Gene editing vector and gene editing method for agrobacterium tumefaciens, and agrobacterium tumefaciens edited strain
By optimizing the Agrobacterium gene editing vector using the CRISPR/spCas9-GFP system, the problems of low editing efficiency and difficulty in removing markers in traditional techniques have been solved, achieving efficient and scarless gene editing, simplifying the operation process and obtaining scarless strains.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2024-09-04
- Publication Date
- 2026-03-12
AI Technical Summary
Traditional Agrobacterium genome editing technology has drawbacks such as low editing efficiency, cumbersome operation steps, and difficulty in removing selection markers, making it impossible to achieve scarless gene editing.
Using the CRISPR/spCas9-GFP gene editing system, we constructed an efficient and simple gene editing vector by optimizing the Pvan promoter, homologous arm length, and GFP marker, enabling gene knockout and insertion. We then used the GFP marker to screen for traceless strains.
This technology enables efficient and traceless editing of the Agrobacterium genome, improves gene editing efficiency, simplifies the operation process, and yields edited strains without selection markers.
Smart Images

Figure CN2024116696_12032026_PF_FP_ABST
Abstract
Description
Gene editing vector of agrobacterium and gene editing method and agrobacterium editing strain thereof TECHNICAL FIELD
[0001] The present application relates to the field of biotechnology, in particular to a gene editing vector of agrobacterium and a gene editing method and agrobacterium editing strain thereof. BACKGROUND
[0002] Agrobacterium tumefaciens belongs to Gram-negative alpha-proteobacteria, and its mediated powerful system for transferring target genes into plant cells is a model bacterium for studying bacterial cell biology, host-microorganism association and biofilm formation. However, traditional agrobacterium genome editing technology has the disadvantages of low editing efficiency, complicated operation steps, and difficult removal of selection markers, which seriously hinders the research and application of agrobacterium.
[0003] In 2014, Shengbiao Hu et al. established a gene editing method in agrobacterium through a lambda-Red homologous recombination system, used a kanamycin resistance gene as a selection marker, and successfully knocked out related genes in the agrobacterium genome. In 2021, Savio D. Rodrigues et al. based on CRISPR / Cas9-mediated single base editing, which can effectively edit the target base in agrobacterium, and the editing efficiency reaches more than 80%. In 2022, Epharaim Aliu et al. realized gene insertion in the agrobacterium genome through a CRISPR RNA-mediated transposase system, and through a Cre-loxP recombination system, large fragments can be accurately deleted.
[0004] Based on the lambda-Red homologous recombination system for gene editing, in order to screen the knockout strain, a kanamycin resistance gene needs to be inserted while knocking out a gene. Therefore, this method cannot obtain an editing strain without a selection marker. CRISPR / Cas9-mediated single base editing cannot achieve the knockout and knockin of the entire gene in the agrobacterium genome. Although the CRISPR RNA-mediated transposase system combined with the Cre-loxP recombination system can achieve gene insertion and deletion, both the genome integration caused by the transposase system and the large fragment DNA deletion caused by the Cre-loxP recombination system will introduce exogenous DNA markers in the genome, which cannot achieve scarless editing. Moreover, the deletion of large fragments of DNA through the Cre-loxP recombination system is time-consuming and laborious, which is not conducive to the research of agrobacterium.
[0005] SUMMARY
[0006] Therefore, the present application provides an agrobacterium gene editing vector, which can achieve efficient editing of agrobacterium genes.
[0007] An agrobacterium gene editing vector comprising the following genetic elements: a plasmid backbone, a Pvan promoter, a spCas9 gene, a green fluorescent protein gene GFP, a gRNA, an upstream homologous arm of a target gene, and a downstream homologous arm of the target gene.
[0008] The agrobacterium gene editing vector adopts a CRISPR / spCas9-GFP gene editing system, and constructs an efficient, simple, and scarless genome editing system in agrobacterium, which can realize gene knockout and insertion.
[0009] In some embodiments, the target gene comprises a tdk gene.
[0010] In some embodiments, the gRNA comprises at least one of the sequences shown in SEQ ID NO. 29, SEQ ID NO. 32, and SEQ ID NO. 35.
[0011] In some embodiments, among the plasmid backbone, the Pvan promoter, the spCas9 gene, the green fluorescent protein gene GFP, the gRNA, the upstream homologous arm of the target gene, and the downstream homologous arm of the target gene, a repeat sequence is connected between two adjacent genetic elements.
