Method for producing diosmin by reconstructing biosynthetic pathway
A gene expression cassette in transgenic plants reconstructs the diosmin biosynthetic pathway, addressing the challenges of halogen use and solvent residues in existing methods by producing high-purity diosmin efficiently and safely.
Patent Information
- Application Number
- PCT/KR2025/002371
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-09-02
- Filing Date
- 2025-02-19
- Publication Date
- 2026-03-05
AI Technical Summary
Existing methods for producing diosmin involve the use of halogens like iodine or bromine, leading to high iodine and bromine content and the need for extensive organic solvents, which are environmentally harmful and costly, and result in residual solvents that are undesirable for pharmaceutical use.
A gene expression cassette comprising AtPAL, AtC4H, Sh4CL, OsCHS, BrCHI, OsFNS, and OsF3'H genes, along with promoters, is used to reconstruct the biosynthetic pathway for diosmin production in transgenic plants, avoiding the use of organic solvents and reducing iodine and bromine content.
The method enables high-purity diosmin production with low iodine and bromine content, reducing environmental impact and production costs while ensuring safety for workers.
Smart Images

Figure KR2025002371_05032026_PF_FP_ABST
Abstract
Description
Method for producing diosmin by reconstructing the biosynthetic pathway
[0001] The present invention relates to a method for producing diosmin or a precursor thereof by predicting a biosynthetic pathway from phenylalanine to diosmin and reconstructing the biosynthetic pathway.
[0002]
[0003] Diosmin is the international nonproprietary name assigned to 7-[[6-O-(6-deoxy-α-L-mannopyracyl)-β-D-glucopyranosyl]oxy-5-hydroxy-2-(3-hydroxy-4-methoxyphenyl)-4H-1-benzopyran-4-one (CAS 520-27-4):
[0004] Diosmin is a naturally occurring flavonoid glycoside available from various plant sources. It is used in therapy due to its pharmacological activity as a phlebotonic or vascular protecting agent, and is indicated, for example, for the treatment of chronic venous insufficiency. Industrially, diosmin is usually prepared starting from the widely available flavonoid hesperidin by extraction from citrus fruits.
[0005] In the prior art, numerous processes suitable for industrial conversion of hesperidin to diosmin have been disclosed. Most of these processes are based on the use of halogens, i.e., iodine or bromine, to perform an oxidation step, typically via a halogenation / dehydrohalogenation mechanism, to obtain a double bond. One of the major difficulties encountered in these processes is the need to remove iodinated or brominated intermediates or by-products formed during the process to obtain diosmin at a purity level acceptable to the European Pharmacopoeia, given that the maximum permitted iodine content is 1000 ppm (0.1%).
[0006] It remains challenging to obtain diosmin using particularly economical and industrially feasible processes with low iodine and / or bromine contents. In particular, previously proposed methods require the extensive use of various organic solvents, and thus the resulting diosmin inevitably contains residual organic solvents, which are undesirable for its use as a pharmaceutical. Furthermore, the industrial use of organic solvents is always problematic, as it not only has a high environmental impact and increases production costs, but also carries potential occupational health risks for workers. Therefore, it is desirable to develop alternative methods for producing diosmin with high purity, particularly with low iodine and / or bromine contents, while avoiding the use of organic solvents.
[0007]
[0008] The present invention aims to solve the above-mentioned problems and other problems related thereto.
[0009] One exemplary object of the present invention is to provide a gene expression cassette for the production of diosmin or a precursor thereof, comprising AtPAL, AtC4H, Sh4CL, OsCHS, BrCHI, OsFNS and OsF3`H genes and promoters.
[0010] Another exemplary object of the present invention is to provide a recombinant vector comprising the above gene expression cassette.
[0011] Another exemplary object of the present invention is to provide a transformant transformed with the recombinant vector.
[0012] Another exemplary object of the present invention is to provide a transgenic plant transformed with the recombinant vector.
[0013] Another exemplary object of the present invention is to provide a transgenic plant transformed with the transformant.
[0014] Another exemplary purpose of the present invention is
[0015] (a) a step of preparing the recombinant vector; and
[0016] (b) It provides a method for producing a transgenic plant for producing diosmin or a precursor thereof, comprising the step of transforming the plant with the recombinant vector.
[0017] Another exemplary purpose of the present invention is
[0018] (a) a step of transforming a plant with the above recombinant vector;
[0019] (b) a step of cultivating and obtaining the transformed plant; and
[0020] (c) It provides a method for producing diosmin or a precursor thereof, comprising a step of extracting diosmin or a precursor thereof from the plant obtained above.
[0021]
[0022] The technical problem to be achieved according to the technical idea of the invention disclosed in this specification is not limited to the problem to solve the above-mentioned problem, and other problems not mentioned will be clearly understood by those skilled in the art from the description below.
[0023]
[0024] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in this application can also be applied to each other description and embodiment. In other words, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application is not limited by the specific descriptions described below.
[0025] As one aspect for achieving the above object, the present invention provides a gene expression cassette for producing diosmin or a precursor thereof, comprising AtPAL, AtC4H, Sh4CL, OsCHS, BrCHI, OsFNS and OsF3`H genes and promoters.
[0026] The 'AtPAL, AtC4H and Sh4CL genes' of the present invention are genes involved in the diosmin biosynthesis pathway, and AtPAL (Arabidopsis thaliana Phenylalanine Ammonia-Lyase) and AtC4H (Arabidopsis thaliana Cinnamate-4-Hydroxylase) were selected from Arabidopsis thaliana, and Sh4CL (Saccharum spp. Hybrid 4-Coumarate Ligase) was selected from Saccharum spp. Hybrid. The AtPAL gene encodes PAL (Phenylalanine Ammonia-Lyase), an enzyme that converts phenylalanine to trans-cinnamic acid; the AtC4H gene encodes C4H (Cinnamate-4-Hydroxylase), an enzyme that converts cinnamic acid to 4-hydroxycinnamic acid (p-coumaric acid); and the Sh4CL gene encodes 4CL (4-Coumarate Ligase), an enzyme that converts p-coumaric acid to coumaroyl-CoA.
[0027] In the present invention, the AtPAL, AtC4H, and Sh4CL genes may be composed of the conventionally known AtPAL, AtC4H, and Sh4CL gene sequences themselves, or sequences codon-optimized for the plant to be transformed. As an example, the AtPAL gene is composed of the base sequence of SEQ ID NO: 1, but is not limited thereto if a mutation having biologically equivalent activity is taken into consideration. In other words, a sequence having 'substantial identity' with the base sequence of the AtPAL gene (SEQ ID NO: 1) disclosed in the prior art may be included in the scope of the present invention, and may mean, for example, a sequence showing 80% or more sequence homology, or 90% or more sequence homology.
[0028] Likewise, the AtC4H or Sh4CL gene is composed of the base sequence of SEQ ID NO: 2 or SEQ ID NO: 3, but is not limited thereto if a variant having biologically equivalent activity is taken into consideration, and a sequence having 'substantial identity' with the base sequence of the AtC4H gene (SEQ ID NO: 2) or the base sequence of the Sh4CL gene (SEQ ID NO: 3) disclosed in the prior art may be included in the scope of the present invention, and may mean, for example, a sequence showing 80% or more sequence homology, or 90% or more sequence homology.
