Composition for treating cancer in tumor-affected dogs comprising recombinant canine interleukin-15

Abstract

The objective of the present invention is to treat cancer in affected dogs by using interleukin-15, which plays a pivotal role in both innate immunity and acquired immunity. Specifically, the present invention relates to a composition for treating cancer in mammary tumor- or lymphoma-affected dogs, or an anticancer immune enhancer, comprising recombinant canine interleukin-15. The present invention also relates to the dosage and use of recombinant canine interleukin-15 in the treatment of cancer in mammary tumor- or lymphoma-affected dogs. The present invention can exhibit therapeutically effective anticancer- or anticancer immunity-enhancing efficacy by minimizing harmful effects or side effects after standard treatment in mammary tumor- or lymphoma-affected dogs by using recombinant canine interleukin-15.

Description

A composition for treating cancer in dogs with tumors comprising recombinant canine interleukin-15

[0001] The present invention relates to the treatment of cancer in canines using interleukin-15, which plays a pivotal role in both innate and adaptive immunity. Specifically, the present invention relates to a composition for treating cancer in dogs with mammary tumors or lymphoma, or an anticancer immune enhancer, comprising recombinant canine interleukin-15. The present invention also relates to the dosage and administration method of recombinant canine interleukin-15 for the treatment of cancer in dogs with mammary tumors or lymphoma.

[0002]

[0003] Interleukin-15, a cytokine that plays a crucial role in the development, survival, and activation of NK cells, offers significant advantages in tumor immunotherapy compared to interleukin-2, which enhances NK cell function. It is used as an immunotherapy agent that promotes NK cell antibody activity. Interleukin-15 is less toxic than interleukin-2 and inhibits activation-induced apoptosis, thereby sustaining NK cell survival. Furthermore, unlike interleukin-2, interleukin-15 does not affect regulatory T cells, which have immunosuppressive effects. Based on these beneficial characteristics, interleukin-15 is currently being developed for clinical use as an anticancer treatment for humans.

[0004] With the recent increase in the average lifespan of companion animals, the incidence of various diseases caused by immune system disorders, such as autoimmune and degenerative diseases, as well as malignant diseases like cancer, has been rapidly increasing. These diseases are incurable with existing therapeutic approaches. Consequently, the unmet need for cancer treatment among veterinarians, pet owners, and patients is growing. This has led to active research and development of new drugs for companion animal cancer treatments, starting in developed countries. The outlook for the animal pharmaceutical market is also predicted to continue to grow steadily each year.

[0005] Currently, among Korean animal pharmaceutical manufacturers, there are some that are developing anticancer drugs for companion animals, but they are mainly focusing on the development and commercialization of generic drugs or new antiviral vaccines. In Korea, there are various animal immune boosters on the market, such as feed additives and nutritional supplements, but these immune boosters are relatively weak in efficacy because they induce non-specific immune responses, making it difficult to apply them to the treatment of intractable diseases such as malignant cancer. In addition, there are not many attempts at cytokine-based immunotherapy for canine cancer cells, and most of the cytokines used in research are derived from human genes, and species-specific treatment is not being performed.

[0006] Accordingly, the present inventors intend to develop an immunotherapy targeting companion dogs based on the immunological action of interleukin-15, the safety and efficacy of which have been proven in the field of human cancer immunotherapy.

[0007]

[0008] (Prior art literature)

[0009] (Patent Document)

[0010] (Patent Document 0001) Korean Patent No. 1440915

[0011]

[0012] The present invention aims to provide a composition for treating cancer in dogs suffering from mammary tumors or lymphomas, comprising recombinant canine interleukin-15.

[0013] The present invention aims to provide an anticancer immune enhancer for dogs suffering from mammary tumors or lymphomas, comprising recombinant canine interleukin-15.

[0014] The present invention aims to provide a dosage and method of administering recombinant canine interleukin-15 for the treatment of cancer in dogs suffering from mammary tumors or lymphomas.

[0015] The present invention aims to provide a method for treating cancer in a dog suffering from mammary tumor or lymphoma, comprising administering recombinant canine interleukin-15.

[0016]

[0017] The present invention relates to a composition for treating cancer in dogs suffering from mammary tumors or lymphoma, comprising recombinant canine interleukin-15 comprising the amino acid sequence of SEQ ID NO: 1.

[0018] In one embodiment, the composition for treating cancer may be administered after surgical removal of a tumor.

[0019] In one embodiment, the composition for treating cancer may be administered concurrently, sequentially, or in combination with standard anticancer treatment.

[0020] In one embodiment, the standard chemotherapy may be surgical removal of the tumor or a CHOP protocol, wherein the CHOP protocol may be selected from the group consisting of cyclophosphamide, doxorubicin, vincristine, and prednisone.

[0021] In one embodiment, the composition for treating cancer is administered as a first administration daily for 2 to 6 days, 3 to 6 days, 4 to 6 days, 4 to 5 days, or 4 days, wherein the daily administration may be administered 1 to 5 times daily, 1 to 3 times daily, 1 to 2 times daily, or once daily.

[0022] In one embodiment, the composition for treating cancer may be administered with a washout period of 6 days, 8 days, 10 days, or 12 days following the first administration.

[0023] In one embodiment, the composition for treating cancer is administered daily for 2 to 6 days, 3 to 6 days, 4 to 6 days, 4 to 5 days, or 4 days as a second administration after a washout period of the first administration, wherein the daily administration may be administered once to five times daily, once to three times daily, once to twice daily, or once daily.

[0024] In one embodiment, the composition for treating cancer may be administered once a day for four days as a first administration, followed by a 10-day rest period, and then once a day for four days as a second administration.

[0025] In one embodiment, administration may be oral, duodenal, intrapulmonary, intranasal, intrathecal, intravenous, subcutaneous, intraperitoneal, intramuscular, intraarterial, or topical.

[0026] In one embodiment, the administration is intravenous, and may be administered via a catheter placed within a vein.

[0027] In one embodiment, the recombinant canine interleukin-15 may have an average molecular weight of 10 to 15 kDa.

[0028] In one embodiment, the recombinant canine interleukin-15 may be expressed from the nucleic acid sequence of SEQ ID NO: 4.

[0029] In one embodiment, the recombinant canine interleukin-15 can be vaxleukin-15.

[0030] In one embodiment, the dosage of recombinant canine interleukin-15 can be 0.1 to 50 μg / kg, 10 to 30 μg / kg, 15 to 25 μg / kg, or 20 μg / kg.

[0031] The present invention may relate to an anticancer immune enhancer for dogs suffering from mammary tumors or lymphoma, comprising recombinant canine interleukin-15 comprising the amino acid sequence of SEQ ID NO: 1.

[0032] The present invention may relate to a method for treating cancer in a non-human animal suffering from mammary tumor or lymphoma, comprising administering a recombinant canine interleukin-15 comprising the amino acid sequence of SEQ ID NO: 1.

[0033] In one embodiment, the non-human animal may be a dog.

[0034] In one embodiment, the administration step comprises administering recombinant canine interleukin-15 as a first administration daily for 2 to 6 days, 3 to 6 days, 4 to 6 days, 4 to 5 days, or 4 days, wherein the daily administration may be administered once to five times daily, once to three times daily, once to twice daily, or once daily.

[0035] In one embodiment, the administration step may be administered with a 6-day, 8-day, 10-day or 12-day rest period following the first administration.

[0036] In one embodiment, the administration step is a second administration after a washout period of the first administration, administered daily for 2 to 6 days, 3 to 6 days, 4 to 6 days, 4 to 5 days, or 4 days, and the daily administration may be administered once to five times a day, once to three times a day, once to twice a day, or once a day.

[0037] The present invention relates to a method for mass-producing recombinant canine interleukin-15 useful for treating dogs suffering from mammary tumors or lymphoma, and may relate to a method for mass-producing recombinant canine interleukin-15, comprising (1) a culturing step, (2) a cell lysis step, (3) a purification step, and (4) a protein refolding and formulation step.

[0038] In one embodiment, the method for mass production of recombinant canine interleukin-15 may further comprise a seed lot manufacturing step prior to step (1), wherein the seed lot manufacturing step may comprise at least one of i) a master seed lot manufacturing step and ii) a manufacturing seed lot manufacturing step.

[0039] In one embodiment, the method for mass production of recombinant canine interleukin-15 may further include a (5) titer confirmation step or a (6) concentration and filling step after step (4).

[0040]

[0041] The present invention can exhibit therapeutically effective anticancer or anticancer immune enhancement efficacy while minimizing adverse effects or side effects after standard treatment in dogs suffering from mammary tumors or lymphomas using recombinant canine interleukin-15.

[0042] The present invention exhibits the effect of reducing CRP levels in dogs with tumors, thereby reducing the inflammatory response in the body of dogs with tumors. Furthermore, the present invention does not alter the levels of D-dimer in dogs with tumors, thereby preventing an increase in the malignancy of the tumor or the risk of thrombosis.

[0043] The present invention, when administered to canine patients, exhibits effects that improve guardian satisfaction and the quality of life of the patients, and also improves clinical symptoms of the patients. The present invention inhibits the expression of VEGF in canine patients, thereby inhibiting tumor proliferation and exhibiting anticancer effects. The present invention increases the secretion of IFN-γ in canine patients, thereby inhibiting tumor proliferation and exhibiting anticancer effects. The present invention exhibits safety when administered to canine patients, while exhibiting the beneficial anticancer or anticancer immune-enhancing effects.

[0044] The present invention demonstrates an effect of reducing the size of lymph nodes in canine lymphoma patients. The present invention demonstrates an effect of improving the clinical symptoms of canine lymphoma patients. The present invention demonstrates an effect of improving the satisfaction of guardians and the quality of life of canine lymphoma patients when administered to them. The present invention demonstrates an effect of reducing TK-1 concentration, increasing IFN-γ secretion, reducing serum LDH concentration, reducing serum B2M concentration, and reducing CRP levels in canine lymphoma patients, thereby demonstrating an anticancer or anticancer immune enhancement effect.

[0045] The present invention does not alter the D-dimer level in canine lymphoma patients, and thus does not increase the malignancy or thrombotic risk of the tumor. The present invention exhibits safety when administered to canine lymphoma patients, while also exhibiting beneficial anticancer or anticancer immune-enhancing effects.

[0046]

[0047] Figure 1 is a graph showing the change in CRP and D-dimer levels in the breast cancer test group and the control group.

[0048] Figure 2 is a graph showing the change in VEGF concentration in mammary tumor patients administered with recombinant canine interleukin-15. * in the graph indicates the significance of the comparison between groups (test group / control group), # indicates the comparison between week 0 and each period within each group, distinguishing the control group (blue) and the test group (red), and #,*; P<0.05, ##, **; P<0.01, ###, ***; P<0.001 indicates significance.

[0049] Figure 3 is a graph showing the change in IFN-γ concentration in mammary tumor patients administered recombinant canine interleukin-15. * in the graph indicates the significance of the comparison between groups (test group / control group), # indicates the comparison between week 0 and each period within each group, distinguishing the control group (blue) and the test group (red), and #,*; P<0.05, ##, **; P<0.01, ###, ***; P<0.001 indicates significance.

[0050] Figure 4 is a graph showing changes in TK-1 concentration in lymphoma patients administered recombinant canine interleukin-15. # in the graph indicates Week N / Week 0 (comparison of each period to Week 0 within each group), * indicates test group / control group (comparison between groups), and significance was indicated as #,*; P<0.05, ##, **; P<0.01, ###, ***; P<0.001, #####, ****; P<0.0001 for comparison by period and group.

[0051] Figure 5 is a graph showing changes in IFN-γ concentration in lymphoma patients administered recombinant canine interleukin-15. * in the graph indicates test group / control group (comparison between groups), and significance was indicated as *; P<0.05 for comparison between the corresponding period and groups.

[0052] Figure 6 is a graph showing changes in LDH concentration in lymphoma patients administered recombinant canine interleukin-15. * in the graph indicates test group / control group (inter-group comparison), and **; P<0.01 indicates significance as a comparison between the corresponding periods and groups.

[0053] Figure 7 is a graph showing changes in B2M concentration in lymphoma patients treated with recombinant canine interleukin-15. * in the graph indicates the test group / control group (intergroup comparison), and *; P<0.05 indicates significance as a comparison between the corresponding periods and groups.

[0054] Figure 8 is a graph showing the change patterns in CRP and D-dimer levels in the lymphoma test group and the control group.

