in soybeans.

[0086] In the compositions herein, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, and SEQID NO: 25 contain functional short hairpin RNA (shRNA) for autophagy regulation; and SEQ IDNO: 5 contains non-functional shRNA for autophagy regulation. More particularly, pMOZ3307 and pMOZ3308, can have shRNAs or be transcribed to shRNAs, are SEQ ID NO: 22 and SEQ ID NO: 23, respectively, which each target NBR1, during knockdown; and pMOZ3309 and pMOZ3310, which can have shRNAs or be transcribed to shRNAs, are SEQ ID NO: 24 and SEQ ID NO: 25, respectively, which each target ATG5, during knockdown. Responsive to performing knockdown of said genes for regulating autophagy, the plants transfected with SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25 (i.e., the integration of SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25 into the plant) can exhibit: (i) decreased levels of autophagy in the plant, along with (ii) increased expression levels of casein proteins in the plant, wherein the casein proteins can be: (a) SI -alpha casein; (b) S2-alpha casein; (c) beta casein; (d) kappa casein; (e) SI -alpha casein and beta casein; (f) SI -alpha casein and S2-alpha casein; (g) SI -alpha casein and kappa casein; (h) S2-alpha casein and beta casein; (i) S2-alpha casein and kappa casein; (j) beta casein and kappa casein; (k) SI -alpha casein, beta casein, and kappa casein; (1) S2-alpha casein, beta casein, and kappa casein; (m) SI -alpha casein, S2-alpha casein, and kappa casein; (n) SI -alpha casein, S2-alpha casein, and beta casein; and (o) SI -alpha casein, S2-alpha casein, beta casein, and kappa casein

[0087] In embodiments of the disclosure, target gene expression is silenced using an artificial RNA molecule capable of mediating RNA interference. A specific, non-limiting example of such a molecule is a short hairpin RNA (shRNA), which is designed with a tight hairpin turn structure. For instance, the constructs corresponding to SEQ ID NOs: 22, 23, 24, and 25 encode shRNAs configured to silence the expression of target genes such as NBR1 or ATG5. For expression in a host, the shRNA-encoding nucleic acid is typically contained within a vector or plasmid. This vector is then introduced into a plant cell. The vector may be introduced into the plant cell using methodologies selected to achieve either transient expression or stable transformation. For example, in some applications, the vector is delivered in a manner that results in stable transformation, where the nucleic acid encoding the shRNA (e.g., a sequence corresponding to SEQ ID NO: 22, 23, 24, or 25) is integrated into the genome of the plant cell. In other applications, the vector may be delivered via transfection or infiltration to achieve transient expression without genomic integration. Regardless of the method of introduction, thesubsequent expression of the shRNA in the plant cell leads to the targeted suppression of autophagy, which is accompanied by an increased accumulation of a co-expressed protein, such as casein.

[0088] In compositions herein, the ratio of expression level of SI -alpha casein to the expression level of kappa casein is above 1 in plant cells transfected with SEQ ID NO: 26. Stated another way, transfection with non-functional shRNA can lead to higher amounts of SI -alpha casein, relative to kappa casein. More particularly, the amount of SI -alpha casein is ~2.0 times higher than kappa casein in the plant cells transfected with SEQ ID NO. 26.

[0089] In the compositions herein, the ratio of expression level of SI -alpha casein to the expression of kappa casein is below 1 in the plant cells transfected with SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25. Stated another way, transfection with functional shRNA can lead to higher amounts of kappa casein, relative to SI -alpha casein. More particularly, the amount of kappa casein is ~ 1.9 times higher than SI -alpha casein in the plant cells transfected with SEQ ID NO: 22; the amount of kappa casein is ~ 2.2 times higher than Sl- alpha casein in the plant cells transfected with SEQ ID NO: 23; and the amount of kappa casein is ~ 2.3 times higher than alpha casein in the plant cells transfected with SEQ ID NO: 24.

[0090] In compositions herein, the ratio of expression level of S2-alpha casein to the expression level of kappa casein is above 1 in plant cells transfected with SEQ ID NO: 26. Stated another way, transfection with non-functional shRNA can lead to higher amounts of SI -alpha casein, relative to kappa casein.

[0091] In the compositions herein, the ratio of expression level of S2-alpha casein to the expression of kappa casein is below 1 in the plant cells transfected with SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25. Stated another way, transfection with functional shRNA can lead to higher amounts of kappa casein, relative to S2-alpha casein.

[0092] In the compositions herein, a single nucleotide sequence selected from SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, and SEQ ID NO: 26 can modify the plant cell by transforming the plant cell from a first state to a second state, wherein the first state is nottransfected with SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, or SEQ ID NO: 26 and the second state is transfected with SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, or SEQ ID NO: 26, thereby leading to the formation of micelles comprising casein proteins.

[0093] In the compositions herein, as depicted in Fig. 4, a vector can be inserted to a cell in a first state, wherein the vector can release SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25, which contain the shRNA for autophagy regulation by knockdown of Gl, which regulates autophagy. The cell in the first state contains genes, Gl, G2, G3, and G4, which can be expressed to lead to functional gene products, Pl, P2, P3, and P4, respectively. In the knockdown state, Pl, which is the autophagy product from expressing Gl (e.g., transcription of NBR1 or ATG5 to corresponding RNA and translation of the corresponding RNA to proteins), can be eliminated, or substantially reduced (z.e., suppression of autophagy via suppression of transcription of NBR1 or ATG5), by SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25 targeting a gene for regulating autophagy. SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25, which can be an oligonucleotide strand that binds to Gl, and does not bind to G2, G3, or G4, to yield a knockdown state. The knockdown state, in which autophagy is regulated by particular genes among Gl, can lead to the second state, in which micelles containing caseins are formed. The cell in the second state can be a plant containing micelles, wherein the micelles contain caseins and the micelles can be ruptured to obtain caseins, for use in dairy products or other food products.

[0094] In the compositions herein, two or more nucleotide sequences selected from SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, and SEQ ID NO: 26 can modify the plant cell by transforming the plant cell from a first state to a second state, wherein the first state is not transfected with SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, or SEQ ID NO: 26 and the second state is transfected with SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, or SEQ ID NO: 26, thereby leading to the formation of micelles comprising casein proteins.

[0095] In the compositions herein, two nucleotides, which transform the plant cell from the first state to the second state, can be: (i) SEQ ID NO: 22 and SEQ ID NO: 23, which both target a single gene, NBR1, during knockdown of genes related to autophagy and (ii) SEQ ID NO: 24 and SEQ ID NO: 25, which both target a single gene, ATG5, during knockdown of genes related to autophagy, to increase expression levels of casein in the plant cell.

[0096] In the composition herein, two nucleotides, which transform the plant cell from the first state to the second state, can be: (i) SEQ ID NO: 22 and SEQ ID NO: 25, wherein SEQ ID NO: 22 can target a single gene, NBR1, during knockdown of autophagy; (ii) SEQ ID NO: 23 and SEQ ID NO: 26, wherein SEQ ID NO: 23 targets a single gene, NBR1; (iii) SEQ ID NO: 24 and SEQ ID NO: 26, wherein SEQ ID NO: 24 can target a single gene, ATG5, during knockdown of autophagy; and (iv) SEQ ID NO: 25 and SEQ ID NO: 26, wherein SEQ ID NO: 25 can target a single gene, ATG5, during knockdown of autophagy, to increase expression levels of casein in the plant cell.

[0097] In the composition herein, two nucleotides, which transform the plant cell from the first state to the second state, can be: (i) SEQ ID NO: 22 and SEQ ID NO: 24, wherein SEQ ID NO: 22 can target a single gene, NBR1, during knockdown of genes related to autophagy, and SEQ ID NO: 24 can target a single gene, ATG5, during knockdown of genes related to autophagy; (ii) SEQ ID NO: 22 and SEQ ID NO: 25, wherein SEQ ID NO: 22 can target a single gene, NBR1, during knockdown of genes related to autophagy, and SEQ ID NO: 25 can target a single gene, ATG5, during knockdown of genes related to autophagy; (iii) SEQ ID NO: 23 and SEQ ID NO: 24, wherein SEQ ID NO: 23 can target a single gene, NBR1, during knockdown of genes related to autophagy, and SEQ ID NO: 24 can target a single gene, ATG5, during knockdown of genes related to autophagy; (iv) SEQ ID NO: 23 and SEQ ID NO: 25, wherein SEQ ID NO: 22 can target a single gene, NBR1, during knockdown of genes related to autophagy, and SEQ ID NO: 25 can target a single gene, ATG5, during knockdown of genes related to autophagy, to increase expression levels of casein in the plant cell.

[0098] In the compositions herein, micelles can form when inserting SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25 into a plant or a plant cell, in the presence of seedspecific promoters, such that pathways associated with genes regulating autophagy in the seed are suppressed, thereby increasing expression levels of casein, which is contained in the formed micelles. The micelles can reside exclusively / solely within the seed, where the pathways associated with genes regulating autophagy are suppressed, wherein the micelles encapsulate the casein.

[0099] In the compositions herein, the micelles, which form in the seed, when inserting EQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25 into a plant or a plant cell, in the presence of seed specific promoters, such that pathways associated with genes regulating autophagy in the seed are suppressed, thereby increasing expression levels of casein, can be modulated and isolated more readily than the micelles, which form in other parts of the plants containing suppressed pathways associated with genes regulating autophagy. The micelle containing caseins in the seeds have an encapsulating layer that can protect the caseins from degradation, while being dislodged from the seeds. This leads to a composition containing: seed tissue, casein in the micelle, suppressed pathways associated with genes regulating autophagy, wherein said pathways reside solely in the seed tissue, and a genome integrated with SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25.

[0100] In the compositions herein, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID: 24, SEQ ID NO: 25, and SEQ ID NO: 26, each contain Y, wherein Y is appended to: Al, A2, A3, A4, or A5 on the 5’-end and Bl, B2, B3, B4, or B5 on the 3’-end, such that Al-Y-Bl is SEQ ID NO: 22; A2- Y-B2 is SEQ ID NO: 23; A3-Y-B3 is SEQ ID NO: 24; A4-Y-B4 is SEQ ID NO: 25; and A5-Y- B5 is SEQ ID NO: 26 (see Fig. 5). Y is a nucleotide sequence portion common to SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID: 24, SEQ ID NO: 25, and SEQ ID NO: 26; Al and Bl, A2 and B2, A3 and B3, A4 and B4, and A5 and B5, which are appended to Y, distinguish SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, and SEQ ID NO: 26 from each other. Further, the difference in expression levels of casein and relative levels of alpha casein and kappa caseins of SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25 can be attributed to: Al and Bl, A2 and B2, A3 and B3, and A4 and B4 of SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25, respectively. More particularly, Al, Bl, A2, B2, A3, B3, A4, and B4 can adopt conformations when binding or interacting with NBR1, ATG5, orsoybean homologues thereof, which suppress autophagy, thereby increasing expression levels of casein. Al and Bl, A2 and B2, A3 and B3, and A4 and B4, when appended to Y form functional shRNA, whereas A5 and B5 form nonfunctional shRNA. Further, Al is SEQ ID NO: 1, A2 is SEQ ID NO: 2, A3 is SEQ ID NO: 3, and A4 is SEQ ID NO: 4.

