Helper lipids and LNP compositions comprising same

A helper lipid compound with a defined structure enhances the efficacy of lipid nanoparticles for intravenous and intramuscular mRNA delivery, addressing the need for efficient and cost-effective vaccine delivery.

WO2026053147A1PCT designated stage Publication Date: 2026-03-12SANOFI PASTEUR INC
View PDF 48 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2025-09-04
Publication Date
2026-03-12

AI Technical Summary

Technical Problem

There is a need for helper lipids that facilitate efficient intravenous and intramuscular delivery of mRNA for therapeutic applications, such as vaccines, while being cost-effective and free from toxic by-products.

Method used

A helper lipid compound with a specific structure, as defined by Formula (I) or its pharmaceutically acceptable salts, is used in lipid nanoparticles, optionally combined with cationic, structural, and stealth lipids, to enhance stability, rigidity, fluidity, and cell fusion, particularly effective for mRNA delivery.

Benefits of technology

The lipid nanoparticles provide high peptide or protein expression and effective in vivo delivery of mRNA, especially for influenza and respiratory syncytial virus (RSV) vaccines.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000002_0001
    Figure IMGF000002_0001
  • Figure IMGF000003_0001
    Figure IMGF000003_0001
  • Figure IMGF000015_0001
    Figure IMGF000015_0001
Patent Text Reader

Abstract

Provided herein are a class of helper lipids or pharmaceutically acceptable salts thereof. The helper lipids provided herein can be useful for delivery and expression of mRNA and encoded protein, e.g., as a component of a liposomal delivery vehicle, and accordingly can be useful for treating various diseases, disorders and conditions, such as those associated with deficiency of one or more proteins.
Need to check novelty before this filing date? Find Prior Art