[0055]

[0056] Hereinafter, with reference to the attached drawings, embodiments and examples of the present invention will be described in detail so that those skilled in the art can easily implement the present invention. However, the present invention may be implemented in various forms and is not limited to the embodiments and examples described herein.

[0057] Throughout this specification, whenever a part is said to "include" a component, this means that it may include other components, but not to the exclusion of other components, unless otherwise stated.

[0058] The term "prevention" as used herein means any action that inhibits or delays the onset of a disease by administering a composition, and "treatment" means any action that improves or beneficially changes the symptoms of a subject suspected of or suffering from a disease by administering a composition.

[0059] The terms "about" and "approximately" generally refer to an acceptable margin of error for the quantity being measured, depending on the nature or precision of the measurement. For example, the margin of error is within 20% of a given value or range of values, preferably within 10%, more preferably within 5%. Alternatively, and particularly in biological systems, the terms "about" and "approximately" may refer to an average value that is within a factor of 10, preferably within a factor of 10 or 5, more preferably within a factor of 2. The numerical quantities given herein are approximate unless otherwise stated, and unless explicitly stated, the terms "about" or "approximately" mean that they can be estimated.

[0060] In the present invention, a mammary tumor patient may refer to an individual diagnosed with a mammary tumor (benign or malignant) through cytological or histological examination. This may refer to an individual without any underlying disease other than the tumor diagnosis. However, it may also include individuals with underlying diseases that do not significantly impact anticancer evaluation or have little relevance.

[0061] In the present invention, a lymphoma patient may refer to an individual diagnosed with lymphoma through cytological or histological examination. This may refer to an individual without any underlying disease other than the tumor diagnosis. However, it may also include individuals with underlying diseases that do not significantly impact anticancer evaluation or have little relevance.

[0062] The present invention provides a composition for treating cancer in a dog with a mammary tumor or lymphoma, comprising recombinant canine interleukin-15. The present invention provides a method for treating cancer in a dog with a mammary tumor or lymphoma, comprising administering recombinant canine interleukin-15 to the dog. The present invention provides recombinant canine interleukin-15 for use in treating cancer in a dog with a mammary tumor or lymphoma. The present invention provides the use of recombinant canine interleukin-15 in the manufacture of a medicament for treating cancer in a dog with a mammary tumor or lymphoma. The contents of the cancer treatment composition specifically described in the present invention can be similarly applied to methods for treating cancer, recombinant canine interleukin-15 for use in treating cancer, and uses of recombinant canine interleukin-15 for use in treating cancer.

[0063] The present invention provides an anticancer immune enhancer for dogs suffering from mammary tumors or lymphomas, comprising recombinant canine interleukin-15. The present invention provides a method for enhancing anticancer immunity in dogs suffering from mammary tumors or lymphomas, comprising administering recombinant canine interleukin-15 to the dog. The present invention provides recombinant canine interleukin-15 for use in enhancing anticancer immunity in dogs suffering from mammary tumors or lymphomas. The present invention provides the use of recombinant canine interleukin-15 in the manufacture of an anticancer immune enhancer for dogs suffering from mammary tumors or lymphomas. The teachings regarding the composition for treating cancer specifically described in the present invention can be similarly applied to anticancer immune enhancers, methods for enhancing anticancer immunity, recombinant canine interleukin-15 for use in enhancing anticancer immunity, and uses of recombinant canine interleukin-15.

[0064] In one embodiment, the recombinant canine interleukin-15 can comprise amino acid residues from amino acid position 49 to amino acid position 162 of canine interleukin-15. In one embodiment, the recombinant canine interleukin-15 can have an average molecular weight of 10 to 15 kDa.

[0065] In one embodiment, the recombinant canine interleukin-15 may be a recombinant protein expressed and purified in a host E. coli BL21DE3 using a pET30a(+) vector. In one embodiment, the expression vector for producing the recombinant canine interleukin-15 may be a transformation vector produced using a primer set for in vitro amplification of canine interleukin-15 according to the method described in Korean Patent No. 1440915.

[0066] In one embodiment, the recombinant canine interleukin-15 may comprise the amino acid sequence of SEQ ID NO: 1.

[0067] Amino acid sequence of SEQ ID NO: 1: NWQDVILDLEKIDNLIQSIHM DTTLYTESDVHPSCKVTAMKC FLLELGVISLESGSHPIKEAV ENLIILANSDLSSKGNITETG CKECEELEEKSIKEF LQ SFVHIVQMFINSS

[0068] In one embodiment, the recombinant canine interleukin-15 may comprise the amino acid sequence of SEQ ID NO: 2.

[0069] Amino acid sequence of SEQ ID NO: 2: MRISKPHLRSTSIQCYLCLLL ​​NSHFLTEAGIHVFILGCISAG LPKTEANWQDVILDLEKIDNL IQSIHMDTTLYTESDVHPSCK VTAMKCFLLELGVISLESGSH PIKEAVENLIILANSDLSSKG NITETGCKECEELEEKSIKEF LQSFVHIVQMFINSS

[0070] In one embodiment, the recombinant canine interleukin-15 may be a recombinant canine interleukin-15 expressed from a nucleic acid sequence having the following SEQ ID NO: 3.

[0071] 서열번호 3의 핵산 서열: agaaacgttc gtgttgaaaa gccgagcggc ttccgttcca ggagacgcac ccccagagcc cgtgagagcc ccctcgcgtg ctgcgtggcc gccttggctg tgaccgtgac ccgaagccac ccgaagcctg tcactgcagc cgcggcctgg acaaaggaag tattctggat ggatggctgc tggaaaccca ttgccatagc cagctcttct tcaatactta aggatttacc ctgcattgag taatgagaat ttcgaaacca catttgagaa gtacttccat ccagtgctac ttgtgtttac ttctgaacag tcattttcta actgaggctg gcattcatgt cttcattttg ggctgtatca gcgcaggtct tcccaaaaca gaggcaaatt ggcaggacgt gatacttgat ttggaaaaaa ttgacaatct tattcaatct atacatatgg ataccactct gtatactgaa agtgatgtgc atcccagttg caaagtaacc gcgatgaagt gctttctcct ggagttaggt gttatctcgc tcgagtccgg cagtcatccc attaaggaag cagtagagaa cctcatcatc ctcgcaaaca gtgatctgtc ttcgaagggg aatataactg aaacgggatg caaagaatgt gaagaactgg aggaaaagag tattaaggag tttttgcaga gtttcgtgca tatcgtacaa atgttcatca actcctcttg atggcaaagg atctgcttcg gcatttctgc gattaaccag cgtcttccca cggctcgaag gccgtgaaac cctctgcagg tcgttcgggc cgcctgaacg aatttttcta acgagaagat gatccggaat ctcgggtcgg atgaactctt agaaactgaaggcagaaaaa tggcatcgag ggacgtgtcc gtgaactgtc ctcgtgctga ttttgttcat ttattcttaa tttattaccg acgttgtaca tatctgtagc atactataga gcattgaata aaatcgtgta

[0072] In one embodiment, the recombinant canine interleukin-15 may be recombinant canine interleukin-15 expressed from a vector comprising the nucleic acid sequence of SEQ ID NO: 4.

[0073] Nucleic acid sequence of SEQ ID NO: 4: aat tgg cag gac gtg ata ctt gat ttg gaa aaa att gac aat ctt att caa tct ata cat atg gat acc act ctg tat act gaa agt gat gtg cat ccc agt tgc aaa gta acc gcg atg aag tgc ttt ctc ctg gag tta ggt gtt atc tcg ctc gag tcc ggc agt cat ccc att aag gaa gca gta gag aac ctc atc atc ctc gca aac agt gat ctg tct tcg aag ggg aat ata act gaa acg gga tgc aaa gaa tgt gaa gaa ctg gag gaa aag agt att aag gag ttt ttg cag agt ttc gtg cat atc gta caa atg ttc atc aac tcc tct

[0074] In one embodiment, recombinant canine interleukin-15, or a cancer treatment composition or anticancer immune enhancer comprising the same, may be administered to a dog following surgical removal of a tumor. In one embodiment, surgical removal of the tumor may include bilateral or unilateral mammary gland excision in the dog. This administration may be performed 18 hours, 20 hours, 22 hours, 24 hours, 26 hours, 28 hours, or 30 hours after surgical removal of the tumor.

[0075] In one embodiment, the recombinant canine interleukin-15, or a cancer treatment composition or anticancer immune enhancer comprising the same, may be administered simultaneously, sequentially, or in combination with standard anticancer treatment. In one embodiment, the standard anticancer treatment may be, but is not limited to, surgical removal of the tumor or the CHOP protocol. In one embodiment, sequential administration may mean administration before or after the standard anticancer treatment. In one embodiment, the CHOP protocol may be selected from the group consisting of cyclophosphamide, doxorubicin, vincristine, and prednisone.

[0076] In one embodiment, the recombinant canine interleukin-15, or the cancer treatment composition or anticancer immunostimulant comprising the same, may be administered daily for 2 to 6 days, 3 to 6 days, 4 to 6 days, 4 to 5 days, or 4 days as a first administration. In one embodiment, the recombinant canine interleukin-15, or the cancer treatment composition or anticancer immunostimulant comprising the same, may be administered with a washout period of 6 days, 8 days, 10 days, or 12 days after the first administration. In one embodiment, the recombinant canine interleukin-15, or the cancer treatment composition or anticancer immunostimulant comprising the same, may be administered daily for 2 to 6 days, 3 to 6 days, 4 to 6 days, 4 to 5 days, or 4 days as a second administration after a washout period of the first administration. In one embodiment, the above daily administration may be administered 1 to 5 times a day, 1 to 3 times a day, 1 to 2 times a day, or once a day. In one embodiment, the recombinant canine interleukin-15, or a cancer treatment composition or anticancer immune enhancer comprising the same, may be administered once a day for 4 days as the first administration, followed by a 10-day rest period, and then once a day for 4 days as the second administration.

[0077] In one embodiment, administration may be oral, duodenal, intrapulmonary, intranasal, intrathecal, intravenous, subcutaneous, intraperitoneal, intramuscular, intraarterial, or topical, but is not limited thereto. In one embodiment, if administration is intravenous, it may be administered via a catheter inserted into a vein.

[0078] The recombinant canine interleukin-15 according to the present invention can be administered in a dosage sufficient to treat, prevent, or alleviate cancer, or a dosage sufficient to enhance anti-cancer immunity, which may vary from dog to dog depending on factors such as the age, sex, weight, health, degree of disease, and route of administration of the dog. In one embodiment, the dosage of canine interleukin-15 may be administered once or several times daily in an amount of about 0.1 to about 50 μg / kg, about 10 to about 30 μg / kg, about 15 to about 25 μg / kg, or about 20 μg / kg, but is not limited thereto. For example, the dose of canine interleukin-15 is about 0.1 μg / kg or more, about 0.5 μg / kg or more, about 1 μg / kg or more, about 5 μg / kg or more, about 10 μg / kg or more, about 15 μg / kg or more, about 20 μg / kg or more, about 25 μg / kg or more, about 30 μg / kg or more, about 35 μg / kg or more, about 40 μg / kg or more, about 45 μg / kg or more, or about 50 μg / kg or less, about 50 μg / kg or less, about 45 μg / kg or less, about 40 μg / kg or less, about 35 μg / kg or less, about 30 μg / kg or less, about 25 μg / kg or less, about 20 μg / kg or less, about 15 μg / kg or less, about 10 μg / kg or less, or about 5 μg / kg. Below, it may be about 1 ㎍ / kg or less, about 0.5 ㎍ / kg or less, or about 0.1 ㎍ / kg or less.

[0079] In one embodiment, the composition for treating cancer or the anticancer immune enhancer comprising recombinant canine interleukin-15 according to the present invention may be formulated and used in the form of oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, or aerosols, topical preparations, suppositories, or sterile injectable solutions, each according to a method easily applicable to those skilled in the art.

[0080] In one embodiment, the formulation may use diluents or excipients such as, but not limited to, commonly available fillers, bulking agents, binders, wetting agents, disintegrants, carriers, and surfactants.

[0081] The present invention may relate to a method of treating cancer in a non-human animal suffering from mammary tumor or lymphoma, comprising administering recombinant canine interleukin-15.

[0082] In one embodiment, the non-human animal may be a pig, cow, horse, dog, cat, or bird, and may be specifically a dog.

[0083] The present invention relates to a method for mass producing recombinant canine interleukin-15 useful for the treatment of dogs suffering from mammary tumors or lymphomas.

