Methods of treating retinoid responsive cancers

Abstract

There is provided a method of treating retinoid responsive cancer in a patient, comprising administering to said patient a therapeutically effective amount of one or more compounds which, individually or collectively, (i) induce and / or maintain tri-methylation of H3K27 within chromatin comprising one or more genes which encode regulatory elements of the adrenergic proliferative core regulatory circuitry of retinoid responsive cancer cells; and (ii) reduce and / or prevent tri-methylation of H3K27 within chromatin comprising one or more genes which encode ganglioside synthases in retinoid responsive cancer cells.

Description

[0001]METHODS OF TREATING RETINOID RESPONSIVE CANCERS SEQUENCE LISTING The present specification refers to a Sequence Listing, submitted electronically as an .xml file name “3469W01WO Sequence Listing” on September 3, 2025. The .xml file was generated on August 27, 2025 and is 4,096 bytes in size. The entire contents of the Sequence Listing are herein incorporated by reference. FIELD There are provided methods of treating retinoid responsive cancers, in particular neuroblastoma. BACKGROUND Neuroblastoma is a pediatric tumor of the peripheral sympathetic nervous system derived from migratory neural crest cells that have committed to become sympathetic neuroblasts. These tumor cells are highly proliferative and are blocked from undergoing definitive differentiation. Neuroblastoma is known to be caused by mutations that i) disrupt the control of cell proliferation, often due to aberrant overexpression of the MYCN (or MYC) protein, ii) block normal neuronal differentiation pathways and iii) promote cell survival. However, there are very few recurrent coding mutations, and this diversity, particularly in combination with other factors such as age of the patient and stage of tumor at diagnosis, leads to very high ‘clinical variability’ with respect to responsiveness to treatments. Neuroblastoma is the most common extracranial solid tumor among children, and accounts for approximately 15% of pediatric cancer deaths. Due to its difficulty to treat, patients with high-risk neuroblastoma undergo a highly intensified treatment regimen, comprising 12 months of intensified, multimodal chemotherapy, radiotherapy and surgery, followed by 6 months of differentiation therapy combined with immunotherapy (Matthay et al., N. Engl. J. Med. 1999;341(16):1165-1173). This ‘combination treatment strategy’ has resulted in some improvements in overall survival rates, but relapse rates remain high (Matthay et al., J. Clin. Oncol. 2009;27(7):1007-1013). Retinoids are known to have utility in clinical cancer chemoprevention (Freemantle et al. Oncogene. 2003;22,7305–7315). Notably, retinoids have been successfully used in the above outlined ‘combination treatment strategy’ as a ‘differentiation therapy’ (Matthay et al., 1999 ibid.; Thiele et al., Nature. 1985;313(6001):404-406). In particular, isotretinoin, a derivative of retinoic acid, is used to induce proliferative arrest of tumor cells (Thiele et al., 1985 ibid.). It has been shown that this involves epigenetic rewiring of the enhancer landscape to downregulate the proliferative core regulatory circuitry (CRC), as well as the expression of MYCN, while establishing a new retino-sympathetic CRC defined by a new set of highly expressed transcription factors (e.g. SOX4, MEIS1 and RAR) (Zimmerman et al., Sci. Adv. 2021;7(43)). Similarly, anti-GD2 immunotherapy has improved the overall outcome for patients with high-risk neuroblastoma when it is given during maintenance therapy in combination with isotretinoin (Yu et al., Clin. Cancer Res. 2021;27(8):2179-2189). GD2 is a disialoganglioside epitope expressed on the cell surface of most neuroblastoma cells (Wu et al., Cancer Res. 1986;46(1):440-443). Recent studies indicate that GD2 expression is heterogeneous on neuroblastoma cells at diagnosis, but neuroblastoma cells from a high enough fraction of patients express this antigen to make it efficacious to treat each patient with anti-GD2 immunotherapy, alternating with the isotretinoin courses as maintenance therapy (Schumacher-Kuckelkorn et al., Pediatr. Blood Cancer. 2017;64(1):46-56; Yu et al., 2021 ibid.). The density of GD2 expression on the neuroblastoma cell surface may predict the amount of antibody binding and thus the level of neuroblastoma cell killing by the patient’s natural killer cells (Terzic et al., Pediatr. Dev. Pathol. 2018;21(4):355-362). However, the anti-proliferative effects of isotretinoin and its effects on the enhancer landscape of the neuroblastoma cell are reversible when treatment is stopped, which leads to re-growth of tumor cells (Zimmerman et al., 2021 ibid.). It therefore results in a temporary benefit for children with high-risk neuroblastoma, in that differentiation therapy with isotretinoin delays but does not prevent disease recurrence after the treatment is stopped (Matthay et al., J. Clin. Oncol.2009;27(7):1007-1013). This drawback is not typically avoided with continuous dosing of isotretinoin, due to side effects from sustained treatment. For example, isotretinoin can only be given orally on a daily schedule of 14 days, as it begins to induce skin toxicity in young children. When the isotretinoin is stopped, the neuroblastoma cells rapidly resume cell proliferation and neuroblastoma tumors increase in size. There is an urgent need for improved antiproliferative therapies that have a longer lasting effect, preferably irreversible, and therefore reduce recurrence of the cancer upon stopping treatment. SUMMARY Such therapeutic strategies for treating retinoid-responsive cancers by administration of one or more epigenetic inhibitors have been discovered and are provided. Thus, there is provided a method of treating retinoid responsive cancer in a patient, comprising administering to said patient a therapeutically effective amount of one or more compounds which, individually or collectively, (i) induce and / or maintain tri-methylation of H3K27 within chromatin comprising one or more genes which encode regulatory elements of the proliferative core regulatory circuitry of retinoid responsive cancer cells; and (ii) reduce and / or prevent tri-methylation of H3K27 within chromatin comprising one or more genes which encode ganglioside synthases in retinoid responsive cancer cells. Effect (i) reduces the proliferation of retinoid responsive cancer cells and effect (ii) upregulates the expression of the GD2 epitope on the surface of retinoid responsive cancer cells. The induction and / or maintenance, and the reduction and / or prevention of tri-methylation of H3K27 may be either direct or indirect. Also provided is one or more compounds which, individually or collectively, (i) induce and / or maintain tri-methylation of H3K27 within chromatin comprising one or more genes which encode regulatory elements of the proliferative core regulatory circuitry of retinoid responsive cancer cells; and (ii) reduce and / or prevent tri-methylation of H3K27 within chromatin comprising one or more genes which encode ganglioside synthases in retinoid responsive cancer cells; for use in a method of treating retinoid responsive cancer in a patient. Also provided is the use of one or more compounds which, individually or collectively, (i) induce and / or maintain tri-methylation of H3K27 within chromatin comprising one or more genes which encode regulatory elements of the proliferative core regulatory circuitry of retinoid responsive cancer cells; and (ii) reduce and / or prevent tri-methylation of H3K27 within chromatin comprising one or more genes which encode ganglioside synthases in retinoid responsive cancer cells; in the manufacture of a medicament or medicaments for the treatment of retinoid responsive cancer. Also provided is a method of treating retinoid responsive cancer in a patient, comprising administering to said patient a therapeutically effective amount of a KAT6A / 6B inhibitor. Also provided is a KAT6A / 6B inhibitor for use in a method of treating retinoid responsive cancer. Also provided is the use of a KAT6A / 6B inhibitor in the manufacture of a medicament for the treatment of retinoid responsive cancer. Also provided is a method of treating retinoid responsive cancer in a patient, comprising administering to said patient a therapeutically effective amount of a KAT6A / 6B inhibitor and a retinoid. Also provided is a KAT6A / 6B inhibitor and a retinoid for use in a method of treating retinoid responsive cancer. Also provided is the use of a KAT6A / 6B inhibitor and a retinoid in the manufacture of a medicament for the treatment of retinoid responsive