Method for synergistic use of bacillus aryabhattai and arbuscular mycorrhizal fungi

By synergistically applying Bacillus aureus and arbuscular mycorrhizal fungi, a compound microbial system is formed, which solves the problems of easy inactivation of microbial fertilizers in high-salt environments and insignificant soil remediation effects, and achieves efficient soil ecological restoration and plant growth promotion.

WO2026036582A1PCT designated stage Publication Date: 2026-02-19SHANGHAI ZHENYAN BIOLOGICAL TECHNOLOGY CO LTD
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2024/136993
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-08-15
Filing Date
2024-12-05
Publication Date
2026-02-19

AI Technical Summary

Technical Problem

Existing microbial agents are prone to inactivation in high-salt environments and frequently clump together, which limits their application and effectiveness in large-scale planting. Furthermore, traditional microbial fertilizers cannot effectively decompose potassium, fix nitrogen, or migrate heavy metal ions, resulting in insignificant soil ecological restoration effects.

Method used

By employing a synergistic application of Bacillus aureus and arbuscular mycorrhizal fungi, a 1:4 ratio of mixed culture is used to form a complex microbial community. This community can decompose potassium and fix nitrogen, migrate heavy metal ions, and form a large mycelial network in the soil, thereby improving nutrient absorption.

Benefits of technology

It significantly improved the biological activity and stress resistance of microbial fertilizers, enhanced their effects on soil ecological restoration and plant growth promotion, solved the activity problem in high-salt environments, and improved soil remediation capacity.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

A method for synergistic use of Bacillus aryabhattai and arbuscular mycorrhizal fungi, comprising the following step: mixing Bacillus aryabhattai and arbuscular mycorrhizal fungi at a ratio of 1.0:4.0 for culture to obtain a composite microbial inoculant. For Bacillus aryabhattai, the taxonomic name is Bacillus aryabhattai, the deposit location is China Center for Type Culture Collection, the access number is CCTCC NO: M20232038, and the deposit date is 1 November 2023. Compared with the prior art, the present invention relates to using the common characteristics of Bacillus aryabhattai and arbuscular mycorrhizal fungi to form a novel biofertilizer, which can solubilize potassium, fix nitrogen, and mobilize heavy metal ions, thereby achieving obvious effects on soil ecological remediation, disease resistance, and promotion of plant growth.
Need to check novelty before this filing date? Find Prior Art

Description

Method for synergistic application of bacillus aryabhattai and arbuscular mycorrhizal fungi TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to a method for synergistic application of bacillus aryabhattai and arbuscular mycorrhizal fungi. BACKGROUND