[0012] In some embodiments, the plasmid backbone is a pSJ-backbone plasmid backbone, and the nucleotide sequence of the pSJ-backbone plasmid backbone is shown in SEQ ID NO. 1.
[0013] The nucleotide sequence of the Pvan promoter is shown in SEQ ID NO. 4.
[0014] The nucleotide sequence of the spCas9 gene fragment is shown in SEQ ID NO. 7.
[0015] An agrobacterium gene editing method comprising the following steps:
[0016] Constructing the agrobacterium gene editing vector as described above;
[0017] Transforming the agrobacterium gene editing vector into an agrobacterium competent cell, culturing, screening, and obtaining an edited agrobacterium strain after gene editing.
[0018] In some embodiments, the step of constructing the agrobacterium gene editing vector comprises assembling each of the genetic elements by Gibson technology to obtain the agrobacterium gene editing vector.
[0019] In some embodiments, the step of transforming the Agrobacterium gene editing vector into the Agrobacterium competent cells, culturing, and screening comprises:
[0020] transforming the Agrobacterium gene editing vector into the Agrobacterium competent cells and culturing on a resistant plate medium, and then observing whether the single clone colony emits green fluorescence under a blue light lamp;
[0021] verifying the single clone colony emitting green fluorescence under the blue light lamp to obtain the Agrobacterium editing strain.
[0022] In some embodiments, after the step of verifying the single clone colony emitting green fluorescence under the blue light lamp, the method further comprises the following steps: transferring the verified Agrobacterium editing strain to an antibiotic-free culture medium for culturing, and then performing PCR identification to obtain the Agrobacterium editing strain without carrying the gene editing vector.
[0023] An Agrobacterium editing strain prepared by the above gene editing method. BRIEF DESCRIPTION OF DRAWINGS
[0024] FIG. 1 is a plasmid map of pSJ-P23119-gRNA-HRs-Pvan-spCas9-GFP in Example 1;
[0025] FIG. 2 is a tdk gene knockout PCR detection result graph;
[0026] FIG. 3 is a tdk gene knockout efficiency column chart of three different gRNAs in Example 1;
[0027] FIG. 4 is a phenotype identification result graph of the tdk gene knockout strain in Example 1. DETAILED DESCRIPTION
[0028] To make the above objectives, features and advantages of the present application more apparent and easy to understand, the specific embodiments of the present application will be described in detail below with reference to the accompanying drawings. In the following description, a large number of specific details are set forth in order to facilitate a thorough understanding of the present application. However, the present application can be implemented in many other ways different from those described herein, and those skilled in the art can make similar improvements without departing from the scope of the present application, so the present application is not limited to the specific embodiments disclosed below.
[0029] An embodiment of the present application provides an Agrobacterium gene editing vector, and the use of the gene editing vector can achieve efficient editing of the Agrobacterium genome.
[0030] Specifically, the agrobacterium gene editing vector comprises the following genetic elements: a plasmid backbone, a Pvan promoter, a spCas9 gene, a green fluorescent protein gene GFP, a gRNA, and upstream and downstream homologous arms of a target gene.
[0031] The CRISPR / spCas9 (Clustered Regularly Interspaced Short Palindromic Repeats-CRISPR associated protein spCas9) gene editing system is a CRISPR type II system. The CRISPR / spCas9-GFP system has a GFP green fluorescent protein gene fused to the C-terminal of the spCas9 protein, which is used to indicate whether the spCas9 protein is expressed. The principle of the CRISPR / spCas9 system is as follows: ① recognition component: the CRISPR sequence is transcribed to form sgRNA with a targeted recognition function; ② cutting component: the spCas9 protein is a kind of endonuclease, which forms a complex with sgRNA. With the specific recognition and binding of sgRNA and specific DNA sequences, the spCas9 protein cuts the targeted DNA strand, causes a gap in the gene, and realizes the cleavage of the target gene; then the cell repairs the gene through a repair system, such as homologous recombination or non-homologous end joining, to achieve the purpose of gene editing. ③ discrimination component: the spCas9-GFP fusion protein emits green fluorescence under blue light, which can be used to determine whether the spCas9 protein is expressed. If the clone emits green fluorescence, it means that the spCas9 protein is expressed, and gene editing is likely to occur in the cell; if the clone does not emit green fluorescence, it means that the spCas9 protein is not expressed, indicating that gene editing does not occur in the cell. However, these designs are not sufficient to make the CRISPR / spCas9-GFP system work efficiently in agrobacterium. We further optimized the promoter driving the pCas9 gene, the concentration of the promoter inducer, and the length of the homologous arm, as follows: ① In this study, two inducible promoters, Pvan and Pxyl, were tested, and the results showed that the Pvan promoter induced the expression of the spCas9 gene with relatively high gene editing efficiency; ② Using a lower concentration of inducer to induce the expression of the spCas9 gene is conducive to the occurrence of gene editing; ③ Due to the limitation of plasmid size, the homologous arm should not be longer than 2K.