cancer. Also provided is a method of treating retinoid responsive cancer in a patient, comprising administering to said patient a therapeutically effective amount of a KAT6A / 6B inhibitor and an anti-GD2 antibody and / or GD2 CAR-T cells. Also provided is a KAT6A / 6B inhibitor and an anti-GD2 antibody and / or GD2 CAR-T cells for use in a method of treating retinoid responsive cancer. Also provided is the use of a KAT6A / 6B inhibitor and an anti- GD2 antibody and / or GD2 CAR-T cells in the manufacture of a medicament for the treatment of retinoid responsive cancer. Also provided is a method of treating retinoid responsive cancer in a patient, comprising administering to said patient a therapeutically effective amount of a KAT6A / 6B inhibitor, a retinoid, and an anti-GD2 antibody and / or GD2 CAR-T cells. Also provided is a KAT6A / 6B inhibitor, a retinoid, and an anti-GD2 antibody and / or GD2 CAR-T cells for use in a method of treating retinoid responsive cancer. Also provided is the use of a KAT6A / 6B inhibitor, a retinoid, and an anti-GD2 antibody and / or GD2 CAR-T cells in the manufacture of a medicament for the treatment of retinoid responsive cancer. BRIEF DESCRIPTION OF THE DRAWINGS Aspects will now be described in detail with reference to the accompanying drawings, in which: Figure 1A shows the suppression of neuroblastoma cell proliferation in cell lines BE2C, NGP and LAN-5 treated with isotretinoin, PF-9363, or the combination of both compounds at 1 μM concentration for 7 days. Shown are biologic triplicate cell counts representative of 3 independent experiments. *p< 0.05, ** p< 0.01, ***p< 0.001. Figure 1B shows a synergy map created using the publicly available software SynergyFinder+ to test for BLISS. The Synergy Score is represented by the intensity of shading, as shown in the key to the right of the figure. Figure 2A shows the morphology of BE2C and NGP neuroblastoma cells after 14 days of treatment with either DMSO control, 1 μM of isotretinoin alone, 1 μM of PF-9363 alone, or 1 μM of each of isotretinoin and PF-9363 in combination. Black arrows point to long neurites produced in BE2C cells receiving isotretinoin and PF-9363 in combination. Figure 2B shows the measured lengths of neurites (in ^m) for BE2C cells after 7 and 12 days of treatment. ** p< 0.005. Figure 3A shows growth suppression of BE2C neuroblastoma cell xenografts in mice, treated with isotretinoin for 14 days (dotted grey line), followed by vehicle control (solid black line) until day 28 (n = 7), compared to treatment with a vehicle control (solid black line, n = 12) for 28 days. Tumor volume was compared at days 4 and 14 by the Mann-Whitney test (p < 0.0001 for the vehicle vs. isotretinoin treatment groups). Figure 3B compares growth suppression of BE2C neuroblastoma cells xenografted in mice, treated with either PF-9363 for 28 days (n = 5, dotted black line), PF-9363 for 14 days, followed by vehicle control until day 28 (n = 4, dotted grey line), isotretinoin in combination with PF-9363 for 14 days, followed by vehicle control until day 28 (n = 4, dashed grey line), or isotretinoin in combination with PF-9363 for 14 days, followed by PF-9363 only until day 28 (n = 5,dashed black line). Figure 4A compares the upregulation of GD2 expression in BE2C cells by flow cytometry on inhibition of KAT6 activity using PF-9363 (1μM for 14 days), isotretinoin (1μM for 14 days), and the combination of isotretinoin and PF-9363 (1μM of each drug for 14 day). Figure 4B shows the mean fluorescence intensity for GD2 in BE2C cells measured by flow cytometry shown in panel 4A. Figure 4C shows upregulation of ganglioside synthases B4GALNT1 and ST8SIA1 in BE2C cells, treated for 6 days with DMSO (white), isotretinoin 1uM alone (light grey), PF- 93631uM alone (dark grey), or the combination of isotretinoin and PF-9363 (black). Results from RNA-seq with three biological replicates (Stars signify P<0.05). Figure 4D shows BE2C cell killing after treatment with either DMSO, isotretinoin alone, PF-9363 alone, or the combination of isotretinoin and PF-9363 and co-culture with GD2 CAR T cells at an E:T ratio of 0.25:1 for 48 hours (n=3 samples per treatment group). Data are shown as mean+ / - s.d. Significance was determined by one-way ANOVA. * P<0.05, **P<0.001, ** P<0.0001. All compounds administered at a concentration of 1µM each. Figure 5 illustrates the proliferative core regulatory circuit (CRC) of adrenergic neuroblastoma cells. Figure 6A shows the Western blot assay of protein levels for the transcription factors GATA3 and PHOX2B belonging to the adrenergic CRC and MYCN in BE2C cells treated with either DMSO as a control (first column), isotretinoin (second column, circled with black dotted line), PF-9363 (third column), or isotretinoin in combination with PF-9363 (fourth column, circled with black solid line). All compounds were given at 1 μM each for 14 days. Actin is shown as a protein loading control. Figure 6B shows the Western blot assay of protein levels for GATA3, PHOX2B and MYCN extracted from BE2C cells treated for 14 days as in Figure 6A, followed by a 7 day drug washout as follows: In the control group (first column), neuroblastoma cells received DMSO throughout for 21 days. Cells that received first isotretinoin for 14 days, then received DMSO for 7 days in the washout period (second column, circled with black dotted line). Cells treated with PF-9363 alone received this treatment for the entire 21 days (third column), and lastly cells treated with isotretinoin plus PF-9363 for 14 days, then only received PF-9363 treatment for an additional 7 days (fourth column, circled with black solid line). Figure 7A shows the gene tracks over the gene loci of PHOX2B and GATA3 from Cut&Run experiments with an antibody against H3K27me3 in BE2C cells. Cells were treated with DMSO as a control (first row), isotretinoin (second row), PF-9363 (third row) or PF- 9363+isotretinoin (fourth row). All compounds were given at 1 mM each for 12 days. Figure 7B shows bar chart of area under the curve (AUC) of the H3K27me3 across regulatory regions harboring enhancers of the proliferative adrenergic CRC genes PHOX2B and GATA3. DETAILED DESCRIPTION All publications and other reference materials referenced herein are hereby incorporated by reference in their entirety. Although a number of documents are cited herein, their citation does not constitute an admission that any one of them forms part of the common general knowledge in the art. Definitions Unless otherwise defined herein, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains and as commonly used in the art to which this application belongs. Exemplary methods and materials are described below, although methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present disclosure. In case of conflict, the present specification, including its definitions, will control. To facilitate ready understanding, certain terms used herein are defined below. The term “and / or” where used herein is to be taken as specific disclosure of each of the two specified features or components with or without the other. Thus, the term “and / or” as used in a phrase such as “A and / or B” herein is intended to include “A and B”, “A or B”, “A” (alone), and “B” (alone). Likewise, the term "and / or" as used in a phrase such as “A, B, and / or C” is used interchangeably with “A and / or B and / or C” and is intended to encompass each of the following aspects: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone). The word “comprise”, or variations such as “comprises”, or “comprising” will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers. It is further understood that wherever embodiments are described herein with the language “comprising” or grammatical equivalents thereof, otherwise analogous embodiments described in terms of “consisting of” and / or “consisting essentially of” are also provided. In other words, if a composition comprising A, B and C is recited, a composition consisting essentially of A, B and C is also contemplated as is a composition consisting of A, B and C. The term “cancer” is used herein to describe a disease characterized by the uncontrolled, abnormal growth of cells. The term “retinoid responsive cancer” is used herein to describe a cancer whose cancerous cells can be killed, or their growth reduced, repressed, delayed or prevented, by treatment with a retinoid. Examples of retinoid responsive cancer include neuroblastoma (Thiele et al., 1985 ibid.), rhabdomyosarcoma (O’Brien et al., Clinical Epigenetics 2023, 15(1), 167), breast cancer (Garattini et al. Cancer Treat Rev 2014, 40(6), 739–749), acute promyeloocytic leukemia (Douer et al., Blood. 