Streptococcus preparation for treatment of respiratory tract infection

Abstract

The present disclosure relates to pharmaceutical compositions comprising live bacteria strains, and / or bacteriocin molecules which can inhibit the growth and persistence of a pathogen such as S. pneumoniae. Further aspects of the present disclosure relate to the use of the pharmaceutical populations for preventing or treating disease caused by S. pneumoniae, or use of compositions comprising live bacteria as probiotics.

Description

[0001] Streptococcus Preparation for Treatment of Respiratory Tract Infection

[0002] Field

[0003] The present disclosure relates to compositions comprising bacterial strains or combinations thereof with anti-pneumococcal activity bactericidal polypeptides, as well as the use of the compositions for prophylactic and therapeutic inhibition of a broad range of pathogenic bacterial strains.

[0004] Background

[0005] Streptococcus pneumoniae (pneumococcus) is a leading cause of infections worldwide, affecting both children and adults despite available antimicrobial therapies and vaccines. Colonization, which occurs in the form of a biofilm in the upper respiratory tract (URT), is frequent amongst the population, and is a prerequisite for disease and transmission.

[0006] While multivalent pneumococcal conjugate vaccines are highly effective, they target only a subset of the over 100 described serotypes, leading to serotype replacement over time (Ganaie F, 2020, Ganaie F, 2021 , Essink B, 2022, Weinberger DM, 2011 , Felix S, 2021 ). The emergence of multidrug-resistant S. pneumoniae strains compromises treatment options (Cherazard R, 2017) Furthermore, antibiotics have long-term effects by disturbing the microbiota and imposing global selective pressure for resistance. These challenges have spurred interest in developing alternative and complementary approaches to treat or prevent pneumococcal infections. Pneumococcal colonization, which occurs in the form of a biofilm in the upper respiratory tract (URT), is frequent and a prerequisite for disease and transmission (Weiser JN, 2018). Two recent studies have described strategies aimed to target pneumococcal colonization. One proposed the use of human endogenous bile salts (Vidal JE, 2021 ); the other resorted to phage-derived endolysins active against S. pneumoniae (Alreja AB, 2024).

[0007] The use of bacterial strains with probiotic traits for targeted therapeutic is one approach being tested in related areas of infection biology. Examples include: (i) engineered probiotic Escherichia coli strains able to reduce vancomycin-resistant enterococci and Pseudomonas aeruginosa in the gut of animal models (Hwang IY, 2017, Geldart KG 2018); (ii) a phase 1 randomized clinical trial, where a Staphylococcus hominis strain reduced the bacterial load of Staphylococcus aureus in the skin of participants with atopic dermatitis (Nakastuji T, 2021 ); (iii) the use of Streptococcus salivarius and Streptococcus oralis to prevent pharyngotonsillitis in children (Tagg JR, 2004, Andaloro C, 2019); and (iv) the use of Streptococcus dentisani to improve oral health (Ferrer MD, 2020). Studies have shown the protective effect of gut bacteria against respiratory tract infections (RTI), for example, a combination of Lactobacillus plantarum and fructo-oligosaccharide (Panigrahi P, 2017. As yet, no studies have addressed the use of bacteria to target specifically pneumococcal colonization.

[0008] Based on the above-mentioned state of the art, the objective of the present disclosure is to provide means and methods to prevent and treat respiratory infections with S. pneumoniae. This objective is attained by the subject-matter of the independent claims of the present specification, with further advantageous embodiments described in the dependent claims, examples, figures and general description of this specification. Summary of the Invention

[0009] A screening of over 300 human bacterial isolates led to the identification of Streptococcus oralis and Streptococcus mitis strains (S. oralis A22 and S. mitis B22-G22) with inhibitory activity against S. pneumoniae of multiple serotypes and genotypes. Strain F22 was mammal-adapted originating strain F22ADthat also showed inhibitory activity against S. pneumoniae.

[0010] Importantly, strains A22-G22 alone, or in combination, were able to prevent and disrupt pneumococcal biofilms, a proxy for nasopharyngeal colonization that indicates a potential for use as biotherapeutics to control and / or reduce pneumococcal colonization, preventing disease and transmission. Characterization of A22-G22 cell-free supernatants indicated the involvement of secreted proteins or peptides in the inhibitory effect of all S. mitis strains. The present disclosure relates to compositions comprising live bacterial strains, or bacterial-derived antibiotic proteins, and their therapeutic use for preventing and / or treating a disease caused by S. pneumoniae.

[0011] The present disclosure is based, in part, on the finding that strains A22-G22 as described herein, alone, or in combination, prevent S. pneumoniae progression to the lungs following a viral infection, by significantly impacting pneumococcal colonization density. In some embodiments, the viral infection is a respiratory tract infection (RTI), such as respiratory syncytial virus (RSV) and influenza A virus (IAV) infection.

[0012] The present disclosure is also based on the finding that strain F22 and F22ADprevent S. pneumoniae progression to the lungs following influenza A virus (IAV) infection, by significantly impacting pneumococcal colonization density.

[0013] A first aspect of the disclosure relates to pharmaceutical compositions comprising as active agent live bacteria, which are useful for preventing and / or inhibiting the abundance of the opportunistic pneumococcal pathogens present in a human commensal niche, such as the upper respiratory tract. Such formulations can treat, and / or prevent disease caused by S. pneumoniae. The term comprising live bacteria refers to bacteria conforming to a definition of viability meaning metabolically active, and capable of reproduction.

[0014] In some embodiments, pharmaceutical compositions according to the present disclosure comprise at least one strain described herein, namely S. oralis A22, and / or S. mitis B22-G22. In some embodiments, the pharmaceutical compositions comprise a combination of all strains.

[0015] Another aspect of the present disclosure relates to therapeutic preparations of live bacteria, particularly a strain of S. mitis, or S. oralis, comprising a nucleic acid sequence encoding at least one bacteriocin polypeptide listed in Table 6. In some embodiments, the live bacteria comprise one or more genetic locus encoding bacteriocin polypeptides, referring to the loci described in Fig. 2.

[0016] Another aspect of the present disclosure relates to isolated bacteriocin polypeptides listed in Table 6, and pharmaceutical compositions comprising same, for use in preventing and / or reducing S. pneumoniae colonization in a human subject, or treating an infection with S. pneumoniae. The Inventors demonstrate antibiotic effects of such compositions, such as the capacity to disrupt established biofilms that model the colonization conditions that are a requisite for human infection. The present disclosure further relates to use of compositions comprising S. oralis A22, and / or S. mitis, B22-G22, or comprising at least one bacteriocin polypeptide in Table 6, for use in treating S. pneumoniae infection or colonization. These compositions are useful for preventing and / or reducing colonization with the opportunistic pathogen S. pneumoniae, or disrupting established S. pneumoniae biofilms.

[0017] The present disclosure relates to a composition comprising live bacteria, wherein the live bacteria comprise, or essentially consists of, at least one strain having a DNA homology of at least 95% to a strain selected from the list consisting of Streptococcus oralis (S. oralis) A22; Streptococcus mitis (S. mitis) B22, S. mitis C22, S. mitis D22, S. mitis E22, S. mitis F22, S. mitis F22AD, S. mitis E22, and / or S. mitis G22.

[0018] In some embodiments, the live bacteria comprise: an S. oralis strain with the University of Coimbra Bacterial Culture Collection (UCCCB) accession number UCCCB 242, or an S. mitis strain with a UCCCB accession number selected from the list consisting of UCCCB 243, UCCCB 244, UCCCB 245, UCCCB 246, UCCCB 247, UCCCB 268, and UCCCB 248.

[0019] In some embodiments, the live bacteria comprise or essentially consists of a mixture of all strains as specified hereinabove.

[0020] In some embodiments, the composition comprises between 103and 101° live colony forming units (CFU) of the live bacteria. In some embodiments, the composition comprises between 104and 109CFU / mL of the live bacteria. In some embodiments, the composition comprises between 105and 107CFU / mL of the live bacteria.

[0021] Another aspect of the present disclosure relates to an isolated bacteriocin polypeptide >95%, >97%, >98%, >99%, or 100% identical to a bacteriocin polypeptide listed in Table 6, and having substantially the same biological activity compared to the bacteriocin polypeptide listed in Table 6.

[0022] Another aspect of the present disclosure relates to an use of an isolated bacteriocin polypeptide as specified in hereinabove, for inhibiting the growth of a pathogen.

[0023] Another aspect of the present disclosure relates to a composition comprising at least one isolated bacteriocin polypeptide as specified hereinabove.

[0024] In some embodiments, the composition comprises at least one polypeptide >95% >97%, >98%, >99%, or 100% similar to Bad , Bac10.1 , Bac10.2, Bac11 , Bac12.1 , Bac12.2, Bac12.3, Bac13, Bac14.1 , Bac14.2, Bac15, Bac16.1 , Bac16.2, Bac17.1 , Bac17.2, Bac18.1 , Bac18.2, Bac18.3, Bac19, Bac2, Bac20.1 , Bac20.2, Bac21.1 , Bac21.2, Bac22, Bac23, Bac24, Bac25, Bac26, Bac27, Bac3, Bac4, Bac5, Bac6, Bac7, Bac8, Bac9, BlpDi , BlpD2, BlpDs, BlpDeTrunc, BIpEi, BlpE2, BIpEs, BIpKi, BIpKz, BIpKs, BIpM, BIpN, BlpOiikei, BlpOiike2, BIpW-i, BriCiike, MIcAi, MlcA2, MldAi, MldA2, MldAs, MldA4, MldAs, PldAlcTrunc, PldA3N'Trunc, ScbA, SccA, ScfA, ScgA, SlkA. Each possibility represents a separate embodiment of the disclosure.

[0025] In some embodiments, the composition comprises at least two polypeptides >95%, >97%, >98%, >99%, or 100% similar to two bacteriocin polypeptides listed in Table 6, particularly wherein the composition comprises at least two polypeptides >95%, >97%, >98%, >99%, or 100% similar to Bac8-Bac9, Bac1- Bac2v1 , Bac1-Bac12.2, Bac1-Bac13, Bac1-Bac15, Bac1-Bac14.1 , Bac1-Bac17.1 , Bac2v2-Bac12.2, Bac12.2-Bac15, Bac12.2-Bac16.1 , Bac12.2-Bac14.1 , Bac12.2-Bac17.1 , Bac12.2-Bac18.1 , Bac1- BlpOiike2, Bac2v1-Bac10.1 , Bac2v2-BlpOiike2, Bac2v2-Bac23, Bac10.1-Bac22, Bac10.1-Bac23, Bac22- Bac23, Bac1-Bac12.1 , Bac1-Bac16.2, Bac1-Bac12.3, BlpE3-Bac13, BlpDi-Bac15, BlpDi-Bac12.1 , BlpOiike2-Bac12.1 , BlpOiike2-Bac17.1 , BlpOiike2-Bac16.2, BlpOiike2-Bac12.3, BlpOiike2-Bac14.2, BlpOiike2- Bac18.2, Bac17.1-Bac12.3, Bac12.1-Bac18.2, Bac12.3-Bac14.2, Bac12.3-Bac18.2, Bac1-Bac20.1 , Bac10.2-Bac20.1 , Bac14.1-Bac20.1 , Bac20.1-Bac21.1 , Bac1-Bac24, Bac2v2-Bac24, BlpD2-Bac24, Bac24-Bac25, Bac17.2-Bac18.3, Bac12.1-Bac18.1 , BlpE3-Bac12.3, BlpDi-Bac18.2, BlpOiike2-Bac13, and BlpOiike2-Bac15, Bac1-Bac16.1 , Bac2v2-Bac14.1 , Bac12.2-Bac13, Bac1-Bac22, Bac2v2-Bac22, Bac2v2-Bac10.1 , Bac2v2-BlpDi, Bac2v2-BlpE2, BlpOiike2-Bac22, Bac2v2-BlpE3, BlpDi-Bac13, Bad 3- Bac18.2, Bac16.2-Bac14.2, Bac20.2-Bac21.2, Bac2v2-Bac20.1. Each possibility represents a separate embodiment of the disclosure.

[0026] In some embodiments, the concentration of bacteriocin polypeptide is in the range of 1 to 1000 nM. In some embodiments, the concentration of bacteriocin polypeptide is in the range of 5 to 800 nM. In some embodiments, the concentration of bacteriocin polypeptide is in the range of 10 to 500 nM.

[0027] In some embodiments, the composition, or the bacteriocin polypeptide is formulated for upper respiratory tract, ear, genital, or enteral administration.

[0028] In some embodiments, the composition, or the bacteriocin polypeptide is for use in inhibiting and / or reducing, growth of a pathogen in a subject.

[0029] In some embodiments, the pathogen is selected from S. pneumoniae, S. parasanguinis, S. pyogenes, S. agalactiae, or any combination thereof.

[0030] In some embodiments, the composition, or the bacteriocin polypeptide is for use in inhibiting the abundance of a strain classified within the taxonomical species S. pneumoniae present in a human subject’s upper respiratory tract, oral cavity, ear, genitals, or gastrointestinal tract.

[0031] In some embodiments, the composition, or the bacteriocin polypeptide is for use in preventing and / or reducing colonization of a human subject with S. pneumoniae. In some embodiments, the subject has recently been administered an antibiotic drug. In some embodiments, the subject has recently been administered an antibiotic drug selected from a macrolide antibiotic, a lincosamide antibiotic, a tetracycline antibiotic, a beta-lactam antibiotic, a sulphonamide antibiotic, a quinolone antibiotic, co- trimoxazole, chloramphenicol, or any combination thereof.

[0032] In some embodiments, the composition, or the bacteriocin polypeptide is for use in treatment of a patient diagnosed with a S. pneumoniae infection. In some embodiments, the patient is diagnosed with an S. pneumoniae respiratory tract infection. In some embodiments, the patient is diagnosed with pneumonia caused by an S. pneumoniae infection. In some embodiments, the patient is diagnosed with pneumonia, following a viral infection.

[0033] In some embodiments, the S. pneumoniae is a strain characterized as resistant to a macrolide antibiotic, a lincosamide antibiotic, a tetracycline antibiotic, a beta-lactam antibiotic, a sulphonamide antibiotic, a quinolone antibiotic, co-trimoxazole, chloramphenicol, or any combination thereof. Another aspect of the present disclosure relates to a kit comprising the composition, or the bacteriocin polypeptide as described hereinabove. In some embodiments, the kit further comprises at least one additional medicament.

[0034] Another aspect of the present disclosure relates to a use of the composition or the bacteriocin polypeptide as described hereinabove, for inhibiting the growth of a pathogen.

[0035] Another aspect of the present disclosure relates to a use of the composition or the bacteriocin polypeptide as described hereinabove, in preparation of a medicament for treatment or prevention of a microbial infection in a subject.

[0036] Terms and definitions

[0037] General

[0038] For purposes of interpreting this specification, the following definitions will apply and whenever appropriate, terms used in the singular will also include the plural and vice versa. In the event that any definition set forth below conflicts with any document incorporated herein by reference, the definition set forth shall control.

[0039] The terms “comprising”, “having”, “containing”, and “including”, and other similar forms, and grammatical equivalents thereof, as used herein, are intended to be equivalent in meaning and to be open-ended in that an item or items following any one of these words is not meant to be an exhaustive listing of such item or items, or meant to be limited to only the listed item or items. For example, an article “comprising” components A, B, and C can consist of (i.e., contain only) components A, B, and C, or can contain not only components A, B, and C but also one or more other components. As such, it is intended and understood that “comprises” and similar forms thereof, and grammatical equivalents thereof, include disclosure of embodiments of “consisting essentially of” or “consisting of.”

[0040] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit, unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the disclosure, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the disclosure.

[0041] Reference to “about” a value or parameter herein includes (and describes) variations that are directed to that value or parameter per se. For example, description referring to “about X” includes description of “X.”

[0042] As used herein, including in the appended claims, the singular forms “a”, “or” and “the” include plural referents unless the context clearly dictates otherwise.

[0043] "And / or" where used herein is to be taken as specific recitation of each of the two specified features or components with or without the other. Thus, the term "and / or" as used in a phrase such as "A and / or B" herein is intended to include "A and B," "A or B," "A" (alone), and "B" (alone). Likewise, the term "and / or" as used in a phrase such as "A, B, and / or C" is intended to encompass each of the following aspects: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0044] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art (e.g., in cell culture, molecular genetics, nucleic acid chemistry, hybridization techniques and biochemistry, organic synthesis). Standard techniques are used for molecular, genetic, and biochemical methods (see generally, Sambrook et al., Molecular Cloning: A Laboratory Manual, 4th ed. (2012) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. and Ausubel et al., Short Protocols in Molecular Biology (2002) 5th Ed, John Wiley & Sons, Inc.) and chemical methods.

[0045] The term pharmaceutical composition comprising live bacteria in the context of the present specification relates a population of bacteria according to the present disclosure, present in a formulation, for example, a solution, or lyophilised product, comprising at least a proportion of viable bacteria. Viability can be confirmed by known methods such as enzymatic assays, imaging with live fluorescence dyes, planktonic culture in media measured by optical density over time, or growth on agar. A proportion of dead bacteria, or bacterial products or debris, may also be present in such a pharmaceutical preparation of live bacteria.

