Biomarker composition for diagnosing pulmonary fibrosis comprising FUT7 protein or gene encoding same, and method for providing information for diagnosis or prognosis of pulmonary fibrosis using same

Abstract

The present invention relates to a biomarker composition for diagnosing pulmonary fibrosis comprising an FUT7 protein or a gene encoding same, and a method for providing information for diagnosis or prognosis of pulmonary fibrosis using same. By measuring the activity or expression level of the FUT7 protein or the gene encoding same, the composition can be used for diagnosing pulmonary fibrosis and can also be applied to the screening of candidate substances for therapeutic agents for pulmonary fibrosis.

Description

Biomarker composition for diagnosing pulmonary fibrosis comprising FUT7 protein or a gene encoding the same and method for providing information for diagnosing or predicting prognosis of pulmonary fibrosis using the same

[0001] This invention was made with the support of the Ministry of Science and ICT under the task identification number 1711200031 and detailed task number 00274884. The research management specialized institution of the said task is the National Research Foundation of Korea, the research project name is "Individual Basic Research (MSIT)", the research project name is "Identification of the role of FUT7 and PRELP in collagen formation and regulation of extracellular matrix in idiopathic pulmonary fibrosis and development of control technology", the main institution is Soonchunhyang University Industry-Academic Cooperation Foundation, and the research period is 2023.09.01. ~ 2028.02.28.

[0002] This patent application claims priority to Republic of Korea Patent Application No. 10-2024-0106785, filed with the Korean Intellectual Property Office on August 9, 2024, the disclosure of which is incorporated herein by reference.

[0003] The present invention relates to a biomarker composition for diagnosing pulmonary fibrosis, including a FUT7 protein or a gene encoding the same, and a method for providing information for diagnosing or predicting the prognosis of pulmonary fibrosis using the same. More specifically, the present invention relates to a technology for measuring the activity or expression level of a FUT7 protein or a gene encoding the same and utilizing the same for diagnosing pulmonary fibrosis, and also for screening candidate substances for pulmonary fibrosis treatment.

[0004] Idiopathic pulmonary fibrosis (IPF) is an incurable, chronic lung disease caused by excessive collagen deposition, leading to respiratory failure and death. It tends to frequently worsen or progress rapidly, and mortality rates have increased in recent years due to aging.

[0005] Current treatments for pulmonary fibrosis have limited efficacy. Previously used anti-inflammatory drugs (steroids, azathioprine) and antioxidants have been shown to have no significant effect. Meanwhile, pirfenidone and nintedanib, currently used to reduce lung function decline, have unclear mechanisms of action, and serious side effects, such as liver dysfunction and gastrointestinal upset, limit their use.

[0006] While extensive research has been conducted on alveolar damage and fibroblast proliferation in idiopathic pulmonary fibrosis, understanding and research on the mechanisms regulating collagen synthesis and degradation remain scarce. Therefore, the development of novel treatments targeting the mechanisms involved in collagen synthesis and accumulation, a key pathological feature of pulmonary fibrosis, is urgently needed.

[0007] Accordingly, the present inventors confirmed that the expression level of FUT7 protein was higher in patients with idiopathic pulmonary fibrosis (IPF) compared to non-patients, and further confirmed that collagen accumulation, a representative symptom of idiopathic pulmonary fibrosis, was not induced in a FUT7 knockout animal model, thereby proving the relationship between FUT7 protein and idiopathic pulmonary fibrosis.

[0008] Accordingly, the purpose of the present invention is to provide a biomarker composition for diagnosing pulmonary fibrosis comprising the FUT7 protein or a gene encoding the same.

[0009] Another object of the present invention is to provide a composition for diagnosing pulmonary fibrosis, comprising a preparation for measuring the activity or expression level of the FUT7 protein or a gene encoding the same.

[0010] Another object of the present invention is to provide a method for providing information for diagnosing or predicting the prognosis of pulmonary fibrosis, comprising the following steps:

[0011] A measurement step for measuring the activity or expression level of the FUT7 protein or the gene encoding it from a sample isolated from a subject suspected of having pulmonary fibrosis; and

[0012] A comparison step of comparing the activity or expression level of the protein or the gene obtained in the above measurement step with the activity or expression level of the protein or the gene from a normal control sample.