[0002] According to the 2020.03.23 Science and Technology Daily, after the strain of high temperature, salt, acid and alkali, hemolysis safety test, China's MB35-5 strain of 16s sequence and India's ayerpo bacillus 16s rDNA sequence homology is as high as 99%, identified by the national strain identification center as bacillus aryabhattai, it has super strong "silicon" performance, can be mixed with common pesticides and can be made into a kind of biological active silicon fertilizer. Patent application No. 201410167750.8 reported the application of bacillus aryabhattai microbial inoculant in promoting plant growth under high salt stress; authorized patent No. 201610330179.6 discloses a strain of succulents rhizosphere growth promoting bacillus aryabhattai and its application; authorized patent No. 201610368365.9 discloses a blueberry special rhizosphere growth promoting bacillus aryabhattai and its application; authorized patent No. 201610036163.4 discloses that bacillus aryabhattai J5 has the functions of producing auxin, producing siderophore, producing ammonia, producing protease, resisting salt, antagonizing and dephosphorizing; authorized patent No. 201610803675.9 discloses a kind of tea tree special phosphorus and potassium releasing compound microbial inoculant and its preparation method; authorized patent No. 201711081504.0 discloses a strain of bacillus aryabhattai producing neutral amylase; authorized patent No. 201711396251.6 discloses a strain of bacillus aryabhattai for promoting plant growth in heavy saline-alkali soil and its application; authorized patent No. 202010532445.X discloses a preparation method of high concentration bacillus aryabhattai microbial inoculant, which comprises the steps of bacillus aryabhattai strain activation culture, strain fermentation culture, charge replacement exclusion method enrichment and concentration, and spray drying, etc. Obtain high concentration liquid inoculant and solid bacterial powder.The authorized patent No. 202010764651.3 discloses a composite microbial preparation containing wood vinegar and its preparation method and application. The authorized patent No. 202010819593.X screens Bacillus aryabhattai with high efficiency to inhibit various plant fungal pathogens including Fusarium graminearum, Aureobasidium melaninum, Fusarium oxysporum, and Rhizoctonia solani, etc. After use, it does not produce a series of problems such as chemical pesticide residues. The authorized patent No. 202010691164.9 discloses a preparation method of a plant inducer. The authorized patent No. 202110697788.6 discloses a Bacillus aryabhattai strain resistant to heavy metal copper and its application. The plant seeds dyed with Bacillus aryabhattai JDD maintain a germination rate of 76.7-91% under copper ion stress of various concentrations. The authorized patent No. 202111112565.5 discloses a Bacillus strain and its application in promoting growth and degrading chlorpyrifos in rice. The application No. 202111426718.3 discloses a microbial soil remediation agent and its preparation method, which provides a microbial soil remediation agent including Bacillus aryabhattai MB35-5, soybean meal, humic acid salt, low-rank coal, and silicon-containing mineral substances. The microbial soil remediation agent can effectively improve the pH of acidic soil, benefit crop growth, and increase yield. The authorized patent No. 202210230797.9 discloses a broad-spectrum Bacillus aryabhattai strain and its application, which can effectively control the occurrence of pine needle brown spot disease. The authorized patent No. 202210026480.3 discloses Bacillus aryabhattai HZ18-3 and its use. It can tolerate a wide pH range, promote plant growth and development through nitrogen fixation, phosphorus solubilization, and iron carrier production, and decompose cellulose through cellulase production, which is beneficial to soil remediation and can effectively inhibit the growth of Streptomyces prolixus with good resistance. Hebei Mengbang Biological Technology Co., Ltd. authorized patent No. 202210572605.2 discloses a microbial agent granule and its preparation method. It solves the problem of high salt environment caused by mixing various organic substances and inorganic fertilizers in related technologies, which leads to the loss of living bacteria. At the same time, due to high water content, clumping occurs when seeds and fertilizers are sown together, which limits the use range and effect of the product and is not conducive to large-scale crop planting popularization and dissemination. The authorized patent No. 202210706553.3 of Nanjing Forestry University discloses a Bacillus strain and its application. In addition to fixing atmospheric nitrogen, Bacillus aryabhattai also has the functions of dissolving organic and inorganic phosphorus, solubilizing potassium, and secreting IAA. This strain is a rich resource of Pecan growth-promoting bacteria, which has important significance in the development of Pecan microbial fertilizer, the reduction of chemical fertilizer use, and the promotion of plant growth in agriculture and forestry production.Guangxi Academy of Sciences authorized patent 202210655438.8 discloses a kind of biological desulfurization's arbuscular bacillus and its application;Patent application number 202211060367. discloses a kind of brassinolide-zearalenone-arbuscular bacillus compound medicine fertilizer and its preparation method and application;Shanxi Agricultural University patent application number 202210920265.8 discloses a kind of composite microbial inoculant and its preparation method and application in the prevention and treatment of strawberry hollow disease.

[0003] Aarbuscular mycorrhizal fungi (AMF) is a special microorganism widely distributed in various types of soil. It can form a symbiotic mycorrhizal with the roots of about 90% of vascular plants on earth and form a large hyphal network in the soil through its external hyphae, helping the host plant to absorb nutrients such as P, Zn, Cu, and other mineral nutrients with poor mobility in the soil, improving the nutrient level of the host. It also has good control effect on root rot caused by "Sclerotium", "Sclerotinia", "Verticillium", and nematode-induced vascular diseases. Aarbuscular mycorrhizal fungi are a new type of biological fertilizer in agricultural production, which can significantly up-regulate the expression of carbon and phosphorus metabolism-related genes in maize to respond to low phosphorus stress. In the growth of medicinal plants, AMF secretions regulate the growth of Salvia miltiorrhiza. AMF root external hyphae can absorb organic nitrogen in the soil and assimilate it into rich nitrogen arginine through the glutamine pathway. Inoculation of AMF can increase chlorophyll content, enhance the light energy utilization efficiency of tulips, promote the growth of tulips, and increase the biomass of tulip plants. Inoculation of AMF can improve the absorption of mineral nutrients by dandelion, promote plant growth, dilute the chromium concentration in the plant body, and alleviate the toxic effects of "chromium" on dandelion. Inoculation of AMF fungi can provide nutrient elements for medicinal plants and stimulate the growth of medicinal plants. By affecting the secondary metabolism process of medicinal plants, the synthesis of active substances such as terpenes and flavonoids is promoted to improve the quality of medicinal plants. By increasing antioxidant enzyme activity, soluble sugar and soluble protein content, the antioxidant capacity of the plant is enhanced.