[0029] As an example, the AtPAL, AtC4H and Sh4CL genes of the present invention may be base sequences having sequence identity within 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100% of the base sequences of SEQ ID NOS: 1 to 3, within the range of being translated into proteins and exhibiting the biological activity of each enzyme.
[0030] In the present invention, the AtPAL, AtC4H and Sh4CL genes may be co-expressed.
[0031] The 'OsCHS, BrCHI, OsFNS and OsF3'H genes' of the present invention are genes involved in the diosmin biosynthesis pathway, and OsCHS (Oryza sativa Chalcone Synthase), OsFNS (Oryza sativa Flavone Synthase), and OsF3'H (Oryza sativa Flavonoid 3'-Hydroxylase) were selected from rice (Oryza sativa), and BrCHI (Brassica rapa Chalcone Isomerase) was selected from rapeseed (Brassica rapa).
[0032] The OsCHS gene encodes CHS (Chalcone Synthase), an enzyme that combines coumaroyl-CoA and malonyl-CoA to produce naringenin chacone; the BrCHI gene encodes CHI (Chalcone Isomerase), an enzyme that isomerizes naringenin chacone to naringenin; the OsFNS gene encodes FNS (Flavone Synthase), an enzyme that converts flavanone to flavones; and the OsF3'H gene encodes F3'H (Flavonoid 3'-Hydroxylase), an enzyme that adds a hydroxyl group to the 3' position of flavonoids to form dihydroflavonols.
[0033] In the present invention, the OsCHS, BrCHI, OsFNS and OsF3`H genes may be composed of the conventionally known OsCHS, BrCHI, OsFNS and OsF3`H sequences themselves or sequences codon-optimized for the plant to be transformed. As an example, the OsCHS gene is composed of the base sequence of SEQ ID NO: 4, but is not limited thereto if a mutation having biologically equivalent activity is taken into consideration. In other words, a sequence having 'substantial identity' with the base sequence of the OsCHS gene (SEQ ID NO: 4) disclosed in the prior art may be included in the scope of the present invention, and may mean, for example, a sequence showing 80% or more sequence homology, or 90% or more sequence homology.
[0034] Likewise, the BrCHI, OsFNS or OsF3`H gene is composed of the base sequence of SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO: 7, but is not limited thereto if a variant having biologically equivalent activity is taken into consideration, and a sequence having 'substantial identity' with the base sequence of the BrCHI gene (SEQ ID NO: 5), the base sequence of the OsFNS gene (SEQ ID NO: 6) or the base sequence of the OsF3`H gene (SEQ ID NO: 7) disclosed in the prior art may be included in the scope of the present invention, and may mean, for example, a sequence showing 80% or more sequence homology, or 90% or more sequence homology.
[0035] As an example, the OsCHS, BrCHI, OsFNS and OsF3`H genes of the present invention may be base sequences having sequence identity within 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100% of the base sequences of SEQ ID NOS: 4 to 7, within the range of being translated into proteins and exhibiting the biological activity of each enzyme.
[0036] In the present invention, the OsCHS, BrCHI, OsFNS and OsF3`H genes may be expressed simultaneously.
[0037] In the present invention, the AtPAL, AtC4H, Sh4CL, OsCHS, BrCHI, OsFNS and OsF3`H genes may be co-expressed.
[0038] The term "promoter" in the present invention refers to a region of DNA upstream from a structural gene, and refers to a DNA molecule to which RNA polymerase binds to initiate transcription. A "plant promoter" is a promoter capable of initiating transcription in plant cells. A "constitutive promoter" is a promoter that is active under most environmental conditions and developmental states or cell differentiation.
[0039] In the present invention, a conventional promoter can be used as the promoter, and examples thereof include the CaMV 35S promoter, RPS5A (ribosomal protein subunit 5a), Agrobacterium tumefaciens nopaline synthase (NOS) promoter, Agrobacterium tumefaciens octopine synthase gene (OCS) promoter, small subunit of ribulose-1,5-bisphosphate carboxylase (RBCS) promoter, etc., and specifically, the CaMV 35S promoter, but is not limited thereto.
[0040] The "Diosmin" of the present invention is a drug used to treat various vascular diseases, and is a raw material for general medicines used to improve hemorrhoids and varicose veins. Diosmin increases the tension of weakened blood vessel walls and suppresses inflammatory responses, thereby reducing pain and swelling.
[0041] Diosmin is produced by extracting hesperidin, which is found in large quantities in citrus fruits, and chemically converting it into diosmin. Hesperidin has a flavonoid (C6-C3-C6) skeletal structure, and hesperetin is produced when a methyl group (-CH3) is bonded to the 4' position of the B ring of eriodictyol, a flavanone. Hesperetin is produced when glucose is attached to the 7th position of the hesperetin A ring by 7-O-glucosyltransferase to produce hesperetin 7-O-glucoside, and hesperidin is produced when rhamnose is attached to glucose by 1,6 rhamnosyltransferase. The only difference in the chemical structure of hesperidin and diosmin is the presence or absence of a double bond between the C2 and C3 bonds of the flavonoid skeleton C ring. If a double bond is formed between C2 and C3, it becomes diosmin, and if no double bond is formed, it becomes hesperidin.
[0042] In the present invention, the precursor may be apigenin, luteolin or diosmetin.
[0043] The above 'apigenin' is found abundantly in parsley, celery, chamomile, etc., and is a flavonoid with antioxidant, anti-inflammatory, and anti-cancer effects. It is formed by two benzene rings (A and B rings) and one pyran ring (C ring) connected, with two hydroxy (OH) groups attached to the B ring and one hydroxy group also formed on the A ring.
[0044] The above 'Luteolin' is a polyphenol compound belonging to the flavonoid series used in diosmin biosynthesis, has antioxidant activity, and is composed of two benzene rings (A, B) and one pyran ring (C). It is characterized by hydroxyl groups attached to positions 5 and 7 of the A ring and 3 and 4 of the B ring of the benzene ring.
[0045] The above 'Diosmetin' is a flavonoid compound belonging to the flavonone series used in diosmin biosynthesis, and is an aglycone-type flavonone with a structure that has a hydroxyl group at the 4'-position of naringenin, and hydroxyl groups are located at the 4, 5, and 7 positions of the benzene ring.
[0046] In the present invention, the gene expression cassette may include a first multi-gene expression module comprising AtPAL, AtC4H and Sh4CL genes operably linked to a promoter; and a second multi-gene expression module comprising OsCHS, BrCHI, OsFNS and OsF3'H genes operably linked to a promoter.
[0047] In the present invention, the 'gene expression cassette for producing diosmin or a precursor thereof' includes one that promotes the production of diosmin or a precursor thereof.
[0048] The above 'increasing the production of diosmin or a precursor thereof' includes causing a plant that does not produce diosmin or a precursor thereof to produce diosmin or a precursor thereof, or increasing the production of diosmin or a precursor thereof in a plant that produces diosmin or a precursor thereof.