2001;97(1):73-80), medulloblastoma (Chlapek et al., Cancer Cell Int. 2014;14:51), choriocarcinoma (Chou, J. Clin. Endocrinol. Metab. 1982;Jun;54(6):1174–80), teratocarcinoma (Lehtonen et al. Exp. Cell Res. 1983;Mar;144(1):191–7), and non-small cell lung cancer (Pelos et al., J Cancer, 2024, 154(6), 1029–1042). The term “neuroblastoma” is used herein to describe a cancer derived from migratory neural crest cells that have committed to become sympathetic neuroblasts. The term “regulatory elements of the proliferative core regulatory circuitry” is used herein to describe the set of core transcription factors which collectively regulate gene expression within the cells of the retinoid responsive cancer (Durbin et al., Nat. Genet. 2018;50(9):1240-1246; Zimmerman et al., 2021 ibid.). For example, the regulatory elements of the proliferative core regulatory circuitry of adrenergic neuroblastoma cells comprise PHOX2B, ASCL1, GATA3, ISL1, HAND2 and TBX2. The term “ganglioside synthase” is used herein to describe an enzyme which assists the synthesis of gangliosides (e.g. GD2) within the retinoid responsive cancer cells. The terms “treating”, or “treatment” describe the management and care of a subject for the purpose of combating a disease, condition, or disorder. Treating includes preventing the onset of symptoms or complications, alleviating or eliminating symptoms or complications, or eliminating the underlying disease, condition, or disorder. For example, treating cancer in a subject includes reducing, repressing, delaying or preventing the growth of cancerous cells as well as killing cancerous cells within the subject. The terms “administering” and “administration” refer to any method of providing the active substance to a patient. Where the method involves administration of two or more active substances, it results in them exerting their desired pharmacodynamic effects at the same time, or for an overlapping period of time, within the patient's body. Thus, administration of the two or more active substances is not limited to simultaneous administration, nor administration via the same route. It encompasses separate, sequential and simultaneous administration via the same or different routes and in the same or different medicaments, provided that it results in them exerting their desired pharmacodynamic effects at the same time, or for an overlapping period of time, within the patient’s body. Methods of administration are well known to those skilled in the art and include, but are not limited to, oral administration, transdermal administration, administration by inhalation, nasal administration, topical administration, intraaural administration, rectal administration, sublingual administration, buccal administration, and parenteral administration, including injectable administration such as intravenous administration, intra-arterial administration, intramuscular administration, intradermal administration, intrathecal administration, and subcutaneous administration. Administration can be continuous or intermittent. While the above means of administration may provide systemic exposure to the active substance(s), local administration / exposure is also contemplated. A “KAT6A / B inhibitor” is a substance which prevents the histone lysine acetyltransferases KAT6A and / or its paralog KAT6B from carrying out its function of post- translational modification of histones (in particular acetylation of H3K23), preferably by binding to KAT6A and / or KAT6B (preferably to the catalytic domain thereof). A KAT6A / B inhibitor includes one or a combination of any agents such as a small molecule, nucleic acid (e.g., siRNAs or sgRNAs), or antibody, peptide, peptidomimetic or aptamer that acts to disrupt, directly or indirectly, and reduce or even eliminate the function or expression of the KAT6A and / or KAT6B protein or the KAT6A and / or KAT6B gene. Suitable KAT6A / B inhibitors are known in the art or may be identified by their ability to bind to KAT6A / B in a suitable binding assay and / or inhibit KAT6A / B activity in a suitable functional assay. Suitable examples of both these assays are described in WO2020 / 254946. The term “retinoid” is used herein to describe a class of compounds which includes (i) vitamin A (retinol) and geometric isomers thereof, (ii) derivatives of retinol and its geometric isomers wherein the -OH group is oxidized to an aldehyde, carboxylic acid or ester group (e.g. retinal, tretinoin (also known as all-trans-retinoic acid (ATRA)), isotretinoin, alitretinoin and retinyl acetate), and (iii) compounds specifically designed to have a similar biological function to retinol (e.g. etretinate, acitretin, adapalene, bexarotene, tazarotene and trifarotene). The term “anti-GD2 therapy” is used herein to describe therapeutic treatments which utilise the GD2 epitope to target retinoid responsive cancer cells (e.g. anti-GD2 antibody therapy and GD2 CAR T cell therapy). Treatment of retinoid responsive cancer There is provided a method of treating retinoid responsive cancer in a patient, comprising administering to said patient a therapeutically effective amount of one or more compounds which, individually or collectively, (i) induce and / or maintain tri-methylation of H3K27 within chromatin comprising one or more genes which encode regulatory elements of the proliferative core regulatory circuitry of retinoid responsive cancer cells; and (ii) reduce and / or prevent tri-methylation of H3K27 within chromatin comprising one or more genes which encode ganglioside synthases in retinoid responsive cancer cells. Also provided is one or more compounds which, individually or collectively, (i) induce and / or maintain tri-methylation of H3K27 within chromatin comprising one or more genes which encode regulatory elements of the proliferative core regulatory circuitry of retinoid responsive cancer cells; and (ii) reduce and / or prevent tri-methylation of H3K27 within chromatin comprising one or more genes which encode ganglioside synthases in retinoid responsive cancer cells; for use in a method of treating retinoid responsive cancer in a patient. Also provided is the use of one or more compounds which, individually or collectively, (i) induce and / or maintain tri-methylation of H3K27 within chromatin comprising one or more genes which encode regulatory elements of the proliferative core regulatory circuitry of retinoid responsive cancer cells; and (ii) reduce and / or prevent tri-methylation of H3K27 within chromatin comprising one or more genes which encode ganglioside synthases in retinoid responsive cancer cells; in the manufacture of a medicament or medicaments for the treatment of retinoid responsive cancer. The retinoid responsive cancer may be selected from the group comprising neuroblastoma, rhabdomyosarcoma, breast cancer, acute promyeloocytic leukemia, medulloblastoma, skin cancers including melanoma, basal cell carcinoma and cutaneous squamous cell carcinoma, prostate cancer, colorectal cancer, choriocarcinoma, teratocarcinoma, Kaposi’s Sarcoma and non-small cell lung cancer. The retinoid responsive cancer may be neuroblastoma. In this case, the regulatory elements of the proliferative core regulatory circuitry may include those regulating PHOX2B and GATA3. Also in this case, the one or more genes which encode ganglioside synthases may include B4GALNT1 and ST8SIA1. In certain embodiments, a compound which is a KAT6A / B inhibitor is administered. The KAT6A / B inhibitor desirably inhibits the activity of KAT6A and / or its paralog KAT6B with an IC50of 300 nM or less, preferably 100 nM or less, more preferably 50 nM or less. A representative antibody KAT6A / B inhibitor is antibody 21620002 (commercially available from Novus Biologicals) or 78462S (commercially available from Cell Signaling Technology) or HPA065052 (commercially available from Millipore) or HPA006104 (commercially available from Millipore). Representative examples of small molecule KAT6A / B inhibitors that may be useful include OP-3136, QLS1304, WM-1119 (2-fluoro-N'-(3-fluoro-5-(pyridin-2- yl)benzoyl)benzenesulfonohydrazide), WM-8014 (N'-(4-fluoro-5-methyl-[1,1'-biphenyl]-3- carbonyl)benzenesulfonohydrazide), PF-9363 (N'-(4-fluoro-5-methyl-[1,1'-biphenyl]-3- carbonyl)benzenesulfonohydrazide), and PF-07248144 (2-Methoxy-N-{4-methoxy-6-[(1H- pyrazol-1-yl)methyl]-1,2-benzoxazol-3-yl}benzene-1-sulfonamide) as well as pharmaceutically acceptable salts of any of these compounds. The structures of some representative small molecule KAT6A / B inhibitors are as follows: is selected from the group consisting of PF-9363, PF-07248144, WM-1119, WM-8014, and ISM-5043 as well as pharmaceutically acceptable salts of any of these compounds. The KAT6A / B