[0013] Another object of the present invention is to provide a method for providing information for diagnosing or predicting the prognosis of pulmonary fibrosis, comprising the following steps:

[0014] A measurement step of measuring the expression level of FUT7 protein from bronchoalveolar lavage fluid (BALF) isolated from a subject suspected of having pulmonary fibrosis; and

[0015] A judgment step in which it is determined that there is a high possibility of developing pulmonary fibrosis if the expression level of the protein obtained in the above measurement step is 0.163 ng / mL or higher.

[0016] Another object of the present invention is to provide a method for screening a candidate substance for a pulmonary fibrosis treatment agent comprising the following steps:

[0017] A treatment step of contacting or administering a candidate substance to a cell, tissue or subject other than a human in which pulmonary fibrosis is induced;

[0018] A measurement step of measuring the activity or expression level of the FUT7 protein or the gene encoding it from the cell, tissue or subject other than a human that has contacted or administered the candidate substance; and

[0019] A screening step for selecting a candidate substance that reduces the activity or expression level of the protein or gene by contact or administration.

[0020] Another object of the present invention relates to the use of a preparation for diagnosing pulmonary fibrosis that measures the activity or expression level of the FUT7 protein or the gene encoding it.

[0021] The present invention relates to a biomarker composition for diagnosing pulmonary fibrosis, including a FUT7 protein or a gene encoding the same, and a method for providing information for diagnosing or predicting the prognosis of pulmonary fibrosis using the same. According to the present invention, the activity or expression level of the FUT7 protein or the gene encoding the same can be measured to diagnose pulmonary fibrosis, and can also be applied to screening for candidate substances for pulmonary fibrosis treatment.

[0022] The present inventors confirmed that the expression level of FUT7 protein was higher in patients with idiopathic pulmonary fibrosis (IPF) compared to non-patients, and further confirmed that collagen accumulation, a representative symptom of idiopathic pulmonary fibrosis, was not induced in a FUT7 knockout animal model, thereby proving the relationship between FUT7 protein and idiopathic pulmonary fibrosis.

[0023] Hereinafter, the present invention will be described in more detail.

[0024] One aspect of the present invention is a biomarker composition for diagnosing pulmonary fibrosis comprising a FUT7 protein or a gene encoding the same.

[0025] In the present invention, the pulmonary fibrosis may be idiopathic pulmonary fibrosis (IPF).

[0026] Another aspect of the present invention is a composition for diagnosing pulmonary fibrosis, comprising a preparation for measuring the activity or expression level of a FUT7 protein or a gene encoding the same.

[0027] In the present invention, the preparation may be characterized by being an antibody, peptide, peptide mimetic, aptamer or compound that specifically binds to the protein, or a primer or probe that specifically binds to the gene.

[0028] Another aspect of the present invention provides a method for providing information for diagnosing or predicting prognosis of pulmonary fibrosis, comprising the following steps:

[0029] A measurement step for measuring the activity or expression level of the FUT7 protein or the gene encoding it from a sample isolated from a subject suspected of having pulmonary fibrosis; and

[0030] This is a comparison step for comparing the activity or expression level of the protein or the gene obtained in the above measurement step with the activity or expression level of the protein or the gene from a normal control sample.

[0031] In the present invention, the measuring step may be performed by a preparation including an antibody, peptide, peptide mimetic, aptamer or compound that specifically binds to the protein, or a primer or probe that specifically binds to the gene.

[0032] In the present invention, the method may additionally include a determination step of determining that there is a high possibility of developing pulmonary fibrosis when the activity or expression level of the gene is increased compared to a normal control sample.

[0033] Another aspect of the present invention is a method for providing information for diagnosing or predicting the prognosis of pulmonary fibrosis, comprising the following steps:

[0034] A measurement step of measuring the expression level of FUT7 protein from bronchoalveolar lavage fluid (BALF) isolated from a subject suspected of having pulmonary fibrosis; and

[0035] A judgment step in which it is determined that there is a high possibility of developing pulmonary fibrosis if the expression level of the protein obtained in the above measurement step is 0.163 ng / mL or higher.

[0036] In the present invention, the measuring step may be performed by a preparation including an antibody, peptide, peptide mimetic, aptamer or compound that specifically binds to the protein, or a primer or probe that specifically binds to the gene.

[0037] In the present invention, the determination step may additionally determine that the risk of pulmonary fibrosis is high if the expression level of the FUT7 protein obtained in the measurement step is 0.285 ng / mL or higher.