Description

767972: SA9-884PC / PAT24230-WO-PCTHELPER LIPIDS AND LNP COMPOSITIONS COMPRISING SAMECROSS REFERENCE TO RELATED APPLICATIONSThis application claims priority to European Patent Application No. 24306449.0, filed September 5, 2024, the disclosure of which is incorporated herein by reference in its entirety.SEQUENCE LISTINGThe instant application contains a Sequence Listing which has been submitted herewith and is hereby incorporated by reference in its entirety. Said .xml copy, created on September 4, 2025, is named 767972_SA9-884PC_SL, and is 7,370 bytes in size.BACKGROUNDDelivery of nucleic acids has been explored extensively as a potential therapeutic option for certain disease states. In particular, messenger RNA (mRNA) therapy has become an increasingly important option for the prevention and treatment of various diseases (e.g., in the use of vaccines).Efficient delivery of liposome-encapsulated nucleic acids remains an active area of research. The helper lipid component of a liposome plays an important role in improving the efficacy of nucleic acid transfection. Various helper lipids suitable for in vivo use have been discovered. However, there remains a need to identify helper lipids that are effective for intravenous and intramuscular delivery of mRNA (e.g., in vaccines, such as for influenza or respiratory syncytial virus (RSV)). There also remains a need to identify helper lipids that can be synthesized efficiently and cheaply without the formation of potentially toxic by-products.SUMMARYThe present disclosure provides, inter alia, a helper lipid that is a compound having a structure according to Formula (I’):(I’), or a pharmaceutically acceptable salt thereof, wherein X, Y, R1A, R1B, R1C, R2A, R2B, R2C, and n are as defined herein.180953055. v3767972: SA9-884PC / PAT24230-WO-PCTThe present disclosure further provides a helper lipid that is a compound having a structure according to Formula (I):(I), or a pharmaceutically acceptable salt thereof, wherein X, Y, R1A, R1B, R1C, R2A, R2B, R2C, and n are as defined herein.The present disclosure further provides a composition comprising a helper lipid described herein. In some embodiments, the composition further comprises one or more cationic lipids, one or more structural lipids, and one or more stealth lipids.In some embodiments, the composition is a lipid nanoparticle, optionally a liposome. In some embodiments, the lipid nanoparticle encapsulates an mRNA encoding a peptide or protein.In an aspect the liposomal compositions described herein may be used in therapy.DETAILED DESCRIPTIONThe present disclosure provides, inter alia, a class of helper lipid compounds for improved in vivo delivery of therapeutic agents, such as nucleic acids. The helper lipids of the present disclosure may provide improved stability, rigidity, and / or fluidity within lipid bilayers / nanoparticles and facilitate cell fusion and endosomal escape. Lipid nanoparticles comprising the helper lipids of the present disclosure have been found to provide high levels of peptide or protein expression when delivering mRNA encoding for said peptide or protein. In particular, lipid nanoparticles comprising the helper lipids of the present disclosure were found to be particularly effective for intramuscular and intravenous delivery of encapsulated mRNA. It is contemplated that lipid nanoparticles comprising these helper lipid compounds are capable of highly effective in vivo delivery of therapeutic agents and vaccines (e.g., for influenza or respiratory syncytial virus (RSV)).I. DefinitionsUnless otherwise defined herein, scientific and technical terms used in this application shall have the meanings that are commonly understood by those of ordinary skill in the art.280953055. v3767972: SA9-884PC / PAT24230-WO-PCTAs used in the specification and in the claims, the term “comprising” can include the embodiments “consisting of’ and “consisting essentially of.” The terms “comprise(s),” “include(s),” “having,” “has,” “can,” “contain(s),” and variants thereof, as used herein, are intended to be open-ended transitional phrases, terms, or words that require the presence of the named ingredients / steps and permit the presence of other ingredients / steps. However, such description should be construed as also describing compositions or processes as “consisting of’ and “consisting essentially of’ the enumerated ingredients / steps, which allows the presence of only the named ingredients / steps and excludes other ingredients / steps.As used herein, the term “approximately” or “about,” as applied to one or more values of interest, refers to a value that is similar to a stated reference value. In certain embodiments, the term “approximately” or “about” refers to a range of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value).As used herein, the term “delivery” encompasses both local and systemic delivery. For example, delivery of mRNA encompasses situations in which an mRNA is delivered to a target tissue and the encoded protein is expressed and retained within the target tissue (also referred to as “local distribution” or “local delivery”), and situations in which an mRNA is delivered to a target tissue and the encoded protein is expressed and secreted into patient's circulation system (e.g., serum) and systematically distributed and taken up by other tissues (also referred to as “systemic distribution” or “systemic delivery).As used herein, “expression” of a nucleic acid sequence refers to translation of an mRNA into a polypeptide, assembly of multiple polypeptides (e.g., heavy chain or light chain of antibody) into an intact protein (e.g., antibody), and / or post-translational modification of a polypeptide or fully assembled protein (e.g., antibody). In this application, the terms “expression” and “production,” and grammatical equivalent, are used inter-changeably.As used herein, the term “half-life” is the time required for a quantity such as nucleic acid or protein concentration or activity to fall to half of its value as measured at the beginning of a time period.As used herein, the terms “improve,” “increase” or “reduce,” or grammatical equivalents, indicate values that are relative to a baseline measurement, such as a measurement in the same individual prior to initiation of the treatment described herein, or a380953055. v3767972: SA9-884PC / PAT24230-WO-PCT measurement in a control subject (or multiple control subject) in the absence of the treatment described herein.As used herein, the term “in vitro” refers to events that occur in an artificial environment, e.g., in a test tube or reaction vessel, in cell culture, etc., rather than within a multi-cellular organism.As used herein, the term “in vivo” refers to events that occur within a multi-cellular organism, such as a human and a non-human animal. In the context of cell-based systems, the term may be used to refer to events that occur within a living cell (as opposed to, for example, in vitro systems).As used herein, the term "liposome" refers to any lamellar, multilamellar, or solid nanoparticle vesicle. Typically, a liposome as used herein can be formed by mixing one or more lipids or by mixing one or more lipids and polymer(s). In some embodiments, a liposome suitable for the present disclosure contains an ionizable or cationic lipid(s) and optionally non-cationic lipid(s), optionally cholesterol-based lipid(s), and / or optionally PEG- modified lipid(s).As used herein, the term “messenger RNA (mRNA)” refers to a polynucleotide that encodes at least one polypeptide. mRNA as used herein may encompass both modified and unmodified RNA. mRNA may contain one or more coding and non-coding regions. mRNA can be purified from natural sources, produced using recombinant expression systems and optionally purified, chemically synthesized, etc. Where appropriate, e.g., in the case of chemically synthesized molecules, mRNA can comprise nucleoside analogs such as analogs having chemically modified bases or sugars, backbone modifications, etc. An mRNA sequence is presented in the 5' to 3' direction unless otherwise indicated. In some embodiments, an mRNA is or comprises natural nucleosides (e.g., adenosine, guanosine, cytidine, uridine); nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3 -methyl adenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7- deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, and 2-thiocytidine); chemically modified bases; biologically modified bases (e.g., methylated bases); intercalated bases; modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose); and / or modified phosphate groups (e.g., phosphorothioates and 5'-N- phosphoramidite linkages).480953055. v3767972: SA9-884PC / PAT24230-WO-PCTAs used herein, the term “nucleic acid,” in its broadest sense, refers to any compound and / or substance that is or can be incorporated into a polynucleotide chain. In some embodiments, a nucleic acid is a compound and / or substance that is or can be incorporated into a polynucleotide chain via a phosphodiester linkage. In some embodiments, “nucleic acid” refers to individual nucleic acid residues (e.g., nucleotides and / or nucleosides). In some embodiments, “nucleic acid” refers to a polynucleotide chain comprising individual nucleic acid residues. In some embodiments, “nucleic acid” encompasses RNA as well as single and / or double-stranded DNA and / or cDNA.The term “pharmaceutically acceptable” as used herein, refers to substances that, within the scope of sound medical judgment, are suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.Pharmaceutically acceptable salts are well known in the art. For example, S. M. Berge et al., describes pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences (1977) 66: 1-19. Pharmaceutically acceptable salts of the compounds of this disclosure include those derived from suitable inorganic and organic acids and bases.As used herein, the term “subject” refers to a human or any non-human animal (e.g., mouse, rat, rabbit, dog, cat, cattle, swine, sheep, horse or primate). A human includes pre- and post-natal forms. In many embodiments, a subject is a human being. A subject can be a patient, which refers to a human presenting to a medical provider for diagnosis or treatment of a disease. The term “subject” is used herein interchangeably with “individual” or “patient.” A subject can be afflicted with or is susceptible to a disease or disorder but may or may not display symptoms of the disease or disorder.As used herein, the term “substantially” refers to the qualitative condition of exhibiting total or near-total extent or degree of a characteristic or property of interest. One of ordinary skill in the biological arts will understand that biological and chemical phenomena rarely, if ever, go to completion and / or proceed to completeness or achieve or avoid an absolute result. The term “substantially” is therefore used herein to capture the potential lack of completeness inherent in many biological and chemical phenomena.As used herein, the term “target tissues” refers to any tissue that is affected by a disease to be treated. In some embodiments, target tissues include those tissues that display disease-associated pathology, symptom, or feature.As used herein, the term “therapeutically effective amount” of a therapeutic agent means an amount that is sufficient, when administered to a subject suffering from or580953055. v3767972: SA9-884PC / PAT24230-WO-PCT susceptible to a disease, disorder, and / or condition, to treat, diagnose, prevent, and / or delay the onset of the symptom(s) of the disease, disorder, and / or condition. It will be appreciated by those of ordinary skill in the art that a therapeutically effective amount is typically administered via a dosing regimen comprising at least one unit dose.As used herein, the term “treatment” or “treating,” is defined as the application or administration of a therapeutic agent to a patient, or application or administration of a therapeutic agent to an isolated tissue or cell line from a patient (e.g., for diagnosis or ex vivo applications), who has a disorder or disease as described herein, a symptom thereof; where the purpose of the application or administration is to cure, heal, alleviate, relieve, alter, remedy, ameliorate, improve or affect the disorder or disease, or its symptoms. Such treatments may be specifically tailored or modified, based on knowledge obtained from the field of pharmacogenomics.As used herein, the term “prevent” or “prevention” means no disorder or disease development if none had occurred, or no further disorder or disease development if there had already been development of the disorder or disease. Also considered is the ability of one to prevent some or all of the symptoms associated with the disorder or disease.Compounds described herein can comprise one or more asymmetric centers, and thus can exist in various isomeric forms, e.g., enantiomers and / or diastereomers. For example, the compounds described herein can be in the form of an individual enantiomer, diastereomer or geometric isomer, or can be in the form of a mixture of stereoisomers, including racemic mixtures and mixtures enriched in one or more stereoisomer. Isomers can be isolated from mixtures by methods known to those skilled in the art, including chiral high performance liquid chromatography (HPLC) and the formation and crystallization of chiral salts; or preferred isomers can be prepared by asymmetric syntheses. See, for example, Jacques et al., Enantiomers. Racemates and Resolutions (Wiley Interscience, New York, 1981); Wilen et al., Tetrahedron 33:2725 (1977); Eliel, E. L. Stereochemistry of Carbon Compounds (McGraw-Hill, NY, 1962); and Wilen, S. H. Tables of Resolving Agents and Optical Resolutions p. 268 (E. L. Eliel, Ed., Univ, of Notre Dame Press, Notre Dame, Ind. 1972). The present disclosure additionally contemplates compounds as individual isomers substantially free of other isomers, and alternatively, as mixtures of various isomers.When a range of values is listed, it is intended to encompass each value and sub-range within the range. For example “Ci-6 alkyl” is intended to encompass, Ci, C2, C3, C4, C5, Ce, C1.6, Ci-5, C1.4, C1.3, C1.2, C2-6, C2-5, C2-4, C2-3, C3-6, C3-5, C3-4, C4-6, C4-5, and C5.6alkyl.680953055. v3767972: SA9-884PC / PAT24230-WO-PCTAs used herein, “lipophilic” refers to the ability of a group to dissolve in fats, oils, lipids, and lipophilic non-polar solvents such as hexane or toluene. In general, a lipophilic group refers to an unsubstituted n-alkyl or unsubstituted n-alkenyl group having 6 to 50 carbon atoms, e.g., 6 to 40, 6 to 30, 6 to 20, 8 to 20, 8 to 19, 8 to 18, 8 to 17, 8 to 16, or 8 to 15 carbon atoms.As used herein, the term “alkyl” refers to a straight or branched saturated hydrocarbon. For example, an alkyl group can have 1 to 30 carbon atoms (i.e., (Ci-C3o)alkyl), 1 to 20 carbon atoms (i.e., (Ci-C2o)alkyl), 1 to 12 carbon atoms (i.e., (Ci-Ci2)alkyl), 1 to 6 carbon atoms (i.e., (Ci-Ce)alkyl), or 1 to 3 carbon atoms (i.e., (Ci-C3)alkyl). Examples of alkyl groups include, but are not limited to, methyl (Me, -CEE), ethyl (Et, -CH2CH3), 1- propyl ( / / -Pr, / / -propyl, -CH2CH2CH3), isopropyl (z-Pr, z-propyl, -CH(CH3)2), 1-butyl (z / -bu, / / -butyl, -CH2CH2CH2CH3), 2-butyl (.s-bu, .s-butyl, -CH(CH3)CH2CH3), tert-butyl (t-bu, t- butyl, -CH(CH3)3), 1 -pentyl (zz-pentyl, -CH2CH2CH2CH2CH3), 2-pentyl (-CH(CH3) CH2CH2CH3), neopentyl (CH2C(CH3)3), 1 -hexyl (-CH2CH2CH2CH2CH2CH3), 2-hexyl (- CH(CH3)CH2CH2CH2CH3), heptyl (-(CH2)6CH3), octyl (-(CH2)7CH3), 2,2,4-trimethylpentyl (-CH2C(CH3)2CH2CH(CH3)2), nonyl (-(CH2)8CH3), decyl (-(CH2)9CH3), undecyl (- (CH2)IOCH3), and dodecyl (-(CH2)uCH3).As used herein, the term “alkylene” refers to a divalent alkyl group.As used herein, “heteroalkyl” refers to an alkyl group as defined herein which further includes at least one heteroatom (e.g., 1 to 25, e.g., 1, 2, 3, or 4 heteroatoms) selected from oxygen, sulfur, nitrogen, boron, silicon, and phosphorus within (i.e., inserted between adjacent carbon atoms of) and / or placed at one or more terminal position(s) of the parent chain.As used herein, the term “alkenyl” refers to a straight or branched saturated hydrocarbon having at least one site of carbon-carbon double bond unsaturation. For example, an alkenyl group can have 2 to 30 carbon atoms (i.e., (C2-C3o)alkenyl), 2 to 20 carbon atoms (i.e., (C2-C2o)alkenyl), 2 to 12 carbon atoms (i.e., (C2-Ci2)alkenyl) or 2 to 6 carbon atoms (i.e., (C2-Ce)alkenyl), and the alkenyl group can contain 1, 2, 3, or 4 carboncarbon double bonds. The one or more carbon-carbon double bonds can be internal (such as in 2-butenyl) or terminal (such as in 1-butenyl). Included within this term are the cis and trans isomers or mixtures of these isomers. Nonlimiting examples of alkenyl groups include prop- 2-enyl, but-2-enyl, but-3-enyl, 2-methylprop-2-enyl, hex-2-enyl, hex- 5-enyl, 2,3- dimethylbut-2-enyl, and the like.As used herein, the term “alkenylene” refers to a divalent alkenyl group.780953055. v3767972: SA9-884PC / PAT24230-WO-PCTAs used herein, “heteroalkenyl” refers to an alkenyl group as defined herein which further includes at least one heteroatom (e.g., 1 to 25, e.g., 1, 2, 3, or 4 heteroatoms) selected from oxygen, sulfur, nitrogen, boron, silicon, and phosphorus within (i.e., inserted between adjacent carbon atoms of) and / or placed at one or more terminal position(s) of the parent chain.As used herein, the term “alkynyl” refers to a straight or branched saturated hydrocarbon having at least one site of carbon-carbon triple bond unsaturation occurring at any stable point along the chain. For example, an alkynyl group can have 2 to 30 carbon atoms (i.e., (C2-C3o)alkynyl), 2 to 20 carbon atoms (i.e., (C2-C2o)alkynyl), 2 to 12 carbon atoms (i.e., (C2-Ci2)alkynyl) or 2 to 6 carbon atoms (i.e., (C2-Ce)alkynyl), and the alkynyl group can contain 1, 2, 3, or 4 carbon-carbon triple bonds. The one or more carbon-carbon triple bonds can be internal or terminal. Optionally, the alkynyl group may include one or more double bonds (e.g., 1, 2, 3, or 4 double bonds). For purposes of the present disclosure, a hydrocarbon group having one or more triple bonds and one or more double bonds (e.g., an “ene-yne”) is categorized as an alkynyl moiety. Nonlimiting examples of an alkynyl groups include prop-2 -ynyl, but-2-ynyl, but-3-ynyl, pent-2-ynyl, 3-methylpent-4-ynyl, hex-2-ynyl, hex-5-ynyl, etc.As used herein, the term “alkynylene” refers to a divalent alkynyl group.As used herein, “heteroalkynyl” refers to an alkynyl group as defined herein which further includes at least one heteroatom (e.g., 1 to 25, e.g., 1, 2, 3, or 4 heteroatoms) selected from oxygen, sulfur, nitrogen, boron, silicon, and phosphorus within (i.e., inserted between adjacent carbon atoms of) and / or placed at one or more terminal position(s) of the parent chain.As used herein, “carbocyclyl” or “carbocyclic” refers to a radical of a non-aromatic cyclic hydrocarbon group having from 3 to 10 ring carbon atoms (“C3-10 carbocyclyl”) and zero heteroatoms in the non-aromatic ring system. Exemplary carbocyclyl groups include, without limitation, cyclopropyl (C3), cyclopropenyl (C3), cyclobutyl (C4), cyclobutenyl (C4), cyclopentyl (C5), cyclopentenyl (C5), cyclohexyl (C6), cyclohexenyl (C6), cyclohexadienyl (C6), cycloheptyl (C7), cycloheptenyl (C7), cycloheptadienyl (C7), cycloheptatrienyl (C7), cyclooctyl (C8), cyclooctenyl (C8), bicyclo[2.2.1]heptanyl (C7), bicyclo[2.2.2]octanyl (C8), cyclononyl (C9), cyclononenyl (C9), cyclodecyl (CIO), cyclodecenyl (CIO), octahydro- IH-indenyl (C9), decahydronaphthal enyl (CIO), spiro[4.5]decanyl (CIO), and the like. As the foregoing examples illustrate, in certain embodiments, the carbocyclyl group is either monocyclic (“monocyclic carbocyclyl”) or880953055. v3767972: SA9-884PC / PAT24230-WO-PCT polycyclic (e.g., containing a fused, bridged or spiro ring system such as a bicyclic system (“bicyclic carbocyclyl”) or tricyclic system (“tricyclic carbocyclyl”)) and can be saturated or can contain one or more carbon-carbon double or triple bonds. “Carbocyclyl” also includes ring systems wherein the carbocyclyl ring, as defined above, is fused with one or more aryl or heteroaryl groups wherein the point of attachment is on the carbocyclyl ring, and in such instances, the number of carbons continue to designate the number of carbons in the carbocyclic ring system.The term “heterocycle” or “heterocyclyl” refers to a saturated or partially unsaturated ring system that has at least one atom other than carbon in the ring system, wherein the atom is selected from the group consisting of oxygen, nitrogen and sulfur. The heterocyclyl group may, for example, consist of a single ring or multiple rings (e.g., in the form of a spirocyclic, bridged, or fused ring system). Exemplary heterocycles include, but are not limited to oxetanyl, aziridinyl, azetidinyl, pyrrolidinyl, piperidinyl, piperazinyl, morpholinyl, tetrahydropyranyl, tetrahydrofuranyl, and thiomorpholinyl.As used herein, “aryl” refers to a radical of a monocyclic or polycyclic (e.g., bicyclic or tricyclic) 4n+2 aromatic ring system (e.g., having 6, 10, or 14 u electrons shared in a cyclic array) having 6-14 ring carbon atoms and zero heteroatoms provided in the aromatic ring system (“C6-14 aryl”). In some embodiments, an aryl group has 6 ring carbon atoms (“C6 aryl”; e.g., phenyl). In some embodiments, an aryl group has 10 ring carbon atoms (“CIO aryl”; e.g., naphthyl such as 1-naphthyl and 2-naphthyl). In some embodiments, an aryl group has 14 ring carbon atoms (“C14 aryl”; e.g., anthracyl). “Aryl” also includes ring systems wherein the aryl ring, as defined above, is fused with one or more carbocyclyl or heterocyclyl groups wherein the radical or point of attachment is on the aryl ring, and in such instances, the number of carbon atoms continue to designate the number of carbon atoms in the aryl ring system.The term “heteroaryl” refers to a single aromatic ring that has at least one atom other than carbon in the ring, wherein the atom is selected from the group consisting of oxygen, nitrogen and sulfur. The term “heteroaryl” includes single aromatic rings of from 1 to 6 carbon atoms and 1 to 4 heteroatoms selected from the group consisting of oxygen, nitrogen and sulfur. Exemplary heteroaryl ring systems include but are not limited to pyridinyl, pyrimidinyl, pyrazinyl, pyridazinyl, pyrimidinyl, pyrazolyl, oxazolyl, oxadiazolyl, isoxazolyl, triazolyl, imidazolyl, tetrazolyl, thienyl, thiazolyl, isothiazolyl, thiadiazolyl, or furyl.The term “halogen” or “halo” refers to bromo (-Br), chloro (-C1), fluoro (-F) or iodo (-I).980953055. v3767972: SA9-884PC / PAT24230-WO-PCTAs used herein, a “counteranion” is a negatively charged group associated with a positively charged quarternary amine in order to maintain electronic neutrality. Exemplary counteranions include halide ions (e.g., F — , Cl — , Br — , I — ), NO3-, C1O4-, OH — , H2PO4-, HSO4-, sulfonate ions (e.g., methansulfonate, trifluoromethanesulfonate, p-toluenesulfonate, benzenesulfonate, 10-camphor sulfonate, naphthal ene-2-sulfonate, naphthalene- 1 -sulfonic acid-5-sulfonate, ethan-1 -sulfonic acid-2-sulfonate, and the like), and carboxylate ions (e.g., acetate, ethanoate, propanoate, benzoate, glycerate, lactate, tartrate, glycolate, and the like).As used herein, the term “partially unsaturated” refers to a ring moiety that includes at least one double or triple bond. The term “partially unsaturated” is intended to encompass rings having multiple sites of unsaturation, but is not intended to include aromatic groups (e.g., aryl or heteroaryl moieties) as herein defined.As used herein, the term “saturated” refers to a ring moiety that does not contain a double or triple bond, i.e., the ring contains all single bonds.Nitrogen atoms can be substituted or unsubstituted as valency permits, and include primary, secondary, tertiary, and quarternary nitrogen atoms.As understood from the above, alkyl, alkenyl, alkynyl, heteroalkyl, heteroalkenyl, heteroalkynyl, carbocyclyl, heterocyclyl, aryl, and heteroaryl groups, as defined herein, are, in certain embodiments, optionally substituted. Optionally substituted refers to a group which may be substituted or unsubstituted (e.g., “substituted” or “unsubstituted” alkyl, “substituted” or “unsubstituted” alkenyl, “substituted” or “unsubstituted” alkynyl, “substituted” or “unsubstituted” heteroalkyl, “substituted” or “unsubstituted” heteroalkenyl, “substituted” or “unsubstituted” heteroalkynyl. “substituted” or “unsubstituted” carbocyclyl. “substituted” or “unsubstituted” heterocyclyl, “substituted” or “unsubstituted” aryl or “substituted” or “unsubstituted” heteroaryl group). In general, the term “substituted” means that at least one hydrogen present on a group is replaced with a permissible substituent, e.g., a substituent which upon substitution results in a stable compound, e.g., a compound which does not spontaneously undergo transformation such as by rearrangement, cyclization, elimination, or other reaction. Unless otherwise indicated, a “substituted” group has a substituent at one or more substitutable positions of the group, and when more than one position in any given structure is substituted, the substituent is either the same or different at each position. The term “substituted” is contemplated to include substitution with all permissible substituents of organic compounds, any of the substituents described herein that results in the formation of a stable compound. The present invention contemplates any and all such combinations in order to arrive at a stable compound. For purposes of this invention, heteroatoms such as nitrogen1080953055. v3767972: SA9-884PC / PAT24230-WO-PCT may have hydrogen substituents and / or any suitable substituent as described herein which satisfy the valencies of the heteroatoms and results in the formation of a stable moiety.Exemplary carbon atom substituents include, but are not limited to, halogen, — CN, — NO2, — N3, — SO2H, — SO3H, —OH, — ORaa, — ON(Rbb)2, — N(Rbb)2, — N(Rbb)3+X— , — N(ORcc)Rbb, — SeH, — SeRaa, — SH, — SRaa, — SSRcc, — C(=O)Raa, — CO2H, — CHO, — C(ORcc)2, — CO2Raa, — OC(=O)Raa, — OCO2Raa, — C(=O)N(Rbb)2, — OC(=O)N(Rbb)2, — NRbbC(=O)Raa, — NRbbCO2Raa, — NRbbC(=O)N(Rbb)2, — C(=NRbb)Raa, — C(=NRbb)ORaa, — OC(=NRbb)Raa, — OC(=NRbb)ORaa, — C(=NRbb)N(Rbb)2, — OC(=NRbb)N(Rbb)2, — NRbbC(=NRbb)N(Rbb)2, — C(=O)NRbbSO2Raa, — NRbbSO2Raa, — SO2N(Rbb)2, — SO2Raa, — SO2ORaa, — OSO2Raa, — S(=O)Raa, — OS(=O)Raa, — Si(Raa)3 — OSi(Raa)3 — C(=S)N(Rbb)2, — C(=O)SRaa, — C(=S)SRaa, — SC(=S)SRaa, — SC(=O)SRaa, — OC(=O)SRaa, — SC(=O)ORaa, — SC(=O)Raa, — P(=O)2Raa, — OP(=O)2Raa, — P(=O)(Raa)2, — OP(=O)(Raa)2, — OP(=O)(ORcc)2, — P(=O)2N(Rbb)2, — OP(=O)2N(Rbb)2, — P(=O)(NRbb)2, — OP(=O)(NRbb)2, — NRbbP(=O)(ORcc)2, — NRbbP(=O)(NRbb)2, — P(Rcc)2, — P(Rcc)3, — OP(Rcc)2, — OP(Rcc)3, — B(Raa)2, — B(ORcc)2, — BRaa(ORcc), Cl-50 alkyl, C2-50 alkenyl, C2-50 alkynyl, C3-14 carbocyclyl, 3-14 membered heterocyclyl, C6-14 aryl, and 5-14 membered heteroaryl, wherein each alkyl, alkenyl, alkynyl, carbocyclyl, heterocyclyl, aryl, and heteroaryl is independently substituted with 0, 1, 2, 3, 4, or 5 Rdd groups; or two geminal hydrogens on a carbon atom are replaced with the group =0, =S, =NN(Rbb)2, =NNRbbC(=O)Raa, =NNRbbC(=O)ORaa, =NNRbbS(=O)2Raa, =NRbb, or =NORcc; each instance of Raa is, independently, selected from Cl-50 alkyl, C2-50 alkenyl, C2- 50 alkynyl, C3-10 carbocyclyl, 3-14 membered heterocyclyl, C6-14 aryl, and 5-14 membered heteroaryl, or two Raa groups are joined to form a 3-14 membered heterocyclyl or 5-14 membered heteroaryl ring, wherein each alkyl, alkenyl, alkynyl, carbocyclyl, heterocyclyl, aryl, and heteroaryl is independently substituted with 0, 1, 2, 3, 4, or 5 Rdd groups; each instance of Rbb is, independently, selected from hydrogen, — OH, — ORaa, — N(Rcc)2, — CN, — C(=O)Raa, — C(=O)N(Rcc)2, — CO2Raa, — SO2Raa, — C(=NRcc)ORaa, — C(=NRcc)N(Rcc)2, — SO2N(Rcc)2, — SO2Rcc, — SO2ORcc, — SORaa, — C(=S)N(Rcc)2, — C(=O)SRcc, — C(=S)SRcc, — P(=O)2Raa, — P(=O)(Raa)2, — P(=O)2N(Rcc)2, — P(=O)(NRcc)2, Cl-50 alkyl, C2-50 alkenyl, C2-50 alkynyl, C3-10 carbocyclyl, 3-14 membered heterocyclyl, C6-14 aryl, and 5-14 membered heteroaryl, or two1180953055. v3767972: SA9-884PC / PAT24230-WO-PCTRbb groups, together with the heteroatom to which they are attached, form a 3-14 membered heterocyclyl or 5-14 membered heteroaryl ring, wherein each alkyl, alkenyl, alkynyl, carbocyclyl, heterocyclyl, aryl, and heteroaryl is independently substituted with 0, 1, 2, 3, 4, or 5 Rdd groups; each instance of Rcc is, independently, selected from hydrogen, Cl -50 alkyl, C2-50 alkenyl, C2-50 alkynyl, C3-10 carbocyclyl, 3-14 membered heterocyclyl, C6-14 aryl, and 5- 14 membered heteroaryl, or two Rcc groups, together with the heteroatom to which they are attached, form a 3-14 membered heterocyclyl or 5-14 membered heteroaryl ring, wherein each alkyl, alkenyl, alkynyl, carbocyclyl, heterocyclyl, aryl, and heteroaryl is independently substituted with 0, 1, 2, 3, 4, or 5 Rdd groups; each instance of Rdd is, independently, selected from halogen, — CN, — NO2, — N3, — SO2H, — SO3H, —OH, — ORee, — ON(Rff)2, — N(Rff)2, — N(Rff)3+X— , — N(ORee)Rff, — SH, — SRee, — SSRee, — C(=O)Ree, — CO2H, — CO2Ree, — OC(=O)Ree, — OCO2Ree, — C(=O)N(Rff)2, — OC(=O)N(Rff)2, — NRffC(=O)Ree, — NRffCO2Ree, — NRffC(=O)N(Rff)2, — C(=NRff)ORee, — OC(=NRff)Ree, — OC(=NRff)ORee, — C(=NRff)N(Rff)2, — OC(=NRff)N(Rff)2, — NRffC(=NRff)N(Rff)2, — NRffSO2Ree, — SO2N(Rff)2, — SO2Ree, — SO2ORee, — OSO2Ree, — S(=O)Ree, — Si(Ree)3, — OSi(Ree)3, — C(=S)N(Rff)2, — C(=O)SRee, — C(=S)SRee, — SC(=S)SRee, — P(=O)2Ree, — P(=O)(Ree)2, — OP(=O)(Ree)2, — OP(=O)(ORee)2, Cl -50 alkyl, C2-50 alkenyl, C2-50 alkynyl, C3-10 carbocyclyl, 3-10 membered heterocyclyl, Ce-io aryl, 5-10 membered heteroaryl, wherein each alkyl, alkenyl, alkynyl, carbocyclyl, heterocyclyl, aryl, and heteroaryl is independently substituted with 0, 1, 2, 3, 4, or 5 Rgg groups, or two geminal Rdd substituents can be joined to form =0 or =S; each instance of Ree is, independently, selected from Cl -50 alkyl, C2-50 alkenyl, C2- 50 alkynyl, C3-10 carbocyclyl, C6-10 aryl, 3-10 membered heterocyclyl, and 3-10 membered heteroaryl, wherein each alkyl, alkenyl, alkynyl, carbocyclyl, heterocyclyl, aryl, and heteroaryl is independently substituted with 0, 1, 2, 3, 4, or 5 Rgg groups; each instance of Rff is, independently, selected from hydrogen, Cl-50 alkyl, C2-50 alkenyl, C2-50 alkynyl, C3-10 carbocyclyl, 3-10 membered heterocyclyl, C6-10 aryl and 5- 10 membered heteroaryl, or two Rff groups, together with the heteroatom to which they are attached, form a 3-14 membered heterocyclyl or 5-14 membered heteroaryl ring, wherein each alkyl, alkenyl, alkynyl, carbocyclyl, heterocyclyl, aryl, and heteroaryl is independently substituted with 0, 1, 2, 3, 4, or 5 Rgg groups; and1280953055. v3767972: SA9-884PC / PAT24230-WO-PCT each instance of Rgg is, independently, halogen, — CN, — NO2, — N3, — SO2H, — SO3H, —OH, — OC1-50 alkyl, — ON(C1-50 alkyl)2, — N(Cl-50 alkyl)2, — N(Cl-50 alkyl)3+X— , — NH(Cl-50 alkyl)2+X— , — NH2(C1-5O alkyl)+X— , — NH3+X— , — N(OC1-50 alkyl)(Cl-50 alkyl), — N(OH)(C1-50 alkyl), — NH(OH), — SH, -SC1-50 alkyl, — SS(C1-5O alkyl), — C(=O)(Cl-50 alkyl), — CO2H, — CO2(Cl-50 alkyl), — OC(=O)(C1- 50 alkyl), — OCO2(Cl-50 alkyl), — C(=O)NH2, — C(=O)N(Cl-50 alkyl)2, — OC(=O)NH(Cl-50 alkyl), — NHC(=O)(Cl-50 alkyl), — N(Cl-50 alkyl)C(=O)(Cl-50 alkyl), — NHCO2(Cl-50 alkyl), — NHC(=O)N(Cl-50 alkyl)2, — NHC(=O)NH(Cl-50 alkyl), — NHC(=O)NH2, — C(=NH)O(Cl-50 alkyl), — OC(=NH)(C1-50 alkyl), — OC(=NH)OC1-50 alkyl, — C(=NH)N(Cl-50 alkyl)2, — C(=NH)NH(Cl-50 alkyl), — C(=NH)NH2, — OC(=NH)N(Cl-50alkyl)2, — OC(NH)NH(C1-50 alkyl), — OC(NH)NH2, — NHC(NH)N(Cl-50 alkyl)2, — NHC(=NH)NH2, — NHSO2 (Cl -50 alkyl), — SO2N(Cl-50 alkyl)2, — SO2NH(Cl-50 alkyl), — SO2NH2, — SO2C1-50 alkyl, — SO2OC1-50 alkyl, — OSO2C1-6 alkyl, — SOC1-6 alkyl, — Si(Cl-50 alkyl)3, — OSi(Cl-6 alkyl)3-C(=S)N(Cl-50 alkyl)2, C(=S)NH(Cl-50 alkyl), C(=S)NH2, — C(=O)S(Cl-6 alkyl), — C(=S)SCl-6 alkyl, — SC(=S)SCl-6 alkyl, — P(=O)2(Cl-50 alkyl), — P(=O)(Cl-50 alkyl)2, — OP(=O)(Cl-50 alkyl)2, — OP(=O)(OCl-50 alkyl)2, Cl-50 alkyl, C2-50 alkenyl, C2-50 alkynyl, C3-10 carbocyclyl, C6-10 aryl, 3-10 membered heterocyclyl, 5-10 membered heteroaryl; or two geminal Rgg substituents can be joined to form =0 or =S; wherein X — is a counteranion.Nitrogen atoms can be substituted or unsubstituted as valency permits, and include primary, secondary, tertiary, and quarternary nitrogen atoms. Exemplary nitrogen atom substitutents include, but are not limited to, hydrogen, — OH, — ORaa, — N(Rcc)2, — CN, — C(=O)Raa, — C(=O)N(Rcc)2, — CO2Raa, — SO2Raa, — C(=NRbb)Raa, — C(=NRcc)ORaa, — C(=NRcc)N(Rcc)2, — SO2N(Rcc)2, — SO2Rcc, — SO2ORcc, — SORaa, — C(=S)N(Rcc)2, — C(=O)SRcc, — C(=S)SRcc, — P(=O)2Raa, — P(=O)(Raa)2, — P(=O)2N(Rcc)2, — P(=O)(NRcc)2, Cl-50 alkyl, C2-50 alkenyl, C2-50 alkynyl, C3-10 carbocyclyl, 3-14 membered heterocyclyl, C6-14 aryl, and 5-14 membered heteroaryl, or two Rcc groups, together with the N atom to which they are attached, form a 3-14 membered heterocyclyl or 5-14 membered heteroaryl ring, wherein each alkyl, alkenyl, alkynyl, carbocyclyl, heterocyclyl, aryl, and heteroaryl is independently substituted with 0, 1, 2, 3, 4, or 5 Rdd groups, and wherein Raa, Rbb, Rcc and Rdd are as defined above.Exemplary methods and materials are described below, although methods and materials similar or equivalent to those described herein can also be used in the practice or1380953055. v3767972: SA9-884PC / PAT24230-WO-PCT testing of the present disclosure. In case of conflict, the present specification, including definitions, will control. Generally, nomenclature used in connection with, and techniques of, cell and tissue culture, molecular biology, virology, immunology, microbiology, genetics, analytical chemistry, synthetic organic chemistry, medicinal and pharmaceutical chemistry, and protein and nucleic acid chemistry and hybridization described herein are those well- known and commonly used in the art. Enzymatic reactions and purification techniques are performed according to manufacturer’s specifications, as commonly accomplished in the art or as described herein. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular.Although a number of documents are cited herein, this citation does not constitute an admission that any of these documents forms part of the common general knowledge in the art.II. Three-Tailed Helper LipidsThe present disclosure provides helper lipids that provide improved delivery, uptake, and release of mRNA drug payload. In some embodiments, the helper lipid is a phospholipid comprising three aliphatic tails.Accordingly, in an aspect, the present disclosure provides a helper lipid that is a compound having a structure according to Formula (I’):(I’), or a pharmaceutically acceptable salt thereof, wherein:X is -C(i-6)alkylene-, -C(2-6)alkenylene-, -OC(i-6)alkylene-, -OC(2-6)alkenylene-, - OC(O)C(i-6)alkylene-, -OC(O)C(2-6)alkenylene-, -OC(O)OC(i-6)alkylene-, -OC(O)OC(2- 6)alkenylene-, -NHC(O)C(i-6)alkylene-, -NHC(O)C(2-6)alkenylene-, or -C(i-6)alkylene-O-C(i- 6)alkylene-;Y is -C(2-6)alkylene- or -C(2-6)alkenylene-, each of which is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, - C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, - N(R”)2, -SR” and -SO2R”;1480953055. v3767972: SA9-884PC / PAT24230-WO-PCTR1Aand R1Bare each independently selected from hydrogen and -C(i-io)alkyl, wherein the -C(i-io)alkyl is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, - OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, -N(R”)2, -SR” and -SO2R”; orR1Aand R1Bare taken together with the nitrogen to which they are attached to form a 4-10-membered heterocyclic group that is optionally substituted with one, two, or three -C(i- 6)alkyl groups;R1Cis absent or R1Cis -C(i-io)alkyl that is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, - C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, -N(R”)2, - SR” and -SO2R”, wherein when R1Cis present, the nitrogen to which R1Cis bonded bears a positive charge; orRIARIB,ancjRicare takentogether with the nitrogen to which they are attached to form a 5-11-membered heterocyclic group that is optionally substituted with one, two, or three -C(i-6)alkyl groups, wherein the nitrogen to which R1A, R1B, and R1Care bonded bears a positive charge;R2A5R2B5and R2Care each independently -OR3, -OC(O)R3, or -C(O)OR3; each R3is independently selected from the group consisting of:(i) -C(9-25)alkyl, -C(9-25)alkenyl or -C(9-25)alkynyl, each of which is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, - OC(O)OR”, -NH2, -NHR”, -N(R”)2, -SR” or -SO2R”;wherein: each R3Ais independently -C(i-3i)alkyl, -C(2-3i)alkenyl, or -C(2-3i)alkynyl, each of which is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, - OC(O)R”, -OC(O)OR”, -NH2, -NHR”, -N(R”)2, -SR” and -SO2R”; and each ZA is independently -C(6-io)alkylene- or -C(7-io)alkenylene-, each of which is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, - OC(O)OR”, -NH2, -NHR”, -N(R”)2, -SR” and -SO2R”; and1580953055. v3767972: SA9-884PC / PAT24230-WO-PCT(iii), wherein: each R3Bis independently -C(i-3i)alkyl, -C(2-3i)alkenyl, or -C(2-3i)alkynyl, each of which is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, - OC(O)R”, -OC(O)OR”, -NH2, -NHR”, -N(R”)2, -SR” and -SO2R”; and each ZB is independently -C(6-io)alkylene- or -C(7-io)alkenylene-, each of which is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, - OC(O)OR”, -NH2, -NHR”, -N(R”)2, -SR” and -SO2R”; n is 0 or 1; andR” is independently for each occurrence -C(i-20)alkyl.In some embodiments, the present disclosure provides a compound having a structure according to Formula (I’):(I'), or a pharmaceutically acceptable salt thereof, wherein:X is -C(i-6)alkylene-, -OC(i-6)alkylene-, -NHC(O)C(i-6)alkylene-, or -C(i-6)alkylene-O- C(i-6)alkylene-;Y is -C(2-6)alkylene- or -C(2-6)alkenylene-, each of which is optionally substituted with one -C(O)OH group;R1Aand R1Bare each independently selected from hydrogen and -C(i-io)alkyl, wherein the -C(i-io)alkyl is optionally substituted with one -OH group; orR1Aand R1Bare taken together with the nitrogen to which they are attached to form a 4-10-membered heterocyclic group, that is optionally substituted with one -C(i-6)alkyl group;R1Cis absent or -C(i-io)alkyl, wherein when R1Cis present, the nitrogen to which R1Cis bonded bears a positive charge; orRIARIB,ancjRicare takentogether with the nitrogen to which they are attached to form a 5-11-membered heterocyclic group, that is optionally substituted with one -C(i-6)alkyl group, wherein the nitrogen to which R1A, R1B, and R1Care bonded bears a positive charge;1680953055. v3767972: SA9-884PC / PAT24230-WO-PCTR2A , R2B, and R2Care each independently -OR3, -OC(O)R3, or -C(O)OR3; each R3is independently selected from the group consisting of:(i) -C(9-25)alkyl, -C(9-25)alkenyl or -C(9-25)alkynyl;each R3Ais independently -C(i-3i)alkyl, -C(2-3i)alkenyl, or -C(2-3i)alkynyl; and each ZA is independently -C(6-io)alkylene- or -C(7-io)alkenylene-; and(iii), wherein: each R3Bis independently -C(i-3i)alkyl, -C(2-3i)alkenyl, or -C(2-3i)alkynyl; and each ZB is independently -C(6-io)alkylene- or -C(7-io)alkenylene-; and n is 0 or 1.In some embodiments, the present disclosure provides a compound having a structure according to Formula (I’):(I'), or a pharmaceutically acceptable salt thereof, wherein:X is -C(i-6)alkylene- or -OC(2-6)alkylene-;Y is -C(2-6)alkylene- that is optionally substituted with one -C(O)OH group;R1Aand R1Bare each independently -C(i-5)alkyl that is optionally substituted with one -OH group; orR1Aand R1Bare taken together with the nitrogen to which they are attached to form a 4-10-membered heterocyclic group that is optionally substituted with one -C(i-6)alkyl group;R1Cis absent or R1Cis -C(i-5)alkyl, wherein when R1Cis present, the nitrogen to which R1Cis bonded bears a positive charge; orRIARIB,ancjRicare takentogether with the nitrogen to which they are attached to form a 5-11-membered heterocyclic group that is optionally substituted with one -C(i-6)alkyl group, wherein the nitrogen to which R1A, R1B, and R1Care bonded bears a positive charge;R2A, R2B, and R2Care each independently -OR3, -OC(O)R3, or -C(O)OR3; each R3is independently selected from the group consisting of:1780953055. v3767972: SA9-884PC / PAT24230-WO-PCT(i) -C(9-25)alkyl, -C(9-25)alkenyl or -C(9-25)alkynyl;wherein: each R3Ais independently -C(i-3i)alkyl, -C(2-3i)alkenyl, or -C(2-3i)alkynyl; and each ZA is independently -C(6-io)alkylene- or -C(7-io)alkenylene-; and(iii), wherein: each R3Bis independently -C(i-3i)alkyl, -C(2-3i)alkenyl, or -C(2-3i)alkynyl; and each ZB is independently -C(6-io)alkylene- or -C(7-io)alkenylene-; and n is 0 or 1.In some embodiments, the present disclosure provides a compound having a structure according to Formula (I’):O'), or a pharmaceutically acceptable salt thereof, wherein:R1Ais -C(i-5)alkyl;R1Bis -C(i-5)alkyl that is optionally substituted with one -OH group; orR1Aand R1Bare taken together with the nitrogen to which they are attached to form a 4-10-membered heterocyclic group that is optionally substituted with one -C(i-6)alkyl group;R1Cis absent or R1Cis -C(i-5)alkyl, wherein when R1Cis present, the nitrogen to which R1Cis bonded bears a positive charge; orRIARIB,ancjRicare takentogether with the nitrogen to which they are attached to form a 5-11-membered heterocyclic group that is optionally substituted with one -C(i-6)alkyl group, wherein the nitrogen to which R1A, R1B, and R1Care bonded bears a positive charge;R2A , R2B, and R2Care each independently -OR3, -OC(O)R3, or -C(O)OR3; each R3is independently selected from the group consisting of:1880953055. v3767972: SA9-884PC / PAT24230-WO-PCT(i) -C(9-25)alkyl or -C(9-25)alkenyl;wherein: each R3Ais -C(i-3i)alkyl; and each ZA is -C(6-io)alkylene-; and(iii), wherein: each R3Bis -C(i-3i)alkyl; and each ZB is -C(6-io)alkylene-; and n is 0 or 1.In some embodiments, the present disclosure provides a compound having a structure according to Formula (I):(I), or a pharmaceutically acceptable salt thereof, wherein:X is -C(i-6)alkylene-, -C(2-6)alkenylene-, -OC(i-6)alkylene-, -OC(2-6)alkenylene-, - OC(O)C(i-6)alkylene-, -OC(O)C(2-6)alkenylene-, -OC(O)OC(i.6)alkylene-, -OC(O)OC(2- 6)alkenylene-, -NHC(O)C(i-6)alkylene-, -NHC(O)C(2-6)alkenylene-, or -C(i-6)alkylene-O-C(i- 6)alkylene-;Y is -C(2-6)alkylene- or -C(2-6)alkenylene-, each of which is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, - C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, - N(R”)2, -SR” and -SO2R”;R1Aand R1Bare each independently selected from hydrogen and -C(i-io)alkyl, wherein the -C(i-io)alkyl is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, - OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, -N(R”)2, -SR” and -SO2R”; orR1Aand R1Bare taken together with the nitrogen to which they are attached to form a 4-10-membered heterocyclic group that is optionally substituted with one, two, or three -C(i- 6)alkyl groups;80953055. v3767972: SA9-884PC / PAT24230-WO-PCTR1Cis absent or R1Cis -C(i-io)alkyl that is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, - C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, -N(R”)2, - SR” and -SO2R”, wherein when R1Cis present, the nitrogen to which R1Cis bonded bears a positive charge; orRIARIB,ancjRicare takentogether with the nitrogen to which they are attached to form a 5-11-membered heterocyclic group that is optionally substituted with one, two, or three -C(i-6)alkyl groups, wherein the nitrogen to which R1A, R1B, and R1Care bonded bears a positive charge;R2A, R2B, and R2Care each independently:each R3is independently selected from the group consisting of:(i) -C(4-20)alkenyl or -C(4-20)alkynyl, each of which is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, - N(R”)2, -SR” or -SO2R”;wherein: each R3Ais independently -C(i-3i)alkyl, -C(2-3i)alkenyl, or -C(2-3i)alkynyl, each of which is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, - OC(O)R”, -OC(O)OR”, -NH2, -NHR”, -N(R”)2, -SR” and -SO2R”; and each ZA is independently -C(i-io)alkylene- or -C(2-io)alkenylene-, each of which is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, - OC(O)OR”, -NH2, -NHR”, -N(R”)2, -SR” and -SO2R”; and(iii), wherein: each R3Bis independently -C(i-3i)alkyl, -C(2-3i)alkenyl, or -C(2-3i)alkynyl, each of which is optionally substituted with one, two, or three substituents independently selected2080953055. v3767972: SA9-884PC / PAT24230-WO-PCT from the group consisting of halogen, -C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, - OC(O)R”, -OC(O)OR”, -NH2, -NHR”, -N(R”)2, -SR” and -SO2R”; and each ZB is independently -C(i-io)alkylene- or -C(2-io)alkenylene-, each of which is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, - OC(O)OR”, -NH2, -NHR”, -N(R”)2, -SR” and -SO2R”; n is 0 or 1; andR” is independently for each occurrence -C(i-20)alkyl.In some embodiments, the present disclosure provides a compound having a structure according to Formula (I):(I), or a pharmaceutically acceptable salt thereof, wherein:X is -C(i-6)alkylene-, -OC(i-6)alkylene-, -NHC(0)C(i-6)alkylene-, or -C(i-6)alkylene-O- C(i-6)alkylene-;Y is -C(2-6)alkylene- or -C(2-6)alkenylene-, each of which is optionally substituted with one -C(O)OH group;R1Aand R1Bare each independently selected from hydrogen and -C(i-io)alkyl, wherein the -C(i-io)alkyl is optionally substituted with one -OH group; orR1Aand R1Bare taken together with the nitrogen to which they are attached to form a 4-10-membered heterocyclic group, that is optionally substituted with one -C(i-6)alkyl group;R1Cis absent or -C(i-io)alkyl, wherein when R1Cis present, the nitrogen to which R1Cis bonded bears a positive charge; orRIARIB,ancjRicare takentogether with the nitrogen to which they are attached to form a 5-11-membered heterocyclic group, that is optionally substituted with one -C(i-6)alkyl group, wherein the nitrogen to which R1A, R1B, and R1Care bonded bears a positive charge;R2A, R2B, and R2Care each independently:each R3is independently selected from the group consisting of:2180953055. v3767972: SA9-884PC / PAT24230-WO-PCT(i) -C(4-20)alkenyl or -C(4-20)alkynyl;wherein: each R3Ais independently -C(i-3i)alkyl, -C(2-3i)alkenyl, or -C(2-3i)alkynyl; and each ZA is independently -C(i-io)alkylene- or -C(2-io)alkenylene-; and(iii), wherein: each R3Bis independently -C(i-3i)alkyl, -C(2-3i)alkenyl, or -C(2-3i)alkynyl; and each ZB is independently -C(i-io)alkylene- or -C(2-io)alkenylene-; and n is 0 or 1.In some embodiments, the present disclosure provides a compound having a structure according to Formula (I):(I), or a pharmaceutically acceptable salt thereof, wherein:X is -C(i-6)alkylene- or -OC(2-6)alkylene-;Y is -C(2-6)alkylene- that is optionally substituted with one -C(O)OH group;R1Aand R1Bare each independently -C(i-5)alkyl that is optionally substituted with one -OH group; orR1Aand R1Bare taken together with the nitrogen to which they are attached to form a 4-10-membered heterocyclic group that is optionally substituted with one -C(i-6)alkyl