inhibitor may also be selected from compounds disclosed in WO 2023 / 088233 (e.g., 2,6-dimethoxy-N-(5-(thiazol-2-yloxy)-3,4-dihydro-2H-chromeno[8,7-d]isoxazol-9- yl)benzenesulfonamide) and WO 2023 / 114710. In another preferred embodiment, the KAT6A / B inhibitor is a compound of formula (I): or a pharmaceutically acceptable salt thereof, wherein: R1is H, OCH3, OCH2CH3, CF3, or CH2OCH3; R2is H, fluoro, OH, or OCH3; R3is OCH3, OCD3, OCH2CH3, OCH(CH3)2, O- cycloproyl, flouro, chloro, ethyl, or cyclopropyl; R4is H, CH3, cyclopropyl, OCH3, OCHF2, bromo, or fluoro; and R5is H, fluoro, methyl, hydroxy, or CH2OH. The synthesis of such compounds is described in WO2020 / 254946A1. Preferably, R1is H or OCH3; R2is OCH3; R3is OCH3; R4is H; and R5is H. Most preferably, the KAT6A / B inhibitor is PF-07248144. KAT6A and KAT6B inhibitors may be interfering RNAs (e.g., a siRNA) or a single guide RNA (sgRNA) used as active agent to decrease the level of KAT6A or KAT6B. Nucleic acid sequences of representative sgRNAs that knock out KAT6A are set forth in Table 1. Table 1: Nucleic Acid sequences of KAT6A sgRNA Oligonucleotide Sequence (5'-->3') sgKAT6A-1 TGGCTCCACATCGTAATAGA (SEQ ID NO: 1) sgKAT6A-2 TGATAGCCAATCGTAACTGC (SEQ ID NO: 2) A method of treating retinoid responsive cancer in a patient is also provided, the method comprising administering to said patient a therapeutically effective amount of a KAT6A / B inhibitor. More preferably, the retinoid responsive cancer is neuroblastoma. More preferably, the KAT6A / B inhibitor is PF-07248144. Most preferably, the retinoid responsive cancer is neuroblastoma, and the KAT6A / B inhibitor is PF-07248144. The KAT6A / B inhibitor may desirably be administered in combination with a retinoid. Preferably, the retinoid is selected from the group consisting of retinol, geometric isomers of retinol, retinal, tretinoin (retinoic acid), isotretinoin, alitretinoin, retinyl acetate, etretinate, acitretin, adapalene, bexarotene, tazarotene, trifarotene, fenretinide, temarotene, motretinide and tamibarotene. Even more preferably, the retinoid is isotretinoin. Further provided is a method of treating retinoid responsive cancer in a patient, comprising administering to said patient a therapeutically effective amount of a KAT6A / B inhibitor and a retinoid. More preferably, the retinoid responsive cancer is neuroblastoma. More preferably, the KAT6A / B inhibitor is PF-07248144. More preferably, the retinoid is isotretinoin. Most preferably, the retinoid responsive cancer is neuroblastoma, the KAT6A / B inhibitor is PF-07248144, and the retinoid is isotretinoin. The KAT6A / B inhibitor may be administered in combination with anti-GD2 therapy. Preferably, the anti-GD2 therapy is selected from the group consisting of GD2 CAR-T therapy and GD2 antibody therapy. Even more preferably, the GD2 antibody is selected from the group consisting of dinutuximab, dinatuximab beta, naxitamab, and hu14.18K322A. Further provided is a method of treating retinoid responsive cancer in a patient, comprising administering to said patient a therapeutically effective amount of a KAT6A / B inhibitor and an anti-GD2 antibody and / or GD2 CAR-T cells. More preferably, the retinoid responsive cancer is neuroblastoma. More preferably, the KAT6A / B inhibitor is PF-07248144. More preferably, the anti-GD2 antibody is selected from dinutuximab, dinatuximab beta and naxitamab. Most preferably, the retinoid responsive cancer is neuroblastoma, the KAT6A / B inhibitor is PF-07248144, and the anti-GD2 antibody is selected from dinutuximab, dinatuximab beta and naxitamab The KAT6A / B inhibitor may be administered in combination with a retinoid and anti- GD2 therapy. Preferably, the retinoid is selected from the group consisting of retinol, geometric isomers of retinol, retinal, tretinoin (retinoic acid), isotretinoin, alitretinoin, retinyl acetate, etretinate, acitretin, adapalene, bexarotene, tazarotene and trifarotene. Even more preferably, the retinoid is isotretinoin. Preferably, the anti-GD2 therapy is selected from the group consisting of GD2 CAR-T therapy and GD2 antibody therapy. Even more preferably, the GD2 antibody is selected from the group consisting of dinutuximab, dinatuximab beta and naxitamab. Further provided is a method of treating retinoid responsive cancer in a patient, comprising administering to said patient a therapeutically effective amount of a KAT6A / B inhibitor, a retinoid and an anti-GD2 antibody and / or GD2 CAR-T cells. More preferably, the retinoid responsive cancer is neuroblastoma. More preferably, the KAT6A / B inhibitor is PF- 07248144. More preferably, the retinoid is isotretinoin. More preferably, the anti-GD2 antibody is selected from dinutuximab, dinatuximab beta and naxitamab. Most preferably, the retinoid responsive cancer is neuroblastoma, the KAT6A / B inhibitor is PF-07248144, the retinoid is isotretinoin and the anti-GD2 antibody is selected from dinutuximab, dinatuximab beta and naxitamab EXAMPLES Materials and Methods Cell Lines. Cell lines were obtained from the ATCC (BE2C) and DSMZ (NGP and LAN- 5). All cell lines were short tandem repeat (STR) tested for identity prior to use. Human neuroblastoma cell lines were cultured at 5% CO2in RPMI medium containing 10% fetal bovine serum and 1% penicillin-streptomycin. All cell lines were routinely validated to be free of Mycoplasma species and genotyped by short tandem repeat (STR) analysis at the Dana- Farber Molecular Diagnostic Core Facility. Drug screen. 5000 BE2C cells were plated in each well of a white 96-well plate in 100 μl of total medium containing either DMSO or 5 μM ATRA alone or in combination with one of 452 epigenetic modifying compounds (including the KAT6A / B inhibitor PF-9363). Cells were incubated for five days and then cell viability was assayed with CellTiter-Glo (Promega) according to the manufacturer’s protocol. The z-score is defined as the relative growth of cells treated with compound alone minus the average growth of all treated cells in the screen divided by the standard deviation. The relative growth equals the ratio of viable cell number of cells treated with compound or compound plus isotretinoin vs the viable cell number of the cells treated with DMSO control. Proliferation assays. For cell proliferation assays, neuroblastoma cells were plated in 24 well (10,000 cells / well) or 6 well (20,000 cells / well) plates in RPMI medium containing DMSO, 1 μM isotretinoin, 1 μM PF-9363 or 1 μM isotretinoin plus 1 μM PF-9363. Cell viability was assessed at day 7 (unless noted otherwise) by counting live cells using the Countess (Thermo Fisher Scientific). Chemicals. Isotretinoin and PF-9363 were obtained from MedChemExpress. Cell culture–grade DMSO was purchased from ATCC. Compounds were resuspended in DMSO to a stock concentration of 10 mM and added directly to cell culture medium at the indicated concentrations. Animals. Eight-week-old female NOD.Cg-Prkdcscid Il2rgtm1Wjl / SzJ (NSG) mice (The Jackson Laboratory, RRID:IMSR_JAX:025216) were used for tumor xenograft studies and MTD testing. Western blotting. BE2C cells were plated in 100mm dishes (200,000 cells / dish) and maintained in RPMI medium containing either DMSO, 1 μM isotretinoin, 1 μM PF-9363 or 1 μM isotretinoin plus 1 μM PF-9363. Protein samples were collected at the indicated time points and lysed using radioimmunoprecipitation assay buffer containing protease and phosphatase inhibitors (Cell Signaling Technology). Lysates were quantified by Bradford assay (Bio-Rad), and 10 ^g of extracted protein was separated using Novex SDS–polyacrylamide gel electrophoresis reagents and transferred to nitrocellulose membranes (Life Technologies). Membranes were blocked in 5% milk protein and incubated overnight with primary antibodies against beta actin, MYCN, GATA3 or PHOX2B (see Table 2) as previously described (Zimmerman et al., 2021 ibid.) followed by secondary horseradish peroxidase–linked goat anti- rabbit and anti-mouse (Cell Signaling Technology) antibodies (1:1000) according to the manufacturers’ instructions. Antibody-bound membranes were incubated with SuperSignal West Pico chemiluminescent substrate (Thermo Fisher Scientific) and developed using HyBlot CL autoradiography film (Thomas Scientific). The antibodies that used immunoblotting are listed in Table 2. CUT&RUN sequencing and initial processing. CUT&RUN coupled with high- throughput DNA sequencing was performed using antibodies against H3K27me3 (see Table 2) and Cutana pA / G-MNase (EpiCypher) according to the manufacturer’s protocol as previously described (Zimmerman et al., 2021 ibid.). Reads were aligned to the human reference genome (hg19) using bowtie v1.2.2 in single-end mode