[0038] Another aspect of the present invention is a method for screening a candidate substance for a pulmonary fibrosis treatment agent, comprising the following steps:

[0039] A treatment step of contacting or administering a candidate substance to a cell, tissue or subject other than a human in which pulmonary fibrosis is induced;

[0040] A measurement step of measuring the activity or expression level of the FUT7 protein or the gene encoding it from the cell, tissue or subject other than a human that has contacted or administered the candidate substance; and

[0041] A screening step for selecting a candidate substance that reduces the activity or expression level of the protein or gene by contact or administration.

[0042] In the present invention, the measuring step may be performed by a preparation including an antibody, peptide, peptide mimetic, aptamer or compound that specifically binds to the protein, or a primer or probe that specifically binds to the gene.

[0043] The present invention relates to a biomarker composition for diagnosing pulmonary fibrosis, including a FUT7 protein or a gene encoding the same, and a method for providing information for diagnosing or predicting the prognosis of pulmonary fibrosis using the same. The composition can be used for diagnosing pulmonary fibrosis by measuring the activity or expression level of the FUT7 protein or the gene encoding the same, and can also be applied to screening for candidate substances for pulmonary fibrosis treatment.

[0044] Figure 1a is an immunohistochemistry staining photograph confirming the expression level of FUT7 in lung tissues of a patient group (IPF) and a non-patient group (NC) with idiopathic pulmonary fibrosis according to one embodiment of the present invention.

[0045] Figure 1b is a photograph of the immunoblotting results confirming the expression level of FUT7 in lung tissues of a group of idiopathic pulmonary fibrosis patients (IPF) and a group of non-patients (NC) according to one embodiment of the present invention.

[0046] Figure 1c is a graph showing the results of immunological blotting confirming the expression level of FUT7 in lung tissues of a group of idiopathic pulmonary fibrosis patients (IPF) and a group of non-patients (NC) according to one embodiment of the present invention.

[0047] Figure 2a is a graph comparing the content of FUT7 in bronchoalveolar lavage fluid (BALF) of a patient group with idiopathic pulmonary fibrosis (IPF) and a non-patient group (NC) according to one embodiment of the present invention.

[0048] Figure 2b is a graph showing the forced vital capacity (FVC) measurement values ​​compared to the content of FUT7 in bronchoalveolar lavage fluid of a patient group with idiopathic pulmonary fibrosis (IPF) and a non-patient group (NC) according to one embodiment of the present invention.

[0049] Figure 2c is a diagnostic accuracy graph verified through receiver operating characteristic (ROC) analysis based on data on the content of FUT7 in bronchoalveolar lavage fluid of a group of idiopathic pulmonary fibrosis patients (IPF) and a group of non-patients (NC) according to one embodiment of the present invention.

[0050] Figure 2d is a survival analysis graph based on data on the content of FUT7 in bronchoalveolar lavage fluid of idiopathic pulmonary fibrosis (IPF) patients and non-patients (NC) according to one embodiment of the present invention and prognosis information data of IPF patients.

[0051] Figure 3a is a photograph showing the expression level of FUT7 protein from the lungs of a FUT7 KO (Knock-Out) mouse produced according to one embodiment of the present invention, confirmed by western blot.

[0052] Figure 3b is an immunohistochemical staining photograph confirming the expression level of FUT7 protein from the lungs of a FUT7 KO mouse produced according to one embodiment of the present invention.

[0053] Figure 3c is a photograph showing the expression level of FUT7 protein from the lungs of a FUT7 KO mouse produced according to one embodiment of the present invention, confirmed by Western blot according to whether or not bleomycin (BLM) was administered.

[0054] Figure 4a is a schematic diagram showing the process of producing a pulmonary fibrosis induction model from a FUT7 KO mouse according to one embodiment of the present invention.

[0055] Figure 4b is a hematoxylin and eosin (H&E) stained photograph showing the degree of inflammation and fibrosis from lung tissue of a FUT7 KO mouse in which pulmonary fibrosis is induced according to one embodiment of the present invention.

[0056] Figure 4c is a trichrome stained photograph showing the degree of inflammation and fibrosis from lung tissue of a FUT7 KO mouse in which pulmonary fibrosis is induced according to one embodiment of the present invention.

[0057] Figure 4d is a graph showing the results of trichrome staining that quantified the degree of inflammation and fibrosis from lung tissue of a FUT7 KO mouse in which pulmonary fibrosis was induced according to one embodiment of the present invention, using a hydroxyproline assay.