group;R1Cis absent or R1Cis -C(i-5)alkyl, wherein when R1Cis present, the nitrogen to which R1Cis bonded bears a positive charge; orRIARIB,ancjRicare takentogether with the nitrogen to which they are attached to form a 5-11-membered heterocyclic group that is optionally substituted with one -C(i-6)alkyl group, wherein the nitrogen to which R1A, R1B, and R1Care bonded bears a positive charge;R2A, R2B, and R2Care each independently:80953055. v3767972: SA9-884PC / PAT24230-WO-PCT each R3is independently selected from the group consisting of:(i) -C(4-20)alkenyl or -C(4-20)alkynyl;wherein: each R3Ais independently -C(i-3i)alkyl, -C(2-3i)alkenyl, or -C(2-3i)alkynyl; and each ZA is independently -C(i-io)alkylene- or -C(2-io)alkenylene-; and(iii), wherein: each R3Bis independently -C(i-3i)alkyl, -C(2-3i)alkenyl, or -C(2-3i)alkynyl; and each ZB is independently -C(i-io)alkylene- or -C(2-io)alkenylene-; and n is 0 or 1.In some embodiments, the present disclosure provides a compound having a structure according to Formula (I):(I), or a pharmaceutically acceptable salt thereof, wherein:R1Ais -C(i-5)alkyl;R1Bis -C(i-5)alkyl that is optionally substituted with one -OH group; orR1Aand R1Bare taken together with the nitrogen to which they are attached to form a 4-10-membered heterocyclic group that is optionally substituted with one -C(i-6)alkyl group;R1Cis absent or R1Cis -C(i-5)alkyl, wherein when R1Cis present, the nitrogen to which R1Cis bonded bears a positive charge; orRIARIB,ancjRicare takentogether with the nitrogen to which they are attached to form a 5-11-membered heterocyclic group that is optionally substituted with one -C(i-6)alkyl group, wherein the nitrogen to which R1A, R1B, and R1Care bonded bears a positive charge;R2A, R2B, and R2Care each independently:2380953055. v3767972: SA9-884PC / PAT24230-WO-PCTeach R3is independently selected from the group consisting of:(i) -C(4-20)alkenyl;wherein: each R3Ais independently -C(i-3i)alkyl; and each ZA is independently -C(i-io)alkylene-; and(iii), wherein: each R3Bis independently -C(i-3i)alkyl; and each ZB is independently -C(i-io)alkylene-; and n is 0 or 1.In some embodiments, X is -C(i-6)alkylene-, -C(2-6)alkenylene-, -OC(2-6)alkylene-, - OC(2-6)alkenylene-, -OC(O)C(2-6)alkylene-, -OC(O)C(2-6)alkenylene-, -OC(O)OC(2-6)alkylene-, -OC(O)OC(2-6)alkenylene-, -NHC(O)C(2-6)alkylene-, -NHC(O)C(2-6)alkenylene-, or -C(i- 6)alkylene-O-C(2-6)alkylene-.In some embodiments, X is -C(i-6)alkylene-, -OC(i-6)alkylene-, -NHC(O)C(i-6)alkylene- , or -C(i-6)alkylene-O-C(i-6)alkylene-. In some embodiments, X is -C(i-6)alkylene-, -OC(2- 6)alkylene-, -NHC(O)C(2-6)alkylene-, or -C(i-6)alkylene-O-C(2-6)alkylene-.In some embodiments, X is -C(i-6)alkylene- or -OC(2-6)alkylene-.In some embodiments, X is -C(i-6)alkylene-. In some embodiments, X is -CH2-. In some embodiments, X is -(CH2)2-. In some embodiments, X is -(CH2)3-. In some embodiments, X is -(CH2)4-. In some embodiments, X is -(CH2)5-. In some embodiments, X is -(CH2)e-.In some embodiments, X is -C(2-6)alkenylene-.In some embodiments, X is -OC(i-6)alkylene-. In some embodiments, X is -OC(2- 6)alkylene-. In some embodiments, X is -O(CH2)2-. In some embodiments, X is -O(CH2)3-. In some embodiments, X is -O(CH2)4-. In some embodiments, X is -O(CH2)5-. In some embodiments, X is -O(CH2)e-.In some embodiments, X is -OC(2-6)alkenylene-.2480953055. v3767972: SA9-884PC / PAT24230-WO-PCTIn some embodiments, X is -OC(O)C(i-6)alkylene-. In some embodiments, X is - OC(O)C(2-6)alkylene-.In some embodiments, X is -OC(O)C(2-6)alkenylene-.In some embodiments, X is -OC(O)OC(i-6)alkylene-. In some embodiments, X is - OC(O)OC(2-6)alkylene-. In some embodiments, X is -OC(O)OCH2-. In some embodiments, X is -OC(O)O(CH2)2-. In some embodiments, X is -OC(O)O(CH2)3-. In some embodiments, X is -OC(O)O(CH2)4-. In some embodiments, X is -OC(O)O(CH2)5-. In some embodiments, X is -OC(O)O(CH2)6-.In some embodiments, X is -OC(O)OC(2-6)alkenylene-.In some embodiments, X is -NHC(O)C(i-6)alkylene-. In some embodiments, X is - NHC(O)C(2-6)alkylene-. In some embodiments, X is -NHC(O)(CH2)2-. In some embodiments, X is -NHC(O)(CH2)3-. In some embodiments, X is -NHC(O)(CH2)4-. In some embodiments, X is -NHC(O)(CH2)5-. In some embodiments, X is -NHC(O)(CH2)e-.In some embodiments, X is -NHC(O)C(2-6)alkenylene-.In some embodiments, X is -C(i-6)alkylene-O-C(i-6)alkylene-. In some embodiments, X is -C(i-6)alkylene-O-C(2-6)alkylene-. In some embodiments, X is -CH2-O-C(2-6)alkylene-. In some embodiments, X is -CH2O(CH2)2-.In some embodiments, X is -CH2-, -O(CH2)3-, -O(CH2)4-, -NHC(O)(CH2)2-, - CH2O(CH2)2-. In some embodiments, X is -CH2-, -O(CH2)3-, or -O(CH2)4-. In some embodiments, X is -CH2-. In some embodiments, X is -O(CH2)3-. In some embodiments, X is -O(CH2)4-. In some embodiments, X is -NHC(O)(CH2)2-. In some embodiments, X is - CH2O(CH2)2-.In some embodiments, Y is -C(2-6)alkylene- or -C(2-6)alkenylene-, each of which is optionally substituted with one substituent selected from the group consisting of halogen, - C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, - N(R”)2, -SR” and -SO2R”.In some embodiments, Y is -C(2-6)alkylene- or -C(2-6)alkenylene-, each of which is optionally substituted with one -C(O)OH group. In some embodiments, Y is -C(2-6)alkylene- or -C(2-6)alkenylene-.In some embodiments, Y is -C(2-6)alkylene- that is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, - C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, - N(R”)2, -SR” and -SO2R”. In some embodiments, Y is -C(2-6)alkylene- that is optionally substituted with one substituent selected from the group consisting of halogen, -C(O)R”, -2580953055. v3767972: SA9-884PC / PAT24230-WO-PCTC(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, -N(R”)2, - SR” and -SO2R”.In some embodiments, Y is -C(2-6)alkylene- that is optionally substituted with one - C(O)OH group. In some embodiments, Y is -C(2-6)alkylene-. In some embodiments, Y is - (CH2)2-. In some embodiments, Y is -(CH2)3-. In some embodiments, Y is -(CH2)4-. In some embodiments, Y is -(CH2)5-. In some embodiments, Y is -(CH2)e-. In some embodiments, Y isinsome embodiments, Y isinsome embodiments, Y isIn some embodiments, Y is -C(2-6)alkenylene- that is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, - C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, - N(R”)2, -SR” and -SO2R”. In some embodiments, Y is -C(2-6)alkenylene- that is optionally substituted with one substituent selected from the group consisting of halogen, -C(O)R”, - C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, -N(R”)2, - SR” and -SO2R”.In some embodiments, Y is -C(2-6)alkenylene- that is optionally substituted with one - C(O)OH group. In some embodiments, Y is -C(2-6)alkenylene-.In some embodiments, Y is -CH2CH2- or O^'OH insome embodiments, Y is -CH2CH2-. In some embodiments,In some embodiments, n is 0. In some embodiments, n is 1.In some embodiments, R2Ais -C(O)OR3. In some embodiments, R2Bis -C(O)OR3.In some embodiments, R2Cis -C(O)OR3. In some embodiments, R2A, R2B, and R2Care each -C(O)OR3. In some embodiments, R2A, R2B, and R2Care each -C(O)OR3, and n is 0.In some embodiments, R2Ais O . In some embodiments,,2680953055. v3767972: SA9-884PC / PAT24230-WO-PCT. In some embodiments, R2A, R2B, and R2Care each. In some embodiments, R2A, R2B, and R2Care eachIn some embodiments, R2Ais. In some embodiments, R2B, some embodiments, R2A, R2B, and R2Care each. In some embodiments, R2A, R2B, and R2Care each, and n is 0.In some embodiments, the present disclosure provides a compound having a structure according to Formula (II’):(ir), or a pharmaceutically acceptable salt thereof.In some embodiments, the present disclosure provides a compound having a structure according to Formula (II”):(IF’), or a pharmaceutically acceptable salt thereof.2780953055. v3767972: SA9-884PC / PAT24230-WO-PCTIn some embodiments, the present disclosure provides a compound having a structure according to Formula (II):(II), or a pharmaceutically acceptable salt thereof, wherein:XAis -O-, -OC(O)-, -NHC(O)-, or -OC(O)O-; and m is 1-6.In some embodiments, the present disclosure provides a compound having a structure according to Formula (Il-a):(Il-a), or a pharmaceutically acceptable salt thereof, wherein:XAis -O-, -OC(O)-, -NHC(O)-, or -OC(O)O-; m is 1-6; and v is 2-6.In some embodiments, XA is -O-. In some embodiments, XA is -OC(O)-. In some embodiments, XA is -NHC(O)-. In some embodiments, XA is -OC(O)O-.In some embodiments, the present disclosure provides a compound having a structure according to Formula (Il-b):2880953055. v3767972: SA9-884PC / PAT24230-WO-PCT(Il-b), or a pharmaceutically acceptable salt thereof, wherein: m is 1-6; and v is 2-6.In some embodiments, m is 2-6. In some embodiments, m is 2-4. In some embodiments, m is 1. In some embodiments, m is 2. In some embodiments, m is 3. In some embodiments, m is 4. In some embodiments, m is 5. In some embodiments, m is 6.In some embodiments, v is 2-4. In some embodiments, v is 2. In some embodiments, v is 3. In some embodiments, v is 4. In some embodiments, v is 5. In some embodiments, v is6.In some embodiments, m is 2-4, and v is 2-4. In some embodiments, m is 2-4, and v is2.In some embodiments, R2Ais -OC(O)R3. In some embodiments, R2Bis -OC(O)R3.In some embodiments, R2Cis -OC(O)R3. In some embodiments, R2A, R2B, and R2Care each -OC(O)R3. In some embodiments, R2A, R2B, and R2Care each -OC(O)R3, and n is 1.OIn some embodiments, R2Ais. In some embodiments,, o. In some embodiments, R2A, R2B, and R2Care each. In some embodiments, R2A, R2B, and R2Care eachoIn some embodiments, R2AisIn some embodiments, R2B, o some embodiments, R2A, R2B, and R2Care each. In some embodiments, R2A, R2B, and R2Care each2980953055. v3767972: SA9-884PC / PAT24230-WO-PCTIn some embodiments, the present disclosure provides a compound having a structure according to Formula (III’):(III’), or a pharmaceutically acceptable salt thereof.In some embodiments, the present disclosure provides a compound having a structure according to Formula (III”):or a pharmaceutically acceptable salt thereof.In some embodiments, the present disclosure provides a compound having a structure according to Formula (III):or a pharmaceutically acceptable salt thereof, wherein:XB is absent, -O-, -OC(O)-, -NHC(O)-, -OC(O)O-, or -C(i-6)alkylene-O-; and p is 1-6.3080953055. v3767972: SA9-884PC / PAT24230-WO-PCTIn some embodiments, the present disclosure provides a compound having a structure according to Formula (Ill-a):or a pharmaceutically acceptable salt thereof, wherein:XB is absent, -O-, -OC(O)-, -NHC(O)-, -OC(O)O-, or -C(i-6)alkylene-O-; p is 1-6; and w is 2-6.In some embodiments, XB is absent. In some embodiments, XB is -O-. In some embodiments, XB is -OC(O)-. In some embodiments, XB is -NHC(O)-. In some embodiments, XB is -OC(O)O-. In some embodiments, XB is -C(i-6)alkylene-O-. In some embodiments, XB is -CH2O-.In some embodiments, the present disclosure provides a compound having a structure according to Formula (Ill-b):or a pharmaceutically acceptable salt thereof, wherein: p is 1-6; and w is 2-6.In some embodiments, the present disclosure provides a compound having a structure according to Formula (III-c):3180953055. v3767972: SA9-884PC / PAT24230-WO-PCTor a pharmaceutically acceptable salt thereof, wherein: p is 1-6; and w is 2-6.In some embodiments, the present disclosure provides a compound having a structure according to Formula (Ill-d):or a pharmaceutically acceptable salt thereof, wherein: p is 1-6; and w is 2-6.In some embodiments, p is 1-4. In some embodiments, p is 1-3. In some embodiments, p is 2-4. In some embodiments, p is 1. In some embodiments, p is 2. In some embodiments, p is 3. In some embodiments, p is 4. In some embodiments, p is 5. In some embodiments, p is 6.In some embodiments, w is 2-4. In some embodiments, w is 2. In some embodiments, w is 3. In some embodiments, w is 4. In some embodiments, w is 5. In some embodiments, w is 6.In some embodiments, p is 1-4, and w is 2-4. In some embodiments, p is 1-3, and w is 2-4. In some embodiments, p is 2-4, and w is 2-4. In some embodiments, p is 1-4, and w is 2. In some embodiments, p is 1-3, and w is 2. In some embodiments, p is 2-4, and w is 2.3280953055. v3767972: SA9-884PC / PAT24230-WO-PCTIn some embodiments, R2Ais -OR3. In some embodiments, R2Bis -OR3. In some embodiments, R2Cis -OR3. In some embodiments, R2A, R2B, and R2Care each -OR3. In some embodiments, R2A, R2B, and R2Care each -OR3, and n is 1.In some embodiments, R2Aisin some embodiments, R2Bis, . In some embodiments, R2A, R2B, and R2Care eachin some embodiments,R2A , R2B, and R2Care eachIn some embodiments, R2AisIn some embodiments, R2Bis. , insome embodiments, R2A, R2B, and R2Care eachin some embodiments,R2A, R2B, and R2Care eachIn some embodiments, the present disclosure provides a compound having a structure according to Formula (IV’):(IV’), or a pharmaceutically acceptable salt thereof.In some embodiments, the present disclosure provides a compound having a structure according to Formula (IV”):(IV”),3380953055. v3767972: SA9-884PC / PAT24230-WO-PCT or a pharmaceutically acceptable salt thereof.In some embodiments, the present disclosure provides a compound having a structure according to Formula (IV):(IV), or a pharmaceutically acceptable salt thereof, wherein:Xc is absent, -O-, -OC(O)-, -NHC(O)-, -OC(O)O-, or -C(i-6)alkylene-O-; and q is 1-6.In some embodiments, the present disclosure provides a compound having a structure according to Formula (IV-a):(IV-a), or a pharmaceutically acceptable salt thereof, wherein:Xc is absent, -O-, -OC(O)-, -NHC(O)-, -OC(O)O-, or -C(i-6)alkylene-O-; q is 1-6; and z is 2-6.In some embodiments, Xc is absent. In some embodiments, Xc is -O-. In some embodiments, Xc is -OC(O)-. In some embodiments, Xc is -NHC(O)-. In some embodiments, Xc is -OC(O)O-. In some embodiments, Xc is -C(i-6)alkylene-O-. In some embodiments, Xc is -CH2O-.In some embodiments, the present disclosure provides a compound having a structure according to Formula (IV-b):3480953055. v3767972: SA9-884PC / PAT24230-WO-PCTor a pharmaceutically acceptable salt thereof, wherein: q is 1-6; and z is 2-6.In some embodiments, q is 1-4. In some embodiments, q is 1-3. In some embodiments, q is 2-4. In some embodiments, q is 1. In some embodiments, q is 2. In some embodiments, q is 3. In some embodiments, q is 4. In some embodiments, q is 5. In some embodiments, q is 6.In some embodiments, z is 2-4. In some embodiments, z is 2. In some embodiments, z is 3. In some embodiments, z is 4. In some embodiments, z is 5. In some embodiments, z is 6.In some embodiments, q is 1-4, and z is 2-4. In some embodiments, q is 1-3, and z is 2-4. In some embodiments, q is 2-4, and z is 2-4. In some embodiments, q is 1-4, and z is 2. In some embodiments, q is 1-3, and z is 2. In some embodiments, q is 2-4, and z is 2.In some embodiments, the present disclosure provides a compound having a structure according to Formula (VI’):(VF), or a pharmaceutically acceptable salt thereof.In some embodiments, the present disclosure provides a compound having a structure according to Formula (VI”):80953055. v3767972: SA9-884PC / PAT24230-WO-PCT(VI”), or a pharmaceutically acceptable salt thereof.In some embodiments, the present disclosure provides a compound having a structure according to Formula (VI):(VI), or a pharmaceutically acceptable salt thereof, wherein:XD is absent, -O-, -OC(O)-, -NHC(O)-, -OC(O)O-, or -C(i-6)alkylene-O-; and ql is 1-6.In some embodiments, the present disclosure provides a compound having a structure according to Formula (Vl-a):(VI-a), or a pharmaceutically acceptable salt thereof, wherein:XD is absent, -O-, -OC(O)-, -NHC(O)-, -OC(O)O-, or -C(i-6)alkylene-O-; ql is 1-6; and zl is 2-6.3680953055. v3767972: SA9-884PC / PAT24230-WO-PCTIn some embodiments, XD is absent. In some embodiments, XD is -O-. In some embodiments, XD is -OC(O)-. In some embodiments, XD is -NHC(O)-. In some embodiments, XD is -OC(O)O-. In some embodiments, XD is -C(i-6)alkylene-O-. In some embodiments, XD is -CH2O-.In some embodiments, the present disclosure provides a compound having a structure according to Formula (Vl-b):(VI-b), or a pharmaceutically acceptable salt thereof, wherein: ql is 1-6; and zl is 2-6.In some embodiments, ql is 1-4. In some embodiments, ql is 1-3. In some embodiments, ql is 2-4. In some embodiments, ql is 1. In some embodiments, ql is 2. In some embodiments, ql is 3. In some embodiments, ql is 4. In some embodiments, ql is 5. In some embodiments, ql is 6.In some embodiments, zl is 2-4. In some embodiments, zl is 2. In some embodiments, zl is 3. In some embodiments, zl is 4. In some embodiments, zl is 5. In some embodiments, zl is 6.In some embodiments, ql is 1-4, and zl is 2-4. In some embodiments, ql is 1-3, and zl is 2-4. In some embodiments, ql is 2-4, and zl is 2-4. In some embodiments, ql is 1-4, and zl is 2. In some embodiments, ql is 1-3, and zl is 2. In some embodiments, ql is 2-4, and zl is 2.In some embodiments, each R3is the same.In some embodiments, two R3are the same. In some embodiments, only two R3are the same.In some embodiments, two R3are different from one another.In some embodiments, each R3is independently -C(9-25)alkyl, -C(9-25)alkenyl or -C(9- 25)alkynyl, each of which is optionally substituted with one, two, or three substituents3780953055. v3767972: SA9-884PC / PAT24230-WO-PCT independently selected from the group consisting of halogen, -C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, -N(R”)2, -SR” or -SO2R”.In some embodiments, each R3is independently -C(9-25)alkyl, -C(9-25)alkenyl or -C(9-25)alkynyl, each of which is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, -C(O)OH, -CN, -OH, -OR”, -OC(O)OR”, -NH2, -NHR”, -N(R”)2, -SR” or -SO2R”.In some embodiments, each R3is -C(9-25)alkyl that is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, - C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, - N(R”)2, -SR” or -SO2R”.In some embodiments, each R3is -C(9-25)alkenyl that is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, - C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, - N(R”)2, -SR” or -SO2R”.In some embodiments, each R3is -C(9-25)alkynyl that is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, - C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, - N(R”)2, -SR” or -SO2R”.In some embodiments, each R3is independently -C(9-25)alkyl, -C(9-25)alkenyl or -C(9-25)alkynyl. In some embodiments, each R3is independently -C(9-25)alkyl or -C(9-25)alkenyl. In some embodiments, each R3is -C(9-25)alkyl. In some embodiments, each R3is -C(9-25)alkenyl. In some embodiments, each R3is -C(9-25)alkynyl.In some embodiments, each R3is -C(9)alkyl. In some embodiments, each R3is - C(io)alkyl. In some embodiments, each R3is -Cppalkyl. In some embodiments, each R3is -C(i2)alkyl. In some embodiments, each R3is -C(i3)alkyl. In some embodiments, each R3is -C(i4)alkyl. In some embodiments, each R3is -C(i5)alkyl. In some embodiments, each R3is -C(i6)alkyl. In some embodiments, each R3is -C(i7)alkyl. In some embodiments, each R3is -C(i8)alkyl. In some embodiments, each R3is -C(i9)alkyl. In some embodiments, each R3is -C(2o)alkyl. In some embodiments, each R3is -C(2i)alkyl. In some embodiments, each R3is -C(22)alkyl. In some embodiments, each R3is -C(23)alkyl. In some embodiments, each R3is -C(24)alkyl. In some embodiments, each R3is -C(25)alkyl.In some embodiments, each R3is -C(9)alkenyl. In some embodiments, each R3is - C(io)alkenyl. In some embodiments, each R3is - ipalkenyl. In some embodiments, each R3is -C(i2)alkenyl. In some embodiments, each R3is -C(i3)alkenyl. In some embodiments, each3880953055. v3767972: SA9-884PC / PAT24230-WO-PCTR3is -C(i4)alkenyl. In some embodiments, each R3is -C(i5)alkenyl. In some embodiments, each R3is -C(i6)alkenyl. In some embodiments, each R3is -C(i7)alkenyl. In some embodiments, each R3is -C(is)alkenyl. In some embodiments, each R3is -C(i9)alkenyl. In some embodiments, each R3is -C(20)alkenyl. In some embodiments, each R3is -C(2i)alkenyl. In some embodiments, each R3is -C(22)alkenyl. In some embodiments, each R3is - C(23)alkenyl. In some embodiments, each R3is -C(24)alkenyl. In some embodiments, each R3is -C(25)alkenyl.In some embodiments, each R3is -C(9)alkynyl. In some embodiments, each R3is - C(io)alkynyl. In some embodiments, each R3is -C(ii)alkynyl. In some embodiments, each R3is -C(i2)alkynyl. In some embodiments, each R3is -C(i3)alkynyl. In some embodiments, each R3is -C(i4)alkynyl. In some embodiments, each R3is -C(i5)alkynyl. In some embodiments, each R3is -C(i6)alkynyl. In some embodiments, each R3is -C(i7)alkynyl. In some embodiments, each R3is -C(is)alkynyl. In some embodiments, each R3is -C(i9)alkynyl. In some embodiments, each R3is -C(20)alkynyl. In some embodiments, each R3is -C(2i)alkynyl. In some embodiments, each R3is -C(22)alkynyl. In some embodiments, each R3is - C(23)alkynyl. In some embodiments, each R3is -C(24)alkynyl. In some embodiments, each R3is -C(25)alkynyl.In some embodiments, each R3is.In some embodiments, each R3isIn some embodiments, each R3isIn some embodiments, each R3isIn some embodiments, each R3isIn some embodiments, each R3isIn some embodiments, each R3isO3AA .ZA .In some embodiments, each R3is independentlyRO * , wherein: each R3Ais independently -C(i-3i)alkyl, -C(2-3i)alkenyl, or -C(2-3i)alkynyl, each of which is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, - OC(O)R”, -OC(O)OR”, -NH2, -NHR”, -N(R”)2, -SR” and -SO2R”; and each ZA is independently -C(6-io)alkylene- or -C(7-io)alkenylene-, each of which is optionally substituted with one, two, or three substituents independently selected from the3980953055. v3767972: SA9-884PC / PAT24230-WO-PCT group consisting of halogen, -C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, - OC(O)OR”, -NH2, -NHR”, -N(R”)2, -SR” and -SO2R”. oAA / ZAIn some embodiments, each R3is independently R O , wherein each R3Ais independently -C(i-3i)alkyl, -C(2-3i)alkenyl, or -C(2-3i)alkynyl; and each ZA is independently -C(6-io)alkylene- or -C(7-io)alkenylene-.OIn some embodiments, each R3is independently, wherein each R3Ais independently -C(i-3i)alkyl or -C(2-3i)alkenyl; and each ZA is independently -C(6-io)alkylene- or -C(7-io)alkenylene-.OIn some embodiments, each R3is independently, wherein each R3Ais -C(i-3i)alkyl; and each ZA is -C(6-io)alkylene-.In some embodiments, each R3Ais -C(i-3i)alkyl that is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, - C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, - N(R”)2, -SR” and -SO2R”.In some embodiments, each R3Ais -C(2-3i)alkenyl that is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, - C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, - N(R”)2, -SR” and -SO2R”.In some embodiments, each R3Ais -C(2-3i)alkynyl that is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, - C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, - N(R”)2, -SR” and -SO2R”.In some embodiments, each R3Ais independently -C(i-3i)alkyl, -C(2-3i)alkenyl, or -C(2. 3i)alkynyl. In some embodiments, each R3Ais independently -C(i-3i)alkyl or -C(2-3i)alkenyl. In some embodiments, each R3Ais -C(i-3i)alkyl. In some embodiments, each R3Ais -C(2. 3i)alkenyl. In some embodiments, each R3Ais -C(2-3i)alkynyl.In some embodiments, each R3Ais -C(i)alkyl. In some embodiments, each R3Ais - C(2)alkyl. In some embodiments, each R3Ais -C(3)alkyl. In some embodiments, each R3Ais - C(4)alkyl. In some embodiments, each R3Ais -C(5)alkyl. In some embodiments, each R3Ais -4080953055. v3767972: SA9-884PC / PAT24230-WO-PCTC(6)alkyl. In some embodiments, each R3Ais -C(7)alkyl. In some embodiments, each R3Ais - C(8)alkyl. In some embodiments, each R3Ais -C(9)alkyl. In some embodiments, each R3Ais - C(io)alkyl. In some embodiments, each R3Ais -C(ii)alkyl. In some embodiments, each R3Ais - C(i2)alkyl. In some embodiments, each R3Ais -C(i3)alkyl. In some embodiments, each R3Ais - C(i4)alkyl. In some embodiments, each R3Ais -C(i5)alkyl. In some embodiments, each R3Ais - C(i6)alkyl. In some embodiments, each R3Ais -C(i7)alkyl. In some embodiments, each R3Ais - C(i8)alkyl. In some embodiments, each R3Ais -C(i9)alkyl. In some embodiments, each R3Ais - C(20)alkyl. In some embodiments, each R3Ais -C(2i)alkyl. In some embodiments, each R3Ais - C(22)alkyl. In some embodiments, each R3Ais -C(23)alkyl. In some embodiments, each R3Ais - C(24)alkyl. In some embodiments, each R3Ais -C(25)alkyl. In some embodiments, each R3Ais - C(26)alkyl. In some embodiments, each R3Ais -C(27)alkyl. In some embodiments, each R3Ais - C(28)alkyl. In some embodiments, each R3Ais -C(29)alkyl. In some embodiments, each R3Ais - C(30)alkyl. In some embodiments, each R3Ais -C(3i)alkyl.In some embodiments, each R3Ais -C(2)alkenyl. In some embodiments, each R3Ais - C(3)alkenyl. In some embodiments, each R3Ais -C(4)alkenyl. In some embodiments, each R3Ais -C(5)alkenyl. In some embodiments, each R3Ais -C(6)alkenyl. In some embodiments, each R3Ais -C(7)alkenyl. In some embodiments, each R3Ais -C(8)alkenyl. In some embodiments, each R3Ais -C(9)alkenyl. In some embodiments, each R3Ais -C(io)alkenyl. In some embodiments, each R3Ais -C(ii)alkenyl. In some embodiments, each R3Ais -C(i2)alkenyl. In some embodiments, each R3Ais -C(i3)alkenyl. In some embodiments, each R3Ais - C(i4)alkenyl. In some embodiments, each R3Ais -C(i5)alkenyl. In some embodiments, each R3Ais -C(i6)alkenyl. In some embodiments, each R3Ais -C(i7)alkenyl. In some embodiments, each R3Ais -C(i8)alkenyl. In some embodiments, each R3Ais -C(i9)alkenyl. In some embodiments, each R3Ais -C(20)alkenyl. In some embodiments, each R3Ais -C(2i)alkenyl. In some embodiments, each R3Ais -C(22)alkenyl. In some embodiments, each R3Ais - C(23)alkenyl. In some embodiments, each R3Ais -C(24)alkenyl. In some embodiments, each R3Ais -C(25)alkenyl. In some embodiments, each R3Ais -C(26)alkenyl. In some embodiments, each R3Ais -C(27)alkenyl. In some embodiments, each R3Ais -C(28)alkenyl. In some embodiments, each R3Ais -C(29)alkenyl. In some embodiments, each R3Ais -C(30)alkenyl. In some embodiments, each R3Ais -C(3i)alkenyl.In some embodiments, each R3Ais -C(2)alkynyl. In some embodiments, each R3Ais - C(3)alkynyl. In some embodiments, each R3Ais -C(4)alkynyl. In some embodiments, each R3Ais -C(5)alkynyl. In some embodiments, each R3Ais -C(6)alkynyl. In some embodiments, each R3Ais -C(7)alkynyl. In some embodiments, each R3Ais -C(8)alkynyl. In some embodiments,4180953055. v3767972: SA9-884PC / PAT24230-WO-PCT each R3Ais -C(9)alkynyl. In some embodiments, each R3Ais -C(io)alkynyl. In some embodiments, each R3Ais -Cppalkynyl. In some embodiments, each R3Ais -C(i2)alkynyl. In some embodiments, each R3Ais -C(i3)alkynyl. In some embodiments, each R3Ais - C(i4)alkynyl. In some embodiments, each R3Ais -C(i5)alkynyl. In some embodiments, each R3Ais -C(i6)alkynyl. In some embodiments, each R3Ais -C(i7)alkynyl. In some embodiments, each R3Ais -C(is)alkynyl. In some embodiments, each R3Ais -C(i9)alkynyl. In some embodiments, each R3Ais -C(2o)alkynyl. In some embodiments, each R3Ais -C(2i)alkynyl. In some embodiments, each R3Ais -C(22)alkynyl. In some embodiments, each R3Ais - C(23)alkynyl. In some embodiments, each R3Ais -C(24)alkynyl. In some embodiments, each R3Ais -C(25)alkynyl. In some embodiments, each R3Ais -C(26)alkynyl. In some embodiments, each R3Ais -C(27)alkynyl. In some embodiments, each R3Ais -C(28)alkynyl. In some embodiments, each R3Ais -C(29)alkynyl. In some embodiments, each R3Ais -C(30)alkynyl. In some embodiments, each R3Ais -C(3i)alkynyl.In some embodiments, each R3Ais.In some embodiments, each R3AisIn some embodiments, each R3AisIn some embodiments, each R3Ais.In some embodiments, each ZA is -C(6-io)alkylene- that is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, - C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, - N(R”)2, -SR” and -SO2R”.In some embodiments, each ZA is -C(7-io)alkenylene- that is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, - C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, - N(R”)2, -SR” and -SO2R”.In some embodiments, each ZA is independently -C(6-io)alkylene- or -C(7- io)alkenylene-. In some embodiments, each ZA is -C(6-io)alkylene-. In some embodiments, each ZA is -C(7-io)alkenylene-.In some embodiments, each ZA is -C(6)alkylene-. In some embodiments, each ZA is - C(7)alkylene-. In some embodiments, each ZA is -C(8)alkylene-. In some embodiments, each ZA is -C(9)alkylene-. In some embodiments, each ZA is -C(io)alkylene-.4280953055. v3767972: SA9-884PC / PAT24230-WO-PCTIn some embodiments, each ZA IS -C(7)alkenylene-. In some embodiments, each ZA IS - C(8)alkenylene-. In some embodiments, each ZA is -C(9)alkenylene-. In some embodiments, each ZA is -C(io)alkenylene-.In some embodiments, each ZA isIn some embodiments, each ZA isIn some embodiments, each ZA isIn some embodiments, each R3is independently O , wherein: each R3Bis independently -C(i-3i)alkyl, -C(2-3i)alkenyl, or -C(2-3i)alkynyl, each of which is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, - OC(O)R”, -OC(O)OR”, -NH2, -NHR”, -N(R”)2, -SR” and -SO2R”; and each ZB is independently -C(6-io)alkylene- or -C(7-io)alkenylene-, each of which is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, - OC(O)OR”, -NH2, -NHR”, -N(R”)2, -SR” and -SO2R”.In some embodiments, each R3is independently O , wherein each R3Bis independently -C(i-3i)alkyl, -C(2-3i)alkenyl, or -C(2-3i)alkynyl; and each ZB is independently -C(6-io)alkylene- or -C(7-io)alkenylene-.In some embodiments, each R3is independently 0 , wherein each R3Bis independently -C(i-3i)alkyl or -C(2-3i)alkenyl; and each ZB is independently -C(6-io)alkylene- or -C(7-io)alkenylene-.In some embodiments, each R3is independently 0 , wherein each R3Bis -C(i-3i)alkyl; and each ZB is -C(6-io)alkylene-.In some embodiments, each R3Bis -C(i-3i)alkyl that is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, - C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, - N(R”)2, -SR” and -SO2R”.4380953055. v3767972: SA9-884PC / PAT24230-WO-PCTIn some embodiments, each R3Bis -C(2-3i)alkenyl that is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, - C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, - N(R”)2, -SR” and -SO2R”.In some embodiments, each R3Bis -C(2-3i)alkynyl that is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, - C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, - N(R”)2, -SR” and -SO2R”.In some embodiments, each R3Bis independently -C(i-3i)alkyl, -C(2-3i)alkenyl, or -C(2. 3i)alkynyl. In some embodiments, each R3Bis independently -C(i-3i)alkyl or -C(2-3i)alkenyl. In some embodiments, each R3Bis -C(i-3i)alkyl. In some embodiments, each R3Bis -C(2. 3i)alkenyl. In some embodiments, each R3Bis -C(2-3i)alkynyl.In some embodiments, each R3Bis -C(i)alkyl. In some embodiments, each R3Bis - C(2)alkyl. In some embodiments, each R3Bis -C(3)alkyl. In some embodiments, each R3Bis -C(4)alkyl. In some embodiments, each R3Bis -C(5)alkyl. In some embodiments, each R3Bis -C(6)alkyl. In some embodiments, each R3Bis -C(7)alkyl. In some embodiments, each R3Bis -C(8)alkyl. In some embodiments, each R3Bis -C(9)alkyl. In some embodiments, each R3Bis -C(io)alkyl. In some embodiments, each R3Bis -Cppalkyl. In some embodiments, each R3Bis -C(i2)alkyl. In some embodiments, each R3Bis -C(i3)alkyl. In some embodiments, each R3Bis -C(i4)alkyl. In some embodiments, each R3Bis -C(i5)alkyl. In some embodiments, each R3Bis -C(i6)alkyl. In some embodiments, each R3Bis -C(i7)alkyl. In some embodiments, each R3Bis -C(i8)alkyl. In some embodiments, each R3Bis -C(i9)alkyl. In some embodiments, each R3Bis -C(2o)alkyl. In some embodiments, each R3Bis -C(2i)alkyl. In some embodiments, each R3Bis -C(22)alkyl. In some embodiments, each R3Bis -C(23)alkyl. In some embodiments, each R3Bis -C(24)alkyl. In some embodiments, each R3Bis -C(25)alkyl. In some embodiments, each R3Bis -C(26)alkyl. In some embodiments, each R3Bis -C(27)alkyl. In some embodiments, each R3Bis -C(28)alkyl. In some embodiments, each R3Bis -C(29)alkyl. In some embodiments, each R3Bis -C(30)alkyl. In some embodiments, each R3Bis -C(3i)alkyl.In some embodiments, each R3Bis -C(2)alkenyl. In some embodiments, each R3Bis - C(3)alkenyl. In some embodiments, each R3Bis -C(4)alkenyl. In some embodiments, each R3Bis -C(5)alkenyl. In some embodiments, each R3Bis -C(6)alkenyl. In some embodiments, each R3Bis -C(7)alkenyl. In some embodiments, each R3Bis -C(8)alkenyl. In some embodiments, each R3Bis -C(9)alkenyl. In some embodiments, each R3Bis -C(io)alkenyl. In some embodiments, each R3Bis -Cppalkenyl. In some embodiments, each R3Bis -C(i2)alkenyl. In4480953055. v3767972: SA9-884PC / PAT24230-WO-PCT some embodiments, each R3Bis -C(i3)alkenyl. In some embodiments, each R3Bis - C(i4)alkenyl. In some embodiments, each R3Bis -C(i5)alkenyl. In some embodiments, each R3Bis -C(i6)alkenyl. In some embodiments, each R3Bis -C(i7)alkenyl. In some embodiments, each R3Bis -C(is)alkenyl. In some embodiments, each R3Bis -C(i9)alkenyl. In some embodiments, each R3Bis -C(20)alkenyl. In some embodiments, each R3Bis -C(2i)alkenyl. In some embodiments, each R3Bis -C(22)alkenyl. In some embodiments, each R3Bis - C(23)alkenyl. In some embodiments, each R3Bis -C(24)alkenyl. In some embodiments, each R3Bis -C(25)alkenyl. In some embodiments, each R3Bis -C(26)alkenyl. In some embodiments, each R3Bis -C(27)alkenyl. In some embodiments, each R3Bis -C(28)alkenyl. In some embodiments, each R3Bis -C(29)alkenyl. In some embodiments, each R3Bis -C(30)alkenyl. In some embodiments, each R3Bis -C(3i)alkenyl.In some embodiments, each R3Bis -C(2)alkynyl. In some embodiments, each R3Bis - C(3)alkynyl. In some embodiments, each R3Bis -C(4)alkynyl. In some embodiments, each R3Bis -C(5)alkynyl. In some embodiments, each R3Bis -C(6)alkynyl. In some embodiments, each R3Bis -C(7)alkynyl. In some embodiments, each R3Bis -C(8)alkynyl. In some embodiments, each R3Bis -C(9)alkynyl. In some embodiments, each R3Bis -C(io)alkynyl. In some embodiments, each R3Bis -C(ii)alkynyl. In some embodiments, each R3Bis -C(i2)alkynyl. In some embodiments, each R3Bis -C(i3)alkynyl. In some embodiments, each R3Bis - C(i4)alkynyl. In some embodiments, each R3Bis -C(i5)alkynyl. In some embodiments, each R3Bis -C(i6)alkynyl. In some embodiments, each R3Bis -C(i7)alkynyl. In some embodiments, each R3Bis -C(is)alkynyl. In some embodiments, each R3Bis -C(i9)alkynyl. In some embodiments, each R3Bis -C(20)alkynyl. In some embodiments, each R3Bis -C(2i)alkynyl. In some embodiments, each R3Bis -C(22)alkynyl. In some embodiments, each R3Bis - C(23)alkynyl. In some embodiments, each R3Bis -C(24)alkynyl. In some embodiments, each R3Bis -C(25)alkynyl. In some embodiments, each R3Bis -C(26)alkynyl. In some embodiments, each R3Bis -C(27)alkynyl. In some embodiments, each R3Bis -C(28)alkynyl. In some embodiments, each R3Bis -C(29)alkynyl. In some embodiments, each R3Bis -C(30)alkynyl. In some embodiments, each R3Bis -C(3i)alkynyl.In some embodiments, each R3Bis.In some embodiments, each R3BisIn some embodiments, each R3BisIn some embodiments, each R3Bis4580953055. v3767972: SA9-884PC / PAT24230-WO-PCTIn some embodiments, each ZB is -C(6-io)alkylene- that is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, - C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, - N(R”)2, -SR” and -SO2R”.In some embodiments, each ZB is -C(7-io)alkenylene- that is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, - C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, - N(R”)2, -SR” and -SO2R”.In some embodiments, each ZB is independently -C(6-io)alkylene- or -C(7-io)alkenylene- . In some embodiments, each ZB is -C(6-io)alkylene-. In some embodiments, each ZB is -C(7- io)alkenylene-.In some embodiments, each ZB is -C(6)alkylene-. In some embodiments, each ZB is - C(7)alkylene-. In some embodiments, each ZB is -C(8)alkylene-. In some embodiments, each ZB is -C(9)alkylene-. In some embodiments, each ZB is -C(io)alkylene-.In some embodiments, each ZB is -C(7)alkenylene-. In some embodiments, each ZB is - C(8)alkenylene-. In some embodiments, each ZB is -C(9)alkenylene-. In some embodiments, each ZB is -C(io)alkenylene-.In some embodiments, each ZB isIn some embodiments, each ZB isIn some embodiments, each ZB isOIn some embodiments, each R3isIn some embodiments, each R3is0In some embodiments, each R3is OIn some embodiments, each R3is OOIn some embodiments, each R3isIn some embodiments, each R3is O4680953055. v3767972: SA9-884PC / PAT24230-WO-PCTIn some embodiments, each R3is independently selected from the group consistingO of: (i) -C(9-25)alkyl, -C(9-25)alkenyl or -C(9-25)alkynyl; (ii), wherein each R3Ais independently -C(i-3i)alkyl, -C(2-3i)alkenyl, or -C(2-3i)alkynyl; and each ZA is independently -R3B YC(6-io)alkylene- or -C(7-io)alkenylene-; and (iii) O , wherein each R3Bis independently -C(i-3i)alkyl, -C(2-3i)alkenyl, or -C(2-3i)alkynyl; and each ZB is independently - C(6-io)alkylene- or -C(7-io)alkenylene-.In some embodiments, each R3is independently selected from the group consistingO of: (i) -C(9-25)alkyl or -C(9-25)alkenyl; (ii), wherein each R3Ais independently -C(i-3i)alkyl or -C(2-3i)alkenyl; and each ZA is independently -C(6-io)alkylene- or -C -.ZB_sR3B Y io)alkenylene-; and (iii) 0 , wherein each R3Bis independently -C(i-3i)alkyl or -C(2-3i)alkenyl; and each ZB is independently -C(6-io)alkylene- or -C(7-io)alkenylene-.In some embodiments, each R3is independently selected from the group consistingO of: (i) -C(9-25)alkyl or -C(9-25)alkenyl; (ii), wherein each R3Ais -C(i-3i)alkyl,and each ZA is -C(6-io)alkylene-; and (iii)0, wherein each R3Bis -C(i-3i)alkyl, and each ZB is -C(6-io)alkylene-.In some embodiments, (a) one instance of R3is -C(9-25)alkyl; and (b) the other two instances of R3are independently -C(9-25)alkenyl.In some embodiments, (a) one instance of R3is -C(9-25)alkenyl; and (b) the other two instances of R3are independently -C(9-25)alkyl.4780953055. v3767972: SA9-884PC / PAT24230-WO-PCTIn some embodiments, (a) one instance of R3is -C(9-25)alkyl; and (b) the other twoO instances of R3are independently (i), wherein each R3Ais -C(i-3i)alkyl, and_ ZB jR3B Y each ZA is -C(6-io)alkylene-; or (ii) 0 , wherein each R3Bis -C(i-3i)alkyl, and each ZB is -C(6-io)alkylene-.OIn some embodiments, (a) one instance of R3is (i), wherein each R3Ais -C(i-3i)alkyl, and each ZA is -C(6-io)alkylene-; or (ii) O , wherein each R3Bis - C(i-3i)alkyl, and each ZB is -C(6-io)alkylene-; and (b) the other two instances of R3are independently -C(9-25)alkyl.In some embodiments, (a) one instance of R3is -C(9-25)alkenyl; and (b) the other twoO instances of R3are independently (i), wherein each R3Ais -C(i-3i)alkyl, andR3B"0YZB?each ZA is -C(6-io)alkylene-; or (ii)0, wherein each R3Bis -C(i-3i)alkyl, and each ZB is -C(6-io)alkylene-.OIn some embodiments, (a) one instance of R3is (i), wherein each R3Ais -C(i-3i)alkyl, and each ZA is -C(6-io)alkylene-; or (ii)0, wherein each R3Bis -C(i-3i)alkyl, and each ZB is -C(6-io)alkylene-; and (b) the other two instances of R3are independently -C(9-25)alkenyl.In some embodiments, R2A, R2B, and R2Care each independently selected from the group consisting of:4880953055. v3767972: SA9-884PC / PAT24230-WO-PCT4980953055. v3767972: SA9-884PC / PAT24230-WO-PCTIn some embodiments, each R3is independently -C(4-20)alkenyl or -C(4-20)alkynyl, each of which is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, - OC(O)R”, -OC(O)OR”, -NH2, -NHR”, -N(R”)2, -SR” and -SO2R”.In some embodiments, each R3is independently -C(4-20)alkenyl or -C(4-20)alkynyl, each of which is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, -C(O)OH, -CN, -OH, -OR”, -OC(O)OR”, - NH2, -NHR”, -N(R”)2, -SR” and -SO2R”.In some embodiments, each R3is -C(4-20)alkenyl that is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, - C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, - N(R”)2, -SR” and -SO2R”.In some embodiments, each R3is -C(4-20)alkynyl that is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, - C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, - N(R”)2, -SR” and -SO2R”.In some embodiments, each R3is independently -C(4-20)alkenyl or -C(4-20)alkynyl. In some embodiments, each R3is -C(4-20)alkenyl. In some embodiments, each R3is independently -C(4-20)alkynyl.In some embodiments, each R3is -C(4)alkenyl. In some embodiments, each R3is - C(5)alkenyl. In some embodiments, each R3is -C(6)alkenyl. In some embodiments, each R3is - C(7)alkenyl. In some embodiments, each R3is -C(8)alkenyl. In some embodiments, each R3is - C(9)alkenyl. In some embodiments, each R3is -C(io)alkenyl. In some embodiments, each R3is -C(ii)alkenyl. In some embodiments, each R3is -C(i2)alkenyl. In some embodiments, each R3is -C(i3)alkenyl. In some embodiments, each R3is -C(i4)alkenyl. In some embodiments, each R3is -C(i5)alkenyl. In some embodiments, each R3is -C(i6)alkenyl. In some embodiments, each R3is -C(i7)alkenyl. In some embodiments, each R3is -C(is)alkenyl. In some embodiments, each R3is -C(i9)alkenyl. In some embodiments, each R3is -C(20)alkenyl.In some embodiments, each R3is -C(4)alkynyl. In some embodiments, each R3is - C(5)alkynyl. In some embodiments, each R3is -C(6)alkynyl. In some embodiments, each R3is -C(7)alkynyl. In some embodiments, each R3is -C(8)alkynyl. In some embodiments, each R3is -C(9)alkynyl. In some embodiments, each R3is -C(io)alkynyl. In some embodiments, each R3is -C(ii)alkynyl. In some embodiments, each R3is -C(i2)alkynyl. In some embodiments, each R3is -C(i3)alkynyl. In some embodiments, each R3is -C(i4)alkynyl. In some embodiments,5080953055. v3767972: SA9-884PC / PAT24230-WO-PCT each R3is -C(i5)alkynyl. In some embodiments, each R3is -C(i6)alkynyl. In some embodiments, each R3is -C(i7)alkynyl. In some embodiments, each R3is -C(is)alkynyl. In some embodiments, each R3is -C(i9)alkynyl. In some embodiments, each R3is -C(20)alkynyl.In some embodiments, each R3isIn some embodiments, each R3isOIn some embodiments, each R is independently, wherein: each R3Ais independently -C(i-3i)alkyl, -C(2-3i)alkenyl, or -C(2-3i)alkynyl, each of which is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, - OC(O)R”, -OC(O)OR”, -NH2, -NHR”, -N(R”)2, -SR” and -SO2R”; and each ZA is independently -C(i-io)alkylene- or -C(2-io)alkenylene-, each of which is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, - OC(O)OR”, -NH2, -NHR”, -N(R”)2, -SR” and -SO2R”.O3A / ZAIn some embodiments, each R3is independentlyR, wherein each R3Ais independently -C(i-3i)alkyl, -C(2-3i)alkenyl, or -C(2-3i)alkynyl; and each ZA is independently - C(i-io)alkylene- or -C(2-io)alkenylene-.O3A^ZA AIn some embodiments, each R3is independentlyR, wherein each R3Ais independently -C(i-3i)alkyl or -C(2-3i)alkenyl; and each ZA is independently -C(i-io)alkylene- or -C(2-io)alkenylene-.OAIn some embodiments, each R3is independentlyr3A 0, wherein each R3Ais-C(i-3i)alkyl; and each ZA is -C(i-io)alkylene-.In some embodiments, each R3Ais -C(i-3i)alkyl that is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, - C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, - N(R”)2, -SR” and -SO2R”.In some embodiments, each R3Ais -C(2-3i)alkenyl that is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -5180953055. v3767972: SA9-884PC / PAT24230-WO-PCTC(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, - N(R”)2, -SR” and -SO2R”.In some embodiments, each R3Ais -C(2-3i)alkynyl that is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, - C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, - N(R”)2, -SR” and -SO2R”.In some embodiments, each R3Ais independently -C(i-3i)alkyl, -C(2-3i)alkenyl, or -C(2. 3i)alkynyl. In some embodiments, each R3Ais independently -C(i-3i)alkyl or -C(2-3i)alkenyl. In some embodiments, each R3Ais -C(i-3i)alkyl. In some embodiments, each R3Ais -C(2. 