[0101] In the compositions herein, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID: 24, SEQ ID NO: 25, and SEQ ID NO: 26 each contain Y, wherein Y is appended to: Al, A2, A3, or A4 on the 5’- end and Bl, B2, B3, B4 on the 3 ’-end, such that Al-Y-Bl is SEQ ID NO: 22; A2-Y-B2 is SEQ ID NO: 23; A3-Y-B3 is SEQ ID NO: 24; A4-Y-B4 is SEQ ID NO: 25 (see Fig. 5). Y is a nucleotide sequence portion common to SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25; Al and Bl, A2 and B2, A3 and B3, and A4 and B4, which are appended to Y, distinguish SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25 from each other.

[0102] In the compositions herein, knockdown of genes in a plant, one or more plant cells, or soybean one or more seeds suppresses autophagy within said plant, said one or more plant cells, or said one or more seeds by SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, and / or SEQ ID NO: 25, can increasing levels of casein in said plant, said one or more plant cells, or said one or more seeds, wherein said plant, said one or more plant cells, or said one or more seeds are soybean.

[0103] In the compositions herein, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, and / or SEQ ID NO: 25 can: (i) contact particular genes involved in autophagy regulation during to knockdown, to (ii) form a binding complex with the particular genes involved in autophagy, when (iii) inserted into the soybean plant, one or more soybean plant cells, or soybean one or more seeds and (iv) subsequently integrated into the genome of the soybean, to (v) suppress autophagy in the soybean plant, the one or more soybean plant cells, or the soybean one or more seeds, thereby (vi) forming micelles containing casein proteins in the soybean plant, the one or more soybean plant cells, or the soybean one or more seeds, which is indicative of increased levels of expression of casein proteins. The suppressive effect of the knockdown of the autophagy regulating genes, Glyma.14G210200, Glyma.02G240700, Glyma.05G041600, andGlyma.17G084700, which can involve suppression of the transcription of said genes, can be attributed to: (i) SEQ ID NO: 22 and SEQ ID NO: 23 specifically targeting Glyma.14G210200 and Glyma.02G240700, in which: (a) the binding complex between SEQ ID NO. 22 and Glyma.14G210200 forms, (b) the binding complex between SEQ ID NO: 22 and Glyma.02G240700 forms, (c) the binding complex between SEQ ID NO. 23 and Glyma.14G210200 forms, and (d) the binding complex between SEQ ID NO: 23 and Glyma.02G240700 forms; and (ii) SEQ ID NO: 24 and SEQ ID NO: 25 specifically targeting Glyma.14G210200 and Glyma.02G240700, in which: (a) the binding complex between SEQ ID NO. 24 and Glyma.05G041600 forms, (b) the binding complex between SEQ ID NO: 24 and Glyma.17G084700 forms, (c) the binding complex between SEQ ID NO. 25 and Glyma.05G041600 forms, and (d) the binding complex between SEQ ID NO: 25 and Glyma.17G084700 forms. Stated another way, the aforementioned binding complexes, which contain SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25, facilitate inhibition of pathways associated with autophagy, which leads to suppression of the transcription of genes, wherein Glyma.14G210200, Glyma.02G240700, Glyma.05G041600, and Glyma.17G084700 are also contained within the aforementioned binding complexes.

[0104] In the compositions herein, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, and / or SEQ ID NO: 25 can target Glyma.14G210200, Glyma.02G240700, Glyma.05G041600, and Glyma.17G084700, in, for example, soybean seeds, during knockdown, which suppresses autophagy specifically within the soybean seeds. The autophagy in the soybean seed can be suppressed, during knockdown, by the application of one or more of the following promoters specific to soybean, into the tissue of soybean seeds: PIFAD3-1, Glycinin, and Lei, which are driven by seed specific native or synthetic elements of soybean seeds, not in the soybean plant. SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, and / or SEQ ID NO: 25 can still target Glyma.14G210200, Glyma.02G240700, Glyma.05G041600, and Glyma.17G084700, in the presence of the promoters comprising one or more of PfFAD3-l; Glycinin; and Lei, indicating that the production of alpha-Linolenic acid; the inductive effects of asparagine, proline, and glutamine; and production of lectin, respectively, do not impede SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, and / or SEQ ID NO: 25 from binding to Glyma.14G210200,Glyma.02G240700, Glyma.05G041600, and Glyma.17G084700, during knockdown of Glyma.14G210200, Glyma.02G240700, Glyma.05G041600, and Glyma.17G084700.

[0105] In the compositions herein, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25 can increase the expression of egg white ovalbumin (Gallus gallus), in addition to the increased expression of caseins, via the suppression of autophagy, wherein SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, and SEQ ID NO: 24 target Glyma.14G210200, Glyma.02G240700, Glyma.05G041600, and Glyma.17G084700, during knockdown of Glyma.14G210200, Glyma.02G240700, Glyma.05G041600, and Glyma.17G084700, in, for example, a plant cell. When Glyma.14G210200, Glyma.02G240700, Glyma.05G041600, and Glyma.17G084700 are silenced, a signal can be sent to the expression cassettes for encoding egg white ovalbumin, disclosed in United States Patent Application No. 18 / 202,098, filed on May 25, 2023, which is hereby incorporated in its entirety, wherein the expression cassettes are inserted into the plant cell, and thereby integrated into the genome of the plant cell. The suppression of autophagy during the knockdown of Glyma.14G210200, Glyma.02G240700, Glyma.05G041600, and Glyma.17G084700, forming the above mentioned binding complex with SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25, which can facilitate and not impede the signal sent to the expression cassettes for encoding egg white ovalbumin, thereby triggering the production of egg white ovalbumin in the plant cell.

[0106] In the compositions herein, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25 can be nucleic acids that do not comprise at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42, at least 43, at least 44, at least 45, or at least 46 of the sequences selected from the group consisting of GGTACC, ACCGGT, GGGCCC, GTGCAC, GGCGCGCC, GGTACC, CCTAGG, GGATCC, AGATCT, CACGTC, ATCGAT, TTCGAA, ATCGAT, CGGCCG, GAGCTC, GAATTC, GATATC, AAGCTT, GTTAAC, GGTACC, ACGCGT, CCATGG, CATATG, GCTAGC, GCGGCCGC, ATGCAT,TTAATTAA, CTCGAG, GGGCCC, CTGCAG, CGATCG, CAGCTG, GAGCTC, CCGCGG, GTCGAC, CCCGGG, TACGTA, ACTAGT, GCATGC, CTCGAG, CCCGGG, TCTAGA, CTCGAG, CCCGGG, GGTCTC and GAAGAC.

[0107] In certain embodiments, the nucleic acid molecules encoding the shRNA constructs are designed to be compatible with specific modular cloning systems, such as Golden Gate assembly. To facilitate this, the sequences may be intentionally designed to be substantially free of, or entirely lacking, certain restriction enzyme recognition sites that are used in these cloning systems. For example, in some embodiments, the nucleic acid molecules of SEQ ID NOs: 22, 23, 24, and 25 are devoid of recognition sites for Type IIP restriction enzymes such as EcoRI, BamHI, and Hindlll, and / or are devoid of recognition sites for Type IIS enzymes used in the cloning system, such as Bsal and Bbsl. This design feature is not incidental but is a deliberate engineering choice to streamline the construction of expression vectors.

[0108] In the compositions herein, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25 can be used, and therefore comprised within a food composition, such as a dairy product, which contain one or more plant molecules selected from a plant protein, sugar, or deoxyribonucleic acid.

[0109] In the compositions herein, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25 can be used for the knockdown of particular genes for regulating autophagy, such as NBR1 and / or ATG5, thereby increasing expression of caseins, wherein the caseins comprise one or more of: SI -alpha casein, S2-alpha casein, beta casein, and kappa casein and wherein said caseins can be bovine, buffalo, goat, sheep and camels, yaks, horses, reindeer, and donkey proteins.

[0110] In the compositions herein, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25 can be used for the knockdown of particular genes for regulating autophagy, such as NBR1 and / or ATG5, thereby increasing expression of caseins, wherein the caseins can be free of, essentially free of, or not comprise a detectable amount of: a-lactalbumin or P-lactoglobulin; free of lactoferrin; free of transferrin; free of serum album; free of lysozyme; free of lactoperoxidase; free of immunoglobulin-A; and / or free of lipase.

[0111] The methods herein allow for the production of compositions comprising recombinant caseins that closely mimic the composition of natural milk proteins while being substantially free of other bovine milk components. In some embodiments, the resulting composition comprises one or more caseins and is essentially free of whey proteins such as a-lactalbumin or 0- lactoglobulin, meaning these whey proteins are present at less than 1.0%, 0.5%, 0.1%, or 0.01% of the total protein content, or are undetectable by standard methods like Western blotting or mass spectrometry. This selective production profde is a direct result of the specific heterologous genes introduced and is a key feature of the disclosed food products.

[0112] In the compositions herein, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25 do not comprise a nucleotide sequence that is susceptible to enzymatic digestion by one or more restriction enzymes. For example, the nucleotide sequences provided herein do not comprise a nucleotide sequence that is susceptible to enzymatic digestion by one or more the following restriction digestion enzymes: Acc65I (GGTACC), Agel (ACCGGT), Apal (GGGCCC), ApaLI (GTGCAC), Asci (GGCGCGCC), Asp718I (GGTACC), Avril (CCTAGG), BamHI (GGATCC), Bglll (AGATCT), BmgBI (CACGTC), BspDI (ATCGAT), BstBI (TTCGAA), Clal (ATCGAT), EagI (CGGCCG), Ecl 13611 (GAGCTC), EcoRI (GAATTC), EcoRV (GATATC), Hindlll (AAGCTT), Hpal (GTTAAC), Kpnl (GGTACC), Mlul (ACGCGT), Ncol (CCATGG), Ndel (CATATG), Nhel (GCTAGC), Notl (GCGGCCGC), Nsil (ATGCAT), Pad (TTAATTAA), PaeR7I (CTCGAG), PspOMI (GGGCCC), PstI (CTGCAG), Pvul (CGATCG), PvuII (CAGCTG), Sad (GAGCTC), Sadi (CCGCGG), Sall (GTCGAC), Smal (CCCGGG), SnaBI (TACGTA), Spel (ACTAGT), SphI (GCATGC), Tlil (CTCGAG), TspMI (CCCGGG), Xbal (TCTAGA), Xhol (CTCGAG), Xmal (CCCGGG). In some cases, the nucleotide sequences provided herein do not comprise one or more of the nucleotide sequences in the list above. In some cases, the nucleotide sequences provided herein do not comprise any of the nucleotide sequences in the list above. In some cases, the nucleotide sequences provided herein do not comprise a nucleotide sequence that is susceptible to enzymatic digestion by Eco31I (i.e., Bsal, Bso31I, BspTNI) or Bpil (i.e., BbsI, BpuAI, BstV2I). In some cases, the nucleotide sequences provided herein do not comprise nucleotide sequences GGTCTC or GAAGAC.