[0058] Figure 4e is a graph showing the total number of cells counted from lung tissue of a FUT7 KO mouse in which pulmonary fibrosis is induced according to one embodiment of the present invention.

[0059] FIG. 4f is a graph showing the number of macrophages counted from lung tissue of a FUT7 KO mouse in which pulmonary fibrosis is induced according to one embodiment of the present invention.

[0060] Figure 4g is a graph showing the number of neutrophils counted from lung tissue of a FUT7 KO mouse in which pulmonary fibrosis is induced according to one embodiment of the present invention.

[0061] Figure 4h is a graph showing the number of lymphocytes counted from lung tissue of a FUT7 KO mouse in which pulmonary fibrosis is induced according to one embodiment of the present invention.

[0062] Figure 5a is a schematic diagram of the pGFP-C-shLenti shRNA cloning vector (ORIGENE).

[0063] FIG. 5b is a photograph showing the expression level of collagen from a FUT7 KD stable cell line in which the FUT7 gene is knocked down according to one embodiment of the present invention, confirmed by Western blot.

[0064] The present invention relates to a biomarker composition for diagnosing pulmonary fibrosis comprising a FUT7 protein or a gene encoding the same.

[0065] Hereinafter, the present invention will be described in more detail with reference to the following examples. However, these examples are only intended to illustrate the present invention, and the scope of the present invention is not limited by these examples.

[0066] Throughout this specification, "%" used to indicate the concentration of a particular substance is (wt / wt)% for solid / solid, (wt / vol)% for solid / liquid, and (vol / vol)% for liquid / liquid, unless otherwise stated.

[0067]

[0068] Example 1: Confirmation of differences in FUT7 expression levels according to the presence or absence of idiopathic pulmonary fibrosis.

[0069] Lung tissue samples were isolated from patients with idiopathic pulmonary fibrosis (IPF) and non-patients (NC).

[0070] Specifically, the lung tissue samples were prepared by fixing lung tissues of patients and non-patients with 4% paraformaldehyde, preparing paraffin blocks, and cutting them at 4 μm intervals to prepare tissue samples. After deparaffinization, the tissue samples were washed in running water, washed with DPBS (Dulbecco's Phosphate-Buffered Saline), and then blocked with 5% horse normal serum at room temperature for 1 hour.

[0071] The primary antibody (anti-FUT7, R&D systems) was diluted 1:200 in blocking solution and incubated at 4°C for 17 hours. Subsequently, the secondary antibody (anti-mouse IgG) was diluted 1:1000 and incubated at room temperature for 1 hour. Approximately two drops of ABC solution (avidin: biotin: PBS = 1:1:48) were added, and the sections were stained with immunohistochemistry by treating with DAB solution (0.0005% DAB, 0.03% H2O2 in 50 mM Tris-HCl (pH 7.4) solution) for 10 seconds. After mounting the samples, they were photographed using an optical microscope.

[0072] Next, the expression level of FUT7 was confirmed from the lung tissue sample using immunoblotting.

[0073] Specifically, lysis buffer was added to the lung tissue to prepare a lysate, and proteins were extracted. The proteins were developed using 10% SDS PAGE, transferred to a membrane, and blocked with 5% skim milk. After reaction using anti-FUT7 (R&D systems, 1:1000) as the primary antibody and anti-mouse IgG (FUT7 1:3000) as the secondary antibody, the detection process was performed.

[0074] As can be seen in Figures 1a to 1c, the expression level of FUT7 (fucosyltransferase 7) was confirmed, and the expression level of FUT7 was significantly increased by about 2-fold in the tissues of the patient group (IPF) compared to the tissues of the non-patient group (NC).

[0075]

[0076] Example 2: Confirmation of the correlation between FUT7 expression level in alveolar lavage fluid and lung function.

[0077] Using ELISA, the expression level of FUT7 was measured in bronchoalveolar lavage fluid (BALF) obtained from 12 non-patient normal controls and 56 patients. The correlation with lung function based on forced vital capacity (FVC) measurements was confirmed, and the diagnostic accuracy was verified through receiver operating characteristic (ROC) analysis, and the risk was also confirmed through survival rate analysis.