with parameters –k 2 –m 2 – best and –l set to the read length. For visualization, WIG files were created from aligned read positions using MACS v1.4 with parameters –w –S –space=50 –nomodel –shiftsize=200 to artificially extend reads to be 200 bp and to calculate their density in 50-bp bins. Read counts in 50-bp bins were then normalized to the millions of mapped reads, giving reads per million (RPM) values. WIG files were visualized in the Integrative Genomics Viewer (IGV) browser version 2.7.2 as previously described (Zimmerman et al., 2021 ibid.) . Spike-in normalized RNA-sequencing (RNA-seq): DMSO-, isotretinoin-, PF-9363- and isotretinoin+PF-9363-treated cells were grown in triplicate using six-well plates and collected directly into TRIzol. ERCC spike-in RNA (Life Technologies) was diluted 1:10 in nuclease-free water and added directly to TRIzol lysates after being normalized to cell number as previously described (Zimmerman et al., 2021 ibid.). Libraries preparation and sequencing were conducted as previously described (Weichert-Leahey et al., J Clin Invest, 2023, 133(10), e166919). Graphs were created using Prism 10.2.2 (GraphPad). Flow cytometry: BE2C cells were incubated either with DMSO, 1 μM isotretinoin, 1 μM PF-9363 or 1 μM PF-9363 plus 1 μM isotretinoin for 14 days. Cells were trypsinized into suspension and washed twice with PBS + 2% FBS before staining with primary antibody against GD2 (see Table 2) or secondary only antibody AF647 as a control (see Table 2). Antibodies were incubated for 15–60 min at 37 °C. Cells were filtered through a 40-μM filter and immediately measured on a BD Celesta flow cytometer. Flow cytometry analysis was collected in BD FACSDIVA v9.0. Data analysis was performed in FlowJo (v10.6.1) as previously described (Mabe et al., Nat Cancer. 2022;3(8):976-993). CAR T cell production and CAR T cell cytotoxicity assay: Blood from healthy donors was collected into heparin containing tubes. PBMCs were isolated by Ficoll gradient followed by T cell selection using the Pan T Cell Isolation Kit (Miltenyi Biotec). T cells were activated and expanded using CD3 / CD28 activation beads in X-vivo media containing 10% FBS, penicillin / streptomycin, glutamax and 50 U / mL IL-2. After 48 hours, T cells were transduced with VSV-typed EF1a-driven GD2 CAR or CD19 CAR lentivirus and expanded for an additional 7-10 days. Tumor cell lines were pre-treated as indicated for 14 days. Tumor cells were replated at 10,000 cells / well, followed by addition of CAR T cells at effector-to-target ratio of 0.25:1, 0.5:1, and 1:1. After 48h, Bright-Glo Luciferase (Promega) was added at 1:1 by volume, and incubated for 2 mins prior to quantification using an EnVision microplate reader (Perkin Elmer). GD2 CAR T cell specific killing was calculated as a fraction from maximum luciferase signal in tumor cells co-cultured with CD19 CAR T cells to account for non-specific background killing. Immunohistochemistry: Formalin-fixed, paraffin-embedded (FFPE) blocks were prepared and sectioned, and immunohistochemistry was conducted, at the Research Pathology Core lab at the Dana-Farber Cancer Institute. Ki67 expression was detected using a primary antibody and visualized with a diaminobenzidine-peroxidase system (EnVision+, Dako). Counterstaining was performed with Mayer’s hematoxylin, and slides were imaged using the Echo Revolve4 inverted-microscopy system. GD2 immunofluorescence was detected following a previously described protocol (Fischer-Riepe L, Kailayangiri S, Zimmermann K, et al. Preclinical Development of CAR T Cells with Antigen-Inducible IL18 Enforcement to Treat GD2-Positive Solid Cancers. Clin Cancer Res. 2024; 30(16): 3564-3577). Imaging of the tissue samples was performed using the Akoya Biosciences PhenoCycler®-Fusion 1.0 system, with subsequent visualization using Phenochart and inform (Akoya AI-based software). Statistical analysis. Animal experiments were analyzed by Mann-Whitney test for tumor volume. Other data were analyzed with one- or two-sided ANOVA with post hoc Tukey tests, two-sided t tests, or one- or two-sided Fisher exact tests as appropriate for multiple or pairwise comparisons. Statistical significance was defined as P < 0.05 unless otherwise stated. Data were analyzed with GraphPad Prism 7.01, and all error bars represent SD unless otherwise noted. Table 2 – Antibodies used in methods Antibody Assay Manufacturer Catalog # H3K27me3 CUT&Run Abcam ab192985 MYCN Western blot Cell Signaling 9405S PHOX2B Western blot Santa Cruz Sc-376993 GATA3 Western blot Cell Signaling 5852 GD2 Flow cytometry Santa Cruz Sc-53831 Alexa Fluor 647 (IgG) Flow cytometry Invitrogen A27040 Example 1 - KAT6A / B inhibition is synergistic with a retinoid in reducing growth of neuroblastoma cells in vitro To test the effects of PF-9363 alone and in combination with the retinoid isotretinoin in neuroblastoma, we used three neuroblastoma cell lines BE2C, NGP and LAN5. Cells were plated into 6 well plates with 30,000 cells per well and treated with either DMSO as a control condition, isotretinoin alone, PF-9363 alone or the combination of PF-9363 with isotretinoin. All compounds were given at 1 μM each for seven days. Absolute cell numbers were counted from each condition in triplicates at the end of treatment. The data, as presented in Figure 1A, showed that the treatment with the combination of isotretinoin with PF-9363 caused increased suppression of neuroblastoma cell growth, which was more effective than treatment with either isotretinoin or PF-9363 alone (Figure 1A). To test whether the effectiveness of this combination was a synergistic or additive effect, we conducted excess over BLISS synergy analysis using a publicly available tool. By testing several concentrations of isotretinoin and PF-9363 alone and in combination, we found that the combination was synergistic over a wide range of concentrations (highlighted in grey in Figure 1B), including 1μM for each compound (asterisk), after seven days of treatment with an excess over BLISS synergy score of > 15 (Figure 1B). Taken together, the data showed that inhibition of KAT6A and KAT6B activity suppresses neuroblastoma cell proliferation synergistically with retinoic acid. Example 2 – Cellular morphology of NB cells after 14 days of retinoic acid + PF-9363 treatment in vitro In addition to showing that neuroblastoma proliferation was inhibited synergistically by the combination treatment with isotretinoin and the KAT6A / B inhibitor PF-9363, it was investigated whether the combination also accentuated neuroblastoma cell differentiation compared to isotretinoin alone. Morphological changes of neuroblastoma cells BE2C and NGP were assessed undergoing differentiation therapy with isotretinoin alone or in combination with PF-9363. 100,000 cells were plated into tissue culture plates and treated with either i) DMSO as a control condition, ii) isotretinoin alone, iii) PF-9363 alone or iv) the combination of PF- 9363 plus isotretinoin. Both compounds were given at 1 μM each for 14 days. As shown in Figures 2A and 2B, isotretinoin induced neuronal differentiation of both BE2C and NGP cells, causing the cells to form short neurites. Comparatively, PF-9363 treatment alone had minor effects on BE2C and NGP over 14 days of treatment, with cells showing only subtle morphological changes, most evident in BE2C cells, where cells formed very short neurites (Figure 2A). In contrast, the combination treatment with isotretinoin and PF-9363 induced significant changes in the phenotype of both BE2C and NGP cells, with the formation of long neurites, now bridging from one cell to the neighbouring cell (Figure 2A, black arrows). Measurements of the lengths of the neurites showed significantly longer neurites formed in cells treated with both isotretinoin and PF-9363 compared with either isotretinoin or PF-9363 alone (Figure 2B). Taken together, the data produced in this Example showed that treatment with the combination of the PF-9363 KAT6A / B inhibitor and isotretinoin augments differentiation of neuroblastoma cells treated in vitro to a greater degree than treatment with the corresponding compounds alone. Example 3 – Combination of isotretinoin and PF-9363 is effective in sustained neuroblastoma proliferation in vivo To investigate the effect of PF-9363 in combination with isotretinoin in vivo, a tolerable safety profile was firstly determined for immunodeficient NSG (NOD. Cg-Prkdcscid Il2rgtm1Wjl / SzJ) mice. Specifically, it was found that 50 mg / kg / day of isotretinoin once per day by oral gavage is the maximum tolerated dose (MTD) that can be given to immunocompromised NSG mice either alone or in combination with PF-9363 given at 5 mg / kg / day