SNP molecular marker associated with body weights of chickens at multiple weeks of age and use thereof

By conducting GWAS analysis on chicken populations, SNP molecular markers related to body weight were discovered. By utilizing the characteristic that T is the dominant allele in high-weight chickens, the problem of lack of molecular markers in broiler breeding was solved, enabling early, rapid, and low-cost body weight prediction and breeding improvement.

WO2026051168A1PCT designated stage Publication Date: 2026-03-12CHINA AGRI UNIV
View PDF 4 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-10-25
Publication Date
2026-03-12

AI Technical Summary

Technical Problem

The lack of clear and significant molecular markers in current broiler breeding makes it difficult to accurately assess and select chickens with high weight potential, thus affecting the breeding process.

Method used

GWAS analysis of a hybrid population of 1164 chickens using resequencing technology revealed a SNP molecular marker (chr1:170585684) at the rs13971913 locus in genome version GRCg6a 104. This SNP locus exhibits polymorphisms of C and T. T is the dominant allele in high-weight chickens, while C is the dominant allele in low-weight chickens. This marker was used for genotyping and breeding.

Benefits of technology

It enables early, rapid, and low-cost prediction of chicken weight, thereby improving the weight of breeding populations and has broad breeding application prospects and economic value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2024127496_12032026_PF_FP_ABST
    Figure CN2024127496_12032026_PF_FP_ABST
Patent Text Reader

Abstract

Provided are an SNP molecular marker associated with body weights of chickens at multiple weeks of age and the use thereof, in particular relating to an SNP site associated with body weights of chickens at multiple weeks of age, including 2, 4, 6, 8, 10 and 12 weeks of age. The SNP site chr1:170585684 is located in the intronic region of RCBTB1. The body weights of individuals in a chicken hybrid population at multiple weeks of age are determined and recorded, 1164 chickens are sequenced using resequencing technology, and genome-wide association analysis is performed to obtain an SNP site affecting the body weights at different weeks of age. The SNP frequency of the SNP site in other low-body-weight chicken breeds and high-body-weight chicken breeds subjected to resequencing is statistically analyzed, and it is found that the SNP frequency exhibits a significant difference between the low-body-weight chicken breeds and the high-body-weight chicken breeds. T is a dominant allele in the high-body-weight chickens, whereas C is a dominant allele in the low-body-weight chickens. In a low-body-weight population, the body weight of a breeding population can be increased by means of selecting individuals with the T allele at the site.
Need to check novelty before this filing date? Find Prior Art

Description

SNP molecular marker related to body weight of chickens at multiple ages and application thereof TECHNICAL FIELD

[0001] The present application relates to the field of molecular biology, and particularly relates to a SNP molecular marker related to body weight of chickens at multiple ages and application thereof, in particular to a SNP molecular marker related to body weight of chickens at two weeks, four weeks, six weeks, eight weeks, ten weeks and twelve weeks and application thereof. BACKGROUND

[0002] Chicken is one of the main meat varieties in China, which has the characteristics of high protein, low fat and low cholesterol. In recent years, the chicken production in China has been increasing continuously, and improving muscle yield and quality has been the long-term exploration of breeding scientists. The classical breeding method has made great contribution to the improvement of production traits of agricultural animals. With the continuous advancement of genome work and the extensive development of genetic markers, breeding scientists can select chickens with good yield and quality characteristics for breeding according to specific genetic markers. These genetic markers can help breeding scientists more accurately evaluate and select the genetic potential of chickens and accelerate the breeding process.

[0003] SNP (Single Nucleotide Polymorphism) is one of the common genetic variation forms in genetics. SNP has the advantages of large quantity, high frequency and low mutation rate, and plays an important role in genetic research and molecular selection breeding. However, there is still a lack of molecular markers with clear function and significant effect in the practice of broiler molecular breeding. Therefore, it is the current research focus to excavate molecular markers with large effect and accuracy. If SNP molecular markers related to target traits of chickens can be found and the molecular mechanism of the site is finally analyzed, it will greatly promote the genetic improvement of chickens and bring breakthrough progress to the field of poultry breeding. SUMMARY