[0004] Lin Yulan, Zhang Linping, et al. used Camellia oleifera Abel, arbuscular mycorrhiza (AM) fungus Claroideogolmus etuicatum, and phosphorus-solubilizing bacteria Bacillus aryabhattai as materials to explore the effects of AM fungus and Bacillus aryabhattai interaction on the growth and phosphorus content of Camellia oleifera through pot experiments. The results showed that AM fungus and Bacillus aryabhattai interaction can increase the phosphorus concentration in the aboveground and root system of Camellia oleifera, and the growth-promoting effect on Camellia oleifera is stronger than single inoculation.

[0005] The application is based on the authorized patent 201710547574544 of Shanghai Zhenyan Derivative Technology Co., Ltd. Glomus fungus complex culture medium and symbiotic inclusion and its application, and combines the characteristics of Bacillus aryabhattai for cloning assembly and product production. SUMMARY

[0006] In order to overcome the shortcomings of the prior art, the application provides a method for the synergistic application of Bacillus aryabhattai and glomus fungus.

[0007] To achieve the above-mentioned purpose, a method for the synergistic application of Bacillus aryabhattai and glomus fungus is designed, characterized in that it comprises the following steps:

[0008] The Bacillus aryabhattai and glomus fungus are mixed and cultured at a ratio of 1.0:4.0 to obtain a composite bacteria;

[0009] The classification name of the Bacillus aryabhattai is Bacillus aryabhattai, and the preservation address is China Center for Type Culture Collection, the preservation number is CCTCC NO: M20232038, the preservation time is November 1, 2023, and the preservation address is College of Life Sciences, Wuhan University, Wuhan, Hubei, China 430072.

[0010] Further comprising the following steps:

[0011] S2, spore plasmid extraction, extracting DNA of mixed bacteria, Bacillus aryabhattai and glomus fungus;

[0012] S3, combining the target gene with the vector DNA into a DNA molecule with self-replication ability in vitro;

[0013] S4, synthesizing heterogeneously in host cells Escherichia coli by transformation or transfection, and screening transformants containing the target gene;

[0014] S5, amplifying and extracting the target gene to obtain a large amount of the same DNA or its expression product.

[0015] In step S1, the Bacillus aryabhattai and glomus fungus are co-cultured at a ratio of culture medium MSR:LB=4:1-9:1 at 28°C and 80rpm / min for 8-9 days.

[0016] The specific method of step S4 is as follows:

[0017] S41, fix the DNA molecule to the solid-phase carrier magnetic beads, use the solid-phase carrier to wash the carrier, and perform continuous digestion, ligation and other work to gradually connect the RVD units together;

[0018] S42, design a biotin modified DNA double-stranded sequence with a length of 60bp, and immobilize on a magnetic bead;

[0019] S43, treat the immobilized DNA double-stranded sequence with a restriction enzyme to generate a 3' sticky end, treat the TALE connection unit with a restriction enzyme 5' to generate a 5' sticky end, and combine the 3' sticky end of the previous step to form a 5' sticky end, after 4 or 16 cycles, splice the TALE connection unit, and finally obtain immobilized 10 or 20 connectors;

[0020] S44, cut the connected DNA double-stranded molecule from the solid phase interface with a restriction enzyme, and purify by gel electrophoresis;

[0021] S45, connect the purified DNA double-stranded molecule to the TALEN skeleton vector to obtain a complete TALEN expression plasmid, and identify by plasmid transformation, colony PCR detection and sequencing, finally obtain a single plasmid nuclear complex plasmid, and perform sequence analysis to screen the target gene.