[0046] The term Streptococcus mitis (S. mitis) in the context of the present specification relates to any strain classified as the species S. mitis, in the genus Streptococcus, family Streptococcaceae, order Lactobacillales. These are gram-positive bacteria with a coccus (spherical) shape, catalase negative, and are facultative anaerobes.

[0047] The term Streptococcus oralis (S. oralis) in the context of the present specification relates to any strain classified as the species S. oralis, in the genus Streptococcus, family Streptococcaceae, order Lactobacillales. These are gram-positive bacteria with a coccus (spherical) shape, catalase negative, and are facultative anaerobes.

[0048] The term upper respiratory tract in the context of the present specification refers to the microbial commensal niche encompassing the nose or nostrils, nasal cavity, mouth, throat (nasopharynx and oropharynx), and voice box (larynx).

[0049] The term bacteriocin polypeptide in the context of the present specification relates to peptides, and polypeptides derived from bacteria, here S. mitis and S. oralis, which inhibit the growth of other bacterial strains, here namely S. pneumoniae. Bacteriocins according to the present disclosure are listed in Table 6.

[0050] The term antibiotic, or antibiotic drug in the context of the present specification relates to compounds which either suppress or inhibit bacterial growth, or compounds which kill bacteria. The term encompasses both pharmaceutical formulations for administration to a subject to prevent or treat disease, and also encompasses antiseptic products, and preservatives that prevent bacterial growth in non-therapeutic settings. Resistance to an antibiotic refers to a reduced susceptibility to growth inhibition, or killing by a specific antibiotic compound for a particular bacterial strain. The term subject, in the context of the present specification refers to an individual, or a patient, which is a vertebrate, e.g., a mammal. In some embodiments, the subject is a mammal. In some embodiments, the subject is a human.

[0051] The term pathogen, in the context of the present specification refers to any pathogen capable of inducing a disease in a subject. In some embodiments, the pathogen is a microorganism selected from the group consisting of bacteria, fungi, viruses and parasites.

[0052] The term therapeutically effective amount refers to a concentration of a strain, composition, or bacteriocin polypeptide according to the present disclosure, or their combination, normalized to body weight, that is effective to prevent and / or treat a disease or disorder in a subject. The term “a therapeutically effective amount” refers to an amount effective, at dosages and for periods of time necessary, to achieve a desired therapeutic or prophylactic result. A physician or veterinarian of ordinary skill can readily determine and prescribe the effective amount required.

[0053] Sequences

[0054] Sequences similar or homologous (e.g., at least about 70% sequence identity) to the sequences disclosed herein are also part of the disclosure. In some embodiments, the sequence identity at the amino acid level can be about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher. At the nucleic acid level, the sequence identity can be about 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher. Alternatively, substantial identity exists when the nucleic acid segments will hybridize under selective hybridization conditions (e.g., very high stringency hybridization conditions), to the complement of the strand. The nucleic acids may be present in whole cells, in a cell lysate, or in a partially purified or substantially pure form.

[0055] In the context of the present specification, the terms sequence identity and percentage of sequence identity refer to a single quantitative parameter representing the result of a sequence comparison determined by comparing two aligned sequences position by position. Methods for alignment of sequences for comparison are well-known in the art. Alignment of sequences for comparison may be conducted by the local homology algorithm of Smith and Waterman, Adv. Appl. Math. 2:482 (1981 ), by the global alignment algorithm of Needleman and Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity methods of Pearson and Lipman, Proc. Nat. Acad. Sci. 85:2444 (1988) or by computerized implementations of these algorithms, including, but not limited to: CLUSTAL, GAP, BESTFIT, BLAST, FASTA and TFASTA. Software for performing BLAST analyses is publicly available, e.g., through the National Center for Biotechnology-Information (http: / / blast.ncbi.nlm.nih.gov / ).

[0056] One example for comparison of amino acid sequences is the BLASTP algorithm that uses the default settings: Expect threshold: 10; Word size: 3; Max matches in a query range: 0; Matrix: BLOSUM62; Gap Costs: Existence 11 , Extension 1 ; Compositional adjustments: Conditional compositional score matrix adjustment. One such example for comparison of nucleic acid sequences is the BLASTN algorithm that uses the default settings: Expect threshold: 10; Word size: 28; Max matches in a query range: 0; Match / Mismatch Scores: 1.-2; Gap costs: Linear. Unless stated otherwise, sequence identity values provided herein refer to the value obtained using the BLAST suite of programs (Altschul et al., J. Mol. Biol. 215:403-410 (1990)) using the above identified default parameters for protein and nucleic acid comparison, respectively.

[0057] Reference to identical sequences without specification of a percentage value implies 100% identical sequences (i.e. the same sequence). Particular embodiments make use of the sequences as disclosed herein (i.e. 100% identical).

[0058] The term having substantially the same biological activity in the context of the present disclosure relates to either one or both main functions of a bacteriocin protein, or a composition comprising therapeutic bacteria i.e. inhibitory activity of S. pneumoniae strain growth. The skilled person is aware of methods of comparing S. pneumoniae with and without the presence of a composition comprising a therapeutic bacteriocin polypeptide, or a therapeutic preparation of live bacteria according to the disclosure, such as inhibition of a strain of an S. pneumoniae culture on solid agar (a ‘halo’ / overlay assay, see Fig. 5A, Table 1 ), measuring planktonic growth in liquid media (e.g. Fig. 5B, Fig. 5C), or inhibition of multi-strain biofilms (see Fig. 4,). In particular embodiments of a live bacteria pharmaceutical composition according to the disclosure, it provides equivalent inhibition according to the thresholds for inhibition in an overlay assay as described with reference to Table 1. In particular embodiments of a bacteriocin polypeptide composition according to the present disclosure, it provides equivalent inhibition according to the thresholds for inhibition in the assay as described by Fig. 5C.

[0059] General Biochemistry: Peptides, Amino Acid Sequences

[0060] The term polypeptide in the context of the present specification relates to a molecule consisting of 50 or more amino acids that form a linear chain wherein the amino acids are connected by peptide bonds. The amino acid sequence of a polypeptide may represent the amino acid sequence of a whole (as found physiologically) protein or fragments thereof. The term "polypeptides" and "protein" are used interchangeably herein and include proteins and fragments thereof. Polypeptides are disclosed herein as amino acid residue sequences.

[0061] The term peptide or oligopeptide in the context of the present specification relates to a molecule consisting of up to 50 amino acids, 8 to 30 amino acids, or 8 to 15 amino acids, that form a linear chain wherein the amino acids are connected by peptide bonds. Each possibility represents a separate embodiment of the disclosure.

[0062] Amino acid residue sequences are given from amino to carboxyl terminus. Capital letters for sequence positions refer to L-amino acids in the one-letter code (Stryer, Biochemistry, 3rded. p. 21 ). Lower case letters for amino acid sequence positions refer to the corresponding D- or (2R)-amino acids. Sequences are written left to right in the direction from the amino to the carboxy terminus. In accordance with standard nomenclature, amino acid residue sequences are denominated by either a three letter or a single letter code as indicated as follows: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic Acid (Asp, D), Cysteine (Cys, C), Glutamine (Gin, Q), Glutamic Acid (Glu, E), Glycine (Gly, G), Histidine (His, H), Isoleucine (lie, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), and Valine (Vai, V). The term variant refers to a polypeptide that differs from a reference polypeptide, but retains essential properties. A typical variant of a polypeptide differs in its primary amino acid sequence from another, reference polypeptide. Generally, differences are limited so that the sequences of the reference polypeptide and the variant are closely similar overall and, in many regions, identical. A variant and reference polypeptide may differ in amino acid sequence by one or more modifications (e.g., substitutions, additions, and / or deletions). A substituted or inserted amino acid residue may or may not be one encoded by the genetic code. A variant of a polypeptide may be naturally occurring such as an allelic variant, or it may be a variant that is not known to occur naturally.

[0063] General Molecular Biology: Nucleic Acid Sequences, Expression

[0064] The term gene refers to a polynucleotide containing at least one open reading frame (ORF) that is capable of encoding a particular polypeptide or protein after being transcribed and translated. A polynucleotide sequence can be used to identify larger fragments or full-length coding sequences of the gene with which they are associated. Methods of isolating larger fragment sequences are known to those of skill in the art.

[0065] The term transgene in the context of the present specification relates to a gene or genetic material that has been transferred from one organism to another.

[0066] The term recombinant in the context of the present specification relates to a nucleic acid, which is the product of one or several steps of cloning, restriction and / or ligation and which is different from the naturally occurring nucleic acid.

[0067] The terms gene expression or expression, or alternatively the term gene product, may refer to either of, or both of, the processes - and products thereof - of generation of nucleic acids (RNA) or the generation of a peptide or polypeptide, also referred to transcription and translation, respectively, or any of the intermediate processes that regulate the processing of genetic information to yield polypeptide products. The term gene expression may also be applied to the transcription and processing of a RNA gene product, for example a regulatory RNA or a structural (e.g. ribosomal) RNA. Expression may be assayed both on the level of transcription and translation, in other words mRNA and / or protein product.

[0068] The term nucleotides in the context of the present specification relates to nucleic acid or nucleic acid analogue building blocks, oligomers of which are capable of forming selective hybrids with RNA or DNA oligomers on the basis of base pairing. The term nucleotides in this context includes the classic ribonucleotide building blocks adenosine, guanosine, uridine (and ribosylthymine), cytidine, the classic deoxyribonucleotides deoxyadenosine, deoxyguanosine, thymidine, deoxyuridine and deoxycytidine. It further includes analogues of nucleic acids such as phosphothioates, 2’0-methylphosphothioates, peptide nucleic acids (PNA; N-(2-aminoethyl)-glycine units linked by peptide linkage, with the nucleobase attached to the alpha-carbon of the glycine) or locked nucleic acids (LNA; 2’0, 4’C methylene bridged RNA building blocks). Wherever reference is made herein to a hybridizing sequence, such hybridizing sequence may be composed of any of the above nucleotides, or mixtures thereof. Therapeutic compositions and medical uses

[0069] As used herein, the term treating or treatment of any disease or disorder (e.g. pneumonia) refers in one embodiment to ameliorating the disease or disorder (e.g. slowing or arresting or reducing the development of the disease or at least one of the clinical symptoms thereof). In another embodiment "treating" or "treatment" refers to alleviating or ameliorating at least one physical parameter including those which may not be discernible by the patient. In yet another embodiment, "treating" or "treatment" refers to modulating the disease or disorder, either physically, (e.g., stabilization of a discernible symptom), physiologically (e.g., stabilization of a physical parameter), or both. The term encompasses treatment to reduce, prevent, or inhibit colonization, or re-colonization of a human microbiome niche with S. pneumoniae. Methods for assessing treatment and / or prevention of disease are generally known in the art, unless specifically described hereinbelow.

[0070] As used herein, the term pharmaceutical composition refers to a bacteriocin of the present disclosure, or preparation of one or more live bacterial strains, formulated for mucosal administration. A bacteriocin or a preparation of one or more live bacterial strains according to the present disclosure is formulated for enteral, upper respiratory tract, or topical, administration. In some embodiments, a formulation as described herein comprises a pharmaceutically acceptable carrier. In some embodiments, a bacteriocin according to the present disclosure is formulated for parenteral administration, for example injectable administration.

[0071] As used herein, the term pharmaceutically acceptable carrier includes any solvents, dispersion media, coatings, surfactants, antioxidants, preservatives (for example, antibacterial agents, antifungal agents), isotonic agents, absorption delaying agents, salts, preservatives, drugs, drug stabilizers, binders, excipients, disintegration agents, lubricants, sweetening agents, flavouring agents, dyes, and the like and combinations thereof, as would be known to those skilled in the art (see, for example, Remington: the Science and Practice of Pharmacy, ISBN 08571 10624). The present disclosure also encompasses nanoparticles, liposomes, or cellular carriers within the meaning of pharmaceutically acceptable carrier.

[0072] Detailed Description of the Invention

[0073] Therapeutic bacterial compositions

[0074] A first aspect of the present disclosure relates to pharmaceutical compositions comprising live commensal bacteria, with the capacity to inhibit growth and persistence of the disease-causing pathogen S. pneumoniae. The live bacteria component of the composition comprises at least one strain having a DNA homology of at least 95% to a strain selected from the list consisting of Streptococcus oralis (S. oralis) A22; Streptococcus mitis (S. mitis) B22, S. mitis C22, S. mitis D22, S. mitis E22, S. mitis F22, S. mitis F22AD, S. mitis E22, and / or S. mitis G22. In some embodiments, the live bacteria component of the composition comprises at least one strain having a DNA homology of at least 95%, at least 97%, at least 98%, or at least 99%, to a strain selected from the list consisting of Streptococcus oralis (S. oralis) A22; Streptococcus mitis (S. mitis) B22, S. mitis C22, S. mitis D22, S. mitis E22, S. mitis F22, S. mitis F22AD, S. mitis E22, and / or S. mitis G22. Each possibility represents a separate embodiment of the disclosure. In some embodiments, the live bacteria component of the composition comprises at least one strain selected from the list consisting of Streptococcus oralis (S. oralis) A22; Streptococcus mitis (S. mitis) B22, S. mitis C22, S. mitis D22, S. mitis E22, S. mitis F22, S. mitis F22AD, S. mitis E22, and / or S. mitis G22. Strains described herein include strains that are mammal-adapted. It will become apparent to a person skilled in the art that a mammal-adapted strain refers to a strain adapted to grow and replicate in a mammal. Methods to achieve adapted strains are known in the art and include sequential passage of a strain in a mammal.

[0075] An example of each strain is available from deposits under the Budapest Treaty on the International Recognition of the Deposit of Microorganisms at the University of Coimbra Bacterial Culture Collection (UCCCB) with the following accession numbers: UCCCB 242 (S. oralis A22), UCCCB 243 (S. mitis B22), UCCCB 244 (S. mitis C22), UCCCB 245 (S. mitis D22), UCCCB 246 (S. mitis E22), UCCCB 247 (S. mitis F22), UCCCB 268 (S. mitis F22AD), and UCCCB 248 (S. mitis G22).

[0076] In some embodiments, the bacterial component of the composition essentially consists of one of the above strains. In other embodiments, the composition comprises, or essentially consists of a combination of at least two of these strains. In particular embodiments, the composition comprises in addition to live bacteria, at least one pharmaceutically acceptable carrier, diluent or excipient as described in detail in the section Pharmaceutical Compositions, Administration / Dosage Forms and Salts.

[0077] A composition according to the present disclosure comprising only S. oralis A22 was demonstrated to inhibit S. pneumoniae biofilms under a wide range of conditions. In certain embodiments, the pharmaceutical composition according to the present disclosure consists of the bacterial strain S. oralis A22 together with at least one pharmaceutical excipient.

[0078] In certain embodiments, the present disclosure provides a composition comprising, or consisting of viable bacteria of a strain of S. oralis A22 with the UCCCB accession number UCCCB 242. In some embodiments, the present disclosure provides a composition comprising, or consisting of live bacteria of the strain S. oralis characterized by a genome at least 98%, 99%, or 100% similar to the genome deposited under the European nucleotide archive (ENA) database under the genome accession number ERS19845126. In some embodiments, the composition is provided for medical use.

[0079] In certain embodiments, the present disclosure provides a composition comprising, or consisting of viable bacteria of a strain of S. mitis B22 with the UCCCB accession number UCCCB 243. In some embodiments, the present disclosure provides a composition comprising, or consisting of live bacteria of the strain S. mitis characterized by a genome at least 98%, 99%, or 100% similar to the genome deposited under the ENA database under the genome accession number ERS19845127. In particular embodiments, the composition is provided for medical use.

[0080] In certain embodiments, the present disclosure provides a composition comprising, or consisting of viable bacteria of a strain of S. mitis C22 with the UCCCB accession number UCCCB 244. In some embodiments, the present disclosure provides a composition comprising, or consisting of live bacteria of the strain S. mitis characterised by a genome at least 98%, 99%, or 100% similar to the genome deposited under the ENA database under the genome accession number ERS19845128. In particular embodiments, the composition is provided for medical use.

[0081] In certain embodiments, the present disclosure provides a composition comprising, or consisting of viable bacteria of a strain of S. mitis D22 with the UCCCB accession number UCCCB 245. In some embodiments, the present disclosure provides a composition comprising, or consisting of live bacteria of the strain S. mitis characterized by a genome at least 98%, 99%, or 100% similar to the genome deposited under the ENA database under the genome accession number ERS19845129. In some embodiments, the composition is provided for medical use.

[0082] In certain embodiments, the present disclosure provides a composition comprising, or consisting of viable bacteria of a strain of S. mitis E22 with the UCCCB accession number UCCCB 246. In some embodiments, the present disclosure provides a composition comprising, or consisting of live bacteria of the strain S. mitis characterized by a genome at least 98%, 99%, or 100% similar to the genome deposited under the ENA database under the genome accession number ERS19845130. In some embodiments, the composition is provided for medical use.

