Novel limosilactobacillus fermentum ABF21069 strain and composition for prevention and alleviation of non-alcoholic fatty liver disease and for Anti-inflammatory activity comprising same
The novel Limosilactobacillus fermentum ABF21069 strain effectively addresses NAFLD by consuming fructose and fatty acids, reducing lipid accumulation, and lowering inflammatory cytokines, providing a safer alternative for treating NAFLD.
Patent Information
- Application Number
- PCT/KR2025/014001
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-09-09
- Filing Date
- 2025-09-09
- Publication Date
- 2026-03-12
AI Technical Summary
Current treatments for non-alcoholic fatty liver disease (NAFLD) have limited therapeutic effects and can cause side effects such as diarrhea, nausea, and liver toxicity, while existing lactic acid bacteria do not effectively inhibit lipid synthesis and inflammation.
A novel strain of Limosilactobacillus fermentum ABF21069 (KCTC 14891BP) that survives in the intestinal environment, adheres to intestinal cells, and effectively consumes fructose and fatty acids, reducing serum neutral lipids and lowering inflammatory cytokine expression.
The strain significantly reduces serum neutral lipids and cholesterol levels, improves NAFLD by reducing lipid accumulation, and exhibits excellent anti-inflammatory effects without causing liver toxicity.
Smart Images

Figure PCTKR2025014001-APPB-IMG-000001
Abstract
Description
A novel strain of Limosyl Lactobacillus fermentum ABF21069 and a composition containing the same for prevention, improvement, and anti-inflammatory activity in non-alcoholic fatty liver disease
[0001] The present invention relates to a novel strain of Limosilactobacillus fermentum, and more particularly, to a strain of Limosilactobacillus fermentum ABF21069 (KCTC 14891BP) having excellent improvement in non-alcoholic fatty liver disease and anti-inflammatory activity, and a composition comprising the same.
[0002]
[0003] Fatty liver disease refers to a condition in which fat is deposited in the liver to account for more than 5% of the liver's weight. Depending on the cause, it is broadly classified into alcoholic fatty liver disease (ALDL) and non-alcoholic fatty liver disease (NAFLD). Non-alcoholic fatty liver disease refers to fatty liver disease that occurs in people who drink less than 40g of alcohol per day. It is mostly related to risk factors such as overweight, obesity, diabetes, and hyperlipidemia, and in rare cases, it can occur in people who have taken medication for a long time.
[0004] According to the Korean Association for the Study of the Liver, the prevalence of non-alcoholic fatty liver disease (NAFLD) in Korea ranges from 10% to 24% in the general population and from 58% to 74% in obese individuals. The prevalence has been rapidly increasing in Korea. Furthermore, depending on the condition, it can be divided into simple fatty liver disease, in which fat accumulates in the liver without liver cell damage, and steatohepatitis, in which inflammation of the liver cells leads to severe liver cell damage. Approximately 5% to 20% of steatohepatitis cases develop into cirrhosis, and 1% to 4% of cirrhosis cases can develop into liver cancer, highlighting the importance of treatment. Therefore, suppressing excessive fat accumulation in the liver and controlling the resulting inflammation are crucial.
[0005] High-fat diets and excessive carbohydrate intake are known to increase the development of fatty liver disease. One study found that people who consumed excessive carbohydrates and simple sugars had relatively higher levels of non-alcoholic fatty liver disease and hepatic inflammation. In particular, fructose intake was strongly correlated with fatty liver disease and steatohepatitis. Unlike glucose, fructose can be directly absorbed by liver cells and converted to lipids. Excessive fructose intake can promote lipid synthesis in the liver, leading to increased blood lipid levels and non-alcoholic fatty liver disease. Furthermore, excessive fructose intake is known to induce changes in the gut flora, increasing the influx of endotoxins into the liver and causing liver damage.
[0006] The main pathogenic mechanisms of nonalcoholic fatty liver disease (NAFLD) have been reported to include 1) excessive fat accumulation in hepatocytes due to an imbalance in fatty acid metabolism, 2) inflammatory responses such as IL-1β, IL-6, and TNF-α due to lipotoxicity in the accumulated hepatocytes, and 3) increased oxidative stress. Many studies to treat it have targeted suppressing excessive lipid accumulation and regulating the secretion of inflammatory cytokines, but the pathogenesis is complex, and limited therapeutic effects are expected depending on the pathogenesis. Recently, the U.S. Food and Drug Administration (FDA) approved Rezdiffra as the first treatment for NAFLD, but it can have side effects such as diarrhea, nausea, and liver toxicity. Therefore, an alternative treatment that has fewer side effects, suppresses lipid accumulation, and controls inflammation to help improve fatty liver disease is needed.
