Engineered microorganism and method for biosynthesis of ergothioneine

By introducing betaine methionine cycle and inorganic sulfur utilization pathway into microorganisms, combined with an enhanced histidine biosynthesis pathway, the biosynthesis of ergothionein was optimized, solving the problems of high cost and low efficiency in existing technologies, and realizing engineered microbial cells for efficient ergothionein production.

WO2026037327A1PCT designated stage Publication Date: 2026-02-19TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2025/114364
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-08-14
Filing Date
2025-08-13
Publication Date
2026-02-19

AI Technical Summary

Technical Problem

Existing technologies for producing ergothioneine via microbial fermentation require the addition of expensive methionine, cysteine, and histidine as synthetic precursors, resulting in high costs and low efficiency. Furthermore, traditional chemical synthesis methods pose environmental and health risks.

Method used

By introducing engineered pathways into microorganisms, using betaine as a methyl donor in the methionine cycle and inorganic sulfur utilization pathway to replace expensive methionine, and combining this with an enhanced histidine biosynthesis pathway, the biosynthesis of ergothionein is optimized, avoiding the addition of methionine, cysteine, and histidine as precursors.

Benefits of technology

This technology enables efficient ergothioneine production, reduces production costs, and increases yield without relying on expensive precursors, providing engineered microbial cells for high ergothioneine production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2025114364_19022026_PF_FP_ABST
    Figure CN2025114364_19022026_PF_FP_ABST
Patent Text Reader

Abstract

Provided is the biosynthesis of ergothioneine, and specifically provided is an engineered microorganism for producing ergothioneine, which can significantly improve the yield of ergothioneine without the addition of exogenous amino acids. Further provided are methods for preparing and using the engineered microorganism.
Need to check novelty before this filing date? Find Prior Art

Description

Engineered microorganisms and methods for ergothioneine biosynthesis

[0001] Cross-reference to Related Applications

[0002] This application claims priority to Chinese Patent Application No. 202411118751.3, filed August 14, 2024, the entire contents of which are incorporated herein by reference in their entirety. TECHNICAL FIELD

[0003] The present invention relates to the biosynthesis of ergothioneine and, in particular, provides engineered microorganisms that produce ergothioneine, as well as methods of making and using the engineered microorganisms. BACKGROUND

[0004] Ergothioneine (ERG) is a nontoxic, safe, and functionally diverse sulfur-containing histidine derivative that cannot be synthesized in humans or other vertebrates, but can be synthesized in many fungi or bacteria. ERG was first discovered in 1909 by Charles Tanret in Claviceps purpurea, and later in Mycobacterium, cyanobacteria, and ascomycetes. It has two tautomeric forms, thioether and thiol, in aqueous solution, and this unique isomeric property and redox potential give it highly stable antioxidant properties. Increasing evidence suggests that ergothioneine has very good antioxidant, anti-inflammatory, anti-aging, promotion of neural cell formation, and extension of cell survival cycle, and other benefits. Due to the presence of ERG transporters in living organisms, it can scavenge free radicals and reactive oxygen species, has the potential to prevent or treat neurasthenic and cardiovascular diseases, and plays an important role in maintaining intracellular redox homeostasis and protecting DNA from oxidative damage by metal ions. It has been shown that in a human beta Alzheimer's disease transgenic Caenorhabditis elegans model, ERG can improve health and lifespan, and in addition, the level of ERG in the blood is the best predictor of reduced risk of cardiovascular disease and mortality. Ergothioneine has therefore been hailed as one of the top ten new vitamins for promoting health and delaying aging. However, relying on food intake to obtain a trace amount of ergothioneine concentration is like a drop in the ocean, and adding high concentrations of ergothioneine to functional foods to reduce and prevent the risk of chronic diseases is an urgent need at present. As a dietary supplement and cosmetic additive has been commercialized, which will also make its demand in the future market show a trend of explosive growth. In 2019, the estimated value of dietary supplements worldwide was about $241.1 billion.

[0005] The early chemical synthesis method has too many limitations, and the purified product also carries toxic byproducts or reagents, which is the only method commercialized at present. Due to the increasing demand, the use of metabolic engineering methods to rely on microbial chassis to produce ergothioneine has attracted great interest from researchers, and is currently a sustainable and low-cost alternative to manufacturing processes. So far, some microorganisms such as Mycolicibacterium Smegmatis and Neurospora crassa have been found to have endogenous synthesis pathways, and model strains such as Escherichia coli and Saccharomyces cerevisiae have also been genetically engineered to synthesize ergothioneine. In E. coli, for example, by expressing the egtBCDE genes of Mycobacterium smegmatis and optimizing the medium composition, the initial ERG production was 24 mg / L. In addition, the authors expressed egtA and improved the biosynthesis of cysteine and s-adenosyl methionine, etc. Strategies, ultimately optimized fermentation to produce 1.3 g / L of ergothioneine within 216 h. Another study integrated multiple copies of the Neurospora crassa EGT1 and EGT2 genes into the Aspergillus oryzae genome to produce 231 mg of ERG per kg of solid medium, and in Corynebacterium glutamicum, 264 mg / L of ERG was produced using glucose as the sole carbon source. These studies demonstrate that transgenic microorganisms can produce kilogram-level ergothioneine.

[0006] However, as a chiral amino acid, its synthesis process requires three amino acids as precursors, which is an extremely expensive and difficult choice. For example, methionine, one of the precursors, is the main source of methyl donors for the synthesis of ergothioneine. Due to its complex biosynthetic pathway and strict regulatory mechanism, it is still a great challenge to achieve industrial-scale production through microbial fermentation. L-methionine, L-threonine, L-lysine, and L-isoleucine are all amino acids of the L-aspartate family, but microbial fermentation has been achieved for all of the above amino acids except methionine. Methionine is still dominated by traditional chemical synthesis, but substances such as propylene aldehyde, methyl mercaptan, and hydrogen cyanide involved in the production process pose a serious threat to human and environmental health. As for cysteine, so far the main source of cysteine is animal feathers and human hair, and the extraction process also poses environmental problems of organic waste acid. In addition, high concentrations of cysteine can be toxic to microbial growth, and concentrations exceeding 1 mM in E. coli can adversely affect growth. Therefore, using metabolic engineering strategies to balance intracellular cysteine metabolism or providing a variety of sulfur sources to supply ergot synthesis may be a more effective method. Second, histidine, a precursor for the synthesis of ergothioneine, is one of the amino acids that cannot be produced by microbial fermentation. The traditional method of producing histidine is through protein hydrolysis, such as blood meal or soybeans, which are rich in protein. If added directly as a precursor to synthesize ergothioneine, it will also result in high costs.

[0007] Current commercial synthesis methods are still chemical methods, and microbial fermentation synthesis methods have been attempted by many researchers in different chassis, but the yield is too low, and it is necessary to add amino acids as precursors in the culture medium, which is too high in cost. There is still a need in the art for alternative and improved methods for the biological production of ergothioneine, while improving production efficiency and reducing costs. SUMMARY

[0008] The present application provides engineered biosynthetic pathways to facilitate and optimize the biosynthesis of ergothioneine, which produces high yields of ergothioneine without the need to add methionine, cysteine, histidine as synthetic precursors in the production process, thereby providing the following aspects.

[0009] Engineered microorganism producing ERG

[0010] In one aspect, the present application provides an engineered microbial cell producing ergothioneine (ERG), comprising:

[0011] (i) an aerobic biosynthetic pathway of ergothioneine, which comprises a substrate-to-product conversion from histidine to ergothioneine with cysteine as a sulfur source donor;

[0012] (ii) a methionine cycle with betaine as a methyl donor.

[0013] Methionine cycle

[0014] In certain embodiments, the methionine cycle of (ii) comprises: betaine-homocysteine methyltransferase (BHMT), methionine adenosyltransferase, S-adenosyl-L-homocysteine hydrolase (SAHase), adenosine kinase.

[0015] In certain embodiments, the BHMT is TnBHMT from Thioclava nitratireducens or a homolog (e.g., an ortholog or a paralog) thereof, which transfers the methyl group of betaine to homocysteine in the betaine catabolic pathway.

[0016] In certain embodiments, the BHMT comprises the sequence set forth in SEQ ID NO: 1 or a sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identity thereto.

[0017] In certain embodiments, the BHMT is a TnBHMT from Thioclava nitratireducens as set forth in SEQ ID NO: 1.

[0018] In certain embodiments, the methionine adenosyltransferase is SAM2 from Saccharomyces cerevisiae or a homolog (e.g., an ortholog or a paralog) thereof that catalyzes the reaction of methionine with ATP to produce S-adenosylmethionine (SAM).

[0019] In certain embodiments, the methionine adenosyltransferase comprises the sequence set forth in SEQ ID NO: 3 or a sequence at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.

[0020] In certain embodiments, the methionine adenosyltransferase is SAM2 from Saccharomyces cerevisiae as set forth in SEQ ID NO: 3.

[0021] In certain embodiments, the SAHase is a SAHase from Corynebacterium efficiens or a homolog (e.g., an ortholog or a paralog) thereof that catalyzes the hydrolytic deamination of SAH to produce homocysteine.

[0022] In certain embodiments, the SAHase comprises the sequence set forth in SEQ ID NO: 4 or a sequence at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical thereto.

[0023] In certain embodiments, the SAHase is a SAHase from Corynebacterium efficiens as set forth in SEQ ID NO: 4.

[0024] In certain embodiments, the adenosine kinase is an exogenous adenosine kinase.

[0025] In certain embodiments, the adenosine kinase is ADO1 from Cryptosporidium parvum or a homolog (e.g., an ortholog or a paralog) thereof that catalyzes the production of ATP from adenosine.

[0026] In certain embodiments, the adenosine kinase comprises the sequence set forth in SEQ ID NO: 2 or a sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identity thereto.

[0027] In certain embodiments, the adenosine kinase is ADO1 from Cryptosporidium parvum set forth in SEQ ID NO: 2.

[0028] In certain embodiments, the engineered microbial cell comprises exogenous nucleic acid sequences encoding enzymes of the methionine cycle described above.

[0029] The skilled artisan understands that when multiple exogenous nucleic acid sequences are included in the engineered microbial cell, they can be introduced into the engineered microbial cell as individually regulated expression constructs, as a polycistronic operon, as a single nucleic acid molecule encoding a fusion protein, or any combination thereof, and by different or the same vectors.

[0030] In certain embodiments, the exogenous nucleic acid sequences encoding enzymes of the methionine cycle each independently comprise one or more copies. In certain embodiments, the exogenous nucleic acid sequence encoding BHMT comprises at least two copies.

[0031] In certain embodiments, the exogenous nucleic acid sequences encoding enzymes of the methionine cycle are expressed from a single polycistronic operon, or wherein each exogenous nucleic acid sequence is expressed from a separate promoter.

[0032] In certain embodiments, the exogenous nucleic acid sequences encoding enzymes of the methionine cycle are present in a polycistronic operon. In certain embodiments, the polycistronic operon is operably linked to a promoter, e.g., a prokaryotic cell promoter such as a T7 promoter.

[0033] In certain embodiments, the exogenous nucleic acid sequences encoding enzymes of the methionine cycle are integrated into the chromosome of the cell or are located on a self-replicating plasmid.

[0034] In certain embodiments, the engineered microbial cell comprises exogenous nucleic acid sequences encoding TnBHMT (e.g., SEQ ID NO: 1), SAM2 (e.g., SEQ ID NO: 3), SAHase (e.g., SEQ ID NO: 4), and ADOl (e.g., SEQ ID NO: 2). In certain embodiments, the exogenous nucleic acid sequences encoding TnBHMT, SAM2, SAHase, and ADOl are present in a polycistronic operon. In certain embodiments, the polycistronic operon is operably linked to a promoter, e.g., a prokaryotic promoter, such as a T7 promoter. In certain embodiments, the polycistronic operon is integrated into the chromosome of the cell or is located on a self-replicating plasmid.

[0035] Ergothioneine aerobic biosynthetic pathway

[0036] In certain embodiments, (i) the ergothioneine aerobic biosynthetic pathway comprises: an EgtD enzyme, an Egtl enzyme, an EgtE enzyme.

[0037] The EgtD enzyme refers to a methyltransferase encoded by the egtD gene of Mycobacterium smegmatis or a homolog (e.g., an ortholog or a paralog) thereof, which catalyzes the synthesis of HER from histidine and SAM. In certain embodiments, the homolog is selected from homologous genes in prokaryotes that are capable of naturally synthesizing ergothioneine, such as actinobacteria, cyanobacteria, acidobacteria, firmicutes, and proteobacteria.