[0083] In certain embodiments, the present disclosure provides a composition comprising, or consisting of viable bacteria of a strain of S. mitis F22 with the UCCCB accession number UCCCB 247. In certain embodiments, the present disclosure provides a composition comprising, or consisting of viable bacteria of a strain of S. mitis F22ADwith the UCCCB accession number UCCCB 268. In some embodiments, the present disclosure provides a composition comprising, or consisting of live bacteria of the strain S. mitis characterized by a genome at least 98%, 99%, or 100% similar to the genome deposited under the ENA database under the genome accession number ERS19845132. In particular embodiments, the composition is provided for medical use.

[0084] In certain embodiments, the present disclosure provides a composition comprising, or consisting of viable bacteria of a strain of S. mitis G22 with the UCCCB accession number UCCCB 248. In some embodiments, the present disclosure provides a composition comprising, or consisting of live bacteria of the strain S. mitis characterized by a genome at least 98%, 99%, or 100% similar to the genome deposited under the ENA database under the genome accession number ERS19845132. In some embodiments, the composition is provided for medical use.

[0085] A composition according to the present disclosure comprising a combination of all 7 strains A22-G22 synergistically inhibits S. pneumoniae growth compared to preparations of single strains, and most effectively disrupts established biofilms. In certain embodiments, the pharmaceutical composition according to the present disclosure comprises all strains S. oralis A22; S. mitis B22, S. mitis C22, S. mitis D22, S. mitis E22, S. mitis F22, S. mitis F22AD, S. mitis E22, and S. mitis G22 as described in the preceding 7 paragraphs.

[0086] In certain embodiments, the pharmaceutical compositions comprise at least one strain of a live commensal bacteria A22 to G22 as above, and further comprises a quorum sensing molecule, for example a BIpC, or CSP molecule (Table 3). In other embodiments, the live bacteria preparation and a quorum sensing polypeptide are provided for application in separate formulations. The Inventors describe novel genetic regions, the bacteriocin loci encoding several genes as laid out in Fig. 2, that provide the mechanism for the S. pneumon / ae-inhibitory effect of the above listed strains. For example, a significant loss on the capacity to inhibit most S. pneumoniae isolates was observed upon deletion of blp1 in strains B22, C22 and F22, F22AD, blp3 of strain D22, and blp4 of strain G22 (Table 5). These loci comprised in the genomes of some of the strains A22 to G22 have not been previously described or functionally characterized, and are absent from 7548 S. pneumoniae genomes reviewed by the Inventors. These loci lack virulence genes, and the Inventors demonstrate they encode polypeptides inhibiting growth of a broad range of pathogenic strains. Recombinant preparations of bacteriocin polypeptides encoded by these loci were confirmed to inhibit S. pneumoniae clinical strains either alone, or in combination.

[0087] A next aspect of the present disclosure relates to a pharmaceutical composition comprising a live, commensal bacteria strain comprising a nucleic acid sequence encoding at least one bacteriocin polypeptide sequence (or variant thereof) described in Table 6. In particular embodiments, the commensal bacteria comprises a nucleic acid sequence encoding a bacteriocin polypeptide, or a pair of bacteriocin polypeptides selected from Bac8-Bac9, Bac1-Bac2v1 , Bac1-Bac12.2, Bac1-Bac13, Bac1- Bac21.1 , Bac1-Bac24, Bac2v2-Bac24, BlpD2-Bac24, Bac24-Bac25, Bac17.2-Bac18.3, Bac12.1- Bac18.1 , BlpE3-Bac12.3, BlpDi-Bac18.2, BlpOiike2-Bac13, and BlpOiike2-Bac15, Bac1-Bac16.1 , Bac2v2- Bac14.1 , Bac12.2-Bac13, Bac1-Bac22, Bac2v2-Bac22, Bac2v2-Bac10.1 , Bac2v2-BlpDi, Bac2v2-BlpE2, BlpOiike2-Bac22, Bac2v2-BlpE3, BlpDi-Bac13, Bac13-Bac18.2, Bac16.2-Bac14.2, Bac20.2-Bac21.2, Bac2v2-Bac20.1. In some embodiments of the pharmaceutical composition comprising live commensal bacteria, the bacteria comprises a nucleic acid sequence encoding a bacteriocin polypeptide at least at least (>) 95% similar to one listed in Table 6. In certain embodiments, the composition comprises at least one bacteriocin 100% identical to one listed in Table 6.

[0088] A commensal bacterial strain useful as a live bacteria vector preferably lacks virulence genes, and is adapted to growth and persistence in a human microbiome niche to which the pharmaceutical composition is to be applied, for example, a commensal adapted to the gastrointestinal environment for an oral / enteral medicament, or one adapted to the oral cavity in the case of a composition formulated for upper respiratory administration.

[0089] In particular embodiments, the commensal bacteria comprising a nucleic acid sequence encoding a bacteriocin polypeptide is a strain of the species S. mitis. In particular embodiments, the commensal bacteria comprising a nucleic acid sequence encoding a bacteriocin polypeptide is a strain of the species S. oralis. In particular embodiments, the commensal bacteria is a strain selected from A22 - G22 as described herein. A significant loss on the capacity to inhibit most S. pneumoniae isolates was observed upon deletion of various loci described herein from S. mitis or S. oralis, for example blp1 of strains B22, C22, F22 and F22AD, blp3 of strain D22, and blp4 of strain G22 (Table 5). Another aspect of the present disclosure is thus a pharmaceutical composition comprising a live strain of commensal bacteria, wherein the commensal bacteria comprises a nucleic acid sequence at least 66% similar to a bacteriocin locus selected from the following list: a blp1 locus with the sequence B22_19330-19210, C22_19450-19330, E22_04050-04170, F22_19410- 19290, G22 20130-2010; blp2 locus with the sequence A22 03770-04130; blp3 locus with the sequence D22 17960-17760; blp4 locus with the sequence C22 15990-15830, E22 07590-07760, G22 16660-16500; blp6 locus with the sequence C22_12570-12540, F22_12710-12680; cab1 locus with the sequence B22 00640-00940; cab2 locus with the sequence E22 02620-02370; cab3 locus with the sequence F22 00400-00560; cab4 locus with the sequence C22 00520-00670; cab5 locus with the sequence D22 00350-00420; cab6 locus with the sequence A22 00820-00900; cab7 locus with the sequence G22_00540-00590; cab8 locus with the sequence D22 18840-18800; sob locus with the sequence D22 02310-02360; see locus with the sequence A22 14540-14500; sef locus with the sequence F22 03120-03070; seg locus with the sequence G22 15150-15110; isbo locus with the sequence D22 12430-12340; ipld locus with the sequence D22 05170-05260; mlc locus with the sequence C22 19190-19110; mid locus with the sequence E22_04370-04520; slk locus with the sequence B22_16070-16020, C22_16240-16190, E22_07330-07390, G22_16890-16840. The numerals provide the start and finish of each bacteriocin loci with reference to the genomes listed in Table 2, having the gene arrangements as specified in Fig. 2. The genome accession numbers provide the full strain genomes archived in the European nucleotide archive (ENA) database (maintained at the European Molecular Biology Laboratory's European Bioinformatics Institute (EMBL-EBI)).

[0090] In variants of the nucleic acid sequence listed above, the Inventors surmise a maximum degeneration of genetic code of 44% compared to the sequences described herein can be expected to provide a polypeptide of similar biological function. In some embodiments of the pharmaceutical composition comprising live commensal bacteria, the bacteria comprises a nucleic acid sequence > 95% similar to one of the above loci. In some embodiments of the pharmaceutical composition comprising live commensal bacteria, the bacteria comprises a nucleic acid sequence 100% identical to one of the above loci.

[0091] In particular embodiments, the commensal bacteria comprising a bacteriocin loci nucleic acid sequence listed above is a strain of the species S. mitis. In particular embodiments, the commensal bacteria comprising a bacteriocin loci nucleic acid sequence listed above is a strain of the species S. oralis.

[0092] In some embodiments of the pharmaceutical composition comprising bacteria comprising a bacteriocin loci, the bacteria comprises at least two of the above-listed loci, particularly those shown to have additive or synergistic effect in the inhibition of S. pneumoniae, S. parasanguinis, S. pyogenes, S. agalactiae, or any combination thereof. For example, in some embodiments of the pharmaceutical composition comprising live commensal bacteria, the bacteria comprises a blp1 locus, and a blp4 locus. In some embodiments of the pharmaceutical composition comprising live commensal bacteria, the bacteria comprise a cab7 locus, and a blp4 locus. In some embodiments, the commensal strain carrying the bacteriocin locus is a natural commensal isolated and characterized by the indicated inhibitory loci. In other embodiments, of the pharmaceutical composition according to this aspect of the present disclosure, the bacteriocin locus is encoded by genome-integrated transgene. In some embodiments, the expression of the nucleic acid sequence encoding the bacteriocin locus introduced by genetic engineering methods as a transgene under control of an inducible or constitutive promotor operable in the commensal bacteria.

[0093] Bacteriocin polypeptides

[0094] The Inventors analyzed the bacteriocin loci in protective strains, and developed optimized bacteriocin- gene fragments to produce isolated, recombinant bacteriocin proteins to achieve maximal expression in E. coli and inhibitory activity against S. pneumoniae. The mature bacteriocin sequences were predicted based on the conserved amino acid sequence before the double-glycine motif and have a high potential utility in antiseptic and antibiotic compositions.

[0095] A next aspect of the present disclosure relates to an isolated bacteriocin polypeptide >95%, >97%, >98%, >99%, or >100% identical to a bacteriocin polypeptide listed in Table 6, and having similar biological function to the polypeptide listed in Table 6. The biological function is the inhibition of S. pneumoniae, for example as measured in the assay shown in Fig. 5C.

[0096] A next aspect of the present disclosure relates to the use of an isolated polypeptide >95%, >97%, >98%, >99%, or 100% identical to a bacteriocin polypeptide listed in Table 6, and having substantially the same biological activity compared to said bacteriocin polypeptide listed in Table 6, as an antibiotic or antiseptic, providing specific inhibition of S. pneumoniae growth and biofilm formation and persistence.

[0097] A next aspect of the present disclosure relates to a pharmaceutical composition comprising at least one polypeptide at least >95%, >97%, >98%, >99%, or >100% similar to a bacteriocin polypeptide listed in Table 6. In particular embodiments, the polypeptide >95% similar to the bacteriocin polypeptide in Table 6, also has at least equivalent function to the bacteriocin polypeptide as described in Fig. 5C.

[0098] In particular embodiments of the pharmaceutical composition comprising a polypeptide >95% to a bacteriocin polypeptide described in Table 6, the composition comprises at least one polypeptide >95% similar to Bad , Bac10.1 , Bac10.2, Bac11 , Bac12.1 , Bac12.2, Bac12.3, Bac13, Bac14.1 , Bac14.2, Bac15, Bac16.1 , Bac16.2, Bac17.1 , Bac17.2, Bac18.1 , Bac18.2, Bac18.3, Bac19, Bac2, Bac20.1 , Bac20.2, Bac21.1 , Bac21.2, Bac22, Bac23, Bac24, Bac25, Bac26, Bac27, Bac3, Bac4, Bac5, Bac6, Bac7, Bac8, Bac9, BlpDi, BlpD2, BlpDs, BlpDcirunc, BIpEi, BlpE2, BIpEs, BIpKi, BlpK2, BIpKs, BIpM, BIpN, BlpOiikei, BlpOiike2, BIpW-i, BriCiike, MIcAi, MlcA2, MldAi, MldA2, MldAs, MldA4, MldAs, PldAlcTrunc, PldA3N'Trunc, ScbA, SccA, ScfA, ScgA, SlkA.

[0099] In certain embodiments, the pharmaceutical composition comprises a polypeptide >95%, >97%, >98%, >99%, or >100% identical to BlpOiike2 (SEQ ID NO 22). In particular embodiments, the composition consists of (as an active agent) the polypeptide SEQ ID NO 22.

[0100] In other particular embodiments of the pharmaceutical composition comprising a polypeptide >95% to a bacteriocin polypeptide described in Table 6, the composition comprises at least 2 polypeptides similar to those listed in Table 6. In some embodiments, the composition comprises at least one pair of bacteriocin polypeptides selected from the list consisting of the bacteriocin polypeptide pairs the Inventors demonstrated to have synergistic or additive activity when used together. These pairs include: Bac8-Bac9, Bac1-Bac2v1 , Bac1-Bac12.2, Bac1-Bac13, Bac1-Bac15, Bac1-Bac14.1 , Bac1-Bac17.1 , Bac2v2-Bac12.2, Bac12.2-Bac15, Bac12.2-Bac16.1 , Bac12.2-Bac14.1 , Bac12.2-Bac17.1 , Bac12.2- Bac18.1 , Bac1-BlpOiike2, Bac2v1-Bac10.1 , Bac2v2-BlpOiike2, Bac2v2-Bac23, Bac10.1-Bac22, Bac10.1- Bac23, Bac22-Bac23, Bac1-Bac12.1 , Bac1-Bac16.2, Bac1-Bac12.3, BlpE3-Bac13, BlpD1-Bac15, BlpD1-Bac12.1 , BlpOiike2-Bac12.1 , BlpOiike2-Bac17.1 , BlpOiike2-Bac16.2, BlpOiike2-Bac12.3, BlpO ke2- Bac14.2, BlpOiike2-Bac18.2, Bac17.1-Bac12.3, Bac12.1-Bac18.2, Bac12.3-Bac14.2, Bac12.3-Bac18.2, Bac1-Bac20.1 , Bac10.2-Bac20.1 , Bac14.1-Bac20.1 , Bac20.1-Bac21.1 , Bac1-Bac24, Bac2v2-Bac24, BlpD2-Bac24, Bac24-Bac25, Bac17.2-Bac18.3, Bad 2.1 -Bad 8.1 , BlpE3-Bac12.3, BlpDi-Bac18.2, BlpOiike2-Bac13, and BlpOiike2-Bac15, Bac1-Bac16.1 , Bac2v2-Bac14.1 , Bac12.2-Bac13, Bac1-Bac22, Bac2v2-Bac22, Bac2v2-Bac10.1 , Bac2v2-BlpDi, Bac2v2-BlpE2, BlpOiike2-Bac22, Bac2v2-BlpE3, BlpDi- Bac13, Bac13-Bac18.2, Bac16.2-Bac14.2, Bac20.2-Bac21.2, Bac2v2-Bac20.1.

[0101] In certain embodiments of the pharmaceutical composition comprising a polypeptide >95% to a bacteriocin polypeptide described in Table 6, the concentration of bacteriocin polypeptide is in the range of 1 to 1000 nM. In particular embodiments, the concentration of bacteriocin polypeptide is in the range of 5 to 800 nM. In some embodiments, the concentration of bacteriocin polypeptide is in the range of 10 to 500 nM.

[0102] Medical uses of pharmaceutical compositions comprising therapeutic bacterial strains and / or bacteriocin polypeptides

[0103] Another aspect of the present disclosure relates to pharmaceutical compositions comprising live commensal bacteria described in the section Therapeutic bacterial compositions, particularly strains A22-G22, for use as probiotic. These formulations can establish commensal bacteria populations that prevent, reduce or inhibit colonization, or re-colonization of a human microbiome niche with S. pneumoniae. The upper respiratory tract is particularly vulnerable to opportunistic S. pneumoniae strains associated with disease. A probiotic composition according to the present disclosure can be used to prevent disease caused by S. pneumoniae, such as pneumonia, or otitis media.

[0104] Similarly, another aspect of the present disclosure relates to pharmaceutical compositions comprising at least one polypeptide at least 95% similar to bacteriocin polypeptide described in Table 6, for use in preventing, reducing and / or treating colonization of a microbiome niche with an opportunistic pneumonia-causing pathogen, such as S. pneumoniae.

[0105] Prevention, or treatment of colonization with S. pneumoniae is particularly helpful in populations vulnerable to severe outcomes from respiratory tract infections such as children, and infants, subjects with advanced age, and / or immunocompromised subjects. Likewise, in certain embodiments, the compositions according to the present disclosure are provided to subjects who have been diagnosed with recurrent pneumococcal disease, such as recurrent otitis media due to S. pneumoniae, in order to prevent future episodes by removing of S. pneumoniae from the microbiome of the subject (or maintaining removal of S. pneumoniae from the microbiome by antibiotics). Another aspect of the present disclosure relates to pharmaceutical compositions comprising at least one polypeptide at least 95% similar to bacteriocin polypeptide described in Table 6, and / or compositions comprising live commensal bacteria described in the section Therapeutic bacterial compositions, for use in inhibiting the abundance of a strain classified within the taxonomical species S. pneumoniae in a human subject’s upper respiratory tract, ear, oral cavity, genitals, or gastrointestinal tract.