[0022] The complex bacteria and the LB culture medium are mixed to form the complex bacteria composition, wherein the LB culture medium comprises hairy roots, calcium pantothenate, nicotinic acid, vitamin B1, B6, B12 and fulvic acid.

[0023] The complex bacteria composition is in the form of powder or liquid.

[0024] The method for obtaining the arbuscular mycorrhizal fungus comprises the following steps: taking out the material drenched with the arbuscular mycorrhizal fungus from the sunflower, kidney-shaped grass and thousand-petal sunflower pots, pouring 20±10ml of PDA culture medium into a plate, adding 50ml of spore liquid treated by mutagenesis, uniformly coating with a coating rod, and then carrying out dark culture and preservation at 28.5℃, and screening the required mutant strain after preservation.

[0025] The method for obtaining the arbuscular mycorrhizal fungus comprises the following steps: taking out the arbuscular mycorrhizal fungus of the biomimetic peat substrate inclusion compound, pouring 20±10ml of PDA culture medium into a plate, adding 100ml of spore liquid treated by mutagenesis, uniformly coating with a coating rod, and then carrying out dark culture and preservation at 28.5℃, and screening the required mutant strain after preservation.

[0026] Compared with the prior art, the application utilizes the commonality of bacillus aryabhattai and arbuscular mycorrhizal fungi to form a new type of bacterial fertilizer, which can fix nitrogen, migrate heavy metal ions, repair soil ecology, resist diseases and promote plant growth. BRIEF DESCRIPTION OF DRAWINGS

[0027] Fig. 1 is data when the embodiment one of the application is used.

[0028] Figure 2 is a genomic DNA electropherogram of Bacillus aryabhattai in Example Three of the present application.

[0029] Figure 3 is a PCR amplification-electropherogram of 16S rDNA gene in Example Three of the present application.

[0030] Figure 4 is a genomic DNA electropherogram of arbuscular mycorrhizal fungi in Example Three of the present application.

[0031] Figure 5 is a nested PCR electropherogram of 18S rDNA in Example Three of the present application.

[0032] Figure 6 is a genomic DNA electropherogram of bacteria and fungi co-cultured in Example Three of the present application.

[0033] Figure 7 is a 16S and 18S PCR amplification product electropherogram in Example Three of the present application.

[0034] Figure 8 is a nucleic acid gel of 16S and 18S PCR amplification products in Example Three of the present application.

[0035] Figure 9 is a sequencing result diagram of bacteria 16S and fungi 18S in Example Three of the present application.

[0036] Figure 10 is a coincident part of Bacillus aryabhattai 16S and arbuscular mycorrhizal fungi 18S sequencing results in Example Three of the present application. DETAILED DESCRIPTION

[0037] The present application will be further described below according to the accompanying drawings. Example One

[0038] In this embodiment, the synergistic application method of Bacillus aryabhattai and arbuscular mycorrhizal fungi includes the following steps: mixing and culturing Bacillus aryabhattai and arbuscular mycorrhizal fungi at a ratio of 1.0:4.0 to obtain a composite bacteria;

[0039] The classification name of Bacillus aryabhattai is Bacillus aryabhattai, the preservation address is China Center for Type Culture Collection, the preservation number is CCTCC NO: M20232038, and the preservation time is November 1, 2023. The arbuscular mycorrhizal fungi is commercially purchased.

[0040] Bacillus aryabhattai and arbuscular mycorrhizal fungi are co-cultured at a medium ratio of MSR:LB=4:1-9:1 at 28°C and 80rpm / min for 8-9 days.

[0041] The biological activity and stress resistance of Bacillus aryabhattai combine the characteristics of arbuscular mycorrhizal fungi, and the silicon dissolution activity is increased by 30-50%. After mixed culture, the composite bacteria can dissolve potassium, fix nitrogen, migrate heavy metal ions, repair soil ecology, resist diseases, and promote plant growth.