[0113] In the composition herein, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25 can be codon-optimized for a plant, wherein the plant can be any one of the following, for example, angiosperms and gymnosperms such as Arabidopsis, potato, tomato, tobacco, alfalfa, lemice, carrot, strawberry, sugar beet, cassava, sweet potato, soybean, lima bean, pea, chick pea, maize (com), turf grass, wheat, rice, barley, sorghum, oat, oak, eucalyptus, walnut, palm and duckweed as well as fern and moss. In some aspects, the nucleotide sequences provided herein are codon-optimized for a plant, wherein the plant is a monocot, a dicot, or a vascular plant reproduced from spores such as fern or a nonvascular plant such as moss, liverwort, hornwort, and algae. In some aspects, the nucleotide sequences provided herein are codon-optimized for a dicot plant, include for example Arabidopsis, tobacco, tomato, potato, sweet potato, cassava, alfalfa, lima bean, pea, chick pea, soybean, carrot, strawberry, lettuce, oak, maple, walnut, rose, mint, squash, daisy, quinoa, buckwheat, mung bean, cow pea, lentil, lupin, peanut, fava bean, French beans, mustard, or cactus. In some aspects, the nucleotide sequences provided herein are codon-optimized for a monocot plant, including for example, turf grass, maize (corn), rice, oat, wheat, barley, sorghum, orchid, iris, lily, onion, palm, and duckweed. In some cases, the nucleotide sequences provided herein are codon-optimized for a soybean (i.e., glycine max).

[0114] In the compositions herein, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25 can contribute to new protein folding patterns compared to wild type, due to the impact of codon changes on the rate of protein synthesis. In some embodiments, changes in codon usage enhance the stability and localization of mRNA, optimizing the quantity and positioning of protein synthesis. In some embodiments, the variability of tRNA availability across organisms aligns with the introduced codons, prompting unique translation dynamics. In some embodiments, the modified codon usage enriches traditional patterns of gene expression by affecting the regulatory sequences of DNA and RNA. In some embodiments, changes in codon usage provide an additional dimension to post-translational modifications vital to protein function by introducing alterations in translation speed and timing.

[0115] In the compositions herein, a food composition (such as a dairy product) can comprise: a casein protein, as obtained from transfection of a plant by SEQ ID NO: 22, SEQ ID NO: 23,SEQ ID NO: 24, or SEQ ID NO: 25, and a nucleic acid molecule comprising SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25.

[0116] In the compositions herein, a food composition (such as a dairy product) can comprise: a first nucleic acid molecule comprising SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25; and a second nucleic acid molecule comprising SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25.Definitions

[0117] These and other valuable aspects of the embodiments of the present disclosure consequently further the state of the technology to at least the next level. While the disclosure has been described in conjunction with a specific best mode, it is to be understood that many alternatives, modifications, and variations will be apparent to those skilled in the art in light of the descriptions herein. Accordingly, it is intended to embrace all such alternatives, modifications, and variations that fall within the scope of the included claims. All matters set forth herein or shown in the accompanying drawings are to be interpreted in an illustrative and non-limiting sense.

[0118] As used herein, the phrases “at least one”, “one or more”, and “and / or” are open-ended expressions that are both conjunctive and disjunctive in operation. For example, each of the expressions “at least one of A, B and C”, “at least one of A, B, or C”, “one or more of A, B, and C”, “one or more of A, B, or C” and “A, B, and / or C” means A alone, B alone, C alone, A and B together, A and C together, B and C together, or A, B and C together.

[0119] As used herein, the singular forms “a”, “an” and “the” are intended to include the plural forms as well, unless the context clearly indicates otherwise. Furthermore, to the extent that the terms “including”, “includes”, “having”, “has”, “with”, or variants thereof are used in either the detailed description and / or the claims, such terms are intended to be inclusive in a manner similar to the term “comprising.”

[0120] Use of absolute or sequential terms, for example, “will,” “will not,” “shall,” “shall not,” “must,” “must not,” “first,” “initially,” “next,” “subsequently,” “before,” “after,” “lastly,” and“finally,” are not meant to limit scope of the present embodiments disclosed herein but as exemplary.

[0121] As used herein, “or” may refer to “and”, “or,” or “and / or” and may be used both exclusively and inclusively. For example, the term “A or B” may refer to “A or B”, “A but not B”, “B but not A”, and “A and B”. In some cases, context may dictate a particular meaning.

[0122] Any systems, methods, software, and platforms described herein are modular and not limited to sequential steps. Accordingly, terms such as “first” and “second” do not necessarily imply priority, order of importance, or order of acts.

[0123] As used herein, the term “about” or the symbolwhen referring to a number or a numerical range means that the number or numerical range referred to is an approximation within experimental variability (or within statistical experimental error), and the number or numerical range may vary from, for example, from 1% to 10% of the stated number or numerical range. Unless otherwise indicated by context, the term “about” refers to ±10% of a stated number or value.

[0124] As used herein, the term “approximately” means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, e.g., the limitations of the measurement system. For example, “approximately” can mean within 1 or more than 1 standard deviation, per the practice in the given value. Where particular values are described in the application and claims, unless otherwise stated the term “approximately” should be assumed to mean an acceptable error range for the particular value.

[0125] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the disclosure. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the disclosure, subject to any specifically excluded limit in the stated range. Where the stated range includes oneor both of the limits, ranges excluding either or both of those included limits are also included in the disclosure.

[0126] All ranges disclosed herein also encompass any and all possible sub-ranges and combinations of sub-ranges thereof. Any listed range can be recognized as sufficiently describing and enabling the same range being broken down into at least equal halves, thirds, quarters, fifths, tenths, and so forth. As a non-limiting example, each range discussed herein can be readily broken down into a lower third, middle third and upper third, and the like. All languages such as “up to,” “at least,” “greater than,” “less than,” and the like include the number recited and refer to ranges which can be subsequently broken down into sub-ranges as discussed above. Finally, a range includes each individual member. Thus, for example, a group having 1-3 articles refers to groups having 1, 2, or 3 articles. Similarly, a group having 1-5 articles refers to groups having 1, 2, 3, 4, or 5 articles, and so forth.

[0127] Whenever the term “at least,” “greater than,” “greater than or equal to”, or a similar phrase precedes the first numerical value in a series of two or more numerical values, the term “at least,” “greater than,” “greater than or equal to” or similar phrase applies to each of the numerical values in that series of numerical values. For example, “at least 1, 2, or 3” is equivalent to “at least 1, at least 2, and / or at least 3.”

[0128] Whenever the term “no more than,” “less than,” “less than or equal to,” “no greater than,” “at most,” or a similar phrase, precedes the first numerical value in a series of two or more numerical values, the term “no more than,” “less than,” “less than or equal to,” “no greater than,” “at most,” or similar phrase applies to each of the numerical values in that series of numerical values. For example, “less than 3, 2, or 1” is equivalent to “less than 3, less than 2, and / or less than 1.”

[0129] As used herein, the following meanings apply unless otherwise specified. The word “may” or “can” is used in a permissive sense ( / .< ., meaning having the potential to), rather than the mandatory sense (i.e., meaning must). The words “include”, “including”, and “includes” and the like mean including, but not limited to. The singular forms “a,” “an,” and “the” include plural referents. Thus, for example, reference to “an element” includes a combination of two or moreelements, notwithstanding use of other terms and phrases for one or more elements, such as “one or more.” The phrase “at least one” includes “one”, “one or more”, “one or a plurality” and “a plurality”. The term “or” is, unless indicated otherwise, non -exclusive, z.e., encompassing both “and” and “or.” The term “any of’ between a modifier and a sequence means that the modifier modifies each member of the sequence. So, for example, the phrase “at least any of 1, 2 or 3” means “at least 1, at least 2 or at least 3”. The term "consisting essentially of refers to the inclusion of recited elements and other elements that do not materially affect the basic and novel characteristics of a claimed combination.

[0130] As used herein, “Autophagy” refers to the conserved cellular pathway for the degradation and recycling of cytoplasmic components, including proteins and organelles, within the lysosome or, in plants and fungi, the vacuole. The term is intended to be interpreted broadly to encompass multiple forms of the pathway, including, but not limited to: (i) macroautophagy, characterized by the formation of a double-membraned vesicle called an autophagosome that engulfs cytoplasmic cargo; (ii) microautophagy, involving direct engulfment of cytoplasm by the lysosome / vacuole; and (iii) selective autophagy, wherein specific cargo is recognized by autophagy receptors (e.g, NBR1) and targeted for degradation. The suppression of any gene whose function is required for one or more of these pathways is considered to be suppression of “autophagy” for the purposes of this disclosure.

[0131] As used herein, a “vector” is a plasmid comprising operably linked polynucleotide sequences that facilitate expression of a coding sequence in a particular host organism (e.g., a bacterial expression vector or a plant expression vector). Polynucleotide sequences that facilitate expression in prokaryotes can include, e.g, a promoter, an enhancer, an operator, and a ribosome binding site, often along with other sequences. Eukaryotic cells can use promoters, enhancers, termination and polyadenylation signals and other sequences that are generally different from those used by prokaryotes.

[0132] As used herein, the term “casein micelles” are micelles comprising casein proteins.Examples of casein micelles are described in United States Patent Application No. 16 / 741,680 (Patent No. US11326176), filed on January 13, 2020, titled “Recombinant micelle and method ofin vivo assembly,” and in United States Patent Application No. 17 / 826,021 fded on May 26, 2022, both incorporated herein by reference in its entirety. Recombinant casein micelles can be made in vivo or in vitro using the methods described therein. United States Patent Application No. 17 / 826,021 (United States Patent Application US20220290167A1), titled “Recombinant micelle and method of in vivo assembly” teaches vectors and sequences for making recombinant casein proteins and micelles, which is incorporated herein by reference in its entirety.

[0133] As used herein, the term “milk” means a liquid composition that contains soluble casein micelles and where the weight of soluble casein micelles is equal to or greater than 1% of the total protein weight in the composition.

[0134] U.S. Patent No. 11457649 describes a substitute dairy food, and U.S. Patent Application No. 16 / 862,011 (Publication No. US20210010017A1) describes food compositions comprising a milk protein, both of which are incorporated herein by reference in their entirety.

[0135] As used herein, the term “dairy characteristic” means a characteristic selected from one of the following characteristics of a dairy food: adhesiveness, airiness, appearance, aroma, binding, chewdown, chewiness, coagulation, cohesiveness, compactness, creaminess, crispiness, crumbliness, density, elasticity, emulsification, fattiness, firmness, flavor, foaminess, graininess, greasiness, hardness, handling, juiciness, leavening, mouthcoating, mouthfeel, richness, roughness, slipperiness on tongue, smoothness, springiness, structure, taste, tenderness, texture, thickness, uniformity, and wetness.

[0136] The terms “bind,” “binding,” “hybridize,” and “specifically hybridize,” when used in reference to the interaction between a gene silencing agent (e.g., an shRNA-derived siRNA) and its target nucleic acid (e.g., an mRNA), refer to the sequence-dependent pairing of complementary nucleotides that is sufficient to mediate a downstream biological effect, namely gene suppression via an RNAi pathway. Such binding is specific enough to distinguish the intended target from unrelated nucleic acids under the physiological conditions of a plant cell. This definition encompasses interactions involving perfect (100%) complementarity as well as interactions involving one or more nucleotide mismatches, so long as the overall hybridization isstable enough to trigger the RNAi machinery and result in a detectable reduction in target gene expression.