po. Subsequently, subcutaneous xenografts of BE2C cells in NSG mice were established by injecting BE2C cells in the flanks of these animals. Four days after tumor engraftment, the treatment of the mice was initiated with either i) vehicle control daily by oral dosage for 28 days (Fig 3A, black curve), or ii) isotretinoin 50 mg / kg per os (“po”, by mouth) daily for 14 days (Fig 3A, grey dashed curve), and then the isotretinoin was stopped and the mice received vehicle control for 14 days (Fig 3A, black curve). In group i), the xenografted cells grew exponentially in mice receiving vehicle control over the entire 28 days. In contrast, the growth of the xenografted cells was effectively blocked over the 14 days of isotretinoin treatment in group ii), which reflects the ability of this retinoid to suppress the proliferation of neuroblastoma cells implanted in vivo over the 14-day treatment period without an increase in tumor volume (Figure 3A; p < 0.0005 by Mann-Whitney test). However, when the isotretinoin treatment was discontinued after 14 days and the mice in ii) were given vehicle control, the tumor cells began to grow, and the tumor volumes increased rapidly (Fig 3A). Overall, this illustrates the reversible nature of the anti-proliferative effects of retinoic acid in vivo. To address this problem, the durability of isotretinoin was investigated when it is combined with the KAT6A / B inhibitor. To this end, four different groups of xenografted NSG mice were tested with different regimens of isotretinoin and PF-9363, given alone or in combination (Fig 3B). In group 1, the mice xenografted with BE2C cells were given PF-9363 alone as a dose of 5mg / kg po daily for 14 days, followed by removal of the drug and treatment with vehicle for 14 days (Fig 3B, light grey dotted curve). PF-9363 treatment effectively suppressed the growth of the neuroblastoma cells for 14 days during treatment, but when the drug was removed, the neuroblastoma cells rapidly resumed proliferation (Fig 3B, light grey dotted curve). In group 2, the xenografted mice were given PF-9363 as a single agent 5mg / kg po daily for 28 days (Fig 3B, black dotted curve). In this case, suppression of the growth of the neuroblastoma cells was also observed during the first 14 days of treatment, but even with continued dosing of PF-9363 until 28 days, the tumor cells began to slowly grow and the xenografted tumors increased in size over the next 14 days despite continuing treatment with PF-9363 at the same dosage (Fig 3B, black dotted curve). Taken together, these single agent studies in group 1 and group 2 demonstrated that PF- 9363 treatment alone has promising anti-tumor activity in neuroblastoma in vivo, but its growth suppressing effect as a single agent is not persistent for longer than 14 days even if the treatment is continued. Next, the anti-tumor activity of isotretinoin in combination with PF-9363 was investigated. In group 3, the xenographed mice were treated with isotretinoin 50 mg / kg po in combination with PF-93635 mg / kg po daily for 14 days before ceasing the treatment (Fig 3B, grey dashed curve). The combination of isotretinoin and PF-9363 was well tolerated, and the mice showed no significant tumor growth for the first 14 days of treatment. However, when both compounds were discontinued, the tumor cells grew rapidly, mirroring the results above when the mice were treated with either drug as a single agent (Fig 3B, grey dashed curve). Finally, in group 4, the xenografted mice were treated with isotretinoin 50 mg / kg po in combination with PF-93635 mg / kg po daily for 14 days, and then the treatment was continued with an additional 14 days of PF-9363 5mg / kg po upon discontinuing isotretinoin (Fig 3B, black dashed curve). Consistent with the findings above, the initial 14-day treatment with the combination led to no tumor cell growth (Fig 3B, black dashed curve). Most surprisingly, after an initial 14 days of treatment with the combination of PF-9363 and isotretinoin, treatment with PF-9363 alone was sufficient to sustain prevention of tumor regrowth. It is known that another KAT6A / 6B inhibitor PF-07248144 can be given daily for long periods of time in the absence of dose-limiting toxicity. This compound could also be usefully administered in combination with isotretinoin. Example 4 – Isotretinoin and KAT6A / B inhibitor increase GD-2 expression on neuroblastoma cells Next, the effect of treatment with PF-9363 and isotretinoin on cell surface expression levels of GD2 was investigated. In this experiment, 100,000 BE2C cells were plated into a cell culture dish and treated the cells with i) isotretinoin alone, ii) PF-9363 alone, iii) the combination of isotretinoin plus PF-9363 or iv) DMSO control. Each compound was given at 1 μM for 14 days. BE2C cells were trypsinized to release them from the bottom of the dish and into suspension and then washed twice with PBS + 2% FBS before staining with i) the GD2 antibody (see Table 2) or ii) the secondary only antibody as a control. Antibodies were incubated for 15-60 min at room temperature, and the cells were washed. Cells were filtered through a 40-μM mesh filter and the fluorescence intensity was measured by flow cytometry using a BD Celesta flow cytometer. Laser induced cellular fluorescence measurements were collected using photomultipliers with BD FACSDIVA v9.0. Fluorescence histograms were performed and analysed using FlowJo (v10.6.1) software. As shown in Figures 4A and 4B, BE2C cells lack detectable surface GD2 expression, even though they exhibit the adrenergic cell state. Most notably, Figures 4A and 4B demonstrate that isotretinoin treatment alone had no effect on the density of GD2 expression (light dark curve), whereas PF-9363 treatment (dark grey curve) increased the cell surface density of this glycolipid by approximately 10-fold. The most pronounced effect on surface GD2 expression levels was observed when cells were treated with the combination of PF-9363 plus isotretinoin, which resulted in increased mean fluorescence intensity of anti-GD2 staining on the neuroblastoma cell surface by flow cytometry that was increased by at least 15-fold compared to the DMSO control cells (black curve in Fig. 4A). Furthermore, the upstream catalytic enzymes ST8SIA1 (GD3 Synthase) and B4GALNT1 (GD2 Synthase) have been implicated as two of the rate-limiting enzymes for GD2 expression. As shown in Figure 4C, the RNA expression level of B4GALNT1 increased in BE2C cells, which received the combination treatment with isotretinoin plus PF-9363, but not with each treatment alone, whereas expression of ST8SIA1 was induced by both PF-9363 alone and the combination, but not by isotretinoin alone. Thus, KAT6A / B inhibition alone induces one important enzyme, whereas the combination treatment with isotretinoin and PF-9363 induces both of the important enzymes ST8SIA1 and B4GALNT1 involved in the GD2 synthesis pathway. To determine whether upregulation of GD2 on the cell surface is efficient to induce cell killing by anti-GD2 based immunotherapies in patients with high-risk neuroblastoma, we tested the efficacy of GD2 CAR T cell treatment of BE2C cells that had received treatment with isotretinoin, PF-9363 or PF-9363 plus isotretinoin. Separate treatment with isotretinoin or PF-9363 significantly increased the killing of BE2C cells mediated by GD2 CAR T cells, however, the combination treatment with PF-9363 plus isotretinoin had the greatest effect in mediating increased GD2 CAR T cell killing compared to control cells and was more effective in increasing neuroblastoma cell killing than treatment with either isotretinoin or PF-9363 alone (Fig. 4D). To test if GD2 expression is inducible on the surface of neuroblastoma cells not only in vitro but also in vivo through treatment with isotretinoin plus PF-9363, we performed antiGD2 Immunofluorescence on FFPE tissue sections from drug-treated BE2C xenograft tumors. Consistent with our in vitro findings, control-treated BE2C tumors did not express GD2 on the cell surface when engrafted in NSG mice. Importantly, only combination treatment, but not isotretinoin or PF-9363 alone, induced cell-surface expression of GD2 on tumor cells in vivo, similar to the results in vitro. These data indicate that epigenetic reprogramming of neuroblastoma cell state through inhibition of KAT6A / B activity in combination with retinoic acid is effective to induce high levels of GD2 surface expression and increase the response to specific anti-GD2-based therapies, which may benefit children with high-risk neuroblastoma as a novel combination therapy. Example 5 – Durable repression of the proliferative adrenergic cell state by the combination of isotretinoin