[0042] In specific use, after seedling cultivation by the matrix bag technology, the composite bacteria are applied in the removal and utilization of heavy metal cadmium and mercury in rice planting fields, the recovery and utilization of watermelon heavy land, the treatment and utilization of old peach tree diseases, and the treatment and utilization of tomato nematode diseases. The use data are shown in FIG. 1. Example Two

[0043] This example only illustrates the differences from example one, and the same parts are not repeated.

[0044] The difference between this example and example one is that, in specific use, the composite bacteria are mixed with LB medium containing hairy roots, calcium pantothenate, nicotinic acid, vitamin B1, B6, B12 and fulvic acid to form MSR medium, and then a composite bacteria composition is formed. The composite bacteria composition is a powder or a liquid agent. Example Three

[0045] This example only illustrates the differences from example one, and the same parts are not repeated.

[0046] The difference between this example and example one is that, in this example, the following steps are further included:

[0047] S2, spore plasmid extraction, extracting DNA of mixed bacteria, Bacillus aryabhattai and arbuscular mycorrhizal fungi;

[0048] S3, combining the target gene with the vector DNA to form a DNA molecule with self-replication ability in vitro;

[0049] S4, synthesizing heterologously in host cells Escherichia coli by transformation or transfection, and screening transformants containing the target gene;

[0050] S5, amplifying and extracting the target gene to obtain a large amount of the same DNA or its expression product.

[0051] The specific method of step S4 is as follows:

[0052] S41, the DNA molecule is fixed to the solid phase carrier magnetic beads, the solid phase carrier is used to wash the carrier, and continuous digestion, connection and other work are carried out, so that the RVD units are gradually connected in series; S42, a biotin modified DNA double-stranded sequence with a length of 60 bp is designed and immobilized on the magnetic beads; S43, the immobilized DNA double-stranded sequence is treated with a restriction enzyme, and a 3' sticky end is generated; the TALE connection unit is treated with a restriction enzyme 5', a 5' sticky end is generated, and is paired and combined with the 3' sticky end of the previous step; after 4 or 16 cycles, the TALE connection unit is spliced; finally, 10 or 20 connectors can be obtained; S44, the connected DNA double-stranded molecule is cut from the solid phase interface by a restriction enzyme, and is purified by gel electrophoresis; S45, the purified DNA double-stranded molecule is connected to the TALEN skeleton carrier to obtain a complete TALEN expression plasmid; and the plasmid is transformed, detected by colony PCR and identified by sequencing, so that a single plasmid nuclear complex plasmid can be finally obtained, sequence analysis is carried out, and the target gene is screened out.

[0053] The arthrobacter and arbuscular mycorrhizal fungi were cultured in liquid medium for about 2 days, and fresh mycelium was taken for DNA extraction. As shown in FIG. 2, 10 single colonies were picked from the screening plate and placed in LB liquid medium for shake culture, and the shake culture conditions were 35°C, 180 rpm / min, and overnight 12h. The mycelium was collected, and the Arthrobacter genomic DNA was extracted using a bacterial genomic DNA extraction kit, and the electrophoresis bands were numbered as 1-10, M was a marker with an electrophoresis band of 100-2000 bp, and 1-10 was an electrophoresis band of Arthrobacter genomic DNA. As shown in FIG. 3, PCR amplification was performed using bacterial 16S rDNA universal primers, wherein M was a marker with an electrophoresis band of 100-2000 bp, and 1-10 was an electrophoresis band after PCR amplification of Arthrobacter. As shown in FIG. 3, the PCR amplification product had a clear and bright band at about 1400-1600 bp and no diffusion phenomenon.

[0054] For arbuscular mycorrhizal fungi, the arbuscular mycorrhizal fungal genomic DNA is shown in FIG. 4. As shown in FIG. 4, the genomic DNA band is clear and bright. Nest-PCR amplification was performed using fungal 18S rDNA primers, the first round of PCR used NS1-NS8 primer pairs, and the second round of PCR used NS1-NS4 and AML1-AML2 primer pairs. As shown in FIG. 5, in the PCR amplification, the NS1-NS4 and AML1-AML2 primer pairs obtained DNA fragments of about 1100 bp and 800 bp, respectively, and the band position and size were consistent with the literature and the band was clear. The NS1-NS4 primer pair band was clear and bright.