[0049] In the present invention, the gene expression cassette may increase luteolin biosynthesis. Specifically, when tobacco was transformed with a carrier co-expressing AtPAL, AtC4H, and Sh4CL and a carrier co-expressing OsCHS, BrCHI, OsFNS, and OsF3'H, 134.4 nmol / g FW of luteolin was produced, which was 4.5 times more than when AtPAL, OsCHS, OsFNS, and OsF3'H were co-expressed, which produced 29.8 nmol / g FW, and 16 times more than when AtPAL, OsCHS, OsFNS, and OsF3'H were individually expressed, which produced 8.4 nmol / g FW.
[0050] In the present invention, the gene expression cassette may further include one or more genes selected from the group consisting of PaF4`OMT, CsUGT76F1, and Cs1,6RhaT genes.
[0051] One or more genes selected from the group consisting of the PaF4`OMT, CsUGT76F1 and Cs1,6RhaT genes may be a single gene, such as PaF4`OMT, CsUGT76F1 or Cs1,6RhaT; or may include a combination of two (2) or more genes, i.e., multiple genes, such as the PaF4`OMT and CsUGT76F1 genes, the CsUGT76F1 and Cs1,6RhaT genes, the PaF4`OMT and Cs1,6RhaT genes; or the PaF4`OMT, CsUGT76F1 and Cs1,6RhaT genes.
[0052] The gene expression cassette containing the above multiple genes may be a gene expression cassette containing two or more single genes, each of which is expressed, or a gene expression cassette containing all two or more genes may be expressed.
[0053] The 'PaF4`OMT, CsUGT76F1 and Cs1,6RhaT genes' of the present invention are genes involved in the diosmin biosynthesis pathway, and PaF4`OMT (Perilla albifloraFlavonoid 4'-O-methyltransferase), CsUGT76F1 (Camellia sinensisUDP-Glycosyltransferase 76F1), and Cs1,6RhaT (Citrus species1,6-Rhamnosyltransferase) were selected from Perilla albiflora, Camellia sinensis, and Citrus species, respectively. The PaF4`OMT gene encodes flavonoid 4`-O-methyltransferase, an enzyme that catalyzes the addition of a methyl group to the 4'-position of flavonoids; the CsUGT76F1 gene encodes UDP-glycosyltransferase, an enzyme that catalyzes the addition of glucose to flavonoids and other small molecules; and the Cs1,6RhaT gene encodes 1,6-rhamnosyltransferase, an enzyme that adds rhamnose to flavonoids and other molecules.
[0054] In the present invention, the PaF4`OMT, CsUGT76F1 and Cs1,6RhaT genes may be composed of the conventionally known PaF4`OMT, CsUGT76F1 and Cs1,6RhaT sequences themselves or sequences codon-optimized for the plant to be transformed. As an example, the PaF4`OMT gene is composed of the base sequence of SEQ ID NO: 8, but is not limited thereto if a mutation having biologically equivalent activity is taken into consideration. In other words, a sequence having 'substantial identity' with the base sequence of the PaF4`OMT gene (SEQ ID NO: 8) disclosed in the prior art may be included in the scope of the present invention, and may mean, for example, a sequence showing 80% or more sequence homology, or 90% or more sequence homology.
[0055] Likewise, the CsUGT76F1 or Cs1,6RhaT gene is composed of the base sequence of SEQ ID NO: 13 or SEQ ID NO: 14, but is not limited thereto if a variant having biologically equivalent activity is taken into consideration, and a sequence having 'substantial identity' with the base sequence of the CsUGT76F1 gene (SEQ ID NO: 13) or the base sequence of the Cs1,6RhaT gene (SEQ ID NO: 14) disclosed in the prior art may be included in the scope of the present invention, and may mean, for example, a sequence showing 80% or more sequence homology, or 90% or more sequence homology.
[0056] As an example, the PaF4`OMT, CsUGT76F1 and Cs1,6RhaT genes of the present invention may be base sequences having sequence identity within 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100% of the base sequences of SEQ ID NOS: 8, 13 and 14, within the range of being translated into proteins and exhibiting the biological activity of each enzyme.
[0057] In the present invention, the gene expression cassette may include all of the PaF4`OMT, CsUGT76F1 and Cs1,6RhaT genes, and the PaF4`OMT, CsUGT76F1 and Cs1,6RhaT genes may be expressed simultaneously.
[0058] In the present invention, the gene expression cassette may further include a third multiple gene expression module comprising PaF4`OMT, CsUGT76F1 and Cs1,6RhaT genes operably linked to a promoter. This increases diosmin production, and specifically, in the case of tobacco transformed by introducing the first multi-gene expression module co-expressing AtPAL, AtC4H, and Sh4CL, the second multi-gene expression module co-expressing OsCHS, BrCHI, OsFNS, and OsF3'H, and the third multi-gene expression module co-expressing PaF4'OMT, CsUGT76F1, and Cs1,6RhaT, the diosmin production was 61.9 nmol / g FW, which was about 1.63 times higher than the production of the combination in which the first multi-gene expression module co-expressing AtPAL, AtC4H, and Sh4CL, the second multi-gene expression module co-expressing OsCHS, BrCHI, OsFNS, and OsF3'H, and PaF4'OMT, CsUGT76F1, and Cs1,6RhaT were each expressed, which was 38.1 nmol / g FW.
[0059] In the present invention, the AtPAL, AtC4H, Sh4CL, OsCHS, BrCHI, OsFNS, OsF3`H, PaF4`OMT, CsUGT76F1 and Cs1,6RhaT genes may have codons optimized for expression in plants. In the present invention, the meaning of 'optimization of expression in plants' means recombining genes so that a gene not derived from a specific plant can be maximally expressed in cells of a specific plant, and for the purpose of the present invention, it means converting a codon of a gene not derived from a specific plant into a codon preferred by a specific plant. The 'codon' refers to a sequence of three consecutive bases that designates a specific amino acid. Since 61 types of codons consisting of adenine (A), thymine (T), guanine (G), and cytosine (C) specify 20 amino acids, there are multiple codons that specify specific amino acids, and it is known that the preferred codons for each species, that is, the frequency of occurrence of codons in the genes of different species, are all different.
[0060] In the present invention, the gene expression cassette may increase the biosynthesis of diosmetin or diosmetin 7-O-glucoside.
[0061] As another aspect for achieving the above purpose, the present invention provides a recombinant vector comprising the gene expression cassette.
[0062] In the present invention, 'recombinant' can be used interchangeably with 'genetic manipulation', and means producing a gene that does not exist in nature by using molecular cloning experimental techniques such as modifying, cutting, and connecting genes.