[0038] The Egtl enzyme refers to a bifunctional enzyme encoded by the NcEgt-1 gene of Neurospora crassa or a homolog (e.g., an ortholog or a paralog) thereof, which catalyzes the synthesis of HER from histidine and SAM, and catalyzes the conversion of HER to Cys-HER. In certain embodiments, the homolog is selected from homologous genes in fungi that are capable of naturally synthesizing ergothioneine, such as molds, basidiomycetes, and ascomycetes.

[0039] The EgtE enzyme refers to a PLP-bound C-S lyase encoded by the egtE gene of Mycobacterium smegmatis or a homolog (e.g., an ortholog or a paralog) thereof, which catalyzes the production of ergothioneine from Cys-HER by removing pyruvate and ammonia. In certain embodiments, the homolog is selected from homologous genes in prokaryotes that are capable of naturally synthesizing ergothioneine, such as actinobacteria, cyanobacteria, acidobacteria, firmicutes, and proteobacteria.

[0040] In certain embodiments, the EgtD enzyme is derived from Mycobacterium smegmatis or is a homolog (e.g., an ortholog or a paralog) thereof, e.g., comprises a sequence set forth in SEQ ID NO: 6 or a sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identity thereto.

[0041] In certain embodiments, the EgtD enzyme is the EgtD enzyme derived from Mycobacterium smegmatis set forth in SEQ ID NO: 6.

[0042] In certain embodiments, the Egt1 enzyme is derived from Neurospora crassa or is a homolog (e.g., an ortholog or a paralog) thereof, e.g., comprises a sequence set forth in SEQ ID NO: 5 or a sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identity thereto.

[0043] In certain embodiments, the Egt1 enzyme is the EgtD enzyme derived from Neurospora crassa set forth in SEQ ID NO: 5.

[0044] In certain embodiments, the EgtE enzyme is derived from Mycolicibacterium smegmatis or is a homolog (e.g., an ortholog or a paralog) thereof, e.g., comprises a sequence set forth in SEQ ID NO: 7 or a sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identity thereto.

[0045] In certain embodiments, the EgtE enzyme is the EgtE enzyme derived from Mycobacterium smegmatis set forth in SEQ ID NO: 7.

[0046] In certain embodiments, the engineered microbial cell comprises exogenous nucleic acid sequences encoding enzymes of the ergothioneine aerobic biosynthesis pathway described above. In certain embodiments, the exogenous nucleic acid sequences encoding enzymes of the ergothioneine aerobic biosynthesis pathway are expressed from a single polycistronic operon, or wherein each exogenous nucleic acid sequence is expressed from a separate promoter.

[0047] In certain embodiments, each of the exogenous nucleic acid sequences encoding enzymes of the ergothioneine aerobic biosynthetic pathway independently comprises one or more copies.

[0048] In certain embodiments, the exogenous nucleic acid sequences encoding enzymes of the ergothioneine aerobic biosynthetic pathway comprise at least two copies.

[0049] In certain embodiments, the exogenous nucleic acid sequences encoding enzymes of the ergothioneine aerobic biosynthetic pathway are present in a polycistronic operon. In certain embodiments, the polycistronic operon is operably linked to a promoter, such as a prokaryotic promoter, such as a T7 promoter.

[0050] In certain embodiments, the exogenous nucleic acid sequences encoding enzymes of the ergothioneine aerobic biosynthetic pathway are integrated into the chromosome of the cell or are located on a self-replicating plasmid.

[0051] In certain embodiments, the engineered microbial cell comprises: exogenous nucleic acid sequences encoding EgtD (such as SEQ ID NO: 6), Egt1 (such as SEQ ID NO: 5), and EgtE (such as SEQ ID NO: 7). In certain embodiments, the exogenous nucleic acid sequences encoding EgtD, Egt1, EgtE are present in a polycistronic operon. In certain embodiments, the polycistronic operon is operably linked to a promoter, such as a prokaryotic promoter, such as a T7 promoter. In certain embodiments, the polycistronic operon is integrated into the chromosome of the cell or is located on a self-replicating plasmid.

[0052] Inorganic sulfur utilization pathway

[0053] In certain embodiments, the engineered microbial cell of any of the above embodiments further comprises: (iii) an inorganic sulfur utilization pathway, the pathway comprising substrate-to-product conversion from HER to ergothioneine with inorganic sulfur (such as Na2S, NaHS, K2S, K2S X , Na2S2O3, etc.) as sulfur source donor.

[0054] In certain embodiments, the engineered microbial cell comprises an exogenous nucleic acid sequence encoding an EanB enzyme. The EanB enzyme refers to a protein found in Chlorobium limicola comprising a rhodanese domain or homologs (e.g., orthologs or paralogs) in other anaerobes that directly transfers a sulfur atom to the imidazole ring of HER to generate ergothioneine under anaerobic conditions, thereby effecting substrate-to-product conversion from HER to ergothioneine with inorganic sulfur as sulfur source donor.

[0055] In certain embodiments, the EanB enzyme is derived from or is a homolog (e.g., an ortholog or an analog) of Chlorobium limicola, e.g., comprises a sequence set forth in SEQ ID NO: 8 or a sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identity thereto.

[0056] In certain embodiments, the EanB enzyme is the EanB enzyme derived from Chlorobium limicola set forth in SEQ ID NO: 8.

[0057] In certain embodiments, the exogenous nucleic acid sequence is integrated into the chromosome of the cell or is located on a self-replicating plasmid.

[0058] In certain embodiments, the engineered microbial cell comprises a polycistronic operon comprising: exogenous nucleic acid sequences encoding EgtD (e.g., SEQ ID NO: 6), Egt1 (e.g., SEQ ID NO: 5), and EanB (e.g., SEQ ID NO: 8). In certain embodiments, the polycistronic operon is operably linked to a promoter, e.g., a prokaryotic cell promoter, such as a T7 promoter.

[0059] In certain embodiments, the polycistronic operon is integrated into the chromosome of the cell or is located on a self-replicating plasmid.

[0060] In certain embodiments, the engineered microbial cell comprises (i) an ergot alkaloid aerobic biosynthesis pathway, (ii) a methionine cycle with betaine as the methyl donor, and (iii) an inorganic sulfur utilization pathway as described above. Thereby, the engineered microbial cell uses betaine as the sole methyl donor, replaces the expensive methionine, regenerates the intracellular SAM cycle, and achieves efficient conversion from betaine to ergot alkaloids; at the same time, the demand for intracellular cysteine is reduced, and efficient synthesis of ERG is promoted.

[0061] In certain embodiments, the engineered microbial cell comprises an exogenous nucleic acid sequence encoding a BHMT, a methionine adenosyltransferase, a SAHase, an adenosine kinase, an EgtD, an Egt1, an EgtE, an EanB. Those skilled in the art understand that the above exogenous nucleic acid sequences encoding each enzyme can be introduced into the engineered microbial cell as individually regulated expression constructs, as a polycistronic operon, as a single nucleic acid molecule encoding a fusion protein, or any combination thereof, and through different or the same vectors. In certain embodiments, the exogenous nucleic acid sequences encoding the BHMT, the methionine adenosyltransferase, the SAHase, the adenosine kinase are located in a single operon. In certain embodiments, the exogenous nucleic acid sequences encoding the EgtD, the Egt1, the EgtE are located in a single operon. In certain embodiments, the exogenous nucleic acid sequence encoding the EanB is optionally located in a single operon with additional exogenous nucleic acid sequences encoding the EgtD, the Egt1.

[0062] In certain embodiments, wherein:

[0063] (a) the BHMT is a TnBHMT of Thioclava nitratireducens origin or a homolog (e.g., an ortholog or a paralog) thereof, e.g., comprising a sequence set forth in SEQ ID NO: 1 or a sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identity thereto;

[0064] (b) the methionine adenosyltransferase is a SAM2 of Saccharomyces cerevisiae origin or a homolog (e.g., an ortholog or a paralog) thereof, e.g., comprising a sequence set forth in SEQ ID NO: 3 or a sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identity thereto;

[0065] (c) the SAHase is a SAHase of Corynebacterium efficiens origin or a homolog (e.g., an ortholog or a paralog) thereof, e.g., comprising a sequence set forth in SEQ ID NO: 4 or a sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identity thereto; and / or,

[0066] (d) the adenosine kinase is an exogenous adenosine kinase, for example ADO1 derived from Cryptosporidium parvum or a homologue (e.g. an orthologue or a paralogue) thereof, for example comprising a sequence set forth in SEQ ID NO: 2 or a sequence having at least 80% (e.g. at least 85%, at least 90%, at least 91 %, at least 92%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identity thereto.

[0067] In certain embodiments, wherein:

[0068] (a) the EgtD enzyme is derived from Mycobacterium smegmatis or a homologue (e.g. an orthologue or a paralogue) thereof, for example comprising a sequence set forth in SEQ ID NO: 6 or a sequence having at least 80% (e.g. at least 85%, at least 90%, at least 91 %, at least 92%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identity thereto;

[0069] (b) the Egt1 enzyme is derived from Neurospora crassa or a homologue (e.g. an orthologue or a paralogue) thereof, for example comprising a sequence set forth in SEQ ID NO: 5 or a sequence having at least 80% (e.g. at least 85%, at least 90%, at least 91 %, at least 92%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identity thereto; and / or,

[0070] (c) the EgtE enzyme is derived from Mycolicibacterium smegmatis or a homologue (e.g. an orthologue or a paralogue) thereof, for example comprising a sequence set forth in SEQ ID NO: 7 or a sequence having at least 80% (e.g. at least 85%, at least 90%, at least 91 %, at least 92%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identity thereto.

[0071] In certain embodiments, the EanB enzyme is derived from Chlorobium limicola or a homolog thereof (e.g., an ortholog or a paralog), e.g., comprises a sequence set forth in SEQ ID NO: 8 or a sequence with at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identity thereto;

[0072] In certain embodiments, the engineered microbial cell comprises:

[0073] a first operon comprising exogenous nucleic acid sequences encoding BHMT (e.g., SEQ ID NO: 1), methionine adenosyltransferase (e.g., SEQ ID NO: 3), SAHase (e.g., SEQ ID NO: 4), and adenosine kinase (e.g., SEQ ID NO: 2);

[0074] a second operon comprising exogenous nucleic acid sequences encoding EgtD (e.g., SEQ ID NO: 6), Egtl (e.g., SEQ ID NO: 5), and EgtE (e.g., SEQ ID NO: 7);

[0075] a third operon comprising exogenous nucleic acid sequences encoding EgtD (e.g., SEQ ID NO: 6), Egtl (e.g., SEQ ID NO: 5), and EanB (e.g., SEQ ID NO: 8).

[0076] In certain embodiments, the operons are each independently operably linked to a promoter, e.g., a prokaryotic cell promoter, such as a T7 promoter.

[0077] In certain embodiments, the operons are each independently integrated into the chromosome of the cell or located on a self-replicating plasmid.

[0078] In certain embodiments, the first and second operons are integrated into the chromosome of the cell and the third operon is located on a self-replicating plasmid.

[0079] In certain embodiments, the operons are each independently comprises one or more copies.

[0080] In certain embodiments, the second operon comprises at least two copies.

[0081] Enhanced histidine biosynthetic pathway

[0082] In certain embodiments, the engineered microbial cell of any of the above embodiments further comprises: (iv) an enhanced histidine biosynthetic pathway, said pathway comprising substrate-to-product conversion from 5-phosphoribosyl-a-pyrophosphate (PRPP) to histidine.

[0083] An exemplary pathway for histidine biosynthesis can be found in FIG. 7, which includes eight histidine biosynthesis genes hisG, hisD, hisC, hisB, hisH, hisA, hisF, and hisl.

[0084] HisG is an ATP phosphoribosyltransferase that catalyzes the first step in the histidine biosynthetic pathway. This step is subject to feedback inhibition by histidine, and mutations in HisG have been studied in order to generate feedback-resistant versions of the enzyme, allowing for increased production of histidine. In this document, the term "HisG" encompasses wild-type versions of HisG and also encompasses variant versions of HisG (e.g., feedback-resistant versions of HisG).

[0085] HisD is a histidinol dehydrogenase that catalyzes the last two steps in the histidine biosynthetic pathway.

[0086] HisC is a histidinol phosphate aminotransferase that catalyzes the seventh step in the histidine biosynthetic pathway.

[0087] HisB is a bifunctional enzyme that catalyzes the sixth step (IGP dehydratase) and the eighth step (Hol-P phosphatase) in the histidine biosynthetic pathway.

[0088] HisH protein forms a dimer with HisF, which then functions as an imidazole glycerol phosphate (IGP) synthase and catalyzes the fifth step in the histidine biosynthetic pathway.

[0089] HisA is a l-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methyleneamino]imidazole-4- carboxamide isomerase that catalyzes the fourth reaction in the histidine biosynthetic pathway.

[0090] HisF protein forms a dimer with HisH, which then functions as an imidazole glycerol phosphate (IGP) synthase and catalyzes the fifth step in the histidine biosynthetic pathway.