[0137] In some aspects, the current disclosure provides food products and food product substitutes comprising the nucleic acids disclosed herein. Contemplated food products include dairy products or products that resemble a dairy product (z.e., dairy product substitutes). The term “dairy product” as used herein refers to milk (e.g., whole milk (at least 3.25% milk fat), partly skimmed milk (from 1% to 2% milk fat), skim milk (less than 0.2% milk fat), cooking milk, condensed milk, flavored milk, goat milk, sheep milk, dried milk, evaporated milk, milk foam), and products derived from milk, including but not limited to yogurt (e.g., whole milk yogurt (at least 6 grams of fat per 170 g), low -fat yogurt (between 2 and 5 grams of fat per 170 g), nonfat yogurt (0.5 grams or less of fat per 170 g), Greek yogurt (strained yogurt with whey removed), whipped yogurt, goat milk yogurt, Labneh (labne), sheep milk yogurt, yogurt drinks (e.g., whole milk Kefir, low-fat milk Kefir), Lassi), cheese (e.g., whey cheese such as ricotta; pasta filata cheese such as mozzarella; semi-soft cheese such as Havarti and Muenster; medium- hard cheese such as Swiss and Jarlsberg; hard cheese such as Cheddar and Parmesan; washed curd cheese such as Colby and Monterey Jack; soft ripened cheese such as Brie and Camembert; fresh cheese such as cottage cheese, feta cheese, cream cheese, and curd; processed cheese; processed cheese food; processed cheese product; processed cheese spread; enzyme-modulated cheese; cold-pack cheese), dairy-based sauces (e.g., fresh, frozen, refrigerated, or shelf stable), dairy spreads (e.g., low-fat spread, low-fat butter), cream (e.g., dry cream, heavy cream, light cream, whipping cream, half-and-half, coffee whitener, coffee creamer, sour cream, creme fraiche), frozen confections (e.g., ice cream, smoothie, milk shake, frozen yogurt, sundae, gelato, custard), dairy desserts (e.g., fresh, refrigerated, or frozen), butter (e.g., whipped butter, cultured butter), dairy powders (e.g., whole milk powder, skim milk powder, fat-filled milk powder (i.e., milk powder comprising plant fat in place of all or some animal fat), infant formula, milk protein concentrate (i.e., protein content of at least 80% by weight), milk protein isolate (i.e., protein content of at least 90% by weight), whey protein concentrate, whey protein isolate, demineralized whey protein concentrate, demineralized whey protein concentrate, beta.- lactoglobulin concentrate, beta. -lactoglobulin isolate, alpha-lactalbumin concentrate, alpha-lactalbumin isolate, glycomacropeptide concentrate, glycomacropeptide isolate, casein concentrate, casein isolate, nutritional supplements, texturizing blends, flavoring blends, coloring blends), ready -to-drink or ready -to-mix products (e.g. , fresh, refrigerated, or shelf stable dairy protein beverages, weight loss beverages, nutritional beverages, sports recovery beverages, and energy drinks), puddings, gels, chewables, crisps, and bars. As used herein, the term “food product substitute” (e.g., “dairy product substitute”) refers to a food product that resembles a conventional food product (e.g., can be used in place of the conventional food product). Such resemblance can be due to any physical, chemical, or functional attribute. In some embodiments, the resemblance of the food product provided herein to a conventional food product is due to a physical attribute. Non-limiting examples of physical attributes include color, shape, mechanical characteristics (e.g., hardness, G' storage modulus value, shape retention, cohesion, texture (i.e., mechanical characteristics that are correlated with sensory perceptions (e.g, mouthfeel, fattiness, creaminess, homogenization, richness, smoothness, thickness), viscosity, and crystallinity. In some embodiments, the resemblance of the food product provided herein and a conventional food product is due to a chemical / biological attribute. Non-limiting examples of chemical attributes include nutrient content (e.g., type and / or amount of amino acids (e.g, PDCAAS score), type and / or amount of lipids, type and / or amount of carbohydrates, type and / or amount of minerals, type and / or amount of vitamins), pH, digestibility, shelf-life, hunger and / or satiety regulation, taste, and aroma. In some embodiments, the resemblance of the food product provided herein to a conventional food product is due to a functional attribute. Non-limiting examples of functional attributes include gelling / agglutination behavior (e.g., gelling capacity (i.e., time required to form a gel (i.e., a protein network with spaces filled with solvent linked by hydrogen bonds to the protein molecules) of maximal strength in response to a physical and / or chemical condition (e.g, agitation, temperature, pH, ionic strength, protein concentration, sugar concentration, ionic strength)), agglutination capacity (i.e., capacity to form a precipitate (i.e., a tight protein network based on strong interactions between protein molecules and exclusion of solvent) in response to a physical and / or chemical condition), gel strength (i.e., strength of gel formed, measured in force / unit area (e.g., pascal (Pa))), water holding capacity upon gelling, syneresis upon gelling (i.e., water weeping over time)), foaming behavior (e.g., foaming capacity (i.e., amount of air held in response to a physical and / or chemical condition), foam stability (i.e.,half-life of foam formed in response to a physical and / or chemical condition), foam seep), thickening capacity, use versatility (i.e., ability to use the food product in a variety of manners and / or to derive a diversity of other compositions from the food product; e.g., ability to produce food products that resemble milk derivative products such as yoghurt, cheese, cream, and butter), and ability to form protein dimers.

[0138] Where a definition or use of a term in an incorporated reference is inconsistent or contrary to the definition of that term provided herein, the definition of that term provided herein applies and the definition of that term in the reference does not apply.

[0139] As used herein, the term “recombinant” refers to nucleic acids or proteins formed by laboratory methods of genetic recombination (e.g., molecular cloning) to bring together genetic material from multiple sources, creating sequences that would otherwise not be found in the genome. Recombinant proteins may be expressed in vivo in various types of host cells, including plant cells, bacterial cells, fungal cells, avian cells, and mammalian cells. Recombinant proteins may also be generated in vitro. As used herein, the term “tagged protein” refers to a recombinant protein that includes additional peptides that are not part of the native protein and that remain after post-translational processing.

[0140] As used herein, the term “milk solids” refers to the powder that would be left after milk is dried out and the water is removed.

[0141] As used herein, the phrase “essentially free of’ is used to indicate the indicated component, if present, is present in an amount that does not contribute, or contributes only in a de minimis fashion, to the properties of the composition. In various embodiments, where a composition is essentially free of a particular component, the component is present in less than a functional amount. In various embodiments, the component may be present in trace amounts. Particular limits will vary depending on the nature of the component, but may be, for example, selected from less than 10% by weight, less than 9% by weight, less than 8% by weight, less than 7% by weight, less than 6% by weight, less than 5% by weight, less than 4% by weight, less than 3% by weight, less than 2% by weight, less than 1% by weight, less than 0.5% by weight, less than 0.1% by weight, or less than 0.05% by weight, or less than 0.01% by weight.

[0142] As used herein, the term "stably expressed" refers to expression and accumulation of a protein in a plant cell over time. As an example, a recombinant protein may accumulate because it is not degraded by endogenous plant proteases. As a further example, a recombinant protein is considered to be stably expressed in a plant if it is present in the plant in an amount of 1% or higher per total protein weight of soluble protein extractable from the plant.

[0143] As used herein, the term “a detectable amount” refers to an amount of a composition (e.g., a molecule) that can be detected using the most sensitive analytical techniques up to date, including for example, liquid chromatography methods (e.g., reverse phase HPLC, size exclusion, normal phase chromatography), mass spectrometry (e.g., electrospray tandem mass spectrometry, and electrospray FT-ICR mass spectrometry), or a combination of analytical techniques (e.g., liquid chromatography -tandem mass spectrometry (LC- MS / MS)). In some cases, a detectable amount is at a concentration above 10-2 mol / L, 10-3 mol / L, 10-4 mol / L, 10-5 mol / L, 10-6 mol / L, 10-7 mol / L, 10-8 mol / L, 10-9 mol / L, or 10-10 mol / L.

[0144] As used herein, the term “naturally occurring” means without genetic modification. For example, a naturally occurring ratio of two plant proteins means a ratio of the two plant proteins found in a plant (e.g., plant seed), where the plant is not genetically modified to manipulate the expression levels of the two proteins.

[0145] As used herein, the term “recombinant” refers to nucleic acids or proteins formed by laboratory methods of genetic recombination (e.g., molecular cloning) to bring together genetic material from multiple sources, creating sequences that would otherwise not be found in the genome. Recombinant proteins may be expressed in vivo in various types of host cells, including plant cells, bacterial cells, fungal cells, avian cells, and mammalian cells. Recombinant proteins may also be generated in vitro. As used herein, the term “tagged protein” refers to a recombinant protein that includes additional peptides that are not part of the native protein and that remain after post-translational processing.

[0146] Definition of standard chemistry terms may be found in reference works, including but not limited to, Carey and Sundberg “Advanced Organic Chemistry 4th Ed.” Vols. A (2000) and B (2001), Plenum Press, New York.

[0147] As used herein, the term “homogenous” means uniform structure or composition throughout, such that individual components (e.g., probiotics, particles) cannot be separately observed with the naked eye.

[0148] As used herein, the term “plant” includes whole plant, plant organ, plant tissues, and plant cell and progeny of same, but is not limited to angiosperms and gymnosperms such as Arabidopsis, potato, tomato, tobacco, alfalfa, lemice, carrot, strawberry, sugarbeet, cassava, sweet potato, soybean, lima bean, pea, chick pea, maize (com), turf grass, wheat, rice, barley, sorghum, oat, oak, eucalyptus, walnut, palm, and duckweed as well as fern and moss. Thus, a plant may be a monocot, a dicot, a vascular plant reproduced from spores such as fern or a nonvascular plant such as moss, liverwort, hornwort, and algae. The term “plant,” as used herein, also encompasses plant cells, seeds, plant progeny, propagule whether generated sexually or asexually, and descendants of any of these, such as cuttings or seed. Plant cells include suspension cultures, callus, embryos, meristematic regions, callus tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen, seeds, and microspores. Plants may be at various stages of maturity and may be grown in liquid or solid culture, or in soil or suitable media in pots, greenhouses, or fields. As used herein, the term “plant protein” refers to a protein that is at least 70% homologous to a protein that naturally occurs in a plant.

[0149] As used herein, the term “dicot” refers to a flowering plant whose embryos have two seed leaves or cotyledons. Examples of dicots include Arabidopsis, tobacco, tomato, potato, sweet potato, cassava, alfalfa, lima bean, pea, chick pea, soybean, carrot, strawberry, lettuce, oak, maple, walnut, rose, mint, squash, daisy, quinoa, buckwheat, mung bean, cow pea, lentil, lupin, peanut, fava bean, French beans, mustard, or cactus.

[0150] As used herein, the term “monocot” refers to a flowering plant whose embryos have one cotyledon or seed leaf. Examples of monocots include turf grass, maize (corn), rice, oat, wheat, barley, sorghum, orchid, iris, lily, onion, palm, and duckweed.