[0032] The system has the following advantages: ① In the CRISPR / spCas9-GFP system, the expression of the spCas9 gene is driven by the inducible promoter Pvan, which strictly controls the expression amount of the spCas9 protein, and is beneficial to maximize the editing efficiency of the CRISPR / spCas9-GFP system; ② By screening different lengths of homologous arms, the most suitable length of homologous arm is assembled into the CRISPR / spCas9-GFP system, and the obtained gene editing efficiency is relatively high; ③ In the CRISPR / spCas9-GFP system, the spCas9 protein is labeled with the GFP green fluorescent protein, which can directly determine whether the spCas9 protein is expressed, and then determine the possibility of gene editing of the colony, thereby indirectly improving the screening efficiency of the gene editing strain.
[0033] The above-mentioned agrobacterium gene editing vector adopts the CRISPR / spCas9-GFP gene editing system, constructs an efficient, simple and traceless genome editing system in the agrobacterium, and can realize gene knockout and insertion.
[0034] In some embodiments, the target gene includes a tdk gene. Further, the gRNA includes at least one of the sequences shown in SEQ ID NO. 29, SEQ ID NO. 32 and SEQ ID NO. 35. It should be noted that the target gene is not limited to the above-mentioned gene, and other genes in the agrobacterium can also be subjected to gene editing, and the corresponding gRNA can be designed.
[0035] In some embodiments, a repeat sequence is connected between two adjacent gene elements in the plasmid backbone, the Pvan promoter, the spCas9 gene, the green fluorescent protein gene GFP, the gRNA, the upstream homologous arm of the target gene and the downstream homologous arm of the target gene.
[0036] Further, the length of the repeat sequence is 30 bp.
[0037] In some embodiments, the plasmid backbone is a pSJ-backbone plasmid backbone. The nucleotide sequence of the pSJ-backbone plasmid backbone is shown in SEQ ID NO. 1; the nucleotide sequence of the Pvan promoter is shown in SEQ ID NO. 4; and the nucleotide sequence of the spCas9 gene fragment is shown in SEQ ID NO. 7.
[0038] In some embodiments, the fluorescent protein gene is a GFP green fluorescent protein gene. It should be noted that the fluorescent protein gene is not limited to the above-mentioned gene, and can also be other reporter genes.
[0039] The above-mentioned agrobacterium gene editing vector is a high-efficiency and non-scarring gene editing system, which can realize gene knockout and gene knock-in in agrobacterium.
[0040] The embodiment of the present application also provides an agrobacterium gene editing method, comprising the following steps S110-S120:
[0041] S110, constructing the above-mentioned agrobacterium gene editing vector;
[0042] S120, transforming the agrobacterium gene editing vector into an agrobacterium competent cell, culturing, screening, and obtaining an agrobacterium editing strain.
[0043] The agrobacterium editing strain is a mutant agrobacterium obtained by gene editing (such as gene knockout or knockout operation) on the agrobacterium competent cell by using the above-mentioned agrobacterium gene editing vector.
[0044] In some embodiments, the step of constructing the agrobacterium gene editing vector comprises: assembling each of the gene elements by Gibson technology to obtain the agrobacterium gene editing vector.
[0045] In some embodiments, the step of transforming the agrobacterium gene editing vector into the agrobacterium competent cell, culturing, and screening comprises:
[0046] The agrobacterium gene editing vector is transformed into the agrobacterium competent cell, and cultured on a resistant plate medium, and then it is observed whether the single clone colony emits green fluorescence under a blue light lamp;
[0047] The single clone colony emitting green fluorescence under the blue light lamp is verified to obtain the agrobacterium editing strain.