[0084] In one embodiment, the mass production method may comprise (1) a culture step, (2) a cell lysis step, (3) a purification step, and (4) a protein refolding and formulation step.

[0085] In one embodiment, the mass production method may further comprise a seed lot manufacturing step prior to step (1). In one embodiment, the seed lot manufacturing step may comprise one or more of i) a master seed lot manufacturing step and ii) a manufacturing seed lot manufacturing step. In one embodiment, the seed lot may be produced by transforming a recombinant canine interleukin-15 expression vector.

[0086] In one embodiment, (1) the culturing step may include i) a seed culturing step and ii) a main culturing step. The seed culturing step may include diluting a seed lot obtained from the seed lot preparation step. The main culturing step may include adding isopropyl β-D-1-thiogalactopyranoside to the seed line and culturing it.

[0087] In one embodiment, (2) the cell lysis step may include i) cell recovery, ii) cell lysis and disruption step, and iii) inclusion body supernatant recovery step. In one embodiment, i) cell recovery step may include separating cultured cells into cells and cell supernatant using a centrifuge, recovering the cells, and then adding a buffer to the recovered cells to prepare a suspension. In one embodiment, ii) cell lysis and disruption step may include disrupting the suspension containing the cells using an ultrasonic cell disruptor, centrifuging the suspension to recover the cells, and then washing the suspension using a buffer. In one embodiment, the buffer washing step may include one or more steps of adding a urea buffer having a different concentration to the cells, stirring the mixture, and centrifuging the mixture to recover the cells. Here, the concentration of the urea buffer may be 2M, 4M, 6M, 7M, or 9M. In one embodiment, the step of iii) recovering the inclusion body supernatant may include diluting the recovered cells after washing and then filtering them to recover the inclusion body supernatant.

[0088] In one embodiment, (3) the purification step comprises i) Ni 2+ -NTA charging and adsorption step, and ii) protein recovery step. In one embodiment, i) Ni 2+ -NTA packing and adsorption step is Ni in the column 2+ -After filling the NTA, the supernatant of the inclusion body may be passed through the column for adsorption. In one embodiment, ii) the protein recovery step may include adding a buffer to the column to extract the protein, wherein the buffer may be at least one of a wash buffer and an elution buffer.

[0089] In one embodiment, (4) the protein refolding and formulation step may comprise: i) flowing a first buffer having a volume 10 times greater than that of the liquid chromatography-purified protein and stirring for 16 hours, ii) flowing a second buffer having a volume 10 times greater than that of the liquid chromatography-purified protein and stirring for 16 hours, and iii) stirring using a final buffer for 3 hours. Wherein the first buffer may comprise 4 M urea, 0.3 mM GSH, 0.05 mM GSSG, and 1× PBS, and the second buffer may comprise 1 M urea, 0.3 mM GSH, 0.05 mM GSSG, and 1× PBS. The final buffer may comprise 1% glycerol and 1× PBS.

[0090] In one embodiment, the mass production method may further include a step (5) of titer confirmation after step (4). In one embodiment, the step (5) of titer confirmation may include confirming the concentration of the protein after the formulation is completed. Here, the concentration of the protein may be confirmed according to the Bradford method, and the titer standard may be 1*10^6±10 % IU / mg.

[0091] In one embodiment, the mass production method may further include a (6) concentration and filling step after step (5). In one embodiment, the (6) concentration and filling step may include filtering the recombinant canine interleukin-15 through a filter, checking the protein concentration, and filling the recombinant canine interleukin-15 into a vial after checking the concentration. In one embodiment, the protein concentration may be checked according to the Bradford method. The recombinant canine interleukin-15 may be diluted with an injection agent to be 100 μg / ml per vial and filled. The filled vial may be stored under refrigerated conditions.

[0092] The present invention will be described in more detail through the following test examples; however, the following examples are for illustrative purposes only and are not intended to limit the scope of the present invention.

[0093]

[0094] [Example 1]

[0095] Mass production of recombinant canine interleukin-15

[0096]

[0097] 1. Production of recombinant canine interleukin-15 expression vector

[0098] In this example, the expression vector of recombinant canine interleukin-15 was prepared by amplifying the 486 base pair coding sequence (Open Reading Frame, ORF) of the canine interleukin-15 mRNA base sequence (Genabank accession number, NM_001197188.1) and cloning the 342 base pair encoding the final mature protein (Mature Polypeptide) from which the secretion signal sequence (Signal Peptide) was removed. Specifically, the transformation vector was prepared using a primer set for in vitro amplification of canine interleukin-15 according to the method described in Korean Patent No. 1440915, and the cloned expression vector pET30a(+) was transformed into the protein expression strain E. coli BL21(DE3) to produce the canine recombinant protein interleukin-15. The nucleic acid sequence finally inserted into the canine interleukin-15 expression vector is as shown in SEQ ID NO: 4.

[0099]

[0100] 2. Manufacturing of Master Seed Lot

[0101] The interleukin-15 production plasmid, pET30a(+)::cIL-15, manufactured according to the above step 1. was transformed into E. coli BL21 (DE3) to produce a production seed. The interleukin-15 production seed was inoculated into 50 ml of LB (Luria Bertani) liquid medium supplemented with kanamycin, and then cultured at 37°C and 200 rpm for 16 hours to obtain a master seed lot. The produced seed line was recovered by centrifugation at 2500xg for 15 minutes at 4°C, suspended in seed line storage medium (5 ml LB liquid medium + 30% glycerol), dispensed into vials of 250 μl each, and stored in an ultra-low temperature freezer at -80°C.

[0102] Passage management: When the passage number of the strain reached a certain level during the cultivation process, cultivation was started using a new seed strain.

[0103] Mutation monitoring: The presence and structure of the plasmid were confirmed by PCR and sequencing.

[0104]

[0105] 3. Manufacturing of working seed lots

[0106] One vial of the master seed lot was inoculated into 100 ml of LB liquid medium supplemented with kanamycin, and then cultured at 37°C and 200 rpm for 16 hours to obtain a manufacturing seed lot. The produced seed line was recovered by centrifugation under the conditions of 2500xg, 15 minutes, and 4°C. LB liquid medium supplemented with 30% glycerol was suspended in the centrifuged seed line, dispensed into vials, and stored in an ultra-low temperature freezer at -80°C.

[0107]

[0108] 4. Seed cultivation

[0109] One vial of the stored manufacturing seed lot was diluted with LB liquid medium, spread on LB plate medium containing kanamycin, and cultured at 37°C for 16 hours. One colony cultured on the LB plate medium was collected and inoculated into 80 ml of LB liquid medium containing kanamycin, and cultured at 37°C and 200 rpm for 16 hours to obtain a culture solution with an OD600 of 2.0 or higher, which was used in the following steps.

[0110]

[0111] 5. Main cultivation

[0112] The seed line cultured in the original container was inoculated into 4 L of LB liquid medium supplemented with kanamycin and cultured with shaking under the conditions of aeration rate of 0.5 vvm, 300 rpm, 37 ± 1 ℃, and pH 7 until the OD600 reached 1.8 or higher. When the OD600 reached 1.8 or higher, the temperature of the culture medium was adjusted to 25 ± 1 ℃, and isopropyl β-D-1-thiogalactopyranoside (IPTG) was added and cultured with shaking for 16 hours.

[0113]

[0114] 6. Recovery of fungi

[0115] The cultured pellets were frozen and stored at -20°C, then washed with phosphate-buffered saline (PBS) and centrifuged. After the pellets were separated into cells and supernatant, the supernatant was discarded and the recovered cells were dissolved in 20 mL of phosphate-buffered saline (PBS) per g to prevent clumping, thereby preparing a suspension.

[0116]

[0117] 7. Lysis of mycelia and recovery of inclusion body supernatant

[0118] After disrupting the suspension using an ultrasonic cell disruptor, the cells were collected by centrifugation. The cells were stirred for 18 hours with 2 M urea (2 M urea, 10 mM DTT, 2% Tween 20, 1X PBS), centrifuged, the supernatant was discarded, and the cells were collected. The collected cells were added to 4 M urea (4 M urea, 10 mM DTT, 2% Tween 20, 1X PBS), stirred for 6 hours, centrifuged, the supernatant was discarded, and the cells were collected. The collected cells were added to 6 M urea (6 M urea, 10 mM DTT, 2% Tween 20, 1X PBS), stirred for 10 minutes, centrifuged, the supernatant was discarded, and the cells were collected. The recovered cells were mixed with 7M urea (7M urea, 10mM DTT, 2% Tween20, 1X PBS) and stirred for 10 minutes, centrifuged, and the supernatant was discarded to recover the cells. The recovered cells were mixed with 9M urea (9M urea, 10mM DTT, 2% Tween20, 1X PBS) and stirred for 48 hours. The dissolved sample was diluted with PBS to convert it to 8M and then filtered through a sterile filter. After filtration, the inclusion body supernatant was obtained and stored in a refrigerator at 4℃ until the purification step.

[0119]

[0120] 8. Refining

[0121] Ni 2+ -100 mL of NTA agarose resin was loaded into the column and mounted on FPLC (Fast Protein Liquid Chromatography). CIP buffer (0.5 M NaOH) was flowed through lines A and B. Ni 2+- 300 mL of buffer A (8 M urea, 0.01 M imidazole, 2% Tween, 1X PBS) was passed through a column filled with NTA agarose at a flow rate of 3 mL / min to equilibrate the column. The supernatant obtained in step 7 above was passed through the column at a flow rate of 1 mL / min to be absorbed. Sample loading volume: 300 mL After absorption, 500 mL of buffer A (8 M urea, 0.01 M imidazole, 2% Tween, 1X PBS) was passed through at a flow rate of 3 mL / min. 300 mL of buffer B (8 M urea, 1 M imidazole, 2% Tween, 1X PBS) was passed through linearly at a flow rate of 3 mL / min to recover the peak area of ​​the OD 280 value.

[0122]

[0123] 9. Protein Refolding and Formulation

[0124] Buffer 1 (4 M urea, 0.3 mM GSH, 0.05 mM GSSG, 1X PBS), which is 10 times the amount of protein purified by liquid chromatography, was flowed and stirred for 16 hours. Afterwards, buffer 2 (1 M urea, 0.3 mM GSH, 0.05 mM GSSG, 1X PBS), which is 10 times the amount of protein purified by liquid chromatography, was flowed and stirred for 16 hours. After that, the final buffer (1% glycerol, 1X PBS) was used and stirred for 3 hours.

[0125]

[0126] 10. Check the station

[0127] The concentration of the formulated protein was confirmed according to the Bradford method. The efficacy and potency standard is 1*10^6±10% IU / mg. If it is above the standard, the injection was diluted and filled to 100 ug / ㎖ per vial. If it meets the standard, it was concentrated and filled to 100 ug / ㎖ per vial. If it is below the standard, it is discarded.

[0128]

[0129] 11. Concentration and vial filling

[0130] Recombinant canine interleukin-15 meeting the efficacy and effectiveness criteria was filtered through a 50-mL tube Buckham sterile filter (Corning, 0.22 μm), and the filtered protein was concentrated using Bradford solution. After concentration confirmation, it was diluted with an injection solution to 100 μg / mL per vial, dispensed, and stored under refrigerated conditions (2–8°C) for up to 12 months.

[0131]

[0132] [Example 2]

[0133] Method of administering recombinant canine interleukin-15

[0134]

[0135] The present invention was administered at a concentration of 20 ug per 1 kg of dog body weight (1 vial contains 100 ug / ml of recombinant canine interleukin-15 prepared according to Example 1 above). As a specific example, in order to use a concentration of 100 ug (5 kg of dog body weight X 20 ug of recombinant canine interleukin-15 administration concentration = 100 ug) for a 5 kg dog patient, 1 ml of the present invention was taken, diluted in 10 ml of sterile saline, and a total administration volume of 11 ml was slowly (within 10 minutes) intravenously injected through a catheter installed intravenously.

[0136] The dosing interval is once daily for 4 days, followed by a 10-day break, and then once daily for 4 days. For example, when the patient visited the hospital on January 1, recombinant canine interleukin-15 was administered daily on January 1, January 2, January 3, and January 4, followed by a 10-day break from January 5 to January 14, and then once daily for 4 days on January 15, January 16, January 17, and January 18, and then administration of recombinant canine interleukin-15 was terminated.

[0137] According to this administration method, recombinant canine interleukin-15 was administered to dogs in Examples 3 and 4 below. In Example 3 below, dogs with mammary tumors were selected from individuals diagnosed with mammary tumors (benign and malignant) through cytological or histological examination. If possible, individuals without any underlying diseases that may significantly affect the evaluation of this study other than the tumor diagnosis were selected. However, cases with underlying diseases that did not significantly affect the evaluation of this anticancer treatment or had little relevance were included.