[0091] Hisl is a bifunctional enzyme that catalyzes the second and third steps in the histidine biosynthetic pathway.

[0092] In certain embodiments, the exogenous nucleic acid sequences encoding enzymes of the histidine biosynthesis pathway are expressed from a single multi-cistronic operon, or wherein each exogenous nucleic acid sequence is expressed from a separate promoter. In certain embodiments, the exogenous nucleic acid sequence encoding HisG is expressed from a separate promoter. In certain embodiments, hisD, hisC, hisB, hisH, hisA, hisF, and hisI are expressed from a single multi-cistronic operon.

[0093] In certain embodiments, the engineered microbial cell comprises increased activity of one or more enzymes selected from histidine biosynthesis enzymes including hisG, hisD, hisC, hisB, hisH, hisA, hisF, hisI. In certain embodiments, the increased activity is achieved by overexpression of an exogenous nucleic acid sequence encoding the enzyme.

[0094] In certain embodiments, the engineered microbial cell comprises an exogenous nucleic acid sequence encoding a hisG mutant that is capable of relieving feedback inhibition regulation by histidine. HisG mutants capable of relieving feedback inhibition regulation by histidine are known to those skilled in the art, see, e.g., Wu H, Tian D, Fan X, et al. Highly Efficient Production of l-Histidine from Glucose by Metabolically Engineered Escherichia coli. ACS Synth Biol. 2020;9(7): 1813-1822.

[0095] In certain embodiments, the hisG mutant is derived from C. glutamicum and comprises a mutation selected from N215K / L231F / T235A, N215I, G233H / T235Q, S143F compared to wild-type HisG. In certain embodiments, the hisG mutant is derived from C. glutamicum and comprises a S143F mutation and deletion of the C-terminal regulatory domain compared to wild-type HisG. In certain embodiments, the hisG mutant comprises a sequence set forth in SEQ ID NO: 14.

[0096] In certain embodiments, the hisG mutant is derived from E. coli and comprises a E271K mutation compared to wild-type HisG.

[0097] In certain embodiments, the endogenous hisG gene or homolog thereof (e.g., ortholog or paralog) of the engineered microbial cell is disrupted (e.g., knocked out). In some embodiments where the microbial cell is E. coli, the endogenous hisG gene is disrupted (e.g., knocked out), an exemplary sequence of which is found at, e.g., NCBI: NP_416523.1.

[0098] In certain embodiments, the exogenous nucleic acid sequence encoding the hisG mutant comprises one or more copies, e.g., at least two copies.

[0099] In certain embodiments, the exogenous nucleic acid sequence encoding the hisG mutant is integrated into the chromosome of the cell.

[0100] In certain embodiments, the exogenous nucleic acid sequence encoding the hisG mutant replaces the endogenous hisG gene.

[0101] In certain embodiments, the engineered microbial cell further comprises overexpression of hisD, hisC, hisB, hisH, hisA, hisF, hisI genes. In certain embodiments, the cell comprises exogenous nucleic acid sequences encoding hisD, hisC, hisB, hisH, hisA, hisF, hisI.

[0102] In certain embodiments, hisD, hisC, hisB, hisH, hisA, hisF, hisI are derived from E. coli or are homologs (e.g., orthologs or paralogs) thereof, e.g., comprise the sequences set forth in SEQ ID NOs: 15-21, respectively, or a sequence with at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identity thereto.

[0103] In certain embodiments, the exogenous nucleic acid sequences are present in a polycistronic operon. In certain embodiments, the polycistronic operon is operably linked to a promoter, e.g., a prokaryotic cell promoter, such as a T7 promoter.

[0104] In certain embodiments, the exogenous nucleic acid sequences each independently comprise one or more copies, e.g., at least two copies.

[0105] In certain embodiments, the exogenous nucleic acid sequences each independently are located on a self-replicating plasmid or integrated into the chromosome of the cell.

[0106] In certain embodiments, the enhanced histidine biosynthesis pathway described in any of the above embodiments further comprises: the endogenous purF gene or homolog thereof (e.g., ortholog or paralog) is disrupted (e.g., knocked out). In some embodiments where the microbial cell is E. coli, the endogenous purF gene is disrupted (e.g., knocked out), an exemplary sequence of which is found at, e.g., NCBI: NP_416815.1.

[0107] In certain embodiments, the enhanced histidine biosynthesis pathway described in any of the above embodiments further comprises: an enhanced NAD + regeneration pathway.

[0108] In certain embodiments, the enhanced NAD + regeneration pathway is achieved by overexpression of glutamate dehydrogenase (RocG).

[0109] In certain embodiments, the RocG is derived from Bacillus subtilis or is a homolog (e.g., ortholog or paralog) thereof, e.g., comprises the sequence set forth in SEQ ID NO: 12 or a sequence with at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identity thereto.

[0110] In certain embodiments, the cell comprises an exogenous nucleic acid sequence encoding RocG located on a self-replicating plasmid or integrated into the chromosome of the cell.

[0111] In certain embodiments, the enhanced histidine biosynthesis pathway described in any of the above embodiments further comprises: further comprising an enhanced PRPP biosynthesis pathway.

[0112] In certain embodiments, the enhanced PRPP biosynthesis pathway comprises increased activity of glycerol transport protein GlpF, glycerol kinase DhaK, and glycerol dehydrogenase gldA to enhance conversion from glycerol to PRPP.

[0113] In certain embodiments, the GlpF is derived from Pseudomonas or is a homolog (e.g., ortholog or paralog) thereof, e.g., comprises the sequence set forth in SEQ ID NO: 10 or a sequence with at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identity thereto.

[0114] In certain embodiments, the DhaK is derived from Klebsiella or is a homolog (e.g., an ortholog or a paralog) thereof, e.g., comprises a sequence as set forth in SEQ ID NO: 11 or a sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identity thereto.

[0115] In certain embodiments, the gldA is derived from Klebsiella pneumoniae or is a homolog (e.g., an ortholog or a paralog) thereof, e.g., comprises a sequence as set forth in SEQ ID NO: 9 or a sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identity thereto.

[0116] In certain embodiments, the cell comprises an exogenous nucleic acid sequence encoding GlpF (e.g., SEQ ID NO: 10), DhaK (e.g., SEQ ID NO: 11), and gldA (e.g., SEQ ID NO: 9).

[0117] In certain embodiments, the exogenous nucleic acid sequences encoding GlpF, DhaK, and gldA are present in a polycistronic operon. In certain embodiments, the polycistronic operon is operably linked to a promoter, e.g., a prokaryotic cell promoter, such as a T7 promoter. In certain embodiments, the polycistronic operon is integrated into the chromosome of the cell or is located on a self-replicating plasmid.

[0118] In certain embodiments, the engineered microbial cell with an enhanced histidine biosynthetic pathway comprises an exogenous nucleic acid sequence encoding a hisG mutant capable of relieving feedback inhibition regulation of histidine, hisD, hisC, hisB, hisH, hisA, hisF, hisl, RocG, GlpF, DhaK, gldA; and, an endogenous hisG gene and purF gene or a homolog (e.g., an ortholog or a paralog) thereof is disrupted (e.g., knocked out).

[0119] In certain embodiments, the hisG mutant is derived from C. glutamicum, e.g., comprises a sequence as set forth in SEQ ID NO: 14.

[0120] In certain embodiments, the hisD, hisC, hisB, hisH, hisA, hisF, hisI are derived from, or are homologs (e.g., orthologs or paralogs) of, E. coli, e.g., comprise the sequences set forth in SEQ ID NOs: 15-21, respectively, or a sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identity thereto.

[0121] In certain embodiments, the RocG is derived from, or is a homolog (e.g., ortholog or paralog) of, Bacillus subtilis, e.g., comprises the sequence set forth in SEQ ID NO: 12, or a sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identity thereto.

[0122] In certain embodiments, the GlpF, DhaK, gldA are derived from, or are homologs (e.g., orthologs or paralogs) of, Pseudomonas, Klebsiella, Klebsiella pneumoniae, respectively, e.g., comprise the sequences set forth in SEQ ID NOs: 10, 11, 9, respectively, or a sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identity thereto.

[0123] In certain embodiments, the engineered microbial cell with an enhanced histidine biosynthetic pathway comprises:

[0124] (a) one or more copies (e.g., at least two copies) of an exogenous nucleic acid sequence encoding a hisG mutant (e.g., SEQ ID NO: 14) that is capable of relieving feedback inhibition regulation of histidine;

[0125] (b) one or more copies (e.g., at least two copies) of an exogenous nucleic acid sequence encoding hisD, hisC, hisB, hisH, hisA, hisF, hisI, the exogenous nucleic acid sequence being present in a polycistronic operon;

[0126] (c) one or more copies (e.g., one copy) of an exogenous nucleic acid sequence encoding RocG (e.g., SEQ ID NO: 12).

[0127] (d) one or more copies (e.g., one copy) of an exogenous nucleic acid sequence encoding GlpF (e.g., SEQ ID NO: 10), DhaK (e.g., SEQ ID NO: 11), and gldA (e.g., SEQ ID NO: 9), the exogenous nucleic acid sequence being present in a multi-cistronic operon;

[0128] (e) an endogenous hisG gene or homolog (e.g., ortholog or paralog) thereof is disrupted (e.g., knocked out);

[0129] (f) an endogenous purF gene or homolog (e.g., ortholog or paralog) thereof is disrupted (e.g., knocked out).

[0130] In certain embodiments, the exogenous nucleic acid sequences described in (a)-(d) are integrated into the chromosome of the cell.

[0131] In certain embodiments, the engineered microbial cell comprises (i) an ergot alkaloid oxygenation biosynthetic pathway, (ii) a methionine cycle with betaine as the methyl donor, (iii) an inorganic sulfur utilization pathway, and (iv) an enhanced histidine biosynthetic pathway, as described above, thereby enabling high production of ERG without the addition of an exogenous amino acid.

[0132] In certain embodiments, the engineered microbial cell comprises exogenous nucleic acid sequences encoding: BHMT, methionine adenosyltransferase, SAHase, adenosine kinase, EgtD, Egt1, EgtE, EanB, a hisG mutant capable of relieving feedback inhibition regulation of histidine, hisD, hisC, hisB, hisH, hisA, hisF, hisI, RocG, GlpF, DhaK, and gldA, each as defined in any of the embodiments described above. Those skilled in the art understand that the above exogenous nucleic acid sequences encoding each enzyme can be introduced into the engineered microbial cell as individually regulated expression constructs, as a polycistronic operon, as a single nucleic acid molecule encoding a fusion protein, or any combination thereof, and through different or the same vectors. In certain embodiments, the exogenous nucleic acid sequences encoding BHMT, methionine adenosyltransferase, SAHase, adenosine kinase are located in a single operon. In certain embodiments, the exogenous nucleic acid sequences encoding EgtD, Egt1, EgtE are located in a single operon. In certain embodiments, the exogenous nucleic acid sequence encoding EanB is optionally located in a single operon with additional exogenous nucleic acid sequences encoding EgtD, Egt1. In certain embodiments, the exogenous nucleic acid sequences encoding hisD, hisC, hisB, hisH, hisA, hisF, hisI are located in a single operon. In certain embodiments, the exogenous nucleic acid sequences encoding GlpF, DhaK, and gldA are located in a single operon. In certain embodiments, the endogenous hisG gene and purF gene or homologs thereof (e.g., orthologs or paralogs) of the engineered microbial cell are disrupted (e.g., knocked out).

[0133] Other genetic modifications

[0134] In certain embodiments, the engineered microbial cell described in any of the embodiments above further comprises: an additional exogenous nucleic acid sequence encoding EgtD (e.g., SEQ ID NO: 6), an exogenous nucleic acid sequence encoding Egt1 (e.g., SEQ ID NO: 5), and an exogenous nucleic acid sequence encoding EanB (e.g., SEQ ID NO: 8). In certain embodiments, the additional exogenous nucleic acid sequences are in episomal form on a self-replicating plasmid.

[0135] In certain embodiments, the endogenous metJ gene or homologs thereof (e.g., orthologs or paralogs) of the engineered microbial cell described in any of the embodiments above are disrupted (e.g., knocked out). In some embodiments where the microbial cell is E. coli, the endogenous metJ gene is disrupted (e.g., knocked out), an exemplary sequence of which is found at, e.g., NCBI: NP_418373.1.

[0136] In certain embodiments, the engineered microbial cell of any of the above described embodiments overexpresses an ERG transporter protein. In certain embodiments, the cell comprises an exogenous nucleic acid sequence encoding an ERG transporter protein. In certain embodiments, the ERG transporter protein is mfsTl of Mycolicibacterium neoaurum origin or a homolog (e.g., an ortholog or a paralog) thereof, e.g., comprising a sequence set forth in SEQ ID NO: 13 or a sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identity thereto.