[0055] The complex fungus for arbuscular mycorrhiza is the fungus and Bacillus aryabhattai. The arbuscular mycorrhiza is the fungus, and the Bacillus aryabhattai is the bacterium. The arbuscular mycorrhiza and the Bacillus aryabhattai are co-cultured for 9 days according to the ratio of the culture medium MSR:LB=4:1 / 9:1. The bacterium and the fungus are collected by centrifugation, and the genomic DNA of each is extracted and run on the nucleic acid gel. Referring to Fig. 7, the co-culture condition is 28℃, 80rpm / min, and 8-9 days. As shown in Fig. 6, the genomic DNA bands of the bacterium and the fungus are clearly visible, and the genomic DNA of the bacterium and the fungus obtained according to the ratio of MSR:LB=4:1 is clearer.

[0056] The genomic DNA of the bacterium and the fungus is amplified by PCR using the bacterium 16S rDNA and the fungus 18S rDNA primers, and the fungus is amplified by nested PCR. As shown in Fig. 7, in the PCR amplification, the bacterium 16S obtains a DNA fragment of about 1500 bp, and the fungus 18S obtains a DNA fragment of about 1100 bp. The band position and size are consistent with the literature, and the band is clear. The PCR amplification primers of the bacterium 16S and the fungus 18S obtained according to the ratio of the culture medium MSR:LB=4:1 are clearer.

[0057] The PCR product band of the fungus 18S in Fig. 7 is not very bright. The 16S and 18S obtained according to the ratio of MSR:LB=4:1 are re-amplified by PCR using the ATG enzyme. As shown in Fig. 8, the PCR product bands of 16S and 18S are particularly clear and bright. The 16S and 18S products are recovered from the gel and sent to Huada for first-generation sequencing. The sequencing results are shown in Fig. 9, and the sequencing results of the bacterium 16S and the fungus 18S obtained according to the ratio of MSR:LB=4:1. As shown in Fig. 10, the overlapping sequence is GTGCCAGCAGCCGCGGTAAT (20 bp), which is the target gene.

[0058] The fertilizer containing the target gene has a valid period of 2 years, and is used once every 35-40 days. The use amount is 200g per mu, and the bacterial content is 200 million / g. The biological activity, disease resistance, and stress resistance are comprehensive, and the performance is improved by 30-50%. Example Four

[0059] This example only illustrates the differences from Example One, and the same parts are not repeated.

[0060] The difference between this example and Example One is that the method for obtaining the arbuscular mycorrhizal fungus in this example includes the following steps: taking out the material in the pots of Heliamphora nutans, Nephthytis falcata, and Malvaviscus arboreus that is infected with the arbuscular mycorrhizal fungus, pouring 20±10ml of PDA culture medium into a plate, adding 50ml of spore solution treated by mutagenesis, uniformly coating with a coating rod, and then culturing and preserving in the dark at 28.5℃. After preservation, the mutant strains meeting the requirements are screened. Example Five

[0061] This embodiment only illustrates the differences from the first embodiment, and the same parts are not repeated.

[0062] The difference between this embodiment and the first embodiment is that the method for obtaining the arbuscular mycorrhizal fungus in this embodiment comprises the following steps: taking out the arbuscular mycorrhizal fungus of the biomimetic peat substrate inclusion, pouring 20±10 ml of PDA culture medium into a plate, adding 100 ml of spore liquid treated by mutagenesis, uniformly coating with a coating rod, carrying out dark culture and preservation at 28.5°C, and screening the required mutant strains after preservation.

Claims

1. A method for the synergistic application of Bacillus aryabhattai and arbuscular mycorrhizal fungi, characterized in that: It comprises the following steps: The bacillus aryabhattai and arbuscular mycorrhizal fungi are mixed and cultured in a ratio of 1.0:4.0 to obtain a composite bacteria; The classification name of the bacillus aryabhattai is bacillus aryabhattai, the preservation address is China Center for Type Culture Collection, the preservation number is CCTCC NO: M20232038, and the preservation time is November 1, 2023.