[0106] Another aspect of the present disclosure relates to pharmaceutical compositions comprising live commensal bacteria described in the section Therapeutic bacterial compositions, and / or comprising at least one polypeptide at least 95% similar to bacteriocin polypeptide described in Table 6, for use as an antibiotic.

[0107] Another aspect of the present disclosure relates to pharmaceutical compositions comprising live commensal bacteria described in the section Therapeutic bacterial compositions, and / or comprising at least one polypeptide at least 95% similar to bacteriocin polypeptide described in Table 6, for use in treating a patient diagnosed with an infection with S. pneumoniae. In some embodiments, the composition is provided for use in treating a patient diagnosed with a respiratory tract infection with S. pneumoniae. In some embodiments, composition is provided for use in treating a patient diagnosed with pneumonia caused by infection with S. pneumoniae.

[0108] In some embodiments, a composition as described herein is for use in treating a patient diagnosed with secondary pneumonia. In some embodiments, a composition as described herein is for use in treating a patient diagnosed with pneumonia, following a viral infection. In some embodiments, a composition as described herein is for use in preventing S. pneumoniae progression to lungs in a patient diagnosed with a viral infection. In some embodiments the viral infection is influenza A virus (IAV) infection.

[0109] The present disclosure is based, in part, on the finding that a composition or an isolated bacteriocin polypeptide as described hereinabove decreases S. pneumoniae colonization in a subject.

[0110] The present disclosure is based, in part, on the finding that a composition or an isolated bacteriocin polypeptide as described hereinabove prevents progression of S. pneumoniae to lungs in a subject. In some embodiments, the subject was exposed to an IAV infection.

[0111] Another aspect of the present disclosure relates to a composition or an isolated bacteriocin polypeptide as described hereinabove for use in inhibiting or reducing a load of a microorganism in a subject. In some embodiments, the microorganism is a pathogen.

[0112] Another aspect of the present disclosure relates to the use of a composition or an isolated bacteriocin polypeptide as described hereinabove, for inhibiting the growth of a pathogen.

[0113] Non-limiting examples of a pathogen according to the present disclosure include S. pneumoniae, S. parasanguinis, S. pyogenes, S. agalactiae, or any combination thereof.

[0114] The present disclosure is based, in part, on the finding that a composition or a bacteriocin polypeptide as described hereinabove targets specific pathogens while retaining a degree of specificity. The present disclosure is based, in part, on the finding that a composition or a bacteriocin polypeptide as described hereinabove targets specific pathogens without affecting a natural or commensal, bacterial microbiota, or with limited / reduced effect in a natural or commensal, bacterial microbiota.

[0115] In another aspect of the present disclosure, a composition or a bacteriocin polypeptide as described hereinabove is formulated for mucosal administration. In some embodiments a composition or a bacteriocin polypeptide according to the present disclosure is formulated for upper respiratory tract administration. The present disclosure is based, in part, on the finding that a composition or a bacteriocin polypeptide as described hereinabove provides defence against early pneumococcal infections taking place at the laryngeal mucosal membranes.

[0116] In certain embodiments, a pharmaceutical composition comprising at least one bacteria strain selected from A22-G22 is provided for use in treating, and / or preventing recurrence of pneumonia caused by S. pneumoniae. In other embodiments, a pharmaceutical composition comprising at least one bacteria strain selected from A22-G22 is provided for use in treating, or preventing recurrence of otitis media caused by S. pneumoniae.

[0117] In certain embodiments, a pharmaceutical composition comprising at least one bacteriocin polypeptide listed in Table 6 is provided for use in treating, and / or preventing recurrence of pneumonia caused by S. pneumoniae. In other embodiments, a pharmaceutical composition comprising at least one bacteriocin polypeptide listed in Table 6 is provided for use in treating, or preventing recurrence of otitis media caused by S. pneumoniae.

[0118] The Inventors demonstrate the efficacy of pharmaceutical compositions according to the present disclosure is independent of S. pneumoniae serotype, as both protective strains and bacteriocins showed inhibitory activity towards a diverse collection of S. pneumoniae strains. The Inventors confirmed an effect against at least one resistant strain to the most common antibiotics used to treat S. pneumoniae infections amongst the panel of 30 serotypes and 157 genotypes (based on MSLT). The panel included strains resistant to macrolides, lincosamides, tetracyclines, beta-lactams, chloramphenicol, and co-trimoxazole.

[0119] In certain embodiments, a pharmaceutical composition according to the present disclosure is provided for use in treating a patient colonized with, or diagnosed with an infection caused by, an S. pneumoniae strain characterized as resistant to a macrolide antibiotic, a lincosamide antibiotic, a tetracycline antibiotic, a beta-lactam antibiotic, a sulphonamide antibiotic, a quinolone antibiotic, co-trimoxazole, and / or chloramphenicol.

[0120] Another aspect of the present disclosure relates to pharmaceutical compositions comprising at least one polypeptide at least 95% similar to bacteriocin polypeptide described in Table 6, and / or compositions comprising live commensal bacteria described in the section Therapeutic bacterial compositions, for use in a human subject subsequent to an antibiotic therapy. In particular embodiments, the composition is provided for use within 1 week of the subject having been administered a dose of an antibiotic therapy. In some embodiments, the composition is provided for use every day, for at least three days, within 1 week of a subject having been administered a dose of antibiotic therapy. In certain embodiments, the composition is provided for use in a patient having recently finished to (i.e. preferably at least one day after the last dose) a course of antibiotic therapy comprised administration of a macrolide antibiotic, a lincosamide antibiotic, a tetracycline antibiotic, a beta-lactam antibiotic, a sulphonamide antibiotic, a quinolone antibiotic, co-trimoxazole, and / or chloramphenicol. The products have particular utility in reducing the risk of re-colonization of a patient having recently received a course of antibiotics for treating S. pneumoniae infection, such as pneumonia or otitis media.

[0121] A course of antibiotics relates to a regimen of repeated doses of an antibiotic drug for several consecutive days, or weeks, for example at least one dose per day, for 3 or more, or 5 or more days, of an antibiotic compound.

[0122] In certain embodiments of the aspects of the present disclosure described in this section, the antibiotic is an antibiotic in the class of macrolide antibiotics, natural compounds comprising a large (>8- membered) macrocyclic lactone ring to which one or more deoxy sugars, may be attached. Examples include azithromycin (CAS 83905-01-5), fidaxomicin (CAS 873857-62-6), erythromycin (CAS 114-07-8) or clarithromycin (CAS 81 103-11-9).

[0123] In certain embodiments of the aspects of the present disclosure described in this section, the antibiotic is an antibiotic in the class of lincosamide antibiotics, characterised by a pyrrolidine ring linked to a pyranose moiety via an amide bond, for example, clindamycin (CAS 18323-44-9).

[0124] In certain embodiments of the aspects of the present disclosure described in this section, the antibiotic is an antibiotic in the class of tetracycline antibiotics, molecules comprising a linear fused tetracyclic nucleus, i.e. 4 hydrocarbon rings to which a variety of groups are attached. Examples include tetracycline (CAS 60-54-8), oxytetracycline (CAS 79-57-2), doxycycline (CAS 564-25-0), and minocycline (CAS 10118-90-8).

[0125] In certain embodiments of the aspects of the present disclosure described in this section, the antibiotic is an antibiotic in the class of beta-lactam antibiotics, a class of drugs including, for example penicillin and derivates, and cephalosporins. Example of penicillins include ampicillin (CAS 69-53-4), amoxicillin (CAS 26787-78), and penicillin G (CAS 69-57-8). Examples of cephalosporin antibiotics include cefazolin (CAS 25953-19-9), cefotaxime (CAS 63527-52-6), and ceftriaxone (CAS 73384-59-5).

[0126] In certain embodiments of the aspects of the present disclosure described in this section, the antibiotic is an antibiotic in the class of sulphonamide antibiotics, for example, sulphathiazole (CAS 72-14-0), and trimethoprim (CAS 738-70-5).

[0127] In certain embodiments of the aspects of the present disclosure described in this section, the antibiotic is chloramphenicol (CAS 56-75-7).

[0128] In certain embodiments of the aspects of the present disclosure described in this section, the antibiotic is a combination of two or more antibiotics, for example co-trimoxazole (CAS 8064-90-2), comprising sulphamethoxazole, and trimethoprim.

[0129] Pharmaceutical Compositions, Administration / Dosaoe Forms and Salts

[0130] According to one aspect of the compound according to the present disclosure, the compound according to the present disclosure is provided as a pharmaceutical composition, pharmaceutical administration form, or pharmaceutical dosage form, the pharmaceutical composition, pharmaceutical administration form, or pharmaceutical dosage form comprising at least one of the compounds of the present disclosure and at least one pharmaceutically acceptable carrier, diluent or excipient.

[0131] In certain embodiments of the present disclosure, the compound of the present disclosure is typically formulated into pharmaceutical dosage forms to provide an easily controllable dosage of the drug and to give the patient an elegant and easily handled product.

[0132] Similarly, a dosage form for the prevention or treatment of respiratory tract infection is provided, comprising a bacteriocin polypeptide or a commensal strain according to any of the above aspects or embodiments of the present disclosure.

[0133] The present disclosure further encompasses a pharmaceutical composition comprising a compound of the present disclosure, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier. In further embodiments, the composition comprises at least two pharmaceutically acceptable carriers, such as those described herein.

[0134] Certain embodiments of the present disclosure relate to a dosage form for enteral administration, such as nasal, buccal, oral administration, or as an inhalation form. In addition, the pharmaceutical compositions of the present disclosure can be made up in a solid form (including without limitation capsules, tablets, pills, granules, powders), or in a liquid form (including without limitation solutions, suspensions or emulsions).

[0135] Certain embodiments of the present disclosure relate to a dosage form for upper respiratory tract administration, such as an ointment, cream, aerosol, or a nasal spray.

[0136] Certain embodiments of the present disclosure relate to a dosage form for applying to the ear to treat otitis media. In some embodiments, the bacterial strain, or bacteriocin polypeptide is provided in a liquid solution formulated for drop-wise administration.

[0137] Certain embodiments of the present disclosure relate to a dosage form for genital administration, such as an ointment, or cream.

[0138] Certain embodiments of the present disclosure relate to a dosage form for topical administration. The skilled artisan is aware of a broad range of possible recipes for providing topical formulations, as exemplified by the content of Benson and Watkinson (Eds.), Topical and Transdermal Drug Delivery: Principles and Practice (1st Edition, Wiley 2011 , ISBN-13: 978-0470450291 ); and Guy and Handcraft: Transdermal Drug Delivery Systems: Revised and Expanded (2ndEd., CRC Press 2002, ISBN-13: 978- 0824708610); Osborne and Amann (Eds.): Topical Drug Delivery Formulations (1stEd. CRC Press 1989; ISBN-13: 978-0824781835). In embodiments of the present disclosure relating to topical uses of the compounds of the present disclosure, the pharmaceutical composition is formulated in a way that is suitable for topical administration such as aqueous solutions, suspensions, ointments, creams, gels or sprayable formulations, e.g., for delivery by aerosol or the like, comprising the active ingredient together with one or more of solubilizers, stabilizers, tonicity enhancing agents, buffers and preservatives that are known to those skilled in the art. The dosage regimen for the compounds of the present disclosure may vary depending upon known factors, such as the pharmacodynamic characteristics of the particular agent and its mode and route of administration; the age, sex, health, medical condition, and weight of the recipient; the nature and extent of the symptoms; the kind of concurrent treatment; the frequency of treatment; the route of administration, the renal and hepatic function of the patient, and the effect desired. In certain embodiments, the compounds of the present disclosure may be administered in a single daily dose, or the total daily dosage may be administered in divided doses of two, three, or four times daily.

[0139] In certain embodiments, the pharmaceutical composition or combination of the present disclosure is in unit dosage of about 105to 107colony forming units (CFU) of a therapeutic live bacterial strain per dose, for a subject of about 50-70 kg. The therapeutically effective dosage of a compound, the pharmaceutical composition, or the combinations thereof, is dependent on aspects such as the body weight, age and individual condition, the disorder or disease or the severity thereof being treated. A physician, clinician or veterinarian of ordinary skill can readily determine the effective amount of each of the active ingredients necessary to prevent, treat or inhibit the progress of the disorder or disease.

[0140] The pharmaceutical compositions of the present disclosure can be subjected to conventional pharmaceutical operations such as sterilization (for bacteriocin polypeptide, not bacterial compositions) and / or can contain conventional inert diluents, lubricating agents, or buffering agents, as well as adjuvants, such as preservatives, stabilizers, wetting agents, emulsifiers and buffers, etc. They may be produced by standard processes, for instance by conventional mixing, granulating, dissolving or lyophilizing processes. Many such procedures and methods for preparing pharmaceutical compositions are known in the art, see for example L. Lachman et al. The Theory and Practice of Industrial Pharmacy, 4th Ed, 2013 (ISBN 8123922892).

[0141] Method of Manufacture and Method of Treatment according to the invention

[0142] The present disclosure further encompasses, as an additional aspect, the use of a compound as identified herein such as a bacteriocin polypeptide or variant thereof as specified in detail above, for use in a method of manufacture of a medicament for the treatment or prevention of a S. pneumoniae infection, or prevention or inhibition of (re)colonization of a microbiome niche, such as the upper respiratory tract, with S. pneumoniae.

[0143] Similarly, the present disclosure encompasses methods of treatment of disease, such as pneumonia, comprising administering to a patient in need thereof a therapeutically effective amount of a therapeutic strain of live bacteria, as specified in detail herein. Another aspect of the present disclosure is a method of preventing disease caused by S. pneumoniae, by administering a pharmaceutical composition according to the present disclosure to a subject as a probiotic, in order to reduce transmission, or colonization of S. pneumoniae.

[0144] Wherever alternatives for single separable features are laid out herein as “embodiments”, it is to be understood that such alternatives may be combined freely to form discrete embodiments of the present disclosure. Thus, any of the alternative embodiments for a feature 1 may be combined with any of the alternative embodiments of feature 2 and these combinations may be combined with any feature mentioned herein. The present disclosure further encompasses the following list of items.

[0145] A. A composition comprising a live strain of commensal bacteria, wherein the commensal bacteria comprise a nucleic acid sequence encoding a bacteriocin polypeptide > 95%, >97%, >98%, >99%, or 100% similar to a bacteriocin polypeptide listed in Table 6.

[0146] B. The pharmaceutical composition according to item A, wherein the bacteriocin polypeptide encoded by the nucleic acid sequences is > 95%, >97%, >98%, >99%, or 100% similar to Bad , Bac10.1 , Bac10.2, Bac11 , Bac12.1 , Bac12.2, Bac12.3, Bac13, Bac14.1 , Bac14.2, Bac15, Bac16.1 , Bac16.2, Bac17.1 , Bac17.2, Bac18.1 , Bac18.2, Bac18.3, Bac19, Bac2, Bac20.1 , Bac20.2, Bac21.1 , Bac21.2, Bac22, Bac23, Bac24, Bac25, Bac26, Bac27, Bac3, Bac4, Bac5, Bac6, Bac7, Bac8, Bac9, BlpDi, BlpD2, BlpDs, BlpDeTrunc, BIpEi, BlpE2, BIpEs, BIpKi, BIptG, BIpKs, BIpM, BIpN, BlpOiikei , BlpOiike2, BIpW-i, BriCiike, MIcAi, MlcA2, MldAi, MldA2, MldAs, MldA4, MidAb, PldA1 C'Trunc, PldA3N'Trunc, ScbA, SccA, ScfA, ScgA, SI kA.

[0147] C. The composition according to item A or B, wherein the commensal bacteria comprises a nucleic acid sequence encoding at least two polypeptides > 95%, >97%, >98%, >99%, or 100% similar to at least two bacteriocin polypeptides listed in Table 6, particularly wherein the two bacteriocin polypeptides are selected from Bac8-Bac9, Bac1-Bac2v1 , Bad -Bad 2.2, Bad -Bad 3, Bad- Bac15, Bac1-Bac14.1 , Bac1-Bac17.1 , Bac2v2-Bac12.2, Bac12.2-Bac15, Bac12.2-Bac16.1 , Bac12.2-Bac14.1 , Bac12.2-Bac17.1 , Bac12.2-Bac18.1 , Bac1-BlpOiike2, Bac2v1-Bac10.1 , Bac2v2-BlpOiike2, Bac2v2-Bac23, Bac10.1-Bac22, Bac10.1-Bac23, Bac22-Bac23, Bad- Bac12.1 , Bac1-Bac16.2, Bac1-Bac12.3, BlpE3-Bac13, BlpDi-Bac15, BlpDi-Bac12.1 , BlpOiike2- Bac12.1 , BlpOiike2-Bac17.1 , BlpOiike2-Bac16.2, BlpOiike2-Bac12.3, BlpOiike2-Bac14.2, BlpOiike2- Bac18.2, Bac17.1-Bac12.3, Bac12.1-Bac18.2, Bac12.3-Bac14.2, Bac12.3-Bac18.2, Bad- Bac20.1 , Bac10.2-Bac20.1 , Bac14.1-Bac20.1 , Bac20.1-Bac21.1 , Bac1-Bac24, Bac2v2-Bac24, BlpD2-Bac24, Bac24-Bac25, Bac17.2-Bac18.3, Bac12.1-Bac18.1 , BlpE3-Bac12.3, BlpDi- Bac18.2, BlpOiike2-Bac13, and BlpOiike2-Bac15, Bac1-Bac16.1 , Bac2v2-Bac14.1 , Bac12.2- Bac13, Bac1-Bac22, Bac2v2-Bac22, Bac2v2-Bac10.1 , Bac2v2-BlpDi, Bac2v2-BlpE2, BlpOiike2- Bac22, Bac2v2-BlpE3, BlpDi-Bac13, Bac13-Bac18.2, Bac16.2-Bac14.2, Bac20.2-Bac21.2, Bac2v2-Bac20.1.