[0004] In view of the deficiencies in the prior art, the present application aims to provide a SNP molecular marker related to the body weight of chickens at multiple ages and its application. The individuals of a cross population of 1164 chickens with different body weight records at different ages are sequenced using resequencing technology, GWAS analysis is performed, and a SNP site significantly related to the body weight of chickens at two, four, six, eight, ten and twelve ages is obtained. The SNP is rs13971913 (chr1:170585684) located in the genome version GRCg6a 104. The polymorphism of the SNP molecular marker is C and T, and includes three genotypes of CC, TT and CT. The SNP frequency of the SNP in other low-weight chicken species and high-weight chicken species in resequencing is counted, and it is found that there is a significant difference in the low-weight chicken species and the high-weight chicken species. In the high-weight chicken, T is the dominant allele, and in the low-weight chicken, C is the dominant allele. In the population with lower weight, by selecting individuals with allele T, the body weight of the chicken can be improved.

[0005] To solve the above technical problems, the technical scheme provided by the present application is:

[0006] A SNP molecular marker related to the body weight of chickens at multiple ages,

[0007] The SNP molecular marker is located at chr1:170585684 of the genome GRCg6a 104, and the alleles of the SNP site are T and C; and includes three genotypes of TT, TC and CC.

[0008] The economic traits are the body weight of chickens at two weeks old, four weeks old, six weeks old, eight weeks old, ten weeks old and twelve weeks old.

[0009] In the high-weight chicken, T is the dominant allele, and in the low-weight chicken, C is the dominant allele.

[0010] Preferably,

[0011] The SNP molecular marker is located at the 101st base of the nucleotide sequence shown in SEQ ID NO. 1.

[0012] The application of the above-mentioned SNP molecular marker in the detection of multiple age body weight traits of chickens.

[0013] The above-mentioned application comprises the following steps:

[0014] (1) detecting the genotype of the sample chicken at the SNP site;

[0015] (2) selecting sample chickens with T / T genotype for breeding of dominant lines.

[0016] Preferably,

[0017] The step (1) can adopt direct sequencing, or first amplifying the gene fragment containing the SNP molecular marker and then detecting. For example, a primer is designed to amplify the fragment containing the SNP molecular marker from the sequence shown in SEQ ID NO. 1, and then the alleles at the site are detected.

[0018] The primer pair for amplifying the fragment containing the SNP site of claim 1 is shown in SEQ ID NO. 2 and SEQ ID NO. 3.

[0019] The above-mentioned SNP molecular marker is applied in marker-assisted selection breeding,

[0020] The chicken breed with genotype T / T is selected for breeding.

[0021] The present application has the following beneficial effects:

[0022] The present application provides a SNP molecular marker related to the body weight of chickens at multiple ages and its application. By genotyping the SNP site chr1: 170585684 of 1164 chickens, and analyzing the SNP frequency of the site in low-weight chicken breeds and high-weight chicken breeds, it is found that T is the dominant allele in high-weight chickens, and C is the dominant allele in low-weight chickens. In a population with lower body weight, by selecting individuals with allele T, the body weight of the population can be improved. The site can be used as a SNP molecular marker for breeding of excellent chicken breeds, which can early, quickly, and cost-effectively predict whether the body weight is high or low, has a broad application prospect in chicken breed improvement, and can achieve excellent economic value. BRIEF DESCRIPTION OF DRAWINGS

[0023] The accompanying drawings are included to provide a further understanding of the present application, and constitute a part of the specification, illustrate the present application, and are used to explain the present application, and do not constitute a limitation of the present application. In the drawings:

[0024] Fig. 1A is a Manhattan plot of the GWAS result of two-week-old body weight

[0025] Fig. 1B is a Manhattan plot of the GWAS result of four-week-old body weight

[0026] Fig. 1C is a Manhattan plot of the GWAS result of six-week-old body weight

[0027] Fig. 1D is a Manhattan plot of the GWAS result of eight-week-old body weight

[0028] Fig. 1E is a Manhattan plot of the GWAS result of ten-week-old body weight

[0029] Fig. 1F is a Manhattan plot of the GWAS result of twelve-week-old body weight

[0030] DETAILED DESCRIPTION

[0031] The preferred examples of the present application are described below in conjunction with the accompanying drawings, it should be understood that the following examples are given only for the purpose of illustration and are not intended to limit the scope of the present application. Those skilled in the art can make various modifications and replacements to the present application without departing from the spirit and principles of the present application.