[0063] In the present invention, the 'recombinant vector' may specifically include all of AtPAL, AtC4H, Sh4CL, OsCHS, BrCHI, OsFNS and OsF3`H, and may further include one or more selected from PaF4`OMT, CsUGT76F1 and Cs1,6RhaT. In the present invention, the recombinant vector is an 'expression vector', and such an expression vector is a vector capable of expressing a desired protein or nucleic acid (RNA) in a suitable host cell, and refers to a genetic construct including essential regulatory elements operably linked so that a gene insert can be expressed. It refers to a bacterial plasmid, a phage, a yeast plasmid, a plant cell virus, a mammalian cell virus, or another vector, and in general, any plasmid and vector can be used as long as it can replicate and be stabilized in the host. "Operably linked" means that a nucleic acid expression control sequence and a nucleic acid sequence encoding a desired protein or RNA are functionally linked to perform a general function, and that the gene is linked so that it can be expressed by the expression control sequence. The "expression control sequence" refers to a DNA sequence that controls the expression of a polynucleotide sequence operably linked in a specific host cell. Such control sequences include a promoter for performing transcription, an arbitrary operator sequence for controlling transcription, a sequence encoding a suitable mRNA ribosome binding site, a sequence controlling the termination of transcription and translation, an initiation codon, a stop codon, a polyadenylation signal, and an enhancer.
[0064] In the present invention, an expression vector comprising AtPAL, AtC4H, Sh4CL, OsCHS, BrCHI, OsFNS, OsF3`H, PaF4`OMT, CsUGT76F1, and Cs1,6RhaT gene sequences and appropriate transcription / translation control signals can be constructed by methods well known to those skilled in the art. Such methods include in vitro recombinant DNA techniques, DNA synthesis techniques, and in vivo recombination techniques. The DNA sequences can be effectively linked to an appropriate promoter within the expression vector to drive mRNA synthesis. In addition, the expression vector can include a ribosome binding site as a translation initiation site and a transcription terminator.
[0065] In the present invention, the host vector for producing the recombinant vector is specifically the pAGM8043 vector, and any Agrobacterium commonly used for plant transformation can be used, and specifically, Agrobacterium tumefaciens GV3101 can be used.
[0066] An expression vector may specifically include one or more selectable markers. These markers are nucleic acid sequences that have properties that can be selected, typically by chemical means, and include any gene that can distinguish transformed cells from untransformed cells. Examples include, but are not limited to, genes conferring resistance to herbicides such as glyphosate or phosphinothricin, genes conferring resistance to antibiotics such as kanamycin, G418, bleomycin, hygromycin, and chloramphenicol, and the aadA gene.
[0067] As another aspect for achieving the above purpose, the present invention provides a transformant transformed with the recombinant vector.
[0068] The above 'recombination vector' is as described above.
[0069] The 'transformant' of the present invention is a host cell capable of stably cloning and expressing a vector, and any host cell known in the art can be used, and may be Escherichia coli, Bacillus subtilis, Streptomyces, Pseudomonas, Proteus mirabilis, Staphylococcus, and Agrobacterium tumefaciens, more preferably Agrobacterium tumefaciens, and as an example, Agrobacterium tumefaciens GV3101.
[0070] As another aspect for achieving the above purpose, the present invention provides a transgenic plant transformed with the recombinant vector or the transformant.
[0071] The above 'recombinant', 'recombinant vector' and 'transformant' are as described above.
[0072] The 'plant' of the present invention may be used without limitation as long as it is a plant capable of producing diosmin by expression of the AtPAL, AtC4H, Sh4CL, OsCHS, BrCHI, OsFNS, OsF3`H, PaF4`OMT, CsUGT76F1 and Cs1,6RhaT genes, but specifically may be selected from the group consisting of tobacco, Arabidopsis thaliana, corn, rice, soybean, canola, alfalfa, sunflower, sorghum, wheat, cotton, peanut, tomato, potato, lettuce and pepper, and more specifically may be tobacco.
[0073] As another aspect for achieving the above purpose, the present invention
[0074] (a) a step of preparing the recombinant vector; and
[0075] (b) A method for producing a transgenic plant for producing diosmin or a precursor thereof, comprising the step of transforming the plant with the recombinant vector, is provided.
[0076] The above 'recombinant', 'recombinant vector', 'diosmin', 'precursor' and 'plant' are as described above.
[0077] The 'transformation step' of the present invention can be prepared without limitation using a plant transformation method known in the art. As a plant transformation method, for example, a method of fusing a liposome containing a recombinant vector according to the present invention with a plant protoplast, a method of injecting a recombinant vector into a plant protoplast using PEG, a method of direct injection of the recombinant vector into a plant cell, a microparticle bombardment method, a gene gun, electroporation, a virus-based transformation method, a vacuum infiltration method, a floralmeristem dipping method, etc. can be used. Preferably, a transformation method using Agrobacterium can be used.
[0078] The above 'transformation method using Agrobacterium' is a method of transferring external genes to plant cells using Agrobacterium, a Gram-negative soil bacterium that causes tumors in the roots and stems of plants. This method utilizes the phenomenon in which the T-DNA (transfer DNA) of the tumor-inducing plasmid (Ti plasmid) found in Agrobacterium, such as Agrobacterium tumefaciens and Agrobacterium rhizogenes, is inserted into the genome of the plant.
[0079] The transformation method using Agrobacterium in the present invention can be used to transiently express or stably express the AtPAL, AtC4H, Sh4CL, OsCHS, BrCHI, OsFNS, OsF3`H, PaF4`OMT, CsUGT76F1, and Cs1,6RhaT genes. For transient expression, a part of a plant, for example, a leaf of a plant, is transformed by infecting it with Agrobacterium containing a recombinant vector, and after a period of time in which the desired gene can be sufficiently expressed, the infected part of the plant can be obtained. For stable expression, plant cells or tissues are cultured, infected with Agrobacterium, transformed, and then further cultured to select suitable transformants, and after a redifferentiation process, they can be cultured into transformed plants with complete structures. By obtaining seeds from the transformed plants and allowing them to germinate, stably transformed plants can be obtained in the next generation.
[0080] As another aspect for achieving the above purpose, the present invention
[0081] (a) a step of transforming a plant with the recombinant vector;
[0082] (b) a step of cultivating and obtaining the transformed plant; and
[0083] (c) A method for producing diosmin or a precursor thereof is provided, comprising a step of extracting diosmin or a precursor thereof from the plant obtained above.
[0084] The above 'recombinant', 'recombinant vector', 'plant', 'transformation step', 'diosmin' and precursor are as described above.
[0085] The above 'step of cultivating plants' means providing environmental conditions such as light, temperature, and humidity, and elements necessary for plant growth, such as water, inorganic salts, nutrients, and hormones, after transforming a plant, for a period of time during which the plant expresses an amount of genes that matches the target. When cells, tissues, or cultures thereof isolated from a plant are transformed, elements necessary for plant tissue culture, such as water, nutrients, inorganic salts, and growth regulators, can be delivered through a culture medium. In addition, when AtPAL, AtC4H, Sh4CL, OsCHS, BrCHI, OsFNS, OsF3'H, PaF4'OMT, CsUGT76F1, and Cs1,6RhaT genes according to the present invention are expressed in a plant using an inducible promoter, the plant can be cultivated while applying a corresponding stimulus, such as light, heat, or hormones, necessary for activating the inducible promoter.
[0086] The above 'step of obtaining a plant' means obtaining all or part of a transformed plant that overexpresses a target gene. It may be obtaining a transformed part such as a root, stem, leaf, etc. that overexpresses the gene of the present invention, or a seed of a transformed plant, or it may be obtaining a culture of plant cells or tissues, for example, a callus or protoplast transformed with AtPAL, AtC4H, Sh4CL, OsCHS, BrCHI, OsFNS, OsF3`H, PaF4`OMT, CsUGT76F1, and Cs1,6RhaT genes.