[0148] D. The composition according to any of the preceding items, wherein the commensal bacteria comprises a nucleic acid sequence >66%, >75%, >85%, >90%, >95%, >98%, or >99%, or 100% similar to a bacteriocin locus selected from a blp1 locus with the sequence B22 19330-19210, C22 19450-19330, E22_04050-04170, or F22_19410-19290, G22_20130-2010; a blp2 locus with the sequence A22 03770-04130; a blp3 locus with the sequence D22 17960-17760; a blp4 locus with the sequence C22 15990-15830, E22 07590-07760, or G22 16660-16500; a blp6 locus with the sequence C22 12570-12540, F22 12710-12680; a cab1 locus with the sequence B22 00640-00940; a cab2 locus with the sequence E22 02620-02370; a cab3 locus with the sequence F22 00400-00560; a cab4 locus with the sequence C22 00520-00670; a cab5 locus with the sequence D22 00350-00420; a cab6 locus with the sequence A22 00820- 00900; a cab7 locus with the sequence G22_00540-00590; a cab8 locus with the sequence D22 18840-18800; a scb locus with the sequence D22 02310-02360; a see locus with the sequence A22 14540-14500; a scf locus with the sequence F22_03120-03070; a scg locus with the sequence G22 15150-15110; a isbo locus with the sequence D22 12430-12340; a ipld locus with the sequence D22 05170-05260; a mlc locus with the sequence C22 19190-191 10; a mid locus with the sequence E22_04370-04520; and / or a slk locus with the sequence B22 16070-16020, C22_16240-16190, E22_07330-07390, or G22_16890-16840.

[0149] E. The composition according to item D, wherein expression of the nucleic acid sequence encoding the bacteriocin locus is under control of an inducible or constitutive promotor operable in the commensal bacteria.

[0150] F. The composition according to any one of the preceding items, wherein the commensal bacteria comprise, or consist of a strain of S. mitis.

[0151] G. The composition according to any one of the preceding items, wherein the commensal bacteria comprise, or consist of a strain of S. oralis.

[0152] The present disclosure further encompasses the use of the above items for preventing colonization of a subject with S. pneumoniae, for treating colonization of infection of a patient with S. pneumoniae, and also methods of treating S. pneumoniae colonized human subjects with compositions according to the present disclosure, to prevent or treat S. pneumoniae-d riven disease or pathology.

[0153] The present disclosure further encompasses the use of the above items for reducing colonization of a subject with S. pneumoniae.

[0154] The present disclosure further encompasses the use of a composition as described hereinabove, or a bacteriocin polypeptide as described hereinabove, for inhibiting the growth of a pathogen.

[0155] The present disclosure further encompasses the use of a composition as described hereinabove, or a bacteriocin polypeptide as described hereinabove, in preparation of a medicament for treatment or prevention of a microbial infection in a subject.

[0156] The present disclosure is further illustrated by the following examples and figures, from which further embodiments and advantages can be drawn. These examples are meant to illustrate the present disclosure but not to limit its scope.

[0157] Description of the Figures

[0158] Fig. 1 Seven S. oralis and S. mitis isolates have broad anti-pneumococcal activity. Seven isolates, named strains A22 to G22, inhibited at least 90% of that S. pneumoniae collection and were next tested against additional S. pneumoniae strains (n=77) with diverse bacteriocin-immunity regions (BIR) in the blp locus. Combining the inhibition results of the two pneumococcal collections, strains A22 to G22 inhibited 92.5% to 99.5% of the 230 pneumococci.

[0159] Fig. 2 Genomes of strains A22-G22 encode multiple bacteriocin loci. A schematic representation of gene clusters is shown. Locus size (excluding the flanking genes) is indicated next to the locus name. Putative promoters (BIpR-, SigX-, and RpoD-binding sites) and terminator regions are also represented. Deletion-mutant strains were constructed for bacteriocin-containing regions, indicated by grey arrows. This was done for all strains with the exception of strain E22 and locus scf from strain F22. Locus tags of the represented regions (genes from left to right) are the following: blp1 - B22 19330- 19210, C22 19450-19330, E22_04050-04170, F22_19410-19290, G22_20130-2010; blp2 - A22 03770-04130; blp3 - D22_17960-17760; blp4 - C22_15990-15830, E22 07590-07760, G22_16660-16500; blp6 - C22_12570-12540, F22_12710-12680; cab1 - B22 00640-00940; cab2 - E22_02620-02370; cab3 - F22_00400-00560; cab4 - C22 00520-00670; cab5 - D22_00350-00420; cab6 - A22 00820-00900; cab7 - G22 00540-00590; cab8 - D22_18840-18800; cib - E22_04640-04610, F22_18970- 19000; scb - D22_02310-02360; see - A22_14540-14500; see - C22_05670-05730; scf — F22 03120-03070; seg - G22_15150-15110; mid - E22_04370-04520; ipld - D22 05170-05260; mlc - C22_19190-19110; slk - B22_16070-16020, C22_16240- 16190, E22 07330-07390, G22_16890-16840; isbo - D22_12430-12340.

[0160] Fig. 3 Bacteriocin-like peptide loci of strains A22-G22 are expressed and controlled by the

[0161] BIpC pheromone. Gene expression was measured by qRT-PCR after exposure of strains for 5 min to synthetic cognate BIpC. Loci iblp5. 1, iblp5.2 and blp6 lack a cognate BIpC, hence their gene stimulation was done with addition of blp1 BIpC of the same strain. The Y axis shows fold change differences after BIpC treatment compared to the untreated culture. Error bars represent standard deviation of the mean of three biological replicates.

[0162] Fig. 4 Inhibition of multi strain biofilms: (A) S. pneumoniae and commensal strain (or cocktail) inoculated at the same time in a mixture; (B) commensal strain (or cocktail) inoculated 24h before S. pneumoniae strain; (C) S. pneumoniae inoculated 24h before the commensal strain (or the cocktail); and (D) a 24h S. pneumoniae biofilm three times (1 / day) inoculated with a commensal strain (or cocktail).

[0163] Fig. 5 Bacteriocin with anti-pneumococcal activity on planktonic and solid agar (A) shows effect of single bacteriocin on optical density of culture of S. pneumoniae', photos show inhibition halos resulting from adding bacteriocin to a culture of S. pneumoniae inoculated in solid agar; (B) shows inhibition of the indicated strains by a combination of two bacteriocin polypeptides; (C) summarizes the screening process of inhibition of S. pneumoniae by individual, or pairs of bacteriocin polypeptides. Numbers represent difference of lag phase between treatment and control. Bold indicates Lag phase delayed > 2 hours compared to single bacteriocin’s activity (synergistic effect).

[0164] Fig.6 Minimum inhibitory concentration (MIC) of purified 8xHis-BlpOiike2. Graphics shows the lowest concentration of BlpOnke2 by which serotypes 2, 3, 10A, 15A and 21 were inhibited throughout the duration of the assay (24 hours). MIC was determined using the microdilution method on 96-well plates with a start inoculum of 5x105CFU / mL. The buffer in which 8xHis-BlpOiike2 is solubilized was used as control.

[0165] Fig. 7 Impact of Bl pOnke2 on in vivo S. pneumoniae colonization. Graphic shows the bacterial density of S. pneumoniae recovered from nasal lavages of mice treated with buffer in which Bl pOiike2 is solubilized or Bl pOiike2 itself. Dotted line represents limit of detection of bacterial density. ****p < 0.0001 , Mann-Whitney U test.

[0166] Fig. 8 In vivo interaction between S. pneumoniae and S. mitis in the context of an IAV infection. (A, B) Bacterial loads of S. pneumoniae were determined by selective plating serial dilutions of each recovered sample (NL, BAL and L) from mice of all groups sacrificed at days 8 (A) or 10 (B) post-lAV infection. The dotted line represents the limit of detection (LOD). (C) Flow cytometry of BAL samples was performed for all groups and the presence of neutrophils analysed. *p < 0.05, **p < 0.01 , ****p < 0.0001 , ns: nonsignificant (Kruskal-Wallis followed by Dunn’s multiple comparisons test for multiple comparisons; Mann-Whitney U test to compare two groups).

[0167] Fig. 9 Effect of blp1 bacteriocins on S. pneumoniae. (A) Bacterial loads of S. pneumoniae

[0168] D39-Camrpresent in the nasal lavages of each mouse treated with Bad , Bac2v1 , Bac2v2 and corresponding combinations were quantified for the different groups. The dotted line represents the limit of detection (LOD). ***p < 0.001 , ****p < 0.0001 (Mann- Whitney U test). (B) Maximum growth rate (h-1) was calculated for all growth curves, and the mean of three independent replicates is indicated. (C) The exponential phase delay (in hours), in comparison with the CFPS negative control, was calculated for all treatment groups. The values correspond to intervals of exponential growth delay compared to the control: 0 - timepoint of exponential growth remains equal to or below the control; 1 - timepoint of exponential growth surpasses the control up to 2 hours; 2 - timepoint of exponential growth surpasses the control up to 4 hours; 3 - timepoint of exponential growth surpasses the control more than 4 hours.

[0169] Examples

[0170] Example 1: S. oralis and S. mitis species have broad anti-pneumococcal activity

[0171] It is well known that in the polymicrobial environment of the URT, commensal bacteria and pathobionts compete for space and nutrients. In particular, S. pneumoniae shares the niche with several other Streptococcus spp., commonly regarded as true commensals. The Inventors reasoned that isolates of such closely related species likely compete for the same resources and could be used to control S. pneumoniae colonization.

[0172] To identify commensal streptococci that could potentially inhibit S. pneumoniae, strains previously isolated as non-pneumococcal streptococci (n=313) from nasopharyngeal swabs of healthy children and adults (not colonized with S. pneumoniae at time of sampling and with no antimicrobial consumption in the month preceding sampling) (Almeida ST, 2014, Nunes S, 2016, Almeida ST, 2021 , Felix S, 2021 ), were tested by overlay assays for inhibitory activity against S. pneumoniae. The 313 isolates were initially tested against the blp-bacteriocin (bacteriocin-like peptide) susceptible S. pneumoniae strain P537 (Son MR, 2011 ). Eighty-seven isolates inhibited P537 and these were further tested against 153 S. pneumoniae strains of epidemiologically relevant serotypes (Table 1 ). Seven isolates, hereafter named strains A22 to G22, inhibited at least 90% of that S. pneumoniae collection and were next tested against additional S. pneumoniae strains (n=77) with diverse bacteriocin-immunity regions (BIR) in the blp locus (Valente C, 2016). In total, strains A22 to G22 inhibited >90% of the total S. pneumoniae strains (n=230, of 30 distinct serotypes and 157 multilocus sequence types) (Fig. 1).

[0173] Table 1. Inhibition by A22 to G22 in overlay assays. MLST - multilocus sequence typing; VT - vaccine serotype; NVT - non-vaccine serotype; PCV13 - serotype targeted by the 13-valent pneumococcal conjugate vaccine (and by PCV20); PCV20 - serotype targeted by the 20-valent pneumococcal conjugate vaccine (and not by PCV13); blp - bacteriocin-like peptide; ND - not determined. Results are the mean of at least three independent assays.

[0174]

[0175] To determine the species of strains A22-G22, a multilocus sequence analysis (MLSA) scheme for viridans group streptococci (based on internal sequences of seven housekeeping genes) was used (Bishop CJ, 2009). DNA sequences were extracted from genome sequencing data and concatenated in-frame into a 3063bp fasta file for each strain. Phylogenetic analysis of the concatenated sequences in comparison with the eMLSA database (consisting of 413 strains of 25 viridans streptococcal species plus 14 strains of unknown / uncertain species) was performed using CLC Genomics Workbench (Qiagen). A neighbour-joining phylogenetic tree was generated using the Jukes-Cantor model for nucleotide distance measure and bootstrap analysis was performed based on 500 replicates. The resulting neighbour-joining phylogenetic tree indicated that strain A22 clustered with S. oralis cluster whereas strains B22-G22 clustered with S. mitis. The raw reads and completed genomes of the seven strains were deposited in the European nucleotide archive (ENA) database under the study accession number PRJEB75690 (Table 2).

[0176] Table 2. Streptococcal strains (A22-G22). Strains are deposited under the Budapest Treaty on the International Recognition of the Deposit of Microorganisms at the University of Coimbra Bacterial Culture Collection with the following accession numbers: UCCCB 242 (S. oralis A22), UCCCB 243 (S. mitis B22), UCCCB 244 (S. mitis C22), UCCCB 245 (S. mitis D22), UCCCB 246 (S. mitis E22), UCCCB 247 (S. mitis F22), and UCCCB 248 (S. mitis G22).

[0177] Strain Species ENA genome accession No. UCCCB strain accession No.

[0178] A22 S. oralis ERS19845126 UCCCB 242

[0179] B22 S. mitis ERS19845127 UCCCB 243

[0180] C22 S. mitis ERS19845128 UCCCB 244

[0181] D22 S. mitis ERS19845129 UCCCB 245

[0182] E22 S. mitis ERS19845130 UCCCB 246

[0183] F22 S. mitis ERS19845131 UCCCB 247

[0184] G22 S. mitis ERS19845132 UCCCB 248

[0185] Example 2: Strains A22-G22 encode bacteriocin-related loci

[0186] Cell-free supernatants (CFS) were obtained in early-stationary phase, concentrated 10-fold (10x CFS), and tested for inhibitory activity against S. pneumoniae P537 strain in well-diffusion assays. The 10x CFS of all seven strains had visible inhibitory activity, with strains B22, C22, E22, F22, and G22 displaying the strongest phenotypes. The inhibitory activity of 10x CFS was not affected by heat treatment, even at 121°C. In contrast, protease treatment completely abolished or greatly reduced the activity of most CFS, the exception being supernatants from strains A22 and D22 (not shown). The Inventors hypothesized that some of the inhibitory activity of strains A22-G22 could be due to the production of bacteriocins. An in silico search for bacteriocin-related loci was conducted in the annotated genomes of strains A22-G22. A diverse repertoire of bacteriocin-related gene clusters was found and characterized for genetic content and organization (Fig. 2). Four types of loci, namely bacteriocin-like peptide (blp), competence-associated bacteriocin (cab), streptococci n, and lantibiotic were identified (McAuliffe O, 2001 , Bogaardt C, 2015, Bushin LB, 2018, Rezaei Javan R, 2018). 80% of the putative bacteriocins and 50% of the immunity proteins were absent or rare among S. pneumoniae, and could potentially explain their wide inhibitory activity.

[0187] An in silico analysis of their regulatory regions (promoters and terminators) was conducted (Fig. 2). Consensus binding sequences for the housekeeping sigma factor RpoD (also named o70) were found in the promoter regions of the lantibiotic and streptococcin loci. To investigate whether regulation of blp loci in strains A22-G22 was quorum-sensing dependent, strains were stimulated with their cognate putative BIpC pheromones (Table 3) and measured gene expression (by qRT-PCR) of the regulatory gene blpHand one gene from the bacteriocin and immunity region (BIR). For iblp5.1, iblp5.2 and blp6, which lack blpC (and thus the corresponding cognate pheromone), stimulation was done with BlpC from blp1 (present in the same strains). Addition of BlpC increased transcript levels of most genes when compared to the untreated control (with the exception of some bipH) suggesting the blp loci of strains A22-G22 are expressed and regulated by quorum sensing (Fig. 3). The increased expression of genes of iblp5.1, iblp5.2 and blp6 loci indicated cross regulation between various blp loci occurring in the same strain (Fig. 3). Table 3. Synthetic quorum sensing, competence sensing peptides

[0188] Example 3: Bacteriocin loci of S. mitis strains are implicated in pneumococcal inhibition

[0189] To evaluate the individual contribution of bacteriocin loci to S. pneumoniae inhibition, mutants were constructed lacking the bacteriocin-immunity regions. A total of 28 mutants were constructed (Table 4, Fig. 2).