2. The method of synergistic application of Bacillus aryabhattai and arbuscular mycorrhizal fungi according to claim 1, characterized in that: It also comprises the following steps: S2, spore plasmid extraction, extracting DNA of mixed bacteria, bacillus aryabhattai and arbuscular mycorrhizal fungi; S3, combining the target gene with the vector DNA into a DNA molecule with self-replication ability in vitro; S4, synthesizing heterogeneously in the host cell escherichia coli through transformation or transfection, and screening the transformants containing the target gene; S5, amplifying and extracting the target gene to obtain a large amount of the same DNA or its expression product.

3. The method of synergistic application of Bacillus aryabhattai and arbuscular mycorrhizal fungi according to claim 1, characterized in that: In step S1, the bacillus aryabhattai and arbuscular mycorrhizal fungi are co-cultured in a ratio of 4:1-9:1 of culture medium MSR:LB at 28℃ and 80rpm / min for 8-9 days.

4. The method of synergistic application of Bacillus aryabhattai and arbuscular mycorrhizal fungi according to claim 2, characterized in that: The specific method of step S4 is as follows: S41, fixing the DNA molecule to the solid-phase carrier magnetic beads, using the solid-phase carrier to wash the carrier, and performing continuous digestion, ligation and other work to gradually connect the RVD units together; S42, designing a biotin-modified DNA double-stranded sequence with a length of 60bp and fixing it to the magnetic beads; S43, treating the fixed DNA double-stranded sequence with a restriction enzyme to produce a 3' sticky end, treating the TALE connection unit with a restriction enzyme 5' to produce a 5' sticky end, and combining the 3' sticky end of the previous step with the 5' sticky end to form a complementary pair, and after 4 or 16 cycles, the TALE connection unit is spliced, and finally 10 or 20 connectors are obtained; S44, cutting the connected DNA double-stranded molecule from the solid-phase interface with a restriction enzyme, and purifying it by gel electrophoresis; S45, connecting the purified DNA double-stranded molecule to the TALEN skeleton vector to obtain a complete TALEN expression plasmid; and through plasmid transformation, colony PCR detection and sequencing identification, a single-plasmid nuclear complex plasmid can be finally obtained for sequence analysis to screen the target gene.

5. The method of synergistic application of Bacillus aryabhattai and arbuscular mycorrhizal fungi as claimed in claim 1, wherein: The composite bacteria are mixed with the LB culture medium to form a composite bacteria composition, which comprises hairy roots, calcium pantothenate, nicotinic acid, vitamins B1, B6, B12 and fulvic acid.

6. The method of synergistic application of Bacillus aryabhattai and arbuscular mycorrhizal fungi as claimed in claim 5, wherein: The composite bacteria composition is a powder or a liquid agent.

7. The method of synergistic application of Bacillus aryabhattai and arbuscular mycorrhizal fungi as claimed in claim 1, wherein: The method for obtaining the arbuscular mycorrhizal fungi comprises the following steps: taking out the material infected with arbuscular mycorrhizal fungi from the sunflower, kidney-shaped grass and thousand-petal sunflower pots, pouring 20±10ml of PDA culture medium into a plate, adding 50ml of spore liquid treated by mutagenesis, uniformly coating with a coating rod, and then culturing and preserving at 28.5℃ in the dark, and screening the mutant strains meeting the requirements after preservation.

8. The method of synergistic application of Bacillus aryabhattai and arbuscular mycorrhizal fungi as claimed in claim 1, wherein: The method for obtaining the arbuscular mycorrhizal fungi comprises the following steps: taking out the arbuscular mycorrhizal fungi of the biomimetic peat substrate inclusion compound, pouring 20±10ml PDA culture medium in a plate, adding 100ml spore liquid treated by mutagenesis, uniformly coating by using a coating rod, carrying out dark culture and preservation at 28.5℃, and screening the required mutant strains after preservation.

Citation Information

Patent Citations

  • Arbuscular mycorrhizal fungi efficiently degrading atrazine and promoting plant growth and application of arbuscular mycorrhizal fungi

    CN104560730A

  • Bacillus aryabhattai NDFY-1 and application thereof

    CN113755382A

  • Bacillus aryabhattai HZ18-3 and application thereof

    CN114480183A

  • Synergistic application method of bacillus aryabhattai and arbuscular mycorrhizal fungi

    CN119040177A

  • Bacillus aryabhattai strain promoting resistance of plants against abiotic stress and use thereof

    KR1020180114794A