3i)alkenyl. In some embodiments, each R3Ais -C(2-3i)alkynyl.In some embodiments, each R3Ais -C(i)alkyl. In some embodiments, each R3Ais - C(2)alkyl. In some embodiments, each R3Ais -C(3)alkyl. In some embodiments, each R3Ais -C(4)alkyl. In some embodiments, each R3Ais -C(5)alkyl. In some embodiments, each R3Ais -C(6)alkyl. In some embodiments, each R3Ais -C(7)alkyl. In some embodiments, each R3Ais -C(8)alkyl. In some embodiments, each R3Ais -C(9)alkyl. In some embodiments, each R3Ais -C(io)alkyl. In some embodiments, each R3Ais - ipalkyl. In some embodiments, each R3Ais - C(i2)alkyl. In some embodiments, each R3Ais -C(i3)alkyl. In some embodiments, each R3Ais - C(i4)alkyl. In some embodiments, each R3Ais -C(i5)alkyl. In some embodiments, each R3Ais - C(i6)alkyl. In some embodiments, each R3Ais -C(i7)alkyl. In some embodiments, each R3Ais - C(i8)alkyl. In some embodiments, each R3Ais -C(i9)alkyl. In some embodiments, each R3Ais - C(2o)alkyl. In some embodiments, each R3Ais -C(2i)alkyl. In some embodiments, each R3Ais - C(22)alkyl. In some embodiments, each R3Ais -C(23)alkyl. In some embodiments, each R3Ais - C(24)alkyl. In some embodiments, each R3Ais -C(25)alkyl. In some embodiments, each R3Ais - C(26)alkyl. In some embodiments, each R3Ais -C(27)alkyl. In some embodiments, each R3Ais - C(28)alkyl. In some embodiments, each R3Ais -C(29)alkyl. In some embodiments, each R3Ais - C(30)alkyl. In some embodiments, each R3Ais -C(3i)alkyl.In some embodiments, each R3Ais -C(2)alkenyl. In some embodiments, each R3Ais - C(3)alkenyl. In some embodiments, each R3Ais -C(4)alkenyl. In some embodiments, each R3Ais -C(5)alkenyl. In some embodiments, each R3Ais -C(6)alkenyl. In some embodiments, each R3Ais -C(7)alkenyl. In some embodiments, each R3Ais -C(8)alkenyl. In some embodiments, each R3Ais -C(9)alkenyl. In some embodiments, each R3Ais -C(io)alkenyl. In some embodiments, each R3Ais -Cppalkenyl. In some embodiments, each R3Ais -C(i2)alkenyl. In some embodiments, each R3Ais -C(i3)alkenyl. In some embodiments, each R3Ais - C(i4)alkenyl. In some embodiments, each R3Ais -C(i5)alkenyl. In some embodiments, each5280953055. v3767972: SA9-884PC / PAT24230-WO-PCTR3Ais -C(i6)alkenyl. In some embodiments, each R3Ais -C(i7)alkenyl. In some embodiments, each R3Ais -C(is)alkenyl. In some embodiments, each R3Ais -C(i9)alkenyl. In some embodiments, each R3Ais -C(20)alkenyl. In some embodiments, each R3Ais -C(2i)alkenyl. In some embodiments, each R3Ais -C(22)alkenyl. In some embodiments, each R3Ais - C(23)alkenyl. In some embodiments, each R3Ais -C(24)alkenyl. In some embodiments, each R3Ais -C(25)alkenyl. In some embodiments, each R3Ais -C(26)alkenyl. In some embodiments, each R3Ais -C(27)alkenyl. In some embodiments, each R3Ais -C(28)alkenyl. In some embodiments, each R3Ais -C(29)alkenyl. In some embodiments, each R3Ais -C(30)alkenyl. In some embodiments, each R3Ais -C(3i)alkenyl.In some embodiments, each R3Ais -C(2)alkynyl. In some embodiments, each R3Ais - C(3)alkynyl. In some embodiments, each R3Ais -C(4)alkynyl. In some embodiments, each R3Ais -C(5)alkynyl. In some embodiments, each R3Ais -C(6)alkynyl. In some embodiments, each R3Ais -C(7)alkynyl. In some embodiments, each R3Ais -C(8)alkynyl. In some embodiments, each R3Ais -C(9)alkynyl. In some embodiments, each R3Ais -C(io)alkynyl. In some embodiments, each R3Ais -C(ii)alkynyl. In some embodiments, each R3Ais -C(i2)alkynyl. In some embodiments, each R3Ais -C(i3)alkynyl. In some embodiments, each R3Ais - C(i4)alkynyl. In some embodiments, each R3Ais -C(i5)alkynyl. In some embodiments, each R3Ais -C(i6)alkynyl. In some embodiments, each R3Ais -C(i7)alkynyl. In some embodiments, each R3Ais -C(is)alkynyl. In some embodiments, each R3Ais -C(i9)alkynyl. In some embodiments, each R3Ais -C(20)alkynyl. In some embodiments, each R3Ais -C(2i)alkynyl. In some embodiments, each R3Ais -C(22)alkynyl. In some embodiments, each R3Ais - C(23)alkynyl. In some embodiments, each R3Ais -C(24)alkynyl. In some embodiments, each R3Ais -C(25)alkynyl. In some embodiments, each R3Ais -C(26)alkynyl. In some embodiments, each R3Ais -C(27)alkynyl. In some embodiments, each R3Ais -C(28)alkynyl. In some embodiments, each R3Ais -C(29)alkynyl. In some embodiments, each R3Ais -C(30)alkynyl. In some embodiments, each R3Ais -C(3i)alkynyl.In some embodiments, each R3Ais.In some embodiments, each R3AisIn some embodiments, each R3AisIn some embodiments, each R3Ais.In some embodiments, each ZA is -C(i-io)alkylene- that is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -5380953055. v3767972: SA9-884PC / PAT24230-WO-PCTC(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, - N(R”)2, -SR” and -SO2R”.In some embodiments, each ZA is -C(2-io)alkenylene- that is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, - C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, - N(R”)2, -SR” and -SO2R”.In some embodiments, each ZA is independently -C(i-io)alkylene- or -C(2. io)alkenylene-. In some embodiments, each ZA is -C(i-io)alkylene-. In some embodiments, each ZA is -C(2-io)alkenylene-.In some embodiments, each ZA is -C(i)alkylene-. In some embodiments, each ZA is - C(2)alkylene-. In some embodiments, each ZA is -C(3)alkylene-. In some embodiments, each ZA is -C(4)alkylene-. In some embodiments, each ZA is -C(5)alkylene-. In some embodiments, each ZA is -C(6)alkylene-. In some embodiments, each ZA is -C(7)alkylene-. In some embodiments, each ZA is -C(8)alkylene-. In some embodiments, each ZA is -C(9)alkylene-. In some embodiments, each ZA is -C(io)alkylene-.In some embodiments, each ZA is -C(2)alkenylene-. In some embodiments, each ZA is - C(3)alkenylene-. In some embodiments, each ZA is -C(4)alkenylene-. In some embodiments, each ZA is -C(5)alkenylene-. In some embodiments, each ZA is -C(6)alkenylene-. In some embodiments, each ZA is -C(7)alkenylene-. In some embodiments, each ZA is -C(8)alkenylene-. In some embodiments, each ZA is -C(9)alkenylene-. In some embodiments, each ZA is - C(io)alkenylene-.In some embodiments, each ZA isIn some embodiments, each ZA isIn some embodiments, each R3is independently O , wherein: each R3Bis independently -C(i-3i)alkyl, -C(2-3i)alkenyl, or -C(2-3i)alkynyl, each of which is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, - OC(O)R”, -OC(O)OR”, -NH2, -NHR”, -N(R”)2, -SR” and -SO2R”; and each ZB is independently -C(i-io)alkylene- or -C(2-io)alkenylene-, each of which is optionally substituted with one, two, or three substituents independently selected from the5480953055. v3767972: SA9-884PC / PAT24230-WO-PCT group consisting of halogen, -C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, - OC(O)OR”, -NH2, -NHR”, -N(R”)2, -SR” and -SO2R”.In some embodiments, each R3is independently O , wherein each R3Bis independently -C(i-3i)alkyl, -C(2-3i)alkenyl, or -C(2-3i)alkynyl; and each ZB is independently - C(i-io)alkylene- or -C(2-io)alkenylene-.R3B'°YZB^In some embodiments, each R3is independently O , wherein each R3Bis independently -C(i-3i)alkyl or -C(2-3i)alkenyl; and each ZB is independently -C(i-io)alkylene- or -C(2-io)alkenylene-.In some embodiments, each R3is independently O , wherein each R3Bis -C(i-3i)alkyl; and each ZB is -C(i-io)alkylene-.In some embodiments, each R3Bis -C(i-3i)alkyl that is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, - C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, - N(R”)2, -SR” and -SO2R”.In some embodiments, each R3Bis -C(2-3i)alkenyl that is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, - C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, - N(R”)2, -SR” and -SO2R”.In some embodiments, each R3Bis -C(2-3i)alkynyl that is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, - C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, - N(R”)2, -SR” and -SO2R”.In some embodiments, each R3Bis independently -C(i-3i)alkyl, -C(2-3i)alkenyl, or -C(2- 3i)alkynyl. In some embodiments, each R3Bis independently -C(i-3i)alkyl or -C(2-3i)alkenyl. In some embodiments, each R3Bis -C(i-3i)alkyl. In some embodiments, each R3Bis -C(2- 3i)alkenyl. In some embodiments, each R3Bis -C(2-3i)alkynyl.In some embodiments, each R3Bis -C(i)alkyl. In some embodiments, each R3Bis -C(2)alkyl. In some embodiments, each R3Bis -C(3)alkyl. In some embodiments, each R3Bis -C(4)alkyl. In some embodiments, each R3Bis -C(5)alkyl. In some embodiments, each R3Bis -C(6)alkyl. In some embodiments, each R3Bis -C(7)alkyl. In some embodiments, each R3Bis -5580953055. v3767972: SA9-884PC / PAT24230-WO-PCTC(8)alkyl. In some embodiments, each R3Bis -C(9)alkyl. In some embodiments, each R3Bis - C(io)alkyl. In some embodiments, each R3Bis -C(ii)alkyl. In some embodiments, each R3Bis -C(i2)alkyl. In some embodiments, each R3Bis -C(i3)alkyl. In some embodiments, each R3Bis -C(i4)alkyl. In some embodiments, each R3Bis -C(i5)alkyl. In some embodiments, each R3Bis -C(i6)alkyl. In some embodiments, each R3Bis -C(i7)alkyl. In some embodiments, each R3Bis -C(i8)alkyl. In some embodiments, each R3Bis -C(i9)alkyl. In some embodiments, each R3Bis -C(20)alkyl. In some embodiments, each R3Bis -C(2i)alkyl. In some embodiments, each R3Bis -C(22)alkyl. In some embodiments, each R3Bis -C(23)alkyl. In some embodiments, each R3Bis -C(24)alkyl. In some embodiments, each R3Bis -C(25)alkyl. In some embodiments, each R3Bis -C(26)alkyl. In some embodiments, each R3Bis -C(27)alkyl. In some embodiments, each R3Bis -C(28)alkyl. In some embodiments, each R3Bis -C(29)alkyl. In some embodiments, each R3Bis -C(30)alkyl. In some embodiments, each R3Bis -C(3i)alkyl.In some embodiments, each R3Bis -C(2)alkenyl. In some embodiments, each R3Bis - C(3)alkenyl. In some embodiments, each R3Bis -C(4)alkenyl. In some embodiments, each R3Bis -C(5)alkenyl. In some embodiments, each R3Bis -C(6)alkenyl. In some embodiments, each R3Bis -C(7)alkenyl. In some embodiments, each R3Bis -C(8)alkenyl. In some embodiments, each R3Bis -C(9)alkenyl. In some embodiments, each R3Bis -C(io)alkenyl. In some embodiments, each R3Bis -C(ii)alkenyL In some embodiments, each R3Bis -C(i2)alkenyl. In some embodiments, each R3Bis -C(i3)alkenyl. In some embodiments, each R3Bis - C(i4)alkenyl. In some embodiments, each R3Bis -C(i5)alkenyl. In some embodiments, each R3Bis -C(i6)alkenyl. In some embodiments, each R3Bis -C(i7)alkenyl. In some embodiments, each R3Bis -C(i8)alkenyl. In some embodiments, each R3Bis -C(i9)alkenyl. In some embodiments, each R3Bis -C(20)alkenyl. In some embodiments, each R3Bis -C(2i)alkenyl. In some embodiments, each R3Bis -C(22)alkenyl. In some embodiments, each R3Bis - C(23)alkenyl. In some embodiments, each R3Bis -C(24)alkenyl. In some embodiments, each R3Bis -C(25)alkenyl. In some embodiments, each R3Bis -C(26)alkenyl. In some embodiments, each R3Bis -C(27)alkenyl. In some embodiments, each R3Bis -C(28)alkenyl. In some embodiments, each R3Bis -C(29)alkenyl. In some embodiments, each R3Bis -C(30)alkenyl. In some embodiments, each R3Bis -C(3i)alkenyl.In some embodiments, each R3Bis -C(2)alkynyl. In some embodiments, each R3Bis - C(3)alkynyl. In some embodiments, each R3Bis -C(4)alkynyl. In some embodiments, each R3Bis -C(5)alkynyl. In some embodiments, each R3Bis -C(6)alkynyl. In some embodiments, each R3Bis -C(7)alkynyl. In some embodiments, each R3Bis -C(8)alkynyl. In some embodiments, each R3Bis -C(9)alkynyl. In some embodiments, each R3Bis -C(io)alkynyl. In some5680953055. v3767972: SA9-884PC / PAT24230-WO-PCT embodiments, each R3Bis -Cppalkynyl. In some embodiments, each R3Bis -C(i2)alkynyl. In some embodiments, each R3Bis -C(i3)alkynyl. In some embodiments, each R3Bis - C(i4)alkynyl. In some embodiments, each R3Bis -C(i5)alkynyl. In some embodiments, each R3Bis -C(i6)alkynyl. In some embodiments, each R3Bis -C(i7)alkynyl. In some embodiments, each R3Bis -C(is)alkynyl. In some embodiments, each R3Bis -C(i9)alkynyl. In some embodiments, each R3Bis -C(2o)alkynyl. In some embodiments, each R3Bis -C(2i)alkynyl. In some embodiments, each R3Bis -C(22)alkynyl. In some embodiments, each R3Bis - C(23)alkynyl. In some embodiments, each R3Bis -C(24)alkynyl. In some embodiments, each R3Bis -C(25)alkynyl. In some embodiments, each R3Bis -C(26)alkynyl. In some embodiments, each R3Bis -C(27)alkynyl. In some embodiments, each R3Bis -C(2s)alkynyl. In some embodiments, each R3Bis -C(29)alkynyl. In some embodiments, each R3Bis -C(30)alkynyl. In some embodiments, each R3Bis -C(3i)alkynyl.In some embodiments, each R3BisIn some embodiments, each R3BisIn some embodiments, each R3BisIn some embodiments, each R3Bis.In some embodiments, each ZB is -C(i-io)alkylene- that is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, - N(R”)2, -SR” and -SO2R”.In some embodiments, each ZB is -C(2-io)alkenylene- that is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, - C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, - N(R”)2, -SR” and -SO2R”.In some embodiments, each ZB is independently -C(i-io)alkylene- or -C(2-io)alkenylene- . In some embodiments, each ZB is -C(i-io)alkylene-. In some embodiments, each ZB is -C(2. io)alkenylene-.In some embodiments, each ZB is -C(i)alkylene-. In some embodiments, each ZB is - C(2)alkylene-. In some embodiments, each ZB is -C(3)alkylene-. In some embodiments, each ZB is -C(4)alkylene-. In some embodiments, each ZB is -C(5)alkylene-. In some embodiments, each ZB is -C(6)alkylene-. In some embodiments, each ZB is -C(7)alkylene-. In some5780953055. v3767972: SA9-884PC / PAT24230-WO-PCT embodiments, each ZB is -C(8)alkylene-. In some embodiments, each ZB is -C(9)alkylene-. In some embodiments, each ZB is -C(io)alkylene-.In some embodiments, each ZB is -C(2)alkenylene-. In some embodiments, each ZB is - C(3)alkenylene-. In some embodiments, each ZB is -C(4)alkenylene-. In some embodiments, each ZB is -C(5)alkenylene-. In some embodiments, each ZB is -C(6)alkenylene-. In some embodiments, each ZB is -C(7)alkenylene-. In some embodiments, each ZB is -C(8)alkenylene-. In some embodiments, each ZB is -C(9)alkenylene-. In some embodiments, each ZB is - C(io)alkenylene-.In some embodiments, each ZBIn some embodiments, each ZBIn some embodiments, each ZBIn some embodiments, each R3In some embodiments, each R3In some embodiments, each R3In some embodiments, each R3In some embodiments, each R3In some embodiments, each R3In some embodiments, each R3In some embodiments, each R3In some embodiments, each R3is independently selected from the group consisting of: (i) -C(4-20)alkenyl or -C(4-20)alkynyl; (ii)wherein each R3Ais5880953055. v3767972: SA9-884PC / PAT24230-WO-PCT independently -C(i-3i)alkyl, -C(2-3i)alkenyl, or -C(2-3i)alkynyl; and each ZA is independently - R3B'°YZ= / C(i-io)alkylene- or -C(2-io)alkenylene-; and (iii) O , wherein each R3Bis independently -C(i-3i)alkyl, -C(2-3i)alkenyl, or -C(2-3i)alkynyl; and each ZB is independently - C(i-io)alkylene- or -C(2-io)alkenylene-.In some embodiments, each R3is independently selected from the group consistingO of: (i) -C(4-20)alkenyl; (ii), wherein each R3Ais independently -C(i-3i)alkyl or -C(2-3i)alkenyl; and each ZA is independently -C(i-io)alkylene- or -C(2-io)alkenylene-; and (iii)R3B"°YZB?e0, wherein each R3Bis independently -C(i-3i)alkyl or -C(2-3i)alkenyl; and eachZB is independently -C(i-io)alkylene- or -C(2-io)alkenylene-.In some embodiments, each R3is independently selected from the group consistingO of: (i) -C(4-20)alkenyl; (ii), wherein each R3Ais -C(i-3i)alkyl, and each ZA is -R3B^°YZVC(i-io)alkylene-; and (iii)0, wherein each R3Bis -C(i-3i)alkyl, and each ZB is -C(i-io)alkylene-.In some embodiments, R2A, R2B, and R2Care each independently selected from the group consisting of:5980953055. v3767972: SA9-884PC / PAT24230-WO-PCTIn some embodiments, R1Ais hydrogen or -C(i-io)alkyl, wherein the -C(i-io)alkyl is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, - OC(O)OR”, -NH2, -NHR”, -N(R”)2, -SR” and -SO2R”.In some embodiments, R1Ais hydrogen or -C(i-io)alkyl, wherein the -C(i-io)alkyl is optionally substituted with one -OH group.In some embodiments, R1Ais hydrogen.In some embodiments, R1Ais -C(i-io)alkyl, wherein the -C(i-io)alkyl is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, - OC(O)OR”, -NH2, -NHR”, -N(R”)2, -SR” and -SO2R”.In some embodiments, R1Ais -C(i-io)alkyl that is optionally substituted with one -OH group. In some embodiments, R1Ais -C(i-io)alkyl that is substituted with one -OH group. In some embodiments, R1Ais -C(i-5)alkyl that is optionally substituted with one -OH group. In some embodiments, R1Ais -C(i-5)alkyl that is substituted with one -OH group.In some embodiments, R1Ais -C(i-io)alkyl. In some embodiments, R1Ais -C(i-5)alkyl.In some embodiments, R1Ais selected from the group consisting of hydrogen, -CH3, - CH2CH2OH, -(CH2)3OH, and -(CH2)4OH.In some embodiments, R1Ais selected from the group consisting of -CH3, - CH2CH2OH, -(CH2)3OH, and -(CH2)4OH. In some embodiments, R1Ais -CH3. In some6080953055. v3767972: SA9-884PC / PAT24230-WO-PCT embodiments, R1Ais -CH2CH2OH. In some embodiments, R1Ais -(CJ ^OH. In some embodiments, R1Ais -(CJfc^OH.In some embodiments, R1Bis hydrogen or -C(i-io)alkyl, wherein the -C(i-io)alkyl is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, - OC(O)OR”, -NH2, -NHR”, -N(R”)2, -SR” and -SO2R”.In some embodiments, R1Bis hydrogen or -C(i-io)alkyl, wherein the -C(i-io)alkyl is optionally substituted with one -OH group.In some embodiments, R1Bis hydrogen.In some embodiments, R1Bis -C(i-io)alkyl, wherein the -C(i-io)alkyl is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, - OC(O)OR”, -NH2, -NHR”, -N(R”)2, -SR” and -SO2R”.In some embodiments, R1Bis -C(i-io)alkyl that is optionally substituted with one -OH group. In some embodiments, R1Bis -C(i-io)alkyl that is substituted with one -OH group. In some embodiments, R1Bis -C(i-5)alkyl that is optionally substituted with one -OH group. In some embodiments, R1Bis -C(i-5)alkyl that is substituted with one -OH group.In some embodiments, R1Bis -C(i-io)alkyl. In some embodiments, R1Bis -C(i-5)alkyl.In some embodiments, R1Bis selected from the group consisting of hydrogen, -CH3, - CH2CH2OH, -(CH2)3OH, and -(CH2)4OH.In some embodiments, R1Bis selected from the group consisting of -CH3, - CH2CH2OH, -(CH2)3OH, and -(CH2)4OH. In some embodiments, R1Bis -CH3. In some embodiments, R1Bis -CH2CH2OH. In some embodiments, R1Bis -(CH2)3OH. In some embodiments, R1Bis -(CH2)4OH.In some embodiments, R1Aand R1Bare each independently selected from hydrogen and -C(i-io)alkyl, wherein the -C(i-io)alkyl is optionally substituted with one -OH group.In some embodiments, R1Aand R1Bare each -C(i-io)alkyl that is optionally substituted with one -OH group. In some embodiments, R1Aand R1Bare each -C(i-5)alkyl that is optionally substituted with one -OH group.In some embodiments, R1Aand R1Bare each independently selected from the group consisting of hydrogen, -CH3, -CH2CH2OH, -(CH2)3OH, and -(CH2)4OH.In some embodiments, R1Aand R1Bare each independently selected from the group consisting of -CH3, -CH2CH2OH, -(CH2)3OH, and -(CH2)4OH.6180953055. v3767972: SA9-884PC / PAT24230-WO-PCTIn some embodiments, R1Ais -C(i-5)alkyl, and R1Bis -C(i-5)alkyl that is optionally substituted with one -OH group.In some embodiments, R1Ais -CH3, and R1Bis -CH3, -CH2CH2OH, -(CH2)3OH, or - (CH2)4OH.In some embodiments, R1Aand R1Bare taken together with the nitrogen to which they are attached to form a 4-10-membered heterocyclic group that is optionally substituted with one, two, or three -C(i-6)alkyl groups. In some embodiments, R1Aand R1Bare taken together with the nitrogen to which they are attached to form a 4-10-membered heterocyclic group that is optionally substituted with one -C(i-6)alkyl group.In some embodiments, R1Aand R1Bare taken together with the nitrogen to which they are attached to form a 4-6-membered heterocyclic group that is optionally substituted with one -C(i-6)alkyl group.In some embodiments, R1Aand R1Bare taken together with the nitrogen to which they are attached to form a 4-10-membered heterocyclic group. In some embodiments, R1Aand R1Bare taken together with the nitrogen to which they are attached to form a 4-6-membered heterocyclic group.In some embodiments, R1Cis absent or R1Cis -C(i-io)alkyl that is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, - OC(O)OR”, -NH2, -NHR”, -N(R”)2, -SR” and -SO2R”, wherein when R1Cis present, the nitrogen to which R1Cis bonded bears a positive charge.In some embodiments, R1Cis absent or R1Cis -C(i-io)alkyl, wherein when R1Cis present, the nitrogen to which R1Cis bonded bears a positive charge. In some embodiments, R1Cis absent or R1Cis -C(i-5)alkyl, wherein when R1Cis present, the nitrogen to which R1Cis bonded bears a positive charge. In some embodiments, R1Cis absent or R1Cis -CH3, wherein when R1Cis present, the nitrogen to which R1Cis bonded bears a positive charge.In some embodiments, R1Cis absent. When R1Cis absent, the nitrogen to which R1Aand R1Bare attached can interconvert between a protonated and unprotonated state:It is to be understood that when R1Cis absent, both the protonated and unprotonated form of the nitrogen atom are encompassed.6280953055. v3767972: SA9-884PC / PAT24230-WO-PCTWhen R1Cis present and the nitrogen to which it is attached bears a positive charge, it is to be understood that the positive charge on the nitrogen atom can be balanced by the presence of a counterion (i.e., a counteranion).In some embodiments, R1Cis -C(i-io)alkyl that is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, - C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, -N(R”)2, - SR” and -SO2R”, wherein the nitrogen to which R1Cis bonded bears a positive charge.In some embodiments, R1Cis -C(i-io)alkyl, wherein the nitrogen to which R1Cis bonded bears a positive charge. In some embodiments, R1Cis -C(i-5)alkyl, wherein the nitrogen to which R1Cis bonded bears a positive charge. In some embodiments, R1Cis -CH3, wherein the nitrogen to which R1Cis bonded bears a positive charge.In some embodiments, R1A, R1B, and R1Care taken together with the nitrogen to which they are attached to form a 5-11-membered heterocyclic group that is optionally substituted with one, two, or three -C(i-6)alkyl groups, wherein the nitrogen to which R1A, R1B, and R1Care bonded bears a positive charge. In some embodiments, R1A, R1B, and R1Care taken together with the nitrogen to which they are attached to form a 5-11 -membered heterocyclic group that is optionally substituted with one -C(i-6)alkyl group, wherein the nitrogen to which RIARIB,ancjRicarebon(ie(ibears a positive charge.In some embodiments, R1A, R1B, and R1Care taken together with the nitrogen to which they are attached to form a 5-11-membered heterocyclic group, wherein the nitrogen to which RIARIB,andRicarebonded bears a positive charge.In some embodiments, R1Aand R1Bare each independently selected from hydrogen and -C(i-io)alkyl, wherein the -C(i-io)alkyl is optionally substituted with one -OH group; orR1Aand R1Bare taken together with the nitrogen to which they are attached to form a 4-10-membered heterocyclic group, that is optionally substituted with one -C(i-6)alkyl group; andR1Cis absent or -C(i-io)alkyl, wherein when R1Cis present, the nitrogen to which R1Cis bonded bears a positive charge; orRIARIB,andRicare ta|<en together with the nitrogen to which they are attached to form a 5-11-membered heterocyclic group, that is optionally substituted with one -C(i-6)alkyl group, wherein the nitrogen to which R1A, R1B, and R1Care bonded bears a positive charge.In some embodiments, R1Aand R1Bare each independently -C(i-5)alkyl that is optionally substituted with one -OH group; or6380953055. v3767972: SA9-884PC / PAT24230-WO-PCTR1Aand R1Bare taken together with the nitrogen to which they are attached to form a 4-10-membered heterocyclic group that is optionally substituted with one -C(i-6)alkyl group; andR1Cis absent or R1Cis -C(i-5)alkyl, wherein when R1Cis present, the nitrogen to which R1Cis bonded bears a positive charge; orRIARIB,ancjRicare takentogether with the nitrogen to which they are attached to form a 5-11-membered heterocyclic group that is optionally substituted with one -C(i-6)alkyl group, wherein the nitrogen to which R1A, R1B, and R1Care bonded bears a positive charge;In some embodiments, R1Ais -C(i-5)alkyl;R1Bis -C(i-5)alkyl that is optionally substituted with one -OH group; orR1Aand R1Bare taken together with the nitrogen to which they are attached to form a 4-10-membered heterocyclic group that is optionally substituted with one -C(i-6)alkyl group; andR1Cis absent or R1Cis -C(i-5)alkyl, wherein when R1Cis present, the nitrogen to which R1Cis bonded bears a positive charge; orRIARIB,ancjRicare takentogether with the nitrogen to which they are attached to form a 5-11-membered heterocyclic group that is optionally substituted with one -C(i-6)alkyl group, wherein the nitrogen to which R1A, R1B, and R1Care bonded bears a positive charge;In some embodiments:(i) R1Ais hydrogen, R1Bis hydrogen, and R1Cis absent;(ii) R1Ais -C(i-5)alkyl, R1Bis -C(i-5)alkyl, and R1Cis absent;(iii) R1Ais -C(i-5)alkyl, R1Bis -C(i-5)alkyl, and R1Cis -C(i-5)alkyl;(iv) R1Ais -C(i-5)alkyl, R1Bis -C(i-5)alkyl substituted with one -OH group, and R1Cis absent;(v) R1Aand R1Bare taken together with the nitrogen to which they are attached to form a 4-10-membered heterocyclic group, and R1Cis absent;(vi) R1Aand R1Bare taken together with the nitrogen to which they are attached to form a 4-10-membered heterocyclic group, and R1Cis -C(i-5)alkyl; or(vii) R1A, R1B, and R1Care taken together with the nitrogen to which they are attached to form a 5-11 -membered heterocyclic group.In some embodiments:(i) R1Ais hydrogen, R1Bis hydrogen, and R1Cis absent;(ii) R1Ais -CH3, R1Bis -CH3, and R1Cis absent;(iii) R1Ais -CH3, R1Bis -CH3, and R1Cis -CH3;6480953055. v3767972: SA9-884PC / PAT24230-WO-PCT(iv) R1Ais -CH3, R1Bis -CH2CH2OH, and R1Cis absent;(v) R1Ais -CH3, R1Bis -(CH2)3OH, and R1Cis absent;(vi) R1Ais -CH3, R1Bis -(CH2)4OH, and R1Cis absent; or(vii) R1Ais -CH2CH3, R1Bis -CH2CH3, and R1Cis -CH2CH3.In some embodiments:(i) R1Ais hydrogen, R1Bis hydrogen, and R1Cis absent;(ii) R1Ais -CH3, R1Bis -CH3, and R1Cis absent;(iii) R1Ais -CH3, R1Bis -CH3, and R1Cis -CH3;(iv) R1Ais -CH3, R1Bis -CH2CH2OH, and R1Cis absent;(v) R1Ais -CH3, R1Bis -(CH2)3OH, and R1Cis absent; or(vi) R1Ais -CH3, R1Bis -(CH2)4OH, and R1Cis absent.In some embodiments:(i) R1Ais -CH3, R1Bis -CH3, and R1Cis absent;(ii) R1Ais -CH3, R1Bis -CH3, and R1Cis -CH3;(iii) R1Ais -CH3, R1Bis -CH2CH2OH, and R1Cis absent;(iv) R1Ais -CH3, R1Bis -(CH2)3OH, and R1Cis absent; or(v) R1Ais -CH3, R1Bis -(CH2)4OH, and R1Cis absent.In some embodiments, R1A, R1B, and R1Ctogether with the nitrogen to which they are attached form a group selected from:wherein RNis hydrogen or -C(i-6)alkyl.In some embodiments, R1A, R1B, and R1Ctogether with the nitrogen to which they are attached form a group selected from:6580953055. v3767972: SA9-884PC / PAT24230-WO-PCTwherein RNis hydrogen or -C(i-6)alkyl.In some embodiments, R1A, R1B, and R1Ctogether with the nitrogen to which they are attached form a group selected from:wherein RNis hydrogen or -C(i-6)alkyl.In some embodiments, R1A, R1B, and R1Ctogether with the nitrogen to which they are attached form a group selected from:In some embodiments, R1A, R1B, and R1Ctogether with the nitrogen to which they are attached form the following group:In some embodiments, R1A, R1B, and R1Ctogether with the nitrogen to which they are attached form the following group:In some embodiments, R1A, R1B, and R1Ctogether with the nitrogen to which they are attached form the following group:.In some embodiments, R1A, R1B, and R1Ctogether with the nitrogen to which they are attached form the following group:6680953055. v3767972: SA9-884PC / PAT24230-WO-PCTIn some embodiments, R1A, R1B, and R1Ctogether with the nitrogen to which they are attached form the following group:In some embodiments, R1A, R1B, and R1Ctogether with the nitrogen to which they are attached form the following group:In some embodiments, R1A, R1B, and R1Ctogether with the nitrogen to which they are attached form the following group:In some embodiments, R” is independently for each occurrence -C(i-io)alkyl. In some embodiments, R” is independently for each occurrence -C(i-5)alkyl. In some embodiments, R’' is independently for each occurrence -C(i-3)alkyl.In some embodiments, the present disclosure provides a compound having a structure6780953055. v3767972: SA9-884PC / PAT24230-WO-PCT6880953055. v3767972: SA9-884PC / PAT24230-WO-PCT6980953055. v3767972: SA9-884PC / PAT24230-WO-PCT7080953055. v3767972: SA9-884PC / PAT24230-WO-PCT7180953055. v3767972: SA9-884PC / PAT24230-WO-PCT7280953055. v3767972: SA9-884PC / PAT24230-WO-PCT7380953055. v3767972: SA9-884PC / PAT24230-WO-PCT7480953055. v3767972: SA9-884PC / PAT24230-WO-PCT7580953055. v3767972: SA9-884PC / PAT24230-WO-PCT7680953055. v3767972: SA9-884PC / PAT24230-WO-PCTor a pharmaceutically acceptable salt thereof.In some embodiments, the present disclosure provides a compound having a structure selected from the group consisting of:7780953055. v3767972: SA9-884PC / PAT24230-WO-PCT7880953055. v3767972: SA9-884PC / PAT24230-WO-PCT7980953055. v3767972: SA9-884PC / PAT24230-WO-PCT8080953055. v3767972: SA9-884PC / PAT24230-WO-PCT8180953055. v3767972: SA9-884PC / PAT24230-WO-PCT8280953055. v3767972: SA9-884PC / PAT24230-WO-PCTor a pharmaceutically acceptable salt thereof.In some embodiments, the present disclosure provides a compound having a structure selected from the group consisting of:8380953055. v3767972: SA9-884PC / PAT24230-WO-PCT8480953055. v3767972: SA9-884PC / PAT24230-WO-PCT8580953055. v3767972: SA9-884PC / PAT24230-WO-PCT8680953055. v3767972: SA9-884PC / PAT24230-WO-PCT8780953055. v3767972: SA9-884PC / PAT24230-WO-PCTIn some embodiments, the present disclosure provides a compound having a structure selected from the group consisting of:8880953055. v3767972: SA9-884PC / PAT24230-WO-PCTIn some embodiments, the present disclosure provides a compound having the following structure:(Compound 1), or a pharmaceutically acceptable salt thereof.In some embodiments, the present disclosure provides a compound having the following structure:8980953055. v3767972: SA9-884PC / PAT24230-WO-PCT(Compound 5), or a pharmaceutically acceptable salt thereof.In some embodiments, the present disclosure provides a compound having the following structure:(Compound 9), or a pharmaceutically acceptable salt thereof.In some embodiments, the present disclosure provides a compound having the following structure:(Compound 13), or a pharmaceutically acceptable salt thereof.In some embodiments, the present disclosure provides a compound having the following structure:(Compound 14), or a pharmaceutically acceptable salt thereof.In some embodiments, the present disclosure provides a compound having the following structure:9080953055. v3767972: SA9-884PC / PAT24230-WO-PCT(Compound 15), or a pharmaceutically acceptable salt thereof.In some embodiments, the present disclosure provides a compound having the following structure:(Compound 16), or a pharmaceutically acceptable salt thereof.In some embodiments, the present disclosure provides a compound having the following structure:(Compound 23), or a pharmaceutically acceptable salt thereof.In some embodiments, the present disclosure provides a compound having the following structure:9180953055. v3767972: SA9-884PC / PAT24230-WO-PCT(Compound 53), or a pharmaceutically acceptable salt thereof.In some embodiments, the present disclosure provides a compound having the following structure:(Compound 54), or a pharmaceutically acceptable salt thereof.In some embodiments, the present disclosure provides a compound having the following structure:(Compound 55), or a pharmaceutically acceptable salt thereof.In some embodiments, the present disclosure provides a compound having the following structure:(Compound 56), or a pharmaceutically acceptable salt thereof.III. Two-Tailed Helper LipidsThe present disclosure further provides a helper lipid that is a compound having a structure according to Formula (V):9280953055. v3767972: SA9-884PC / PAT24230-WO-PCT(V), or a pharmaceutically acceptable salt thereof, wherein:X is -C(i-6)alkylene-, -C(2-6)alkenylene-, -OC(i-6)alkylene-, -OC(2-6)alkenylene-, - OC(O)C(i-6)alkylene-, -OC(O)C(2-6)alkenylene-, -NHC(0)C(i-6)alkylene-, -NHC(0)C(2- 6)alkenylene-, or -C(i-6)alkylene-O-C(i-6)alkylene-;Y is -C(2-6)alkylene- or -C(2-6)alkenylene-, each of which is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, - C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, - N(R”)2, -SR” and -SO2R”;R1Aand R1Bare each independently selected from hydrogen and -C(i-io)alkyl, wherein the -C(i-io)alkyl is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, - OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, -N(R”)2, -SR” and -SO2R”; orR1Aand R1Bare taken together with the nitrogen to which they are attached to form a 4-10-membered heterocyclic group that is optionally substituted with one, two, or three -C(i- 6)alkyl groups;R1Cis absent or R1Cis -C(i-io)alkyl that is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, - C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, -N(R”)2, - SR” and -SO2R”, wherein when R1Cis present, the nitrogen to which R1Cis bonded bears a positive charge; orRIARIB,ancjRicare takentogether with the nitrogen to which they are attached to form a 5-11-membered heterocyclic group that is optionally substituted with one, two, or three -C(i-6)alkyl groups, wherein the nitrogen to which R1A, R1B, and R1Care bonded bears a positive charge; each R3is independently selected from the group consisting of:(i) -C(9-25)alkyl, -C(9-25)alkenyl or -C(9-25)alkynyl, each of which is optionally substituted with one, two, or three substituents independently selected from the group9380953055. v3767972: SA9-884PC / PAT24230-WO-PCT consisting of halogen, -C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, - OC(O)OR”, -NH2, -NHR”, -N(R”)2, -SR” or -SO2R”;wherein: each R3Ais independently -C(i-3i)alkyl, -C(2-3i)alkenyl, or -C(2-3i)alkynyl, each of which is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, - OC(O)R”, -OC(O)OR”, -NH2, -NHR”, -N(R”)2, -SR” and -SO2R”; and each ZA is independently -C(6-io)alkylene- or -C(7-io)alkenylene-, each of which is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, - OC(O)OR”, -NH2, -NHR”, -N(R”)2, -SR” and -SO2R”; and(iii), wherein: each R3Bis independently -C(i-3i)alkyl, -C(2-3i)alkenyl, or -C(2-3i)alkynyl, each of which is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(0)R”, -C(0)0H, -C(0)0R”, -CN, -OH, -OR”, - 0C(0)R”, -0C(0)0R”, -NH2, -NHR”, -N(R”)2, -SR” and -SO2R”; and each ZB is independently -C(6-io)alkylene- or -C(7-io)alkenylene-, each of which is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(0)R”, -C(0)0H, -C(0)0R”, -CN, -OH, -OR”, -0C(0)R”, - 0C(0)0R”, -NH2, -NHR”, -N(R”)2, -SR” and -SO2R”; andR” is independently for each occurrence -C(i-2o)alkyl.In some embodiments, the present disclosure provides a compound having a structure according to Formula (V):(V), or a pharmaceutically acceptable salt thereof, wherein:9480953055. v3767972: SA9-884PC / PAT24230-WO-PCTX is -C(i-6)alkylene-, -OC(i-6)alkylene-, -NHC(O)C(i-6)alkylene-, or -C(i-6)alkylene-O- C(i-6)alkylene-;Y is -C(2-6)alkylene- or -C(2-6)alkenylene-, each of which is optionally substituted with one -C(O)OH group;R1Aand R1Bare each independently selected from hydrogen and -C(i-io)alkyl, wherein the -C(i-io)alkyl is optionally substituted with one -OH group; orR1Aand R1Bare taken together with the nitrogen to which they are attached to form a 4-10-membered heterocyclic group, that is optionally substituted with one -C(i-6)alkyl group;R1Cis absent or -C(i-io)alkyl, wherein when R1Cis present, the nitrogen to which R1Cis bonded bears a positive charge; orRIARIB,ancjRicare takentogether with the nitrogen to which they are attached to form a 5-11-membered heterocyclic group, that is optionally substituted with one -C(i-6)alkyl group, wherein the nitrogen to which R1A, R1B, and R1Care bonded bears a positive charge; each R3is independently selected from the group consisting of:(i) -C(9-25)alkyl, -C(9-25)alkenyl or -C(9-25)alkynyl;wherein: each R3Ais independently -C(i-3i)alkyl, -C(2-3i)alkenyl, or -C(2-3i)alkynyl; and each ZA is independently -C(6-io)alkylene- or -C(7-io)alkenylene-; and(iii), wherein: each R3Bis independently -C(i-3i)alkyl, -C(2-3i)alkenyl, or -C(2-3i)alkynyl; and each ZB is independently -C(6-io)alkylene- or -C(7-io)alkenylene-.In some embodiments, the present disclosure provides a compound having a structure according to Formula (V):(V), or a pharmaceutically acceptable salt thereof, wherein:9580953055. v3767972: SA9-884PC / PAT24230-WO-PCTX is -C(i-6)alkylene-;Y is -C(2-6)alkylene-;R1Aand R1Bare each independently -C(i-5)alkyl that is optionally substituted with one -OH group; orR1Aand R1Bare taken together with the nitrogen to which they are attached to form a 4-10-membered heterocyclic group that is optionally substituted with one -C(i-6)alkyl group;R1Cis absent or R1Cis -C(i-5)alkyl, wherein when R1Cis present, the nitrogen to which R1Cis bonded bears a positive charge; orRIARIB,ancjRicare takentogether with the nitrogen to which they are attached to form a 5-11-membered heterocyclic group that is optionally substituted with one -C(i-6)alkyl group, wherein the nitrogen to which R1A, R1B, and R1Care bonded bears a positive charge; each R3is independently selected from the group consisting of:(i) -C(9-25)alkyl, -C(9-25)alkenyl or -C(9-25)alkynyl;each R3Ais independently -C(i-3i)alkyl, -C(2-3i)alkenyl, or -C(2-3i)alkynyl; and each ZA is independently -C(6-io)alkylene- or -C(7-io)alkenylene-; and(iii), wherein: each R3Bis independently -C(i-3i)alkyl, -C(2-3i)alkenyl, or -C(2-3i)alkynyl; and each ZB is independently -C(6-io)alkylene- or -C(7-io)alkenylene-.In some embodiments, the present disclosure provides a compound having a structure according to Formula (V):(V), or a pharmaceutically acceptable salt thereof, wherein:X is -C(i-6)alkylene-;Y is -C(2-6)alkylene-;9680953055. v3767972: SA9-884PC / PAT24230-WO-PCTR1Ais -C(i-5)alkyl;R1Bis -C(i-5)alkyl that is optionally substituted with one -OH group; orR1Aand R1Bare taken together with the nitrogen to which they are attached to form a 4-10-membered heterocyclic group that is optionally substituted with one -C(i-6)alkyl group;R1Cis absent or R1Cis -C(i-5)alkyl, wherein when R1Cis present, the nitrogen to which R1Cis bonded bears a positive charge; orRIARIB,ancjRicare takentogether with the nitrogen to which they are attached to form a 5-11-membered heterocyclic group that is optionally substituted with one -C(i-6)alkyl group, wherein the nitrogen to which R1A, R1B, and R1Care bonded bears a positive charge; each R3is independently -C(9-25)alkyl or -C(9-25)alkenyl.In some embodiments, the present disclosure provides a compound having a structure according to Formula (V):(V), or a pharmaceutically acceptable salt thereof, wherein:X is -C(i-6)alkylene-;Y is -C(2-6)alkylene-;R1Ais -C(i-5)alkyl;R1Bis -C(i-5)alkyl;R1Cis absent or R1Cis -C(i-5)alkyl, wherein when R1Cis present, the nitrogen to which R1Cis bonded bears a positive charge; each R3is independently -C(9-25)alkyl or -C(9-25)alkenyl.In some embodiments, X is -C(i-6)alkylene-. In some embodiments, X is -CH2-. In some embodiments, X is -(CH2)2-. In some embodiments, X is -(CH2)3-. In some embodiments, X is -(CH2)4-. In some embodiments, X is -(CH2)5-. In some embodiments, X is -(CH2)e-.In some embodiments, Y is -C(2-6)alkylene-. In some embodiments, Y is -(CH2)2-. In some embodiments, Y is -(CH2)3-. In some embodiments, Y is -(CH2)4-. In some embodiments, Y is -(CH2)5-. In some embodiments, Y is -(CH2)e-.9780953055. v3767972: SA9-884PC / PAT24230-WO-PCTIn some embodiments, R1Ais hydrogen.In some embodiments, R1Ais -C(i-io)alkyl. In some embodiments, R1Ais -C(i-5)alkyl.In some embodiments, R1Ais selected from the group consisting of hydrogen, -CH3, - CH2CH2OH, -(CH2)3OH, and -(CH2)4OH.In some embodiments, R1Ais selected from the group consisting of -CH3, - CH2CH2OH, -(CH2)3OH, and -(CJfc^OH. In some embodiments, R1Ais -CH3. In some embodiments, R1Ais -CH2CH2OH. In some embodiments, R1Ais -(CJ ^OH. In some embodiments, R1Ais -(CJfc^OH.In some embodiments, R1Bis hydrogen.In some embodiments, R1Bis -C(i-io)alkyl. In some embodiments, R1Bis -C(i-5)alkyl.In some embodiments, R1Bis selected from the group consisting of hydrogen, -CH3, - CH2CH2OH, -(CH2)3OH, and -(CH2)4OH.In some embodiments, R1Bis selected from the group consisting of -CH3, - CH2CH2OH, -(CH2)3OH, and -(CH2)4OH. In some embodiments, R1Bis -CH3. In some embodiments, R1Bis -CH2CH2OH. In some embodiments, R1Bis -(CJfc^OH. In some embodiments, R1Bis -(CH2)4OH.In some embodiments, R1Ais -C(i-5)alkyl, and R1Bis -C(i-5)alkyl.In some embodiments, R1Ais -CH3, and R1Bis -CH3.In some embodiments, R1Cis absent or R1Cis -C(i-io)alkyl, wherein when R1Cis present, the nitrogen to which R1Cis bonded bears a positive charge. In some embodiments, R1Cis absent or R1Cis -C(i-5)alkyl, wherein when R1Cis present, the nitrogen to which R1Cis bonded bears a positive charge. In some embodiments, R1Cis absent or R1Cis -CH3, wherein when R1Cis present, the nitrogen to which R1Cis bonded bears a positive charge.In some embodiments, R1Cis absent. When R1Cis absent, the nitrogen to which R1Aand R1Bare attached can interconvert between a protonated and unprotonated state:It is to be understood that when R1Cis absent, both the protonated and unprotonated form of the nitrogen atom are encompassed.When R1Cis present and the nitrogen to which it is attached bears a positive charge, it is to be understood that the positive charge on the nitrogen atom can be balanced by the presence of a counterion (i.e., a counteranion).9880953055. v3767972: SA9-884PC / PAT24230-WO-PCTIn some embodiments, R1Cis -C(i-io)alkyl, wherein the nitrogen to which R1Cis bonded bears a positive charge. In some embodiments, R1Cis -C(i-5)alkyl, wherein the nitrogen to which R1Cis bonded bears a positive charge. In some embodiments, R1Cis -CH3, wherein the nitrogen to which R1Cis bonded bears a positive charge.In some embodiments:(i) R1Ais hydrogen, R1Bis hydrogen, and R1Cis absent;(ii) R1Ais -C(i-5)alkyl, R1Bis -C(i-5)alkyl, and R1Cis absent;(iii) R1Ais -C(i-5)alkyl, R1Bis -C(i-5)alkyl, and R1Cis -C(i-5)alkyl;(iv) R1Ais -C(i-5)alkyl, R1Bis -C(i-5)alkyl substituted with one -OH group, and R1Cis absent;(v) R1Aand R1Bare taken together with the nitrogen to which they are attached to form a 4-10-membered heterocyclic group, and R1Cis absent;(vi) R1Aand R1Bare taken together with the nitrogen to which they are attached to form a 4-10-membered heterocyclic group, and R1Cis -C(i-5)alkyl; or(vii) R1A, R1B, and R1Care taken together with the nitrogen to which they are attached to form a 5-11 -membered heterocyclic group.In some embodiments:(i) R1Ais hydrogen, R1Bis hydrogen, and R1Cis absent;(ii) R1Ais -CH3, R1Bis -CH3, and R1Cis absent;(iii) R1Ais -CH3, R1Bis -CH3, and R1Cis -CH3;(iv) R1Ais -CH3, R1Bis -CH2CH2OH, and R1Cis absent;(v) R1Ais -CH3, R1Bis -(CH2)3OH, and R1Cis absent; or(vi) R1Ais -CH3, R1Bis -(CH2)4OH, and R1Cis absent.In some embodiments:(i) R1Ais -CH3, R1Bis -CH3, and R1Cis absent;(ii) R1Ais -CH3, R1Bis -CH3, and R1Cis -CH3;(iii) R1Ais -CH3, R1Bis -CH2CH2OH, and R1Cis absent;(iv) R1Ais -CH3, R1Bis -(CH2)3OH, and R1Cis absent; or(v) R1Ais -CH3, R1Bis -(CH2)4OH, and R1Cis absent.In some embodiments, R1A, R1B, and R1Ctogether with the nitrogen to which they are attached form a group selected from:9980953055. v3767972: SA9-884PC / PAT24230-WO-PCTwherein RNis hydrogen or -C(i-6)alkyl.In some embodiments, R1A, R1B, and R1Ctogether with the nitrogen to which they are attached form a group selected from:wherein RNis hydrogen or -C(i-6)alkyl.In some embodiments, R1A, R1B, and R1Ctogether with the nitrogen to which they are attached form a group selected from:wherein RNis hydrogen or -C(i-6)alkyl. In some embodiments, R1A, R1B, and R1Ctogether with the nitrogen to which they are attached form a group selected from:10080953055. v3767972: SA9-884PC / PAT24230-WO-PCTIn some embodiments, R1A, together with the nitrogen to which they are attached form the following group:In some embodiments, each R3is independently -C(9-25)alkyl, -C(9-25)alkenyl or -C(9-25)alkynyl. In some embodiments, each R3is independently -C(9-25)alkyl or -C(9-25)alkenyl. In some embodiments, each R3is -C(9-25)alkyl. In some embodiments, each R3is -C(9-25)alkenyl In some embodiments, each R3is -C(9-25)alkynyl.In some embodiments, each R3is -C(9)alkyl. In some embodiments, each R3is - C(io)alkyl. In some embodiments, each R3is -Cppalkyl. In some embodiments, each R3is -C(i2)alkyl. In some embodiments, each R3is -C(i3)alkyl. In some embodiments, each R3is -C(i4)alkyl. In some embodiments, each R3is -C(i5)alkyl. In some embodiments, each R3is -C(i6)alkyl. In some embodiments, each R3is -C(i7)alkyl. In some embodiments, each R3is -C(i8)alkyl. In some embodiments, each R3is -C(i9)alkyl. In some embodiments, each R3is -C(20)alkyl. In some embodiments, each R3is -C(2i)alkyl. In some embodiments, each R3is -C(22)alkyl. In some embodiments, each R3is -C(23)alkyl. In some embodiments, each R3is -C(24)alkyl. In some embodiments, each R3is -C(25)alkyl.In some embodiments, each R3is -C(9)alkenyl. In some embodiments, each R3is - C(io)alkenyl. In some embodiments, each R3is - ipalkenyl. In some embodiments, each R3is -C(i2)alkenyl. In some embodiments, each R3is -C(i3)alkenyl. In some embodiments, each R3is -C(i4)alkenyl. In some embodiments, each R3is -C(i5)alkenyl. In some embodiments, each R3is -C(i6)alkenyl. In some embodiments, each R3is -C(i7)alkenyl. In some embodiments, each R3is -C(is)alkenyl. In some embodiments, each R3is -C(i9)alkenyl. In some embodiments, each R3is -C(20)alkenyl. In some embodiments, each R3is -C(2i)alkenyl. In some embodiments, each R3is -C(22)alkenyl. In some embodiments, each R3is - C(23)alkenyl. In some embodiments, each R3is -C(24)alkenyl. In some embodiments, each R3is -C(25)alkenyl.In some embodiments, each R3isIn some embodiments, each R3isIn some embodiments, each R3isIn some embodiments, each R3isIn some embodiments, each R3isIn some embodiments, each R3is10180953055. v3767972: SA9-884PC / PAT24230-WO-PCTIn some embodiments, each R3isOIn some embodiments, each R3is independently, wherein each R3Ais independently -C(i-3i)alkyl, -C(2-3i)alkenyl, or -C(2-3i)alkynyl; and each ZA is independently -C(6-io)alkylene- or -C(7-io)alkenylene-.OIn some embodiments, each R3is independently, wherein each R3Ais independently -C(i-3i)alkyl or -C(2-3i)alkenyl; and each ZA is independently -C(6-io)alkylene- or -C(7-io)alkenylene-.OIn some embodiments, each R3is independently, wherein each R3Ais -C(i-3i)alkyl; and each ZA is -C(6-io)alkylene-.In some embodiments, each R3is independently 0 , wherein each R3Bis independently -C(i-3i)alkyl, -C(2-3i)alkenyl, or -C(2-3i)alkynyl; and each ZB is independently -C(6-io)alkylene- or -C(7-io)alkenylene-._ ZgjR3BIn some embodiments, each R3is independently 0 , wherein each R3Bis independently -C(i-3i)alkyl or -C(2-3i)alkenyl; and each ZB is independently -C(6-io)alkylene- or -C(7-io)alkenylene-.In some embodiments, each R3is independently 0 , wherein each R3Bis -C(i-3i)alkyl; and each ZB is -C(6-io)alkylene-.OIn some embodiments, each R3isIn some embodiments, each R3is OIn some embodiments, each R3is OIn some embodiments, each R3is O10280953055. v3767972: SA9-884PC / PAT24230-WO-PCTOIn some embodiments, each R3isIn some embodiments, each R3isIn some embodiments, each R3isIn some embodiments, each R3isIn some embodiments, the present disclosure provides a compound having the following structure:(Compound 37), or a pharmaceutically acceptable salt thereof.IV. Lipid Nanoparticles CompositionsThe present disclosure also provides a composition comprising a lipid nanoparticle (LNP), wherein the LNP comprises a helper lipid of the present disclosure (e.g., a lipid of Formula I’, I, II’, II”, II, Il-a, Il-b, IIP, III”, III, IILa, Ill-b, IILc, IILd, IV’, IV”, IV, IV-a, IV- b, or V) and an ionizable or cationic lipid.In some embodiments, the LNP further comprises at least one of a structural lipid or a stealth lipid. In some embodiments, the LNP comprises a helper lipid of the present disclosure, an ionizable or cationic lipid, and a structural lipid. In some embodiments, the LNP comprises a helper lipid of the present disclosure, an ionizable or cationic lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of the present disclosure, an ionizable or cationic lipid, a structural lipid, and a stealth lipid.10380953055. v3767972: SA9-884PC / PAT24230-WO-PCTA. lonizable / Cationic LipidsAn ionizable lipid facilitates mRNA encapsulation and may be a cationic lipid. A cationic lipid affords a positively charged environment at low pH to facilitate efficient encapsulation of the negatively charged mRNA drug substance.In some embodiments, the cationic lipid has a structure according to Formula CAT-I:(CAT-I), or a pharmaceutically acceptable salt thereof, wherein: p is an integer of between 1 and 9, inclusive; each instance of R2is independently hydrogen or optionally substituted Ci-6 alkyl; each instance of L is independently an optionally substituted alkylene, optionally substituted alkenylene, optionally substituted alkynylene, optionally substituted heteroalkylene, optionally substituted heteroalkenylene, optionally substituted heteroalkynylene, optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, or optionally substituted heteroarylene, or combination thereof; each instance of R6and R7is independently a group of formula (i), (ii), or (iii);Formulae (i), (ii), and (iii) are:10480953055. v3767972: SA9-884PC / PAT24230-WO-PCT wherein: each instance of R' is independently hydrogen or optionally substituted alkyl;X is O, S, or NRX, wherein Rxis hydrogen, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, or a nitrogen protecting group;Y is O, S, or NRY, wherein RYis hydrogen, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, or a nitrogen protecting group;Rpis hydrogen, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, an oxygen protecting group when attached to an oxygen atom, a sulfur protecting group when attached to a sulfur atom, or a nitrogen protecting group when attached to a nitrogen atom; andRLis optionally substituted C1.50 alkyl, optionally substituted C2-50 alkenyl, optionally substituted C2-50 alkynyl, optionally substituted heteroCi.50 alkyl, optionally substituted heteroC2-5o alkenyl, optionally substituted heteroC2-so alkynyl, or a polymer.In certain embodiments of the lipid of Formula CAT-I, a group of formula (i) represents a group of formula (i-a) or a group of formula (i-b):wherein each variable is independently as defined above and