[0190] Table 4. Strains A22-G22 encode several bacteriocin-related loci. Four types of bacteriocin-related gene loci were identified based on genetic content and organization: bacteriocin-like peptide (blp), competence-associated bacteriocin (cab), streptococcin and lantibiotic. Loci lacking bacteriocin genes (but otherwise containing genes characteristic of bacteriocin loci) were considered incomplete and are indicated with an “ / ’’ as prefix. Loci underlined indicate those for which deletion mutants of bacteriocin- containing regions were constructed. Loci highlighted in bold are first described in this study.

[0191] Bacteriocin lociTotal no. of l 1 ull 1 I | j

[0192] Blp Competence Streptococcin Lantibiotic

[0193] A22 blp2 cab6 see 3

[0194] B22 blp1, iblp5.1 cab1, icib isca2, iscb2, iscc, isce2 slk 9

[0195] C22 blp1, blp4, blpS cab4, icib see, isca2, iscc, iscq mlc, slk 11

[0196] D22 blp3 cab5, cab8 scb, iscal, iscc ipld, isbo, inis 9

[0197] E22 blp1, blp4 cab2, cib isca3, iscc, iscel mid, slk, Han 10

[0198] ___ blp1, iblp5.2, .. . . „ . , „ . .

[0199] F22 r dd cab3, cib sef, iscal, iscbl, isce4n9 blp 6 -

[0200] „„„ ■ .. scq, isca2, iscb2, iscc, „

[0201] G22 blp1 blp4 cab7 icib — ’ slk 10

[0202] CFS of all wild-type strains and mutants were tested against S. pneumoniae D39 and P537 growing in solid media (well-diffusion assays). The strongest reduction in inhibitory activity was associated with deletion of blp1 in strains B22 and F22 (Table 5). Deletion of other bacteriocin loci also led to a reduction in inhibitory activity, although to a smaller extent. For example, loss of inhibitory effect against S. pneumoniae D39 was observed upon exposure of CFS of mutants of strains C22 (lacking bip4, blpS, cab4, see, or mid), F22 (lacking cib), and G22 (lacking blp4, cab7 or s / k). Secondly, the Inventors tested the same CFS of all wild-type strains and mutants against S. pneumoniae D39 and P537 growing in liquid media. As in the well-diffusion assays, the CFS of mutants lacking blp1 in strains B22 and F22 showed a significant loss of inhibitory activity of S. pneumoniae D39 and P537 (Table 5). In addition, mutants of strains C22 (lacking blp1, blp4, or see), D22 (lacking blp3), and G22 (lacking blp1, blp4, or seg) showed a significant decrease in the capacity to inhibit S. pneumoniae D39 and / or P537 (Table 5). Variability in the degree of inhibition by strains A22-D22, F22, and G22 and its mutants on S. pneumoniae D39 compared to S. pneumoniae P537 was observed in agreement with the fact that S. pneumoniae is genetically diverse, including in the content of bacteriocin and immunity protein genes (Table 5). Thirdly, the Inventors conducted assays in solid media (agar overlay) and tested the wild-type strains and their corresponding deletion mutants against a collection of 45 S. pneumoniae isolates (representative of 23 serotypes and 42 multilocus sequence types) (Table 1, Table 5). A significant loss on the capacity to inhibit most S. pneumoniae isolates was observed upon deletion of blp1 of strains B22, C22 and F22, blp3 of strain D22, and blp4 of strain G22 (Table 5). Collectively, these analyses indicated that the bacteriocin-related loci encoded by the genomes of strains A22-G22 can be expressed in laboratory conditions and thus could be responsible for part of the inhibitory activity of strains A22- G22. Additionally, for some bacteriocin loci, expression was quorum-sensing dependent and could be stimulated by the addition of cognate synthetic pheromones.

[0203] G22Ab / p4, a mutant that showed some (but not complete) loss of inhibitory activity, was used to construct double deletion mutants (G22Ab / p4Ab / p7, G22Ab / p4Acab7, G22Ab / p4As / g, and

[0204] G22Ab / p4As / k). Deletion of both blp1 and blp4 completely abolished G22 inhibitory activity in the overlay assays, a result not observed with the corresponding single deletion mutants (Table 5). This was also observed when the CFS of G22Ab / p4Ab / p7 was tested against S. pneumoniae D39 and P537 growing in solid and liquid media (Table 5). For other double mutants of G22, no significant additive effects were noted, albeit a small effect seemed to occur in G22Ab / p4Acab7.

[0205] Table 5. Inhibitory action of deletion mutants.aLocus cab1 from strain B22 was deleted in two parts.bDouble-deletion mutants constructed for strain G22; results of assays are compared to single deletion mutant of locus blp4

[0206] Example 4. Strains A22-G22 inhibit S. pneumoniae in multi-species biofilms

[0207] To assess the potential of strains A22-G22 to inhibit S. pneumoniae in a biofilm, their ability to grow in biofilms was evaluated. Single and dual-species biofilms were performed in an abiotic surface. Strains were grown in THY until mid-exponential phase (ODeoonm ~ 0.5). Each strain was diluted to 105cfu / mL in 2.5 mL of THY supplemented with catalase (1600 U / mL), inoculated on 24-well plates and incubated at 34°C in 5% CO2. Dual-species biofilms were grown in a 1 :1 ratio of one S. pneumoniae strain (D39-RCm, 5756-RCm, or 7632-RCm) and one commensal strain, or a cocktail of the seven strains inoculated in a mixture. Four experimental designs were tested (Fig. 4): (A) S. pneumoniae and commensal strain (or cocktail) inoculated at the same time in a mixture; (B) commensal strain (or cocktail) inoculated 24h before S. pneumoniae strain; (C) S. pneumoniae inoculated 24h before the commensal strain (or the cocktail); and (D) a 24h S. pneumoniae biofilm inoculated three times (1 / day) with a commensal strain (or cocktail). In experiments B, C and D, at 24h, 1.25mL of spent medium was carefully removed and a fresh culture of S. pneumoniae, commensal strain or cocktail (at 107CFU / mL) in 1.25mL of fresh medium was added avoiding disturbance of the pre-formed biofilm. In experiment D), the procedure was repeated at 48h and 72h. As controls, single biofilms of the strains being tested were done in parallel using the same starter inoculum and replacing spent medium with fresh medium at the pre-determined times. Biofilms were incubated and 24h after the last inoculation, supernatants were carefully removed and biofilms were resuspended in 500pL of PBS. Serial dilutions for viability assessment were plated in parallel in BA and BA supplemented with 8 pg / mL of chloramphenicol for discrimination between strains. CFUs were counted after overnight incubation at 37°C in 5% CO2 enriched atmosphere.

[0208] A22-G22 strains interfered with S. pneumoniae biofilms, in several of the conditions tested. For example, when inoculated at the same time with S. pneumoniae, strains A22, D22, and F22 individually inhibited S. pneumoniae biofilm formation. If added 24 hours in advance, all strains were able to severely affect the capacity of at least one S. pneumoniae to form biofilm. Finally, if added to a 24h pre-existing biofilm of S. pneumoniae, all strains A22-G22 had the capacity to significantly disrupt the biofilm of at least one S. pneumoniae strain. Notably, S. oralis A22 negatively affected S. pneumoniae biofilm in all conditions tested. The Inventors simulated a 3-day treatment where they added the strain of interest (A22-G22) every 24h to a pre-grown S. pneumoniae biofilm. Six of the seven strains (all but C22) were able to significantly inhibit S. pneumoniae D39-RCm and all were able to disrupt and, in most cases, even eliminate the biofilm of S. pneumoniae strain 7632-RCm. Adding a cocktail of the seven strains (A22- G22) was very effective in preventing S. pneumoniae biofilm formation in the majority of the conditions tested. Particularly, the cocktail was better than each strain alone when added to a 24h pre-existing biofilm of S. pneumoniae D39-RCm and 7632-RCm.

[0209] Together, these results support the potential of strains A22-G22 to be used to interfere with pneumococcal biofilm formation, a fundamental step of in vivo colonization. Strains A22-G22 were able to prevent and disrupt pneumococcal biofilms, a proxy of nasopharyngeal colonization. Addition of commensal strains to pneumococcal biofilms for three consecutive days, simulating a 3-day repeated treatment, resulted in the highest degree of inhibition. Additionally, when the seven strains were combined in a single cocktail, pneumococcal biofilms were severely affected, indicating an added value of using more than one strain. Additionally, strains A22-G22 could be used for the design of novel engineered strains with optimal characteristics for the same purpose.

[0210] Example 5: Bacteriocin polypeptides with anti-pneumococcal activity

[0211] Strains A22-G22 encode a total 73 putative bacteriocin genes of interest. Of these, 58 are not post- translationally modified. To identify which of these bacteriocins have anti-pneumococcal activity, the Inventors designed optimized bacteriocin-gene fragments to achieve maximal expression. The mature bacteriocin sequences were predicted based on the conserved amino acid sequence before the doubleglycine motif. Corresponding mature nucleotide sequences were codon optimized for Escherichia coli (Table 6). Additionally, the ribosome-binding site was optimized to maximize the translation rate in E. coli for each bacteriocin. In the end, DNA fragments were designed with minimal T7 promoter (TAATACGACTCACTATAG, SEQ ID NO 01 ), RBS, initiation codon (ATG), mature bacteriocin gene codon optimized for E. coli, a spacer sequence (GCTTTATCTGAGAATATACTCGAA, SEQ ID NO 02), and T7 terminator (CCCCTAGCCCGCTCTTATCGGGCGGCTAGGGG, SEQ ID NO 03). Then, cell-free synthesis of bacteriocins was performed using PUREfrex®2.0 (GeneFrontier Corporation, Japan). For each bacteriocin, a final concentration of 10 nM of respective DNA fragment was used. As control, a reaction with the same volume of water (instead of DNA) was made. All reactions were incubated for 4 hours at 37°C.

[0212] Table 6. Bacteriocin polypeptide sequences. In bold are the cleavage motifs for mature peptides.

[0213] Cell-free produced bacteriocins were tested for anti-pneumococcal activity against S. pneumoniae D39 and P537 (representative example Fig.5A). Pneumococcal cultures were grown in Todd-Hewitt broth supplemented with 0.5% yeast extract (THY) at 37°C until and ODeoonm of 0.5 (c.a. 108CFU / mL). Then, the effect on planktonic growth was assessed using 384-well plates. S. pneumoniae D39 and P537 cultures were diluted in fresh THY (104CFU / mL) containing 1600 U / mL of catalase. Ninety microliters of cultures were added per well and treated with 10 pL of cell-free synthesized bacteriocin reaction. As controls, the same volume of reaction was substituted by either water, THY or cell-free reaction (with water instead of DNA). Planktonic growth was monitored during 24 hours by measuring OD595nm every 30 minutes using a plate reader (Tecan Infinite 200 Pro). Three independent experiments were performed to evaluate the inhibitory activity of all bacteriocins alone (Fig. 5A).

[0214] Additionally, the anti-pneumococcal activity of bacteriocins were screened on solid agar (representative example Fig. 5A,). Briefly, pneumococcal cultures were first grown in THY at 37°C until an ODeoonm of 0.5. Then, a mixture containing 750pl of culture, 7125U of catalase, 8ml of warm THY, and 21 ml of molten Tryptic Soy broth with 1% agar was dispensed in three Petri dishes (~10 mL / plate). After solidification, 2 pL of cell-free synthesized bacteriocin reactions were stabbed. Cell-free reaction (with water instead of DNA) was used as a negative control. Plates were incubated overnight at 37°C in 5% CO2. On the following day, plates were inspected for growth inhibition halos around the stabs - indicating inhibitory activity of bacteriocins. Three independent experiments were done for each bacteriocin.

[0215] Seven bacteriocins significantly halted pneumococcal growth in planktonic media mostly by delaying the exponential phase. Additionally, eight bacteriocins were found to inhibit S. pneumoniae D39 and / or P537 on solid agar. Of these, BlpOiike2 was the only bacteriocin that showed consistent anti-pneumococcal activity despite the assay and the pneumococcal strain (Fig. 5A, Fig. 5C).

[0216] Additionally, the inhibitory activity of pairs of bacteriocins predicted to act as two-peptide due to presence of GxxxG, SxxxS or AxxxA motif was tested (where x is any amino acid). Only putative pairs of bacteriocins occurring on a given strain were considered, in a total of 297 potentially synergistic pairs. Inhibitory activity of two-peptide bacteriocins was only tested against S. pneumoniae D39. The effect on planktonic growth was evaluated as described above with 5 |_iL of each cell-free synthesized bacteriocin (Fig. 5B, Fig. 5C).

[0217] The array of bacteriocins available for testing and the individual results obtained for each hold promise of great potential of these peptides in the control of pneumococcal infections. 65 pairs delayed pneumococcal lag phase by at least 1 hour compared to the respective single bacteriocins’ activity. Of these, seven pairs showed potent anti-pneumococcal activity by completely abolishing S. pneumoniae D39 planktonic growth throughout the duration of the assay (Fig. 5C). The Inventors performed heterologous expression and purification to investigate the minimum inhibitory concentration (MIC) of purified 8xHis-BlpOiike2 against S. pneumoniae D39 and 13 epidemiologically relevant pneumococcal strains. To determine the MIC of 8xHis-BlpOiike2 against S. pneumoniae, the EUCAST guidelines for the microdilution method were followed with minor alterations. The MIC was defined as being the lowest concentration in which no growth was observed between 16-24h. Examples shown on Fig. 6, revealed a MIC ranging from 13.5 to 432 nM. Furthermore, 8xHis-BlpOiike2 completely abolished the growth of all tested serotypes accordingly to the previous results obtained with cell-free protein synthesis.

[0218] Methods

[0219] Bacterial strains

[0220] Two bacterial collections were used: a collection of commensal non-pneumococcal streptococcal isolates used to screen for strains with anti-pneumococcal activity, and a S. pneumoniae collection against which the inhibitory activity of the commensal streptococci was evaluated. The non- pneumococcal streptococcal strains (n=313) were isolated from the upper respiratory tract of humans (children and adults). Isolates were obtained from nasopharyngeal samples of healthy individuals not colonized with S. pneumoniae at the time of sampling and with no antimicrobial use in the month preceding sampling. Isolates were initially characterized based on the observation of haemolysis, colony morphology, optochin susceptibility, bile solubility, and / or presence of a copy of a typical S. pneumoniae lytA (Llull D, 2006).

[0221] A total of 230 S. pneumoniae strains recovered from nasopharyngeal swabs of children up to 6 years old were included: 153 strains were selected to represent epidemiologically relevant serotypes (Nunes S, 2016, Felix S, 2021 ), and 77 were representative of diverse bacteriocin-immunity regions (BIR) (Valete C, 2016). Strains were previously characterized based on serotyping and multilocus sequence typing (MLST) (Felix S, 2021 , Nunes S, 2016, Valente C, 2016). S. pneumoniae strains P537, P133, were used as controls in overlay and supernatant assays. Strain P537 is a serotype 6A strain from which the entire bacteriocin-like peptide (blp) locus was deleted, being susceptible to bacteriocins of b / p-type (Son MR, 2011 ). It was used as a negative control for inhibitory activity in overlay assays, and as a susceptible indicator of inhibition in both overlay and supernatant assays. Strain P133 is a serotype 6A strain with an active blp locus (Son MR, 2011 ). It was used as positive control for inhibitory activity in the overlay assays. Strain D39 is a laboratory strain of serotype 2 easily manipulated in lab conditions (Avery T, 1944). D39 was used as an indicator strain in the supernatant assays. Finally, S. pneumoniae strains D39-RCm and 7632-RCm (serotype 15A) were used in biofilm and overlay assays. These strains are resistant to chloramphenicol (due to insertion of P hipA-hlpA-gf p_Camr construct).

[0222] Inhibition overlay assays

[0223] Inhibition overlay assays were done as described before (Son MR, 2011 , Maricic N, 2014). Controls and test strains were grown in Todd-Hewitt broth (BACTO™, BD) supplemented with 0.5% yeast extract (Fisher Scientific) (THY), at 37°C until ODeoonm of 0.5 was reached. Glycerol was added to the cultures at a final concentration of 15%, and the mixtures were transferred to a 96 well-plate. Then, strains were plated using a replica plater on 20 mL of Tryptic Soy agar supplemented with 5% sheep blood (BBL™ STACKER™ Plates, BD) (BA) and incubated overnight at 37°C in 5% CO2. On the following day, the growth in the BA plates was collected with a replica plater and stabbed onto Tryptic Soy broth (BACTO™, BD) with 1 .5% agar (Fisher Scientific) (TSAgar) plates supplemented with 4750U of catalase (Sigma-Aldrich). The stabbed plates were incubated for 6h at 37°C in 5% CO2.

[0224] Overlay strains were grown in THY at 37°C until an ODeoonm of 0.5 was reached. A mixture containing 200pl of the overlay strain, 4750U of catalase, 5ml of warm THY, and 3ml of molten TSAgar was gently dispensed on top of the stabbed TSAgar plates. After solidification of the overlay layer, the plates were incubated overnight at 37°C in 5% CO2. On the following day, plates were inspected for growth inhibition halos around the stabbed strain - indicating inhibitory activity of the test strain towards the overlay strain. At least three independent experiments were done for each overlay strain. Test strains were considered inhibitory towards the overlay strain if inhibition halos were observed in at least two of three independent experiments.