[0151] As used herein, the term "transgenic plant" means a plant that has been transformed with one or more exogenous nucleic acids. "Transformation" refers to a process by which a nucleic acid is stably integrated into the genome of a plant cell. "Stably transformed" refers to thepermanent, or non-transient, retention, expression, or a combination thereof of a polynucleotide in and by a cell genome. A stably integrated polynucleotide is one that is a fixture within a transformed cell genome and can be replicated and propagated through successive progeny of the cell or resultant transformed plant. Transformation can occur under natural or artificial conditions using various methods. Transformation can rely on any method for the insertion of nucleic acid sequences into a prokaryotic or eukaryotic host cell, including Agrob acterium- mediated transformation as illustrated in U.S. Pat. Nos. 5,159,135; 5,824,877; 5,591,616 and 6,384,301, all of which are incorporated herein by reference in its entirety. Methods for plant transformation also include microprojectile bombardment as illustrated in U.S. Pat. Nos. 5,015,580; 5,550,318; 5,538,880; 6,153,812; 6,160,208; 6,288,312 and 6,399,861, all of which are incorporated herein by reference in its entirety. Recipient cells for the plant transformation include meristem cells, callus, immature embryos, hypocotyls explants, cotyledon explants, leaf explants, and gametic cells such as microspores, pollen, sperm and egg cells, and any cell from which a fertile plant can be regenerated, as described in U.S. Pat. Nos. 6,194,636;6,232,526; 6,541,682 and 6,603,061 and U.S. Patent Application publication US 2004 / 0216189 Al, all of which are incorporated herein by reference in its entirety.

[0152] Additional methods and concepts related to codon optimization are described in U.S. Patent Application publication US20200024327A1 (Optimized factor viii gene) to Tan et al and in U.S. Pat. No. US9427003 (Synthetic genes) to Larrinua et al, both of which are incorporated herein by reference in its entirety.

[0153] As used herein, the term “in-vitro” means outside a living organism.

[0154] As used herein, the term “fusion protein” refers to a protein comprising at least two constituent proteins that are encoded by separate genes, and that have been joined so that they are transcribed and translated as a single polypeptide.

[0155] As used herein, the terms “gene suppression,” “gene silencing,” and “gene knockdown” are used interchangeably to refer to any method that results in a reduction in the expression of a target gene or the activity of its encoded product. This reduction can occur at the transcriptionallevel (reduced mRNA synthesis) or the post-transcriptional level (increased mRNA degradation or reduced translation) and results in a lower-than-normal level of functional protein.

[0156] ‘ ‘RNA interference” or “RNAi” refers to a biological process in which RNA molecules inhibit gene expression or translation, by neutralizing targeted mRNA molecules. As used herein, an “RNAi agent” is any nucleic acid molecule that can mediate RNAi, including but not limited to, short hairpin RNA (shRNA), small interfering RNA (siRNA), and artificial microRNA (amiRNA).

[0157] Certain aspects of the disclosure have other steps or elements in addition to or in place of those mentioned above. The steps or elements will become apparent to those skilled in the art from a reading of the following detailed description when taken with reference to the accompanying drawings.

[0158] While some embodiments of the present disclosure have been shown and described herein, those skilled in the art would recognize that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the disclosure. Various alternatives to the embodiments of the disclosure described herein may be employed in practicing the disclosure. It is intended that the following claims define the scope of the disclosure and that methods and structures within the scope of these claims and their equivalents be covered thereby.EXAMPLES

[0159] It will be more readily understood by reference to the following examples, which are included merely for purposes of illustration of certain aspects and embodiments of the present disclosure, and are not intended to limit the disclosure. Aspects of the present disclosure are now being generally described, namely: the design and construction of shRNA constructs targeting ATG5 and NBR1 autophagy components; the development of expression vectors incorporating these suppression constructs; the transformation of soybean plants with both the autophagy suppression system and bovine casein expression constructs; and the evaluation of recombinant protein accumulation under conditions of reduced autophagy activity. The examples detail thespecific sequences used for targeting autophagy components, the vector systems employed for delivery and expression, and the methods for assessing the impact on heterologous protein accumulation in transformed plants. Aspects of the present disclosure are now being generally described, namely: the determination of the nucleotides in sequences corresponding to plasmids described herein; the isolation of RNA, DNA and proteins produced by these sequences and plasmids; the insertion of sequences of DNA into relevant plasmids, and the subsequent insertion into a soybean plant; and the determination of casein levels in the soybean after insertion of the plasmids. Aspects of the present disclosure are now being generally described, namely the determination of the sequence of nucleotides for addition into a soybean; isolation of nucleotides; addition of the nucleotides into the soybean; formulation of food product containing caseins derived from the nucleotides added in the soybean, The nucleotides contained shRNA were selected from the group comprising: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25. SEQ ID NO: 1 and SEQ ID NO: 22 corresponded to pMOZ3307, which targeted NBR1 via functional shRNA contained in pMOZ3307. SEQ ID NO: 2 and SEQ ID NO: 23 corresponded to pMOZ3308, which targeted NBR1 via functional shRNA contained in pMOZ3308. SEQ ID NO: 3 and SEQ ID NO: 24 corresponded to pMOZ3309, which targeted ATG5 via functional shRNA contained in pMOZ3309. SEQ ID NO: 4 and SEQ ID NO: 25 corresponded to pMOZ3310, which targeted ATG5 via functional shRNA contained in pMOZ3310. SEQ ID NO: 5 corresponded to pMOZ3557, which targeted NBR1 via functional shRNA contained in pMOZ3557. SEQ ID NO: 6 corresponded to pMOZ3558, which targeted NBR1 via shRNA contained in pMOZ3558. SEQ ID NO: 7 corresponded to pMOZ3559, which targeted ATG5 via shRNA contained in pMOZ3559. SEQ ID NO: 8 corresponded to pMOZ4095, which targeted ATG5 via shRNA contained in pMOZ4095. SEQ ID NO: 9 corresponded to pMOZ4096, which targeted NBR1 via shRNA contained in pMOZ4096.Example 1: Production of Recombinant Plant Made In-Vivo Casein Micelles

[0160] Vectors: Multigene vectors, such as the plasmids described above, were isolated, wherein the vectors expressed the coding regions for the following proteins: (1) bovine a-Sl-casein(Uniprot accession # P02662), (2) green fluorescent protein (GFP, Uniprot accession # P42212), 3) bovine P-casein (Uniprot accession # P02666), (4) bovine K-casein (Uniprot accession # P02668), and (5) bovine FAM20C kinase (uniprot accession number # F1MXQ3). The vectors, which express SEQ ID NOs: 1-10, 12, 14, 16, 18, 20-25 were assembled using the modular cloning system MoClo (Engler, Carola, Mark Youles, Ramona Gruetzner, Tim-Martin Ehnert, Stefan Werner, Jonathan D. G. Jones, Nicola J. Patron, and Sylvestre Marillonnet. “A Golden Gate Modular Cloning Toolbox for Plants.” ACS Synthetic Biology 3, no. 11 (November 21, 2014): 839-43. https: / / doi.org / 10.1021 / sb4001504). All proteins were expressed under constitutively active, seed specific, or synthetic plant promoters, with a subset of these proteins possessing translationally-fused epitope tags and / or target-peptide sequences on their C-termini.

[0161] Caseins: Gene sequences encoding bovine a-Sl-casein (P02662), bovine P-casein (P02666), and bovine K-casein (P02668) were derived from Uniprot and modified to include the following C-terminal elements: (a) (AGTTCG): two-serine spacer providing adequate folding space without steric hindrance; (b) (GATTACAAAGATGACGACGATAAG): flag-tag for protein identification / purification; (c) (CATCATCACCATCACCAC): 6-Histidine tag for protein identification / purification; and (d) (CATGATGAGTTG): HDEL target peptide for endoplasmic reticulum (ER) retention.

[0162] Additionally, an N-terminus signal peptide, gmGlycininl (GY1, P04776), was added to all three caseins to target them towards the ER and vacuoles. Recombinant casein sequences were expressed under the constitutive AtuMas promoter and 5' untranslated region (UTR). Reference: NCBI PMC287101 (https: / / www.ncbi.nlm.nih.gov / pmc / articles / PMC287101 / ).

[0163] E. coli transformation: The plasmids, above, were each transformed into a Lucigen Ecloni 10G bacterium using the following chemical transformation protocol. First, Lucigen Ecloni 10G E.coli thermo-competent cells were thawed on ice for approximately 5 minutes. Then, competent cells were spiked with 1 pg-100 ng of plasmid DNA and left to incubate on ice for 10 minutes. Once complete, the plasmid-bacterial mixture was heat shocked at 42°C for 90 seconds and immediately replaced on ice for 5 minutes. Afterwards, transformed cells were mixed with lOOpl of liquid broth (LB) and cultured in a 37°C shaker set to 225 rpm for 45minutes. Following incubation, cultured bacteria was plated on LB agar plates with the appropriate antibiotic for selection (1 :1000 concentration) and left to further incubate overnight in a 37°C growth chamber.

[0164] High throughput blue-white selection: Following overnight incubation, plates were checked for bacterial colony growth. To increase recombinant bacteria selection, a MoClo compatible blue-white selection system was used. Tn brief, blue-white selection plasmid vectors carry the “lacZ” operon sequence within their multiple cloning site. In the absence of recombinant DNA, the lacZ operon will enable a biochemical reaction that turns the colony blue. Whereas, when recombination occurs, lacZ operon activity will be disrupted leaving the colony to be white. For each cloning reaction, at least two white colonies were chosen for further verification.

[0165] Plasmid selection and verification: Picked colonies were placed in 5 mLs of LB plus their respective selection antibiotic (1 :1000 concentration) and cultured overnight in a 37°C shaker (225 rpm). Once cloudy, plasmids were purified out of bacteria using the NucleoSpin miniprep kit (Takara bio inc.). Then, each plasmid was digested using the appropriate restriction enzymes in order to confirm the presence of a DNA insert and sent for sanger and nanopore sequencing to confirm sequence correctness. Colonies containing the correct plasmids were made into frozen 20% glycerol stocks.

[0166] Electroporation into agrobacterium: The completed plasmids were each transformed into a respective EHA105 electrocompetent agrobacterium cell. To achieve this, 30ng of the purified plasmid was mixed into ice-thawed electrocompetent cells and swiftly transferred into a pre-chilled 0.2 cm Gene pulser cuvette. The cuvette was then loaded into an electroporation chamber and given an electric pulse of 2.5kV. The resulting transformed cells were mixed with 500 pl of LB and left to culture in a 28°C shaking incubator (120rpm) for 2-4 hours. Afterwards, cultured cells were plated onto LB agar plates containing the appropriate antibiotic selection media and placed in a 28°C incubator for two days. Once colonies formed, a minimum of three were picked for further verification via purification, digestion, and sequencing.

[0167] Transient agrobacterium transformation into zygotic soy embryos: Zygotic soybeans were transiently transformed using agrobacterium. Specifically, a 5mL starter culture of agrobacterium, which contains the plasmid, was started from either a glycerol stock or bacterial colony and incubated for two days in a 28°C shaker (120rpm). Once cloudy, the 5mL starter culture was used to inoculate a larger 200mL overnight culture.

[0168] Bacteria preparation: Large plasmid agrobacterium cultures were spun down in a large centrifuge at 3400g for 10 minutes. The supernatant was then removed and the remaining agrobacterium pellet was resuspended in 30mL of LCCM. Post resuspension, the agrobacterium was centrifuged at 3400g for 6 minutes, and then subjected to one more round of supernatant removal, pellet resuspension and centrifugation. After the final spin down, the remaining supernatant was removed and the bacterial pellet was resuspended in lOmL of LCCM. An OD600 measurement was then taken and the agrobacterium solution was diluted to a final concentration of 1.4 OD600. The resulting agrobacterium solution was spiked with fresh acetosyringone (lOOpM final concentration) and subsequently incubated at room temperature while shaking (120rpm) for 1-2 hours.