described herein. In some embodiments of the lipid of Formula CAT-I, a group of formula (i) is a group of formula (i-a). In some embodiments of the lipid of Formula CAT-I, a group of formula (i) is a group of formula (i-b).In some embodiments of the lipid of Formula CAT-I, each of R6and R7is independently a group of formula (i). In some embodiments of the lipid of Formula CAT-I, each of R6and R7is independently a group of formula (ii). In some embodiments of the lipid10580953055. v3767972: SA9-884PC / PAT24230-WO-PCT of Formula CAT-I, each of R6and R7is independently a group of formula (iii). In some embodiments of the lipid of Formula CAT-I, each of R6and R7is independently a group of formula (i-a). In some embodiments of the lipid of Formula CAT-I, each of R6and R7is independently a group of formula (i-b).In some embodiments of the lipid of Formula CAT-I, each instance of R' is hydrogen.In some embodiments of the lipid of Formula CAT-I, L is an optionally substituted alkylene.As generally defined above with respec to the lipid of Formula CAT-I, p is an integer of between 1 and 9, inclusive. In certain embodiments of the lipid of Formula CAT-I, p is 1. In certain embodiments of the lipid of Formula CAT-I, p is 2. In certain embodiments of the lipid of Formula CAT-I, p is 3. In certain embodiments of the lipid of Formula CAT-I, p is 4. In certain embodiments of the lipid of Formula CAT-I, p is 5. In certain embodiments of the lipid of Formula CAT-I, p is 6. In certain embodiments of the lipid of Formula CAT-I, p is 7. In certain embodiments of the lipid of Formula CAT-I, p is 8. In certain embodiments of the lipid of Formula CAT-I, p is 9.In some embodiments of the lipid of Formula CAT-I, the lipid has a structure according to Formula CAT-Ia:or a pharmaceutically acceptable salt thereof, wherein each variable is independently as defined above and described herein.In certain embodiments of the lipid of Formula CAT-I, L is an optionally substituted alkylene; e.g., optionally substituted Ci-soalkylene, optionally substituted Ci-4oalkylene, optionally substituted Ci-3oalkylene, optionally substituted Ci-2oalkylene, optionally substituted C4-2oalkylene, optionally substituted Ce-2oalkylene, optionally substituted Cs- 2oalkylene, optionally substituted Cio-2oalkylene, optionally substituted Ci-ealkylene, optionally substituted C2-ealkylene, optionally substituted C .alkylene, optionally substituted C4-ealkylene, optionally substituted C4-5alkylene, or optionally substituted C3-4alkylene. In some embodiments of the lipid of Formula CAT-I, L is optionally substituted Ci alkylene. In10680953055. v3767972: SA9-884PC / PAT24230-WO-PCT some embodiments of the lipid of Formula CAT-I, L is optionally substituted C2 alkylene. In some embodiments of the lipid of Formula CAT-I, L is optionally substituted C3 alkylene. In some embodiments of the lipid of Formula CAT-I, L is optionally substituted C4 alkylene. In some embodiments of the lipid of Formula CAT-I, L is optionally substituted C5 alkylene. In some embodiments of the lipid of Formula CAT-I, L is optionally substituted Ce alkylene. In some embodiments of the lipid of Formula CAT-I, L is optionally substituted C7 alkylene. In some embodiments of the lipid of Formula CAT-I, L is optionally substituted C8alkylene. In some embodiments of the lipid of Formula CAT-I, L is — CH2 — . In some embodiments of the lipid of Formula CAT-I, L is — (CH2)2 — . In some embodiments of the lipid of Formula CAT-I, L is — (CH2)3 — . In some embodiments of the lipid of Formula CAT-I, L is — (CH2)4 — . In some embodiments of the lipid of Formula CAT-I, L is — (CH2)5 — . In some embodiments of the lipid of Formula CAT-I, L is — (CH2)e — . In some embodiments of the lipid of Formula CAT-I, L is — (CFF)? — . In some embodiments of the lipid of Formula CAT-I, L is — (CH2)8— .In certain embodiments of the lipid of Formula CAT-I, L is an optionally substituted alkenylene, e.g., optionally substituted C2-5oalkenylene, optionally substituted C2- 4oalkenylene, optionally substituted C2-3oalkenylene, optionally substituted C2-2oalkenylene, optionally substituted C4-2oalkenylene, optionally substituted Ce-2oalkenylene, optionally substituted Cx-2oalkenylene, optionally substituted Cio-2oalkenylene, optionally substituted C2- ealkenylene, optionally substituted C3-6alkenylene, optionally substituted C4-ealkenylene, optionally substituted C4-5alkenylene, or optionally substituted C3-4alkenylene.In certain embodiments of the lipid of Formula CAT-I, L is an optionally substituted alkynylene, e.g., optionally substituted C2-5oalkynylene, optionally substituted C2- 4oalkynylene, optionally substituted C2-3oalkynylene, optionally substituted C2-2oalkynylene, optionally substituted C4-2oalkynylene, optionally substituted Ce-2oalkynylene, optionally substituted C8-2oalkynylene, optionally substituted Cio-2oalkynylene, optionally substituted C2- ealkynylene, optionally substituted C3-6alkynylene, optionally substituted C4-ealkynylene, optionally substituted C4-5alkynylene, or optionally substituted C3-4alkynylene.In certain embodiments of the lipid of Formula CAT-I, L is an optionally substituted heteroalkylene; e.g., optionally substituted heteroCi-soalkylene, optionally substituted heteroCi-4oalkylene, optionally substituted heteroCi-3oalkylene, optionally substituted heteroCi-2oalkylene, optionally substituted heteroC4-2oalkylene, optionally substituted heteroCe-2oalkylene, optionally substituted heteroC8-2oalkylene, optionally substituted heteroCi-2oalkylene, optionally substituted heteroCi-ealkylene, optionally substituted10780953055. v3767972: SA9-884PC / PAT24230-WO-PCT heteroC2-6alkylene, optionally substituted heteroC3-6-alkylene, optionally substituted heteroC4-ealkylene, optionally substituted heteroC4-salkylene, or optionally substituted heteroC3-4alkylene.In certain embodiments of the lipid of Formula CAT-I, L is an optionally substituted heteroalkenyl ene, e.g., optionally substituted heteroC2-5oalkenylene, optionally substituted heteroC2-4oalkenylene, optionally substituted heteroC2-3oalkenylene, optionally substituted heteroC2-2oalkenylene, optionally substituted heteroC4-2oalkenylene, optionally substituted heteroCe-2oalkenylene, optionally substituted heteroCs-2oalkenylene, optionally substituted heteroCio-2oalkenylene, optionally substituted heteroC2-ealkenylene, optionally substituted heteroCs-ealkenylene, optionally substituted heteroC4-ealkenylene, optionally substituted heteroC4-salkenylene, or optionally substituted heteroC3-4alkenylene.In certain embodiments of the lipid of Formula CAT-I, L is an optionally substituted heteroalkynylene, e.g., optionally substituted heteroC2-5oalkynylene, optionally substituted heteroC2-4oalkynylene, optionally substituted heteroC2-3oalkynylene, optionally substituted heteroC2-2oalkynylene, optionally substituted heteroC4-2oalkynylene, optionally substituted heteroCe-2oalkynylene, optionally substituted heteroCs-2oalkynylene, optionally substituted heteroCio-2oalkynylene, optionally substituted heteroC2-ealkynylene, optionally substituted heteroCs-ealkynylene, optionally substituted heteroC4-ealkynylene, optionally substituted heteroC4-salkynylene, or optionally substituted heteroC3-4alkynylene.In certain embodiments of the lipid of Formula CAT-I, L is an optionally substituted carb ocyclyl ene, e.g., optionally substituted C3-iocarbocyclylene, optionally substituted C5- scarbocyclylene, optionally substituted Cs-ecarbocyclylene, optionally substituted Cscarbocyclylene, or optionally substituted Cecarbocyclylene.In certain embodiments of the lipid of Formula CAT-I, L is an optionally substituted heterocyclylene, e.g., optionally substituted 3-14 membered heterocyclylene, optionally substituted 3-10 membered heterocyclylene, optionally substituted 5-8 membered heterocyclylene, optionally substituted 5-6 membered heterocyclylene, optionally substituted 5-membered heterocyclylene, or optionally substituted 6-membered heterocyclylene.In certain embodiments of the lipid of Formula CAT-I, L is an optionally substituted arylene, e.g., optionally substituted phenylene. In some embodiments, L is optionally substituted phenylene. In some embodiments, L is substituted phenylene. In some embodiments, L is unsubstituted phenylene.In certain embodiments of the lipid of Formula CAT-I, L is an optionally substituted heteroarylene, e.g., optionally substituted 5-14 membered heteroarylene, optionally10880953055. v3767972: SA9-884PC / PAT24230-WO-PCT substituted 5-10 membered heteroarylene, optionally substituted 5-6 membered heteroarylene, optionally substituted 5-membered heteroarylene, or optionally substituted 6- membered heteroarylene.In some embodiments of the lipid of Formula CAT-I, the lipid has a structure according to Formula CAT-Ib:or a pharmaceutically acceptable salt thereof, wherein each variable is independently as defined above and described herein, and wherein 1 is an integer between 1 and 10.In certain embodiments of the lipid of Formula CAT-Ib, q is an integer between 2 and 10, inclusive. In certain embodiments of the lipid of Formula CAT-Ib, q is an integer between 2 and 8, inclusive. In certain embodiments of the lipid of Formula CAT-Ib, q is an integer between 2 and 6, inclusive. In certain embodiments of the lipid of Formula CAT-Ib, q is 3 or 4. In certain embodiments of the lipid of Formula CAT-Ib, q is 1. In certain embodiments of the lipid of Formula CAT-Ib, q is 2. In certain embodiments of the lipid of Formula CAT-Ib, q is 3. In certain embodiments of the lipid of Formula CAT-Ib, q is 4. In certain embodiments of the lipid of Formula CAT-Ib, q is 5. In certain embodiments of the lipid of Formula CAT- Ib, q is 6. In certain embodiments of the lipid of Formula CAT-Ib, q is 7. In certain embodiments of the lipid of Formula CAT-Ib, q is 8.In some embodiments of the lipid of Formula CAT-I, R6is a group of formula (i). In some embodiments of the lipid of Formula CAT-I, R6is a group of formula (i-a). In some embodiments of the lipid of Formula CAT-I, R6is a group of formula (i-al ) :i-al).In some embodiments of the lipid of Formula CAT-I, R6is a group of formula (i-b). In some embodiments of the lipid of Formula CAT-I, R6is a group of formula (ii). In some embodiments of the lipid of Formula CAT-I, R6is a group of formula (iii).10980953055. v3767972: SA9-884PC / PAT24230-WO-PCTIn some embodiments of the lipid of Formula CAT-I, R7is a group of formula (i). In some embodiments of the lipid of Formula CAT-I, R7is a group of formula (i-a). In some embodiments of the lipid of Formula CAT-I, R7is a group of formula (i-al). In some embodiments of the lipid of Formula CAT-I, R7is a group of formula (i-b). In some embodiments of the lipid of Formula CAT-I, R7is a group of formula (ii). In some embodiments of the lipid of Formula CAT-I, R7is a group of formula (iii).In some embodiments of the lipid of Formula CAT-I, each instance of R6and R7is independently a group of the formula (i). In some embodiments of the lipid of Formula CAT- I, each instance of R6and R7is independently a group of the formula (i-a). In some embodiments of the lipid of Formula CAT-I, each instance of R6and R7is independently a group of the formula (i-b). In some embodiments of the lipid of Formula CAT-I, each instance of R6and R7is independently a group of the formula (ii). In some embodiments of the lipid of Formula CAT-I, each instance of R6and R7is independently a group of the formula (iii).In some embodiments of the lipid of Formula CAT-I, R6and R7are the same. In some embodiments of the lipid of Formula CAT-I, R6and R7are different.In some embodiments of the lipid of Formula CAT-I, R6and R7are the same group of formula (i-al):i-al), wherein RLis as defined above and described herein.In some embodiments of the lipid of Formula CAT-I, R6and R7are the same group of formulai-al), wherein RLis optionally substituted Ci-soalkyl, optionally substituted C2-soalkenyl, optionally substituted C2-soalkynyl, optionally substituted heteroCi-soalkyl, optionally substituted heteroC2-5oalkenyl, or optionally substituted heteroC2-5oalkynyl.In some embodiments of the lipid of Formula CAT-I, R6and R7are the same group of formula11080953055. v3767972: SA9-884PC / PAT24230-WO-PCTi-al), wherein R is optionally substituted Cs-25alkyl, optionally substituted Cs-25alkenyl, optionally substituted Cs-25alkynyl, optionally substituted heteroCs-25alkyl, optionally substituted heteroCs-25alkenyl, or optionally substituted heteroC5-25alkynyl.In some embodiments of the lipid of Formula CAT-I, R6and R7are the same group of formulai-al), wherein RLis optionally substituted Cs-isalkyl, optionally substituted Cs-isalkenyl, optionally substituted Cs-isalkynyl, optionally substituted heteroCs-isalkyl, optionally substituted heteroCs-isalkenyl, or optionally substituted heteroCs-isalkynyl.In some embodiments of the lipid of Formula CAT-I, R6and R7are the same group of formulai-al), wherein RLis optionally substituted Ci-soalkyl.In some embodiments of the lipid of Formula CAT-I, R6and R7are the same group of formulai-al), wherein RLis optionally substituted Cs-25alkyl.In some embodiments of the lipid of Formula CAT-I, R6and R7are the same group of formulai-al), wherein RLis optionally substituted Cs-2oalkyl.11180953055. v3767972: SA9-884PC / PAT24230-WO-PCTIn some embodiments of the lipid of Formula CAT-I, R6and R7are the same group of formulai-al), wherein RLis optionally substituted Cs-isalkyl.In some embodiments of the lipid of Formula CAT-I, R2is hydrogen. In some embodiments of the lipid of Formula CAT-I, at least one instance of R2is hydrogen. In some embodiments of the lipid of Formula CAT-I, each instance of R2is hydrogen.In certain embodiments of the lipid of Formula CAT-I, R2is optionally substituted Ci- ealkyl, optionally substituted C2-ealkyl, optionally substituted Cs-ealkyl, optionally substituted C4-ealkyl, optionally substituted C4-salkyl, or optionally substituted C3-4alkyl. In certain embodiments of the lipid of Formula CAT-I, at least one instance of R2is optionally substituted Ci-ealkyl.As generally defined above with respect to the lipid of Formula CAT-I, each instance of R' is independently hydrogen or optionally substituted alkyl. In some embodiments of the lipid of Formula CAT-I, R' is hydrogen. In some embodiments of the lipid of Formula CAT- I, R' is substituted alkyl. In certain embodiments of the lipid of Formula CAT-I, at least one instance of R' is hydrogen. In certain embodiments of the lipid of Formula CAT-I, at least two instances of R' are hydrogen. In certain embodiments of the lipid of Formula CAT-I, each instance of R' is hydrogen. In certain embodiments of the lipid of Formula CAT-I, at least one instance of R' is optionally substituted alkyl, e.g., methyl. In certain embodiments of the lipid of Formula CAT-I, at least two instances of R' are optionally substituted alkyl, e.g., methyl. In some embodiments of the lipid of Formula CAT-I, at least one instance of R' is hydrogen, and at least one instance of R' is optionally substituted alkyl. In certain embodiments of the lipid of Formula CAT-I, one instance of R' is optionally substituted alkyl, and the rest are hydrogen.As generally defined above with respect to the lipid of Formula CAT-I, X is O, S, or NRX. In some embodiments of the lipid of Formula CAT-I, X is O. In some embodiments of the lipid of Formula CAT-I, X is S. In some embodiments of the lipid of Formula CAT-I, X is NRX, wherein Rxis as defined above and described herein.As generally defined above with respect to the lipid of Formula CAT-I, Rxis hydrogen, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted11280953055. v3767972: SA9-884PC / PAT24230-WO-PCT alkynyl, optionally substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, or a nitrogen protecting group. In some embodiments of the lipid of Formula CAT -I, Rxis hydrogen. In some embodiments of the lipid of Formula CAT-I, Rxis optionally substituted alkyl. In some embodiments of the lipid of Formula CAT-I, Rxis optionally substituted alkenyl. In some embodiments of the lipid of Formula CAT-I, Rxis optionally substituted alkynyl. In some embodiments of the lipid of Formula CAT-I, Rxis optionally substituted carbocyclyl. In some embodiments of the lipid of Formula CAT-I, Rxis optionally substituted heterocyclyl. In some embodiments of the lipid of Formula CAT-I, Rxis optionally substituted aryl. In some embodiments of the lipid of Formula CAT-I, Rxis optionally substituted heteroaryl. In some embodiments of the lipid of Formula CAT-I, Rxis a nitrogen protecting group.As generally defined above with respect to the lipid of Formula CAT-I, Y is O, S, or NRY. In some embodiments of the lipid of Formula CAT-I, Y is O. In some embodiments of the lipid of Formula CAT-I, Y is S. In some embodiments of the lipid of Formula CAT-I, Y is NRY, wherein RYis as defined above and described herein.As generally defined above with respect to the lipid of Formula CAT-I, RYis hydrogen, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, or a nitrogen protecting group. In some embodiments of the lipid of Formula CAT-I, RYis hydrogen. In some embodiments of the lipid of Formula CAT-I, RYis optionally substituted alkyl. In some embodiments of the lipid of Formula CAT-I, RYis optionally substituted alkenyl. In some embodiments of the lipid of Formula CAT-I, RYis optionally substituted alkynyl. In some embodiments of the lipid of Formula CAT-I, RYis optionally substituted carbocyclyl. In some embodiments of the lipid of Formula CAT-I, RYis optionally substituted heterocyclyl. In some embodiments of the lipid of Formula CAT-I, RYis optionally substituted aryl. In some embodiments of the lipid of Formula CAT-I, RYis optionally substituted heteroaryl. In some embodiments of the lipid of Formula CAT-I, RYis a nitrogen protecting group.As generally defined above with respect to the lipid of Formula CAT-I, Rpis hydrogen, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, optionally substituted heteroaryl, an oxygen protecting group when attached to an oxygen atom, a sulfur protecting group when attached to a sulfur atom, or a nitrogen protecting group when attached to a nitrogen atom. In some embodiments of the lipid of11380953055. v3767972: SA9-884PC / PAT24230-WO-PCTFormula CAT-I, Rpis hydrogen. In some embodiments of the lipid of Formula CAT-I, Rpis optionally substituted alkyl. In some embodiments of the lipid of Formula CAT-I, Rpis optionally substituted alkenyl. In some embodiments of the lipid of Formula CAT-I, Rpis optionally substituted alkynyl. In some embodiments of the lipid of Formula CAT-I, Rpis optionally substituted carbocyclyl. In some embodiments of the lipid of Formula CAT-I, Rpis optionally substituted heterocyclyl. In some embodiments of the lipid of Formula CAT-I, Rpis optionally substituted aryl. In some embodiments of the lipid of Formula CAT-I, Rpis optionally substituted heteroaryl. In some embodiments of the lipid of Formula CAT-I, Rpis an oxygen protecting group when attached to an oxygen atom. In some embodiments of the lipid of Formula CAT-I, Rpis a sulfur protecting group when attached to a sulfur atom. In some embodiments of the lipid of Formula CAT-I, Rpis a nitrogen protecting group when attached to a nitrogen atom.As generally defined above with respect to the lipid of Formula CAT-I, RLis optionally substituted C1.50 alkyl, optionally substituted C2-50 alkenyl, optionally substituted C2-50 alkynyl, optionally substituted heteroCi.50 alkyl, optionally substituted heteroC2- 50 alkenyl, optionally substituted heteroC2-so alkynyl, or a polymer.In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted Ci- 50 alkyl. In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted C2-30 alkyl. In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted C2-20 alkyl. In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted C2-15 alkyl. In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted C2-10 alkyl.In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted Ce- 50 alkyl. In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted Ce-30 alkyl. In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted Ce-20 alkyl. In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted Ce-15 alkyl. In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted Ce-10 alkyl.In some embodiments of the lipid of Formula CAT-I, for example, in any of the above embodiments, RLis a substituted alkyl group. In some embodiments of the lipid of Formula CAT-I, RLis an unsubstituted alkyl group. In some embodiments of the lipid of Formula CAT-I, RLis an optionally substituted straight-chain alkyl group. In some embodiments of the lipid of Formula CAT-I, RLis a substituted straight-chain alkyl group. In some embodiments of the lipid of Formula CAT-I, RLis an unsubstituted straight-chain alkyl11480953055. v3767972: SA9-884PC / PAT24230-WO-PCT group. In some embodiments of the lipid of Formula CAT-I, RLis an optionally substituted branched alkyl group. In some embodiments of the lipid of Formula CAT-I, RLis a substituted branched alkyl group. In some embodiments of the lipid of Formula CAT-I, RLis an unsubstituted branched alkyl group. In certain embodiments of the lipid of Formula CAT-I, at least one instance of RLis an unsubstituted alkyl. Exemplary unsubstituted alkyl groups include, but are not limited to, — CEE, — C2H5, — C3H7, — C4H9, — C5H11, — CeHi3, — C7H15, — CgHn, — C9H19, — C10H21, — C11H23, — C12H25, — C13H27, — C14H29, — C15H31, — C16H33, — C17H35, — C18H37, — C19H39, — C20H41 — C21H43, — C22H45, — C23H47, — C24H49, and — C25H51. In certain embodiments of the lipid of Formula CAT-I, at least one instance of RLis a substituted alkyl. For example, in certain embodiments of the lipid of Formula CAT-I, at least one instance of RLis an alkyl substituted with one or more fluorine substituents. Exemplary fluorinated alkyl groups include, but are not limited to:11580953055. v3767972: SA9-884PC / PAT24230-WO-PCTIn some embodiments of the lipid of Formula CAT-I, RLis optionally substituted C2-50 alkenyl. In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted11680953055. v3767972: SA9-884PC / PAT24230-WO-PCTC2-30 alkenyl. In some embodiments of the lipid of Formula CAT -I, RLis optionally substituted C2-20 alkenyl. In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted C2-18 alkenyl. In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted C2-15 alkenyl. In some embodiments of the lipid of Formula CAT- I, RLis optionally substituted C2-10 alkenyl.In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted Ce- 50 alkenyl. In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted Ce-30 alkenyl. In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted C6-20 alkenyl. In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted Ce-is alkenyl. In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted Ce-i5 alkenyl. In some embodiments of the lipid of Formula CAT- I, RLis optionally substituted Ce-io alkenyl.In some embodiments of the lipid of Formula CAT-I, for example, in any of the above embodiments, RLis a substituted alkyl group. In some embodiments of the lipid of Formula CAT-I, RLis an unsubstituted alkyl group. In some embodiments of the lipid of Formula CAT-I, RLis an optionally substituted straight-chain alkenyl group. In some embodiments of the lipid of Formula CAT-I, RLis a substituted straight-chain alkenyl group. In some embodiments of the lipid of Formula CAT-I, RLis an unsubstituted straight-chain alkenyl group. In some embodiments of the lipid of Formula CAT-I, RLis an optionally substituted branched alkenyl group. In some embodiments of the lipid of Formula CAT-I, RLis a substituted branched alkenyl group. In some embodiments of the lipid of Formula CAT-I, RLis an unsubstituted branched alkenyl group.Exemplary unsubstituted alkenyl group include, but are not limited to:11780953055. v3767972: SA9-884PC / PAT24230-WO-PCT. Myristoleic — (CH2)7CH=CH(CH2)CH3,. Palmitoliec — (CH2)7CH=CH(CH2)5CH3,. Sapienic — (CH2)4CH=CH(CH2)8CH3, . Oleic — (C2)7CH=CH(CH2)7CH3,. Linoleic — (CH2)7CH=CHCH2CH=CH(CH2)4CH3.11880953055. v3767972: SA9-884PC / PAT24230-WO-PCT. a-Linolenic — (CH2)7CH=CHCH2CH=CHCH2CH=CHCH2CH3,• Arachinodonic —(CH2)3CH=CHCH2CH=CHCH2CH=CHCH2CH=CH(CH2)4CH3,• Eicosapentaenoic —(CH2)3CH=CHCH2CH=CHCH2CH=CHCH2CH=CHCH2CH=CHCH2CH3,. Erucic — (CH2)11CH=H(C(CH2)7CH3, and• Docosahexaenoic —(CH2)2CH=CHCH2CH=CHCH2CH=CHCH2CH=CHCH2CH=CHCH2CH=CH—CH2CH3.In some embodiments of the lipid of Formula CAT-I, wherein RLis defined as a Ce- soalkyl or Ce-soalkenyl groups, such groups are meant to encompass lipophilic groups (also referred to as a “lipid tail”). Lipophilic groups comprise a group of molecules that include fats, waxes, oils, fatty acids, and the like. Lipid tails present in these lipid groups can be saturated and unsaturated, depending on whether or not the lipid tail comprises double bonds. The lipid tail can also comprise different lengths, often categorized as medium (i.e., with tails between 7-12 carbons, e.g., C7-i2 alkyl or C7-i2alkenyl), long (i.e., with tails greater than 12 carbons and up to 22 carbons, e.g., Ci3.22alkyl or Ci3.22alkenyl), or very long (i.e., with tails greater than 22 carbons, e.g., C23.3o alkyl or C23.3o alkenyl).In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted C2. so alkynyl. In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted C2.3o alkynyl. In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted C2.2o alkynyl. In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted C2-15 alkynyl. In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted C2-10 alkynyl.In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted Ce- 50 alkynyl. In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted Ce-3o alkynyl. In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted Ce-2o alkynyl. In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted Ce-is alkynyl. In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted Ce-io alkynyl.In some embodiments of the lipid of Formula CAT-I, for example, in any of the above embodiments, RLis a substituted alkynyl group. In some embodiments of the lipid of Formula CAT-I, RLis an unsubstituted alkynyl group. In some embodiments of the lipid of Formula CAT-I, RLis an optionally substituted straight-chain alkynyl group. In some embodiments of11980953055. v3767972: SA9-884PC / PAT24230-WO-PCT the lipid of Formula CAT-I, RLis an optionally substituted straight-chain alkynyl group. In some embodiments of the lipid of Formula CAT-I, RLis a substituted straight-chain alkynyl group. In some embodiments of the lipid of Formula CAT-I, RLis an unsubstituted straightchain alkynyl group. In some embodiments of the lipid of Formula CAT-I, RLis an optionally substituted branched alkynyl group. In some embodiments of the lipid of Formula CAT-I, RLis a substituted branched alkynyl group. In some embodiments of the lipid of Formula CAT-I, RLis an unsubstituted branched alkynyl group.In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted heteroCi-soalkyl. In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted heteroC2-3oalkyl. In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted heteroC2-2oalkyl. In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted heteroC2-i5alkyl. In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted heteroC2-ioalkyl.In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted heteroCe-soalkyl. In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted heteroCe-soalkyl. In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted heteroCe-2oalkyl. In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted heteroCe-isalkyl. In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted heteroCe-ioalkyl.In some embodiments of the lipid of Formula CAT-I, for example, in any of the above embodiments, RLis a substituted heteroalkyl group. In some embodiments of the lipid of Formula CAT-I, RLis an unsubstituted heteroalkyl group. In some embodiments of the lipid of Formula CAT-I, RLis an optionally substituted straight-chain heteroalkyl group. In some embodiments of the lipid of Formula CAT-I, RLis a substituted straight-chain heteroalkyl group. In some embodiments of the lipid of Formula CAT-I, RLis an unsubstituted straightchain heteroalkyl group. In some embodiments of the lipid of Formula CAT-I, RLis an optionally substituted branched heteroalkyl group. In some embodiments of the lipid of Formula CAT-I, RLis a substituted branched heteroalkyl group. In some embodiments of the lipid of Formula CAT-I, RLis an unsubstituted branched heteroalkyl group.Exemplary unsubstituted heteroalkyl groups include, but are not limited to:12080953055. v3767972: SA9-884PC / PAT24230-WO-PCTIn some embodiments of the lipid of Formula CAT-I, RLis optionally substituted heteroC2-5oalkenyl. In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted heteroC2-3oalkenyl. In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted heteroC2-2oalkenyl. In some embodiments of the lipid of Formula CAT- I, RLis optionally substituted heteroC2-isalkenyl. In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted heteroC2-ioalkenyl.In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted heteroCe-soalkenyl. In some embodiments of the lipid of Formula CAT-I, RLis optionally12180953055. v3767972: SA9-884PC / PAT24230-WO-PCT substituted heteroCe-soalkenyl. In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted heteroCe-2oalkenyl. In some embodiments of the lipid of Formula CAT- I, RLis optionally substituted heteroCe-isalkenyl. In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted heteroCe-ioalkenyl.In some embodiments of the lipid of Formula CAT-I, for example, in any of the above embodiments, RLis a substituted heteroalkenyl group. In some embodiments of the lipid of Formula CAT-I, RLis an unsubstituted heteroalkenyl group. In some embodiments of the lipid of Formula CAT-I, RLis an optionally substituted straight-chain heteroalkenyl group. In some embodiments of the lipid of Formula CAT-I, RLis a substituted straight-chain heteroalkenyl group. In some embodiments of the lipid of Formula CAT-I, RLis an unsubstituted straight-chain heteroalkenyl group. In some embodiments of the lipid of Formula CAT-I, RLis an optionally substituted branched heteroalkenyl group. In some embodiments of the lipid of Formula CAT-I, RLis a substituted branched heteroalkenyl group. In some embodiments of the lipid of Formula CAT-I, RLis an unsubstituted branched heteroalkenyl group.In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted heteroC2-5oalkynyl. In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted heteroC2-3oalkynyl. In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted heteroC2-2oalkynyl. In some embodiments of the lipid of Formula CAT- I, RLis optionally substituted heteroC2-i5alkynyl. In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted heteroC2-ioalkynyl.In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted heteroCe-soalkynyl. In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted heteroCe-soalkynyl. In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted heteroCe-2oalkynyl. In some embodiments of the lipid of Formula CAT- I, RLis optionally substituted heteroCe-isalkynyl. In some embodiments of the lipid of Formula CAT-I, RLis optionally substituted heteroCe-ioalkynyl.In some embodiments of the lipid of Formula CAT-I, for example, in any of the above embodiments, RLis a substituted heteroalkynyl group. In some embodiments of the lipid of Formula CAT-I, RLis an unsubstituted heteroalkynyl group. In some embodiments of the lipid of Formula CAT-I, RLis an optionally substituted straight-chain heteroalkynyl group. In some embodiments of the lipid of Formula CAT-I, RLis a substituted straight-chain heteroalkynyl group. In some embodiments of the lipid of Formula CAT-I, RLis an unsubstituted straight-chain heteroalkynyl group. In some embodiments of the lipid of12280953055. v3767972: SA9-884PC / PAT24230-WO-PCTFormula CAT-I, RLis an optionally substituted branched heteroalkynyl group. In some embodiments of the lipid of Formula CAT-I, RLis a substituted branched heteroalkynyl group. In some embodiments of the lipid of Formula CAT-I, RLis an unsubstituted branched heteroalkynyl group.In some embodiments of the lipid of Formula CAT-I, RLis a polymer. As used herein, a “polymer”, in some embodiments, refers to a compound comprised of at least 3 (e.g., at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, etc.) repeating covalently bound structural units. The polymer is in certain embodiments biocompatible (i.e., non-toxic). Exemplary polymers include, but are not limited to, cellulose polymers (e.g., hydroxyethylcellulose, ethylcellulose, carboxymethylcellulose, methylc cellulose, hydroxypropylmethylcellulose (HPMC)), dextran polymers, polymaleic acid polymers, poly(acrylic acid) polymers, poly(vinylalcohol) polymers, polyvinylpyrrolidone (PVP) polymers, and polyethyleneglycol (PEG) polymers, and combinations thereof.In some embodiments of the lipid of Formula CAT-I, RLis a lipophilic, hydrophobic and / or non-polar group. In some embodiments of the lipid of Formula CAT-I, RLis a lipophilic group. In some embodiments of the lipid of Formula CAT-I, RLis a hydrophobic group. In some embodiments of the lipid of Formula CAT-I, RLis a non-polar group.In some embodiments of the lipid of Formula CAT-I, when an RLgroup is depicted as bisecting a carbon-carbon bond, e.g., of the formula (i), it is understood that RLmay be bonded to either carbon.Various combinations of the above embodiments of Formula CAT-I are contemplated herein.In some embodiments, the lipid of Formula CAT-I has a structure according toFormula CAT-Ic:12380953055. v3767972: SA9-884PC / PAT24230-WO-PCTwherein each of R2and RLis independently as defined above and described herein.In some embodiments, the lipid of Formula CAT-I has a structure according to Formula CAT-Id:wherein each of R2and RLis independently as defined above and described herein.In some embodiments of the lipid of Formula CAT-I, CAT-Ia, CAT-Ib, CAT-Ic, or CAT-Id, RLis Ci -20 alkyl or C2-20 alkenyl. In some embodiments of the lipid of Formula CAT- I, CAT-Ia, CAT-Ib, CAT-Ic, or CAT-Id, RLis C6-20 alkyl or C6-20 alkenyl. In some embodiments, the lipid of Formula CAT-I is cKK-ElO, having the following structure:12480953055. v3767972: SA9-884PC / PAT24230-WO-PCTIn some embodiments, the lipid of Formula CAT-I is OF-02, having the following structure:Additional examples of cationic lipids suitable for LNPs of the present disclosure are described in WO 2013063468, WO 2016205691, and WO 2013063468, each of which is incorporated by reference herein in its entirety.In some embodiments, the cationic lipid has a structure according to Formula CAT-II:(CAT-II), or a pharmaceutically acceptable salt thereof, wherein:A1is selected fromwherein the left hand side of each depicted structure is bound to the -(CH2)a-;Z1is selected from, wherein the right hand side of each depicted structure is bound to the -(CH2)a-;12580953055. v3767972: SA9-884PC / PAT24230-WO-PCTR1Aand R1Bare each independently selected from optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted acyl, and -WkxkY1; each W1is independently selected from optionally substituted alkyl and optionally substituted alkenyl; each X1is independently selected from -*O-(C=O)-optionally substituted alkyl, - (*C=O)-O-optionally substituted alkyl, -*O-(C=O)-optionally substituted alkenyl, and - (*C=O)-O-optionally substituted alkenyl, wherein the atom marked with a * is connected to W1, each Y1is independently selected from hydrogen, -*O-(C=O)-optionally substituted alkyl, -(*C=O)-O-optionally substituted alkyl, -*O-(C=O)-optionally substituted alkenyl, and -(*C=O)-O-optionally substituted alkenyl, wherein the atom marked with a * is connected to X1; b is 1, 2, 3, 4, or 5; and each a is independently selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10.In some embodiments, the lipid of Formula CAT-II has a structure according to Formula CAT-IIa:or a pharmaceutically acceptable salt thereof.In some embodiments, the lipid of Formula CAT-II has a structure according toFormula CAT-IIb:12680953055. v3767972: SA9-884PC / PAT24230-WO-PCT or a pharmaceutically acceptable salt thereof.In some embodiments, the lipid of Formula CAT-II has a structure according to Formula CAT-IIc:or a pharmaceutically acceptable salt thereof.In some embodiments of the lipid of Formula CAT-II, A1and Z1are the same. In some embodiments of the lipid of Formula CAT-II, A1and Z1are different.In some embodiments of the lipid of Formula CAT-II, A1iswherein the left hand side of the depicted structure is bound to the -(CH2)a-. In some embodiments of the O lipid of Formula CAT-II, A iswherein the left hand side of the depicted structure is bound to the -(CH2)a-. In some embodiments of the lipid of Formula CAT-II,A1iswherein the left hand side of the depicted structure is bound to the -(CH2)a-In some embodiments of the lipid of Formula CAT-II, Z1iswherein the right hand side of the depicted structure is bound to the -(CH2)a-. In some embodiments ofO the lipid of Formula CAT-II, Z1is, wherein the right hand side of the depicted structure is bound to the -(CH2)a-. In some embodiments of the lipid of Formula CAT-II,Z1iswherein the right hand side of the depicted structure is bound to the -(CH2)a-.12780953055. v3767972: SA9-884PC / PAT24230-WO-PCTIn some embodiments of the lipid of Formula CAT-II, A1iswherein the left hand side of the depicted structure is bound to the -(CH2)a-, and Z1iswherein the right hand side of the depicted structure is bound to the -(CH2)a-.In some embodiments of the lipid of Formula CAT-II, A1iswherein the left hand side of the depicted structure is bound to the -(CH2)a-, and Z1iswherein the right hand side of the depicted structure is bound to the -(CH2)a-.In some embodiments of the lipid of Formula CAT-II, A1iswherein the left hand side of the depicted structure is bound to the -(CH2)a-, and Z1iswherein the right hand side of the depicted structure is bound to the -(CH2)a-.In some embodiments of the lipid of Formula CAT-II, A1iswherein the left hand side of the depicted structure is bound to the -(CH2)a-, and Z1iswherein the right hand side of the depicted structure is bound to the -(CH2)a-.In some embodiments of the lipid of Formula CAT-II, A1iswherein the left hand side of the depicted structure is bound to the -(CH2)a-, and Z1iswherein the right hand side of the depicted structure is bound to the -(CH2)a-.In some embodiments of the lipid of Formula CAT-II, A1iswherein the left hand side of the depicted structure is bound to the -(CH2)a-, and Z1iswherein the right hand side of the depicted structure is bound to the -(CH2)a-.12880953055. v3767972: SA9-884PC / PAT24230-WO-PCTIn some embodiments of the lipid of Formula CAT-II, A1is, wherein theO left hand side of the depicted structure is bound to the -(CH2)a-, and Z1iswherein the right hand side of the depicted structure is bound to the -(CH2)a-.In some embodiments of the lipid of Formula CAT-II, A1is, wherein theO left hand side of the depicted structure is bound to the -(CH2)a-, and Z1iswherein the right hand side of the depicted structure is bound to the -(CH2)a-.In some embodiments of the lipid of Formula CAT-II, A1is, wherein the left hand side of the depicted structure is bound to the -(CH2)a-, and Z1iswherein the right hand side of the depicted structure is bound to the -(CH2)a-.In some embodiments of the lipid of Formula CAT-II, R1Aand R1Bare each independently selected from:12980953055. v3767972: SA9-884PC / PAT24230-WO-PCTIn some embodiments of the lipid of Formula CAT-II, each a is independently selected from 2, 3 and 4. In some embodiments of the lipid of Formula CAT-II, each a is the same. In some embodiments of the lipid of Formula CAT-II, each a is different.In some embodiments of the lipid of Formula CAT-II, R1Aand R1Bare -W^X^Y1.In some embodiments of the lipid of Formula CAT-II, W^X^Y1is defined as follows: each W1is independently selected from optionally substituted C1-20 alkyl and optionally substituted C2-20 alkenyl, each X1is independently selected from -*O-(C=O)- optionally substituted C1-20 alkyl, -(*C=O)-O-optionally substituted C1-20 alkyl, -*O-(C=O)- optionally substituted C2-20 alkenyl, and -(*C=O)-O-optionally substituted C2-20 alkenyl, wherein the atom marked with a * is connected to W1, each Y1is independently selected from hydrogen, -*O-(C=O)-optionally substituted C1-20 alkyl, -(*C=O)-O-optionally substituted Ci- 20 alkyl, -*O-(C=O)-optionally substituted C2-20 alkenyl, and -(*C=O)-O-optionally substituted C2-20 alkenyl, wherein the atom marked with a * is connected to X1.In some embodiments of the lipid of Formula CAT-II, - W^X^Y1; is defined as follows: each W1is independently selected from optionally substituted CA-B alkyl and optionally substituted CC-D alkenyl, each X1is independently selected from -*O-(C=O)- optionally substituted CA-B alkyl -(*C=O)-O-optionally substituted CA-B alkyl -*O-(C=O)- optionally substituted CC-D alkenyl and -(*C=O)-O-optionally substituted CC-D alkenyl wherein the atom marked with a * is connected to W1, each Y1is independently selected from hydrogen, -*O-(C=O)-optionally substituted CA-B alkyl, -(*C=O)-O-optionally substituted CA-B alkyl, -*O-(C=O)-optionally substituted CC-D alkenyl, and -(*C=O)-O-optionally substituted CC-D alkenyl, wherein the atom marked with a * is connected to X1.13080953055. v3767972: SA9-884PC / PAT24230-WO-PCTIn some embodiments of the lipid of Formula CAT-II, CA-B is C1-20 and CC-D is C2-20. In some embodiments CA-B is C1-15 and CC-D is C2-15. In some embodiments CA-B is C1-10 and CC-D is C2-10. In some embodiments CA-B is C3-15 and CC-D is C3-15. In some embodiments CA- B is C3-10 and CC-D is C3-10. In some embodiments CA-B is C3-8 and CC-D is C3-8.In some embodiments of the lipid of Formula CAT-II, R1Aand RIBare each independently selected from optionally substituted C5-50 alkyl, optionally substituted C5-50 alkenyl, optionally substituted C5-50 alkynyl, optionally substituted C5-50 acyl, and -W^X^Y1, wherein -W^X^Y1is as defined herein.In some embodiments of the lipid of Formula CAT-II, R1Aand RIBare each independently selected from optionally substituted C5-50 alkyl, optionally substituted C5-50 alkenyl, optionally substituted C5-50 alkynyl, and optionally substituted C5-50 acyl.In some embodiments of the lipid of Formula CAT-II, R1Aand RIBare each independently selected from optionally substituted C5-30 alkyl, optionally substituted C5-30 alkenyl, optionally substituted C5-30 alkynyl, optionally substituted C5-30 acyl and -W^X^Y1, wherein -W^X^Y1is as defined herein.In some embodiments of the lipid of Formula CAT-II, R1Aand RIBare each independently selected from optionally substituted C5-30 alkyl, optionally substituted C5-30 alkenyl, optionally substituted C5-30 alkynyl, and optionally substituted C5-30 acyl.In some embodiments of the lipid of Formula CAT-II, R1Aand RIBare each: independently selected from optionally substituted C5-20 alkyl, optionally substituted C5-20 alkenyl, optionally substituted C5-20 alkynyl, optionally substituted C5-20 acyl, and -W^X^Y1, wherein -W^X^Y1.In some embodiments of the lipid of Formula CAT-II, R1Aand RIBare each independently selected from optionally substituted C5-20 alkyl, optionally substituted C5-20 alkenyl, optionally substituted C5-20 alkynyl, and optionally substituted C5-20 acyl.In some embodiments of the lipid of Formula CAT-II, R1Aand RIBare each independently optionally substituted C5-50 alkyl. In some embodiments of the lipid of Formula CAT-II, R1Aand RIBare each independently optionally substituted C5-30 alkyl. In some embodiments of the lipid of Formula CAT-II, R1Aand RIBare each independently optionally substituted C5-20 alkyl. In some embodiments of the lipid of Formula CAT-II, R1Aand RIBare each independently optionally substituted C5-15 alkyl.In some embodiments of the lipid of Formula CAT-II, R1Aand RIBare each independently C5-50 alkyl. In some embodiments of the lipid of Formula CAT-II, R1Aand RIBare each independently C5-30 alkyl. In some embodiments of the lipid of Formula CAT-II, R1A13180953055. v3767972: SA9-884PC / PAT24230-WO-PCT and RIBare each independently C5-20 alkyl. In some embodiments of the lipid of Formula CAT-II, R1Aand RIBare each independently C5-15 alkyl.In some embodiments of the lipid of Formula CAT-II, R1Aand RIBare each independently optionally substituted C5-50 alkenyl. In some embodiments of the lipid of Formula CAT-II, R1Aand RIBare each independently optionally substituted C5-30 alkenyl. In some embodiments of the lipid of Formula CAT-II, R1Aand RIBare each independently optionally substituted C5-20 alkenyl. In some embodiments of the lipid of Formula CAT-II, R1Aand RIBare each independently optionally substituted C5-15 alkenyl.In some embodiments of the lipid of Formula CAT-II, R1Aand RIBare each independently C5-50 alkenyl. In some embodiments of the lipid of Formula CAT-II, R1Aand RIBare each independently C5-30 alkenyl. In some embodiments of the lipid of Formula CAT- II, R1Aand RIBare each independently C5-20 alkenyl. In some embodiments of the lipid of Formula CAT-II, R1Aand RIBare each independently C5-15 alkenyl.In some embodiments of the lipid of Formula CAT-II, R1Aand RIBare each independently optionally substituted C5-50 alkynyl. In some embodiments of the lipid of Formula CAT-II, R1Aand RIBare each independently optionally substituted C5-30 alkynyl. In some embodiments of the lipid of Formula CAT-II, R1Aand RIBare each independently optionally substituted C5-20 alkynyl. In some embodiments of the lipid of Formula CAT-II, R1Aand RIBare each independently optionally substituted C5-15 alkynyl.In some embodiments of the lipid of Formula CAT-II, R1Aand RIBare each independently C5-50 alkynyl. In some embodiments of the lipid of Formula CAT-II, R1Aand RIBare each independently C5-30 alkynyl. In some embodiments of the lipid of Formula CAT- II, R1Aand RIBare each independently C5-20 alkynyl. In some embodiments of the lipid of Formula CAT-II, R1Aand RIBare each independently C5-15 alkynyl.In some embodiments of the lipid of Formula CAT-II, R1Aand RIBare not optionally substituted. In some embodiments of the lipid of Formula CAT-II, each R1Ais the same. In some embodiments of the lipid of Formula CAT-II, each R1Ais different. In some embodiments of the lipid of Formula CAT-II, each RIBis the same. In some embodiments of the lipid of Formula CAT-II, each RIBis different. In some embodiments of the lipid of Formula CAT-II, R1Aand RIBare the same. In some embodiments of the lipid of Formula CAT-II, R1Aand R1Bare different.In some embodiments, the lipid of Formula CAT-II is GL-HEPES-E3-E10-DS-3-E18- 1 (2-(4-(2-((3-(Bis((Z)-2-hydroxyoctadec-9-en-l-13280953055. v3767972: SA9-884PC / PAT24230-WO-PCT yl )ami no)propyl )di sulfaneyl )ethyl )pi perazi n- 1 -yl )ethyl 4-(bis(2- hydroxydecyl)amino)butanoate), having the following structure:In some embodiments, the lipid of Formula CAT-II is 2-(4-(3-((4-(bis((Z)-2- hydroxyoctadec-9-en-l-yl)amino)butyl)disulfaneyl)propyl)piperazin-l-yl)ethyl 4-(bis(2- hydroxydecyl)amino)butanoate, having the following structure:In some embodiments, the