[0137] In certain embodiments, the engineered microbial cell of any of the above described embodiments has a disrupted (e.g., knocked out) endogenous metJ gene or a homolog (e.g., an ortholog or a paralog) thereof, and further comprises an exogenous nucleic acid sequence encoding mfsTl (e.g., SEQ ID NO: 13); preferably, the exogenous nucleic acid sequence is on a self-replicating plasmid.

[0138] Exemplary engineered microorganisms

[0139] Exemplary embodiments of engineered microbial cells provided herein include:

[0140] Embodiment 1. An engineered microbial cell comprising:

[0141] (i) an ergot alkaloid aerobic biosynthetic pathway comprising EgtD (e.g., SEQ ID NO: 6), Egtl (e.g., SEQ ID NO: 5), and EgtE (e.g., SEQ ID NO: 7);

[0142] (ii) a methionine cycle with betaine as the methyl donor comprising BHMT (e.g., SEQ ID NO: 1), methionine adenosyltransferase (e.g., SEQ ID NO: 3), SAHase (e.g., SEQ ID NO: 4), and adenosine kinase (e.g., SEQ ID NO: 2);

[0143] (iii) an inorganic sulfur utilization pathway comprising EanB (e.g., SEQ ID NO: 8);

[0144] (iv) an enhanced histidine biosynthesis pathway comprising a hisG mutant (such as SEQ ID NO: 14) capable of relieving feedback inhibition regulation of histidine, hisD (such as SEQ ID NO: 15), hisC (such as SEQ ID NO: 16), hisB (such as SEQ ID NO: 17), hisH (such as SEQ ID NO: 18), hisA (such as SEQ ID NO: 19), hisF (such as SEQ ID NO: 20), hisl (such as SEQ ID NO: 21);

[0145] (v) an enhanced NAD + biosynthetic pathway comprising RocG (such as SEQ ID NO: 12);

[0146] (vi) an enhanced PRPP biosynthetic pathway comprising GlpF (such as SEQ ID NO: 10), DhaK (such as SEQ ID NO: 11), gldA (such as SEQ ID NO: 9).

[0147] Embodiment 2. The engineered microbial cell of Embodiment 1, comprising exogenous nucleic acid sequences encoding the enzymes recited in (i)-(vi). Preferably, the exogenous nucleic acid sequences encoding the enzymes recited in (i)-(vi) are in separate operons, respectively.

[0148] Embodiment 3. The engineered microbial cell of Embodiment 1 or 2, wherein an endogenous hisG gene or homolog thereof (e.g., an ortholog or a paralog) is knocked out. In some cases where the microbial cell is E. coli, the endogenous hisG gene is knocked out.

[0149] Embodiment 4. The engineered microbial cell of any one of Embodiments 1-3, wherein an endogenous purF gene or homolog thereof (e.g., an ortholog or a paralog) is knocked out. In some cases where the microbial cell is E. coli, the endogenous purF gene is knocked out.

[0150] Embodiment 5. The engineered microbial cell of any one of Embodiments 1-4, wherein the engineered microbial cell comprises:

[0151] a first operon comprising exogenous nucleic acid sequences encoding BHMT (such as SEQ ID NO: 1), a methionine adenosyltransferase (such as SEQ ID NO: 3), a SAHase (such as SEQ ID NO: 4), and an adenosine kinase (such as SEQ ID NO: 2);

[0152] a second operon comprising an exogenous nucleic acid sequence encoding EgtD (such as SEQ ID NO: 6), Egt1 (such as SEQ ID NO: 5), and EgtE (such as SEQ ID NO: 7);

[0153] a third operon comprising an exogenous nucleic acid sequence encoding EanB (such as SEQ ID NO: 8); preferably, the third operon further comprises an exogenous nucleic acid sequence encoding EgtD (such as SEQ ID NO: 6) and Egt1 (such as SEQ ID NO: 5);

[0154] a fourth operon comprising an exogenous nucleic acid sequence encoding a hisG mutant (such as SEQ ID NO: 14) capable of relieving feedback inhibition regulation of histidine;

[0155] a fifth operon comprising an exogenous nucleic acid sequence encoding hisD (such as SEQ ID NO: 15), hisC (such as SEQ ID NO: 16), hisB (such as SEQ ID NO: 17), hisH (such as SEQ ID NO: 18), hisA (such as SEQ ID NO: 19), hisF (such as SEQ ID NO: 20), hisI (such as SEQ ID NO: 21);

[0156] a sixth operon comprising an exogenous nucleic acid sequence encoding RocG (such as SEQ ID NO: 12);

[0157] a seventh operon comprising an exogenous nucleic acid sequence encoding GlpF (such as SEQ ID NO: 10), DhaK (such as SEQ ID NO: 11), and gldA (such as SEQ ID NO: 9);

[0158] and wherein the endogenous hisG gene and the endogenous purF gene or a homolog (e.g., an ortholog or a paralog) thereof are knocked out. In some cases where the microbial cell is Escherichia coli, the endogenous hisG gene and the endogenous purF gene are knocked out.

[0159] Embodiment 6. The engineered microbial cell of Embodiment 5, wherein: the first through seventh operons are integrated into the chromosome of the cell.

[0160] Embodiment 7. The engineered microbial cell of Embodiment 5 or 6, wherein: the first through seventh operons each independently comprise one or more copies; preferably, the second, fourth, and fifth operons comprise at least two copies.

[0161] Embodiment 8. The engineered microbial cell of any one of embodiments 1-7, further comprising an additional exogenous nucleic acid sequence encoding EgtD (such as SEQ ID NO: 6), an exogenous nucleic acid sequence encoding Egtl (such as SEQ ID NO: 5), and an exogenous nucleic acid sequence encoding EanB (such as SEQ ID NO: 8) in episomal form.

[0162] Embodiment 9. The engineered microbial cell of any one of embodiments 1-8, wherein an endogenous metJ gene or homolog thereof (e.g., an ortholog or a paralog) is knocked out. In some cases where the microbial cell is E. coli, the endogenous metJ gene is knocked out.

[0163] Embodiment 10. The engineered microbial cell of any one of embodiments 1-9, further comprising an exogenous nucleic acid sequence encoding mfsTl (such as SEQ ID NO: 13); preferably, the exogenous nucleic acid sequence is on a self-replicating plasmid.

[0164] Microbial cell

[0165] The present disclosure provides genetic modifications that facilitate or optimize ergothioneine biosynthesis. Those skilled in the art will appreciate that the genetic modifications exemplified herein are described with reference to a suitable host organism, such as E. coli, and its corresponding metabolic reactions. However, given the complete genome sequencing of a variety of organisms and the high level of skill in the art of genomics, those skilled in the art will be able to readily apply the teachings and guidance provided herein to substantially all other organisms. For example, the E. coli metabolic alterations exemplified herein can be readily applied to other species by incorporating the same or analogous encoding nucleic acids from species other than the reference species through the substitution of species homologs (e.g., orthologs or paralogs). For example, the sequences of enzymes introduced into the host organism exemplified herein can be substituted for the same or analogous homologs (e.g., orthologs or paralogs) of species other than the reference species.

[0166] Ortholog and paralog gene substitutions can be determined by methods well known to those skilled in the art. For example, algorithms such as Align, BLAST, or ClustalW can be employed to determine the sequence identity or similarity between two compared sequences, and to determine the presence or significance of gaps in the sequence, which can be assigned a weight or score. Based on such similarity, one skilled in the art can determine whether the similarity is high enough to indicate that the proteins are related by evolution through a common ancestor.

[0167] In certain embodiments, the engineered microbial cell as described above is a bacterium.

[0168] In certain embodiments, the engineered microbial cell as described above is E. coli.

[0169] Methods of making engineered microorganisms

[0170] The engineered microbial cells of the present invention can be produced by any genetic engineering method known to those of skill in the art, without limitation.

[0171] Expression of the enzymes in the host cell can be achieved by introducing a nucleic acid comprising a nucleotide sequence encoding the enzyme under the control of a regulatory element that permits expression in the host cell. In some embodiments, the nucleic acid is an extrachromosomal plasmid. In other embodiments, the nucleic acid is a chromosomal integration vector, which can integrate the nucleotide sequence into the chromosome of the host cell. Exemplary techniques for introducing nucleic acids encoding these enzymes into host cells include, but are not limited to, spheroplasting, electroporation, PEG 1000-mediated transformation, and lithium acetate or lithium chloride-mediated transformation.

[0172] Overexpression of the enzymes in the host cell can be achieved, for example, by providing multiple copies of the gene or by altering the promoter region to provide stronger expression. The copy number of the enzyme in the host cell can be altered by modifying transcription of the gene encoding the enzyme. This can be achieved, for example, by modifying the copy number of the nucleotide sequence encoding the enzyme (e.g., by using an expression vector comprising a higher or lower copy number of the nucleotide sequence, or by introducing additional copies of the nucleotide sequence into the genome of the host cell), or by increasing the strength of the promoter or operator operably linked to the nucleotide sequence.

[0173] In certain embodiments, the nucleic acid used to genetically modify the host cell comprises one or more selection markers, such as an antibiotic resistance marker, which can be used to select for transformed host cells and for exerting selective pressure on the host cell to maintain the exogenous DNA.

[0174] Inhibition of enzyme activity in the host cell can be achieved, for example, by deleting or disrupting a nucleotide sequence encoding the enzyme in the host cell genome. In some embodiments, reduced activity can be achieved by introducing a gene disruption. The term “gene disruption” encompasses any genetic alteration that inactivates the encoded gene product. The genetic alteration can be, for example, deletion or knockout of the entire gene, deletion of regulatory sequences required for transcription or translation, deletion of a portion of the gene to result in a truncated gene product, or by any of various mutagenic strategies that inactivate the encoded gene product.

[0175] In certain embodiments, one particularly useful method of gene disruption can be complete deletion or knockout of a gene, as it reduces or eliminates the occurrence of genetic reversion in the engineered microorganism of the disclosure. Deletion or knockout of an endogenous gene can be achieved by any gene editing system known in the art, such as zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), or clustered regularly interspaced short palindromic repeats (CRISPR).

[0176] In other embodiments, an endogenous gene can also be knocked down by gene silencing, such as by using oligonucleotides that bind to the gene encoding it or its mRNA, resulting in a temporary change in expression. Exemplary methods of gene silencing include, but are not limited to, RNA interference (RNAi), small interfering RNA (siRNA), or short hairpin RNA (shRNA), which are used to inactivate messenger RNA of a specific gene and effectively inhibit the expression of that gene.

[0177] Methods of producing ERG

[0178] In another aspect, the present application provides the use of the engineered microbial cell of the present application in the biosynthesis of ergothioneine (ERG).

[0179] In another aspect, the present application provides a method for producing ergothioneine (ERG), comprising culturing the engineered microbial cell described in the present application in a culture medium. In certain embodiments, the method further comprises recovering ergothioneine from the culture. In certain embodiments, the culturing is for a time sufficient to produce ergothioneine.

[0180] The method generally involves culturing the host cell in a suitable medium comprising a carbon source under suitable conditions. Suitable conditions and suitable media for culturing microorganisms are well known in the art. In certain embodiments, the carbon source is a monosaccharide (simple sugar), a disaccharide, a polysaccharide, a non-fermentable carbon source, or one or more combinations thereof. Non-limiting examples of suitable monosaccharides include glucose, galactose, mannose, fructose, ribose, and combinations thereof. Non-limiting examples of suitable disaccharides include sucrose, lactose, maltose, trehalose, cellobiose, and combinations thereof. Non-limiting examples of suitable polysaccharides include starch, glycogen, cellulose, chitin, and combinations thereof. Non-limiting examples of suitable non-fermentable carbon sources include acetate and glycerol.

[0181] In certain embodiments, the culture medium is suitable for E. coli culturing.

[0182] In certain embodiments, the culture medium is supplemented with histidine betaine, glycerol, and inorganic sulfur (such as Na2S, NaHS, K2S, K2S X , Na2S2O3).

[0183] In certain embodiments, the medium comprises: yeast extract, peptone, sodium chloride, K2HPO4, glycerol, histidine betaine, MgSO4, inorganic sulfur (such as Na2S, NaHS, K2S, K2S X , Na2S2O3).

[0184] In certain embodiments, the inorganic sulfur is Na2S2O3.

[0185] In certain embodiments, the medium comprises: yeast extract 24 g / L, peptone 12 g / L, sodium chloride 5 g / L, K2HPO4 2 g / L, glycerol 30 g / L, histidine betaine 2 g / L, MgSO4 0.3 g / L, 8 mM Na2S2O3.

[0186] In certain embodiments, the method does not comprise adding methionine, cysteine and / or histidine to the medium.

[0187] Methods of increasing ergothioneine yield

[0188] In another aspect, the present application provides a method for increasing the yield of ergothioneine (ERG), comprising introducing into a microbial cell the genetic modifications comprised by the engineered microbial cell of the present application.