[0048] Specifically, the step of electrotransforming the agrobacterium comprises: adding 500 ng of the assembled agrobacterium gene editing vector into 100 microliters of agrobacterium competent cells. After gently mixing, it is transferred to a 2mm electroshock cup and placed on ice for 20 min. The BIORAD ECO2 program is selected for 2.5kV electrotransformation, 1mL of PYE liquid medium is quickly added, and the bacteria are resuscitated at 30°C for 3h. After centrifugation at 6000rpm for 3min, 900 microliters of supernatant is removed, the remaining 100 microliters of liquid is used to resuspend the bacterial precipitate, and the resuspension is plated on a PYE resistant plate (Kan).
[0049] The fluorescent protein gene is a green fluorescent protein gene GFP, and the step of screening the agrobacterium editing strain comprises: after being plated on the kan resistant plate for three days, it is observed whether the single clone colony emits green fluorescence under a blue light lamp, and the single clone colony emitting green fluorescence is divided into small blocks on a new PYE resistant plate (Kan). The next day, PCR verification is performed to obtain the agrobacterium editing strain.
[0050] In some embodiments, the step of verifying the single clone colony emitting green fluorescence under blue light is followed by the steps of transferring the verified Agrobacterium editing bacteria to an antibiotic-free PYE liquid medium for culture, and then performing PCR identification to obtain Agrobacterium editing bacteria strains without carrying a gene editing vector. The purpose of the Agrobacterium editing bacteria losing the gene editing plasmid is to obtain Agrobacterium editing bacteria strains with a clean background without any selection markers, which is of great significance for the subsequent study of Agrobacterium editing bacteria strains.
[0051] The above-mentioned Agrobacterium gene editing method can achieve gene knockout and knock-in in Agrobacterium. By constructing an efficient, simple and scarless gene editing system, it can realize streamlined gene editing, obtain edited strains without selection markers, greatly improve the efficiency of gene editing, fill the technical gap in this field, and play an important role.
[0052] An embodiment of the present application also provides an Agrobacterium editing strain prepared by the above-mentioned gene editing method.
[0053] The following are specific examples.
[0054] In the examples, reagents and instruments are used as conventional choices in the art unless otherwise specified. The experimental methods not specified in the examples are usually carried out according to conventional conditions, for example, the conditions described in the literature, books or the methods recommended by the kit manufacturers.
[0055] The sequences of the genes and primers involved in Example 1 below are shown in Table 1. In Table 1, pJ23119 is the promoter of each sgRNA in the examples, which drives the expression of each sgRNA in the examples; sgRNA scaffold is the sgRNA together with gRNA sequence, which plays a role in targeting DNA target in gene editing, and sgRNA scaffold sequence plays a role in binding spCas9 protein; in Table 1, the capital letter part is the corresponding designed homologous arm.
[0056] Table 1 Sequences of genes and primers involved in Example 1
[0057] Example 1 Gene editing of Agrobacterium
[0058] (1) Design of gRNA:
[0059] The design was performed using the CHOP CHOP online tool, the specific website of which is: http: / / chopchop.cbu.uib.no / .
[0060] Specifically, the target gene of the embodiment includes a tdk gene, the nucleotide sequence of which is shown in Table 1; three gRNAs, namely gRNA1, gRNA2 and gRNA3, are designed for the tdk gene, and the specific sequences of gRNA1, gRNA2 and gRNA3 are tttccagggcaagctcttcc, gaaggcgcccagatcgaagt and cagatcgaagttggcggcaa, respectively.
[0061] (2) Design of plasmid:
[0062] The plasmid map designed in the embodiment is shown in FIG. 1, which mainly comprises the following parts, namely a pSJ-backbone plasmid skeleton, a vanillate inducible promoter Pvan, a spCas9 gene, a green fluorescent protein gene GFP, a gRNA and a homologous arm. The gRNA and the repair template (homologous arm) can be replaced according to the different target genes. The sequences of the elements are shown in Table 1. The main method for assembling the elements into a plasmid is the Gibson assembly method, and the specific operation steps are as follows:
[0063] (a) Design primers to linearize the pSJ-backbone plasmid skeleton and Pvan. After linearization, there will be a 30bp repeat sequence between the two elements (this needs to be considered before designing the primers). Then assemble, the system is 20 microliters, of which the pSJ-backbone plasmid skeleton is 0.1 pmol, the Pvan inducible system element is 0.2 pmol, 2 microliters of Exnase II, 4 microliters of 5X CE II Buffer, and water is added to 10 microliters. Then place the PCR instrument at 37°C for 30 min. Then transform the assembly product into DH5α competent cells, and screen on LB kanamycin-resistant plates to obtain the plasmid pSJ-Pvan.