lipid of Formula CAT-II is GL-HEPES-E3-E12-DS-4-E10 (2-(4-(2-((4-(bis(2-hydroxydecyl)amino)butyl)disulfaneyl)ethyl)piperazin-l-yl)ethyl 4-(bis(2- hydroxy dodecyl)amino)butanoate), having the following structure:In some embodiments, the lipid of Formula CAT-II is GL-HEPES-E3-E12-DS-3-E14 (2-(4-(2-((3-(Bis(2-hydroxytetradecyl)amino)propyl)disulfaneyl)ethyl)piperazin-l- yl)ethyl 4-(bis(2-hydroxydodecyl)amino)butanoate), having the following structure:13380953055. v3767972: SA9-884PC / PAT24230-WO-PCTIn some embodiments, the cationic lipid is CL-B (2-(4-(4-((4-(bis((Z)-2- hydroxyoctadec-9-en-l-yl)amino)butyl)disulfaneyl)butyl)piperazin-l-yl)ethyl 4-(bis(2- hydroxydodecyl)amino)butanoate), having the following structure:Additional examples of cationic lipids suitable for LNPs of the present disclosure are described in WO 2022221688, which is incorporated by reference herein in its entirety.Other cationic lipids that can be used include those described, for example, in WO 2016176330, WO 2017049245, and WO 2017075531.Accordingly, in some embodiments, the cationic lipid has a structure according to Formula CAT-III:(CAT-III), or a pharmaceutically acceptable salt thereof, wherein: oneSC(=O)-, -NRaC(=O)-, -C(=O)NRa-, -NRaC(=O)NRa-, -OC(=O)NRa- or -NRaC(=O)O-,13480953055. v3767972: SA9-884PC / PAT24230-WO-PCT and the other of L1or L2is -O(C=O)-, -(C=O)O-, -C(=O)-, -O-, -S(O)X-, -S-S-, -C(=O)S-, - SC(=O)-, -NRaC(=O)-, -C(=O)NRa-, -NRaC(=O)NRa-, -OC(=O)NRa- or -NRaC(=O)O- or a direct bond;G1and G2are each independently unsubstituted C1-C12 alkylene or C1-C12 alkenylene;G3is C1-C24 alkylene, C1-C24 alkenylene, C3-C8 cycloalkylene, C3-C8 cycloalkenylene;Rais H or C1-C12 alkyl;R1and R2are each independently C6-C24 alkyl or C6-C24 alkenyl;R3is H, OR5, CN, — C(=O)OR4, — OC(=O)R4or — NR5C(=O)R4;R4is C1-C12 alkyl;R5is H or Ci-Ce alkyl; and x is 0, 1 or 2.Accordingly, in some embodiments, the cationic lipid has a structure according to Formula CAT-IV:(CAT-IV), or a pharmaceutically acceptable salt thereof, wherein:Ri is selected from the group consisting of C5-30 alkyl, C5-20 alkenyl, -R*YR", -YR", and -R"M'R';R2 and R3 are independently selected from the group consisting of H, C1.14 alkyl, C2- 14 alkenyl, -R*YR", -YR", and -R*OR", or R2 and R3, together with the atom to which they are attached, form a heterocycle or carbocycle;R4 is selected from the group consisting of a C3-6 carbocycle, -(CH2)nQ, - (CH2)nCHQR, -CHQR, -CQ(R)2, and unsubstituted Ci-6 alkyl, where Q is selected from a carbocycle, heterocycle, -OR, -O(CH2)nN(R)2, -C(O)OR, -OC(O)R, -CX3, -CX2H, -CXH2, - CN, -N(R)2, -C(O)N(R)2, -N(R)C(O)R, -N(R)S(O)2R, -N(R)C(O)N(R)2, -N(R)C(S)N(R)2, - N(R)R8, -O(CH2)nOR, -N(R)C(=NR9)N(R)2, -N(R)C(=CHR9)N(R)2, -OC(O)N(R)2, - N(R)C(O)OR, -N(OR)C(O)R, -N(OR)S(O)2R, -N(OR)C(O)OR, -N(OR)C(O)N(R)2, - N(OR)C(S)N(R)2, -N(OR)C(=NR9)N(R)2, -N(OR)C(=CHR9)N(R)2, -C(=NR9)N(R)2, - C(=NR9)R, -C(O)N(R)OR, and -C(R)N(R)2C(O)OR, and each n is independently selected from 1, 2, 3, 4, and 5;13580953055. v3767972: SA9-884PC / PAT24230-WO-PCT each R5 is independently selected from the group consisting of C1.3 alkyl, C2-3 alkenyl, and H; each Re is independently selected from the group consisting of C1.3 alkyl, C2-3 alkenyl, and H;M and M' are independently selected from -C(O)O-, -OC(O)-, -C(O)N(R')-, - N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)2-, -S-S-, an aryl group, and a heteroaryl group;R7 is selected from the group consisting of C1.3 alkyl, C2-3 alkenyl, and H;Rs is selected from the group consisting of C3-6 carbocycle and heterocycle;R9is selected from the group consisting of H, CN, NO2, Ci-6 alkyl, -OR, -S(O)2R, - S(O)2N(R)2, C2-6 alkenyl, C3-6 carbocycle and heterocycle; each R is independently selected from the group consisting of C1.3 alkyl, C2-3 alkenyl, and H; each R' is independently selected from the group consisting of Ci-is alkyl, C2- 18 alkenyl, -R*YR", -YR", and H; each R" is independently selected from the group consisting of C3-14 alkyl and C3- 14 alkenyl; each R* is independently selected from the group consisting of C1.12 alkyl and C2- 12 alkenyl; each Y is independently a C3-6 carbocycle; each X is independently selected from the group consisting of F, Cl, Br, and I; and m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13.Further cationic lipids are described in WO2022 / 013439, which is incorporated herein by reference in its entirety.In some embodiments, the cationic lipid is MC3, having the following structure:In some embodiments, the cationic lipid is SM-102 (9-heptadecanyl 8-{(2- hydroxyethyl)[6-oxo-6-(undecyloxy)hexyl]amino}octanoate), having the following structure:13680953055. v3767972: SA9-884PC / PAT24230-WO-PCTIn some embodiments, the cationic lipid is ALC-0315 [(4- hydroxybutyl)azanediyl]di(hexane-6,l-diyl) bis(2 -hexyldecanoate), having the following structure:In some embodiments, the cationic lipid is cOm-EEl, having the following structure:In some embodiments, the cationic lipid is bis(3-(bis(2-hydroxydodecyl)amino)propyl) 2,2'-(methylazanediyl)diacetate, having the following structure:In some embodiments, the cationic lipid is bis(3-(bis(2-hydroxydodecyl)amino)propyl) 3 -hydroxy-3 -methylpentanedioate, having the following structure:In some embodiments, the cationic lipid is (2,5-dimethylpiperazine-l,4- diyl)bis(ethane-2,l-diyl) bis(5-(bis(2-hydroxydodecyl)amino)pentanoate), having the following structure:13780953055. v3767972: SA9-884PC / PAT24230-WO-PCTIn some embodiments, the cationic lipid is tris(5-(octanoyloxy)pentyl) 2-((3- (dimethylamino)propanoyl)oxy)propane-l,2,3-tricarboxylate, havinlg the following structure:In some embodiments, the cationic lipid may be selected from the group comprising CKK-E12; cKK-ElO; OF-02; [(6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl] 4- (dimethylamino)butanoate (D-Lin-MC3-DMA); 2,2-dilinoleyl-4-dimethylaminoethyl-[l,3]- di oxolane (DLin-KC2-DMA); l,2-dilinoleyloxy-N,N-dimethyl-3 -aminopropane (DLin- DMA); di((Z)-non-2-en-l-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319); 9-heptadecanyl 8-{(2-hydroxyethyl)[6-oxo-6-(undecyloxy)hexyl]amino}octanoate (SM-102); [(4-hydroxybutyl)azanediyl]di(hexane-6,l-diyl) bis(2-hexyldecanoate) (ALC-0315); [3- (dimethylamino)-2-[(Z)-octadec-9-enoyl]oxypropyl] (Z)-octadec-9-enoate (DODAP); 2,5- bis(3-aminopropylamino)-N-[2-[di(heptadecyl)amino]-2-oxoethyl]pentanamide (DOGS); [(3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-17-[(2R)-6-methylheptan-2-yl]- 2, 3, 4, 7, 8, 9,1 l,12,14,15,16,17-dodecahydro-lH-cyclopenta[a]phenanthren-3-yl] N-[2- (dimethylamino)ethyl]carbamate (DC-Chol); tetrakis(8-methylnonyl) 3,3 ',3", 3"'- (((methylazanediyl) bis(propane-3,l diyl))bis (azanetriyl))tetrapropionate (3060il0); decyl (2-(dioctylammonio)ethyl) phosphate (9A1P9); ethyl 5,5-di((Z)-heptadec-8-en-l-yl)-l-(3- (pyrrolidin-l-yl)propyl)-2,5-dihydro-lH-imidazole-2-carboxylate (A2-Iso5-2DC18); bis(2- (dodecyldi sulfanyl)ethyl) 3 , 3 '-((3 -methyl-9-oxo- 10-oxa- 13,14-dithia-3 , 6- diazahexacosyl)azanediyl)dipropionate (BAME-016B); 1,1 '-((2-(4-(2-((2-(bis(2-13880953055. v3767972: SA9-884PC / PAT24230-WO-PCT hydroxy dodecyl)amino)ethyl) (2-hydroxydodecyl)amino)ethyl) piperazin- 1 - yl)ethyl)azanediyl) bis(dodecan-2-ol) (C12-200); 3,6-bis(4-(bis(2- hydroxydodecyl)amino)butyl)piperazine-2, 5-dione (cKK-E12); hexa(octan-3-yl) 9, 9', 9", 9"', 9'"', 9"'"- ((((benzene-l,3,5-tricarbonyl)yris(azanediyl)) tris (propane-3,1 -diyl)) tris(azanetriyl))hexanonanoate (FTT5); (((3,6-dioxopiperazine-2,5-diyl)bis(butane-4, 1- diyl))bis(azanetriyl))tetrakis(ethane-2, 1 -diyl) (9Z,9'Z,9"Z,9'"Z, 12Z, 12'Z, 12"Z, 12"'Z)-tetrakis (octadeca-9,12-di enoate) (OF-Deg-Lin); TT3; N1,N3,N5-tris(3- (didodecylamino)propyl)benzene-l,3,5-tricarboxamide; Nl-[2-((lS)-l-[(3- aminopropyl)amino]-4-[di(3-aminopropyl)amino]butylcarboxamido)ethyl]-3,4-di[oleyloxy]- benzamide (MVL5); heptadecan-9-yl 8-((2-hydroxyethyl)(8-(nonyloxy)-8- oxooctyl)amino)octanoate (Lipid 5); GL-HEPES-E3-E10-DS-3-E18-1; GL-HEPES-E3-E12- DS-4-E10; GL-HEPES-E3-E12-DS-3-E14; and combinations thereof.In some embodiments, the cationic lipid is biodegradable.In some embodiments, the cationic lipid is not biodegradable.In some embodiments, the cationic lipid is cleavable.In some embodiments, the cationic lipid is not cleavable.Cationic lipids are described in further detail in Dong et al. (PNAS. 111(11):3955-60. 2014); Fenton et al. (Adv Mater. 28:2939. 2016); U.S. Pat. No. 9,512,073; U.S. Pat. No. 10,201,618; EP 22307007.9; EP 22307007.9; WO 2022 / 221688; WO 2022 / 066916; and WO 2022 / 0257716, each of which is incorporated herein by reference.B. Structural LipidsA structural lipid component provides stability to the lipid bilayer structure within the lipid nanoparticle. In some embodiments, the LNP comprises one or more structural lipid. In some embodiments, the structural lipid is a cholesterol-based lipid. Suitable cholesterol-based lipids include, for example: DC-Choi (N,N-dimethyl-N-ethylcarboxamidocholesterol), 1,4- bis(3-N-oleylamino-propyl)piperazine (Gao et al., Biochem Biophys Res Comm. (1991) 179:280; Wolf et al., BioTechniques (1997) 23: 139; U.S. Pat. 5,744,335), imidazole cholesterol ester (“ICE”; WO2011 / 068810), sitosterol (22,23 -dihydrostigmasterol), P- sitosterol, sitostanol, fucosterol, stigmasterol (stigmasta-5,22-dien-3-ol), ergosterol, desmosterol (3B-hydroxy-5,24-cholestadiene), lanosterol (8,24-lanostadien-3b-ol), 7- dehydrocholesterol (A5,7-cholesterol), dihydrolanosterol (24,25-dihydrolanosterol), zymosterol (5a-cholesta-8,24-dien-3B-ol), lathosterol (5a-cholest-7-en-3B-ol), diosgenin ((3p,25R)-spirost-5-en-3-ol), campesterol (campest-5-en-3B-ol), campestanol (5a-campestan-13980953055. v3767972: SA9-884PC / PAT24230-WO-PCT3b-ol), 24-methylene cholesterol (5,24(28)-cholestadien-24-methylen-3B-ol), cholesteryl margarate (cholest-5-en-3B-yl heptadecanoate), cholesteryl oleate, cholesteryl stearate and other modified forms of cholesterol.In some embodiments, the structural lipid is cholesterol.C. Stealth LipidsA stealth lipid component provides control over particle size and stability of the nanoparticle. The addition of such components may prevent complex aggregation and provide a means for increasing circulation lifetime and increasing the delivery of a lipidnucleic acid pharmaceutical composition to target tissues. Typically, the stealth lipid is a polyethylene glycol-conjugated (PEGylated) lipid. These components may be selected to rapidly exchange out of the pharmaceutical composition in vivo (see, e.g., U.S. Pat. 5,885,613).Contemplated PEGylated lipids include, but are not limited to, a polyethylene glycol (PEG) chain of up to 5 kDa in length covalently attached to a lipid with alkyl chain(s) of Ce- C20 (e.g., Cs, C10, C12, C14, Ci6, or Cis) length, such as a derivatized ceramide (e.g., N- octanoyl-sphingosine-l-[succinyl(m ethoxypoly ethylene glycol)] (C8 PEG ceramide)). In some embodiments, the PEGylated lipid is l,2-dimyristoyl-rac-glycero-3- methoxypolyethylene glycol (DMG-PEG); l,2-distearoyl-sn-glycero-3- phosphoethanolamine-polyethylene glycol (DSPE- PEG); l,2-dilauroyl-sn-glycero-3- phosphoethanolamine-poly ethylene glycol (DLPE-PEG); or 1,2-distearoyl-rac-glycero- polyethelene glycol (DSG-PEG).In some embodiments, the PEG has a high molecular weight, e.g., 2000-2400 g / mol. In some embodiments, the PEG is PEG2000 (or PEG-2K). In some embodiments, the PEGylated lipid is DMG-PEG2000, DSPE-PEG2000, DLPE-PEG2000, DSG-PEG2000, or C8 PEG2000. In some embodiments, the PEGylated lipid is dimyristoyl-PEG2000 (DMG- PEG2000).In some embodiments, the stealth lipid is a polyoxazoline polymer-conjugated lipid. Polyoxazoline polymer-conjugated lipids suitable for the LNP compositions of the present disclosure are described, for example, in WO2022 / 173667 and WO2023 / 031394.In some embodiments, the stealth lipid is a polysarcosine-conjugated (pSar) lipid. In some embodiment, the polysarcosine comprises 25-45 sarcosine units. In some embodiment, the polysarcosine comprises 25 sarcosine units. In some embodiment, the polysarcosine comprises 35 sarcosine units. In some embodiment, the polysarcosine comprises 45 sarcosine14080953055. v3767972: SA9-884PC / PAT24230-WO-PCT units. Nonlimiting examples of pSar lipids include N-tetradecyl-pSar25, N-hexadecyl- pSar25, N-octadecyl-pSar25, N-dodecyl-pSar25, l,2-dimyristoyl-sn-glycero-3-succinyl-N- polysarcosine-25 (DMG-pSar25), l,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N- polysarcosine-25 (18: 1 PE (DOPE) pSar25), N,N-ditetradecylamine-N- succinyl[methyl(polysarcosine)45], N,N-ditetradecylamine-N- succinyl[methyl(polysarcosine)35], and N,N-ditetradecyl-polysarcosine-25. Further examples of pSar lipids suitable for the LNP compositions of the present disclosure are described in W02020 / 070040.D. Further Helper LipidsIn some embodiments, the LNP further comprises an additional helper lipid such as l,2-dioleoyl-SN-glycero-3 -phosphoethanolamine (DOPE); l,2-distearoyl-sn-glycero-3- phosphocholine (DSPC); l,2-dioleoyl-sn-glycero-3-phospho-L-serine (DOPS); 1,2- dielaidoyl-sn-glycero-3 -phosphoethanolamine (DEPE); and l,2-dioleoyl-sn-glycero-3- phosphocholine (DPOC), dipalmitoylphosphatidylcholine (DPPC), 1,2-dilauroyl-sn-glycero- 3 -phosphocholine (DLPC), 1,2-Distearoylphosphatidylethanolamine (DSPE), or 1,2- dilauroyl-sn-glycero-3-phosphoethanolamine (DLPE). Helper lipids enhance the structural stability of the LNP and helps the LNP in endosomal escape. A helper lipid may improve uptake and release of an mRNA drug payload encapsulated in the LNP. In some embodiments, the helper lipid is a zwitterionic lipid. Without wishing to be bound by theory, the helper lipid can have fusogenic properties for enhancing uptake and release of the drug payload. Examples of helper lipids areFurther exemplary helper lipids include dioleoylphosphatidylcholine (DOPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-l- carboxylate (DOPE-mal), dipalmitoyl phosphatidyl ethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), phosphatidylserine, sphingolipids, cerebrosides, gangliosides, 16-0-monom ethyl PE, 16-O-dimethyl PE, 18-1-trans PE, l-stearoyl-2-oleoyl- phosphatidyethanolamine (SOPE), or a combination thereof.E. Combinations of Lipid Components and Molar RatiosIn some embodiments, the LNP comprises a helper lipid of the present disclosure, a cationic or ionizable lipid, and a structural lipid. In some embodiments, the LNP comprises a14180953055. v3767972: SA9-884PC / PAT24230-WO-PCT helper lipid of the present disclosure, a cationic or ionizable lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of the present disclosure, a cationic or ionizable lipid, a structural lipid, and a stealth lipid.In some embodiments, the LNP comprises a helper lipid of Formula (I’), a cationic or ionizable lipid, and a structural lipid. In some embodiments, the LNP comprises a helper lipid of Formula (I’), a cationic or ionizable lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (I’), a cationic or ionizable lipid, a structural lipid, and a stealth lipid.In some embodiments, the LNP comprises a helper lipid of Formula (I’), a cationic or ionizable lipid of Formula (CAT-I) or (CAT-II), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (I’), a cationic or ionizable lipid of Formula (CAT-I), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (I’), a cationic or ionizable lipid of Formula (CAT-II), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (I’); a cationic or ionizable lipid selected from cKK-ElO, OF-02, GL-HEPES-E3- E12-DS-4-E10, and CL-B; a structural lipid; and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (I’); a cationic or ionizable lipid selected from cKK-ElO, OF-02, GL-HEPES-E3-E12-DS-4-E10, and CL-B; a structural lipid that is cholesterol; and a stealth lipid that is DMG-PEG2000.In some embodiments, the LNP comprises a helper lipid of Formula (I), a cationic or ionizable lipid, and a structural lipid. In some embodiments, the LNP comprises a helper lipid of Formula (I), a cationic or ionizable lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (I), a cationic or ionizable lipid, a structural lipid, and a stealth lipid.In some embodiments, the LNP comprises a helper lipid of Formula (I), a cationic or ionizable lipid of Formula (CAT-I) or (CAT-II), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (I), a cationic or ionizable lipid of Formula (CAT-I), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (I), a cationic or ionizable lipid of Formula (CAT-II), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (I); a cationic or ionizable lipid selected from cKK-ElO, OF-02, GL-HEPES-E3- E12-DS-4-E10, and CL-B; a structural lipid; and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (I); a cationic or ionizable lipid selected from cKK-14280953055. v3767972: SA9-884PC / PAT24230-WO-PCTE10, OF-02, GL-HEPES-E3-E12-DS-4-E10, and CL-B; a structural lipid that is cholesterol; and a stealth lipid that is DMG-PEG2000.In some embodiments, the LNP comprises a helper lipid of Formula (IF), a cationic or ionizable lipid, and a structural lipid. In some embodiments, the LNP comprises a helper lipid of Formula (IF), a cationic or ionizable lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (IL), a cationic or ionizable lipid, a structural lipid, and a stealth lipid.In some embodiments, the LNP comprises a helper lipid of Formula (II’), a cationic or ionizable lipid of Formula (CAT-I) or (CAT-II), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (II’), a cationic or ionizable lipid of Formula (CAT-I), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (II’), a cationic or ionizable lipid of Formula (CAT-II), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (II’); a cationic or ionizable lipid selected from cKK-ElO, OF-02, GL-HEPES-E3- E12-DS-4-E10, and CL-B; a structural lipid; and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (II’); a cationic or ionizable lipid selected from cKK-ElO, OF-02, GL-HEPES-E3-E12-DS-4-E10, and CL-B; a structural lipid that is cholesterol; and a stealth lipid that is DMG-PEG2000.In some embodiments, the LNP comprises a helper lipid of Formula (II”), a cationic or ionizable lipid, and a structural lipid. In some embodiments, the LNP comprises a helper lipid of Formula (II”), a cationic or ionizable lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (II”), a cationic or ionizable lipid, a structural lipid, and a stealth lipid.In some embodiments, the LNP comprises a helper lipid of Formula (II”), a cationic or ionizable lipid of Formula (CAT-I) or (CAT-II), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (II”), a cationic or ionizable lipid of Formula (CAT-I), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (II”), a cationic or ionizable lipid of Formula (CAT- II), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (II”); a cationic or ionizable lipid selected from cKK-ElO, OF-02, GL- HEPES-E3-E12-DS-4-E10, and CL-B; a structural lipid; and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (II”); a cationic or ionizable lipid selected from cKK-ElO, OF-02, GL-HEPES-E3-E12-DS-4-E10, and CL-B; a structural lipid that is cholesterol; and a stealth lipid that is DMG-PEG2000.14380953055. v3767972: SA9-884PC / PAT24230-WO-PCTIn some embodiments, the LNP comprises a helper lipid of Formula (II), a cationic or ionizable lipid, and a structural lipid. In some embodiments, the LNP comprises a helper lipid of Formula (II), a cationic or ionizable lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (II), a cationic or ionizable lipid, a structural lipid, and a stealth lipid.In some embodiments, the LNP comprises a helper lipid of Formula (II), a cationic or ionizable lipid of Formula (CAT-I) or (CAT-II), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (II), a cationic or ionizable lipid of Formula (CAT-I), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (II), a cationic or ionizable lipid of Formula (CAT-II), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (II); a cationic or ionizable lipid selected from cKK-ElO, OF-02, GL-HEPES-E3- E12-DS-4-E10, and CL-B; a structural lipid; and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (II); a cationic or ionizable lipid selected from cKK-ElO, OF-02, GL-HEPES-E3-E12-DS-4-E10, and CL-B; a structural lipid that is cholesterol; and a stealth lipid that is DMG-PEG2000.In some embodiments, the LNP comprises a helper lipid of Formula (ILa), a cationic or ionizable lipid, and a structural lipid. In some embodiments, the LNP comprises a helper lipid of Formula (ILa), a cationic or ionizable lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (Il-a), a cationic or ionizable lipid, a structural lipid, and a stealth lipid.In some embodiments, the LNP comprises a helper lipid of Formula (ILa), a cationic or ionizable lipid of Formula (CAT-I) or (CAT-II), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (ILa), a cationic or ionizable lipid of Formula (CAT-I), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (ILa), a cationic or ionizable lipid of Formula (CAT-II), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (ILa); a cationic or ionizable lipid selected from cKK- E10, OF-02, GL-HEPES-E3-E12-DS-4-E10, and CL-B; a structural lipid; and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (ILa); a cationic or ionizable lipid selected from cKK-ElO, OF-02, GL-HEPES-E3-E12-DS-4-E10, and CL-B; a structural lipid that is cholesterol; and a stealth lipid that is DMG-PEG2000.In some embodiments, the LNP comprises a helper lipid of Formula (ILb), a cationic or ionizable lipid, and a structural lipid. In some embodiments, the LNP comprises a helper14480953055. v3767972: SA9-884PC / PAT24230-WO-PCT lipid of Formula (Il-b), a cationic or ionizable lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (Il-b), a cationic or ionizable lipid, a structural lipid, and a stealth lipid.In some embodiments, the LNP comprises a helper lipid of Formula (Il-b), a cationic or ionizable lipid of Formula (CAT-I) or (CAT-II), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (Il-b), a cationic or ionizable lipid of Formula (CAT-I), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (Il-b), a cationic or ionizable lipid of Formula (CAT-II), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (Il-b); a cationic or ionizable lipid selected from cKK-ElO, OF-02, GL-HEPES-E3-E12-DS-4-E10, and CL-B; a structural lipid; and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (Il-b); a cationic or ionizable lipid selected from cKK-ElO, OF-02, GL-HEPES-E3-E12-DS-4-E10, and CL-B; a structural lipid that is cholesterol; and a stealth lipid that is DMG-PEG2000.In some embodiments, the LNP comprises a helper lipid of Formula (III’), a cationic or ionizable lipid, and a structural lipid. In some embodiments, the LNP comprises a helper lipid of Formula (III’), a cationic or ionizable lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (III’), a cationic or ionizable lipid, a structural lipid, and a stealth lipid.In some embodiments, the LNP comprises a helper lipid of Formula (III’), a cationic or ionizable lipid of Formula (CAT-I) or (CAT-II), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (III’), a cationic or ionizable lipid of Formula (CAT-I), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (III’), a cationic or ionizable lipid of Formula (CAT-II), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (III’); a cationic or ionizable lipid selected from cKK- E10, OF-02, GL-HEPES-E3-E12-DS-4-E10, and CL-B; a structural lipid; and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (III’); a cationic or ionizable lipid selected from cKK-ElO, OF-02, GL-HEPES-E3-E12-DS-4-E10, and CL-B; a structural lipid that is cholesterol; and a stealth lipid that is DMG-PEG2000.In some embodiments, the LNP comprises a helper lipid of Formula (III”), a cationic or ionizable lipid, and a structural lipid. In some embodiments, the LNP comprises a helper lipid of Formula (III”), a cationic or ionizable lipid, and a stealth lipid. In some embodiments,14580953055. v3767972: SA9-884PC / PAT24230-WO-PCT the LNP comprises a helper lipid of Formula (III”), a cationic or ionizable lipid, a structural lipid, and a stealth lipid.In some embodiments, the LNP comprises a helper lipid of Formula (III”), a cationic or ionizable lipid of Formula (CAT-I) or (CAT-II), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (III”), a cationic or ionizable lipid of Formula (CAT-I), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (III”), a cationic or ionizable lipid of Formula (CAT-II), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (III”); a cationic or ionizable lipid selected from cKK- E10, OF-02, GL-HEPES-E3-E12-DS-4-E10, and CL-B; a structural lipid; and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (III”); a cationic or ionizable lipid selected from cKK-ElO, OF-02, GL-HEPES-E3-E12-DS-4-E10, and CL-B; a structural lipid that is cholesterol; and a stealth lipid that is DMG-PEG2000.In some embodiments, the LNP comprises a helper lipid of Formula (III), a cationic or ionizable lipid, and a structural lipid. In some embodiments, the LNP comprises a helper lipid of Formula (III), a cationic or ionizable lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (III), a cationic or ionizable lipid, a structural lipid, and a stealth lipid.In some embodiments, the LNP comprises a helper lipid of Formula (III), a cationic or ionizable lipid of Formula (CAT-I) or (CAT-II), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (III), a cationic or ionizable lipid of Formula (CAT-I), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (III), a cationic or ionizable lipid of Formula (CAT-II), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (III); a cationic or ionizable lipid selected from cKK-ElO, OF-02, GL-HEPES-E3- E12-DS-4-E10, and CL-B; a structural lipid; and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (III); a cationic or ionizable lipid selected from cKK-ElO, OF-02, GL-HEPES-E3-E12-DS-4-E10, and CL-B; a structural lipid that is cholesterol; and a stealth lipid that is DMG-PEG2000.In some embodiments, the LNP comprises a helper lipid of Formula (Ill-a), a cationic or ionizable lipid, and a structural lipid. In some embodiments, the LNP comprises a helper lipid of Formula (Ill-a), a cationic or ionizable lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (Ill-a), a cationic or ionizable lipid, a structural lipid, and a stealth lipid.14680953055. v3767972: SA9-884PC / PAT24230-WO-PCTIn some embodiments, the LNP comprises a helper lipid of Formula (Ill-a), a cationic or ionizable lipid of Formula (CAT-I) or (CAT-II), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (Ill-a), a cationic or ionizable lipid of Formula (CAT-I), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (Ill-a), a cationic or ionizable lipid of Formula (CAT-II), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (Ill-a); a cationic or ionizable lipid selected from cKK-ElO, OF-02, GL-HEPES-E3-E12-DS-4-E10, and CL-B; a structural lipid; and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (IILa); a cationic or ionizable lipid selected from cKK-ElO, OF-02, GL-HEPES-E3-E12-DS-4-E10, and CL-B; a structural lipid that is cholesterol; and a stealth lipid that is DMG-PEG2000.In some embodiments, the LNP comprises a helper lipid of Formula (Ill-b), a cationic or ionizable lipid, and a structural lipid. In some embodiments, the LNP comprises a helper lipid of Formula (Ill-b), a cationic or ionizable lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (Ill-b), a cationic or ionizable lipid, a structural lipid, and a stealth lipid.In some embodiments, the LNP comprises a helper lipid of Formula (Ill-b), a cationic or ionizable lipid of Formula (CAT-I) or (CAT-II), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (Ill-b), a cationic or ionizable lipid of Formula (CAT-I), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (Ill-b), a cationic or ionizable lipid of Formula (CAT-II), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (Ill-b); a cationic or ionizable lipid selected from cKK-ElO, OF-02, GL-HEPES-E3-E12-DS-4-E10, and CL-B; a structural lipid; and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (Ill-b); a cationic or ionizable lipid selected from cKK-ElO, OF-02, GL-HEPES-E3-E12-DS-4-E10, and CL-B; a structural lipid that is cholesterol; and a stealth lipid that is DMG-PEG2000.In some embodiments, the LNP comprises a helper lipid of Formula (III-c), a cationic or ionizable lipid, and a structural lipid. In some embodiments, the LNP comprises a helper lipid of Formula (III-c), a cationic or ionizable lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (III-c), a cationic or ionizable lipid, a structural lipid, and a stealth lipid.In some embodiments, the LNP comprises a helper lipid of Formula (III-c), a cationic or ionizable lipid of Formula (CAT-I) or (CAT-II), a structural lipid, and a stealth lipid. In14780953055. v3767972: SA9-884PC / PAT24230-WO-PCT some embodiments, the LNP comprises a helper lipid of Formula (III-c), a cationic or ionizable lipid of Formula (CAT-I), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (III-c), a cationic or ionizable lipid of Formula (CAT-II), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (III-c); a cationic or ionizable lipid selected from cKK-ElO, OF-02, GL-HEPES-E3-E12-DS-4-E10, and CL-B; a structural lipid; and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (III-c); a cationic or ionizable lipid selected from cKK-ElO, OF-02, GL-HEPES-E3-E12-DS-4-E10, and CL-B; a structural lipid that is cholesterol; and a stealth lipid that is DMG-PEG2000.In some embodiments, the LNP comprises a helper lipid of Formula (Ill-d), a cationic or ionizable lipid, and a structural lipid. In some embodiments, the LNP comprises a helper lipid of Formula (Ill-d), a cationic or ionizable lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (Ill-d), a cationic or ionizable lipid, a structural lipid, and a stealth lipid.In some embodiments, the LNP comprises a helper lipid of Formula (Ill-d), a cationic or ionizable lipid of Formula (CAT-I) or (CAT-II), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (Ill-d), a cationic or ionizable lipid of Formula (CAT-I), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (Ill-d), a cationic or ionizable lipid of Formula (CAT-II), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (Ill-d); a cationic or ionizable lipid selected from cKK-ElO, OF-02, GL-HEPES-E3-E12-DS-4-E10, and CL-B; a structural lipid; and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (IILd); a cationic or ionizable lipid selected from cKK-ElO, OF-02, GL-HEPES-E3-E12-DS-4-E10, and CL-B; a structural lipid that is cholesterol; and a stealth lipid that is DMG-PEG2000.In some embodiments, the LNP comprises a helper lipid of Formula (IV’), a cationic or ionizable lipid, and a structural lipid. In some embodiments, the LNP comprises a helper lipid of Formula (IV’), a cationic or ionizable lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (IV’), a cationic or ionizable lipid, a structural lipid, and a stealth lipid.In some embodiments, the LNP comprises a helper lipid of Formula (IV’), a cationic or ionizable lipid of Formula (CAT-I) or (CAT-II), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (IV’), a cationic or ionizable lipid of Formula (CAT-I), a structural lipid, and a stealth lipid. In some14880953055. v3767972: SA9-884PC / PAT24230-WO-PCT embodiments, the LNP comprises a helper lipid of Formula (IV’), a cationic or ionizable lipid of Formula (CAT-II), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (IV’); a cationic or ionizable lipid selected from cKK- E10, OF-02, GL-HEPES-E3-E12-DS-4-E10, and CL-B; a structural lipid; and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (IV’); a cationic or ionizable lipid selected from cKK-ElO, OF-02, GL-HEPES-E3-E12-DS-4-E10, and CL-B; a structural lipid that is cholesterol; and a stealth lipid that is DMG-PEG2000.In some embodiments, the LNP comprises a helper lipid of Formula (IV”), a cationic or ionizable lipid, and a structural lipid. In some embodiments, the LNP comprises a helper lipid of Formula (IV”), a cationic or ionizable lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (IV”), a cationic or ionizable lipid, a structural lipid, and a stealth lipid.In some embodiments, the LNP comprises a helper lipid of Formula (IV”), a cationic or ionizable lipid of Formula (CAT-I) or (CAT-II), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (IV”), a cationic or ionizable lipid of Formula (CAT-I), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (IV”), a cationic or ionizable lipid of Formula (CAT-II), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (IV”); a cationic or ionizable lipid selected from cKK-ElO, OF-02, GL-HEPES-E3-E12-DS-4-E10, and CL-B; a structural lipid; and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (IV”); a cationic or ionizable lipid selected from cKK-ElO, OF-02, GL-HEPES-E3-E12-DS-4-E10, and CL-B; a structural lipid that is cholesterol; and a stealth lipid that is DMG-PEG2000.In some embodiments, the LNP comprises a helper lipid of Formula (IV), a cationic or ionizable lipid, and a structural lipid. In some embodiments, the LNP comprises a helper lipid of Formula (IV), a cationic or ionizable lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (IV), a cationic or ionizable lipid, a structural lipid, and a stealth lipid.In some embodiments, the LNP comprises a helper lipid of Formula (IV), a cationic or ionizable lipid of Formula (CAT-I) or (CAT-II), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (IV), a cationic or ionizable lipid of Formula (CAT-I), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (IV), a cationic or ionizable lipid of Formula (CAT- II), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper14980953055. v3767972: SA9-884PC / PAT24230-WO-PCT lipid of Formula (IV); a cationic or ionizable lipid selected from cKK-ElO, OF-02, GL- HEPES-E3-E12-DS-4-E10, and CL-B; a structural lipid; and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (IV); a cationic or ionizable lipid selected from cKK-ElO, OF-02, GL-HEPES-E3-E12-DS-4-E10, and CL-B; a structural lipid that is cholesterol; and a stealth lipid that is DMG-PEG2000.In some embodiments, the LNP comprises a helper lipid of Formula (IV-a), a cationic or ionizable lipid, and a structural lipid. In some embodiments, the LNP comprises a helper lipid of Formula (IV-a), a cationic or ionizable lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (IV-a), a cationic or ionizable lipid, a structural lipid, and a stealth lipid.In some embodiments, the LNP comprises a helper lipid of Formula (IV-a), a cationic or ionizable lipid of Formula (CAT-I) or (CAT-II), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (IV-a), a cationic or ionizable lipid of Formula (CAT-I), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (IV-a), a cationic or ionizable lipid of Formula (CAT-II), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (IV-a); a cationic or ionizable lipid selected from cKK-ElO, OF-02, GL-HEPES-E3-E12-DS-4-E10, and CL-B; a structural lipid; and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (IV-a); a cationic or ionizable lipid selected from cKK-ElO, OF-02, GL-HEPES-E3-E12-DS-4-E10, and CL-B; a structural lipid that is cholesterol; and a stealth lipid that is DMG-PEG2000.In some embodiments, the LNP comprises a helper lipid of Formula (IV-b), a cationic or ionizable lipid, and a structural lipid. In some embodiments, the LNP comprises a helper lipid of Formula (IV-b), a cationic or ionizable lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (IV-b), a cationic or ionizable lipid, a structural lipid, and a stealth lipid.In some embodiments, the LNP comprises a helper lipid of Formula (IV-b), a cationic or ionizable lipid of Formula (CAT-I) or (CAT-II), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (IV-b), a cationic or ionizable lipid of Formula (CAT-I), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (IV-b), a cationic or ionizable lipid of Formula (CAT-II), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (IV-b); a cationic or ionizable lipid selected from cKK-ElO, OF-02, GL-HEPES-E3-E12-DS-4-E10, and CL-B; a structural lipid; and a stealth15080953055. v3767972: SA9-884PC / PAT24230-WO-PCT lipid. In some embodiments, the LNP comprises a helper lipid of Formula (IV-b); a cationic or ionizable lipid selected from cKK-ElO, OF-02, GL-HEPES-E3-E12-DS-4-E10, and CL-B; a structural lipid that is cholesterol; and a stealth lipid that is DMG-PEG2000.In some embodiments, the LNP comprises a helper lipid selected from the group consisting of compounds 1-36, a cationic or ionizable lipid, and a structural lipid. In some embodiments, the LNP comprises a helper lipid selected from the group consisting of compounds 1-36, a cationic or ionizable lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid selected from the group consisting of compounds 1-36, a cationic or ionizable lipid, a structural lipid, and a stealth lipid.In some embodiments, the LNP comprises a helper lipid selected from the group consisting of compounds 1-36, a cationic or ionizable lipid of Formula (CAT-I) or (CAT-II), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid selected from the group consisting of compounds 1-36, a cationic or ionizable lipid of Formula (CAT-I), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid selected from the group consisting of compounds 1-36, a cationic or ionizable lipid of Formula (CAT-II), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid selected from the group consisting of compounds 1-36; a cationic or ionizable lipid selected from cKK-ElO, OF-02, GL-HEPES- E3-E12-DS-4-E10, and CL-B; a structural lipid; and a stealth lipid. In some embodiments, the LNP comprises a helper lipid selected from the group consisting of compounds 1-36; a cationic or ionizable lipid selected from cKK-ElO, OF-02, GL-HEPES-E3-E12-DS-4-E10, and CL-B; a structural lipid that is cholesterol; and a stealth lipid that is DMG-PEG2000.In some embodiments, the LNP comprises a helper lipid selected from the group consisting of compounds 1-5, 8-18, 22, 23, and 27-36; a cationic or ionizable lipid; and a structural lipid. In some embodiments, the LNP comprises a helper lipid selected from the group consisting of compounds 1-5, 8-18, 22, 23, and 27-36; a cationic or ionizable lipid; and a stealth lipid. In some embodiments, the LNP comprises a helper lipid selected from the group consisting of compounds 1-5, 8-18, 22, 23, and 27-36; a cationic or ionizable lipid: a structural lipid; and a stealth lipid.In some embodiments, the LNP comprises a helper lipid selected from the group consisting of compounds 1-5, 8-18, 22, 23, and 27-36; a cationic or ionizable lipid of Formula (CAT-I) or (CAT-II); a structural lipid; and a stealth lipid. In some embodiments, the LNP comprises a helper lipid selected from the group consisting of compounds 1-5, 8-18, 22, 23, and 27-36; a cationic or ionizable lipid of Formula (CAT-I); a structural lipid; and a15180953055. v3767972: SA9-884PC / PAT24230-WO-PCT stealth lipid. In some embodiments, the LNP comprises a helper lipid selected from the group consisting of compounds 1-5, 8-18, 22, 23, and 27-36; a cationic or ionizable lipid of Formula (CAT-II); a structural lipid; and a stealth lipid. In some embodiments, the LNP comprises a helper lipid selected from the group consisting of compounds 1-5, 8-18, 22, 23, and 27-36; a cationic or ionizable lipid selected from cKK-ElO, OF-02, GL-HEPES-E3-E12- DS-4-E10, and CL-B; a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid selected from the group consisting of compounds 1-5, 8-18, 22, 23, and 27-36; a cationic or ionizable lipid selected from cKK-ElO, OF-02, GL-HEPES-E3-E12- DS-4-E10, and CL-B; a structural lipid that is cholesterol; and a stealth lipid that is DMG- PEG2000.In some embodiments, the LNP comprises a helper lipid selected from the group consisting of compounds 1, 5, 9, 13-16, and 23; a cationic or ionizable lipid; and a structural lipid. In some embodiments, the LNP comprises a helper lipid selected from the group consisting of compounds 1, 5, 9, 13-16, and 23; a cationic or ionizable lipid; and a stealth lipid. In some embodiments, the LNP comprises a helper lipid selected from the group consisting of compounds 1, 5, 9, 13-16, and 23; a cationic or ionizable lipid; a structural lipid; and a stealth lipid.In some embodiments, the LNP comprises a helper lipid selected from the group consisting of compounds 1, 5, 9, 13-16, and 23; a cationic or ionizable lipid of Formula (CAT-I) or (CAT-II); a structural lipid; and a stealth lipid. In some embodiments, the LNP comprises a helper lipid selected from the group consisting of compounds 1, 5, 9, 13-16, and 23; a cationic or ionizable lipid of Formula (CAT-I); a structural lipid; and a stealth lipid. In some embodiments, the LNP comprises a helper lipid selected from the group consisting of compounds 1, 5, 9, 13-16, and 23; a cationic or ionizable lipid of Formula (CAT-II); a structural lipid; and a stealth lipid. In some embodiments, the LNP comprises a helper lipid selected from the group consisting of compounds 1, 5, 9, 13-16, and 23; a cationic or ionizable lipid selected from cKK-ElO, OF-02, GL-HEPES-E3-E12-DS-4-E10, and CL-B; a structural lipid; and a stealth lipid. In some embodiments, the LNP comprises a helper lipid selected from the group consisting of compounds 1, 5, 9, 13-16, and 23; a cationic or ionizable lipid selected from cKK-ElO, OF-02, GL-HEPES-E3-E12-DS-4-E10, and CL-B; a structural lipid that is cholesterol; and a stealth lipid that is DMG-PEG2000.In some embodiments, the LNP comprises a helper lipid of Formula (V), a cationic or ionizable lipid, and a structural lipid. In some embodiments, the LNP comprises a helper lipid of Formula (V), a cationic or ionizable lipid, and a stealth lipid. In some embodiments, the15280953055. v3767972: SA9-884PC / PAT24230-WO-PCTLNP comprises a helper lipid of Formula (V), a cationic or ionizable lipid, a structural lipid, and a stealth lipid.In some embodiments, the LNP comprises a helper lipid of Formula (V), a cationic or ionizable lipid of Formula (CAT-I) or (CAT-II), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (V), a cationic or ionizable lipid of Formula (CAT-I), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (V), a cationic or ionizable lipid of Formula (CAT-II), a structural lipid, and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (V); a cationic or ionizable lipid selected from cKK-ElO, OF-02, GL-HEPES-E3- E12-DS-4-E10, and CL-B; a structural lipid; and a stealth lipid. In some embodiments, the LNP comprises a helper lipid of Formula (V); a cationic or ionizable lipid selected from cKK-ElO, OF-02, GL-HEPES-E3-E12-DS-4-E10, and CL-B; a structural lipid that is cholesterol; and a stealth lipid that is DMG-PEG2000.In some embodiments, the helper lipid may comprise a molar ratio from about 5% to about 35% (e.g., from about 15% to about 30%) of the total lipid present in the lipid nanoparticle. In some embodiments, the helper lipid may comprise a molar ratio from about 25% to about 35% of the total lipid present in the lipid nanoparticle. In some embodiments, the helper lipid may comprise a molar ratio of about 30% of the total lipid present in the lipid nanoparticle. In some embodiments, the helper lipid may comprise a molar ratio of about 33% of the total lipid present in the lipid nanoparticle.In some embodiments, the ionizable or cationic lipid may comprise a molar ratio from about 20% to about 70% (e.g., from about 35% to about 60%) of the total lipid present in the lipid nanoparticle. In some embodiments, the ionizable or cationic lipid may comprise a molar ratio from about 35% to about 45% of the total lipid present in the lipid nanoparticle. In some embodiments, the ionizable or cationic lipid may comprise a molar ratio of about 40% of the total lipid present in the lipid nanoparticle.In some embodiments, the structural lipid may comprise a molar ratio from about 15% to about 50% (e.g., from about 20% to about 45%) of the total lipid present in the lipid nanoparticle. In some embodiments, the structural lipid may comprise a molar ratio from about 22% to about 32% of the total lipid present in the lipid nanoparticle. In some embodiments, the structural lipid may comprise a molar ratio of about 25% of the total lipid present in the lipid nanoparticle. In some embodiments, the structural lipid may comprise a molar ratio of about 28.5% of the total lipid present in the lipid nanoparticle.15380953055. v3767972: SA9-884PC / PAT24230-WO-PCTIn some embodiments, the stealth lipid may comprise a molar ratio from about 0.5% to about 10% (e.g., from about 1.5% to about 2%) of the total lipid present in the lipid nanoparticle. In some embodiments, the stealth lipid may comprise a molar ratio from about 1% to about 5% of the total lipid present in the lipid nanoparticle. In some embodiments, the stealth lipid may comprise a molar ratio of about 1.5% of the total lipid present in the lipid nanoparticle. In some embodiments, the stealth lipid may comprise a molar ratio of about 2% of the total lipid present in the lipid nanoparticle. In some embodiments, the stealth lipid may comprise a molar ratio of about 5% of the total lipid present in the lipid nanoparticle.In some embodiments, the LNP comprises the helper lipid at a molar ratio between 15% and 30%, the ionizable or cationic lipid at a molar ratio between 35% and 60%, the structural lipid at a molar ratio between 20% and 45%, and the stealth lipid at a molar ratio between 1.5% and 2%.In some embodiments, the LNP comprises the helper lipid at a molar ratio between 25% and 35%, the ionizable or cationic lipid at a molar ratio between 35% and 45%, the structural lipid at a molar ratio between 22% and 32%, and the stealth lipid at a molar ratio between 1% and 5%.In some embodiments, the LNP comprises the helper lipid at a molar ratio of about 30%, the ionizable or cationic lipid at a molar ratio of about 40%, the structural lipid at a molar ratio of about 28.5%, and the stealth lipid at a molar ratio of about 1.5%.In some embodiments, the LNP comprises the helper lipid at a molar ratio of about 33%, the ionizable or cationic lipid at a molar ratio of about 40%, the structural lipid at a molar ratio of about 25%, and the stealth lipid at a molar ratio of about 2%.To calculate the actual amount of each lipid to be put into an LNP formulation, the molar amount of the cationic or ionizable lipid is first determined based on a desired N / P ratio, where N is the number of nitrogen atoms in the cationic lipid and P is the number of phosphate groups in the mRNA to be transported by the LNP. Next, the molar amount of each of the other lipids is calculated based on the molar amount of the cationic lipid and the molar ratio selected. These molar amounts are then converted to weights using the molecular weight of each lipid.F. Active Ingredients of the LNPsThe active ingredient of the present LNP composition may be an mRNA that encodes a polypeptide of interest. In certain embodiments, the polypeptide is an antigen. In certain embodiments, the polypeptide is a therapeutic polypeptide. The therapeutic polypeptide may15480953055. v3767972: SA9-884PC / PAT24230-WO-PCT be an antibody (e.g., an antibody heavy chain or an antibody light chain. The therapeutic polypeptide may be an enzyme.The mRNA molecule encapsulated by the present disclosure LNPs may comprise at least one ribonucleic acid (RNA) comprising an ORF encoding a polypeptide of interest. In certain embodiments, the mRNA further comprises at least one 5’ UTR, 3’ UTR, a poly(A) tail, and / or a 5’ cap. i. 5’ CapAn mRNA 5’ cap can provide resistance to nucleases found in most eukaryotic cells and promote translation efficiency. Several types of 5’ caps are known. A 7- methylguanosine cap (also referred to as “m7G” or “Cap-0”), comprises a guanosine that is linked through a 5’ - 5’ - triphosphate bond to the first transcribed nucleotide.A 5' cap is typically added as follows: first, an RNA terminal phosphatase removes one of the terminal phosphate groups from the 5’ nucleotide, leaving two terminal phosphates; guanosine triphosphate (GTP) is then added to the terminal phosphates via a guanylyl transferase, producing a 5 ‘5 ‘5 triphosphate linkage; and the 7-nitrogen of guanine is then methylated by a methyltransf erase. Examples of cap structures include, but are not limited to, m7G(5’)ppp, (5’(A,G(5’)ppp(5’)A, and G(5’)ppp(5’)G. Additional cap structures are described in U.S. Publication No. US 2016 / 0032356 and U.S. Publication No. US 2018 / 0125989, which are incorporated herein by reference.5 ’-capping of polynucleotides may be completed concomitantly during the in vitro- transcription reaction using the following chemical RNA cap analogs to generate the 5’- guanosine cap structure according to manufacturer protocols: 3’-O-Me-m7G(5’)ppp(5’)G (the ARCA cap); G(5’)ppp(5’)A; G(5’)ppp(5’)G; m7G(5’)ppp(5’)A; m7G(5’)ppp(5’)G; m7G(5')ppp(5')(2'OMeA)pG; m7G(5')ppp(5')(2'OMeA)pU; m7G(5')ppp(5')(2'OMeG)pG (New England BioLabs, Ipswich, MA; TriLink Biotechnologies). 