[0138] In Example 4 below, lymphoma patients were selected from individuals diagnosed with lymphoma through cytological or histological examination. Subjects were selected without any underlying diseases that could significantly impact the results of this study, other than the tumor diagnosis. However, subjects with underlying diseases that did not significantly impact the results of this anticancer evaluation or had only a minor correlation were included.

[0139]

[0140] [Example 3]

[0141] Safety and efficacy evaluation of intravenous injection of recombinant canine interleukin-15 in dogs with mammary tumors

[0142]

[0143] Example 3-1. Evaluation schedule and evaluation items

[0144] After surgical removal of the mammary tumor in the enrolled dogs of this trial, recombinant canine interleukin-15 was administered to the enrolled dogs according to the method of Example 1 above, and the response to this was evaluated for a total of 3 months. The trial plan was carried out according to the clinical trial schedule below (Table 1), and if more frequent examinations were necessary at the investigator's discretion, additional evaluations were possible for each dog. The efficacy evaluation variables before and after administration of recombinant canine interleukin-15 to the enrolled dogs and between the test group and the control group were analyzed, and the therapeutic effect was confirmed through clinical observation (○ in Table 1 indicates confirmed items, △ indicates partially confirmed (unconfirmed) items).

[0145] [Table 1] Exam Schedule

[0146]

[0147]

[0148] 1 BW (body weight) represents body weight, BCS (body condition score) represents body condition index, BP (blood pressure) represents blood pressure, and TPR (temperature, pulse, and respiratory rate) represents body temperature, pulse, and respiratory rate.

[0149] 2 CRP (C-reactive protein) indicates acute inflammation, and D-dimer indicates thrombosis.

[0150]

[0151] Example 3-2. Comparison of primary efficacy evaluation variables between the mammary tumor test group and the control group.

[0152] Changes in CRP and D-dimer levels in 27 mice in the tumor test group and 28 mice in the control group were assessed on each assessment date during the trial period (Fig. 1). CRP and D-dimer levels are efficacy evaluation variables for assessing tumor-induced inflammatory changes and thrombotic risk factors.

[0153]

[0154] <CRP 수치 평가>

[0155] CRP levels are a marker for assessing acute inflammation. Tumors can induce inflammatory changes within the body, either internally or through changes in the immune system. Therefore, assessing CRP levels provides information about the inflammatory state of tumor patients, enabling assessment of their overall condition and treatment response. The normal range for CRP levels in dogs is 20 mg / L or less, and levels above 30 mg / L are considered abnormal.

[0156] The mean CRP level at week 0 before the start of the trial was 28.35±53.97 mg / L in the trial group and 11.31±10.33 mg / L in the control group, confirming that the mean CRP value was elevated above normal in the trial group. There was no statistically significant difference observed between the CRP levels at week 0 before the trial between the trial and control groups (P=0.097). In the trial group, the CRP level decreased within the normal range at the second week after the start of the trial and remained within the normal range until week 12, the end of the trial. The CRP level of the control group remained within the normal range throughout the trial period. No significant difference was observed in the CRP levels between the trial and control groups at weeks 2, 4, 8, and 12, respectively.

[0157] To evaluate the effects of recombinant canine interleukin-15 administration on CRP levels in the experimental and control groups during the experimental period, the statistical significance of CRP levels at week 0 (pre-treatment) and week 12 (the end of the trial) was assessed. Results showed a significant difference in CRP levels in the experimental group before and after treatment (P=0.012), while no significant difference was observed in the control group (P=0.147).

[0158]

[0159] <D-이합체 평가>

[0160] D-dimer levels are an indicator of blood coagulation and lysis. Because thrombosis and changes in blood clotting tendencies occur in cancer patients, D-dimer is used as an indicator of tumor malignancy and is utilized to assess a patient's overall condition, treatment response, and prognosis. The normal range for D-dimer levels in dogs is 0.3 ug / mL or less, and levels above 0.3 ug / mL are considered abnormal.

[0161] When examining the change pattern of D-dimer, the mean value of D-dimer in the test group at 0 weeks before administration of recombinant canine interleukin-15 was 0.29±0.51 ug / mL, and the mean value of D-dimer in the control group was 0.14±0.18 ug / mL. There was no significant difference in the D-dimer level between the test group and the control group before administration of recombinant canine interleukin-15 (P=0.506). In the test group, the D-dimer level was maintained within the normal range during the test period, and in the control group, the mean value of D-dimer was measured higher than the normal range at weeks 4 and 12.

[0162] To evaluate the effect of recombinant canine interleukin-15 on the D-dimer of the test group and the control group during the test period, the statistical significance of the D-dimer levels at week 0 before the test and week 12 at the end of the test was evaluated. As a result, the D-dimer levels in both the test group and the control group did not change significantly before and after administration of recombinant canine interleukin-15 (P=0.221, P=0.310, respectively).

[0163]

[0164] <Evaluation Results>

[0165] Before the start of the trial, no significant differences in CRP and D-dimer levels were confirmed between the test and control groups. However, when the changes in CRP and D-dimer levels in each group before and after the trial were evaluated, a significant decrease in the CRP level was confirmed in the test group administered recombinant canine interleukin-15. This suggests that the administration of recombinant canine interleukin-15 helps reduce the inflammatory response in the body of patients with tumors. No significant differences in D-dimer were confirmed before and after the trial in either the test or control group. Since D-dimer is an indicator that increases when the malignancy and risk of thrombosis of the tumor increase, it is evaluated that no significant changes in D-dimer levels were observed in both the test and control groups in this study in which standard treatment was performed.

[0166]

[0167] Example 3-3. Parent satisfaction evaluation

[0168] Guardian satisfaction between the experimental and control groups following recombinant canine interleukin-15 administration was assessed through a guardian questionnaire on the quality of life of their dogs. The questionnaire comprised a total of 29 items divided into 10 categories and was assessed five times (weeks 0, 2, 4, 8, and 12). Each item was scored from 0 to 4 using a scoring system, and data on weekly evaluation scores are presented as "mean ± standard deviation" in Table 2.

[0169] [Table 2] Parental Satisfaction Assessment

[0170]

[0171]

[0172]

[0173]

[0174] For the 29 items, we analyzed whether there were significant differences in the evaluation time for each item, differences between the test group and the control group, and interactions between the measurement time and the group.

[0175] Among the four evaluation items for the first category, the degree of happiness, the item for increased activity of the patient was confirmed to have a significant difference depending on the evaluation time in both the test and control groups (p=0.008), and no significant difference was confirmed in the difference between groups or the interaction between groups depending on the measurement time.

[0176] Among the evaluation items for mental health in the second category, both the evaluation items for sleep time and the evaluation items for depression showed significant differences according to the evaluation time (p<0.001, p=0.004 respectively), and the sleep time evaluation item showed a difference between groups according to the measurement time (p=0.005). The test group was confirmed to have a significant increase in sleep time before the test compared to the control group, and this difference persisted until the second week of the test and did not show a significant difference from the fourth week evaluation. In other words, the test group showed significant improvement in sleep and reduction in depression in the fourth week compared to before treatment, but no group interaction according to the measurement time was confirmed.

[0177] In the pain assessment category, significant differences were confirmed by measurement time point (p<0.001), group (p=0.002), and group by measurement time point (p<0.001) in the tumor site pain assessment item. In the evaluation through a post-hoc test, it was confirmed that the tumor site pain assessment of the test group was significantly reduced at all evaluation time points compared to before treatment (0 week). In the appetite and meal quantity assessment category, differences were confirmed between the test and control groups in the items of meal quantity normalization and palatability normalization (p=0.037, p=0.043, respectively). In the test group, the decrease in appetite was confirmed to be more pronounced than the control group before the start of the test (0 week) (p=0.011), and it was evaluated that appetite increased as the test progressed. In the hygiene assessment category, significant differences were confirmed by measurement time point in both hygiene and hair condition assessment items (p=0.002, p=0.009, respectively). However, no differences between the test and control groups or group interactions by measurement time point were confirmed.

[0178] Among the categories of hydration status evaluation, for the items on urination status, there was a significant difference between the test group and the control group before the test and in the second week of the test (p=0.013), and no difference according to the measurement time or interaction between the measurement time and the group was confirmed. Among the categories of mobility evaluation, for the item on the evaluation of difficulty in getting up, there was no significant difference according to the measurement time or group, but a significant interaction between the groups according to the measurement time was confirmed (p=0.013), and in the test group, the degree of difficulty in getting up decreased as the test progressed, whereas in the control group, the related values ​​significantly increased in the 8th and 12th weeks.

[0179] Among the categories of cardiopulmonary function evaluation, for the item evaluating fatigue, a difference was confirmed between groups (p=0.035), and in the evaluation in the second week of the test, the fatigue of the test group was confirmed to be significantly higher than that of the control group, and this difference was not confirmed after the fourth week of the test. Finally, in the category evaluating overall health, in the item evaluating the rapid decline in quality of life after tumor diagnosis, a significant difference was confirmed according to the measurement time (p=0.001) and a significant difference by group (p=0.040), but no group interaction was confirmed according to the measurement time. Before the test (week 0), the decline in quality of life after tumor diagnosis in the test group was evaluated to be more prominent than that in the control group (p=0.014), and this was confirmed to show a significant improvement in the fourth week of the test. For items assessing whether the ongoing treatment affected quality of life, there was a difference between the groups (p=0.036). The experimental group showed a pattern of continuous improvement compared to pre-trial levels, whereas the control group showed a pattern of increasing levels from the 8th week of the trial. However, no differences by measurement time point or interaction between groups by measurement time point were identified.

[0180] In addition to evaluating the differences according to the evaluation time point, the differences between the test group and the control group, and the interaction between the measurement time point and the group for each of the 29 items of guardian satisfaction, the evaluation results at week 0, before administration of recombinant canine interleukin-15, and at week 12, the end of the test, were additionally compared and evaluated between the test group and the control group (Table 3). In the test group, when comparing the pre- and post-test, out of a total of 29 items, four items significantly improved: happiness, mental health, pain assessment, and hygiene assessment. In the control group, significant improvements were confirmed in three items of mental health and hygiene assessment. In the test group administered recombinant canine interleukin-15, both happiness and mental health showed significant improvements in items related to increased activity (p=0.029, p=0.031, respectively), and a significant decrease was also observed in items related to pain assessment (p=0.017). It is evaluated that the reduction in pain had a positive effect on happiness and mental health assessment through improved activity. In particular, when comparing the scores of the test group and the control group before drug administration in the pain assessment category, it was confirmed that the pain level of the individuals included in the test group was higher than that of the individuals included in the control group, and while pain improvement was notable after test drug administration, such changes were not confirmed in the control group. Significant improvements were confirmed in the same hygiene evaluation items in both the test group and the control group (respectively, p=0.025 and p=0.011).

[0181] [Table 3] Parent satisfaction assessment before and after treatment

[0182]

[0183]

[0184]

[0185] The most important factor that guardians consider when treating dogs with tumors is the quality of life of the dogs related to treatment. Therefore, assessing the quality of life of dogs based on a guardian questionnaire becomes an important factor in the treatment and prognosis of dogs with tumors. A comprehensive review of the analysis results of 29 quality of life assessment questionnaire items included in a total of 10 categories revealed that the initial evaluations of the experimental group were worse than those of the control group in items such as increased sleep, pain at the tumor site, decreased appetite, urination patterns, and fatigue after the tumor diagnosis. However, as the trial progressed, the evaluation values ​​for each item improved, and there was no difference between the groups at the end of the trial.

[0186] In two items, namely, pain at the tumor site in the pain assessment category and difficulty in getting up in the mobility assessment category, there was a significant difference in group-by-measurement time-point interaction. In both items, significant differences in improvement by group were confirmed (p<0.001 and p=0.013, respectively).

[0187]

[0188] Example 3-4. Veterinarian satisfaction evaluation

[0189] The veterinarian satisfaction assessment of the experimental and control groups following administration of recombinant canine interleukin-15 was conducted through a veterinarian questionnaire on the improvement rate of clinical symptoms in patients with the disease. Veterinary oncologists have recently worked to establish objective indicators for evaluating tumor treatment, and the American Society of Veterinary Oncologists recommends using veterinary evaluation indicators that are easy to evaluate, reproducible, and relatively objective in evaluating the treatment of veterinary tumor patients. During the five evaluation periods (weeks 0, 2, 4, 8, and 12) following administration of recombinant canine interleukin-15, veterinarians evaluated the presence or absence of abnormalities in the patients' condition based on 18 items falling into seven major categories.