[0087] The above 'step of extracting diosmin or a precursor thereof' is a step of isolating diosmin or a precursor thereof from a transgenic plant, wherein the transgenic plant is crushed and filtered to extract diosmin or a precursor thereof. Diosmin or a precursor thereof can be separated with high purity by filtering using a known method such as chromatography. In order to extract diosmin or a precursor thereof, the plant can be pretreated by freezing or drying. By the production method of the present invention, transgenic plants expressing multiple genes of AtPAL, AtC4H, Sh4CL, OsCHS, BrCHI, OsFNS, OsF3`H, PaF4`OMT, CsUGT76F1 and Cs1,6RhaT can be rapidly propagated in large quantities, thereby mass-producing diosmin or a precursor thereof.
[0088]
[0089] The reconstruction of the diosmin biosynthetic pathway through optimal gene selection according to the present invention has the effect of enabling mass production of diosmin or its precursor in plants, and therefore can be usefully used for mass production of diosmin or its precursor in the form of a gene expression cassette, a recombinant vector, a transformant, a transgenic plant, a method for producing a transgenic plant, or a method for producing diosmin or its precursor.
[0090]
[0091] Figure 1 shows the diosmin biosynthetic metabolic pathway.
[0092] Figure 2 shows a gene combination module involved in luteolin biosynthesis.
[0093] Figure 3 shows the results of UPLC-DAD-QToF-MS analysis over time to confirm the amount of luteolin produced by each module.
[0094] Figure 4 shows the results of UPLC-DAD-QToF-MS analysis to confirm the amount of luteolin produced by each module according to mass / charge.
[0095] Figure 5 shows the quantified results of UPLC-DAD-QToF-MS analysis to confirm the amount of luteolin produced by each module.
[0096] Figure 6 shows the results of measuring the expression of flavonoid-4`-O-methyltransferases in bacterial cells.
[0097] Figure 7 shows the results of HPLC analysis to confirm the amount of diosmetin produced by flavonoid-4`-O-methyltransferases.
[0098] Figure 8 shows the results of UPLC-DAD-QToF-MS analysis to confirm the production of diosmetin in tobacco leaves introduced with PC4+CCFF or PC4+CCFF and PaF4`OMT.
[0099] Figure 9 shows the results of UPLC-DAD-QToF-MS analysis over time to confirm the production of diosmetin in tobacco leaves introduced with the PC4+CCFF module and PaF4`OMT together.
[0100] Figure 10 shows the results of UPLC-DAD-QToF-MS analysis to confirm the production of diosmetin in tobacco leaves by introducing the PC4+CCFF module and PaF4`OMT together, according to mass / charge.
[0101] Figure 11 shows the quantification results of UPLC-DAD-QToF-MS analysis to confirm the production of diosmetin in tobacco leaves introduced with the PC4+CCFF module and PaF4`OMT together.
[0102] Figure 12 shows the results of UPLC-DAD-QToF-MS analysis over time to determine the production of diosmetin 7-O-glucoside in tobacco leaves introduced with CsUGT76F1.
[0103] Figure 13 shows the results of UPLC-DAD-QToF-MS analysis to determine the production of diosmetin 7-O-glucoside in tobacco leaves introduced with CsUGT76F1, according to mass / charge.
[0104] Figure 14 shows the results of measuring the expression of rhamnosyltransferases in bacterial cells.
[0105] Figure 15 shows the results of UPLC-DAD-QToF-MS analysis to confirm the amount of diosmin produced by rhamnosyltransferases over time.
[0106] Figure 16 shows the results of UPLC-DAD-QToF-MS analysis to confirm the amount of diosmin produced by rhamnosyltransferases according to mass / charge.
[0107] Figure 17 shows the quantified results of UPLC-DAD-QToF-MS analysis to confirm the amount of diosmin production in tobacco leaves introduced with Cs1,6RhaT.
[0108] Figure 18 shows a gene combination module involved in diosmin biosynthesis.
[0109] Figure 19 shows the results of UPLC-DAD-QToF-MS analysis over time to determine the amount of diosmin production in tobacco leaves in which PC4, CCFF, and OGR modules are co-expressed.
[0110] Figure 20 shows the results of UPLC-DAD-QToF-MS analysis to determine the amount of diosmin production in tobacco leaves in which PC4, CCFF, and OGR modules are co-expressed, plotted according to mass / charge.
[0111] Figure 21 shows the results of quantifying diosmin production in tobacco leaves co-expressing PC4, CCFF, and OGR modules using UPLC-DAD-QToF-MS.
[0112] Figure 22 shows the results of UPLC-DAD-QToF-MS analysis to determine the production of apigenin-7-O-rutinoside in tobacco leaves in which PC4, CCFF, and OGR modules are co-expressed, plotted according to mass / charge.
[0113] Figure 23 shows the results of UPLC-DAD-QToF-MS analysis to determine the production of luteolin-7-O-rutinoside in tobacco leaves in which PC4, CCFF, and OGR modules are co-expressed, plotted according to mass / charge.
[0114] Figure 24 shows the results of quantification of UPLC-DAD-QToF-MS analysis of apigenin-7-O-rutinoside and luteolin-7-O-rutinoside in tobacco leaves in which PC4, CCFF, and OGR modules are co-expressed.
[0115]
[0116] Hereinafter, the present invention will be described in more detail through the following examples. However, these examples are intended to exemplify the present invention and the scope of the present invention is not limited to these examples.
[0117]
[0118] Example 1. Prediction of the diosmin biosynthetic metabolic pathway and selection of an optimal combination of genes related to the diosmin biosynthetic metabolic pathway.
[0119] 1. Prediction of diosmin biosynthetic pathway and selection of candidate genes
[0120] The biosynthetic pathway of diosmin or its precursor according to the present invention is predicted as shown in Fig. 1. The starting material of the diosmin biosynthetic pathway is phenylalanine, which is detected in large quantities in plants such as tobacco (Nicotiana benthamiana). Specifically, it is known to be detected at a level of 70 nmol / g FW in tobacco (Nicotiana benthamiana). Candidate genes for diosmin biosynthesis include phenylalanine ammonia lyase (PAL), cinnamate 4 hydroxylase (C4H), 4-coumarate lyase (4CL), chalcone synthase (CHS), chalcone isomerase (CHI), flavanone 3-hydroxylase (F3`H), and flavone synthase (F3`H). There are a total of 10 genes, including flavonoid-4`-O-methyltransferase (FNS), flavonoid-4`-O-methyltransferase (F4'OMT), flavonoid 7-O-glucosyltransferase (F7GT), and 1,6 rhamnosyltransferase (1,6 RhaT).
[0121] The above 10 gene sequences were obtained by analyzing the cDNA library of the National Center for Biotechnology Information (NCBI), and the candidate sequences of optimized gene combinations were isolated from plants containing each enzyme gene using reverse transcription-PCR. The diosmin biosynthetic pathway and sequence numbers involved in the 10 isolated genes are shown in Table 1.