5’-capping of modified RNA may be completed post-transcriptionally using a vaccinia virus capping enzyme to generate the Cap 0 structure: m7G(5’)ppp(5’)G. Cap 1 structure may be generated using both vaccinia virus capping enzyme and a 2’-0 methyl-transferase to generate: m7G(5’)ppp(5’)G- 2’-O-methyl. Cap 2 structure may be generated from the Cap 1 structure followed by the 2’- O-methylation of the 5 ’-antepenultimate nucleotide using a 2’-0 methyl-transferase. Cap 3 structure may be generated from the Cap 2 structure followed by the 2’-O-methylation of the 5’-preantepenultimate nucleotide using a 2’-0 methyl-transferase.15580953055. v3767972: SA9-884PC / PAT24230-WO-PCTIn certain embodiments, the mRNA of the disclosure comprises a 5’ cap selected from the group consisting of 3’-O-Me-m7G(5’)ppp(5’)G (the ARCA cap), G(5’)ppp(5’)A, G(5’)ppp(5’)G, m7G(5’)ppp(5’)A, m7G(5’)ppp(5’)G, m7G(5')ppp(5')(2'OMeA)pG, m7G(5')ppp(5')(2'OMeA)pU, and m7G(5')ppp(5')(2'OMeG)pG.In certain embodiments, the mRNA of the disclosure comprises a 5’ cap of:ii. Untranslated Region (UTR)In some embodiments, the mRNA of the disclosure includes a 5’ and / or 3’ untranslated region (UTR). In mRNA, the 5’ UTR starts at the transcription start site and continues to the start codon but does not include the start codon. The 3 ’ UTR starts immediately following the stop codon and continues until the transcriptional termination signal.In some embodiments, the mRNA disclosed herein may comprise a 5’ UTR that includes one or more elements that affect an mRNA’s stability or translation. In some embodiments, a 5’ UTR may be about 10 to 5,000 nucleotides in length. In some embodiments, a 5’ UTR may be about 50 to 500 nucleotides in length. In some embodiments, the 5’ UTR is at least about 10 nucleotides in length, about 20 nucleotides in length, about 30 nucleotides in length, about 40 nucleotides in length, about 50 nucleotides in length, about 100 nucleotides in length, about 150 nucleotides in length, about 200 nucleotides in length, about 250 nucleotides in length, about 300 nucleotides in length, about 350 nucleotides in length, about 400 nucleotides in length, about 450 nucleotides in length, about 500 nucleotides in length, about 550 nucleotides in length, about 600 nucleotides in length, about 650 nucleotides in length, about 700 nucleotides in length, about 750 nucleotides in length, about 800 nucleotides in length, about 850 nucleotides in length, about 900 nucleotides in length, about 950 nucleotides in length, about 1,000 nucleotides in length, about 1,500 nucleotides in length, about 2,000 nucleotides in length, about 2,500 nucleotides in length, about 3,000 nucleotides in length, about 3,500 nucleotides in length, about 4,000 nucleotides in length, about 4,500 nucleotides in length or about 5,000 nucleotides in length.15680953055. v3767972: SA9-884PC / PAT24230-WO-PCTIn some embodiments, the mRNA disclosed herein may comprise a 3’ UTR comprising one or more of a polyadenylation signal, a binding site for proteins that affect an mRNA’s stability of location in a cell, or one or more binding sites for miRNAs. In some embodiments, a 3’ UTR may be 50 to 5,000 nucleotides in length or longer. In some embodiments, a 3’ UTR may be 50 to 1,000 nucleotides in length or longer. In some embodiments, the 3’ UTR is at least about 50 nucleotides in length, about 100 nucleotides in length, about 150 nucleotides in length, about 200 nucleotides in length, about 250 nucleotides in length, about 300 nucleotides in length, about 350 nucleotides in length, about 400 nucleotides in length, about 450 nucleotides in length, about 500 nucleotides in length, about 550 nucleotides in length, about 600 nucleotides in length, about 650 nucleotides in length, about 700 nucleotides in length, about 750 nucleotides in length, about 800 nucleotides in length, about 850 nucleotides in length, about 900 nucleotides in length, about 950 nucleotides in length, about 1,000 nucleotides in length, about 1,500 nucleotides in length, about 2,000 nucleotides in length, about 2,500 nucleotides in length, about 3,000 nucleotides in length, about 3,500 nucleotides in length, about 4,000 nucleotides in length, about 4,500 nucleotides in length, or about 5,000 nucleotides in length.In some embodiments, the mRNA disclosed herein may comprise a 5’ or 3’ UTR that is derived from a gene distinct from the one encoded by the mRNA transcript (i.e., the UTR is a heterologous UTR).In certain embodiments, the 5’ and / or 3’ UTR sequences can be derived from mRNA which are stable (e.g., globin, actin, GAPDH, tubulin, histone, or citric acid cycle enzymes) to increase the stability of the mRNA. For example, a 5’ UTR sequence may include a partial sequence of a CMV immediate-early 1 (IE1) gene, or a fragment thereof, to improve the nuclease resistance and / or improve the half-life of the mRNA. Also contemplated is the inclusion of a sequence encoding human growth hormone (hGH), or a fragment thereof, to the 3’ end or untranslated region of the mRNA. Generally, these modifications improve the stability and / or pharmacokinetic properties (e.g., half-life) of the mRNA relative to their unmodified counterparts, and include, for example, modifications made to improve such mRNA resistance to in vivo nuclease digestion.Exemplary 5’ UTRs include a sequence derived from a CMV immediate-early 1 (IE1) gene (U.S. Publication Nos. 2014 / 0206753 and 2015 / 0157565, each of which is incorporated herein by reference), or the sequence GGGAUCCUACC (SEQ ID NO: 1) (U.S. Publication No. 2016 / 0151409, incorporated herein by reference).15780953055. v3767972: SA9-884PC / PAT24230-WO-PCTIn various embodiments, the 5’ UTR may be derived from the 5’ UTR of a TOP gene. TOP genes are typically characterized by the presence of a 5 ’-terminal oligopyrimidine (TOP) tract. Furthermore, most TOP genes are characterized by growth-associated translational regulation. However, TOP genes with a tissue specific translational regulation are also known. In certain embodiments, the 5’ UTR derived from the 5’ UTR of a TOP gene lacks the 5’ TOP motif (the oligopyrimidine tract) (e.g., U.S. Publication Nos. 2017 / 0029847, 2016 / 0304883, 2016 / 0235864, and 2016 / 0166710, each of which is incorporated herein by reference).In certain embodiments, the 5’ UTR is derived from a ribosomal protein Large 32 (L32) gene (U.S. Publication No. 2017 / 0029847, supra).In certain embodiments, the 5’ UTR is derived from the 5’ UTR of an hydroxysteroid (17-b) dehydrogenase 4 gene (HSD17B4) (U.S. Publication No. 2016 / 0166710, supra).In certain embodiments, the 5’ UTR is derived from the 5’ UTR of an ATP5A1 gene (U.S. Publication No. 2016 / 0166710, supra).In some embodiments, an internal ribosome entry site (IRES) is used instead of a 5’ UTR.In some embodiments, the 5 ’UTR comprises a nucleic acid sequence reproduced below: GGACAGAUCGCCUGGAGACGCCAUCCACGCUGUUUUGACCUCCAUAGAAGACA CCGGGACCGAUCCAGCCUCCGCGGCCGGGAACGGUGCAUUGGAACGCGGAUUC CCCGUGCCAAGAGUGACUCACCGUCCUUGACACG.(SEQ ID NO:2)In some embodiments, the 3 ’UTR comprises a nucleic acid sequence reproduced below:CGGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAA GUUGCCACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUC.(S EQ ID NO:3)The 5’ UTR and 3 ’UTR are described in further detail in W02012 / 075040, incorporated herein by reference. iii. Polyadenylated TailAs used herein, the terms “poly(A) sequence,” “poly(A) tail,” and “poly(A) region” refer to a sequence of adenosine nucleotides at the 3’ end of the mRNA molecule. The poly(A) tail may confer stability to the mRNA and protect it from exonuclease degradation. The poly(A) tail may enhance translation. In some embodiments, the poly(A) tail is15880953055. v3767972: SA9-884PC / PAT24230-WO-PCT essentially homopolymeric. For example, a poly(A) tail of 100 adenosine nucleotides may have essentially a length of 100 nucleotides. In certain embodiments, the poly(A) tail may be interrupted by at least one nucleotide different from an adenosine nucleotide (e.g., a nucleotide that is not an adenosine nucleotide). For example, a poly(A) tail of 100 adenosine nucleotides may have a length of more than 100 nucleotides (comprising 100 adenosine nucleotides and at least one nucleotide, or a stretch of nucleotides, that are different from an adenosine nucleotide). In certain embodiments, the poly(A) tail comprises the sequence AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGCAUAUGACUAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAA.(SEQ ID NO:4)The “poly(A) tail,” as used herein, typically relates to RNA. However, in the context of the disclosure, the term likewise relates to corresponding sequences in a DNA molecule (e.g., a “poly(T) sequence”).The poly(A) tail may comprise about 10 to about 500 adenosine nucleotides, about 10 to about 200 adenosine nucleotides, about 40 to about 200 adenosine nucleotides, or about 40 to about 150 adenosine nucleotides. The length of the poly(A) (SEQ ID NO: 5) tail may be at least about 10, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, or 500 adenosine nucleotides.In some embodiments where the nucleic acid is an RNA, the poly(A) tail of the nucleic acid is obtained from a DNA template during RNA in vitro transcription. In certain embodiments, the poly(A) tail is obtained in vitro by common methods of chemical synthesis without being transcribed from a DNA template. In various embodiments, poly(A) tails are generated by enzymatic poly adenylation of the RNA (after RNA in vitro transcription) using commercially available polyadenylation kits and corresponding protocols, or alternatively, by using immobilized poly(A)polymerases, e.g., using methods and means as described in WO20 16 / 174271.The nucleic acid may comprise a poly(A) tail obtained by enzymatic polyadenylation, wherein the majority of nucleic acid molecules comprise about 100 (+ / -20) to about 500 (+ / - 50) or about 250 (+ / -20) adenosine nucleotides.In some embodiments, the nucleic acid may comprise a poly(A) tail derived from a template DNA and may additionally comprise at least one additional poly(A) tail generated by enzymatic polyadenylation, e.g., as described in W02016 / 091391.In certain embodiments, the nucleic acid comprises at least one polyadenylation signal.In various embodiments, the nucleic acid may comprise at least one poly(C) sequence.15980953055. v3767972: SA9-884PC / PAT24230-WO-PCTThe term “poly(C) sequence (SEQ ID NO: 6),” as used herein, is intended to be a sequence of cytosine nucleotides of up to about 200 cytosine nucleotides. In some embodiments, the poly(C) sequence comprises about 10 to about 200 cytosine nucleotides, about 10 to about 100 cytosine nucleotides, about 20 to about 70 cytosine nucleotides, about 20 to about 60 cytosine nucleotides, or about 10 to about 40 cytosine nucleotides. In some embodiments, the poly(C) sequence comprises about 30 cytosine nucleotides. iv. Chemical ModificationThe mRNA disclosed herein may be modified or unmodified. In some embodiments, the mRNA may comprise at least one chemical modification. In some embodiments, the mRNA disclosed herein may contain one or more modifications that typically enhance RNA stability. Exemplary modifications can include backbone modifications, sugar modifications, or base modifications. In some embodiments, the disclosed mRNA may be synthesized from naturally occurring nucleotides and / or nucleotide analogues (modified nucleotides) including, but not limited to, purines (adenine (A) and guanine (G)) or pyrimidines (thymine (T), cytosine (C), and uracil (U)). In certain embodiments, the disclosed mRNA may be synthesized from modified nucleotide analogues or derivatives of purines and pyrimidines, such as, e.g., 1-methyl-adenine, 2-methyl-adenine, 2-methylthio-N-6-isopentenyl-adenine, N6-methyl-adenine, N6-isopentenyl-adenine, 2-thio-cytosine, 3-methyl-cytosine, 4-acetyl- cytosine, 5-methyl-cytosine, 2,6-diaminopurine, 1-methyl-guanine, 2-methyl-guanine, 2,2- dimethyl-guanine, 7-methyl-guanine, inosine, 1-methyl-inosine, pseudouracil (5-uracil), dihydro-uracil, 2-thio-uracil, 4-thio-uracil, 5-carboxymethylaminomethyl-2 -thio-uracil, 5- (carboxyhydroxymethyl)-uracil, 5-fluoro-uracil, 5 -bromo-uracil, 5- carboxymethylaminomethyl-uracil, 5-methyl-2-thio-uracil, 5-methyl-uracil, N-uracil-5-oxy acetic acid methyl ester, 5-methylaminomethyl-uracil, 5-methoxyaminomethyl-2-thio-uracil, 5’ -methoxy carbonylmethyl-uracil, 5-methoxy-uracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v), 1-methyl-pseudouracil, queosine, P-D-mannosyl-queosine, phosphoramidates, phosphorothioates, peptide nucleotides, methylphosphonates, 7- deazaguanosine, 5-methylcytosine, and inosine.In some embodiments, the disclosed mRNA may comprise at least one chemical modification including, but not limited to, pseudouridine, N1 -methylpseudouridine, 2- thiouridine, 4’ -thiouridine, 5-methylcytosine, 2-thio-l-m ethyl- 1-deaza-pseudouri dine, 2-thio- 1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio- dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-16080953055. v3767972: SA9-884PC / PAT24230-WO-PCT pseudouridine, 4-thio-l-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methyluridine, 5-methyluridine, 5-methoxyuridine, and 2’-O-methyl uridine.In some embodiments, the chemical modification is selected from the group consisting of pseudouridine, N1 -methylpseudouridine, 5-methylcytosine, 5-methoxyuridine, and a combination thereof.In some embodiments, the chemical modification comprises N1 -methylpseudouridine.In some embodiments, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% of the uracil nucleotides in the mRNA are chemically modified.In some embodiments, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% of the uracil nucleotides in the ORF are chemically modified.The preparation of such analogues is described, e.g., in U.S. Pat. No. 4,373,071, U.S. Pat. No. 4,401,796, U.S. Pat. No. 4,415,732, U.S. Pat. No. 4,458,066, U.S. Pat. No. 4,500,707, U.S. Pat. No. 4,668,777, U.S. Pat. No. 4,973,679, U.S. Pat. No. 5,047,524, U.S. Pat. No. 5,132,418, U.S. Pat. No. 5,153,319, U.S. Pat. No. 5,262,530, and U.S. Pat. No. 5,700,642. v. mRNA SynthesisThe mRNAs disclosed herein may be synthesized according to any of a variety of methods. For example, mRNAs according to the present disclosure may be synthesized via in vitro transcription (IVT). Some methods for in vitro transcription are described, e.g., in Geall et al. (2013) Semin. Immunol. 25(2): 152-159; Brunelle et al. (2013) Methods Enzymol. 530: 101-14. Briefly, IVT is typically performed with a linear or circular DNA template containing a promoter, a pool of ribonucleotide triphosphates, a buffer system that may include DTT and magnesium ions, an appropriate RNA polymerase (e.g., T3, T7, or SP6 RNA polymerase), DNase I, pyrophosphatase, and / or RNase inhibitor. The exact conditions may vary according to the specific application. The presence of these reagents is generally undesirable in a final mRNA product and these reagents can be considered impurities or contaminants which can be purified or removed to provide a clean and / or homogeneous mRNA that is suitable for therapeutic use. While mRNA provided from in vitro transcription reactions may be desirable in some embodiments, other sources of mRNA can be used16180953055. v3767972: SA9-884PC / PAT24230-WO-PCT according to the instant disclosure including wild-type mRNA produced from bacteria, fungi, plants, and / or animals.Where desired, the LNP or the LNP formulation may be multi-valent. In some embodiments, the LNP may carry mRNAs that encode more than one polypeptide (e.g., antigen), such as two, three, four, five, six, seven, eight, nine, ten, or more polypeptides. For example, the LNP may carry multiple mRNA molecules, each encoding a different polypeptide; or carry a polycistronic mRNA that can be translated into more than one polypeptide (e.g., each polypeptide-coding sequence is separated by a nucleotide linker encoding a self-cleaving peptide such as a 2A peptide). An LNP carrying different mRNA molecules typically comprises (encapsulate) multiple copies of each mRNA molecule. For example, an LNP carrying or encapsulating two different mRNA molecules typically carries multiple copies of each of the two different mRNA molecules.In some embodiments, a single LNP formulation may comprise multiple kinds (e.g., two, three, four, five, six, seven, eight, nine, ten, or more) of LNPs, each kind carrying a different mRNA.G. Buffer and Other ComponentsTo stabilize the nucleic acid and / or LNPs (e.g., to prolong the shelf-life of the vaccine product), to facilitate administration of the LNP pharmaceutical composition, and / or to enhance in vivo expression of the nucleic acid, the nucleic acid and / or LNP can be formulated in combination with one or more carriers, targeting ligands, stabilizing reagents (e.g., preservatives and antioxidants), and / or other pharmaceutically acceptable excipients. Examples of such excipients are parabens, thimerosal, thiomersal, chlorobutanol, bezalkonium chloride, and chelators (e.g., EDTA).The LNP compositions of the present disclosure can be provided as a frozen liquid form or a lyophilized form. A variety of cryoprotectants may be used, including, without limitations, sucrose, trehalose, glucose, mannitol, mannose, dextrose, and the like. The cryoprotectant may constitute 5-30% (w / v) of the LNP composition. In some embodiments, the LNP composition comprises trehalose, e.g., at 5-30% (e.g., 10%) (w / v). Once formulated with the cryoprotectant, the LNP compositions may be frozen (or lyophilized and cryopreserved) at -20°C to -80°C.The LNP compositions may be provided to a patient in an aqueous buffered solution - thawed if previously frozen, or if previously lyophilized, reconstituted in an aqueous buffered solution at bedside. The buffered solution may be isotonic and suitable for e.g.,16280953055. v3767972: SA9-884PC / PAT24230-WO-PCT intramuscular or intradermal injection. In some embodiments, the buffered solution is a phosphate-buffered saline (PBS). In some embodiments, the buffered solution is a Tris buffered solution.H. Processes for Making the Present LNP FormulationsThe present LNPs can be prepared by various techniques presently known in the art. For example, multilamellar vesicles (MLV) may be prepared according to conventional techniques, such as by depositing a selected lipid on the inside wall of a suitable container or vessel by dissolving the lipid in an appropriate solvent, and then evaporating the solvent to leave a thin film on the inside of the vessel or by spray drying. An aqueous phase may then be added to the vessel with a vortexing motion that results in the formation of MLVs. Unilamellar vesicles (ULV) can then be formed by homogenization, sonication or extrusion of the multilamellar vesicles. In addition, unilamellar vesicles can be formed by detergent removal techniques.Various methods are described in US 2011 / 0244026, US 2016 / 0038432, US 2018 / 0153822, US 2018 / 0125989, and PCT / US2020 / 043223 (filed July 23, 2020) and can be used to practice the present disclosure. One exemplary process entails encapsulating mRNA by mixing it with a mixture of lipids, without first pre-forming the lipids into lipid nanoparticles, as described in US 2016 / 0038432. Another exemplary process entails encapsulating mRNA by mixing pre-formed LNPs with mRNA, as described in US 2018 / 0153822.In some embodiments, the process of preparing mRNA-loaded LNPs includes a step of heating one or more of the solutions to a temperature greater than ambient temperature, the one or more solutions being the solution comprising the pre-formed lipid nanoparticles, the solution comprising the mRNA and the mixed solution comprising the LNP-encapsulated mRNA. In some embodiments, the process includes the step of heating one or both of the mRNA solution and the pre-formed LNP solution, prior to the mixing step. In some embodiments, the process includes heating one or more of the solutions comprising the preformed LNPs, the solution comprising the mRNA and the solution comprising the LNP- encapsulated mRNA, during the mixing step. In some embodiments, the process includes the step of heating the LNP- encapsulated mRNA, after the mixing step. In some embodiments, the temperature to which one or more of the solutions is heated is or is greater than about 30°C, 37°C, 40°C, 45°C, 50°C, 55°C, 60°C, 65°C, or 70°C. In some embodiments, the temperature to which one or more of the solutions is heated ranges from about 25-70°C,16380953055. v3767972: SA9-884PC / PAT24230-WO-PCT about 30-70°C, about 35-70°C, about 40-70°C, about 45-70°C, about 50-70°C, or about 60- 70°C. In some embodiments, the temperature is about 65°C.Various methods may be used to prepare an mRNA solution suitable for the present disclosure. In some embodiments, mRNA may be directly dissolved in a buffer solution described herein. In some embodiments, an mRNA solution may be generated by mixing an mRNA stock solution with a buffer solution prior to mixing with a lipid solution for encapsulation. In some embodiments, an mRNA solution may be generated by mixing an mRNA stock solution with a buffer solution immediately before mixing with a lipid solution for encapsulation. In some embodiments, a suitable mRNA stock solution may contain mRNA in water or a buffer at a concentration at or greater than about 0.2 mg / ml, 0.4 mg / ml, 0.5 mg / ml, 0.6 mg / ml, 0.8 mg / ml, 1.0 mg / ml, 1.2 mg / ml, 1.4 mg / ml, 1.5 mg / ml, or 1.6 mg / ml, 2.0 mg / ml, 2.5 mg / ml, 3.0 mg / ml, 3.5 mg / ml, 4.0 mg / ml, 4.5 mg / ml, or 5.0 mg / ml.In some embodiments, an mRNA stock solution is mixed with a buffer solution using a pump. Exemplary pumps include but are not limited to gear pumps, peristaltic pumps and centrifugal pumps. Typically, the buffer solution is mixed at a rate greater than that of the mRNA stock solution. For example, the buffer solution may be mixed at a rate at least lx, 2x, 3x, 4x, 5x, 6x, 7x, 8x, 9x, lOx, 15x, or 20x greater than the rate of the mRNA stock solution. In some embodiments, a buffer solution is mixed at a flow rate ranging between about 100-6000 ml / minute (e.g., about 100-300 ml / minute, 300-600 ml / minute, 600-1200 ml / minute, 1200-2400 ml / minute, 2400-3600 ml / minute, 3600-4800 ml / minute, 4800-6000 ml / minute, or 60-420 ml / minute). In some embodiments, a buffer solution is mixed at a flow rate of, or greater than, about 60 ml / minute, 100 ml / minute, 140 ml / minute, 180 ml / minute, 220 ml / minute, 260 ml / minute, 300 ml / minute, 340 ml / minute, 380 ml / minute, 420 ml / minute, 480 ml / minute, 540 ml / minute, 600 ml / minute, 1200 ml / minute, 2400 ml / minute, 3600 ml / minute, 4800 ml / minute, or 6000 ml / minute.In some embodiments, an mRNA stock solution is mixed at a flow rate ranging between about 10-600 ml / minute (e.g., about 5-50 ml / minute, about 10-30 ml / minute, about 30-60 ml / minute, about 60-120 ml / minute, about 120-240 ml / minute, about 240-360 ml / minute, about 360-480 ml / minute, or about 480-600 ml / minute). In some embodiments, an mRNA stock solution is mixed at a flow rate of or greater than about 5 ml / minute, 10 ml / minute, 15 ml / minute, 20 ml / minute, 25 ml / minute, 30 ml / minute, 35 ml / minute, 40 ml / minute, 45 ml / minute, 50 ml / minute, 60 ml / minute, 80 ml / minute, 100 ml / minute, 200 ml / minute, 300 ml / minute, 400 ml / minute, 500 ml / minute, or 600 ml / minute.16480953055. v3767972: SA9-884PC / PAT24230-WO-PCTThe process of incorporation of a desired mRNA into a lipid nanoparticle is referred to as “loading.” Exemplary methods are described in Lasic et al., FEBS Lett. (1992) 312:255-8. The LNP-incorporated nucleic acids may be completely or partially located in the interior space of the lipid nanoparticle, within the bilayer membrane of the lipid nanoparticle, or associated with the exterior surface of the lipid nanoparticle membrane. The incorporation of an mRNA into lipid nanoparticles is also referred to herein as “encapsulation” wherein the nucleic acid is entirely or substantially contained within the interior space of the lipid nanoparticle.Suitable LNPs may be made in various sizes. In some embodiments, decreased size of lipid nanoparticles is associated with more efficient delivery of an mRNA. Selection of an appropriate LNP size may take into consideration the site of the target cell or tissue and to some extent the application for which the lipid nanoparticle is being made.A variety of methods known in the art are available for sizing of a population of lipid nanoparticles. Preferred methods herein utilize Zetasizer Nano ZS (Malvern Panalytical) to measure LNP particle size. In one protocol, 10 pl of an LNP sample are mixed with 990 pl of 10% trehalose. This solution is loaded into a cuvette and then put into the Zetasizer machine. The z-average diameter (nm), or cumulants mean, is regarded as the average size for the LNPs in the sample. The Zetasizer machine can also be used to measure the poly dispersity index (PDI) by using dynamic light scattering (DLS) and cumulant analysis of the autocorrelation function. Average LNP diameter may be reduced by sonication of formed LNP. Intermittent sonication cycles may be alternated with quasi-elastic light scattering (QELS) assessment to guide efficient lipid nanoparticle synthesis.In some embodiments, the majority of purified LNPs, i.e., greater than about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the LNPs, have a size of about 70-150 nm (e.g., about 145 nm, about 140 nm, about 135 nm, about 130 nm, about 125 nm, about 120 nm, about 115 nm, about 110 nm, about 105 nm, about 100 nm, about 95 nm, about 90 nm, about 85 nm, or about 80 nm). In some embodiments, substantially all (e.g., greater than 80 or 90%) of the purified lipid nanoparticles have a size of about 70-150 nm (e.g., about 145 nm, about 140 nm, about 135 nm, about 130 nm, about 125 nm, about 120 nm, about 115 nm, about 110 nm, about 105 nm, about 100 nm, about 95 nm, about 90 nm, about 85 nm, or about 80 nm).In some embodiments, the LNPs in the present composition have an average size of less than 150 nm, less than 120 nm, less than 100 nm, less than 90 nm, less than 80 nm, less than 70 nm, less than 60 nm, less than 50 nm, less than 30 nm, or less than 20 nm.16580953055. v3767972: SA9-884PC / PAT24230-WO-PCTIn some embodiments, greater than about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% of the LNPs in the present composition have a size ranging from about 40-90 nm (e.g., about 45-85 nm, about 50-80 nm, about 55-75 nm, about 60-70 nm), about 40-90 nm (e.g., about 45-85 nm, about 50-80 nm, about 55-75 nm, about 60-70 nm), or about 50-70 nm (e.g., 55-65 nm) are particular suitable for pulmonary delivery via nebulization.In some embodiments, the dispersity, or measure of heterogeneity in size of molecules (PDI), of LNPs in a pharmaceutical composition provided by the present disclosure is less than about 0.5. In some embodiments, an LNP has a PDI of less than about 0.5, less than about 0.4, less than about 0.3, less than about 0.28, less than about 0.25, less than about 0.23, less than about 0.20, less than about 0.18, less than about 0.16, less than about 0.14, less than about 0.12, less than about 0.10, or less than about 0.08. The PDI may be measured by a Zetasizer machine as described above.In some embodiments, greater than about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the purified LNPs in a pharmaceutical composition provided herein encapsulate an mRNA within each individual particle. In some embodiments, substantially all (e.g., greater than 80% or 90%) of the purified lipid nanoparticles in a pharmaceutical composition encapsulate an mRNA within each individual particle. In some embodiments, a lipid nanoparticle has an encapsulation efficiency of between 50% and 99%; or greater than about 60, 65, 70, 75, 80, 85, 90, 92, 95, 98, or 99%. Typically, lipid nanoparticles for use herein have an encapsulation efficiency of at least 90% (e.g., at least 91, 92, 93, 94, or 95%).In some embodiments, an LNP has a N / P ratio of between 1 and 10. In some embodiments, a lipid nanoparticle has a N / P ratio above 1, about 1, about 2, about 3, about 4, about 5, about 6, about 7, or about 8. In further embodiments, a typical LNP herein has an N / P ratio of 4.In some embodiments, a pharmaceutical composition according to the present disclosure contains at least about 0.5 pg, 1 pg, 5 pg, 10 pg, 100 pg, 500 pg, or 1000 pg of encapsulated mRNA. In some embodiments, a pharmaceutical composition contains about 0.1 pg to 1000 pg, at least about 0.5 pg, at least about 0.8 pg, at least about 1 pg, at least about 5 pg, at least about 8 pg, at least about 10 pg, at least about 50 pg, at least about 100 pg, at least about 500 pg, or at least about 1000 pg of encapsulated mRNA.Packaging and Use of the mRNA-LNPThe mRNA-LNP can be packaged for parenteral (e.g., intramuscular, intradermal, subcutaneous, or intravenous) administration, nasopharyngeal (e.g., intranasal)16680953055. v3767972: SA9-884PC / PAT24230-WO-PCT administration, or mucosal (e.g., intranasal, oral, rectal) administration. The compositions may be in the form of an extemporaneous formulation, where the LNP composition is lyophilized and reconstituted with a physiological buffer (e.g., PBS) just before use. The compositions also may be shipped and provided in the form of an aqueous solution or a frozen aqueous solution and can be directly administered to subjects without reconstitution (after thawing, if previously frozen).Accordingly, the present disclosure provides an article of manufacture, such as a kit, that provides the mRNA-LNP in a single container, or provides the mRNA-LNP in one container and a physiological buffer for reconstitution in another container. The container(s) may contain a single-use dosage or multi-use dosage. The containers may be pre-treated glass vials or ampules. The article of manufacture may include instructions for use as well.In some embodiments, the present disclosure provides methods of preventing or treating a disease or disorder by administering the composition of the disclosure to a subject in need thereof. In some embodiments, the subject is suffering from or susceptible to an infection.In some embodiments, the present disclosure provides methods of eliciting an immune response in a subject in need thereof, comprising administering to the subject a prophylactically effective amount of a composition described herein.In some embodiments, the present disclosure provides methods of preventing an infection or reducing one or more symptoms of an infection in a subject in need thereof, comprising administering to the subject a prophylactically effective amount of the composition.In some embodiments of the methods described herein, the composition is administered to the subject mucosally, intramuscularly, intranasally, intravenously, subcutaneously, or intradermally. In some embodiments, the composition is administered mucosally. In some embodiments, the composition is administered intranasally.In some embodiments of the methods described herein, the subject is administered one or more doses of the composition, wherein each dose comprises 1-250 pg of mRNA. In some embodiments, each dose comprises 2.5-135 pg of mRNA. In some embodiments, each dose comprises 2.5., 5, 15, 45, or 135, pg of mRNA.In some embodiments of the methods described herein, the subject is administered two doses of the composition. In some embodiments, the two doses of the composition are administered with an interval of 1-6 weeks, e.g., 2-6 weeks. In some embodiments, the two doses of the composition are administered with an interval of 1, 2, 3, 4, 5, or 6 weeks. In16780953055. v3767972: SA9-884PC / PAT24230-WO-PCT some embodiments, the two doses of the composition are administered with an interval of 4 weeks.In some embodiments of the methods described herein, the subject is administered more than two doses of the composition. For example, the subject is administered three, four, five, or six doses of the composition. In some embodiments, the three, four, five, or six doses of the composition are administered with an interval of 1-6 weeks, e.g., 2-6 weeks. In some embodiments, the three, four, five, or six doses of the composition are administered with an interval of 1, 2, 3, 4, 5, or 6 weeks. In some embodiments, the three, four, five, or six doses of the composition are administered with an interval of 4 weeks.The present disclosure also provides the use of a composition described herein for the manufacture of a medicament for use in any of the methods described herein.The present disclosure further provides a kit comprising a composition of the present disclosure. In some embodiments, the kit comprises a containing comprising a single-use or multi-use dosage of the composition. In some embodiments, the containing is a vial. In some embodiments, the container is a pre-filled nasal spray device.V. Particular Embodiments1. A compound having a structure according for Formula (I):(I), or a pharmaceutically acceptable salt thereof, wherein:X is -C(i-6)alkylene-, -C(2-6)alkenylene-, -OC(i-6)alkylene-, -OC(2-6)alkenylene-, - OC(O)C(i-6)alkylene-, -OC(O)C(2-6)alkenylene-, -OC(O)OC(i-6)alkylene-, -OC(O)OC(2- 6)alkenylene-, -NHC(O)C(i-6)alkylene-, -NHC(O)C(2-6)alkenylene-, or -C(i-6)alkylene-O-C(i- 6)alkylene-;Y is -C(2-6)alkylene- or -C(2-6)alkenylene-, each of which is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, - C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, - N(R”)2, -SR” and -SO2R”;R1Aand R1Bare each independently selected from hydrogen and -C(i-io)alkyl, wherein the -C(i-io)alkyl is optionally substituted with one, two, or three substituents independently16880953055. v3767972: SA9-884PC / PAT24230-WO-PCT selected from the group consisting of halogen, -C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, - OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, -N(R”)2, -SR” and -SO2R”; orR1Aand R1Bare taken together with the nitrogen to which they are attached to form a 4-10-membered heterocyclic group that is optionally substituted with one, two, or three -C(i- 6)alkyl groups;R1Cis absent or R1Cis -C(i-io)alkyl that is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, - C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, -N(R”)2, - SR” and -SO2R”, wherein when R1Cis present, the nitrogen to which R1Cis bonded bears a positive charge; orRIARIB,ancjRicare takentogether with the nitrogen to which they are attached to form a 5-11-membered heterocyclic group that is optionally substituted with one, two, or three -C(i-6)alkyl groups, wherein the nitrogen to which R1A, R1B, and R1Cis bonded bears a positive charge;R2A, R2B, and R2Care each independently:each R3is independently selected from the group consisting of:(i) -C(4-2o)alkenyl or -C(4-2o)alkynyl, each of which is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, - C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, - N(R”)2, -SR” or -SO2R”;wherein: each R3Ais independently -C(i-3i)alkyl, -C(2-3i)alkenyl, or -C(2-3i)alkynyl, each of which is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, - OC(O)R”, -OC(O)OR”, -NH2, -NHR”, -N(R”)2, -SR” and -SO2R”; and each ZA is independently -C(i-io)alkylene- or -C(2-io)alkenylene-, each of which is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, - OC(O)OR”, -NH2, -NHR”, -N(R”)2, -SR” and -SO2R”; and16980953055. v3767972: SA9-884PC / PAT24230-WO-PCTR3B'°z¥(iii) O , wherein: each R3Bis independently -C(i-3i)alkyl, -C(2-3i)alkenyl, or -C(2-3i)alkynyl, each of which is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, - OC(O)R”, -OC(O)OR”, -NH2, -NHR”, -N(R”)2, -SR” and -SO2R”; and each ZB is independently -C(i-io)alkylene- or -C(2-io)alkenylene-, each of which is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, - OC(O)OR”, -NH2, -NHR”, -N(R”)2, -SR” and -SO2R”; n is 0 or 1; andR” is independently for each occurrence -C(i-20)alkyl.2. The compound of embodiment 1, or a pharmaceutically acceptable salt thereof, wherein X is -C(i-6)alkylene-, -OC(i-6)alkylene-, -NHC(O)C(i-6)alkylene-, or -C(i-6)alkylene-O- C(i-6)alkylene-.3. The compound of embodiment 1 or embodiment 2, or a pharmaceutically acceptable salt thereof, wherein X is -C(i-6)alkylene- or -OC(2-6)alkylene-.4. The compound of embodiment 1 or embodiment 2, or a pharmaceutically acceptable salt thereof, wherein X is -CH2-, -O(CH2)3-, -O(CH2)4-, -NHC(O)(CH2)2-, -CH2O(CH2)2-.5. The compound of any one of embodiments 1-4, or a pharmaceutically acceptable salt thereof, wherein X is -CH2-, -O(CH2)3-, or -O(CH2)4-.6. The compound of embodiment 1, wherein the compound has a structure according to Formula (II):17080953055. v3767972: SA9-884PC / PAT24230-WO-PCT(II), or a pharmaceutically acceptable salt thereof, wherein:XAis -O-, -OC(O)-, -NHC(O)-, or -OC(O)O-; and m is 1-6.7. The compound of embodiment 1 or embodiment 6, wherein the compound has a structure according to Formula (Il-a):(Il-a), or a pharmaceutically acceptable salt thereof, wherein:XAis -O-, -OC(O)-, -NHC(O)-, or -OC(O)O-; m is 1-6; and v is 2-6.8. The compound of embodiment 6 or embodiment 7, or a pharmaceutically acceptable salt thereof, wherein XA is -O-.9. The compound of any one of embodiments 6-8, or a pharmaceutically acceptable salt thereof, wherein m is 2-4.10. The compound of any one of embodiments 7-9, or a pharmaceutically acceptable salt thereof, wherein v is 2.11. The compound of embodiment 6 or embodiment 7, wherein the compound has a structure according to Formula (Il-b):17180953055. v3767972: SA9-884PC / PAT24230-WO-PCT(Il-b) or a pharmaceutically acceptable salt thereof; wherein m is 2-4; and v is 2-4.12. The compound of embodiment 1, wherein the compound has a structure according toFormula (III):or a pharmaceutically acceptable salt thereof, wherein:XB is absent, -O-, -OC(O)-, -NHC(O)-, -OC(O)O-, or -C(i-6)alkylene-O-; and p is 1-6. 13. The compound of embodiment 1 or embodiment 12, wherein the compound has a structure according to Formula (Ill-a):or a pharmaceutically acceptable salt thereof, wherein:17280953055. v3767972: SA9-884PC / PAT24230-WO-PCTXB is absent, -O-, -OC(O)-, -NHC(O)-, -OC(O)O-, or -C(i-6)alkylene-O-; p is 1-6; and w is 2-6.14. The compound of embodiment 12 or embodiment 13, or a pharmaceutically acceptable salt thereof, wherein XB is absent.15. The compound of any one of embodiments 12-14, or a pharmaceutically acceptable salt thereof, wherein p is 1-4.16. The compound of any one of embodiments 13-15, or a pharmaceutically acceptable salt thereof, wherein w is 2.17. The compound of embodiment 12 or embodiment 13, wherein the compound has a structure according to Formula (III-b):(III-b), or a pharmaceutically acceptable salt thereof, wherein: p is 1-3; and w is 2-6.18. The compound of embodiment 12 or embodiment 13, wherein the compound has a structure according to Formula (III-c):17380953055. v3767972: SA9-884PC / PAT24230-WO-PCT(III-C), or a pharmaceutically acceptable salt thereof, wherein: p is 2-4; and w is 2-6.19. The compound of embodiment 12 or embodiment 13, wherein the compound has a structure according to Formula (Ill-d):or a pharmaceutically acceptable salt thereof, wherein: p is 2-4; and w is 2-6.20. The compound of embodiment 1, wherein the compound has a structure according toFormula (IV):(IV),17480953055. v3767972: SA9-884PC / PAT24230-WO-PCT or a pharmaceutically acceptable salt thereof, wherein:Xc is absent, -O-, -OC(O)-, -NHC(O)-, -OC(O)O-, or -C(i-6)alkylene-O-; and q is 1-6.21. The compound of embodiment 1, wherein the compound has a structure according to Formula (IV-a):(IV-a), or a pharmaceutically acceptable salt thereof, wherein:Xc is absent, -O-, -OC(O)-, -NHC(O)-, -OC(O)O-, or -C(i-6)alkylene-O-; q is 1-6; and z is 2-6.22. The compound of embodiment 20 or embodiment 21, or a pharmaceutically acceptable salt thereof, wherein Xc is absent.23. The compound of any one of embodiments 20-22, or a pharmaceutically acceptable salt thereof, wherein q is 1-3.24. The compound of any one of embodiments 21-23, or a pharmaceutically acceptable salt thereof, wherein z is 2.25. The compound of embodiment 20 or embodiment 21, wherein the compound has a structure according to Formula (IV-b):17580953055. v3767972: SA9-884PC / PAT24230-WO-PCTor a pharmaceutically acceptable salt thereof, wherein: q is 1-3; and z is 2-6.26. The compound of any one of embodiments 1-6, 12 and 20, or a pharmaceutically acceptable salt thereof, wherein Y is -C(2-6)alkylene- or -C(2-6)alkenylene-.27. The compound of any one of embodiments 1-6, 12, 20, and 26, or a pharmaceutically acceptable salt thereof, wherein Y is -C(2-6)alkylene-.28. The compound of any one of embodiments 1-6, 12 and 20, or a pharmaceutically acceptable salt thereof, wherein Y is -C(2-6)alkylene- that is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, - C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, - N(R”)2, -SR” or -SO2R”.29. The compound of any one of embodiments 1-6, 12, 20, and 28, or a pharmaceuticallyacceptable salt thereof, wherein Y is -CH2CH2- or O^^OH30. The compound of any one of embodiments 1-6, 12, 20, and 26-29, or a pharmaceutically acceptable salt thereof, wherein Y is -CH2CH2-.31. The compound of any one of embodiments 1-30, or a pharmaceutically acceptable salt thereof, wherein each R3is the same.17680953055. v3767972: SA9-884PC / PAT24230-WO-PCT32. The compound of any one of embodiments 1-31, or a pharmaceutically acceptable salt thereof, wherein each R3is independently -C(4-20)alkenyl or -C(4-20)alkynyl, each of which is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, - OC(O)OR”, -NH2, -NHR”, -N(R”)2, -SR” and -SO2R”.33. The compound of any one of embodiments 1-32, or a pharmaceutically acceptable salt thereof, wherein each R3is independently -C(4-20)alkenyl.34. The compound of any one of embodiments 1-33, or a pharmaceutically acceptable salt thereof, wherein each R3is independently selected from the group consisting of:35. The compound of any one of embodiments 1-31, or a pharmaceutically acceptable salt thereof, wherein each R3is independently:36. The compound of any one of embodiments 1-31 and 35, or a pharmaceutically acceptable salt thereof, wherein each R3Ais independently -C(i-3i)alkyl, -C(2-3i)alkenyl, or - C(2-3i)alkynyl.37. The compound of any one of embodiments 1-31, 35, and 36, or a pharmaceutically acceptable salt thereof, wherein each R3Ais independently -C(i-3i)alkyl.38. The compound of any one of embodiments 1-31 and 35-37, or a pharmaceutically acceptable salt thereof, wherein each ZA is independently -C(i-io)alkylene- or -C(2- io)alkenylene-.39. The compound of any one of embodiments 1-31 and 35-38, or a pharmaceutically acceptable salt thereof, wherein each ZA is independently -C(i-io)alkylene-.17780953055. v3767972: SA9-884PC / PAT24230-WO-PCT40. The compound of any one of embodiments 1-31 and 35-39, or a pharmaceutically acceptable salt thereof, wherein each R3is independently selected from the group consisting of:41. The compound of any one of embodiments 1-31, or a pharmaceutically acceptable salt thereof, wherein each R3is independently:42. The compound of any one of embodiments 1-31 and 41, or a pharmaceutically acceptable salt thereof, wherein each R3Bis independently -C(i-3i)alkyl, -C(2-3i)alkenyl, or - C(2-3i)alkynyl.43. The compound of any one of embodiments 1-31, 41, and 42, or a pharmaceutically acceptable salt thereof, wherein each R3Bis independently -C(i-3i)alkyl.44. The compound of any one of embodiments 1-31 and 41-43, or a pharmaceutically acceptable salt thereof, wherein each ZB is independently -C(i-io)alkylene- or -C(2- io)alkenylene-.45. The compound of any one of embodiments 1-31 and 41-44, or a pharmaceutically acceptable salt thereof, wherein each ZB is independently -C(i-io)alkylene-.46. The compound of any one of embodiments 1-31 and 41-45, or a pharmaceutically acceptable salt thereof, wherein each R3is independently selected from the group consisting of:17880953055. v3767972: SA9-884PC / PAT24230-WO-PCT47. The compound of any one of embodiments 1-5 and 26-30, or a pharmaceutically acceptable salt thereof, wherein R2A, R2B, and R2Care each independently selected from the group consisting of:17980953055. v3767972: SA9-884PC / PAT24230-WO-PCT48. The compound of any one of embodiments 1-47, or a pharmaceutically acceptable salt thereof, wherein R1Aand R1Bare each independently selected from hydrogen and -C(i- io)alkyl, wherein the -C(i-io)alkyl is optionally substituted with one -OH group.49. The compound of any one of embodiments 1-48, or a pharmaceutically acceptable salt thereof, wherein R1Aand R1Bare each independently selected from the group consisting of hydrogen, -CH3, -CH2CH2OH, -(CH2)3OH, and -(CH2)4OH.50. The compound of any one of embodiments 1-48, or a pharmaceutically acceptable salt thereof, wherein R1Aand R1Bare each independently -C(i-5)alkyl that is optionally substituted with one -OH group.51. The compound of any one of embodiments 1-50, or a pharmaceutically acceptable salt thereof, wherein R1Ais -CH3, and R1Bis -CH3, -CH2CH2OH, -(CH2)3OH, or -(CH2)4OH.52. The compoun...