[0190] Each item evaluated whether the corresponding symptom occurred in each category, and the clinical symptom improvement rates of the test group and the control group during the test are as shown in Table 4 below. For each clinical symptom improvement evaluation, it was scored according to the severity of each detailed indicator, but since the frequency of occurrence for each indicator was low and the difference in severity was not large, the results indicated the number of abnormal symptoms that occurred by week in each group. The difference in the frequency of occurrence of abnormal symptoms at each measurement time point between the test group and the control group was presented by evaluating statistical significance, and statistical evaluation was not possible in cases where there was no occurrence in each group.

[0191] [Table 4] Evaluation of veterinarian satisfaction through clinical symptom improvement rate

[0192]

[0193]

[0194] 1 BCS (body condition score) represents the body condition index.

[0195] The overall abnormal symptom category is divided into evaluations of the dog's attitude / reactivity decrease, lethargy, and placebo symptoms. In the test group, abnormal symptoms were observed a total of 7 times (3 times, 2 times, and 2 times, respectively) for the 3 items before administration of recombinant canine interleukin-15, but the number of abnormal symptoms decreased to 5 times at 2 weeks, 3 times at 4 weeks, 2 times at 8 weeks, and 2 times at the end of the test in week 12. On the other hand, in the control group, no dogs complained of decreased reactivity or lethargy at week 0 before the evaluation, but symptoms were confirmed 2 times at 2 weeks, 2 times at 4 weeks, 10 times at 8 weeks, and 18 times or more at the end of the evaluation in week 12.

[0196] For the attitude / reaction and apathy items of hallucination, there was a significant difference in the frequency of occurrence between the test group and the control group (p=0.040, p=0.005, respectively).

[0197] Among the nutritional abnormality symptom categories, weight loss and BCS changes were observed in the experimental group twice at week 0, seven times at week 2, three times at week 4, four times at week 8, and once at week 12. In the control group, no changes were observed at week 0 before the trial, and weight loss and BCS changes were observed once at week 2, once at week 4, twice at week 8, and three times at week 12. However, there was no significant difference in weight loss and BCS changes between the experimental and control groups (p=0.154, p=1.000, respectively). In the case of muscle mass loss, no specific changes were observed during the clinical trial in either the experimental or control groups.

[0198] In the digestive symptom category, in the test group, digestive symptoms were confirmed 4 times in week 0, 5 times in week 2, 6 times in week 4, 8 times in week 8, and 5 times in week 12 for 3 items in the evaluation of decreased appetite, vomiting, and diarrhea. On the other hand, in the control group, decreased appetite was not confirmed throughout the entire evaluation period, and vomiting and diarrhea symptoms were confirmed 2 times in week 0, 2 times in week 2, 0 times in week 4, 4 times in week 8, and 7 times in week 12. Overall, the frequency of digestive symptoms seemed to be higher in the test group, and in the control group, the frequency of digestive symptoms seemed to increase in the later stages of the clinical evaluation compared to the beginning of the trial, but there was no significant difference in the frequency of vomiting and diarrhea symptoms between the test group and the control group (each p=0.714 and p=0.260, respectively).

[0199] For the respiratory symptom category, dyspnea and cough were evaluated twice in the test group at week 0, once in week 2, 0 times in week 4, 3 times in week 8, and 5 times in week 12. In the control group, dyspnea and cough were evaluated zero in week 0, three times in week 2, five times in week 4, eight times in week 8, and 13 times in week 12, showing a tendency for the frequency of respiratory abnormalities in the control group to increase noticeably, but the frequency of dyspnea and cough symptoms did not show a significant difference between the test group and the control group (p=0.714, p=0.260, respectively).

[0200] No neurological symptoms were observed in either the test or control groups throughout the entire evaluation period. In the case of metabolic abnormalities, fever was observed once at week 0 in the test group, but it improved thereafter. In the control group, an increase in ionized calcium level was observed in one animal at week 12, but no clinical symptoms were observed. As for other abnormal symptoms, bruising at the injection site occurred in one animal in the test group, and there was an animal suspected of pneumonia at week 8, but it was confirmed that there was no relationship with recombinant canine interleukin-15.

[0201] Each item in the neurological abnormality, metabolic abnormality, and other abnormality categories had a low occurrence frequency and could not be statistically significant.

[0202] In the control group, it was confirmed that the overall frequency of clinical symptoms was lower than that of the test group at the beginning of the trial participation (week 0), and at the end of the evaluation (week 12), the symptoms of decreased reactivity of the patients and lethargy, diarrhea, dyspnea, and coughing tended to increase significantly compared to the test group. When the frequency of occurrence of abnormal symptoms for each item in all categories evaluated during the clinical trial was comprehensively compared to that in the test and control groups, it was found that there was a significant difference in the frequency of clinical symptom occurrence between the test and control groups (p<0.001). Based on this, it is evaluated that the administration of recombinant canine interleukin-15 has a positive effect on improving clinical symptoms in dogs with mammary tumors.

[0203]

[0204] Example 3-5. Measurement of VEGF concentration for secondary efficacy evaluation in the mammary tumor test group and control group

[0205] To evaluate the clinical efficacy of recombinant canine interleukin-15, the expression levels of VEGF, a tumor-related marker, and IFN-γ, a tumor immunity-related factor, were assessed in the serum of dogs with mammary tumors. The concentrations of each substance were measured using a sandwich ELISA technique in the serum of dogs before the first administration of recombinant canine interleukin-15 (week 0) and at 2, 4, 8, and 12 weeks after administration.

[0206] VEGF concentrations were measured in a total of 55 subjects, including the test group (27 animals) and the control group (28 animals), who were included in the clinical trial and completed the entire test, and the results are shown in Table 5 and Figure 2.

[0207] [Table 5] Analysis of VEGF concentration and changes in patients with mammary tumors

[0208]

[0209]

[0210] The VEGF concentration was measured using serum from the recombinant canine interleukin-15 administration group (red square graph in Figure 2) as the test group and the non-administration group (blue circular graph in Figure 2) as the control group before administration (week 0) and at weeks 2, 4, 8, and 12, and the results were expressed as the mean ± standard deviation (STD) for each week. * indicates the significance of the comparison between groups (test group / control group), and # indicates the comparison between week 0 and each period within each group, with #,*; P<0.05, ##, **; P<0.01, ###, ***; P<0.001 indicating significance.

[0211] The VEGF concentration was measured for each individual and period, and the mean and standard deviation were calculated, and compared between groups for each period and before and after administration of recombinant canine interleukin-15. A tendency toward a lower VEGF concentration was observed in the test group overall compared to the control group during the test period. In the test group, the VEGF concentration at week 12 (111.0±44.36) compared to before administration of recombinant canine interleukin-15 (week 0, 107.7±42.30) did not show significant changes in either increase or decrease (P=0.729) and maintained a constant concentration, whereas in the control group, the VEGF concentration at week 12 (138.5±49.10) showed a high significance (P=0.000) increase compared to before administration of recombinant canine interleukin-15 (week 0, 109.2±26.68). In the control group, VEGF concentration tended to decrease at week 8 (108.4 ± 28.10), but this was not a statistically significant change (P = 0.870). In a comparison between groups, a lower VEGF concentration was observed in the test group (111.0 ± 44.36) compared to the control group (138.5 ± 49.10) at week 12, and a significant difference (P = 0.037) was observed between the two groups.

[0212] Therefore, it is analyzed that administration of recombinant canine interleukin-15 can exhibit an anticancer effect by inhibiting tumor proliferation through suppression of the expression of VEGF, which is involved in tumor angiogenesis and increases with disease progression.

[0213]

[0214] Example 3-6. Measurement of IFN-γ concentration for secondary efficacy evaluation in mammary tumor test group and control group

[0215] The IFN-γ concentration was measured for each individual and period, and the mean and standard deviation were calculated, and compared between the groups before and after administration of recombinant canine interleukin-15 and for each period. As a result of the test for changes in IFN-γ concentration during the test period, the IFN-γ concentration in the test group increased significantly (P=0.002) at week 4 (60.14±3.78) compared to before administration of recombinant canine interleukin-15 (week 0, 57.66±4.21), whereas in the control group, compared to week 0 (58.70±10.35), there was no significant increase or decrease at week 2 (63.11±15.28), week 8 (58.52±9.04), and week 12 (57.32±7.09), and there was a significant decrease (P=0.012) at week 4 (55.95±7.75). In addition, in the inter-group comparison, a higher concentration of IFN-γ (60.14±3.78) was observed in the 4-week test group compared to the 4-week control group (55.95±7.75), which showed a high significance of P=0.001, confirming a meaningful difference between the two groups (Table 6 and Fig. 3).

[0216] [Table 6] Analysis of IFN-γ concentration and changes in mammary tumor patients

[0217]

[0218]

[0219] The concentrations were measured using serum from the recombinant canine interleukin-15 administration group (red square graph in Figure 3) as the test group and the non-administration group (blue circular graph in Figure 3) as the control group before administration (week 0) and at weeks 2, 4, 8, and 12, and are expressed as the mean ± standard deviation (STD) for each week. * indicates the significance of the comparison between groups (test group / control group), and # indicates the comparison between week 0 and each period within each group, and #,*; P<0.05, ##, **; P<0.01, ###, ***; P<0.001 indicates significance.

[0220] These results suggest that administration of recombinant canine interleukin-15 can induce the secretion of IFN-γ, a tumor immune cytokine, at 4 weeks, and that administration of recombinant canine interleukin-15 can inhibit tumor proliferation by increasing IFN-γ in the tumor microenvironment (TME), thereby exhibiting an anticancer effect.

[0221]

[0222] Example 3-7. Evaluation of hematological indicators for safety assessment

[0223] To evaluate the effects of recombinant canine interleukin-15 administration on white blood cells, red blood cells, and platelets in dogs, a complete blood count (CBC) was performed using whole blood from the dogs. CBCs can assess abnormalities in total white blood cell count (WBC) and WBC types (neu, lympho, mono, eosin, and baso), red blood cell (RBC) and hemoglobin (Hb) levels, hematocrit (HCT), and platelet (PLT) counts. Table 7 presents the CBC test results for the test and control groups administered recombinant canine interleukin-15.

[0224] [Table 7] Complete blood counts of the breast cancer test group and the control group

[0225]

[0226]

[0227] In terms of white blood cell counts, both the experimental and control groups showed a slight decrease during the evaluation period, but all values ​​remained within the normal range. Examining changes in specific white blood cells, the decrease in total white blood cell counts appeared to be associated with a decrease in neutrophils. Overall, neutrophils showed a slight decrease, while lymphocytes showed a slight increase.

[0228] Red blood cell count, hemoglobin level, and hematocrit did not show significant changes in the recombinant canine interleukin-15 administration group and the control group during the experimental period, and all results were within the normal range. Hemoglobin level and hematocrit level were confirmed to increase in the control group at week 8, which may be related to the increase in the number of clinical symptoms related to diarrhea among the digestive symptoms in the control group at weeks 8 and 12 in the clinical symptom improvement rate. However, all returned to the normal range at week 12, and were not evaluated as clinically unusual.

[0229] Platelet counts also remained within the normal range in both the test and control groups during the evaluation period, and no unusual findings were observed.

[0230] In summary, no specific changes in complete blood counts were observed during the clinical trial evaluation period in either the test group or the control group administered recombinant canine interleukin-15 to dogs with mammary tumors.

[0231] To evaluate the effects of recombinant canine interleukin-15 administration on the liver, kidneys, and other internal organs of dogs, blood chemistry tests were performed using the dogs' serum. Blood chemistry tests can assess blood sugar, kidney-related parameters, phosphorus and calcium, protein, and liver-related parameters. The blood chemistry test results for the test and control groups administered recombinant canine interleukin-15 are presented in Table 8.

[0232] [Table 8] Hematological values ​​of the breast cancer test group and the control group

[0233]

[0234]

[0235]

[0236] In both the test and control groups, no specific abnormalities were observed in blood sugar levels, kidney-related values, phosphorus and calcium values, and protein values ​​during the test period, and all values ​​were within the normal range.