[0122]
[0123] The coding sequences (CDS) of the 10 genes finally selected among the 16 genes were amplified using Q5™ High-Fidelity DNA Polymerase (New England BioLabs, USA) and gene-specific primers (Table 2). The PCR conditions for DNA amplification were as follows: 98°C for 30 s, followed by 33 cycles of 98°C for 10 s, 58°C for 15 s, and 72°C for 40 s, and a final extension at 72°C for 2 min. The PCR products were purified using a Gel Extraction Kit (Qiagen, Hilden, Germany), subcloned into Level 0 vectors, and confirmed by sequencing.
[0124]
[0125] Gene primer sequence (5' → 3') SEQ ID NO: AtPALFTTGAAGACAAAATGGAGATTAACGGGGCACAC17RTTGAAGACAAAAGCCCTTAACATATTGGAATGGGAGCTC18AtC4HFTTGAAGACAAAATGGATTCTGCTACTCCTTGAGAA19RTTGAAGACAAAAGCTTAGCAGTTCCGCGGCTTCATAAC20Sh4CLFTTGAAGACAAAA TGGAGACTCCTCCCCAAGA21RTTGAAGACAAAAGCCTAATTAGGAAGATCAGCTGCTAGC22OsCHSFTTGAAGACAAAATGGCTGCTGCAG23RTTGAAGACAAAAGCTCATGCCGCG24BrCHIFTTGAAGACAAAATGTCTTCTTCCAACTGTCCGTC25RTTGAAGACAAAAGCTCAGTTCTCTTT GGCCAGTTTATC26OsFNSFTTGAAGACAAAATGGCATCATTG27RTTGAAGACAAAAGCTCACAGGAG28OsF3'H(OsCYP75B3)FTTGAAGACAAAAGCTCAAACACC29RTTGAAGACAAAATGGACGTAGTGC30PaF4'OMTFTTGAAGACAAAATGGCGGTATCCAC31RTTGAAGACAAAAG CCTACTTCCGGAC32CsUGT76F1FTTGAAGACAAAATGGATCAAAGAAAAGGTCGCAG33RTTGAAGACAAAAGCTTACTGAGTGTGGAAAGTAAATGTCTC34Cs1,6RhaTFTTGAAGACAAAATGCACGCCCCTTCGAAC35RTTGAAGACAAAAGCCTATTAAGCTAAGGCTTTGAGATCCTTG36
[0126] 2. Selection of an optimized combination of genes related to the diosmin biosynthetic metabolic pathway.
[0127] 2.1. Selection of genes to optimize luteolin production and construction of modular carriers
[0128] AtPAL, OsCHS, OsFNS, OsF3'H genes and AtC4H, Sh4CL, BrCHI were newly added and introduced into binary vectors plCH47791 (AtPAL), plCH47751 (OsCHS), plCH47772 (OsFNS), plCH47781 (OsF3'H), plCH47732 (AtC4H), plCH47742 (Sh4CL), plCH47761 (BrCHI), respectively, to construct a vector, which was then transformed into Agrobacterium tumefaciens GV3101. The existing carrier that simultaneously expressed AtPAL, OsCHS, OsFNS, and OsF3'H was named PCFF, and the carrier that individually expressed these genes as four genes was named P+C+F+F. For modularization by metabolic pathway, the carrier that simultaneously expressed three phenylpropanoid metabolic pathway genes AtPAL, AtC4H, and Sh4CL was named PC4, and the carrier that simultaneously expressed four genes OsCHS, BrCHI, OsFNS, and OsF3'H for synthesizing luteolin in the flavonoid metabolic pathway was named CCFF. The carrier that did not introduce any of the genes among AtPAL, OsCHS, OsFNS, OsF3'H, AtC4H, Sh4CL, and BrCHI was named GV and used as a negative control (Fig. 2). The Agrobacterium solution transformed with these carriers was injected onto the back of tobacco (Nicotiana benthamiana) leaves and cultured for 6 days.
[0129] To confirm whether luteolin was produced by a combination of genes transiently expressed in tobacco leaves, leaf samples were collected, frozen, and ground, extracted with 80% methanol for one day, and then treated with acidic alcohol (1 N HCl) at 95°C for 2 hours to aglycone flavonoid molecules existing in the plant in the form of glycosides, and UPLC-DAD-QToF-MS analysis was performed. The fragment ion m / z value of luteolin aglycone, 287.05 [M+H]+ peak, was detected at 24.1 min for all three combinations of P+C+F+F, PCFF, and PC4+CCFF and compared with the luteolin standard (Fig. 3), and detected according to mass / charge and compared with the luteolin standard (Fig. 4). This was quantified (Fig. 5). That is, three different combinations of transporters, P+C+F+F, PCFF, and PC4+CCFF, were transiently expressed in tobacco and the production of luteolin was compared. The P+C+F+F combination produced 8.4 nmol / g FW, the PCFF combination 29.8 nmol / g FW, and the PC4+CCFF combination 134.4 nmol / g FW of luteolin, confirming that PC4+CCFF is the optimal reconstructed module combination that produces 4.5 times more luteolin than PCFF and 16 times more than P+C+F+F.
[0130]
[0131] 2.2. Selection of the optimal enzyme gene for biosynthesizing luteolin into diosmin
[0132] Luteolin is biosynthesized into diosmetin by flavonoid-4`-O-methyltransferase (F4`OMT), and diosmetin is ultimately converted into diosmin by glucosyltransferase and rhamnosyltransferase.
[0133] In order to select the optimal genes for biosynthesizing diosmin from luteolin, five previously reported flavonoid-4`-O-methyltransferase (F4`OMT) genes, PaF4`OMT, MpOMT4, SOMT2, CreOMT1, and CreOMT4, one flavonoid 7-O-glucosyltransferase (F7GT) gene, CsUGT76F1, 1,6 rhamnosyltransferase (1,6 RhaT), and three genes, Cs1,6RhaT, CiRhaT-GD4x, and CiRhaT-AH2x, were selected.
[0134]
[0135] 2.2.1. Selection of the optimal flavonoid-4`-O-methyltransferase
[0136] The CDS of flavonoid-4'-O-methyltransferase was introduced into the bacterial expression vector pGEX-6p-1, and expression was confirmed by culturing bacterial cells. The vehicle control group (VC) corresponds to a negative control group that only includes a vehicle without the flavonoid-4'-O-methyltransferase gene (Fig. 6).
[0137] Afterwards, luteolin as a substrate was added and cultured for 3 hours to extract flavonoids from bacterial cells with ethyl acetate, evaporate the ethyl acetate with nitrogen gas, and elute the flavonoids in 80% methanol, which were analyzed by HPLC and UPLC-DAD-QToF-MS. The experimental group containing only the carrier without the gene was set as a negative control group, indicated as VC, and HPLC analysis confirmed that diosmetin was produced from the luteolin substrate by PaF4´OMT and MpOMT4, SOMT2, CreOMT1, and CreOMT4. This was confirmed by comparing the retention time and UV-spectrum values with the standard values of diosmetin and luteolin, and the analysis results showed that PaF4´OMT had the highest 4´-O-methyltransferase activity, and thus was selected as the optimal gene (Fig. 7).