[0078] Specifically, to obtain BALF, the site where the lavage fluid was to be injected was approached through a bronchoscope along the bronchial tube, and 20 to 50 mL of sterile saline was repeatedly injected several times to obtain the sample. The sample was centrifuged, the supernatant was collected, and 100 μl was added to each FUT7-coated plate and incubated at 37°C for 1 hour. After washing three times, the secondary antibody was added and incubated at room temperature for 1 hour. After washing three times, streptavidin-HRP was added and incubated at room temperature for 1 hour. After washing three times, TMB solution was added and reacted at room temperature for 30 minutes, and then the stop solution was added and measured with an ELISA reader.

[0079] As can be seen in Figures 2a and 2b, the content of FUT7 in the patient group (IPF) was 0.229 ± 0.038 ng / mL, which was approximately 3 times higher than that of the non-patient group (NC) at 0.085 ± 0.044 pg / mL, and FUT7 was confirmed to be inversely proportional to the lung function value based on the forced vital capacity (the total amount of air exhaled with effort; FVC%) measurement value (p < 0.01).

[0080] As shown in Figures 2c and 2d, ROC analysis verified that FUT7 could distinguish between IPF and the control group with a diagnostic accuracy of 77.98% at a cutoff value of 0.163 ng / mL (specificity: 64.29%, sensitivity: 91.67%), and in survival analysis, the group with FUT7 levels ≥0.285 ng / mL showed a tendency for a 5.38-fold higher risk compared to the group with levels ≥0.285 ng / mL (p= 0.02). The survival analysis results were derived from the Kaplan-Meier survival analysis using data on FUT7 content in bronchoalveolar lavage fluid and prognostic information (follow-up period, death status) of IPF patients.

[0081]

[0082] Example 3: Generation of FUT7 KO mice

[0083] To prepare an idiopathic pulmonary fibrosis-induced disease model, the FUT7 gene was knocked out by deleting 1,016 bp of DNA from exon 2 (underlined) of the FUT7 mouse gene (GenBank accession number: NM_001177366.1), which consists of four exons, using the CRISPR / Cas9 system to generate a FUT7 KO mouse (Macrogen, Seoul).

[0084] 서열번호1명칭FUT7 마우스 유전자(GenBank accession number: NM_001177366.1)서열(5'->3')1 cttggtgaga tggagaggaa ccttggctac aagctatagc tttgcccacc agagcctgct61 ggaggggaat caaacaagcc tggacctgag gctgggacta gctttcctgt ttctggagtg121 gatgccaacc ccctgcccac cagcctgcct gtccacgcca gggacacaca gactccttcc181 ctttccagac tggaaagccc cctcctggga gagcaggaag gaagcaacct gcaactcttc241 cagccctgga ccttgggctg aacctacagt tcaagggtac caccccacca ggaggctgcg301 ggcctggggc ggcctagctg gaggagcaac attcatggta atttggtttt tctggctgtg361 gggatcagct cctggaagtg cccctgtgcc tcagtccaca ctcaccatcc ttatctggca421 ctggcctttc accaaccggc cgccagagct acctggtgac acctgcactc gctatggcat481 ggccagctgc cgtctgagtg ctaaccggag cctgctagcc agtgctgatg ctgtggtctt541 ccaccaccgt gagctgcaaa cccggcaatc tctcctaccc ctggaccaga ggccacacgg601 acagccttgg gtctgggcct ccatggaatc gcccagtaat acccatggtc tccatcgctt661 ccggggcatc ttcaactggg tgctgagcta tcggcgtgat tcagatatct ttgtacccta721 cggtcgcttg gagcctctct ctgggcccac atccccacta ccggccaaaa gcaggatggc781 tgcctgggtg atcagcaatttccaggagcg gcagcagcgt gcaaagctgt accggcagct841 ggcccctcat ctgcaggtgg atgtgttcgg tcgcgccagc ggacggcccc tatgcgctaa901 ttgtctgctg cccactttgg cccggtaccg cttctacctg gcctttgaga actcacagca961 tcgggactac atcactgaga agttctggcg caatgccctg gcggctggtg ctgtacccgt1021 ggcgctggga cctcctcggg ccacctacga ggcttttgtg ccaccagatg cctttgtaca1081 cgtggacgac ttcagctctg cccgtgaact ggctgtcttc ctcgtcagca tgaatgagag1141 tcgttatcgt ggcttctttg cttggcgaga ccggctccgt gtgcggctcc tgggtgactg1201 gagggagcgc ttctgcacca tctgtgcccg ctacccttac ttgccccgca gccaggtcta1261 tgaagacctt gaaagctggt tccaggcttg aactcctgct gctgggagag gctggatggg1321 tgggagactg atgttgaaac caaagagctg ggcatccagg cttttggtca ccatggcact1381 accccaaggc ttttcctgtt cagtgagcag gaattcagga tataaggaga aaactgggct1441 gagatgccct ggtgggcttt agagtagggg cccaggataa gagacaatga attaatgagg1501 agcatatggg gaaggtggct gagggtccct gacttacctt gacccatggc tgaaggctcc1561 atgcccatgg ctggagctgg gaccctacac ttctatagtc aaggtgctta gcctcaaggt1621 tgcagatgca ccctctagta ctctgggtgc agactgtacactgggcgcag ggggttgtgg1681 aaggacagtg cagatgattc tgggcttttg acaccacagt tcccccaggg aaagaggcac1741 tactaataaa aacactgaca gaaa