[0169] Seed sterilization and preparation: During the agrobacterium incubation period, pods were picked from soy plants containing 8-10 mm embryos (~8 weeks old) and sterilized by the following method: 70% ethanol bath for 30 seconds, 10% bleach bath for 10 minutes, three sequential sterilized deionized water bath for 5 minutes each. After sterilization, seeds were aseptically removed from their pods, dissected from their seed coats, and split in half.

[0170] Explant inoculation: Once agrobacterium cultures finished incubating, silwet-77 (0.03% v / v) was added and mixed until dissolved. Then, 30 cotyledon halves (15 explants) were placed in the agrobacterium culture (which contained the vectors), and sonicated for 20 seconds at a 20% amplitude with 5s / l / s on / off pulse cycles. The contact of the cotyledon halves and the agrobacterium culture (which contained the vectors) allowed for the suppression of autophagy in the cotyledon. After sonication, explants were vacuum infiltrated for 5 minutes and left to incubate for two hours on a room temperature rotator.

[0171] Plating explants: Explants were removed from bacterial culture and placed flat down (adaxial side down) on SCCM plates with a layer of sterile filter paper. Plates were then wrapped with micropore tape and incubated for 3 days in a dark 24°C chamber.

[0172] Washing explants: After plants incubated in the dark for 3 days, they were washed three times for five minutes each with sterile water containing Rif, Carb+Cef Then, they were replated on SCCM plates containing filter paper and left to incubate in a dark 24°C chamber for another 7-9 days.

[0173] Protein Crude Extraction: Roughly 40 plates containing the plasmids - transformed cotyledons were flash frozen in liquid nitrogen and crushed into a fine powder. Then, 100 grams of powder was measured out and mixed with a tris protein extraction buffer (50 mM Tris, 300 mM KC1, 0.5% Tween-20, 3.65% glycerol, Sigma plant protease inhibitor, pH 8.6). The resulting mixture rotated for 1 hour at 4°C and then spun down at 1300rpm for 30 minutes at 4°C.

[0174] Casein purification: Crude protein extract was first clarified using a ,45pm filter. Then, the sample was mixed with nickel resin, rotated at 4°C for 4 hours, and subsequently centrifuged for 2 minutes at 1000g. After centrifugation, the supernatant was removed and the remaining sample was washed with a wash buffer (50mM Tris base, 300mM KCL, 20mM imidazole, pH 7.4). To remove impurities, the wash step was repeated four times. After the last wash, the proteins were rotated in an elution buffer at 4°C for 15 minutes. Then, they were centrifuged at 700g for two minutes. The supernatant was saved for later analysis and the elution step was repeated another four times.

[0175] Casein characterization: To confirm successful purification of the caseins, the first three elution samples were run on a BioRad TGX AnykD Mini Protean SDS-PAGE gel and blotted (Western blot) with antibodies against FLAG to check for the presence of the caseins, whereby: “WT” is wildtype control. “Flag” is a positive control for flag tag. “Wl” is wash 1. “El” (elution 1), “E2” (elution 2) and “E3” (elution 3) are serial elution. This blot was compared to the initial flow through and wash supernatants, which were expected to have minimal FLAG detection. Positive bands were enriched in the elution samples and present at the expected size of 27kDa.As all three caseins have Flag tag, mass spectrometry was used to confirm the presence of all three proteins.Example 2: Effect of ATG5 and NBR1 Suppression on Heterologous Protein Accumulation

[0176] The following example will demonstrate the effects of targeted suppression of autophagy components on heterologous protein accumulation in soybean plants.

[0177] Glycine max (L.) Merr. plants were transformed with constructs targeting the ATG5 and NBR1 autophagy components. The control plants received only the casein expression construct. Four experimental groups were tested: plants which expressed ATG5 targeted with shRNA (e.g., using constructs from SEQ ID NOs: 3, 4, 7, 8, 24, and 25); plants expressing NBR1 targeted with shRNA (e.g., using constructs from SEQ ID NOs: 1, 2, 5, 6, 9, 22, and 23); and plants expressing both targeting shRNAs simultaneously, and control plants.

[0178] The targeting constructs were designed based on the native soybean sequences of ATG5 and NBR1 . The high sequence similarity between the two soybean ATG5 orthologs(Glyma.14G210200 and Glyma.02G240700) allowed for simultaneous targeting with a single shRNA construct. Similarly, the NBR1 constructs will target both soybean NBR1 genes (Glyma.05 G041600 and Glyma.17G084700).

[0179] Three vector systems employed for delivery of the suppression constructs: vector series 2437 (represented in SEQ ID NOs: 1 -4), 3259 (represented in SEQ ID NOs: 5-8), and 4026 (represented in SEQ ID NOs: 8-9). These vectors provide different options for expression control and will allow optimization of the suppression system.

[0180] Plant samples were analyzed for recombinant protein accumulation, shRNA expression levels, and autophagy marker protein levels. Analysis will include protein extraction and quantification, RNA analysis to confirm shRNA expression, and assessment of ATG5 and NBR1 protein levels to confirm suppression efficiency.

[0181] The experimental design specifically examined the individual and combined effects of ATG5 and NBR1 suppression on heterologous protein accumulation. The use of multiple vectorsystems and targeting constructs will allow optimization of the suppression approach while maintaining plant viability.Example 3: Conservation Analysis Supporting Cross-Species Application

[0182] The following example demonstrated the evolutionary conservation of autophagy components between soybean and Arabidopsis, supporting the broader applicability of the targeting approach.

[0183] Sequence analysis was performed by comparing soybean ATG5 with its Arabidopsis ortholog, and soybean NBR1 with its Arabidopsis counterpart. This analysis identified conserved regions suitable for targeting in multiple species.

[0184] The high degree of conservation observed in the ATG5 sequences suggested regions where shRNA targeting could be effective across species. Similarly, analysis of NBR1 conservation patterns identified domains critical for autophagy receptor function that could serve as targeting sites.

[0185] This comparative analysis informed the design of targeting constructs that could be effective in multiple plant species, potentially extending the utility of the disclosure beyond soybean.Example 4: Assessment of Plant Viability Under Autophagy Suppression

[0186] The following example evaluated the effects of ATG5 and NBR1 suppression on plant growth and stress responses in the absence of heterologous protein expression.

[0187] Glycine max (L.) Merr. plants were transformed with the suppression constructs alone, without the casein expression system. Four experimental groups were established: ATG5 suppression only (using constructs from SEQ ID NOs: 3, 4, and 7), NBR1 suppression only (using constructs from SEQ ID NOs: 1, 2, 5, and 6), combined ATG5 and NBRl suppression (utilizing plasmids pMOZ4095 and pMOZ4096), and wild-type controls.

[0188] The experimental analysis encompassed multiple aspects of plant development and stress response. Primary growth parameters measured include plant height, leaf area, and total biomassaccumulation. Developmental progression was tracked through key events such as flowering time and seed set. Environmental stress responses were assessed through controlled exposure to drought and heat conditions. Additional measurements included final seed yield, seed quality parameters, and molecular markers of native protein turnover.

[0189] This control experiment was essential for distinguishing between effects caused by autophagy suppression itself versus effects specifically related to heterologous protein accumulation; and establishing the optimal balance between enhanced protein accumulation and maintained plant vigor.

[0190] Results from this experiment informed strategies for fine-tuning expression of the suppression constructs, potentially through the use of inducible or tissue-specific promoters if constitutive suppression shows adverse effects.Example 5: Synthetic Milk formulation

[0191] Milk primarily consists of approximately 40% casein proteins, with most of these proteins being in micellar form, as obtained from, for example, pMOZ3307, pMOZ3308, pMOZ3309, or pMOZ3310. Therefore, in order to begin testing if purified caseins can be reconstituted into micelles, purified casein powder was purchased and turned into milk. To achieve this, 2.5 g of casein powder (Sigma Aldrich C3400-500G) was added to 50ml of deionized water. The resulting casein solution was then stirred and heated to 37°C using a stir bar and magnetic hot plate. Once at temperature, the following minerals were added in sequential order: ImL tripotassium citrate, 6 mL potassium phosphate, and 5mL calcium chloride. Then, 625 pl of potassium phosphate and 1250pl of calcium chloride was added eight additional times in four minute intervals. After all components were added, the casein solution remained stirring but allowed to gradually cool for one hour. Then, 12 mL of deionized water and 9mL of heavy cream was added to the solution.Example 6: Synthetic fat free cheese formulation

[0192] Synthetic cheese formulation: A critical step in cheesemaking is the modification of functional casein micelles, as obtained from, for example, pMOZ3307, pMOZ3308, pMOZ3309,pMOZ3310, pMOZ3357, pMOZ3358, pPMOZ3359, pMPOZ4095, or pMOZ4096. Indeed, cheese makers use rennet enzymes, which function to aggregate micelles and form a curd by modifying k-casein. Synthetic cheese was produced from synthetic milk by first cooling the synthetic milk down to 14°C with an ice bath, pH’d to 5.6 using citric acid, and then heated to 32°C. Additionally, in parallel to the synthetic milk treatment, 200mL of water was heated to 80°C. Once the water reached temperature, 200pl of it was separated out and vigorously mixed with 50pl of rennet. Then, the rennet solution was added to the heated synthetic milk. The resulting synthetic milk was stirred with a spatula and left to sit for 15 minutes, where it began to form curds. Once many curds formed, they were cut into horizontal and vertical pieces and further heated to 41°C. The resulting whey (remaining liquid) was separated from the curds by use of a cheese cloth. The removal of whey was repeated four times. The remaining cheese curds were placed in a beaker and slowly suspended in 50mL of 80°C water, where it sat for 5 minutes prior to being drained of water. Then it was resuspended for another 5 minutes in order for the curds to homogenize, forming a cheese ball.Example 7: Recombinant milk formulation

[0193] In this example, 800pg / 50pl of purified pMOZ3307, pMOZ3308, pMOZ3309, or pMOZ3310 caseins in micellar form were subjected to the synthetic milk protocol but scaled down to make only 50pl. Specifically, ,3pL tripotassium citrate, and 1.16uL potassium phosphate, and 1.6 pl of calcium chloride were used for the initial mineral conditions and ,2pL Potassium Phosphate Sol. and .4 pL Calcium Chloride Sol. were added every 4 minutes for a total of 12 times.

[0194] Presence of casein phosphorylation sites: To form functional micelles (e.g, pMOZ3307, pMOZ3308, pMOZ3309, or pMOZ3310 caseins in micellar form) for milk making, casein proteins require phosphorylation. Phosphorylation enables caseins to bind to calcium phosphate and exist in a colloidal state, and without it, caseins will aggregate during the milk making process. Therefore, to validate the casein phosphorylation, recombinant milk samples were sent for mass spectroscopy. This analysis revealed the expression of all three caseins andthe presence of a phosphosite on beta casein (i.e., nucleic acid sites associated with phosphorylation).