[0237] Liver-related values ​​were evaluated in four major ways: ALT, ALKP, GGT, and TBIL. In the test group, it was confirmed that ALKP and GGT were elevated above the normal range before administration of recombinant canine interleukin-15 (week 0). This means that some liver-related values ​​were already elevated before administration of recombinant canine interleukin-15 in some test groups. If recombinant canine interleukin-15 affects the liver, an increase in the related values ​​may be observed, but the liver-related values ​​in the test group showed a downward trend during the test period. Therefore, it is determined that administration of recombinant canine interleukin-15 does not have a specific effect on liver values.

[0238] To evaluate the effects of recombinant canine interleukin-15 administration on electrolyte levels in dogs, electrolyte tests were performed using the dogs' serum. These tests assess sodium, potassium, and chloride levels. The electrolyte test results for the experimental and control groups administered recombinant canine interleukin-15 are presented in Table 9.

[0239] [Table 9] Electrolyte levels in the breast cancer test group and the control group

[0240]

[0241]

[0242] No significant changes in sodium, potassium, or chloride levels were observed in either the test or control groups during the study period, and all values ​​remained within normal ranges. Therefore, administration of recombinant canine interleukin-15 was assessed to have no significant effect on electrolyte changes in the dogs.

[0243]

[0244] Example 3-8. Vital signs and physical examination for safety evaluation of recombinant canine interleukin-15 administration in dogs with mammary tumors.

[0245] To confirm the changes in vital signs of the mammary tumor clinical trial subjects during the trial period, six indicators, including body weight, body condition score (BCS), body temperature, heart rate, respiratory rate, and blood pressure, were monitored for a total of five times during the three-month evaluation period of the test group and the control group participating in the clinical trial (Table 10).

[0246] [Table 10] Changes in biometric information between the breast cancer test group and the control group

[0247]

[0248]

[0249] In terms of body weight, there was a significant difference in the body weights of the individuals participating in the test group and the control group (P=0.002), which was due to the inclusion of larger dogs in the control group compared to the test group. However, no significant change in body weight was observed according to the measurement time point during the test period (P=0.355), and the interaction between the measurement time point and the group was confirmed to be not significantly different (P=0.743).

[0250] In addition to the difference in body weight between the groups, the body condition score (BCS), which is an index of body condition, was also evaluated. BCS is an index that can be used to evaluate the obesity or fat content of companion animals. There was no difference in the BCS of the test group and the control group at the time of measurement or between groups, and there was no significant difference in the interaction between groups according to the measurement time. In other words, when body weight and BCS are evaluated simultaneously, it can be seen that there is a difference in the size of the individuals included in the test group and the control group, but there is no difference in the degree of obesity. In addition, it can be seen that there is no change according to the measurement time for both indices and no interaction between groups according to the measurement time.

[0251] In the case of body temperature, significant changes were confirmed according to the measurement time (P<0.001), but all measured values ​​were within the normal range (within 39.5 degrees), indicating that there was no clinically unusual condition. In addition, no difference was confirmed between the test group and the control group (P=0.107).

[0252] In the case of respiratory rate, in the test group, the respiratory rate was confirmed to be 27.5±13.3 times / min at week 0 and 31.0±11.6 times / min at week 12, and in the control group, the respiratory rate was 29.6±9.4 times / min at week 0 and 32.2±8.3 times / min at week 12. Both the test group and the control group showed a tendency to slightly increase in respiratory rate during the experimental period, confirming a significant change in respiratory rate over time (P<0.001). However, the respiratory rates evaluated in the test and control groups did not greatly deviate from the normal respiratory rate of companion animals (within 30 times in a stable state), and since most animals tend to show a slight increase in respiratory rate when they are examined and treated at a hospital, the increase in each respiratory rate is judged to have no clinical significance. In addition, no difference was confirmed between the test and control groups (P=0.474).

[0253] For heart rate and blood pressure, no significant differences were observed between groups or at different measurement points during the evaluation period in either the experimental or control groups. Furthermore, no group interaction was observed based on measurement point.

[0254] In conclusion, six parameters, including body weight, BCS, body temperature, heart rate, respiratory rate, and blood pressure, were evaluated five times over three months. Body temperature and respiratory rate showed a tendency to increase over time, but the measured values ​​remained within the normal range, and no clinically significant changes were observed. Therefore, it is determined that administration of recombinant canine interleukin-15 does not specifically affect the vital signs of the animal.

[0255] [Example 4] Safety and efficacy evaluation after intravenous injection of recombinant canine interleukin-15 in dogs with lymphoma

[0256]

[0257] Example 4-1. The enrolled dogs in this trial were administered recombinant canine interleukin-15 in combination with the existing treatment after being diagnosed with lymphoma, and the investigator evaluated the response for a total of 3 months. The trial plan was carried out according to the clinical trial schedule below (Table 11), and if more frequent examinations were necessary at the investigator's discretion, additional evaluations were possible for each dog. The efficacy evaluation variables before and after administration of recombinant canine interleukin-15 to the enrolled dogs and between the test group and the control group were analyzed, and the therapeutic effect was confirmed through clinical observation (○ in Table 11 indicates confirmed items, △ indicates partially confirmed (unconfirmed) items). In Table 11, standard chemotherapy refers to the CHOP protocol, which includes dogs that have previously received chemotherapy and dogs that are currently receiving chemotherapy. For dogs that have not yet received chemotherapy, chemotherapy is started before the third visit and continued until the end of the clinical trial.

[0258]

[0259] [Table 11] Exam Schedule

[0260]

[0261]

[0262]

[0263] Example 4-2. Comparison of primary efficacy evaluation variables between the lymphoma test group and the control group.

[0264] In order to evaluate the efficacy of the administered drug for the test group and control group participating in the clinical trial of recombinant canine interleukin-15 administration, the status after drug administration was classified based on four criteria for changes in lymph node size. The four evaluation criteria based on changes in tumor diameter are as follows: CR (complete remission) refers to a state in which the baseline tumor completely disappeared, PR (partial response) refers to a state in which the sum of the longest diameters of the baseline tumor decreased by 30% or more, SD (stable disease) refers to a state in which the rate of decrease in the longest diameter of the baseline tumor was less than 10%, or the diameter increased by less than 20%, and PD (progressive disease) refers to a state in which the sum of the longest diameters of the baseline tumor increased by 20% or more.

[0265] CR and PR can be assessed as responsive to ongoing treatment, while SD and PD can be assessed as slow or progressive disease remission. The CR and PR rates in the test group were 76.5%, and the CR and PR rates in the control group were 73.7% (Table 12). Patients in the PD state, defined as a 20% or greater increase in the sum of the longest diameters of the reference lymph nodes, were present in 11.8% of the test group and 15.8% of the control group.

[0266] [Table 12] Changes in lymph node size in the lymphoma test group and control group

[0267]

[0268]

[0269] In the test group administered with recombinant canine interleukin-15, the size of the lymph nodes decreased in most cases, indicating that the drug treatment was generally effective in treating dogs with the disease. The effect was judged to be slightly better or similar to that of the control group that received only standard treatment.

[0270]

[0271] Example 4-3. Veterinarian satisfaction evaluation

[0272] The veterinarian satisfaction assessment of the test and control groups following administration of recombinant canine interleukin-15 was conducted through a veterinarian questionnaire on the improvement rate of clinical symptoms in the dogs. During a total of five evaluation periods, the veterinarians evaluated the presence of abnormalities in the dogs based on 18 items falling into seven major categories. Each item evaluated the occurrence of symptoms for each category. The improvement rates of clinical symptoms in the test and control groups during the experiment are shown in Table 13 below. For each clinical symptom improvement evaluation, it was scored according to the severity of each detailed indicator, but since the difference in severity by indicator was not large, the table shows the number of clinical symptoms that occurred by week in each group.

[0273] [Table 13]. Veterinarian satisfaction assessment based on clinical symptom improvement rate.

[0274]

[0275]

[0276]

[0277] In the case of overall abnormal symptoms, they are divided into evaluations for decreased responsiveness or lethargy, etc. In the test group, abnormal symptoms were observed a total of 10 times for 3 items before administration of recombinant canine interleukin-15, but they gradually decreased, and the number of abnormal symptoms decreased to 2 times at the 12th week, the end of the experiment. In the control group, there were 5 complaints of decreased responsiveness or lethargy at 0 weeks before the evaluation, and they gradually decreased, but increased again to about 4 complaints of decreased responsiveness or lethargy at the 12th week, the end of the evaluation.

[0278] In the case of nutritional abnormalities, the test group showed about 3 times in week 0 before administration of recombinant canine interleukin-15, but the nutritional abnormalities improved during the experimental period, and the number of abnormalities decreased to 1 in week 12. On the other hand, in the control group, similar to the test group, there were individuals complaining of nutritional abnormalities such as weight loss or changes in BCS 3 times in week 0, and this frequency was similar throughout the experimental period except for the evaluation in week 2.

[0279] In terms of digestive symptoms, the test group showed about 5 digestive symptoms including loss of appetite, vomiting, and diarrhea before administration of recombinant canine interleukin-15 (week 0), and during the evaluation period, loss of appetite, vomiting, and diarrhea symptoms slightly decreased. On the other hand, in the control group, one digestive symptom was observed at the beginning of the test (week 0), but the frequency increased during the experimental period, and a total of 5 digestive symptoms appeared at week 12, showing a tendency for symptoms to increase.

[0280] In terms of respiratory symptoms, dyspnea and cough were evaluated. In the test group, respiratory symptoms were observed approximately once before administration of recombinant canine interleukin-15 (week 0), and no respiratory symptoms were observed at the end of the test. In the control group, respiratory symptoms were observed four times at the beginning of the test (week 0), and the number of individuals complaining of dyspnea and cough tended to decrease during the evaluation period.

[0281] No neurological symptoms were observed in either the test or control groups during the entire evaluation period. Polyuria was observed once in the test group before administration of recombinant canine interleukin-15 (week 0) and about 3 times in both control groups, and once in each group at the end of the study. In the control group, persistent hypercalcemia was observed in one animal, and fever was observed in the test group within 4 weeks of evaluation and disappeared thereafter, but in the control group, there was no febrile symptom at the beginning of the evaluation, but an animal with febrile symptom developed at week 12.

[0282] In summary, it can be confirmed that the improvement in clinical symptoms was more noticeable in the test group administered recombinant canine interleukin-15 than in the control group. The frequency of clinical symptoms complained before the test (0 week) in both the test group and the control group was similar at the beginning, 21 and 20 times, respectively. However, as the experiment progressed, the frequency of clinical symptoms in the recombinant canine interleukin-15 administration group decreased to 17 times at 2 weeks, 8 times at 4 weeks, and 7 times at 8 weeks, and the frequency of clinical symptoms at the end of the evaluation (12 weeks) was approximately 7 times. On the other hand, the frequency of clinical symptoms in the control group decreased to 9 times at 2 weeks and then increased to 18 times at 4 weeks. The frequency of clinical symptoms at the end of the evaluation (12 weeks) did not decrease, remaining at 20 times. Based on this, it is evaluated that the administration of recombinant canine interleukin-15 has a positive effect on improving clinical symptoms in canine lymphoma patients.

[0283]

[0284] Example 4-4. Parent satisfaction evaluation

[0285] The evaluation of guardian satisfaction between the experimental and control groups following recombinant canine interleukin-15 administration was conducted through a guardian questionnaire regarding the quality of life of their dogs. Over a total of five evaluation periods, guardians assessed their dogs' condition across 29 items, categorized into 10 broad categories. Each item was scored from 0 to 4 using a scoring system, and data on weekly evaluation scores are presented as "mean ± standard deviation" in Table 14.

[0286] [Table 14]. Parental Satisfaction Assessment

[0287]

[0288]

[0289]

[0290]

[0291] The evaluation of guardian satisfaction was conducted by comparing the results at week 0, before administration of recombinant canine interleukin-15, and at week 12, after the end of the experiment, in the test and control groups, respectively (Table 15).

[0292] [Table 15] Comparison of caregiver satisfaction ratings before and after treatment

[0293]

[0294]

[0295]

[0296] In the test group, out of 9 categories and a total of 29 items, 8 categories and 15 items showed significant improvement, while in the control group, significant improvement was confirmed in only 1 item among the overall health status evaluation categories.

[0297] In the test group administered recombinant canine interleukin-15, significant improvements were observed in nearly all categories related to happiness and mental health. Administration of recombinant canine interleukin-15 was evaluated to have a positive effect on improving the happiness and mental health of the dogs.

[0298] In addition, statistical significance was confirmed in evaluation items such as pain relief, improved diet, and improved mobility, and a clear improvement effect was confirmed compared to the control group in the overall health status evaluation.