[0032] The present application provides a SNP molecular marker related to the body weight of chickens at different ages and its application, the SNP molecular marker is located in the intron region of RCBTB1, chr1:170585684 of genome GRCg6a 104, and the SNP molecular marker is located at the 101st base in the nucleotide sequence shown in SEQ ID NO. 1; the alleles of the SNP site are C and T; the economic traits are the body weight of chickens at two weeks, four weeks, six weeks, eight weeks, ten weeks and twelve weeks, and in high-weight chickens, T is the dominant allele, and in low-weight chickens, C is the dominant allele, in the population with lower weight, by selecting individuals with allele T, the body weight of chickens can be improved.

[0033] SEQ ID NO. 1 (chr1:170585584-170585784)

[0034] caccgtaacaaggctacagtcccagtcacgacatgcattttcctttttattttcaataagaagctgagtcattagcacaacttaatgaagccattcgctctggatgagacaccctaaaaaacccacctatattccagcaagacgcatacagaaataagaatgcaaaggccccacggagtaaggctccaaagatttgttctc

[0035] Example 1 Whole genome association analysis of chicken body weight at different ages

[0036] 1. Test material

[0037] The individuals of a chicken hybrid population were used as the research object, and the body weight of 1164 chicken individuals was measured at two weeks, four weeks, six weeks, eight weeks, ten weeks and twelve weeks, and the determination was strictly carried out according to the internal standard of the chicken farm.

[0038] 2. Test method

[0039] 2.1 Phenotype determination

[0040] When the chickens reach the corresponding age, place each chicken on a weighing device and wait for the chicken to remain relatively calm and balanced, then record the displayed body weight value, and record the gender.

[0041] 2.2 Whole genome SNP typing method of chicken based on resequencing technology

[0042] The sequencing data is aligned to the GRCg6a 104 reference genome using gtx align, SNP site detection is performed using Basevar, and STITCH estimates the genotype probability of all individuals. For the SNP sites obtained by typing, high-quality sites are retained according to MAF < 0.05, site call rate < 0.95, and info score < 0.4, a total of 7,901,521 SNPs.

[0043] The specific steps of amplification are as follows: the blood tissue of the hybrid population sample is used to extract DNA using the total DNA extraction kit of Beijing Tiangeng Biological Technology Co., Ltd., and the OD value of the extracted DNA is detected by spectrophotometer, that is, OD 260 / OD 280 and OD 260 / OD 230 ratio to determine the concentration and purity of DNA, and agarose gel electrophoresis is used to detect the integrity of DNA. The genome of the hybrid population sample is used as a template, and the corresponding primers are designed for its sequence using Oligo7 software, and the sequence amplification is performed using Novozyme 2 × Taq Master Mix, and the reaction system is as follows: 95℃, pre-denaturation 3min; 95℃, denaturation 15s, 60℃, annealing 15s, 72℃, extension 15s, 30 cycles; 72℃, complete extension 5min. Finally, agarose gel electrophoresis is used to detect the product fragment size.

[0044] The sequence of the primer pair for amplifying the SNP site fragment is as follows:

[0045] The sequence of the primer pair is as follows:

[0046] F: CACCGTAACAAGGCTACAGT (SEQ ID NO. 2)

[0047] R: GAGAACAAATCTTTGGAGC (SEQ ID NO. 3)

[0048] 2.3 Whole genome association analysis

[0049] FastGWA is used to perform whole genome association analysis on the body weight phenotypes of 1164 chickens at two weeks, four weeks, six weeks, eight weeks, ten weeks and twelve weeks.

[0050] 2.4 SNP sites significantly associated with body weight traits

[0051] Detection of genome-wide significant sites, significant sites were identified according to FDR < 0.05.

[0052] 3. Results and analysis

[0053] The present application takes 1164 chickens of a crossbreed population as the object, uses 7,901,521 SNPs obtained by resequencing technology to perform GWAS analysis on the body weight of chickens at different ages, and determines a SNP (chr1: 170585684) site significantly associated with the body weight of chickens at different ages, as shown in Figure 1.

[0054] Example 2 Frequency distribution of SNP (chr1: 170585684) in different chicken breeds

[0055] 1. Test materials

[0056] Low-weight chicken breeds: Mustache chicken (n=15), Beijing oil chicken (n=25), tea flower chicken (n=30), Daweishan miniature chicken (n=33), silk feather chicken (n=57), and Tibetan chicken (n=154).

[0057] High-weight chicken breeds: Lingnan yellow-feather broiler (n=16), white-feather broiler (n=20), Kobao chicken (n=33), and recessive white-feather chicken (n=113).