[0189] In certain embodiments, the microbial cell is a bacterium.

[0190] In certain embodiments, the microbial cell is Escherichia coli.

[0191] In certain embodiments, the method comprises introducing into the microbial cell:

[0192] (i) an ergothioneine aerobic biosynthesis pathway comprising EgtD (such as SEQ ID NO: 6), Egt1 (such as SEQ ID NO: 5), and EgtE (such as SEQ ID NO: 7);

[0193] (ii) a methionine cycle with betaine as the methyl donor comprising BHMT (such as SEQ ID NO: 1), methionine adenosyltransferase (such as SEQ ID NO: 3), SAHase (such as SEQ ID NO: 4) and adenosine kinase (such as SEQ ID NO: 2);

[0194] (iii) an inorganic sulfur utilization pathway comprising EanB (such as SEQ ID NO: 8);

[0195] (iv) an enhanced histidine biosynthesis pathway comprising a hisG mutant (such as SEQ ID NO: 14), hisD (such as SEQ ID NO: 15), hisC (such as SEQ ID NO: 16), hisB (such as SEQ ID NO: 17), hisH (such as SEQ ID NO: 18), hisA (such as SEQ ID NO: 19), hisF (such as SEQ ID NO: 20), hisl (such as SEQ ID NO: 21) that is capable of relieving feedback inhibition regulation of histidine;

[0196] (v) an enhanced NAD + biosynthetic pathway comprising RocG (such as SEQ ID NO: 12);

[0197] (vi) an enhanced PRPP biosynthetic pathway comprising GlpF (such as SEQ ID NO: 10), DhaK (such as SEQ ID NO: 11), gldA (such as SEQ ID NO: 9).

[0198] In certain embodiments, the method comprises introducing into the microbial cell an exogenous nucleic acid sequence encoding the enzymes recited in (i)-(vi).

[0199] In certain embodiments, the method comprises further comprising knocking out an endogenous hisG gene or homolog thereof (e.g., an ortholog or a paralog).

[0200] In certain embodiments, the method comprises further comprising knocking out an endogenous purF gene or homolog thereof (e.g., an ortholog or a paralog).

[0201] In certain embodiments, the method comprises introducing into the microbial cell:

[0202] a first operon comprising exogenous nucleic acid sequences encoding BHMT (such as SEQ ID NO: 1), methionine adenosyltransferase (such as SEQ ID NO: 3), SAHase (such as SEQ ID NO: 4), and adenosine kinase (such as SEQ ID NO: 2);

[0203] a second operon comprising exogenous nucleic acid sequences of EgtD (such as SEQ ID NO: 6), Egtl (such as SEQ ID NO: 5), and EgtE (such as SEQ ID NO: 7);

[0204] a third operon comprising an exogenous nucleic acid sequence encoding EanB (such as SEQ ID NO: 8); preferably, the third operon further comprises an exogenous nucleic acid sequence encoding EgtD (such as SEQ ID NO: 6) and Egtl (such as SEQ ID NO: 5);

[0205] a fourth operon comprising an exogenous nucleic acid sequence encoding a hisG mutant (such as SEQ ID NO: 14) capable of relieving feedback inhibition regulation of histidine;

[0206] a fifth operon comprising an exogenous nucleic acid sequence encoding hisD (such as SEQ ID NO: 15), hisC (such as SEQ ID NO: 16), hisB (such as SEQ ID NO: 17), hisH (such as SEQ ID NO: 18), hisA (such as SEQ ID NO: 19), hisF (such as SEQ ID NO: 20), hisl (such as SEQ ID NO: 21);

[0207] a sixth operon comprising an exogenous nucleic acid sequence encoding RocG (such as SEQ ID NO: 12);

[0208] a seventh operon comprising an exogenous nucleic acid sequence encoding GlpF (such as SEQ ID NO: 10), DhaK (such as SEQ ID NO: 11), and gldA (such as SEQ ID NO: 9);

[0209] and knocking out an endogenous hisG gene and an endogenous purF gene or homologs (e.g., orthologs or paralogs) thereof.

[0210] In certain embodiments, the first through seventh operons are integrated into the chromosome of the cell.

[0211] In certain embodiments, the first through seventh operons each independently comprise one or more copies; preferably, the second, fourth, and fifth operons comprise at least two copies.

[0212] In certain embodiments, the method further comprises introducing into the cell additional exogenous nucleic acid sequences encoding EgtD (such as SEQ ID NO: 6), Egtl (such as SEQ ID NO: 5), and EanB (such as SEQ ID NO: 8) in the form of episomal plasmids.

[0213] In certain embodiments, the method further comprises knocking out an endogenous metJ gene or homologs (e.g., orthologs or paralogs) thereof.

[0214] In certain embodiments, the method further comprises introducing an exogenous nucleic acid sequence encoding mfsTl (such as SEQ ID NO: 13); preferably, the exogenous nucleic acid sequence is on a self-replicating plasmid.

[0215] Definitions

[0216] In the present disclosure, unless otherwise indicated, any concentration range, percentage range, ratio range, or integer range is to be construed as including any integer value within such range and, where appropriate, fractions thereof. As used herein, the term "about" means ±10% (e.g., ±5%, ±2%, or ±1%) of the indicated range or value. It should be understood that the terms "one," "a," and "an" as used herein refer to "one or more" of the enumerated components. The use of the alternative (e.g., "or") should be understood to mean either one, both, or any combination thereof of the alternatives.

[0217] In the present disclosure, unless otherwise indicated, scientific and technical terms have the meanings that would be understood by one of ordinary skill in the art. To better understand the present disclosure, definitions and explanations of terms are provided below.

[0218] As used herein, the term "ergothioneine aerobic biosynthetic pathway" includes the bacterial pathway from L-histidine to biosynthesize ergothioneine, which is represented by Mycobacterium smegmatis and involves EgtA / EgtB / EgtC / EgtD / EgtE, and the fungal pathway from L-histidine to biosynthesize ergothioneine, which is represented by Neurospora crassa and involves Egt1 / Egt2.

[0219] In the bacterial pathway, EgtD catalyzes the synthesis of hercynine (HER) from histidine and S-adenosylmethionine (SAM); in the presence of Fe 2+ EgtB catalyzes the oxidative sulfurization of HER with γ-glutamylcysteine (γ-GC) synthesized by EgtA to form γ-glutamyl-histidinyl-trimethyl inner salt base cysteine sulfoxide (γGC-HER); γGC-HER is then catalyzed by EgtC to remove glutamate to form histidinyl-trimethyl inner salt base cysteine sulfoxide (Cys-HER); finally, EgtE catalyzes Cys-HER to remove pyruvate and ammonia to form ergothioneine.

[0220] In the fungal pathway, only two enzymes are involved, Egt1 and Egt2. Egt1 is a bifunctional enzyme that methylates histidine to form HER and directly converts HER to Cys-HER; Egt2 functions the same as EgtE to cleave the C-S bond of Cys-HER to form ergothioneine.

[0221] As used herein, the term “ergothioneine anaerobic biosynthetic pathway” includes the anaerobic bacterial pathway from L-histidine to biosynthesize ergothioneine, which is represented by Chlorobium lumicola and involves EanA / EanB. In this pathway, EanA catalyzes the conversion of histidine to HER, followed by EanB transferring a sulfur atom to the imidazole ring of HER under anaerobic conditions to generate ergothioneine.

[0222] As used herein, the term “methionine cycle” refers to the reaction of methionine with ATP catalyzed by an adenosyltransferase to generate S-adenosylmethionine (SAM), the catalysis of SAM by a methyltransferase to transfer a methyl group to another substance to methylate it, and the generation of S-adenosyl-L-homocysteine (SAH) upon demethylation of SAM, the removal of adenosyl from SAH to generate homocysteine, and the re-methylation of homocysteine with a methyl group from 5-methyltetrahydrofolate (5-MTHF) to regenerate methionine, forming a cycle, which is referred to as the methionine cycle.

[0223] As used herein, the term “betaine as a methyl donor methionine cycle” refers to the methionine cycle in which betaine is used as a methyl donor to transfer its methyl group to homocysteine catalyzed by betaine-homocysteine methyltransferase (BHMT) to form methionine. See, e.g., Liu Q, Lin B, Tao Y. Improved methylation in E. coli via an efficient methyl supply system driven by betaine. Metab Eng. 2022;72:46-55, which is incorporated herein by reference.

[0224] In some embodiments, the cycle comprises: methionine reacting with ATP catalyzed by an adenosine transferase (such as methionine adenosyltransferase SAM2 from S. cerevisiae) to generate S-adenosylmethionine (SAM), SAM catalyzing the transfer of a methyl group to another substance to methylate it (e.g., in the present application, SAM catalyzes the transfer of a methyl group to histidine to form HER by EgtD / Egtl enzymes), and SAM demethylation to generate S-adenosyl-L-homocysteine (SAH), SAH catalyzing the removal of adenosine to generate homocysteine (Homocysteine) by a SAH hydrolase (e.g., SAHase from Corynebacterium efficiens), and homocysteine accepting a methyl group from betaine to regenerate methionine catalyzed by BHMT.

[0225] In some embodiments, the cycle further comprises: adenosine generated from SAH hydrolysis forming ATP catalyzed by an adenosine kinase (e.g., ADOl from Cryptosporidium parvum), enabling regeneration of adenosine to ATP.

[0226] As used herein, the term "endogenous" refers to a nucleic acid or protein that is present in or expressed by a wild-type or parent microorganism from which an engineered microorganism disclosed herein is derived. For example, an endogenous gene is a gene that naturally occurs in a wild-type or parent microorganism from which an engineered microorganism disclosed herein is derived. In one embodiment, expression of an endogenous gene can be controlled by an exogenous regulatory element, e.g., an exogenous promoter.

[0227] As used herein, the term "exogenous" refers to a nucleic acid or protein that is derived from outside of an engineered microorganism disclosed herein. For example, an exogenous gene or enzyme can be artificially or recombinantly produced and introduced into or expressed in an engineered microorganism disclosed herein. An exogenous gene or enzyme can also be isolated from a heterologous microorganism and introduced into or expressed in an engineered microorganism disclosed herein. An exogenous nucleic acid can be adapted to integrate into the genome of an engineered microorganism disclosed herein or to remain extrachromosomally, e.g., in a plasmid, in an engineered microorganism disclosed herein.

[0228] As used herein, the term "microbe," "microorganism," or "microbial cell" means any organism that exists in the form of a microscopic cell.

[0229] As used herein, the term "host" refers to a cell or microorganism that can be genetically modified, e.g., by mutation, use of an exogenous nucleic acid molecule, by knockout, or a combination thereof, to possess or improve ergothioneine production relative to an unmodified host cell. In certain embodiments, the host cell can optionally already possess other genetic modifications that confer other desirable properties.

[0230] As used herein, the term "parent cell" refers to a cell having the same genetic background as a host cell disclosed herein, except that it does not comprise a particular genetic modification (e.g., mutation or knockout of an endogenous nucleic acid, introduction of an exogenous or heterologous nucleic acid, or a combination thereof), and which serves as a starting point for the introduction of the genetic modification, resulting in the host cell disclosed herein.

[0231] As used herein, the term "overexpress" refers to the level of gene expression or gene product in a non-native or recombinant microorganism that is higher than the level of gene expression or gene product found in a parent or wild-type microorganism when grown under the same conditions. In certain embodiments, overexpression can occur at the transcriptional level, the translational level, or both, which can be due to altered regulatory control (e.g., use of a strong promoter) or an increase in copy number, or both.

[0232] As used herein, the term "vector" refers to a nucleic acid carrier into which a polynucleotide can be inserted. When the vector allows for expression of a protein encoded by a polynucleotide inserted therein, the vector is referred to as an expression vector. Vectors can have elements of genetic material carried for expression in a host cell by transformation, transduction, or transfection into the host cell. Vectors are well known to those skilled in the art and include, but are not limited to, plasmids, bacteriophages, cosmids, artificial chromosomes such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC), or P1 -derived artificial chromosomes (PAC); bacteriophages such as lambda phage or M13 phage, and animal viruses. Animal viruses that can be used as vectors include, but are not limited to, retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpesviruses (e.g., herpes simplex viruses), poxviruses, baculoviruses, papillomaviruses, papovaviruses (such as SV40). Vectors can comprise multiple elements for controlling expression, including but not limited to promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. In addition, vectors can comprise origins of replication.

[0233] As used herein, the term "homolog" describes those nucleotide sequences that have sequence similarity and encode polypeptides that share at least one functional characteristic (e.g., biochemical activity), or those polypeptides that have sequence similarity and at the same time have at least one functional similarity (e.g., biochemical activity).