[0064] (b) Design primers to linearize the obtained plasmid pSJ-Pvan and spCas9 gene element, and also make the two fragments have a 30bp repeat sequence between them. Assemble according to the method of step (a) above, the molar ratio of the two elements is 1:1, and other methods are the same as step (a) above, to obtain the pSJ-Pvan-spCas9 plasmid.
[0065] (c) Design primers to linearize plasmid pSJ-Pvan-spCas9 and GFP, and make 30 bp repeat sequence between two fragments. Assemble according to the method of step (a) above, the molar ratio of two elements is 1:1, and other methods are the same as step (a) above. The pSJ-Pvan-spCas9-GFP plasmid can be obtained.
[0066] (d) Design primers to assemble plasmid pSJ-Pvan-spCas9-GFP, P23119-sgRNA scaffold, upstream and downstream homologous arms of target gene. Linearize pSJ-Pvan-spCas9-GFP, P23119-sgRNA scaffold, upstream and downstream homologous arms of target gene, and make 30 bp repeat sequence between each element. Assemble using the method of step (a) above, the molar ratio of each element is 1:1:1:1, and the total molar number is not more than 0.2 pmol. Other methods are the same as step (a) above. The pSJ-P23119-sgRNA scaffold-HRs-Pvan-spCas9-GFP plasmid can be obtained.
[0067] (e) Design gRNA sequence on primers, and perform loop PCR on plasmid pSJ-P23119-sgRNA scaffold-HRs-Pvan-spCas9-GFP to obtain linear fragments. Then, linearize the fragments and transform DH5α competent cells, and screen on LB resistance (Kan) plates to achieve the connection of gRNA between P23119 and sgRNA scaffold, and obtain the gene editing vector pSJ-P23119-sgRNA-HRs-Pvan-spCas9-GFP. The plasmid map is shown in Figure 1.
[0068] (3) Agrobacterium gene editing:
[0069] (a) Take 500 ng of assembled plasmid (i.e. pSJ-P23119-sgRNA-HRs-Pvan-spCas9-GFP plasmid) and add to 100 microliters of Agrobacterium competent cells; wherein the Agrobacterium competent cells are prepared from Agrobacterium cells with accession number ATCC 33970. Mix gently and transfer to a 2 mm electroporation cup, and place on ice for 20 min. Select BIORAD ECO2 program, 2.5 kV electroporation, quickly add 1 mL PYE liquid medium, and recover at 30°C for 3 h. Centrifuge at 6000 rpm for 3 min, remove 900 microliters of supernatant, resuspend the remaining 100 microliters of bacterial pellet, and spread the resuspension on a PYE resistance plate (Kan).
[0070] (b) Three days later, check if there are any monoclonal colonies growing. Under blue light, monoclonal colonies that emit green fluorescence are cut into small squares on new PYE resistant (kan) plates, and PCR verification is performed the next day to obtain Agrobacterium editing strains.
[0071] (4) Agrobacterium editing strains discard gene editing plasmids:
[0072] The purpose of Agrobacterium editing strains discarding gene editing plasmids is to obtain mutant strains with clean background without any selection markers, which is of great significance for the subsequent study of Agrobacterium mutants. Specifically, Agrobacterium mutants are picked into antibiotic-free PYE liquid medium, incubated at 28°C, 220 rpm, and overnight. The next day, the bacterial solution is diluted 1000-fold, and 100 microliters are plated on antibiotic-free PYE solid plates and incubated at 30°C. Three days later, specific primers on the gene editing plasmid are used to detect the colonies on the plates to determine whether the plasmid is lost. If the plasmid is lost, no band will be produced after PCR amplification of the specific primers; if the plasmid exists, a band will be produced after PCR amplification of the specific primers.
[0073] (5) Results detection
[0074] The above steps (1)-(4) are used to knock out the tdk gene in Agrobacterium. PCR combined with gel electrophoresis is used to identify the tdk gene knockout, and the detection results are shown in Figure 2, which shows the detection results of tdk gene knockout in Agrobacterium using gRNA1. The knockout efficiency of tdk gene using three different gRNAs is detected by PCR, and the results are shown in Figure 3. The phenotype identification of tdk gene knockout mutant of Sinorhizobium meliloti using nutritional metabolic deficiency method is shown in Figure 4. In Figure 4, the first petri dish (labeled PYE) is the result of phenotype identification using PYE medium without 5-fluorodeoxyuridine, and the second petri dish (labeled PYE+5FudR) is the result of phenotype identification using PYE medium containing 5-fluorodeoxyuridine.