[0058] 2. Test method

[0059] 2.1 Data collection

[0060] The whole genome resequencing data from the above 6 low-weight chicken breeds and 4 high-weight chicken breeds were downloaded from the SRA database of NCBI (https: / / ncbi.nlm.nih.gov / sra).

[0061] 2.2 SNP typing using GATK

[0062] The gVCF of the above resequencing samples was constructed based on the GRCg6a 104 reference genome using the GTX server gtx wgs command, and then joint variant detection was performed on all gVCF samples using the gtx gi and gtx joint commands to obtain a genotype VCF file.

[0063] 2.3 Filtering and quality control of SNPs

[0064] After joint variant calling, SNPs sites were extracted using the SelectVariants tool of the GATK software package, and then the whole genome resequencing data was quality controlled using the VariantFiltration tool of the GATK software package according to the following hard filtering parameters: MQ < 40.0, FS > 60.0, SOR > 3.0, MQRankSum < -12.5, ReadPosRankSum < -8.0, QUAL < 30. Finally, after the above quality control, a total of 44,272,587 resequencing SNPs sites were obtained.

[0065] 2.4 Calculate the allele frequency of chr1: 170585684 in different chicken breeds

[0066] The allele frequency of chr1: 170585684 in different chicken breeds was calculated using vcftools --freq2.

[0067] 3. Results and analysis

[0068] The results of the SNP (chr1: 170585684) SNP frequency distribution in different low weight chicken breeds and high weight chicken breeds are shown in Table 1, and there is a significant difference between low weight chicken breeds and high weight chicken breeds. In high weight chickens, T is the dominant allele, and in low weight chickens, C is the dominant allele.

[0069] Table 1 SNP (chr1: 170585684) SNP frequency in different low weight chicken breeds and high weight chicken breeds

[0070]

[0071] Analysis found a SNP molecular marker related to chicken weight traits at multiple ages, and in populations with lower weight, breeding individuals with the T / T allele can increase the weight of the breeding population.

[0072] The contents not described in detail in the specification belong to the prior art known to those skilled in the art.

[0073] Finally, it should be noted that the above description is only a preferred example of the present application and does not limit the present application, although the present application has been described in detail with reference to the foregoing embodiments, and those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent replacements to some technical features. Any modification, equivalent replacement, improvement, etc. made within the spirit and principles of the present application shall be included within the protection scope of the present application.

Claims

1. A SNP molecular marker related to the body weight of chickens at multiple ages, characterized in that, the SNP molecular marker is located at chr1: 170585684 bp of the genome GRCg6a 104, and the alleles of the SNP site are T and C; and the three genotypes of TT, TC and CC are included; the economic traits are the body weight of chickens at two weeks, four weeks, six weeks, eight weeks, ten weeks and twelve weeks; in high-weight chickens, T is the dominant allele, and in low-weight chickens, C is the dominant allele. 2.The SNP molecular marker related to the body weight of chickens at multiple ages according to claim 1, characterized in that, the SNP molecular marker is located at the 101st base in the nucleotide sequence shown in SEQ ID NO.

1. 3.Use of the SNP molecular marker of claim 1 in the detection of the body weight of chickens at multiple ages.

4. Use according to claim 3, characterized in that, including the following steps: (1) detecting the genotype of the sample chicken at the SNP site; (2) selecting sample chickens with the T / T genotype for breeding of the dominant strain. 5.The use according to claim 4, characterized in that, the step (1) can use direct sequencing, or first amplify the gene fragment containing the SNP molecular marker and then detect. 6.A primer pair for amplifying the fragment containing the SNP site of claim 1, characterized in that, the sequence of the primer pair is shown in SEQ ID NO. 2 and SEQ ID NO.

3. 7.Use of the SNP molecular marker of claim 1 in marker-assisted selection breeding, characterized in that, selecting chickens with the genotype of T / T for breeding.

Citation Information

Patent Citations

  • Haplotype molecular marker related to chicken weight traits and application

    CN110951889A

  • FAM124A gene molecular marker related to chicken weight character and application of FAM124A gene molecular marker

    CN118389709A

  • SNP (Single Nucleotide Polymorphism) molecular marker related to multi-week-age weight of chicken and application of SNP molecular marker

    CN119753154A

  • Smart flashlight

    KR1020240178887A