Claims

1. 767972: SA9-884PC / PAT24230-WO-PCTCLAIMS1. A compound having a structure according for Formula (I):(I), or a pharmaceutically acceptable salt thereof, wherein:X is -C(i-6)alkylene-, -C(2-6)alkenylene-, -OC(i-6)alkylene-, -OC(2-6)alkenylene-, - OC(O)C(i-6)alkylene-, -OC(O)C(2-6)alkenylene-, -OC(O)OC(i-6)alkylene-, -OC(O)OC(2- 6)alkenylene-, -NHC(O)C(i-6)alkylene-, -NHC(O)C(2-6)alkenylene-, or -C(i-6)alkylene-O-C(i- 6)alkylene-;Y is -C(2-6)alkylene- or -C(2-6)alkenylene-, each of which is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, - C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, - N(R”)2, -SR” and -SO2R”;R1Aand R1Bare each independently selected from hydrogen and -C(i-io)alkyl, wherein the -C(i-io)alkyl is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, - OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, -N(R”)2, -SR” and -SO2R”; orR1Aand R1Bare taken together with the nitrogen to which they are attached to form a 4-10-membered heterocyclic group that is optionally substituted with one, two, or three -C(i- 6)alkyl groups;R1Cis absent or R1Cis -C(i-io)alkyl that is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, - C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, -N(R”)2, - SR” and -SO2R”, wherein when R1Cis present, the nitrogen to which R1Cis bonded bears a positive charge; orRIARIB,ancjRicare takentogether with the nitrogen to which they are attached to form a 5-11-membered heterocyclic group that is optionally substituted with one, two, or three -C(i-6)alkyl groups, wherein the nitrogen to which R1A, R1B, and R1Cis bonded bears a positive charge;R2A, R2B, and R2Care each independently:36080953055. v3767972: SA9-884PC / PAT24230-WO-PCTeach R3is independently selected from the group consisting of:(i) -C(4-20)alkenyl or -C(4-20)alkynyl, each of which is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, - C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, - N(R”)2, -SR” or -SO2R”;wherein: each R3Ais independently -C(i-3i)alkyl, -C(2-3i)alkenyl, or -C(2-3i)alkynyl, each of which is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, - OC(O)R”, -OC(O)OR”, -NH2, -NHR”, -N(R”)2, -SR” and -SO2R”; and each ZA is independently -C(i-io)alkylene- or -C(2-io)alkenylene-, each of which is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, - OC(O)OR”, -NH2, -NHR”, -N(R”)2, -SR” and -SO2R”; and(iii), wherein: each R3Bis independently -C(i-3i)alkyl, -C(2-3i)alkenyl, or -C(2-3i)alkynyl, each of which is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, - OC(O)R”, -OC(O)OR”, -NH2, -NHR”, -N(R”)2, -SR” and -SO2R”; and each ZB is independently -C(i-io)alkylene- or -C(2-io)alkenylene-, each of which is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, - OC(O)OR”, -NH2, -NHR”, -N(R”)2, -SR” and -SO2R”; n is 0 or 1; andR” is independently for each occurrence -C(i-20)alkyl.

2. The compound of claim 1, wherein the compound has a structure according to Formula (Il-a):80953055. v3767972: SA9-884PC / PAT24230-WO-PCT(Il-a), or a pharmaceutically acceptable salt thereof, wherein:XAis -O-, -OC(O)-, -NHC(O)-, or -OC(O)O-; m is 1-6; and v is 2-6.

3. The compound of claim 1, wherein the compound has a structure according to Formula (Ill-a):or a pharmaceutically acceptable salt thereof, wherein:XB is absent, -O-, -OC(O)-, -NHC(O)-, -OC(O)O-, or -C(i-6)alkylene-O-; p is 1-6; and w is 2-6.

4. The compound of claim 1, wherein the compound has a structure according toFormula (IV-a):36280953055. v3767972: SA9-884PC / PAT24230-WO-PCT(IV-a), or a pharmaceutically acceptable salt thereof, wherein:Xcis absent, -O-, -OC(O)-, -NHC(O)-, -OC(O)O-, or -C(i-6)alkylene-O-; q is 1-6; and z is 2-6.

5. The compound of any one of claims 1-4, or a pharmaceutically acceptable salt thereof, wherein each R3is independently selected from the group consisting of:

6. The compound of any one of claims 1-5, or a pharmaceutically acceptable salt thereof, wherein:(i) R1Ais hydrogen, R1Bis hydrogen, and R1Cis absent;(ii) R1Ais -C(i-5)alkyl, R1Bis -C(i-5)alkyl, and R1Cis absent;(iii) R1Ais -C(i-5)alkyl, R1Bis -C(i-5)alkyl, and R1Cis -C(i-5)alkyl;36380953055. v3767972: SA9-884PC / PAT24230-WO-PCT(iv) R1Ais -C(i-5)alkyl, R1Bis -C(i-5)alkyl substituted with one -OH group, and R1Cis absent;(v) R1Aand R1Bare taken together with the nitrogen to which they are attached to form a 4-10-membered heterocyclic group, and R1Cis absent; (vi) R1Aand R1Bare taken together with the nitrogen to which they are attached to form a 4-10-membered heterocyclic group, and R1Cis -C(i-5)alkyl; or(vii) R1A, R1B, and R1Care taken together with the nitrogen to which they are attached to form a 5-11 -membered heterocyclic group.

7. A compound having a structure selected from the group consisting of:36480953055. v3767972: SA9-884PC / PAT24230-WO-PCT36580953055. v3767972: SA9-884PC / PAT24230-WO-PCT36680953055. v3767972: SA9-884PC / PAT24230-WO-PCT36780953055. v3767972: SA9-884PC / PAT24230-WO-PCT36880953055. v3767972: SA9-884PC / PAT24230-WO-PCT36980953055. v3767972: SA9-884PC / PAT24230-WO-PCT37080953055. v3767972: SA9-884PC / PAT24230-WO-PCT37180953055. v3767972: SA9-884PC / PAT24230-WO-PCT37280953055. v3767972: SA9-884PC / PAT24230-WO-PCT37380953055. v3767972: SA9-884PC / PAT24230-WO-PCTacceptable salt thereof.

8. A composition comprising:(1) one or more compound according to Formula (I’):(I’), or a pharmaceutically acceptable salt thereof, wherein:X is -C(i-6)alkylene-, -C(2-6)alkenylene-, -OC(i-6)alkylene-, -OC(2-6)alkenylene-, - OC(O)C(i-6)alkylene-, -OC(O)C(2-6)alkenylene-, -OC(O)OC(i-6)alkylene-, -OC(O)OC(2- 6)alkenylene-, -NHC(O)C(i-6)alkylene-, -NHC(O)C(2-6)alkenylene-, or -C(i-6)alkylene-O-C(i- 6)alkylene-;Y is -C(2-6)alkylene- or -C(2-6)alkenylene-, each of which is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, - C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, - N(R”)2, -SR” and -SO2R”;R1Aand R1Bare each independently selected from hydrogen and -C(i-io)alkyl, wherein the -C(i-io)alkyl is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, - OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, -N(R”)2, -SR” and -SO2R”; orR1Aand R1Bare taken together with the nitrogen to which they are attached to form a 4-10-membered heterocyclic group that is optionally substituted with one, two, or three -C(i- 6)alkyl groups;R1Cis absent or R1Cis -C(i-io)alkyl that is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, - C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, -OC(O)OR”, -NH2, -NHR”, -N(R”)2, -37480953055. v3767972: SA9-884PC / PAT24230-WO-PCTSR” and -SO2R”, wherein when R1Cis present, the nitrogen to which R1Cis bonded bears a positive charge; orRIARIB,ancjRicare takentogether with the nitrogen to which they are attached to form a 5-11-membered heterocyclic group that is optionally substituted with one, two, or three -C(i-6)alkyl groups, wherein the nitrogen to which R1A, R1B, and R1Cis bonded bears a positive charge;R2A , R2B, and R2Care each independently -OR3, -OC(O)R3, or -C(O)OR3; each R3is independently selected from the group consisting of:(i) -C(9-25)alkyl, -C(9-25)alkenyl or -C(9-25)alkynyl, each of which is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, - OC(O)OR”, -NH2, -NHR”, -N(R”)2, -SR” or -SO2R”;wherein: each R3Ais independently -C(i-3i)alkyl, -C(2-3i)alkenyl, or -C(2-3i)alkynyl, each of which is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, - OC(O)R”, -OC(O)OR”, -NH2, -NHR”, -N(R”)2, -SR” and -SO2R”; and each ZA is independently -C(6-io)alkylene- or -C(7-io)alkenylene-, each of which is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, - OC(O)OR”, -NH2, -NHR”, -N(R”)2, -SR” and -SO2R”; andF °YZB^(iii) 0 , wherein: each R3Bis independently -C(i-3i)alkyl, -C(2-3i)alkenyl, or -C(2-3i)alkynyl, each of which is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, - OC(O)R”, -OC(O)OR”, -NH2, -NHR”, -N(R”)2, -SR” and -SO2R”; and each ZB is independently -C(6-io)alkylene- or -C(7-io)alkenylene-, each of which is optionally substituted with one, two, or three substituents independently selected from the group consisting of halogen, -C(O)R”, -C(O)OH, -C(O)OR”, -CN, -OH, -OR”, -OC(O)R”, - OC(O)OR”, -NH2, -NHR”, -N(R”)2, -SR” and -SO2R”; n is 0 or 1; and37580953055. v3767972: SA9-884PC / PAT24230-WO-PCTR” is independently for each occurrence -C(i-20)alkyl;(2) one or more cationic lipids,(3) one or more structural lipids, and(4) one or more stealth lipids.

9. A composition comprising:(1) one or more compound of any one of claims 1-7, or a pharmaceutically acceptable salt thereof,(2) one or more cationic lipids,(3) one or more structural lipids, and(4) one or more stealth lipids.

10. The composition of claim 8 or claim 9, wherein the composition is a lipid nanoparticle, optionally a liposome.

11. The composition of claim 10, wherein the lipid nanoparticle encapsulates an mRNA encoding a peptide or protein.

12. A vaccine comprising the composition of claim 11.

13. The composition of claim 11 for use in therapy.

14. The composition of claim 11 for use in a method of treating or preventing a disease amenable to treatment or prevention by the peptide or protein encoded by the mRNA, optionally wherein the mRNA encodes an antigen and / or the disease is (a) a protein deficiency, optionally wherein the protein deficiency affects the liver, lung, brain or muscle, (b) an autoimmune disease, (c) an infectious disease, or (d) cancer.

15. The composition for use according to claim 13 or claim 14, wherein the composition is administered intravenously, intrathecally, or intramuscularly, or by pulmonary delivery, optionally through nebulization.37680953055. v3

Citation Information

Patent Citations

  • Alkenyl substituted 2,5-piperazinediones, compositions, and uses thereof

    US10201618B2

  • Delivery of mRNA for the augmentation of proteins and enzymes in human genetic diseases

    US20110244026A1

  • Lipid nanoparticle compositions and methods for mRNA delivery

    US20140206753A1

  • Pulmonary delivery of mRNA to non-lung target cells

    US20150157565A1

  • Quantitative assessment for cap efficiency of messenger RNA

    US20160032356A1