[0299] In the control group that received only standard anticancer treatment, no significant improvement was observed in specific evaluation indicators, but significant improvement was observed in one item related to quality of life among the overall health status items.

[0300] In conclusion, the results of the evaluation of guardian satisfaction based on the quality of life of the dogs suggest that administration of recombinant canine interleukin-15 has a positive effect on improving overall evaluation indicators, and its effect is evaluated to be better than that of the control group that only received standard anticancer treatment.

[0301]

[0302] Example 4-5. Evaluation of TK-1, a tumor-related blood marker, in the lymphoma test group and control group.

[0303] To evaluate the clinical efficacy of recombinant canine interleukin-15, the expression levels of tumor markers TK-1, and tumor immunity-related factors IFN-γ and LDH were assessed in the serum of canine lymphoma patients. The concentrations of each cytokine were measured using a sandwich ELISA technique in the serum of patients before the first administration of recombinant canine interleukin-15 (week 0) and at 2, 4, 8, and 12 weeks after administration.

[0304] In order to evaluate the clinical efficacy of recombinant canine interleukin-15, serum samples from 17 test group animals that completed the clinical trial, 19 control group animals, and animals that died or were abandoned during the entire clinical trial period were used for measurement, and the concentration of TK-1, which is used clinically as a tumor diagnostic marker, was measured, and the analysis results are shown in Table 16 and Fig. 4.

[0305] [Table 16] Analysis of changes in TK-1 concentration and relative concentration ratio in lymphoma patients treated with recombinant canine interleukin-15.

[0306]

[0307]

[0308] The TK-1 concentration was measured using the serum before administration (week 0) and at weeks 2, 4, 8, and 12 in the recombinant canine interleukin-15 administration group (red square graph in Figure 4) as the test group and the non-administration control group (blue circular graph in Figure 4). The relative ratio of concentration (relative concentration ratio) means the relative ratio of the concentration of the corresponding cytokine at each period to the concentration before recombinant canine interleukin-15 administration (week 0) for each individual, and is expressed as the mean ± standard deviation (STD) for each week. # indicates week N / week 0 (comparison of each period to week 0 within each group), * indicates test group / control group (comparison between groups), and #,*; P<0.05, ##, **; P<0.01, ###, ***; P<0.001, #####, ****; Significance was indicated as P<0.0001.

[0309] The TK-1 concentration was measured for each individual and period, and the mean and standard deviation were calculated, and compared between groups before and after administration of recombinant canine interleukin-15 and for each period. During the test period, a trend of lower relative concentration ratios was observed in the test group compared to the control group, and no significant difference was observed by period (F=2.892, p=0.080). However, a significant difference was confirmed in the group difference (F=5.202, p=0.026) and the interaction between period and group (F=2.910, p=0.023).

[0310] As a result of the post-analysis, it was observed that the relative concentration ratio of TK-1 concentration at week 8 (0.81±0.25) showed a significant decrease (p=0.015) compared to before administration of recombinant canine interleukin-15 (1.00±0.00) in the test group, whereas the relative concentration ratio at week 8 (1.36±0.49) showed a significant increase (p=0.014) compared to before administration of recombinant canine interleukin-15 (1.00±0.00) in the control group.

[0311] In addition, in the intergroup comparison, a lower relative concentration ratio of TK-1 (0.81±0.25) was observed in the test group compared to the control group (1.36±0.49) at week 8, which was highly significant (p 0.0001) to confirm a significant difference between the two groups.

[0312] Therefore, TK-1 showed a tendency of lower relative concentration ratio in the test group overall compared to the control group during the test period, and in the comparison according to the time before and after administration of recombinant canine interleukin-15, a significant increase was shown in the control group before and 8 weeks after administration of recombinant canine interleukin-15, whereas a significant decrease was shown in the test group, and it was confirmed that the difference in decrease in the test group compared to the control group was significantly higher at 8 weeks after administration of recombinant canine interleukin-15.

[0313] To evaluate the clinical efficacy of recombinant canine interleukin-15, IFN-γ concentrations were measured using serum samples from 17 test groups that completed the full clinical trial, 19 control groups, and individuals including those that died or were abandoned during the trial, and the results are presented in Table 17 and Fig. 5. The IFN-γ concentrations for each individual and time period were measured, and the mean and standard deviation for each group were calculated. The relative concentration ratio of IFN-γ showed an overall decreasing trend in the control group throughout the entire test period. On the other hand, it was observed that the test group tended to be maintained at the level before recombinant canine interleukin-15 administration. The verification results showed no significant difference according to time period (F=2.154, p=0.119), but there was a significant difference between groups (F=11.010, p=0.002) and a significant difference in the interaction between time period and group (F=3.092, p=0.017). As a result of the post-hoc analysis, the relative concentration of IFN-γ was higher in the test group (1.05±0.10) than in the control group (0.94±0.16) at 4 weeks after administration of recombinant canine interleukin-15, and the difference in the amount of change between the two groups (p=0.012) was statistically significant. In addition, at the end of the test, 12 weeks after administration of recombinant canine interleukin-15, the relative concentration of IFN-γ was higher in the test group (1.03±0.15) than in the control group (0.89±0.21), and the difference in the amount of change between the two groups (p=0.020) was statistically significant. Therefore, in the comparison according to the time before and after administration of recombinant canine interleukin-15, IFN-γ did not show a significant change within the test group, but the relative concentration ratio of IFN-γ showed a tendency to decrease in the control group throughout the test period, whereas it was observed to tend to be maintained at a certain level in the test group, and it was confirmed that it was significantly higher in the test group than in the control group at 4 and 12 weeks.

[0314] [Table 17]. Changes in IFN-γ concentration and relative concentration ratio in lymphoma patients administered recombinant canine interleukin-15.

[0315]

[0316]

[0317] The IFN-γ concentration was measured using the serum before administration (week 0) and at weeks 2, 4, 8, and 12 in the recombinant canine interleukin-15 administration group (red square graph in Figure 5) as the test group and the non-administration control group (blue circular graph in Figure 5). The relative ratio of concentration (relative concentration ratio) means the relative ratio of the concentration of the corresponding cytokine at each period to the concentration before recombinant canine interleukin-15 administration (week 0) for each individual, and is expressed as the mean ± standard deviation (STD) for each week. # indicates week N / week 0 (comparison of each period to week 0 within each group), * indicates test group / control group (comparison between groups), and #,*; P<0.05 is used as a comparison between the corresponding periods and groups to indicate significance.

[0318]

[0319] Example 4-6. Changes in serum LDH concentration due to administration of recombinant canine interleukin-15 in lymphoma patients

[0320] To evaluate the clinical efficacy of recombinant canine interleukin-15, serum samples from 17 test animals that completed the full-term clinical trial, 19 control animals, and animals that died or were abandoned during the trial were used to measure LDH, a representative tumor marker used for tumor prognosis assessment and prediction. The results are presented in Table 18 and Fig. 6.

[0321] [Table 18] Analysis of changes in LDH concentration in lymphoma patients administered recombinant canine interleukin-15.

[0322]

[0323]

[0324] The LDH concentration was measured using the serum before administration (week 0) and at weeks 2, 4, 8, and 12 in the recombinant canine interleukin-15 administration group (red bar in Figure 6) as the test group and the non-administration group (blue bar in Figure 6) as the control group. The relative ratio of concentration (relative concentration ratio) means the relative ratio of the concentration of the corresponding cytokine at each period to the concentration before recombinant canine interleukin-15 administration (week 0) for each individual, and is expressed as the mean ± standard deviation (STD) for each week. # indicates week N / week 0 (comparison of each period to week 0 within each group), *: test group / control group (comparison between groups), and significance was indicated as #,*; P<0.05, ##, **; P<0.01 as a comparison between the corresponding periods and groups.

[0325] The LDH concentration for each individual and period was measured to obtain the mean and standard deviation, and since the difference in the mean concentration between groups before administration of recombinant canine interleukin-15 was not large, the concentration itself was analyzed. In the control group, an increasing trend was observed at 4 weeks after administration, whereas in the test group, a decreasing trend was observed throughout the entire test period. As a result of comparing the period before and after administration of recombinant canine interleukin-15 and the groups for each period, there was no significant difference in the period (F=0.976, p=0.416) or group (F=3.250, p=0.077), but a significant difference was confirmed in the interaction between the period and group (F=3.708, p=0.006).

[0326] As a result of the post-analysis, no significant change was observed within the test group over the period, whereas in the comparison between groups, the LDH concentration of the test group (145.60±126.40) was significantly lower than that of the control group (436.60±382.40) at week 12, and the test result showed high significance (p=0.005), confirming a meaningful difference between the two groups.

[0327] Therefore, when comparing LDH levels according to the time before and after administration of recombinant canine interleukin-15, the control group showed an increasing trend, whereas the test group showed a decreasing trend throughout the entire test period. Furthermore, a significant difference was confirmed, as the test group showed lower concentrations than the control group at 12 weeks after administration.

[0328]

[0329] Example 4-7. Changes in serum β2-microglobulin (B2M) concentrations due to administration of recombinant canine interleukin-15 in lymphoma patients

[0330] To evaluate the clinical efficacy of recombinant canine interleukin-15, the concentration of B2M, which is used clinically as a tumor diagnostic marker, was measured, and the analysis results are shown in Table 19 and Fig. 7.

[0331] [Table 19] Analysis of changes in B2M concentration and relative concentration ratio in lymphoma patients administered recombinant canine interleukin-15.

[0332]

[0333]

[0334] The LDH concentration was measured using the serum before administration (week 0) and at weeks 2, 4, 8, and 12 in the recombinant canine interleukin-15 administration group (red circular graph in Figure 7) as the test group and the non-administration control group (blue circular graph in Figure 7). The relative ratio of concentration (relative concentration ratio) means the relative ratio of the concentration of the corresponding cytokine at each period to the concentration before recombinant canine interleukin-15 administration (week 0) for each individual, and is expressed as the mean ± standard deviation (STD) for each week. # indicates week N / week 0 (comparison of each period to week 0 within each group), * indicates test group / control group (comparison between groups), and #,*; P<0.05 was used as a significance for the comparison between the corresponding periods and groups.

[0335] B2M concentrations were measured for each individual and period, and the mean and standard deviation were calculated. Comparisons were made between groups before and after administration of recombinant canine interleukin-15 and for each period. During the test period, the relative concentration ratio of B2M increased in the control group overall, while it tended to decrease in the test group. As a result of the test, there was no significant difference in the period (F=1.022, p=0.377), group (F=3.307, p=0.074), and the interaction between the period and group (F=2.063, p=0.088). However, in the post-hoc analysis, a significant decrease (p=0.048) was observed in the B2M relative concentration ratio (0.92±0.19) of the test group compared to the control group (1.03±0.15) at week 8 of recombinant canine interleukin-15 administration. In addition, a significant difference (p=0.031) was observed in the lower B2M relative concentration ratio (0.91±0.19) in the test group compared to the control group (1.04±0.13) at week 12, confirming a meaningful difference between the two groups.

[0336] Therefore, B2M showed a tendency of lower relative concentration ratio in the test group compared to the control group overall during the test period, and a significant decrease difference was confirmed in the test group compared to the control group at 8 and 12 weeks after administration of recombinant canine interleukin-15.

[0337]

[0338] Example 4-8. Evaluation of changes in serum sIL-2R and TNF-α concentrations due to administration of recombinant canine interleukin-15 in lymphoma test and control groups.

[0339] To evaluate the clinical efficacy of recombinant canine interleukin-15, the concentrations of antitumor immune factors sIL-2R and TNF-α were measured, and the results are presented in Tables 20 and 21, respectively.

[0340] [Table 20] Analysis of changes in sIl-2R concentration and relative concentration ratio in lymphoma patients administered recombinant canine interleukin-15.

[0341]

[0342] [Table 21] Analysis of changes in TNF-α concentration and relative concentration ratio in lymphoma patients administered recombinant canine interleukin-15.

[0343]

[0344]

[0345] The sIL-2R and TNF-α concentrations for each individual and period were measured, and the mean and standard deviation for each group were calculated, and the relative concentration ratio was applied for analysis and evaluation. As a result of the verification, there was no significant difference in the sIL-2R (T; F=0.963 / p=0.421, G; F=0.090 / p=0.765, G*T; F=1.689 / p=0.155) and TNF-α concentrations (T; F=0.761 / p=0.529, G; F=0.139 / p=0.711, G*T; F=0.609 / p=0.657) between periods and groups or in the interaction, and this was also confirmed in the results of the post-hoc analysis conducted thereafter. From these results, the safety of recombinant canine interleukin-15 could be confirmed.