[0225] Preparation of cell-free supernatants

[0226] Strains A22-G22 were grown in THY at 37°C until early-stationary phase. Cultures were centrifuged at 5,000 x g for 10 minutes at 4°C, and the cell-free supernatants (CFS) were collected and filtered with a 0.2mm filter. CFS were concentrated 10-fold (10x CFS) by water evaporation under vacuum using the Acid-Resistant CentriVap Vacuum Concentrator (Labconco). When indicated, 10x CFS from wild-type strains were heat- and protease-treated. For heat treatment, samples were incubated at 37°C, 45°C, 60°C and 75°C for 1.5h, at 95°C for 1 h, and at 121°C for 20 min (the latter mimicking sterilizing conditions). For protease treatment, samples were incubated with 1 mg / ml proteinase K (Roche Diagnostics) at 37°C for 3h. Untreated and treated supernatants were tested for inhibitory activity.

[0227] Well-diffusion assays

[0228] S. pneumoniae D39 and P537 were grown in Todd-Hewitt broth supplemented with 0.5% yeast extract (THY) at 37°C until an ODeoonm Of 0.5 was reached. A mixture containing 750pl of D39 or P537 culture, 7125U of catalase, 8ml of warm THY, and 21 ml of molten Tryptic Soy broth with 1.5% agar (TSAgar) was dispensed in a Petri dish. After solidification, wells were done in the agar using the top of 1 mL- pipette tips, and 200p I of the supernatant to be tested (of strains A22-G22 or its derivatives) was poured inside the well (one supernatant per well). 10x THY was used as negative control. The plates were incubated overnight at 37°C in 5% CO2. On the following day, the plates were inspected for growth inhibition halos around the well - indicating inhibitory activity of the supernatant towards the bacterial strain. At least three independent experiments were done for each supernatant.

[0229] Growth curves and cell viability

[0230] S. pneumoniae D39 and P537 were grown in THY at 37°C until an ODeoonm of 0.3. Cultures were split in 3 mL aliquots and treated with 300 uL of 10x CFS of strains A22-G22 or 10x THY. The ODeoonm was monitored every 30 min. In addition, cell viability of pneumococcal cultures treated with CFS of strains A22-G22 was determined. One hundred microliter aliquots were taken 3h after CFS treatment and serially diluted in PBS. For each dilution, three 20 uL drops were plated in BA and incubated overnight at 37°C in a 5% CO2 atmosphere. On the following day, colony forming units (CFUs) were counted. Generation of bacteriocin-deficient mutants

[0231] Deletion mutants of the bacteriocin immunity regions were constructed for loci coding for putative bacteriocins. F22 Eblpl was generated as previously described (Salvadori G, 2016). The remaining mutants were generated by allelic replacement with an antibiotic resistance gene flanked by Iox66 and Iox71 sites. Nested primers were used to amplify the desired product.

[0232] Heterologous expression and purification of BlpOnke2

[0233] To further explore the inhibitory activity of bacteriocins, a protocol for expression and purification was optimized. Briefly, the codon optimized mature nucleotide sequence of Bl pOiike2 was fused with an 8xHis- tag in the N-terminal and cloned in pET32a (pBAC-8xHis-BlpOiike2). This expression vector was transformed into E. coli C43(DE3). For expression, E. coli C43(DE3) containing pBAC-8xHis-BlpOiike2 was cultured in 2-YT medium supplemented with 100 mg / mL ampicillin and incubated overnight at 37°C with 180 rpm. Then, the culture was diluted to an optical density at 600nm (ODeoonm) of 0.05 in fresh 2- YT medium supplemented with 100 mg / mL ampicillin and incubated at 37°C with 180 rpm until culture reached ODeoonm of 0.6. At this point, protein expression was induced using 500 pM of isopropyl p-D-1- thiogalactopyranoside (IPTG) and incubation at 30°C with 150 rpm agitation 12-14 hours. On the following day, cells were harvested by centrifugation and resuspended in lysis buffer (50 mM Tris-HCI, 150 mM NaCI) with 1 mM phenylmethylsulphonyl fluoride (PMSF). Then, cells were disrupted using a French Press and soluble (organelles) and insoluble (cellular debris) fractions were separated by centrifugation.

[0234] The insoluble fraction was resuspended in wash buffer (50 mM KPi pH 7, 500 mM NaCI, 2 M Urea, 0.3% Tween20). Then, it was sonicated at 0.5x amplitude and 80% cycle for 3 minutes and centrifuged at 10,000g at 4°C for 10 minutes. The supernatant was transferred to a falcon tube and the pellet was resuspended in wash buffer. These steps were further repeated twice. Following the last centrifugation, the pellet was resuspended in Buffer A (50 mM KPi pH 7, 500 mM NaCI, 6 M Urea, 1 mM DTT, 0.3% Tween20, 5% Glycerol and 20 mM Imidazole) and ultracentrifuged at 40,000 rpm at 4°C for 1 hour. The resulting supernatant was injected into a 5 ml HisTrap HP column (Cytiva) containing Ni Sepharose High Performance (HP) Affinity Resin to perform purification by immobilized metal affinity chromatography (IMAC).

[0235] The sample was equilibrated with Buffer B (50 mM KPi pH 7, 500 mM NaCI, 1 mM DTT, 0.3% Tween20, 5% Glycerol and 20 mM Imidazole) to remove urea and gradually renature the protein. Finally, the proteins bound to the column were eluted with a step gradient with Buffer C (50 mM KPi pH 7, 500 mM NaCI, 6 M Urea, 0.3% Tween20, 5% Glycerol and 500 mM Imidazole). Purified 8xHis-BlpOiike2 was further confirmed by tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis (Tricine-SDS- PAGE) followed by Western Blot to detect His-tagged proteins. Additionally, protein concentration was determined by measuring absorbance at 205 nm.

[0236] Minimum inhibitory activity of 8xHis-BlpOnke2 against S. pneumoniae D39

[0237] To determine the MIC of 8xHis-BlpOiike2 against S. pneumoniae D39, the EUCAST guidelines were followed with minor alterations. Briefly, the pneumococcal strain was cultures in THY at 37°C until ODeoonm Of 0.5 (c.a. 108CFU / mL). Then, to each well of a 96-well plate, a mixture containing 5x105 cfu / mL, 1600 U / mL of catalase and fresh THY was added. Additionally, 25 ju.L of either two-fold dilutions of 8xHis-BlpOiike2, bacteriocin buffer or THY was added to a final volume of 200 pL in each well. Growth was monitored by incubating the plate at 37°C for 24 hours and measuring OD595nm every 10 minutes using a plate reader. The MIC was defined as being the lowest concentration in which no growth was observed between 16-24h - 108nM.

[0238] Example 6: In vivo inhibition of S. pneumoniae by BlpOnke2

[0239] Methods

[0240] The in vivo inhibitory activity of BlpOiike2 was tested against S. pneumoniae D39-CanT in a mouse model of pneumococcal nasopharyngeal colonization. Briefly, six to eight-week-old C57BL / 6J female mice were intranasally inoculated, while under general anesthesia with inhaled isoflurane (Abbot), with 105CFU in 10 pL of S. pneumoniae. Mice were daily monitored for clinical symptoms such as weight loss, lethargy, and ruffled fur. Three-day colonized mice were then intranasally inoculated with 10 pL of BlpOiike2 or the bacteriocin buffer alone, every 8 hours. Mice were sacrificed with CO2 72 hours after the first bacteriocin treatment and nasal lavage (NL) collected as previously described in the literature. Bacterial quantification was performed by 10-fold serial dilution of each NL sample in tryptic soy agar plates with 5% sheep blood supplemented with 5 pg / mL of gentamicin (GBA) to prevent the growth of contaminants.

[0241] Results

[0242] As demonstrated in Fig. 7, S. pneumoniae colonization was significantly reduced following treatment with Bl pOnke2 (c.a. 65 times), compared to treatment with the bacteriocin buffer alone.

[0243] Example 7: Inhibition ofS. pneumoniae and other relevant bacteria by the bacteriocin pair Bac24- Bac25 Methods

[0244] Streptococci were grown in C+YYB (0.86 mM L-arginine, 0.3 mM L-aspargine, 0.99 mM L-cysteine, 0.14 mM L-glutamine, 1.06 mM L-glycine, 1.53 mM L-isoleucine, 3.05 mM L-leucine, 2.38 mM L-serine, 2.13 mM L-valine, 22.5 pM CaCl2, 2.46 mM MgCl2, 5.84 mM maltose, 37 pM L-adenine, 24.4 mM sodium acetate, 2.18 mM sodium pyruvate, 1.62 pM nicotinic acid, 0.97 pM pyridoxine hydrochloride, 2.52 pM D-calcium pantothenate, 0.59 pM thiamine hydrochloride, 0.27 pM riboflavin, 28.7 pM choline chloride, 34.2 mM NaCI, 0.1 pM MnSO4, 0.819 nM biotin, 0.48 g.L-1BSA, 8 g.L-1yeast extract and 50 mM PBS; pH 7.4). Neisseria lactamica, Haemophilus influenzae and Dolosigranulum pigrum were grown in C+YYB with 20 pg.mL-1hemin and 20 pg.mL-1NAD. Staphylococcus aureus, Staphylococcus epidermidis and Moraxella catarrhalis were grown in tryptic soy broth (TSB), Corynebacterium accolens was grown in TSB with 0.5% Tween 80, and Klebsiella pneumoniae was grown in lysogeny broth.

[0245] Bacterial strains were grown to exponential phase and diluted to ODeoo of 0.1 in fresh media. Strains were added to clear non-treated 96-well plates (195 pL) and 5pL of a mixture containing 1 :1 synthetic Bac24 and Bac25 was added (final concentration 0.975 pM of each bacteriocin), or 5pL of DMSO (final concentration 0.00975%). Growth of bacteria was recorded every 10 min for 24 h in a plate reader, by measuring the OD595. Growth was calculated by the Area Under the Curve (AUC). Relative growth was calculated by the ratio in AUC of DMSO- versus Bac24-Bac25-treated bacteria. Lysis was noted when a decrease in OD (from the initial OD 0.1 ) was observed. Results

[0246] The inhibitory profile of Bac24 and Bac25 was tested against 26 bacterial species: 18 streptococci (from 5 distinct phylogenetic streptococcal groups), four Gram-negatives and four additional non-streptococcal Gram-positives (Table 7). Lysis was observed only for two species: S. pneumoniae and S. parasanguinis. A slight reduction in growth (relative growth <0.9) was noted for 16 / 26 species. However, the most affected species in terms of relative growth were S. pyogenes and S. agalactiae. Both species can cause a wide range of infections in humans (S. pyogenes - pharyngitis, skin infections, scarlet fever, etc.; S. agalactiae - urinary tract infections, pneumonia, bacteremia, etc.). This suggests that a combination of some bacteriocins could be used to target other pathogens besides S. pneumoniae.

[0247] Table 7. Inhibition profile of an equimolar mixture of bacteriocins Bac24 and Bac25 against Grampositive and Gram-negative bacteria.

[0248] Example 8: Inhibition of S. pneumoniae by S. mitis F22

[0249] Methods

[0250] The in vivo inhibitory activity of mouse adapted S. mitis strains WT (F22Ad) and mutant (F22AdAb / p7) (inoculated at 1O10CFU / mL) was tested against S. pneumoniae D39-CanT in the context of a IAV infection. Briefly, six to eight-week-old C57BL / 6J female mice were infected with 2000 plaque forming units (PFU) of X31 IAV strain in 30 pL of PBS 1x. Six days after infection, IAV and mock-infected mice were sacrificed for viral load assessment. Seven days after infection, IAV infected mice were separated into groups inoculated with 10 pL of either S. pneumoniae, S. mitis F22Ad, S. mitis 22Mbip1 , or each S. pneumoniae / S. mitis mixtures. Groups of mice inoculated with PBS 1x were used as control. For inoculum concentration confirmation, serial dilutions were plated onto tryptic soy agar plates with 5% sheep blood (BAP) and BAP supplemented with 4 pg / mL of chloramphenicol for strain differentiation. Mice were sacrificed one or three days after bacterial inoculation (8- or 10-days post IAV infection, respectively) and nasal lavage (NL), bronchoalveolar lavage (BAL) and lungs were collected. Bacterial quantification was performed by 10-fold serial dilution of each sample, plated in parallel in tryptic soy agar plates with 5% sheep blood supplemented with 5 pg / mL of gentamicin (GBA) and GBA supplemented with 4 pg / mL of chloramphenicol for strain differentiation.

[0251] The presence of immune cells in the BAL of infected mice was analyzed by flow cytometry. Samples were centrifuged and transferred to a V-bottom 96-well plate (Thermo Scientific). Fc blocking (rat antimouse CD16 / CD32, clone 2.4G2, BD Pharmingen™) was performed to minimize unspecific staining, and cells were incubated 20 min at 4°C. Primary antibodies were added and cells were incubated 25 min at 4°C, in the dark with agitation. Live / Dead Fixable Yellow Dead Cell Stain Kit (Invitrogen™) was used, and cells were incubated 20 min at room temperature in the dark. Finally, cells were fixed with Intracellular (IC) Fixation Buffer (Invitrogen™) according to manufacturer’s recommendations. Flow cytometry analysis of cell populations was performed in a BD LSR Fortessa X-20 SORP (BD Biosciences) equipped with BD FACSDiva™ 8 (BD Biosciences) and FlowJo™ software v10.10 (BD Life Sciences).

[0252] Results

[0253] The Inventors aimed to evaluate whether S. mitis F22Adcould impact S. pneumoniae colonization in the context of a previous IAV infection. To this end, mice were intranasally infected with the non-lethal and moderately virulent X31 IAV strain to enable recovery from viral infection. Seven days post IAV infection, different groups of mice were intranasally inoculated with either a mixture of S. pneumoniae and S. mitis F22Ador with each strain alone as controls. This experimental design is an adaptation of a previously described model for secondary pneumococcal pneumonia. Mice were inoculated 7 days after influenza infection since this timepoint has been associated with the peak of susceptibility to bacterial pneumonia when S. pneumoniae is aspirated directly (using between 20 and 50 pL of inoculum) to the lower respiratory tract bypassing nasopharyngeal colonization. Although this model recapitulates secondary pneumococcal pneumonia, it does not mimic the preceding S. pneumoniae colonization period, a fundamental prerequisite for disease in humans.

[0254] To overcome this limitation, in our model, the Inventors inoculated mice with S. pneumoniae in a low volume (10 pL), insufficient for direct inoculation of the lungs, enabling to first establish colonization of the URT. Mice were monitored daily for changes in body weight and development of clinical symptoms. No significant differences were observed in the weight of mice among the various groups, with the maximum weight loss occurring on day 6 post-lAV infection, with approximately 15% weight reduction. All mice were able to recover their initial weight. Damage and inflammation of the lungs were evaluated at days 6, 8, and 10 post-lAV infection. The histological score of the lungs was high on day 6 (with an average value of 24 for lAV-infected mice), corresponding to the peak of IAV infection at this timepoint. At days 8 and 10 post-lAV infection, no significant differences in the histological scores were detected between groups. These results collectively support that the severity of lung damage was independent of the bacteria inoculated and, indeed, a result of the IAV infection itself.

[0255] The nasopharyngeal loads of S. pneumoniae, obtained upon inoculation of mice exposed to IAV infection, were higher (c.a. 1 log) than those observed in the absence of IAV, as previously described. Particularly, neuraminidases present in both S. pneumoniae and IAV are known to be responsible for the desialylation of host cells, releasing high amounts of sialic acid that are used by S. pneumoniae. Consequently, S. pneumoniae growth in the nasopharynx increases, leading to its aspiration into the lower respiratory tract. In fact, detection of high pneumococcal density in the nasopharynx of humans, associated with a viral infection, has been described as a risk factor for secondary pneumococcal pneumonia. Accordingly, the Inventors also detected high densities of S. pneumoniae in the bronchoalveolar lavages and lungs at days 8 and 10 post-lAV infection (Fig. 8A and 8B). S. mitis F22Ad, by contrast, colonized the nasopharynx of mice at comparable levels regardless of presence or absence of a previous IAV infection, and was rarely detected in the bronchoalveolar lavages or the lungs, both on days 8 and 10 post-lAV infection.

[0256] By day 8 post-lAV infection, no significant differences in bacterial loads of S. pneumoniae detected in the nasal lavages were observed between mice inoculated with S. pneumoniae alone or in a mixture with S. mitis F22Ad(Fig. 8A). However, a significant difference was observed in the lungs of mice. While most mice (13 out of 14) inoculated with S. pneumoniae alone presented high bacterial loads in the lungs (ranging from 3.3 x 101CFU / mL to 2.9 x 104CFU / mL), six mice inoculated with the mixture of S. pneumoniae and S. mitis F22Adhad no S. pneumoniae in the lungs, and nine had S. pneumoniae at significantly lower densities (2.0 x 101and 9.3 x 102CFU / mL, p<0.01 ).