[0085] Thereafter, as shown in Figures 3a and 3b, the expression level of FUT7 protein was measured by western blot for FUT7 KO mice (+ / +) and control WT mice (- / -). In addition, changes in collagen expression due to knockout of the FUT7 gene were confirmed.

[0086] Specifically, mice were divided into two groups: FUT7 KO mice and WT (Wild Type) mice as a control group. The mice were sacrificed to obtain bronchoalveolar lavage fluid (BALF), intratracheal, and lung tissues. Primary fibroblasts were then isolated from the lungs and cultured. The cultured primary fibroblasts were treated with bleomycin in 0.2% DMEM medium at 10 ug / ml for 48 hours to induce lung fibrosis. Then, changes in collagen in the cells were confirmed using Western blot.

[0087] As can be seen in Figure 3c, compared to WT mice, the levels of ECM (extracellular matrix) components such as collagen, fibronectin, and α-SMA (Alpha Smooth Muscle Actin) decreased in FUT7 KO mice, and did not significantly increase even after bleomycin treatment.

[0088]

[0089] Example 4: Production of a pulmonary fibrosis-induced model

[0090] As shown in Fig. 4a, FUT7 KO mice and control WT mice were administered bleomycin intratracheally (IT) on day 0, and sacrificed (sampled) on day 21 to obtain lung tissue and bronchoalveolar lavage fluid.

[0091] To determine the degree of inflammation and fibrosis in the lung tissue of the mouse, hematoxylin and eosin (H&E) staining was performed. To determine the degree of collagen accumulation, trichrome staining and hydroxyproline assay were performed in relation to lung tissue weight, and the number of inflammatory cells was determined in bronchoalveolar lavage fluid.

[0092] As can be seen in Figure 4b, inflammation and fibrosis were significantly reduced in the lung tissue of the FUT7 KO mouse group (FUT7 KO BLM) in which pulmonary fibrosis was induced compared to the control group (BLM).

[0093] CTLFUT7 KOBLMFUT7 KO + BLMHydroxyproline (ug / mg)0.106±0.0170.097±0.0050.274-±0.0380.144±0.011

[0094] In addition, as can be seen in Table 2 and Figures 4c and 4d, collagen accumulation was significantly reduced in the lung tissue of the FUT7 KO mouse group (FUT7 KO BLM) in which pulmonary fibrosis was induced compared to the control group (BLM). The number of total cells, macrophages, neutrophils, and lymphocytes was counted from the bronchoalveolar lavage fluid of the mice.

[0095] CTLFUT7 KOBLMFUT7 KO + BLMTotal cell count (X 10 4 / ml)5.156±0.7424.542±1.27123.800±2.41714.436±1.553Macrophage count (X 10 4 / ml)5.124±0.7364.154±0.91116.322±1.35911.740±1.353Neutrophil count (X 10 4 / ml)0.020±0.0030.080±0.0703.489±0.6080.781±0.081Lymphocyte count (X 10 4 / ml)0.010±0.0040.264±0.2843.876±0.5431.487±0.120

[0096] As can be seen in Table 3 and Figures 4e to 4h, the number of inflammatory cells in the bronchoalveolar lavage fluid of the FUT7 KO mouse group (FUT7 KO BLM) in which pulmonary fibrosis was induced was significantly reduced compared to the control group (BLM).

[0097]

[0098] Example 5: Confirmation of changes in collagen expression due to decreased expression of FUT7 protein.