[0138] PaF4´OMT, selected through an E. coli feeding assay, was introduced into the binary vector plCH47791 to construct a carrier, which was then transformed into Agrobacterium tumefaciens GV3101. The Agrobacterium solution transformed with PC4+CCFF and PaF4´OMT carriers was injected into the back of tobacco (Nicotiana benthamiana) leaves for 6 days, step by step of biosynthesis. To determine whether diosmetin was produced by a combination of genes transiently expressed in tobacco leaves, leaf samples were collected, frozen, and ground, extracted with 80% methanol for one day, and then treated with acidic alcohol (1 N HCl) at 95°C for 2 hours to perform UPLC-DAD-QToF-MS analysis of aglycone-formed flavonoids. As a result, it was confirmed that diosmetin was produced in the combination of PC4+CCFF and PaF4'OMT (Fig. 8), and the fragment ion m / z value of 301.07 [M+H]+ peak was detected at 25.6 min and compared with the diosmetin standard (Fig. 9), and the detection was performed according to mass / charge and compared with the diosmetin standard (Fig. 10), and as a result of quantifying this, it was confirmed that approximately 48.7 nmol / g FW of diosmetin was produced in the combination of PC4+CCFF+PaF4´OMT (Fig. 11).
[0139]
[0140] 2.2.2. Confirmation of the production efficiency of diosmetin 7-O-glucoside by flavonoid 7-O-glucosyltransferase.
[0141] CsUGT76F1 was selected as the optimal gene through an E. coli feeding assay and introduced into the binary vector plCH47742 to construct a carrier, which was then transformed into Agrobacterium tumefaciens GV3101. The Agrobacterium solution transformed with PC4+CCFF, PaF4'OMT, and the CsUGT76F1 carrier was injected into the back of tobacco (Nicotiana benthamiana) leaves for 6 days. To determine whether diosmetin 7-O-glucoside was produced by a combination of genes transiently expressed in tobacco leaves, leaf samples were collected, frozen, and ground, extracted with 80% methanol for one day, and then treated with acidic alcohol (1 N HCl) at 95°C for 2 hours to perform UPLC-DAD-QToF-MS analysis of aglycone-formed flavonoids. In the combination of PC4+CCFF and PaF4'OMT and CsUGT76F1 sequentially added, a fragment ion m / z value of 463.12 [M+H]+ peak was detected at 21.8 min and compared with the diosmetin 7-O-glucoside standard (Fig. 12). The detection was performed according to mass / charge and compared with the diosmetin 7-O-glucoside standard (Fig. 13). The results of quantification showed that 33.1 nmol / g FW of diosmetin 7-O-glucoside was produced in the combination of PC4+CCFF+PaF4'OMT+CsUGT76F1. Through this, it was confirmed that the CsUGT76F1 gene can be used in combination to produce diosmetin 7-O-glucoside.
[0142]
[0143] 2.2.3. Selection of the optimal 1,6 rhamnosyltransferase
[0144] The CDS of 1,6 rhamnosyltransferase was introduced into the bacterial expression vector pGEX-6p-1, and expression was confirmed by culturing bacterial cells. VC corresponds to the negative control group in which the 1,6 rhamnosyltransferase gene was not introduced (Fig. 14).
[0145] Afterwards, the substrate diosmetin 7-O-glucoside was added and cultured for 3 hours to extract flavonoids from the bacterial cells with ethyl acetate. After evaporating the ethyl acetate with nitrogen gas, the flavonoids were eluted in 80% methanol and analyzed by HPLC and UPLC-DAD-QToF-MS. Through UPLC-DAD-QToF-MS analysis, the fragment ion m / z value of 607.16 [M+H]+ peak was detected in all three RhaT candidates, Cs1,6RhaT, CiRhaT-GD4x, and CiRhaT-AH2x. Among them, Cs1,6RhaT showed the highest 1,6 rhamnosyltransferase activity, and was selected as the optimal gene (Fig. 15).
[0146] Cs1,6RhaT was selected as the optimal gene through an E. coli feeding assay and introduced into the binary vector plCH47732 to construct a carrier, which was then transformed into Agrobacterium tumefaciens GV3101. The Agrobacterium solution transformed with PC4+CCFF, PaF4`OMT, CsUGT76F1, and Cs1,6RhaT carriers was injected into the back of tobacco (Nicotiana benthamiana) leaves for 6 days. To determine whether diosmin was produced by a combination of genes transiently expressed in tobacco leaves, leaf samples were collected, frozen, and ground, extracted with 80% methanol for one day, and then treated with acidic alcohol (1 N HCl) at 95°C for 2 hours to perform UPLC-DAD-QToF-MS analysis of aglycone-formed flavonoids. In the combination of PC4+CCFF and PaF4'OMT, CsUGT76F1, and Cs1,6RhaT, the fragment ion m / z value of 607.16 [M+H]+ peak was detected according to mass / charge and compared with the diosmin standard (Fig. 16). The quantified results showed that 38.1 nmol / g FW diosmin was produced in the combination of PC4+CCFF+PaF4'OMT+CsUGT76F1+Cs1,6RhaT (Fig. 17).
[0147]
[0148] Example 2. Optimization of diosmin production through modularization of selected optimal genes.
[0149] Using the 10 optimal genes of the diosmin biosynthetic pathway selected in Example 1, a multi-gene expression vector of three genes, a phenylpropanoid biosynthetic module (PC4), a luteolin biosynthetic module (CCFF), and a luteolin modifier module (OGR), was constructed and transiently expressed in tobacco leaves by transforming Agrobacterium tumefaciens GV3101 (Fig. 18). The Agrobacterium solution transformed with the PC4+CCFF+OGR vector was injected onto the back of tobacco leaves and cultured for 6 days.
[0150] To confirm whether diosmin was produced by a combination of genes transiently expressed in tobacco leaves, leaf samples were collected, frozen, and ground, and extracted with 80% methanol for one day, followed by UPLC-DAD-QToF-MS analysis of flavonoid glycosides. The fragment ion m / z value of 609.18 [M+H]+ peak was detected at 25.0 min in the PC4+CCFF+OGR module and compared with the diosmin standard (Fig. 19). The mass / charge was compared with the diosmin standard (Fig. 20), and this was quantified and presented (Fig. 21).
[0151] The amount of diosmin produced using the modular transporter co-expressing three metabolic pathways was 61.9 nmol / g FW, which was approximately 1.63 times higher than that of the PC4+CCFF+PaF4`OMT+CsUGT76F1+Cs1,6RhaT combination in which PC4, CCFF, PaF4`OMT, CsUGT76F1, and Cs1,6RhaT were expressed, respectively, producing 38.1 nmol / g FW of diosmin. It is judged to be a similar level of production to that of diosmin (400 μg / g DW) produced in lemons among citrus fruits.
[0152]
[0153] Example 3. Confirmation of the production of apigenin glycosides and luteolin glycosides by the selected optimal gene module.