[0195] Immunogold electron microscopy for micelle validation: Casein micelles (e g., pMOZ3307, pMOZ3308, pMOZ3309, or pMOZ3310 caseins in micellar form) have been previously shown to be detectable using transmission electron microscopy (TEM). Therefore, recombinant milk, synthetic milk, non-fat raw bovine milk, and a purified sample of non-casein soy proteins, were all fixed in a 0.1% PFA solution, embedded in LR white resin, and immunolabeled with commercially available beta polyclonal antibodies (ProSci did the rabbits, Pacific Immunology did the goats, Bioss antibodies) and colloidal gold -conjugated 6 nm secondary antibodies (Ted Pella, inc. or Electron Microscopy Sciences). Each sample was imaged on a Talos L120C G2 transmission electron microscope using practices known to those skilled in the art. Each sample possessed spherical protein-assembled structures but only the samples containing caseins were decorated with anti -beta-bound gold particles. Recombinant milk, derived from pMOZ3307, pMOZ3308, pMOZ3309, or pMOZ3310, had FLAG tags at the C-terminus of each casein. Therefore, as a secondary method for detection, each sample was stained with FLAG primary antibodies (ProteinTech) and colloidal gold -conjugated lOnm secondary particles (Ted Pella, inc. or Electron Microscopy Sciences). FLAG-bound gold particles were only detected in recombinant milk, derived from pMOZ3307, pMOZ3308, pMOZ3309, or pMOZ3310, and not on the other non -FLAG tagged samples. To ensure that FLAG was specifically binding to casein micelles, recombinant milk, derived from pMOZ3307, pMOZ3308, pMOZ3309, or pMOZ3310, was dually stained with FLAG (lOnm secondary gold particles) and Beta (6nm secondary gold particles) The FLAG signal overlapped with Beta, suggesting that FLAG selectively stains casein micelles in recombinant milk samples.Example 8: Recombinant fat free cheese formulation

[0196] Recombinant milk was subjected to the cheesemaking process described above but scaled down to only use 50pl of recombinant milk. The resulting cheese consisted of the same texture as the synthetic cheese, as well as store bought non-fat mozzarella cheese. To confirm that recombinant cheese consisted of caseins, bovine mozzarella cheese , synthetic cheese , andrecombinant cheese were fixed for immunogold microscopy. All samples showed tight dense protein aggregates that positively stained with Beta-bound gold particles. In addition, recombinant cheese showed positive FLAG-bound gold particles.Example 9: Fats and Emulsification

[0197] Plant proteins were screened for their ability to withstand the cheese making process (pH drops to 5.6). Only one protein, Solanic potato protein, was found to remain similar in functionality despite this change in pH. This protein along with other hydrocolloid combinations were then evaluated for emulsion stability. Out of the 15 evaluated, 4 were selected for testing in the cheese application based on their prolonged emulsion stability. During cheese application trials it became apparent that emulsion stability was not necessarily related to curd formation of the recombined casein.

[0198] To create any given emulsion the hydrocolloid was first solubilized into the water / aqueous phase on a wt / wt basis. If a higher amount of hydrocolloid was used this was subtracted from the water phase. All hydrocolloids were initially added via manual spatula stirring. After initial stirring, the hydrocolloid was then sheared using an IKA T18 digital Ultra Torrax for 1 minute at 10,000 rpm.

[0199] At this point, 15 wt / wt% of oil was heated to 65°C and the resulting aqueous phase was also heated separately to this temperature using a microwave for both phases. Once both phases were at 65°C, the oil and aqueous phase were combined and were sheared for 2 minutes at 6000 rpm using an Silverson mixer. 150 ml were made at a time to allow enough material to be sheared by the Silverson.

[0200] Emulsions were then immediately added into milk that had been produced using the methods previously described. Milk was taken from larger aliquots that had been made the day previously and had been stored at 4 °C.Example 10: Method of Making a Composition Containing Plant Made In-Vivo CaseinMicelles

[0201] To prepare the Protein Solution (3% W / V), powdered micellar casein protein is mixed with deionized (DI) water. The mixing vessel is submerged in water kept at 37C and stirred at 1000 RPM. A mixer, stirring plate, or sonicator is used to mix the proteins until they are evenly dispersed in the water. The mixing speed has been optimized to disperse the proteins without entrapping air in the solution. The water content can be adjusted according to the usage of other ingredients.

[0202] Using the fats described above, product mixture A is prepared by slowly adding them to the resulting protein solution. Mixers or sonicators can be used for mixing. In a typical scenario, fats and the protein solution are mixed at medium to high speeds to ensure the oil is evenly dispersed. Sugars and flavors are then mixed into product mixture A in order to yield product mixture B. Sugars and flavors can be adjusted to suit different applications.Sequence Listings

[0203] In the compositions herein, SEQ ID NO: 1 represents a polynucleotide sequence corresponding to shRNA targeting Glycine max NBR1 (variant A), derived from plasmid pMOZ3307, wherein SEQ ID NO: 1 is Al of SEQ ID NO: 22 in pMOZ3307.

[0204] In the compositions herein, SEQ ID NO: 2 represents a polynucleotide sequence corresponding to shRNA targeting Glycine max NBR1 (variant B), derived from plasmid pMOZ3308, wherein SEQ ID NO: 2 is A2 of SEQ ID NO: 23 in pMOZ3308.

[0205] In the compositions herein, SEQ ID NO: 3 represents a polynucleotide sequence corresponding to shRNA targeting Glycine max ATG5 (variant A), derived from plasmid pMOZ3309, wherein SEQ ID NO: 3 is A3 of SEQ ID NO: 24 in pMOZ3309.

[0206] In the compositions herein, SEQ ID NO: 4 represents a polynucleotide sequence corresponding to shRNA targeting Glycine max ATG5 (variant B), derived from plasmid pMOZ3310, wherein SEQ ID NO: 4 is A4 of SEQ ID NO: 25 in pMOZ3310.

[0207] In the compositions herein, SEQ ID NO: 5 represents a polynucleotide sequence corresponding to shRNA targeting NBR1 shRNA variant A, derived from expression vector pMOZ3557.

[0208] In the compositions herein, SEQ ID NO: 6 represents a polynucleotide sequence corresponding to shRNA targeting NBR1 shRNA variant B, derived from expression vector pMOZ3558.

[0209] In the compositions herein, SEQ ID NO: 7 represents a polynucleotide sequence corresponding to shRNA targeting ATG5 shRNA, derived from expression vector pMOZ3559.

[0210] In the compositions herein, SEQ ID NO: 8 represents a polynucleotide sequence corresponding to shRNA targeting ATG5 shRNA, derived from expression vector pMOZ4095.

[0211] In the compositions herein, SEQ ID NO: 9 r represents a polynucleotide sequence corresponding to shRNA targeting NBR1 shRNA, derived from expression vector pMOZ4096.

[0212] In the compositions herein, SEQ ID NO: 10 represents the native DNA sequence of Glycine max ATG5 (Glyma.14G210200).

[0213] In the compositions herein, SEQ ID NO: 11 represents the corresponding amino acid sequence, which is the expression product of SEQ ID NO. 10.

[0214] In the compositions herein, SEQ ID NO: 12 represents the native DNA sequence of Glycine max ATG5 (Glyma.02G240700).

[0215] In the compositions herein, SEQ ID NO: 13 represents the corresponding amino acid sequence, which is the expression product of SEQ ID NO. 12.

[0216] In the compositions herein, SEQ ID NO: 14 represents the native DNA sequence of Glycine max NBR1 (Glyma.05G041600).

[0217] In the compositions herein, SEQ ID NO: 15 represents the corresponding amino acid sequence, which is the expression product of SEQ ID NO. 14.

[0218] In the compositions herein, SEQ ID NO: 16 represents the native DNA sequence of Glycine max NBRl (Glyma.17G084700).

[0219] In the compositions herein, SEQ ID NO: 17 represents the corresponding amino acid sequence, which is the expression product of SEQ ID NO. 16.

[0220] In the compositions herein, SEQ ID NO: 18 represents the native DNA sequence of Arabidopsis thaliana ATG5 (At5G17290).

[0221] In the compositions herein, SEQ ID NO: 19 represents the corresponding amino acid sequence, which is the expression product of SEQ ID NO. 18.

[0222] In the compositions herein, SEQ ID NO: 20 represents the native DNA sequence of Arabidopsis thaliana NBRl (At4g24690).

[0223] In the compositions herein, SEQ ID NO: 21 represents the corresponding amino acid sequence, which is the expression product of SEQ ID NO. 20.

[0224] In the compositions herein, SEQ ID NO: 22 in pMOZ3307 can be Al-Y-Bl, wherein: Al=GACTCTGCTCTTGTGATCAAGGTGAAATATGGAGATACCCTCAGGCGCTTCAGTGCTCATGTTGATGAGAATAATAGGCTGGATCTTGACATGGTTGGCTTGAGGGCAAAGATATGTTCTATCTTCAGTTTCAGTGCTGATGAAAATTTAATTCTGAGATATGTTGATGAA GATGCCAATTG;Y=gtaagtttctgcttctacctttgatatatatataataattatcattaattagtagtaatataatatttcaaatatttttttcaaaataaaagaatgtagt atatagcaattgcttttctgtagtttataagtgtgtatattttaatttataacttttctaatatatgaccaaaatttgttgatgtgcag; Bl = TTGGGAAATTGGGTTCATCTTCATCAACATATCTCAGAATTAAATTTTCATCAGCACT GAAACTGAAGATAGAACATATCTTTGCCCTCAAGCCAACCATGTCAAGATCCAGCCT ATTATTCTCATCAACATGAGCACTGAAGCGCCTGAGGGTATCTCCATATTTCACCTTGATCACAAGAGCAGAGTC, see Fig. 5.

[0225] In the compositions herein, SEQ ID NO: 23 in pMPZ3308 can be A2-Y-Y2, wherein: A2=ATGCCCCCATTTAAAAGGAGCCATAGTCACACTGATGCAATGTCTGGTATGTTCCATAAGGGGGTCCGCTGTGATGGCTGTGGTGTCTATCCAATAACTGGACCTCGTTTCAAATCCAAAGTAAAGGAAAATTATGATCTTTGCAACATTTGTTTCAATGAAATGGGT AATGGGACCAATTG;Y=gtaagtttctgcttctacctttgatatatatataataattatcattaattagtagtaatataatatttcaaatatttttttcaaaataaaagaatgtagt atatagcaattgcttttctgtagtttataagtgtgtatattttaatttataacttttctaatatatgaccaaaatttgttgatgtgcag;B2=TTGGGAAATTGGGTTTCCCATTACCCATTTCATTGAAACAAATGTTGCAAAGATCATAATTTTCCTTTACTTTGGATTTGAAACGAGGTCCAGTTATTGGATAGACACCACA GCCATCACAGCGGACCCCCTTATGGAACATACCAGACATTGCATCAGTGTGACTATGGCTCCTTTTAAATGGGGGCAT, see Fig. 5.

[0226] In the compositions herein, SEQ ID NO: 24 in pMOZ3309 can be A3-Y-B3, wherein:A3=CTTTGCTGATTTCGCTCTTGAAGCCTCAGTTCAGCACCACGCTTCCCCCTGGAGTCGACACCATTTGGTTTGAGTACAAAGGCCTCCCTCTCAAGTGGTATATACCTACTGGAGT TCTTTTTGATCTTTTGTGCGTGGAGCCAGAGAGGCCGTGGAATTTAACCCAATTG;Y=gtaagtttctgcttctacctttgatatatatataataattatcattaattagtagtaatataatatttcaaatatttttttcaaaataaaagaatgtagt atatagcaattgcttttctgtagtttataagtgtgtatattttaatttataacttttctaatatatgaccaaaatttgttgatgtgcag; B3=TTGGGAAATTGGGTTGTTAAATTCCACGGCCTCTCTGGCTCCACGCACAAAAGATCAAAAAGAACTCCAGTAGGTATATACCACTTGAGAGGGAGGCCTTTGTACTCAAACCA AATGGTGTCGACTCCAGGGGGAAGCGTGGTGCTGAACTGAGGCTTCAAGAGCGAAATCAGCAAAG, see Fig. 5.