[0099] In order to confirm the change in collagen expression level when the expression of FUT7 protein was reduced by FUT7 shRNA, human fibroblasts were transduced using the pGFP-C-shLenti shRNA cloning vector (ORIGENE) as shown in Fig. 5a to produce a FUT7 KD stable cell line in which the FUT7 gene was knocked down, and 10 ng / ml of TGF-β was treated to stimulate collagen expression.

[0100] As can be seen in Fig. 5b, it was confirmed that a decrease in the expression of FUT7 protein led to a decrease in the expression of collagen protein, and even when stimulated by TGF-β, the expression amount of collagen protein did not significantly increase.

[0101] The present invention relates to a biomarker composition for diagnosing pulmonary fibrosis, including a FUT7 protein or a gene encoding the same, and a method for providing information for diagnosing or predicting the prognosis of pulmonary fibrosis using the same. More specifically, the present invention relates to a technology for measuring the activity or expression level of a FUT7 protein or a gene encoding the same and utilizing the same for diagnosing pulmonary fibrosis, and also for screening candidate substances for pulmonary fibrosis treatment.

Claims

1. A biomarker composition for diagnosing pulmonary fibrosis comprising a FUT7 protein or a gene encoding the same.

2. A biomarker composition for diagnosing pulmonary fibrosis, wherein the pulmonary fibrosis in claim 1 is idiopathic pulmonary fibrosis (IPF).

3. A composition for diagnosing pulmonary fibrosis, comprising a preparation for measuring the activity or expression level of FUT7 protein or a gene encoding the same.

4. A composition for diagnosing pulmonary fibrosis, characterized in that in the third paragraph, the agent is an antibody, peptide, peptide mimetic, aptamer or compound that specifically binds to the protein, or a primer or probe that specifically binds to the gene.

5. A method for providing information for diagnosing or predicting the prognosis of pulmonary fibrosis, including the following steps: A measurement step for measuring the activity or expression level of the FUT7 protein or the gene encoding it from a sample isolated from a subject suspected of having pulmonary fibrosis; and A comparison step of comparing the activity or expression level of the protein or the gene obtained in the above measurement step with the activity or expression level of the protein or the gene from a normal control sample.

6. A method for providing information for diagnosing or predicting the prognosis of pulmonary fibrosis, wherein the measuring step is performed by a preparation comprising an antibody, peptide, peptide mimetic, aptamer or compound that specifically binds to the protein, or a primer or probe that specifically binds to the gene.

7. A method for providing information for diagnosing or predicting the prognosis of pulmonary fibrosis, wherein the method further includes a determination step of determining that the possibility of developing pulmonary fibrosis is high when the activity or expression level of the gene is increased compared to a normal control sample.

8. A method for providing information for diagnosing or predicting the prognosis of pulmonary fibrosis, including the following steps: A measurement step of measuring the expression level of FUT7 protein from bronchoalveolar lavage fluid (BALF) isolated from a subject suspected of having pulmonary fibrosis; and A judgment step in which it is determined that there is a high possibility of developing pulmonary fibrosis if the expression level of the protein obtained in the above measurement step is 0.163 ng / mL or higher.

9. A method for providing information for diagnosing or predicting the prognosis of pulmonary fibrosis, wherein the measuring step is performed by a preparation comprising an antibody, peptide, peptide mimetic, aptamer or compound that specifically binds to the protein, or a primer or probe that specifically binds to the gene.

10. A method for providing information for diagnosing or predicting prognosis of pulmonary fibrosis, wherein in the judgment step, if the expression level of the FUT7 protein obtained in the measurement step is 0.285 ng / mL or higher, the risk of pulmonary fibrosis is additionally determined to be high.

11. A method for screening candidates for pulmonary fibrosis treatment agents, including the following steps: A treatment step of contacting or administering a candidate substance to a cell, tissue or subject other than a human in which pulmonary fibrosis is induced; A measurement step of measuring the activity or expression level of the FUT7 protein or the gene encoding it from the cell, tissue or subject other than a human that has contacted or administered the candidate substance; and A screening step for selecting a candidate substance that reduces the activity or expression level of the protein or gene by contact or administration.

12. A method for screening a candidate substance for a pulmonary fibrosis treatment agent in claim 11, wherein the measuring step is performed by a preparation comprising an antibody, peptide, peptide mimetic, aptamer or compound that specifically binds to the protein, or a primer or probe that specifically binds to the gene.

Images