[0154] In order to confirm whether flavone glycosides were produced by a combination of genes transiently expressed in tobacco leaves using a multi-gene expression vector of three genes, namely, a phenylpropanoid biosynthesis module (PC4), a luteolin biosynthesis module (CCFF), and a luteolin modifying enzyme module (OGR), manufactured in the same manner as in Example 2, leaf samples were collected, frozen, and ground, extracted with 80% methanol for one day, and then UPLC-DAD-QToF-MS analysis of flavone glycosides was performed. Peaks containing fragment ion m / z values of 271.06 and 287.05 of apigenin aglycone and luteolin aglycone were extracted from the MS spectrum in the PC4+CCFF+OGR module, and apigenin 7-O-rutinoside and luteolin 7-O-rutinoside were identified (Figs. 22 and 23) and quantified (Fig. 24). This indicates that, in addition to diosmin, glycosides in the form of apigenin 7-O-rutinoside and luteolin 7-O-rutinoside were additionally produced.
[0155]
[0156] From the above description, those skilled in the art will understand that the present invention can be implemented in other specific forms without altering its technical spirit or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present invention should be interpreted as encompassing all changes or modifications derived from the meaning and scope of the following claims and their equivalent concepts, rather than the detailed description above.
Claims
1. A gene expression cassette for the production of diosmin or a precursor thereof, comprising AtPAL, AtC4H, Sh4CL, OsCHS, BrCHI, OsFNS and OsF3`H genes and promoters.
2. In paragraph 1, The above AtPAL gene is a gene expression cassette for producing diosmin or a precursor thereof, comprising a base sequence of sequence number 1.
3. In paragraph 1, The above AtC4H gene is a gene expression cassette for producing diosmin or a precursor thereof, comprising a base sequence of sequence number 2.
4. In paragraph 1, The above Sh4CL gene is a gene expression cassette for producing diosmin or a precursor thereof, comprising a base sequence of sequence number 3.
5. In paragraph 1, The above OsCHS gene is a gene expression cassette for producing diosmin or a precursor thereof, comprising a base sequence of sequence number 4.
6. In paragraph 1, The above BrCHI gene is a gene expression cassette for producing diosmin or a precursor thereof, comprising a base sequence of sequence number 5.
7. In paragraph 1, The above OsFNS gene is a gene expression cassette for producing diosmin or a precursor thereof, comprising a base sequence of sequence number 6.
8. In paragraph 1, The above OsF3`H gene is a gene expression cassette for producing diosmin or a precursor thereof, comprising a base sequence of sequence number 7.
9. In paragraph 1, A gene expression cassette for the production of diosmin or its precursor, wherein the AtPAL, AtC4H and Sh4CL genes are co-expressed.
10. In paragraph 1, A gene expression cassette for the production of diosmin or its precursor, wherein the OsCHS, BrCHI, OsFNS and OsF3`H genes are co-expressed.
11. In paragraph 1, A gene expression cassette for producing diosmin or a precursor thereof, wherein the gene expression cassette comprises a first multi-gene expression module comprising AtPAL, AtC4H and Sh4CL genes operably linked to a promoter; and a second multi-gene expression module comprising OsCHS, BrCHI, OsFNS and OsF3'H genes operably linked to a promoter.
12. In paragraph 1, A gene expression cassette for the production of diosmin or a precursor thereof, wherein the precursor is apigenin, luteolin or diosmetin.
13. In paragraph 1, The above gene expression cassette is a gene expression cassette for the production of diosmin or a precursor thereof, which increases luteolin biosynthesis.
14. In paragraph 1, A gene expression cassette for producing diosmin or a precursor thereof, wherein the gene expression cassette further comprises at least one selected from the group consisting of PaF4`OMT, CsUGT76F1 and Cs1,6RhaT genes.
15. In paragraph 14, The above PaF4`OMT gene is a gene expression cassette for producing diosmin or a precursor thereof, comprising a base sequence of sequence number 8.
16. In paragraph 14, The above CsUGT76F1 gene is a gene expression cassette for producing diosmin or a precursor thereof, comprising a base sequence of SEQ ID NO:
13.
17. In paragraph 14, The above Cs1,6RhaT gene is a gene expression cassette for producing diosmin or a precursor thereof, comprising a base sequence of sequence number 14.
18. In paragraph 14, A gene expression cassette for producing diosmin or a precursor thereof, wherein the gene expression cassette further comprises a third multiple gene expression module comprising PaF4`OMT, CsUGT76F1 and Cs1,6RhaT genes operably linked to a promoter.
19. A recombinant vector comprising a gene expression cassette of any one of claims 1 to 18.
20. A transformant transformed with a recombinant vector according to Article 19.
21. In paragraph 20, A transformant, wherein the transformant is Agrobacterium.
22. A transgenic plant transformed with the recombinant vector of Article 19.
23. In paragraph 22, A transgenic plant, characterized in that the plant is selected from the group consisting of tobacco, Arabidopsis thaliana, corn, rice, soybean, canola, alfalfa, sunflower, sorghum, wheat, cotton, peanut, tomato, potato, lettuce, and pepper.
24. A transgenic plant transformed with the transformant of Article 20.
25. In paragraph 24, A transgenic plant, characterized in that the plant is selected from the group consisting of tobacco, Arabidopsis thaliana, corn, rice, soybean, canola, alfalfa, sunflower, sorghum, wheat, cotton, peanut, tomato, potato, lettuce, and pepper. 26.(a) A step of preparing the recombinant vector of Article 19; and (b) A method for producing a transgenic plant for producing diosmin or a precursor thereof, comprising the step of transforming the plant with the recombinant vector.
27. In paragraph 26, A method for producing a transformed plant, wherein the transformation is performed by Agrobacterium into which the recombinant vector has been introduced.
28. In paragraph 26, A method for producing a transgenic plant, wherein the precursor is apigenin, luteolin or diosmetin.
29. In paragraph 26, A method for producing a transgenic plant, characterized in that the plant is selected from the group consisting of tobacco, Arabidopsis thaliana, corn, rice, soybean, canola, alfalfa, sunflower, sorghum, wheat, cotton, peanut, tomato, potato, lettuce, and pepper. 30.(a) A step of transforming a plant with the recombinant vector of paragraph 19; (b) a step of cultivating and obtaining the transformed plant; and (c) A method for producing diosmin or a precursor thereof, comprising a step of extracting diosmin or a precursor thereof from the plant obtained above.
31. In paragraph 30, A method for producing diosmin or a precursor thereof, wherein the transformation is performed by Agrobacterium into which the recombinant vector has been introduced.
32. In paragraph 30, A method for producing diosmin or a precursor thereof, wherein the precursor is apigenin, luteolin or diosmetin.
33. In paragraph 30, A method for producing diosmin or a precursor thereof, characterized in that the plant is selected from the group consisting of tobacco, Arabidopsis thaliana, corn, rice, soybean, canola, alfalfa, sunflower, sorghum, wheat, cotton, peanut, tomato, potato, lettuce, and pepper.
Citation Information
Patent Citations
Application of OsF3'H gene in resistance to pathogens
CN114657205B
Recombinant yeast strain for synthesizing aromatic compound as well as construction method and application of recombinant yeast strain
CN118109326A
Wide area spreader with high blowing efficiency
KR1020230043317A
Method for sidelink positioning of user devices in nr-based wireless communication system and an apparatus therefore
KR1020250084391A