[0234] As used herein, the term "ortholog" refers to a homologous gene or protein that is functionally equivalent to a gene or protein referenced in another species. Orthologous sequences are homologous sequences in different species that derive from a single sequence of a last common ancestor, with the sequence and its primary function being conserved. Homologous sequences are sequences inherited from a common ancestor in two species. When referring to an amino acid or nucleotide / nucleic acid sequence from a given species, the term "ortholog" refers to the same amino acid or nucleotide / nucleic acid sequence from a different species. It will be appreciated that two sequences are orthologs of one another when they derive from a common ancestral sequence by linear descent and / or are closely related in both their sequence and their biological function. Orthologs will typically have a high degree of sequence identity, but can not (and often will not) share 100% sequence identity.

[0235] As used herein, the term "paralog" describes homologous sequences that result from a duplication event of a sequence. Paralogous sequences are typically of the same species, but this is not required. Paralogs can be divided into in-paralogs (pairs of paralogs that arose after the speciation event) and out-paralogs (pairs of paralogs that arose before the speciation event). Inter-species out-paralogs are pairs of paralogs that exist between two organisms due to duplication before speciation. Intra-species out-paralogs are pairs of paralogs that exist in the same organism, but whose duplication event occurred after speciation. Paralogs often have the same or similar function.

[0236] As used herein, the term "identity" refers to a measure of the similarity between nucleotide sequences or amino acid sequences. Generally, sequences are aligned for maximum match. "Identity" has the meaning commonly known in the art and can be calculated by published algorithms (e.g., BLAST). Beneficial effects

[0237] This invention provides an improved engineered microbial cell that, while producing high yields of ergothioneine, eliminates the need for the addition of methionine, cysteine, and histidine as precursors during the production process, significantly reducing the cost of microbial fermentation production and demonstrating broad application prospects. Specifically, (1) the engineered microbial cells of the present invention use betaine as the sole methyl donor, replacing the expensive methionine, thereby enabling the regeneration of intracellular SAM. Based on this, the ergothioneine synthesis route is coupled to achieve efficient conversion from betaine to ergothioneine; (2) in the traditional synthesis route, the sulfur source of ERG comes from intracellular cysteine. If a high yield of the target product is desired, the intracellular cysteine ​​pathway needs to be strengthened or exogenous addition is required. If the pathway is strengthened, it will cause cytotoxicity and there is a barrier to the upper limit of concentration. If exogenous addition is too costly, the engineered microbial cells of the present invention retain the traditional synthesis route and introduce an inorganic sulfur utilization pathway. This dual pathway can reduce the intracellular demand for cysteine ​​and promote the efficient synthesis of ERG; (3) the engineered microbial cells of the present invention also have a histidine-enhanced pathway. By combining and optimizing with the two modules of (1) and (2), high yield of ERG can be achieved without adding exogenous amino acids. Attached Figure Description

[0238] The invention is further described in the following non-limiting drawings:

[0239] Figure 1: Schematic diagram of the design of the methyl cycle system coupled with the ERG pathway.

[0240] Figure 2: Validation results of the traditional ergot pathway in BL21.

[0241] Figure 3: Optimization results of the combination of the methyl cycle module and the ergot pathway.

[0242] Figure 4: Schematic diagram of the ERG production route by introducing an inorganic sulfur module combined with a methyl cycle system.

[0243] Figure 5: Results of fermentation test for introducing inorganic sulfur after genome integration of methyl cycle and ergot synthesis pathway.

[0244] Figure 6: Effects of different inorganic sulfur sources on fermentation.

[0245] Figure 7: Schematic diagram of histidine enhancement modification.

[0246] Figure 8: Fermentation test results of the above modules and optimized key genes after integration of the histidine pathway.

[0247] Figure 9: Results of global optimization fermentation test.

[0248] Figure 10: Fermentation test results of a 5L fermenter.

[0249] Figure 11: Validation results of the inorganic sulfur pathway.

[0250] Figure 12: The yield of histidine corresponding to different optimization strategies of the histidine production pathway. Examples

[0251] The present application will now be described in the following non-limiting examples.

[0252] Those skilled in the art will appreciate that the examples describe the application in terms of preferred embodiments, and that the application is not intended to be limited to the preferred embodiments. The experimental methods in the examples are conventional unless otherwise specified. The specific conditions in the examples are conventional or as recommended by the manufacturer unless otherwise specified. The reagents or instruments used are conventional products available on the market unless otherwise specified.

[0253] Materials and Methods

[0254] 1. The E. coli BL21 (DE3) and E. coli DH5a involved in the following examples are laboratory preserved, and the different exogenous genes involved in the construction of the pathway are artificially synthesized genes purchased from Jinweizhi Biotechnology Co., Ltd. and Jingke Biotechnology Co., Ltd.

[0255] 2. Culture medium

[0256] LB medium: yeast powder 10 g / L, peptone 5 g / L, sodium chloride 10 g / L,

[0257] Shaking flask fermentation medium: yeast powder 24 g / L, peptone 12 g / L, sodium chloride 5 g / L, K2HPO4 2 g / L, glycerol 30 g / L, histidine betaine 2 g / L, MgSO4 0.3 g / L, 8 mM Na2S2O3.

[0258] 3. Sample post-treatment method

[0259] Take a certain amount of fermentation liquid sample, dilute it by a proper multiple, treat it at 95-100°C for 12-15 minutes, and then centrifuge and filter it.

[0260] 4. Sample detection method

[0261] High performance liquid chromatography (HPLC) detection method: waters, UV detector, NH2 column (250 x 4.6 mm, 5 μm), mobile phase ratio: acetonitrile: water = 8:2, flow rate 1 mL / min, column temperature 35°C, ultraviolet absorption: 254 nm, sample volume 10 μL, detection time: 30 min.

[0262] Example 1

[0263] 1.1 Construction of the ergothioneine synthesis pathway

[0264] The corresponding primers were designed to synthesize the sequence as a template, and EgtD, Egt1 and EgtE were amplified by PCR to obtain a linear vector fragment. Then, the three fragments were fused and amplified by fusion PCR to obtain the ergothioneine synthesis operon EgtD-Egt1-EgtE, which was expressed in series using the T7 promoter. Finally, the amplified fragment was connected to the linear vector by one-step cloning, and transformed into E. coli DH5a competent cells; the transformants were obtained by coating the transformation product on LB solid medium containing 50 μg.mL-1 kanamycin and incubating in a 37°C incubator for 12 h; the transformants were picked for colony PCR verification, and the correct transformants were inoculated into LB liquid medium and incubated overnight before plasmid extraction and sequencing verification. The correct recombinant plasmid pET28a-EgtD-Egt1-EgtE was obtained.

[0265] 1.2 Fermentation test of the synthesis pathway

[0266] The constructed recombinant plasmid pET28a-EgtD-Egt1-EgtE was transformed into wild-type E. coli BL21(DE3) and coated on LB solid medium containing 50 μg.mL-1 kanamycin and incubated in a 37°C incubator for 12 h to obtain the transformants; the transformants were picked and cultured in liquid medium containing kanamycin for 8-12 h, then inoculated into 20 ml / 250 ml shake flasks at a 1% inoculation amount and cultured at 37°C and 200 rpm. When the OD 600 reached 0.6-0.8, 1 mM IPTG was added for induction at 28°C.

[0267] 1.3 Test of the culture scheme

[0268] To determine the ergothioneine synthesis efficiency, different substrates were added to the culture medium for fermentation comparison. The results showed that the ergothioneine yield was relatively low without the addition of methionine, and there was a small but not significant increase after the addition of histidine betaine, proving that the pathway could work normally in E. coli, and methionine was a very critical precursor, as shown in Figure 2.

[0269] Example 2

[0270] In this example, betaine was used as a methyl donor substrate to recycle and regenerate the ergot synthesis pathway for high-yield ERG, as shown in Figure 1.

[0271] 2.1 Construction of the methyl recycling supply system

[0272] The corresponding primers were designed to synthesize the sequence as a template for TnBHMT, SAM2, ADO1, and SAHase by PCR amplification, and the linear fragment of the vector was obtained. The amplified fragment was connected to the linear vector by one-step cloning method, and transformed into E. coli DH5a competent cells. The transformation product was coated on LB solid medium containing 34 μg / mL chloramphenicol and cultured in a 37°C incubator for 12 h. The transformants were selected and subjected to colony PCR verification. The correct transformants were inoculated into LB liquid medium and cultured overnight. The plasmid was extracted and sequenced for verification. The correct verification was obtained as the recombinant plasmid pACYCDuet-TnBHMT, pACYCDuet-SAM2, pACYCDuet-ADO1, and pACYCDuet-SAHase. Then, different fragments were combined and amplified by fusion PCR to obtain an expression vector with different gene combinations.

[0273] 2.2 Methyl cycle system coupled with ergot synthesis pathway fermentation test

[0274] The schematic diagram of the methyl cycle system coupled with the ergot synthesis pathway is shown in FIG. 1. To test the combination effect of the methyl cycle supply system and the ergot synthesis pathway, the recombinant plasmids constructed in Example 1.1 and the methyl donor cycle related plasmids constructed in Example 2.1 were transformed into BL21 in different combinations, coated on LB solid plates containing 34 μg / mL chloramphenicol and 50 μg / mL kanamycin double antibiotic resistance, and cultured overnight. The colonies were picked and subjected to fermentation test. The specific fermentation method is shown in Example 1.2. The results show that the methyl supply system we constructed can effectively provide methyl donors for the production of ergothioneine. The best production strategy is to overexpress each gene in the methyl cycle system to ensure the normal operation of the system. Finally, the yield reached 171 mg / L in 72 hours without adding methionine, as shown in FIG. 3.

[0275] 2.3 Optimization of the combination strategy of the methyl cycle system and the ergot synthesis pathway

[0276] To further improve the supply strategy of the methyl cycle system, we increased the copy number of different genes in the methyl cycle system, combined them, and transformed them into BL21. The colonies were coated on LB solid plates containing 34 μg / mL chloramphenicol and 50 μg / mL kanamycin double antibiotic resistance, and cultured overnight. The colonies were picked and subjected to fermentation test. The ergothioneine pathway was combined and expressed, and the fermentation method is shown in Example 1.2. The results show that when the copy number of TnBHMT gene increases, the promotion effect on ergothioneine production is the most obvious, and the yield can reach 210 mg / L in 48 h.

[0277] Example 3

[0278] The present embodiment designs to introduce EanB gene to realize the conversion of C-H bond to C-S bond by inorganic sulfur in one step, as shown in Figure 4.

[0279] 3.1 Construction of inorganic sulfur pathway

[0280] The corresponding primers were designed to synthesize the sequence of Jinweizhi as a template, and EanB was amplified by PCR to obtain a linear fragment of the vector. Then, the two fragments were fused and amplified by fusion RCR. The amplified fragments and the fused fragments were connected to the linear vector by one-step cloning method, and transformed into E. coli DH5a competent cells. The transformation product was spread on LB solid medium containing 50 μg / mL kanamycin and cultured in a 37℃ constant temperature incubator for 12 h to obtain the transformants. The transformants were picked for colony PCR verification, and the correct transformants were inoculated into LB liquid medium and cultured overnight. The plasmid was extracted and sequenced for verification. The correct verification obtained the recombinant plasmid pET28a-EanB.

[0281] 3.2 Verification of inorganic sulfur pathway

[0282] In wild-type E. coli BL21, the corresponding genes of the inorganic sulfur pathway were transformed, and fermentation test was carried out. The fermentation method is shown in Example 1.2. The results showed that the product could not be detected when EanB was transformed alone, because there was no precursor substance Hercynine in the cell. When EanB and Egt1, EgtD were co-transformed, ERG could be detected, as shown in Figure 11, which proved that EanB could realize S transfer reaction.

[0283] Example 4

[0284] 4.1 Construction of methyl cycle system and ergot synthesis pathway chassis

[0285] In order to combine the inorganic sulfur conversion pathway and the methyl cycle system and the traditional ergothioneine synthesis pathway, we integrated the methyl cycle system operon TnBHMT-SAM2-SAHase-ADO1 and the ergot synthesis pathway operon EgtD-Egt1-EgtE into the E. coli genome using tandem expression technology, T7 promoter, and integration sites BL-2 (N20: tttaaagaaatctgtcttta (SEQ ID NO: 22)) and BL-1 (N20: tgtctgtttgatattccgac (SEQ ID NO: 23)), respectively. The integration method was crispr technology. First, the plasmid containing the pEcCas9 protein was transferred into the strain to be edited in advance, and the Cas9 protein was induced to express. Then, the strain was made competent again, and the plasmid containing the guideRNA and N20 sequence and the integration fragment were transferred into it. The plate was incubated overnight, and the positive clones were verified by sequencing. By optimizing the integration of different copy numbers of module genes and the free expression of the key genes EgtD-Egt1-EanB of the inorganic sulfur pathway, optimization tests were carried out.