plus PF-9363-mediated KAT6 inhibition in neuroblastoma Figure 5 illustrates the regulatory elements of the adrenergic proliferative core regulatory circuit (CRC) of adrenergic neuroblastoma cells. Each transcription factor in the adrenergic CRC is highly expressed in adrenergic neuroblastoma cells. The expression of each transcription factor is regulated by a large super-enhancer (also called stitch-enhancer and designated SE). The circuit is assembled such that each transcription factor binds to and autoregulates its own SE, as well as the SEs that regulate the expression of each of the other CRC members. Thus, the CRC members form an interconnected autoregulatory loop of transcriptional regulation. These transcription factors also bind together within episomes to the enhancers of the extended regulatory network of the CRC, which includes up to 350 genes that drive the active cell proliferation of neuroblastoma cells (Durbin et al., 2018 ibid.) The MYCN oncogene is often amplified in neuroblastoma and the MYCN protein is expressed at high levels. The MYCN protein binds with the CRC transcription factors to upregulate the expression of its downstream network of gene expression. Due to the structure of the CRC, if one transcription factor is depleted, the expression levels of each of the other transcription factors will be decreased, along with the expression levels of genes of the extended regulatory network, and neuroblastoma cells can no longer proliferate. It is known that the isotretinoin treatment causes downregulation of the adrenergic CRC members GATA3 and PHOX2B and replaces the adrenergic CRC with a new retinosympathetic CRC, causing the downregulation of the MYCN oncogene and neuronal differentiation of the neuroblastoma cells (Zimmerman et al., 2021 ibid.). To investigate the cellular mechanism underlying the sustained growth suppression of neuroblastoma cells induced by treatment with the combination of isotretinoin and the KAT6A / B inhibitor PF-9363, the protein levels of MYCN, and the adrenergic CRC members GATA3 and PHOX2B were determined in each group after 14 and 21 days of treatment. 100,000 BE2C cells were plated into a cell culture dish and treated with either DMSO (group I), isotretinoin (group II), PF-9363 (group III), or the combination of isotretinoin plus PF-9363 (group IV). All treatment groups were independently plated in duplicate. Compounds were given at 1 μM each for 14 days. At day 14, cells were harvested from each treatment condition (I-IV) and cells were lysed using immunoprecipitation assay buffer containing protease and phosphatase inhibitors. After day 14, the second cell culture dish from each treatment condition was continued in culture. BE2C cells continued to receive treatment with either DMSO (group I) or PF-9363 (group III) for an additional 7 days. BE2C cells that were previously treated with isotretinoin alone were now kept in culture with DMSO and isotretinoin treatment was stopped (group II). Cells that were previously treated with isotretinoin plus PF- 9363, now only received PF-9363 treatment for the following 7 days (group IV). Lysates from BE2C cells from all treatment conditions were quantified by Bradford assay, and 10 ^g of extracted protein was separated using Novex SDS–polyacrylamide gel electrophoresis reagents and transferred to nitrocellulose membranes. Membranes were blocked in 5% milk protein and incubated with primary anti-bodies against MYCN, PHOX2B, GATA3 or beta actin overnight followed by secondary horseradish peroxidase–linked goat anti-rabbit and anti-mouse antibodies according to the manufacturers’ instructions. Antibody-bound membranes were incubated with SuperSignal West Pico chemiluminescent substrate and developed using HyBlot CL autoradiography film. When neuroblastoma cells were treated with the PF-9363 alone for 14 and 21 days (group III), sustained high levels MYCN expression was observed, as well as the adrenergic CRC members PHOX2B and GATA3, compared to the DMSO control group (group I) (Fig 6 left and right panel, first column in each panel). Treatment with isotretinoin alone for 14 days dramatically slowed the growth of BE2C cells in vitro (data not shown) and downregulated the expression of MYCN and the adrenergic CRC members, represented here by PHOX2B and GATA3 (group II, Fig 6, left panel, second column, circled by a dotted black line). However, when isotretinoin was withdrawn and replaced with DMSO vehicle alone, the neuroblastoma cells resume proliferation and grow as rapidly as before treatment with isotretinoin (data not shown). Along with the rapid cell growth, MYCN protein levels return to very high levels by 7 days after isotretinoin was removed from the medium, and the adrenergic CRC transcription factors PHOX2B and GATA3 also return to the very high expression levels in DMSO control-treated cells (group II, Fig 6, right panel, second column, circled by a dotted black line). To test whether the combination of isotretinoin treatment and KAT6 inhibition leads to prolonged suppression of the expression of MYCN and adrenergic CRC, the protein levels of MYCN, PHOX2B and GATA3 were analysed at day 14 and 21, 7 days after removing isotretinoin, but while maintaining treatment with PF9363 (group IV). In cells that received treatment with both isotretinoin and PF-9363 for 14 days, MYCN, PHOX2B and GATA3 expression was significantly suppressed similarly to the effects of isotretinoin (group V, Fig 6 left panel, fourth column, circled by a black solid line). In contrast to group II, in cells of group IV , which were maintained in PF-9363 alone for 7 days after isotretinoin treatment was stopped on day 14, the expression levels of MYCN, PHOX2B and GATA3 were continuously suppressed (group V, Fig 6 right panel, fourth column, circled by a black solid line). Overall, the data generated in this Example suggested that inhibition of KAT6A / B leads to more permanent loss of expression of MYCN and adrenergic CRC members PHOX2B and GATA3, preventing tumor cell proliferation even after isotretinoin treatment is stopped. This Example thus supports the conclusion that combined treatment of isotretinoin and PF-9363 induces a more permanent differentiated cell state than isotretinoin alone as long as PF-9363 treatment is continued as isotretinoin is withdrawn after 14 days. Enforcing durable inhibition of cell proliferation would prevent disease growth and recurrence in children with high-risk neuroblastoma. Example 6 – KAT6 inhibition and isotretinoin induce methylation of H3K27 over adrenergic enhancers in neuroblastoma in vitro It was then investigated whether H3K27me3 modifications were enriched at regulatory elements of GATA3 and PHOX2B proteins after treatment with i) isotretinoin, ii) PF-9363, and iii) the combination of isotretinoin and PF-9363, based on Cut&Run experiments using an antibody against H3K27me3. 100,000 BE2C cells were plated into cell culture dishes and treated the cells with either i) DMSO, ii) isotretinoin, iii) PF-9363 or iv) the combination of PF-9363 and isotretinoin. All compounds were given at 1 μM each for 14 days. CUT&RUN coupled with high-throughput DNA sequencing was performed using an H3K27me3 antibody and Cutana pA / G-MNase from EpiCypher) according to the manufacturer’s protocol and as previously described (Zimmerman et al., 2021)). Sequencing reads of immunoprecipitated DNA fragments were aligned to the sequence of the human reference genome (hg19) using bowtie v1.2.2 in single-end mode with parameters –k 2 –m 2 –best and –l set to the read length. For visualization, WIG files were created from aligned read positions using MACS v1.4 with parameters –w –S –space=50 – nomodel –shiftsize=200 to artificially extend reads to be 200 bp and to calculate their density in 50-bp bins. Read counts in 50-bp bins were then normalized to the millions of mapped reads, giving reads per million (RPM) values. WIG files were visualized in the Integrative Genomics Viewer (IGV) browser version 2.7.2. It was found that H3K27me3 was enriched across the genomic loci of the PHOX2B and GATA3 genes (Fig 7A) from BE2C cells that had been treated with isotretinoin, or the combination of isotretinoin and PF-9363, compared to the DMSO control. Furthermore, it was found that the increase in the H3K27me3 modification was even greater in BE2C cells receiving the combination of isotretinoin and PF-9363, compared to administration of isotretinoin and PF-9363 alone (Fig 7B). Taken together, these results demonstrate that the combination of isotretinoin and PF-9363 leads to a more durable silencing of these important proliferative adrenergic CRC genes in neuroblastoma cells, relative to the individual agents.