[0075] From Figures 2-4, it can be seen that the tdk gene knockout in Agrobacterium is achieved, with a knockout efficiency of up to 91%.
[0076] The Agrobacterium gene editing vector and editing method of the present application realize gene knockout and gene knock-in in Agrobacterium, construct a high-efficiency, simple, and traceless gene editing system, realize streamlined gene editing, and obtain editing strains without selection markers. This system greatly improves the efficiency of gene editing, fills the gap in this field, and plays an important role.
[0077] Any combination of the technical features in the above-described embodiments can be made, and for the sake of brevity, not all possible combinations are described, however, as long as the combination of the technical features does not exist in contradiction, it shall be considered within the scope of the present disclosure.
[0078] The above-described embodiments only express several implementation manners of the present application, the description is more specific and detailed, but it shall not be understood as a limitation on the patent scope of the present application. It shall be pointed out that, for those skilled in the art, several modifications and improvements can be made without departing from the concept of the present application, and these shall be within the protection scope of the present application. Therefore, the protection scope of the present application patent shall be subject to the appended claims.
Claims
1. An Agrobacterium gene editing vector, characterized in that, The agrobacterium gene editing vector comprises the following genetic elements: a plasmid backbone, a Pvan promoter, a spCas9 gene, a green fluorescent protein gene GFP, a gRNA, an upstream homologous arm of a target gene, and a downstream homologous arm of the target gene.
2. The Agrobacterium gene editing vector of claim 1, wherein, The target gene comprises a tdk gene.
3. The Agrobacterium gene editing vector of claim 2, wherein, The gRNA comprises at least one of the sequences shown as SEQ ID NO. 29, SEQ ID NO. 32, and SEQ ID NO.
35.
4. The Agrobacterium gene editing vector of any one of claims 1-3, wherein, Among the plasmid backbone, the Pvan promoter, the spCas9 gene, the green fluorescent protein gene GFP, the gRNA, the upstream homologous arm of the target gene, and the downstream homologous arm of the target gene, a repeat sequence is connected between two adjacent genetic elements.
5. The Agrobacterium gene editing vector of any one of claims 1-3, wherein, The plasmid backbone is a pSJ-backbone plasmid backbone, and a nucleotide sequence of the pSJ-backbone plasmid backbone is shown as SEQ ID NO.
1. A nucleotide sequence of the Pvan promoter is shown as SEQ ID NO.
4. A nucleotide sequence of the spCas9 gene fragment is shown as SEQ ID NO.
7.
6. A method of gene editing of Agrobacterium, comprising, The method comprises the following steps: constructing the agrobacterium gene editing vector according to any one of claims 1-5; transforming the agrobacterium gene editing vector into an agrobacterium competent cell, culturing, screening, and obtaining an agrobacterium editing strain.
7. The method of gene editing of claim 6, wherein, The step of constructing the agrobacterium gene editing vector comprises assembling each of the genetic elements by Gibson technology to obtain the agrobacterium gene editing vector.
8. The method of gene editing of claim 6, wherein, The step of transforming the agrobacterium gene editing vector into an agrobacterium competent cell, culturing, and screening comprises: transforming the agrobacterium gene editing vector into the agrobacterium competent cell and culturing on a resistant plate medium, and then observing whether a single colony emits green fluorescence under a blue light lamp; verifying the single colony emitting green fluorescence under the blue light lamp to obtain the agrobacterium editing strain.
9. The method of gene editing according to any one of claims 5-8, wherein, After the step of verifying the single colony emitting green fluorescence under the blue light lamp, the method further comprises the following steps: transferring the verified agrobacterium editing strain to a culture medium without antibiotics, and then performing PCR identification to obtain an agrobacterium editing strain that does not carry the gene editing vector.
10. An Agrobacterium editing strain, characterized in that, obtained by the gene editing method according to any one of claims 6-9.
Citation Information
Patent Citations
Gene editing method and application of intestinal bacterium bacteroides
CN116004688A
Method for genome editing
US20190153430A1
Synthetic toolkit for plant transformation
US20220411811A1