[0286] 4.2 Fermentation test of the chassis strain (described in 3.3)

[0287] The fermentation test method of the integrated chassis strain is described in 1.2, but methionine and cysteine do not need to be added in the fermentation medium. Finally, under the condition of exogenous supplementation of inorganic sulfur Na2S2O3, the shake flask fermentation was carried out for 72 h, and the yield reached 450 mg / L (Figure 5).

[0288] 4.3 Influence test of different inorganic sulfur sources

[0289] The induction time and temperature are described in 1.2. During the culture process, different types of inorganic sulfur (Na2S, NaHS, K2S, K2S X , Na2S2O3) were added to a final concentration of 4 mM. The results are shown in Figure 6. Different types of inorganic sulfur promote the improvement of ergothioneine, among which Na2S2O3 is more obvious, and high concentration does not affect cell growth. Therefore, Na2S2O3 is selected as the inorganic sulfur source.

[0290] Example 5 Strengthening the utilization of glycerol pathway

[0291] Primers were designed, and using the Genewiz synthesized sequence as a template, PCR amplification was performed on the glycerol transporter GlpF, glycerol kinase DhaK, and glycerol dehydrogenase gldA to obtain linear fragments. Integration was performed on strain YJ144 using CRISPR technology. First, a plasmid containing the pEcCas9 protein was pre-transformed into the strain to be edited to induce Cas9 protein expression. Then, the strain was made competent again, and a plasmid containing guide RNA and the N20 sequence, along with the integrated fragment, was transformed. The mixture was plated and cultured overnight, and sequencing confirmed positive clones, yielding strain YJ145. This process increases the supply of the precursor PRPP.

[0292] Example 6: Enhancement and Optimization of Histidine Production Pathway

[0293] The strategies for enhancing and optimizing the histidine production pathway are shown in Figure 7.

[0294] Primers were designed, and HisG was amplified by PCR using the Genewiz synthesized sequence as a template. The histidine synthesis operon hissD-hisC-hisB-hisH-hisA-hisF-hisI was amplified using the wild-type *E. coli* BL21 genome as a template to obtain a linear vector fragment. The endogenous *E. coli* HisG (NCBI: NP_416523.1) was replaced with a HisG mutant from *Corynebacterium glutamicum* to relieve histidine feedback inhibition. Using CRISPR technology, the histidine synthesis operon was integrated into the BL-7 site, with the N20 localization sequence (gaaggcgattaaacgccatc (SEQ ID NO: 24)). First, a plasmid containing pEcCas9 protein was pre-transformed into the strain to be edited to induce Cas9 protein expression. Then, the strain was made competent again, and a plasmid containing guide RNA and the N20 sequence, along with the integrated fragment containing the HisG mutant, was transduced. The mixture was plated and cultured overnight, and positive clones were verified by sequencing. Strategies such as relieving feedback inhibition of histidine and increasing the copy number of the histidine synthesis operon were employed to raise the histidine titer to 2 g / L. Subsequently, we further knocked out the endogenous purF gene (NCBI: NP_416815.1), as this pathway not only competes for the metabolic precursor PRPP but also consumes a significant amount of ATP. Since the final two steps of histidine synthesis require the consumption of two NAD+ molecules... + Therefore, we also overexpressed glutamate dehydrogenase RocG to enhance NAD. + The recycling process ultimately yielded a histidine shake-flask fermentation yield of 2.4 g / L (Figure 12).

[0295] Example 7: Optimization of histidine production pathway to construct a high-yield ergothionein chassis.

[0296] To combine module one (methyl cycle system) and module two inorganic sulfur utilization pathway and ergot synthesis pathway with high histidine-producing strain, we integrated methyl donor cycle module TnBHMT-SAM2-SAHase-ADO1, traditional synthesis module EgtD-Egt1-EgtE, inorganic sulfur utilization module EgtD-Egt1-EanB, and histidine synthesis operon hisD-hisC-hisB-hisH-hisA-hisF-hisI module into the genome, respectively, with different copy number combinations for optimization, each module was expressed in parallel with T7 promoter string, and the enhanced glycerol pathway described in Example 5 and the enhanced histidine production pathway described in Example 6 were integrated. The results are shown in Figure 8a. The final yield in shake flask fermentation in the medium without adding any amino acid reached 155 mg / L.

[0297] Example 8 Metabolic pathway optimization to improve ERG yield

[0298] On the basis of the chassis strain described in Example 7, we found the best combination of genes for producing ERG by overexpressing the key genes of the ergot synthesis pathway and the inorganic sulfur utilization pathway again, as shown in the right panel of Figure 8b, which further improved the yield to 382 mg / L.

[0299] Example 9 Global optimization to improve ERG production

[0300] Based on the three-module integration and the optimal phenotype combination found in Example 8, we considered knocking out the endogenous metJ (a SAM-dependent transcriptional regulator, see NCBI: NP_418373.1), which is a key repressor protein for methionine synthesis, and overexpressing the mfsT1 gene from Mycolicibacterium neoaurum, which is a transporter protein for ERG. The fermentation results are shown in Figure 9. The final yield in shake flask fermentation in the medium without adding any amino acid, with glycerol as the sole carbon source and exogenous addition of Na2S2O3, reached 1206 mg / L. As shown in Table 1, compared with traditional microbial fermentation production methods, two or three amino acids need to be added to the medium as precursors for ERG production, while the present application does not need to add any amino acid to achieve or exceed the currently reported production level of ERG.

[0301] Table 1: Comparison of yields of different production strains

[0302] Example 10

[0303] The high-yield chassis described in Example 9 was scaled up in a 5L fermentor. Specifically, the strain described in Example 9 was inoculated into LB medium containing kanamycin and incubated overnight. The inoculum was then inoculated into the fermentor at a 4% inoculum size. The fermentation base medium was: yeast powder 24 g / L, peptone 12 g / L, sodium chloride 5 g / L, K2HPO42 g / L, glycerol 30 g / L, histidine betaine 2 g / L, MgSO42 g / L, 8 mM Na2S2O3, and 0.5 mM IPTG. The temperature was maintained at 30°C until the OD reached 30, at which point the temperature was reduced to 28°C for induction. The final concentration of IPTG was 1 mM, the dissolved oxygen level was controlled at 30%, and the pH was maintained at about 6.8. After a certain period of induction, glycerol was added at a rate of 6 g / L, and Na2S2O3and betaine were added in batches during the process. The fermentation was carried out for 96 hours, and the yield reached 11.5 g (Figure 10). 3, When the OD reached 30, the temperature was reduced to 28°C for induction. The final concentration of IPTG was 1 mM, the dissolved oxygen level was controlled at 30%, and the pH was maintained at about 6.8. After a certain period of induction, glycerol was added at a rate of 6 g / L, and Na2S2O3and betaine were added in batches during the process. The fermentation was carried out for 96 hours, and the yield reached 11.5 g (Figure 10).

[0304] Sequence information

[0305] SEQ ID NO: 1 (TnBHMT)

[0306] SEQ ID NO: 2 (SAM2)

[0307] SEQ ID NO: 3 (SAHase)

[0308] SEQ ID NO: 4 (ADO1)

[0309] SEQ ID NO: 5 (EgtD)

[0310] SEQ ID NO: 6 (Egt1)

[0311] SEQ ID NO: 7 (EgtE)

[0312] SEQ ID NO: 8 (EanB)

[0313] SEQ ID NO: 9 (gldA)

[0314] SEQ ID NO: 10 (glpF)

[0315] SEQ ID NO: 11 (DhaK)

[0316] SEQ ID NO: 12 (rocG)

[0317] SEQ ID NO: 13 (mfsT1)

[0318] SEQ ID NO: 14 (HisG m )

[0319] SEQ ID NO: 15 (hisD)

[0320] SEQ ID NO: 16 (hisC)

[0321] SEQ ID NO: 17 (hisB)

[0322] SEQ ID NO: 18 (hisH)

[0323] SEQ ID NO: 19 (hisA)

[0324] SEQ ID NO: 20 (hisF)

[0325] SEQ ID NO: 21 (hisI)

Claims

1. An engineered microbial cell producing ergothioneine (ERG) comprising: (i) an ergothioneine aerobic biosynthetic pathway, said pathway comprising a substrate to product conversion from histidine to ergothioneine with cysteine as a sulfur source donor; (ii) a methionine cycle with betaine as a methyl donor.

2. The engineered microbial cell of claim 1, wherein, The methionine cycle comprises: betaine homocysteine methyltransferase (BHMT), methionine adenosyltransferase, S-adenosyl-L-homocysteine hydrolase (SAHase), adenosine kinase; Preferably wherein: (a) the BHMT is a TnBHMT of Thioclava nitratireducens origin or a homologue thereof, for example comprising a sequence as set forth in SEQ ID NO: 1 or a sequence having at least 80% identity thereto; (b) the methionine adenosyltransferase is SAM2 of Saccharomyces cerevisiae origin or a homologue thereof, for example comprising a sequence as set forth in SEQ ID NO: 3 or a sequence having at least 80% identity thereto; (c) the SAHase is a SAHase of Corynebacterium efficiens origin or a homologue thereof, for example comprising a sequence as set forth in SEQ ID NO: 4 or a sequence having at least 80% identity thereto; and / or, (d) the adenosine kinase is an exogenous adenosine kinase, for example ADOl of Cryptosporidium parvum origin or a homologue thereof, for example comprising a sequence as set forth in SEQ ID NO: 2 or a sequence having at least 80% identity thereto.

3. The engineered microbial cell of claim 2, comprising exogenous nucleic acid sequences encoding the enzymes of the methionine cycle; Preferably, the exogenous nucleic acid sequences encoding the enzymes of the methionine cycle each independently comprise one or more copies; Preferably, the exogenous nucleic acid sequences encoding the enzymes of the methionine cycle are present in a polycistronic operon; Preferably, the exogenous nucleic acid sequences encoding the enzymes of the methionine cycle are integrated into the chromosome of the cell or are located on a self-replicating plasmid.

4. The engineered microbial cell of any one of claims 1-3, wherein, The engineered microbial cell comprises exogenous nucleic acid sequences encoding TnBHMT (as in SEQ ID NO: 1), SAM2 (as in SEQ ID NO: 3), SAHase (as in SEQ ID NO: 4) and ADOl (as in SEQ ID NO: 2); Preferably, the exogenous nucleic acid sequences are present in a polycistronic operon; Preferably, the polycistronic operon is integrated into the chromosome of the cell or is located on a self-replicating plasmid.

5. The engineered microbial cell of any one of claims 1-4, wherein, The ergothioneine aerobic biosynthetic pathway comprises: an EgtD enzyme, an Egtl enzyme, an EgtE enzyme; Preferably wherein: (a) the EgtD enzyme is derived from Mycobacterium smegmatis or homologues thereof, for example comprising the sequence shown in SEQ ID NO: 6 or a sequence with at least 80% identity thereto; (b) the Egt1 enzyme is derived from Neurospora crassa or homologues thereof, for example comprising the sequence shown in SEQ ID NO: 5 or a sequence with at least 80% identity thereto; and / or, (c) the EgtE enzyme is derived from Mycolicibacterium smegmatis or homologues thereof, for example comprising the sequence shown in SEQ ID NO: 7 or a sequence with at least 80% identity thereto.

6. The engineered microbial cell of claim 5, comprising exogenous nucleic acid sequences encoding enzymes of the ergothioneine aerobic biosynthesis pathway; Preferably, the exogenous nucleic acid sequences encoding enzymes of the ergothioneine aerobic biosynthesis pathway each independently comprise one or more copies; Preferably, the exogenous nucleic acid sequences encoding enzymes of the ergothioneine aerobic biosynthesis pathway are present in a polycistronic operon; Preferably, the exogenous nucleic acid sequences encoding enzymes of the ergothioneine aerobic biosynthesis pathway are integrated into the chromosome of the cell or are located on a self-replicating plasmid.

7. The engineered microbial cell of claim 5 or 6, wherein, the engineered microbial cell comprises exogenous nucleic acid sequences encoding EgtD (as in SEQ ID NO: 6), Egt1 (as in SEQ ID NO: 5), and EgtE (as in SEQ ID NO: 7); Preferably, the exogenous nucleic acid sequences are present in a polycistronic operon; Preferably, the polycistronic operon is integrated into the chromosome of the cell or is located on a self-replicating plasmid.

8. The engineered microbial cell of any one of claims 1-7, further comprising: (iii) an inorganic sulfur utilization pathway, said pathway comprising substrate-to-product conversion from HER to ergothioneine with inorganic sulfur as sulfur source donor; Preferably, the engineered microbial cell comprises an exogenous nucleic acid sequence encoding an EanB enzyme; Preferably, the EanB enzyme is derived from Chlorobium limicola or homologues thereof, for example comprising the sequence shown in SEQ ID NO: 8 or a sequence with at least 80% identity thereto; Preferably, the exogenous nucleic acid sequence is integrated into the chromosome of the cell or is located on a self-replicating plasmid.