[0346]

[0347] Example 4-9. Inflammation and thrombosis improvement indicators (CRP / D-dimer)

[0348] The changes in CRP and D-dimer by day of evaluation during the test period for 17 heads of the lymphoma test group and 19 heads of the control group are shown in Table 22 below and Figure 8, respectively.

[0349] [Table 22]. Changes in CRP and D-dimer in the lymphoma test and control groups.

[0350]

[0351] Before administration of recombinant canine interleukin-15 (week 0), the mean CRP levels were measured similarly in the test and control groups, and the difference between the two groups was not statistically significant (p=0.363). The CRP level in the test group showed a tendency to continuously decrease from 2 weeks after the first administration of recombinant canine interleukin-15, but no significant difference was observed. In the case of D-dimer levels, no significant change was observed in the test group, but in the control group, the D-dimer level increased significantly above the normal range at 12 weeks, which was confirmed to be a significant change (p=0.003).

[0352] Looking at the change pattern of CRP, the average CRP value before administration of recombinant canine interleukin-15 (week 0) in the test group was 17.5±31.6 mg / L, and in the control group it was 17.7±31.2 mg / L, and there was no statistically significant difference in the CRP values ​​between the two groups (p=0.363). The CRP value of the test group showed a tendency to continuously decrease until 12 weeks after the start of the test, and the average CRP value of the control group showed a pattern of increasing at 2 weeks and then decreasing, and the average CRP values ​​of both groups remained within the normal range throughout the test period.

[0353] To evaluate the effect of administration of recombinant canine interleukin-15 on the CRP levels of the test and control groups during the experimental period, the statistical significance of the CRP levels before the test and at weeks 0 and 12, the end of the test, was evaluated. As a result, no significant difference was confirmed in the CRP levels of the test and control groups before and after treatment (p=0.646, 0.929, respectively).

[0354] Looking at the change pattern of D-dimer, the average D-dimer value before administration of recombinant canine interleukin-15 (week 0) in the test group was 0.1±0.1 ug / mL, and in the control group it was 0.2±0.1 ug / mL. There was no significant difference in the D-dimer values ​​of the two groups before administration of recombinant canine interleukin-15 (week 0) (p=0.257). In the test group, the D-dimer level did not show much change throughout the test period and was maintained within the normal range, but in the control group, a significant increase in the average D-dimer level was confirmed at week 12 (p=0.000).

[0355] To evaluate the effect of recombinant canine interleukin-15 on D-dimer in the experimental and control groups during the experimental period, the statistical significance of the D-dimer levels before the test and at weeks 0 and 12, the end of the test, was assessed. As a result, no significant difference in the D-dimer levels was confirmed in the experimental group (p=0.285), but a significant difference was confirmed in the D-dimer levels of the control group at week 12, with the levels increasing above the normal range (p=0.003).

[0356]

[0357] Example 4-10. Evaluation of hematological indicators for safety assessment

[0358] To evaluate the effects of recombinant canine interleukin-15 administration on the patient's white blood cells, red blood cells, and platelets, a complete blood count (CBC) was performed using whole blood from the patients. CBCs can assess total white blood cell counts, the number of different types of white blood cells, red blood cell and hemoglobin levels, hematocrit, and platelet counts. Table 23 presents the CBC test results for the experimental and control groups administered recombinant canine interleukin-15.

[0359] [Table 23] Complete blood counts of the lymphoma test group and control group

[0360]

[0361]

[0362] In both the test and control groups, the total white blood cell count, as well as the counts and ratios of specific blood cells, were within the normal range during the trial evaluation period. The red blood cell count, hemoglobin level, and hematocrit did not show significant changes in the recombinant canine interleukin-15 administration group and the control group during the trial period, and all results were within the normal range. The platelet count also remained within the normal range in both the test and control groups throughout the evaluation period, and no unusual findings were observed.

[0363] In conclusion, no specific changes in complete blood counts were observed in either the experimental group administered recombinant canine interleukin-15 or the control group not administered recombinant canine interleukin-15 to lymphoma patients. Recombinant canine interleukin-15 is assessed to have no effect on complete blood counts in lymphoma patients.

[0364]

[0365] Example 4-11. Blood chemistry test by administration of recombinant canine interleukin-15 to lymphoma patients

[0366] To evaluate the effects of recombinant canine interleukin-15 administration on the liver, kidneys, and other internal organs, blood chemistry tests were performed using the patients' serum. Blood chemistry tests can assess blood sugar, kidney-related parameters, phosphorus and calcium, protein, and liver-related parameters. The blood chemistry test results for the test and control groups administered recombinant canine interleukin-15 are presented in Table 24.

[0367] [Table 24] Hematological parameters of the lymphoma test group and control group

[0368]

[0369]

[0370]

[0371] Blood sugar levels in the experimental group remained largely unchanged throughout the study period and remained within the normal range. In the control group, blood sugar levels were measured somewhat higher at the pre-test assessment (Week 0). However, this was within the range that could increase due to stress, such as blood sampling, and is therefore not considered clinically significant.

[0372] Among the kidney-related values, blood urea nitrogen (BUN) level was confirmed to have increased in the test group at 12 weeks, but it did not significantly exceed the normal range, and the creatinine level, which evaluates kidney function, was within the normal range, so the slight increase in value is judged to have no clinical significance. Calcium and phosphorus levels were confirmed to exist within the normal range in both the test and control groups without significant changes during the test period.

[0373] Liver-related evaluation values ​​are largely evaluated in four areas: ALT, ALP, GGT, and TBIL. In the test group, it was confirmed that ALT, ALP, and GGT values ​​were elevated above the normal range before administration of recombinant canine interleukin-15 (week 0). However, this means that some liver-related values ​​were already elevated before administration of recombinant canine interleukin-15 in some dogs. If the administered drug affects the liver, a continuous increase in the related values ​​should be observed during the test evaluation period. However, since the liver-related values ​​of the test group showed a tendency to decrease during the test period, it is determined that administration of recombinant canine interleukin-15 does not have a specific effect on liver values.

[0374] In the control group, it was confirmed that the liver-related values ​​of ALT, ALPK, and GGT were elevated above the normal range at week 0, and it was observed that the liver values ​​of the control group were similar or slightly elevated during the evaluation period.

[0375] In conclusion, it was assessed that administration of recombinant canine interleukin-15 had no effect on body organs such as the liver and kidneys of lymphoma patients.

[0376] To evaluate the effects of recombinant canine interleukin-15 administration on patients' electrolyte levels, electrolyte tests were performed using the patients' serum. These tests assess sodium, potassium, and chloride levels. The electrolyte test results for the test and control groups administered recombinant canine interleukin-15 are presented in Table 25.

[0377] [Table 25] Electrolyte levels in the lymphoma test group and control group

[0378]

[0379]

[0380] No significant changes in sodium, potassium, and chloride levels were observed in either the experimental or control groups during the study period, and all values ​​remained within normal ranges. Therefore, administration of recombinant canine interleukin-15 was assessed to have no significant effect on the patients' electrolyte changes.

Claims

1. A composition for treating cancer in a dog suffering from mammary tumor or lymphoma, comprising recombinant canine interleukin-15 comprising the amino acid sequence of sequence number 1.

2. A composition for treating cancer, which is administered after surgical removal of a tumor in the first paragraph.

3. A composition for treating cancer, which is administered simultaneously, sequentially, or in combination with standard anticancer treatment in the first paragraph.

4. A composition for treating cancer, wherein the standard anticancer treatment in claim 3 is surgical removal of the tumor or a CHOP protocol or a combination thereof, and the CHOP protocol is selected from the group consisting of cyclophosphamide, doxorubicin, vincristine, and prednisone.

5. A composition for treating cancer, wherein the composition is administered daily for 2 to 6 days, 3 to 6 days, 4 to 6 days, 4 to 5 days, or 4 days as the first administration, and the daily administration is administered once to five times a day, once to three times a day, once to twice a day, or once a day.

6. A composition for treating cancer, wherein the composition is administered daily for 4 days as the first administration, and the daily administration is administered once a day, according to any one of the preceding claims.

7. A composition for treating cancer, which is administered with a rest period of 6 days, 8 days, 10 days, or 12 days after the first administration in paragraph 5.

8. A composition for treating cancer, which is administered with a 10-day rest period after the first administration in paragraph 5.

9. A composition for treating cancer, wherein, in paragraph 7, the second administration is administered daily for 2 to 6 days, 3 to 6 days, 4 to 6 days, 4 to 5 days, or 4 days after a drug-free period of the first administration, and the daily administration is administered once to five times a day, once to three times a day, once to twice a day, or once a day.

10. A composition for treating cancer, wherein the composition is administered daily for 4 days as a second administration after a break in the first administration, and the daily administration is administered once a day.

11. A composition for treating cancer, wherein the composition is administered once a day for 4 days as the first administration, followed by a 10-day break, and then administered once a day for 4 days as the second administration, in any one of the first to third clauses.

12. A composition for treating cancer, wherein the administration in paragraph 5 is oral, duodenal, intrapulmonary, intranasal, intrathecal, intravenous, subcutaneous, intraperitoneal, intramuscular, intraarterial or local administration.

13. A composition for treating cancer, wherein the administration is intravenous administration in the 12th paragraph.

14. A composition for treating cancer, wherein the intravenous administration is administered through a catheter installed in a vein.

15. A composition for treating cancer, wherein the recombinant canine interleukin-15 in claim 1 has an average molecular weight of 10 to 15 kDa.

16. A composition for treating cancer, wherein the recombinant canine interleukin-15 in paragraph 1 is expressed from a nucleic acid sequence of SEQ ID NO:

4.

17. A composition for treating cancer, wherein the dosage of recombinant canine interleukin-15 in paragraph 1 is 0.1 to 50 μg / kg, 10 to 30 μg / kg, 15 to 25 μg / kg, or 20 μg / kg.

18. An anticancer immune enhancer for dogs suffering from mammary tumors or lymphoma, comprising recombinant canine interleukin-15 comprising the amino acid sequence of SEQ ID NO:

1.

19. A method for treating cancer in a dog suffering from mammary tumor or lymphoma, comprising administering recombinant canine interleukin-15 comprising the amino acid sequence of SEQ ID NO:

1.

20. A method for treating cancer in claim 19, wherein the administration step comprises administering recombinant canine interleukin-15 as a first administration daily for 2 to 6 days, 3 to 6 days, 4 to 6 days, 4 to 5 days, or 4 days, and the daily administration is administered once to five times a day, once to three times a day, once to twice a day, or once a day.

21. A method for treating cancer in claim 19, wherein the administration step is to administer recombinant canine interleukin-15 daily for 4 days as a first administration, and the daily administration is administered once a day.

22. A method for treating cancer in claim 20, wherein the administration step is administered with a drug-free period of 6 days, 8 days, 10 days, or 12 days after the first administration.

23. A method for treating cancer in claim 20, wherein the administration step is administered with a 10-day rest period after the first administration.

24. A method for treating cancer in claim 22, wherein the administration step is a second administration after a drug-free period of the first administration, administered daily for 2 to 6 days, 3 to 6 days, 4 to 6 days, 4 to 5 days, or 4 days, and the daily administration is administered once to five times a day, once to three times a day, once to twice a day, or once a day.

25. A method for treating cancer in claim 22, wherein the administration step is a second administration after a rest period of the first administration, and the daily administration is administered once a day for four days.

26. A method for treating cancer, wherein, in paragraph 19, the first administration is administered once a day for 4 days, followed by a 10-day break, and then the second administration is administered once a day for 4 days.

27. A method for mass producing recombinant canine interleukin-15 useful for the treatment of dogs with mammary tumors or lymphoma. A method for mass production of recombinant canine interleukin-15, comprising (1) a culture step, (2) a cell lysis step, (3) a purification step, and (4) a protein refolding and formulation step.

28. A method for mass producing recombinant canine interleukin-15 in claim 27, wherein the recombinant canine interleukin-15 comprises the amino acid sequence of sequence number 1.

29. In paragraph 27, (1) further comprising a seed lot manufacturing step prior to step, A method for mass production of recombinant canine interleukin-15, wherein the seed lot manufacturing step comprises at least one of i) a master seed lot manufacturing step and ii) a manufacturing seed lot manufacturing step.

30. A method for mass production of recombinant canine interleukin-15, wherein, in paragraph 27, after step (4), a step (5) of confirming the potency and a step (6) of concentrating and filling are additionally included.

Images