[0257] By day 10 post-lAV infection, the Inventors observed a significant difference in bacterial loads of S. pneumoniae recovered from the nasal lavages of mice inoculated with S. pneumoniae alone or in a mixture with S. mitis F22Ad, indicative of an anti-pneumococcal effect of S. mitis on colonization (Fig. 8B). Moreover, the preventive effect observed in the lungs by day 8 post-lAV infection was even more pronounced by day 10. While all mice inoculated with S. pneumoniae alone presented high bacterial loads in the lungs (ranging from 4.0 x 102CFU / mL to 1.5 x 106CFU / mL), nine mice inoculated with the mixture of S. pneumoniae and S. mitis F22Adhad no S. pneumoniae in the lungs, and six had S. pneumoniae at significantly lower densities (3.3 x 101and 4.8 x 102CFU / mL, p<0.01 ).

[0258] Taken together, these results suggest that S. mitis F22Adprevents progression of S. pneumoniae D39- CanT to the lungs in mice previously exposed to an IAV infection, by targeting colonizing S. pneumoniae.

[0259] To evaluate the immune response of mice following the IAV infection and the bacterial challenges described above, the Inventors performed flow cytometry of BAL samples collected at days 6, 8, and 10 and measured monocytes, neutrophils, CD4+, and CD8+cells. For monocytes, CD4+and CD8+cells, there were no statistically significant differences between groups challenged with one or more bacterial strains, suggesting that the immune response to IAV was not affected by the presence of bacteria.

[0260] Significant differences were observed in the proportion of neutrophils, found in the BAL on day 10 post- lAV infection (Fig. 8C), which was significantly higher in mice inoculated with S. pneumoniae alone. This finding is in agreement with the higher bacterial loads detected in this group of BAL samples, compared to its load when inoculated in a mixture with S. mitis, indicating that S. mitis F22Adhas a direct preventive effect on the progression of S. pneumoniae D39-Camrto the lungs.

[0261] Previously, the in vitro inhibitory effect of S. mitis F22 against S. pneumoniae was associated with the presence of the blp1 bacteriocin locus. To investigate if this bacteriocin locus was also linked to the prevention of S. pneumoniae progression to the lungs following IAV infection, a blp1 deletion mutant was constructed in the background of S. mitis F22Ad(F22AdAb / p7). The loss of anti-pneumococcal inhibitory activity of the adapted mutant S. mitis in vitro was first confirmed in overlay assays. S. mitis F22Mbiblp1 colonized mice similarly to the WT and it was also rarely detected in the bronchoalveolar lavages or the lungs, both on days 8 and 10 post-lAV infection. Mice were intranasally inoculated with a mixture of S. mitis F22Mblp1 and S. pneumoniae, with the same experimental design described above; as controls, a mixture of WT S. mitis and S. pneumoniae, or each bacterial strain alone were tested in parallel.

[0262] By day 8 post-lAV infection, S. pneumoniae alone or in the presence of S. mitis F22Ml blp1 was detected in the lungs of mice at similar densities (Fig. 8A). This was in sharp contrast with the lower lung density when S. pneumoniae was inoculated in a mixture with S. mitis F22Ad. By day 10 post-lAV infection this difference was even more pronounced (Fig. 8B). Moreover, mice inoculated with S. pneumoniae in the presence of S. mitis 22M / b!p1 , were equally colonized in the nasopharynx as mice inoculated with S. pneumoniae alone.

[0263] Together, these results indicate that the ability of S. mitis F22Adto prevent S. pneumoniae migration to the lungs is dependent on the blp1 bacteriocin locus.

[0264] Samples were also tested for the presence of monocytes, CD4+, CD8+cells, and neutrophils. Results were similar to those described above with no statistically significant differences between groups for most immune cell types, with the exception of neutrophils. Neutrophils’ recruitment was significantly higher, not only when mice were inoculated with S. pneumoniae alone, but also in the group inoculated with a mixture of S. pneumoniae and S. mitis F22^°Eblp1 (Fig. 8C).

[0265] Example 9: Inhibition of S. pneumoniae by blp1 bacteriocins

[0266] Methods

[0267] The in vivo inhibitory activity of bacteriocins from the blp1 bacteriocin locus - Bad , Bac2v1 , Bac2v2 and their combinations - was tested against S. pneumoniae D39-CanT in the mouse model of pneumococcal nasopharyngeal colonization. Briefly, six to eight-week-old C57BL / 6J female mice were intranasally inoculated with 105CFU in 10 pL of S. pneumoniae. Three-day colonized mice were then intranasally inoculated with 10 pL of each cell-free synthesized bacteriocin, alone or in combination, every 12 hours for the following three days. The CFPS reaction using water instead of DNA was used as control. Mice were sacrificed 12 hours after the last inoculation, NL collected, and bacterial quantification performed as described above.

[0268] Cell-free synthesized bacteriocins were also tested in vitro against 36 serotypes of S. pneumoniae. Pneumococcal cultures were grown in C+YYB medium at 37°C until reaching an ODeoonm of 0.5. These cultures were then diluted to 104CFU / mL in fresh C+YYB medium, distributed in 384-well plates (90 pL per well) and treated with 10 pL of cell-free synthesized bacteriocin (when in single; 5 pL of each when in combination). Controls were treated with the same volume of water, C+YYB medium or the CFPS reaction using water instead of DNA. Growth was monitored for 24 hours by measuring OD595nm every 30 minutes using a plate reader (Tecan Infinite 200 Pro). Three independent experiments were performed for each bacteriocin.

[0269] Results

[0270] To test whether bacteriocins produced by the blp1 locus of S. mitis F22Adimpacted colonization by S. pneumoniae, these were first synthesized using a cell-free protein synthesis (CFPS) system. The blp1 bacteriocin locus contains two bacteriocins, Bad and Bac2, that are not post-translationally modified. The mature bacteriocin sequences were predicted, based on the conserved amino acid sequence before a double-glycine motif; for Bac2 two putative cleavage sites were found and thus two variants - Bac2v1 and Bac2v2 - were obtained.

[0271] To test if these bacteriocins were able to perturb colonization by S. pneumoniae, mice were intranasally inoculated with S. pneumoniae D39-CanT at day 0 and colonization established for three days. At day three post-inoculation, mice were intranasally inoculated with 10 pL of either Bad , Bac2v1 or Bac2v2. Moreover, these bacteriocins are predicted to act as a two-peptide due to the presence of GxxxG motifs and thus a mixture of Bad and Ba2v1 or Bad and Ba2v2 was also intranasally inoculated in a final volume of 10 pL. The CFPS reaction using water instead of DNA was used as negative control. This inoculation was repeated every 12 hours for the following three days. At 12 hours post the last inoculation, mice were sacrificed, NL collected and S. pneumoniae bacterial loads quantified.

[0272] The Inventors observed no effect of Bad or Bac2v2 alone or in combination when the bacterial loads for S. pneumoniae were compared to the CFPS control (Fig. 9A). However, a significant decrease in the bacterial loads of S. pneumoniae was observed in mice inoculated with Bac2v1. This decrease was even more pronounced when Bac2v1 was inoculated in combination with Bad with bacterial loads being approximately 10 times lower than those obtained with the CFPS control (Fig. 9A).

[0273] Importantly, the three-day treatment with CFPS produced bacteriocins had no adverse effects on mouse health, as evaluated by monitoring mouse weight.

[0274] Taken together these results indicate that bacteriocins produced by blp1 of S. mitis F22 decrease S. pneumoniae colonization of mice and that Bad and Bac2v1 can either act synergistically and / or as a two-peptide antimicrobial agent.

[0275] To assess if the observed inhibitory effect of Bac2v1 , alone and in combination with Bad , was maintained towards a diverse collection of S. pneumoniae serotypes and genotypes, a panel of 36 S. pneumoniae strains was tested. Planktonic growth was monitored over 24 hours in the presence of either Bad , Bac2v1 , their combination or the CFPS negative control. Bac2v1 , either alone or in combination with Bad , significantly impaired bacterial growth across nearly all tested serotypes. This effect was evident as a reduction in growth rate (Fig. 9B) or a delay in the onset of the exponential phase (Fig. 9C). Notably, serotypes 14 and 15B / C were the only exceptions, showing no significant response to treatment. Bad alone did not exhibit any inhibitory activity.

[0276] The inhibitory profile observed in vivo for D39-Camrcolonization was recapitulated in vitro, with a marked decrease in growth rate upon treatment with Bac2v1 in combination with Bad . An enhanced inhibitory effect of the combination, relative to Bac2v1 alone, was also observed for serotypes 6A and 24F. However, for most serotypes, Bac2v1 alone was sufficient to disrupt normal growth dynamics.

[0277] These findings demonstrate the broad-spectrum inhibitory potential of Bac2v1 against S. pneumoniae, highlighting its promise as a candidate for targeted antimicrobial strategies, particularly when enhanced through combination with Bad .

Claims

Claims1. A composition comprising live bacteria, wherein the live bacteria comprise, or essentially consist of, at least one strain having a DNA homology of at least 95% to a strain selected from the list consisting of:Streptococcus oralis (S. oralis) A22;Streptococcus mitis (S. mitis) B22,S. mitis C22,S. mitis D22,S. mitis E22,S. mitis F22S. mitis F22AD, and / orS. mitis G22.

2. The composition according to claim 1 , wherein the live bacteria comprise: an S. oralis strain with the University of Coimbra Bacterial Culture Collection (UCCCB) accession number UCCCB 242, or an S. mitis strain with a UCCCB accession number selected from the list consisting of UCCCB 243, UCCCB 244, UCCCB 245, UCCCB 246, UCCCB 247, UCCCB 248 and UCCCB 268.

3. The composition according to any of the preceding claims, wherein the live bacteria comprise, or essentially consists of a mixture of all strains as specified in claim 1 .

4. The composition according to any of the preceding claims, comprising between 103and 1O10, particularly 104-109, more particularly 105-107live colony forming units per milliliter of said live bacteria.

5. An isolated bacteriocin polypeptide >95%, >97%, >98%, >99%, or 100% identical to a bacteriocin polypeptide listed in Table 6, and having substantially the same biological activity compared to said bacteriocin polypeptide listed in Table 6.

6. Use of an isolated bacteriocin polypeptide as specified in claim 5 for inhibiting the growth of a pathogen.

7. A composition comprising at least one isolated bacteriocin polypeptide as specified in claim 5.

8. The composition according to claim 7, wherein the composition comprises at least one polypeptide >95% >97%, >98%, >99%, or 100% similar to Bad , Ba 0.1 , Bad 0.2, Bac11 , Bac12.1 , Bac12.2, Bac12.3, Bac13, Bac14.1 , Bac14.2, Bac15, Bac16.1 , Bac16.2, Bac17.1 , Bac17.2, Bac18.1 , Bac18.2, Bac18.3, Bac19, Bac2, Bac20.1 , Bac20.2, Bac21.1 , Bac21.2, Bac22, Bac23, Bac24, Bac25, Bac26, Bac27, Bac3, Bac4, Bac5, Bac6, Bac7, Bac8, Bac9,BlpDi, BlpD2, BlpDs, BlpDcTrunc, BIpEi, BlpE2, BIpEs, BIpKi, Blpfc, BIpKs, BIpM, BIpN, BlpOiikei, BlpOiike2, BIpW-i, BriCiike, MIcAi, MlcA2, MldAi, MldA2, MldAs, MldA4, MldAs, PldAlcTrunc, PldA3N'Trunc, ScbA, SccA, ScfA, ScgA, SlkA.

9. The composition according to claim 7, or 8 wherein the composition comprises at least two polypeptides >95%, >97%, >98%, >99%, or 100% similar to two bacteriocin polypeptides listed in Table 6, particularly wherein the composition comprises at least two polypeptides >95%, >97%, >98%, >99%, or 100% similar to Bac8-Bac9, Bac1-Bac2v1 , Bad -Bad 2.2, Bad -Bad 3, Bac1-Bac15, Bac1-Bac14.1 , Bac1-Bac17.1 , Bac2v2-Bac12.2, Bac12.2-Bac15, Bac12.2- Bac16.1 , Bac12.2-Bac14.1 , Bac12.2-Bac17.1 , Bac12.2-Bac18.1 , Bac1-BlpOiike2, Bac2v1- Bac10.1 , Bac2v2-BlpOiike2, Bac2v2-Bac23, Bac10.1-Bac22, Bac10.1-Bac23, Bac22-Bac23, Bac1-Bac12.1 , Bac1-Bac16.2, Bac1-Bac12.3, BlpE3-Bac13, BlpDi-Bac15, BlpDi-Bac12.1 , BlpOiike2-Bac12.1 , BlpOiike2-Bac17.1 , BlpOiike2-Bac16.2, BlpOiike2-Bac12.3, BlpOiike2-Bac14.2, BlpOiike2-Bac18.2, Bac17.1-Bac12.3, Bac12.1-Bac18.2, Bac12.3-Bac14.2, Bac12.3-Bac18.2, Bac1-Bac20.1 , Bac10.2-Bac20.1 , Bac14.1-Bac20.1 , Bac20.1-Bac21.1 , Bac1-Bac24, Bac2v2- Bac24, BlpD2-Bac24, Bac24-Bac25, Bac17.2-Bac18.3, Bac12.1-Bac18.1 , BlpE3-Bac12.3, BlpDi-Bac18.2, BlpOiike2-Bac13, and BlpOiike2-Bac15, Bac1-Bac16.1 , Bac2v2-Bac14.1 , Bac12.2-Bac13, Bac1-Bac22, Bac2v2-Bac22, Bac2v2-Bac10.1 , Bac2v2-BlpDi, Bac2v2-BlpE2, BlpOiike2-Bac22, Bac2v2-BlpE3, BlpDi-Bac13, Bac13-Bac18.2, Bac16.2-Bac14.2, Bac20.2- Bac21.2, Bac2v2-Bac20.1 .

10. The composition according to any one of the claims 6 to 9, wherein the concentration of bacteriocin polypeptide is in the range of 1 to 1000 nM, particularly wherein the concentration of bacteriocin polypeptide is in the range of 5 to 800 nM, more particularly wherein the concentration of bacteriocin polypeptide is in the range of 10 to 500 nM.1 1. The composition according to any one of the claims 1 to 4, or 7 to 10, or the bacteriocin polypeptide according to claim 5, formulated for upper respiratory tract, ear, genital, or enteral administration.

12. The composition according to any one of claims 1 to 4, or 7 to 10, or the bacteriocin polypeptide according to claim 5, for use in inhibiting and / or reducing, growth of a pathogen in a subject.

13. The composition according to the previous claim, wherein said pathogen is selected from S. pneumoniae, S. parasanguinis, S. pyogenes, S. agalactiae, or any combination thereof.

14. The composition according to any one of the claims 1 to 4, or 7 to 10, or the bacteriocin polypeptide as specified in claim 5, for use in inhibiting the abundance of a strain classified within the taxonomical species S. pneumoniae present in a human subject’s upper respiratory tract, oral cavity, ear, genitals, or gastrointestinal tract.

15. The composition according to any one of the claims 1 to 4, or 7 to 10, or the bacteriocin polypeptide according to claim 5, for use in preventing and / or reducing colonization of a human subject with S. pneumoniae.

16. The composition according to the previous claim, wherein the subject has recently been administered an antibiotic drug.

17. The composition according to the previous claim, wherein the subject has recently been administered an antibiotic drug selected from a macrolide antibiotic, a lincosamide antibiotic, a tetracycline antibiotic, a beta-lactam antibiotic, a sulphonamide antibiotic, a quinolone antibiotic, co-trimoxazole, chloramphenicol, or any combination thereof.

18. The composition according to any one of the claims 1 to 4, or 7 to 10, or the bacteriocin polypeptide according to claim 5, for use in treatment of a patient diagnosed with a S. pneumoniae infection, particularly diagnosed with an S. pneumoniae respiratory tract infection, more particularly diagnosed with pneumonia caused by an S. pneumoniae infection.

19. The composition for use according to claim 14, wherein the S. pneumoniae is a strain characterized as resistant to a macrolide antibiotic, a lincosamide antibiotic, a tetracycline antibiotic, a beta-lactam antibiotic, a sulphonamide antibiotic, a quinolone antibiotic, co- trimoxazole, chloramphenicol, or any combination thereof.

20. A kit comprising the composition according to any one of the claims 1 to 4, or claims 7 to 10, or the bacteriocin polypeptide according to claim 5, and optionally at least one additional medicament.

21. Use of the composition according to any one of the claims 1 to 4, or 7 to 10, or the bacteriocin polypeptide according to claim 5, for inhibiting the growth of a pathogen.

22. Use of the composition according to any one of the claims 1 to 4, or claims 7 to 10, or the bacteriocin polypeptide according to claim 5, in preparation of a medicament for treatment or prevention of a microbial infection in a subject.

Images