Claims

CLAIMS 1. A method of treating retinoid responsive cancer in a patient, comprising administering to said patient a therapeutically effective amount of one or more compounds which, individually or collectively, (i) induce and / or maintain tri-methylation of H3K27 within chromatin comprising one or more genes which encode regulatory elements of the proliferative core regulatory circuitry of retinoid responsive cancer cells; and (ii) reduce and / or prevent tri-methylation of H3K27 within chromatin comprising one or more genes which encode ganglioside synthases in retinoid responsive cancer cells.

2. The method of claim 1, wherein the retinoid responsive cancer is neuroblastoma.

3. The method of claim 2, wherein the one or more regulatory elements of the proliferative core regulatory circuitry are selected from the group consisting of PHOX2B and GATA3.

4. The method of claim 2, wherein the one or more genes which encode ganglioside synthases are selected from the group consisting of B4GALNT1 and ST8SIA1.

5. The method of any one of claims 1 to 4, wherein a therapeutically effective amount of a compound which is a KAT6A / B inhibitor is administered.

6. The method of claim 5, wherein the KAT6A / B inhibitor is selected from the group consisting of PF-9363 and PF-07248144.

7. The method of claim 5 or claim 6, wherein the KAT6A / B inhibitor is administered in combination with a retinoid.

8. The method of claim 7, wherein the retinoid is selected from the group consisting of retinol, geometric isomers of retinol, retinal, tretinoin (retinoic acid), isotretinoin, alitretinoin, retinyl acetate, etretinate, acitretin, adapalene, bexarotene, tazarotene and trifarotene.

9. The method of claim 5 or claim 6, wherein the KAT6A / B inhibitor is administered in combination with anti-GD2 therapy.

10. The method of claim 7 or claim 8, wherein the KAT6A / B inhibitor and the retinoid are administered in combination with anti-GD2 therapy.

11. The method of claim 9 or claim 10, wherein the anti-GD2 therapy is selected from the group consisting of GD2 CAR-T therapy and GD2 antibody therapy.

12. The method of claim 11, wherein the anti-GD2 therapy is GD2 antibody therapy and the GD2 antibody is selected from the group consisting of dinutuximab, dinatuximab beta and naxitamab.

13. A method of treating retinoid responsive cancer in a patient, comprising administering to said patient a therapeutically effective amount of a KAT6A / B inhibitor.

14. The method of claim 13, wherein the retinoid responsive cancer is neuroblastoma.

15. The method of claim 13 or claim 14, wherein the KAT6A / B inhibitor is selected from the group consisting of PF-9363 and PF-07248144.

16. The method of any one of claims 13 to 15, wherein the KAT6A / B inhibitor is administered in combination with a retinoid.

17. The method of claim 16, wherein the retinoid is selected from the group consisting of retinol, geometric isomers of retinol, retinal, tretinoin (retinoic acid), isotretinoin, alitretinoin, retinyl acetate, etretinate, acitretin, adapalene, bexarotene, tazarotene and trifarotene.

18. The method of any one of claims 13 to 15, wherein the KAT6A / B inhibitor is administered in combination with anti-GD2 therapy.

19. The method of claim 16 or claim 17, wherein the KAT6A / B inhibitor and the retinoid are administered in combination with anti-GD2 therapy.

20. The method of claim 18 or claim 19, wherein the anti-GD2 therapy is selected from the group consisting of GD2 CAR-T therapy and GD2 antibody therapy.

21. The method of claim 20, wherein the anti-GD2 therapy is GD2 antibody therapy and the GD2 antibody is selected from the group consisting of dinutuximab, dinatuximab beta and naxitamab.

Images