[0227] In the compositions herein, SEQ ID NO: 25 in pMOz3310 can be A4-Y-B4, wherein:A4=AGTGTAAAGTGGAGCTTTATTAACTCACTGAAAGAGGCTGCATATGTAATAAATGGGAATAGCAAAAATGTGATGAACATGTCTCAAACTGATCAGGTGGAGCTCTGGGG CTCTGTTTTAAATGGTAACTTTGAAACTTATCGACGGGTGCCAATTG;Y=gtaagtttctgcttctacctttgatatatatataataattatcattaattagtagtaatataatatttcaaatatttttttcaaaataaaagaatgtagt atatagcaattgcttttctgtagtttataagtgtgtatattttaatttataacttttctaatatatgaccaaaatttgttgatgtgcag;B4=TTGGGAAATTGGGTTCACCCGTCGATAAGTTTCAAAGTTACCATTTAAAACAGAGCCCCAGAGCTCCACCTGATCAGTTTGAGACATGTTCATCACATTTTTGCTATTCCCA TTTATTACATATGCAGCCTCTTTCAGTGAGTTAATAAAGCTCCACTTTACACT, see Fig.5.

[0228] In the compositions herein, SEQ ID NO: 26 in pMOZ3303 can be A5-Y-B5, wherein:A5=TCTTCTCCCGCGGAGTTTTATCACTCTCTTCCGCCAATAACGAAGGCATATGGCACCGTTTGCCTGTTGGCTACCGCAACTTACCATCTTGGATTATATCATCCAGCTTACATTGCACTATTCTACGATAAAGTGTTCTACGGTTTTCAGCCAATTG;Y=gtaagtttctgcttctacctttgatatatatataataattatcattaattagtagtaatataatatttcaaatatttttttcaaaataaaagaatgtagt atatagcaattgcttttctgtagtttataagtgtgtatattttaatttataactttctaatatatgaccaaaatttgttgatgtgcag;B5=TTGGGAAATTGGGTTCTGAAAACCGTAG, see Fig. 5.

Claims

CLAIMSWhat is claimed is:

1. A plant comprising:SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, or SEQ ID NO: 26; and casein in a micelle.

2. The plant of claim 1, wherein SEQ ID NO: 26 contains non -functional short hairpin RNA and SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25 each contain a respective functional short hairpin RNA.

3. The plant of claim 2, wherein the respective functional short hairpin RNA of SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25, each correspond to higher expression levels of the casein in the micelle, in comparison to the non-functional short hairpin RNA of SEQ ID NO: 26.

4. The plant of claim 1, further comprising: genes involved regulating autophagy, wherein said genes undergo knockdown via SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25.

5. A method for enhancing recombinant protein accumulation in transgenic plants, comprising suppressing expression of autophagy-related genes ATG5 and NBR1 using shRNA constructs.

6. The method of claim 5, wherein the suppression of ATG5 and NBR1 reduces autophagy- mediated degradation of recombinant proteins.

7. The method of claim 5, wherein the shRNA constructs target conserved regions of ATG5 and NBR1 in soybean.

8. The method of claim 5, wherein the recombinant protein is a milk protein selected from the group consisting of alpha SI -casein, alpha S2-casein, beta-casein, and kappa-casein.

9. The method of claim 5, wherein the recombinant protein is an enzyme selected from the group consisting of amylases, cellulases, proteases, peroxidases, and laccases.

10. The method of claim 5, wherein the recombinant protein is a therapeutic protein selected from the group consisting of monoclonal antibodies, cytokines, and human serum albumin.

11. A transgenic plant comprising a recombinant protein expression system and a suppression system targeting ATG5 and NBR1.

12. The transgenic plant of claim 11, wherein the suppression system includes at least one shRNA construct targeting ATG5 and at least one shRNA construct targeting NBR1.

13. The transgenic plant of claim 11, wherein the suppression system is controlled by an inducible promoter.

14. The transgenic plant of claim 11, wherein the suppression system is controlled by a tissuespecific promoter.

15. A vector system for enhancing recombinant protein accumulation in plants, comprising a nucleic acid sequence encoding an shRNA construct targeting ATG5 and NBR1.

16. The vector system of claim 15, wherein the shRNA constructs are expressed under control of a constitutive promoter.

17. The vector system of claim 15, wherein the shRNA constructs are expressed under control of a stress-inducible promoter.

18. The vector system of claim 15, wherein the shRNA constructs are expressed under control of a seed-specific promoter.

19. A method for producing a recombinant protein in a plant, comprising: transforming the plant with a recombinant protein expression system; transforming the plant with a suppression system targeting ATG5 and NBR1;cultivating the plant under conditions that allow recombinant protein expression; and harvesting the recombinant protein.

20. The method of claim 19, wherein the recombinant protein accumulates at levels at least 2- fold higher than in the absence of autophagy suppression.

21. The method of claim 19, further comprising introducing a chemically inducible element allowing temporal control of ATG5 and NBR1 suppression.

22. A soybean plant genetically modified to express a recombinant protein and suppress ATG5 and NBR1 expression through an shRNA-mediated mechanism.

23. The soybean plant of claim 22, wherein the suppression of ATG5 and NBR1 does not significantly affect plant growth or yield.

24. A method for increasing the stability of an expressed protein in a transgenic plant, comprising: introducing shRNA into a plant cell, thereby inhibiting autophagy pathways via RNA interference targeting ATG5 and NBR1, wherein the shRNA is contained within SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25.

25. The method of claim 24, wherein the shRNA of SEQ ID NO: 1 and SEQ ID NO: 22 are each targeting NBR1.

26. The method of claim 24, wherein the shRNA of SEQ ID NO: 2 and SEQ ID NO: 23 are each targeting NBR1.

27. The method of claim 24, wherein the shRNA of SEQ ID NO: 3 and SEQ ID NO: 24 are each targeting ATG5.

28. The method of claim 24, wherein the shRNA of SEQ ID NO: 4 and SEQ ID NO: 25 are each targeting ATG5.

29. The method of claim 24, wherein the shRNA of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO:3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25 are functional in expressing caseins.

30. The method of claim 29, wherein the caseins are alpha casein and kappa casein.

31. The method of claim 24, wherein SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO:4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25 are each isolated and codon optimized.

32. A nucleic acid molecule comprising a nucleotide sequence that is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25.

32. The nucleic acid molecule of claim 31, wherein SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25 perform knockdown of genes regulating autophagy.

33. The nucleic acid molecule of claim 32, wherein the genes regulating autophagy consist of the group selected from: ATG5, NBR1, Glyma. l4G210200, Glyma.02G240700, Glyma.05G041600, and Glyma.17G084700.

34. The nucleic acid molecule of claim 32, wherein SSEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25 each have short hairpin ribonucleic acids (shRNA) targeting the genes regulating autophagy.

35. A method for modifying one or more plant cells to increase an expression level of a protein heterologous to the one or more plant cells, comprising: obtaining SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25 in an isolated and codon optimized state; adding SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25 in the isolated and codon optimized state, into the one or more plant cells;responsive to adding SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25, into the one or more the plant cells, contacting SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25 with genetic contents of the one or more plant cells; and responsive to contacting SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25 with the genetic contents of the one or more plant cells, performing knockdown of genes involved in autophagy regulation, thereby: suppressing transcription of the genes involved in autophagy regulation; and increasing the expression of the protein heterologous to the one or more plant cells.

36. The method of claim 35, wherein the one or more plant cells are soybean.

37. The method of claim 35, wherein protein heterologous to the one or more plant cells is casein, egg white protein, or casein and egg white protein.

38. The method of claim 35, wherein the casein is (a) SI -alpha casein; (b) S2-alpha casein; (c) beta casein; (d) kappa casein; (e) SI -alpha casein and beta casein; (f) SI -alpha casein and S2-alpha casein; (g) SI -alpha casein and kappa casein; (h) S2-alpha casein and beta casein; (i) S2-alpha casein and kappa casein; (j) beta casein and kappa casein; (k) SI -alpha casein, beta casein, and kappa casein; (1) S2-alpha casein, beta casein, and kappa casein; (m) SI -alpha casein, S2-alpha casein, and kappa casein; (n) SI -alpha casein, S2-alpha casein, and beta casein; and (o) SI -alpha casein, S2-alpha casein, beta casein, and kappa casein.

39. The method of claim 35, wherein SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25 contain functional short hairpin RNA, thereby increasing the express! onal level of casein.

40. A method for silencing genes involved in regulating autophagy, comprising: obtaining SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25 in an isolated and codon optimized state; adding SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25 in the isolated and codon optimized state, into one or more plant cells;integrating SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25 with a genome within the one or more plant cells; and performing CRISPR directed to the genes involved in autophagy regulation, thereby: suppressing transcription of the genes involved in autophagy regulation; and increasing expression of casein protein or egg white protein in the one or more plant cells.

41. A method for silencing genes involved in regulating autophagy, comprising: obtaining SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25 in an isolated and codon optimized state; adding SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25 in the isolated and codon optimized state, into a seed; adding a promoter to the seed, wherein the promoter is selected from the group consisting of: PfFAD3-l, Glycinin, and Lei; integrating SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25 with a genome within the seed; and performing knockdown of the genes involved in autophagy regulation, thereby: suppressing transcription of the genes involved in autophagy regulation; forming a micelle, wherein the micelle resides in the seed; increasing expression of casein protein, wherein the casein protein is contained within the micelle.

42. A method for silencing genes involved in regulating autophagy, comprising: obtaining SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25 in an isolated and codon optimized state; adding SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25 in the isolated and codon optimized state, into an organism; integrating SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25 with a genome within the organism; and performing gene silencing of the genes involved in autophagy regulation, thereby: suppressing transcription of the genes involved in autophagy regulation; forming a micelle, wherein the micelle resides in the seed; andincreasing expression of casein protein, wherein the casein protein is contained within the micelle.

43. The method of claim 41, wherein the gene silencing comprises: Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR), virus-induced gene silencing (VIGS), antisense oligonucleotide therapy, genomic imprinting, and RNA-directed DNA methylation.

44. A plant comprising:SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25; casein in a micelle; and one or more seeds, wherein the one or more seeds contain suppressed pathways associated with genes regulating autophagy, wherein said pathways reside solely in the one or more seeds.

45. A plant cell, comprising:SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25; casein in a micelle; promoters within seed tissue; and suppressed pathways associated with genes regulating autophagy, wherein said pathways reside solely in the seed tissue.

46. A composition comprising:SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25; casein produced in a plant or plant cell, wherein plant or plant cell comprises a suppressed pathway for regulating autophagy activity in a seed; and a micelle contained within the seed, wherein the micelle encapsulates the casein.

47. The composition of claim 46, wherein SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQID NO: 9, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25 is isolated and codon-optimized.

Images