9. The engineered microbial cell of claim 8, wherein, the engineered microbial cell comprises a polycistronic operon comprising: exogenous nucleic acid sequences encoding EgtD (as in SEQ ID NO: 6), Egt1 (as in SEQ ID NO: 5), and EanB (as in SEQ ID NO: 8); Preferably, the polycistronic operon is integrated into the chromosome of the cell or is located on a self-replicating plasmid.

10. The engineered microbial cell of any one of claims 1-9, wherein, the engineered microbial cell comprises exogenous nucleic acid sequences encoding: BHMT, methionine adenosyltransferase, SAHase, adenosine kinase, EgtD, Egt1, EgtE, EanB; Preferably, the BHMT, methionine adenosyltransferase, SAHase, adenosine kinase are as defined in claim 2; Preferably, the EgtD, Egt1, EgtE are as defined in claim 5; Preferably, the EanB is as defined in claim 8.

11. The engineered microbial cell of claim 10, wherein, The engineered microbial cell comprises: a first operon comprising exogenous nucleic acid sequences encoding a BHMT (as in SEQ ID NO: 1), a methionine adenosyltransferase (as in SEQ ID NO: 3), a SAHase (as in SEQ ID NO: 4), and an adenosine kinase (as in SEQ ID NO: 2); a second operon comprising exogenous nucleic acid sequences encoding an EgtD (as in SEQ ID NO: 6), an Egt1 (as in SEQ ID NO: 5), and an EgtE (as in SEQ ID NO: 7); a third operon comprising exogenous nucleic acid sequences encoding an EgtD (as in SEQ ID NO: 6), an Egt1 (as in SEQ ID NO: 5), and an EanB (as in SEQ ID NO: 8); Preferably, the operons are each independently integrated into the chromosome of the cell or located on a self-replicating plasmid; Preferably, the first and second operons are integrated into the chromosome of the cell and the third operon is located on a self-replicating plasmid; Preferably, the operons are each independently comprised of one or more copies; preferably, the second operon is comprised of at least two copies.

12. The engineered microbial cell of any one of claims 1-11, further comprising: (iv) an enhanced histidine biosynthesis pathway, said pathway comprising substrate to product conversion from 5-phosphoribosyl-l -pyrophosphate (PRPP) to histidine.

13. The engineered microbial cell of claim 12, comprising increased activity of one or more enzymes selected from the group consisting of histidine biosynthesis enzymes, including hisG, hisD, hisC, hisB, hisH, hisA, hisF, hisl; Preferably, the increased activity is achieved by overexpression of an exogenous nucleic acid sequence encoding the enzyme.

14. The engineered microbial cell of claim 13, comprising an exogenous nucleic acid sequence encoding a hisG mutant, said hisG mutant being capable of relieving feedback inhibition regulation of histidine; preferably, the hisG mutant is derived from C. glutamicum, for example comprising the sequence set forth in SEQ ID NO: 14; Preferably, its endogenous hisG gene or homolog thereof (e.g. ortholog or paralog) is disrupted (e.g. knocked out); Preferably, the exogenous nucleic acid sequence encoding the hisG mutant is comprised of one or more copies; Preferably, the exogenous nucleic acid sequence encoding the hisG mutant is integrated into the chromosome of the cell; Preferably, the exogenous nucleic acid sequence encoding the hisG mutant replaces the endogenous hisG gene.

15. The engineered microbial cell of claim 14, further comprising overexpression of hisD, hisC, hisB, hisH, hisA, hisF, hisl genes; Preferably, the hisD, hisC, hisB, hisH, hisA, hisF, hisl are derived from E. coli or homologs thereof, e.g., comprise the sequences set forth in SEQ ID NOs: 15-21, respectively, or sequences having at least 80% identity thereto; Preferably, the cell comprises exogenous nucleic acid sequences encoding hisD (e.g., SEQ ID NO: 15), hisC (e.g., SEQ ID NO: 16), hisB (e.g., SEQ ID NO: 17), hisH (e.g., SEQ ID NO: 18), hisA (e.g., SEQ ID NO: 19), hisF (e.g., SEQ ID NO: 20), hisl (e.g., SEQ ID NO: 21); Preferably, the exogenous nucleic acid sequences are present in a polycistronic operon; Preferably, the exogenous nucleic acid sequences each independently comprise one or more copies; Preferably, the exogenous nucleic acid sequences each independently are located on a self-replicating plasmid or integrated into the chromosome of the cell.

16. The engineered microbial cell of any one of claims 12-15, wherein the endogenous purF gene or homolog (e.g., ortholog or paralog) thereof is disrupted (e.g., knocked out).

17. The engineered microbial cell of any one of claims 12-16, comprising an enhanced NAD + regeneration pathway; Preferably, the enhanced NAD + The regenerative pathway is achieved by overexpression of glutamate dehydrogenase (RocG); Preferably, the RocG is derived from Bacillus subtilis or homologs thereof, e.g., comprises the sequence set forth in SEQ ID NO: 12 or sequences having at least 80% identity thereto; Preferably, the cell comprises an exogenous nucleic acid sequence encoding RocG, which is located on a self-replicating plasmid or integrated into the chromosome of the cell.

18. The engineered microbial cell of any one of claims 12-17, further comprising an enhanced PRPP biosynthetic pathway; Preferably, the cell comprises increased activities of glycerol transporter GlpF, glycerol kinase DhaK, and glycerol dehydrogenase gldA to enhance conversion from glycerol to PRPP; Preferably, the GlpF, DhaK, gldA are derived from Pseudomonas, Klebsiella, Klebsiella pneumoniae, respectively, or homologs (e.g., orthologs or paralogs) thereof, e.g., comprise the sequences set forth in SEQ ID NOs: 10, 11, 9, respectively, or sequences having at least 80% identity thereto; Preferably, the cell comprises exogenous nucleic acid sequences encoding GlpF (e.g., SEQ ID NO: 10), DhaK (e.g., SEQ ID NO: 11), and gldA (e.g., SEQ ID NO: 9); Preferably, the exogenous nucleic acid sequences are present in a polycistronic operon; Preferably, the polycistronic operon is integrated into the chromosome of the cell or located on a self-replicating plasmid.

19. The engineered microbial cell of any one of claims 12-18, wherein, the engineered microbial cell comprises an exogenous nucleic acid sequence encoding a hisG mutant capable of relieving feedback inhibition regulation of histidine, hisD, hisC, hisB, hisH, hisA, hisF, hisI, RocG, GlpF, DhaK, gldA; and, an endogenous hisG gene and purF gene or homologs (e.g., orthologs or paralogs) thereof are disrupted (e.g., knocked out); Preferably, wherein: the hisG mutant is as defined in claim 14; the hisD, hisC, hisB, hisH, hisA, hisF, hisI are as defined in claim 15; the RocG is as defined in claim 17; and / or, the GlpF, DhaK, gldA are as defined in claim 18; Preferably, the engineered microbial cell comprises: (a) an exogenous nucleic acid sequence comprising a hisG mutant (e.g., SEQ ID NO: 14) capable of relieving feedback inhibition regulation of histidine; (b) an exogenous nucleic acid sequence comprising hisD, hisC, hisB, hisH, hisA, hisF, hisI, the exogenous nucleic acid sequence being present in a multi-cistronic operon; (c) an exogenous nucleic acid sequence comprising a RocG (e.g., SEQ ID NO: 12); (d) an exogenous nucleic acid sequence comprising GlpF (e.g., SEQ ID NO: 10), DhaK (e.g., SEQ ID NO: 11), and gldA (e.g., SEQ ID NO: 9), the exogenous nucleic acid sequence being present in a multi-cistronic operon; (e) an endogenous hisG gene or homologs (e.g., orthologs or paralogs) thereof is disrupted (e.g., knocked out); (f) an endogenous purF gene or homologs (e.g., orthologs or paralogs) thereof is disrupted (e.g., knocked out); Preferably, the exogenous nucleic acid sequences of (a)-(d) are integrated into the chromosome of the cell.

20. The engineered microbial cell of any one of claims 1-19, comprising: a first operon comprising exogenous nucleic acid sequences encoding BHMT (e.g., SEQ ID NO: 1), methionine adenosyltransferase (e.g., SEQ ID NO: 3), SAHase (e.g., SEQ ID NO: 4), and adenosine kinase (e.g., SEQ ID NO: 2); a second operon comprising exogenous nucleic acid sequences of EgtD (e.g., SEQ ID NO: 6), Egtl (e.g., SEQ ID NO: 5), and EgtE (e.g., SEQ ID NO: 7); a third operon comprising an exogenous nucleic acid sequence encoding EanB (e.g., SEQ ID NO: 8); preferably, the third operon further comprises exogenous nucleic acid sequences encoding EgtD (e.g., SEQ ID NO: 6) and Egtl (e.g., SEQ ID NO: 5); a fourth operon comprising an exogenous nucleic acid sequence encoding a hisG mutant (such as SEQ ID NO: 14) capable of relieving feedback inhibition regulation of histidine; a fifth operon comprising an exogenous nucleic acid sequence encoding hisD (such as SEQ ID NO: 15), hisC (such as SEQ ID NO: 16), hisB (such as SEQ ID NO: 17), hisH (such as SEQ ID NO: 18), hisA (such as SEQ ID NO: 19), hisF (such as SEQ ID NO: 20), hisl (such as SEQ ID NO: 21); a sixth operon comprising an exogenous nucleic acid sequence encoding a RocG (such as SEQ ID NO: 12); a seventh operon comprising an exogenous nucleic acid sequence encoding GlpF (such as SEQ ID NO: 10), DhaK (such as SEQ ID NO: 11), and gldA (such as SEQ ID NO: 9); And wherein, the endogenous hisG gene and the endogenous purF gene or homologues (e.g. orthologues or paralogues) thereof are disrupted (e.g. knocked out); preferably, the first to seventh operons are integrated into the chromosome of the cell; preferably, the first to seventh operons each independently comprise one or more copies; preferably, the second, fourth and fifth operons comprise at least two copies.

21. The engineered microbial cell of claim 20, further comprising an additional exogenous nucleic acid sequence encoding EgtD (such as SEQ ID NO: 6), an exogenous nucleic acid sequence encoding Egtl (such as SEQ ID NO: 5), and an exogenous nucleic acid sequence encoding EanB (such as SEQ ID NO: 8); preferably, the additional exogenous nucleic acid sequence is in episomal form on a self-replicating plasmid.

22. The engineered microbial cell of any one of claims 1-21, wherein the endogenous metJ gene or homologues (e.g. orthologues or paralogues) thereof is disrupted (e.g. knocked out).

23. The engineered microbial cell of any one of claims 1-22, which overexpresses an ERG transporter; preferably, the cell comprises an exogenous nucleic acid sequence encoding an ERG transporter; preferably, the ERG transporter is mfsTl of Mycolicibacterium neoaurum origin or a homologue thereof, e.g. comprising the sequence set forth in SEQ ID NO:

13.

24. The engineered microbial cell of claim 20 or 21, wherein the endogenous metJ gene or homologues (e.g. orthologues or paralogues) thereof is disrupted (e.g. knocked out). preferably, the cell further comprises an exogenous nucleic acid sequence encoding mfsTl (such as SEQ ID NO: 13); preferably, the exogenous nucleic acid sequence is on a self-replicating plasmid.

25. The engineered microbial cell of any one of claims 1-24, which is a bacterium.

26. The engineered microbial cell of any one of claims 1-24, which is Escherichia coli.

27. Use of the engineered microbial cell of any one of claims 1-26 in the biosynthesis of ergothioneine (ERG).

28. A method for producing ergothioneine (ERG), comprising culturing the engineered microbial cell of any one of claims 1-26 in a culture medium; Preferably, the culture medium is supplemented with histidinol, glycerol and inorganic sulfur (such as Na2S2O3); Preferably, the culture medium comprises: yeast extract, peptone, sodium chloride, K2HPO4, glycerol, histidinol, MgSO4, Na2S2O3; Preferably, the method further comprises recovering ergothioneine (ERG) from the culture; Preferably, the method does not comprise adding methionine, cysteine and / or histidine to the culture medium.

29. A method for increasing the yield of ergothioneine (ERG), comprising introducing into a microbial cell a genetic modification as defined in any one of claims 1-24; preferably, the microbial cell is a bacterium, such as Escherichia coli.

Citation Information

Patent Citations

  • Ergothioneine production method

    CN112004936A

  • Enzyme, genetically engineered bacterium and method for catalytically producing ergothioneine by using genetically engineered bacterium

    CN115851655A

  • Microbial ergothioneine biosynthesis

    WO2022174177A1