[0007] Meanwhile, lactic acid bacteria have been reported to have various health-promoting effects, including promoting the proliferation of beneficial intestinal bacteria, regulating immunity, and improving metabolic diseases. In particular, some lactic acid bacteria are known to reduce intrahepatic fat and triglycerides, improve non-alcoholic fatty liver disease, and suppress inflammatory responses by inhibiting nitric oxide production and modulating the expression of inflammatory genes. Therefore, functional lactic acid bacteria that are safe, exhibit excellent anti-inflammatory activity, and inhibit lipid synthesis can be considered a promising alternative for improving non-alcoholic fatty liver disease.
[0008]
[0009] The present inventors sought to select a novel functional strain that effectively removes fructose and long-chain fatty acids in an intestinal environment, and to discover a novel lactic acid bacteria that not only inhibits fat synthesis in the liver but also has excellent anti-inflammatory activity and can improve non-alcoholic fatty liver disease.
[0010]
[0011] The present invention provides a Limosilactobacillus fermentum ABF21069 (KCTC 14891BP) strain.
[0012] In addition, the present invention provides a food composition comprising at least one selected from among Limosilactobacillus fermentum ABF21069 (KCTC 14891BP) strain, a lysate thereof, a culture solution thereof, a culture thereof, an extract thereof, an extract thereof, and a dead cell thereof.
[0013] At this time, the food composition may preferably be used for improving inflammation, improving non-alcoholic fatty liver disease, or improving hyperlipidemia.
[0014] In addition, the present invention provides a pharmaceutical composition for preventing or treating inflammation, which comprises at least one selected from among Limosilactobacillus fermentum ABF21069 (KCTC 14891BP) strain, a lysate thereof, a culture thereof, a culture thereof, an extract thereof, an extract thereof, and a killed cell thereof as an effective ingredient.
[0015] In addition, the present invention provides a pharmaceutical composition for preventing or treating non-alcoholic fatty liver disease, which comprises at least one selected from among Limosilactobacillus fermentum ABF21069 (KCTC 14891BP) strain, a lysate thereof, a culture thereof, a culture thereof, an extract thereof, an extract thereof, and a killed cell thereof as an active ingredient.
[0016] In addition, the present invention provides a pharmaceutical composition for preventing or treating hyperlipidemia, which comprises at least one selected from among Limosilactobacillus fermentum ABF21069 (KCTC 14891BP) strain, a lysate thereof, a culture thereof, a culture thereof, an extract thereof, an extract thereof, and a killed cell thereof as an effective ingredient.
[0017]
[0018] The novel strain of Limosyl Lactobacillus fermentum ABF21069 of the present invention survives in the intestinal environment where acid and bile are present, and has the ability to adhere to intestinal cells, allowing it to settle in the intestines. In addition, since it can effectively consume high concentrations of fructose and fatty acids simultaneously in the intestinal environment, it can be usefully utilized for the prevention, improvement, and treatment of non-alcoholic fatty liver disease caused by excessive fructose and fat intake. In particular, it exhibits the effect of improving non-alcoholic fatty liver disease by significantly reducing serum neutral lipids when administered orally, and exhibits an excellent anti-inflammatory effect by lowering the expression levels of inflammatory cytokines in various organs. In addition, it exhibits the effect of improving hyperlipidemia by reducing neutral lipid and cholesterol contents. The Limosyl Lactobacillus fermentum ABF21069 strain of the present invention, which exhibits such efficacy, is a type of lactic acid bacteria and has no side effects upon ingestion, so it can be usefully utilized in food compositions, pharmaceutical compositions, health functional food compositions, etc.
[0019]
[0020] Figure 1 is a graph showing the culture results of the strain (ABF21069) of the present invention in an intestinal-like environment and a fructose and fatty acid input medium, where (A) shows the number of viable cells, (B) shows the pH, (C) shows the residual fructose in the culture medium, and (D) shows the residual long-chain fatty acids in the culture medium.
[0021] Figure 2 shows a schematic diagram of an animal experiment.
[0022] Figure 3 shows the results of measuring liver toxicity indices in the serum of animals that fasted for 6 hours at the end of the intervention. (A) is a graph analyzing aspartate aminotransferase (AST), and (B) is a graph analyzing alanine aminotransferase (ALT).
[0023] Figure 4 is a graph showing the results of measuring indicators of dyslipidemia, with (A) showing the content of neutral lipids in serum and (B) showing the content of total cholesterol.
[0024] Figure 5 shows the results of evaluating the effect of ABF21069 administration on improving neutral lipid accumulation in the liver using Oil red O staining.
[0025] Figure 6 is a graph measuring changes in mRNA expression levels of the genes SREBP1, FASN, SCD1, and DGAT1, which are indicators of lipid synthesis in the liver.
[0026] Figure 7 shows the results of qualitative and quantitative analysis of protein changes in liver lipid synthesis indicators using western blot. (A) represents ACC1-pS79, (B) represents ACC1, (C) represents FAS, (D) represents SCD1, (E) represents DGAT1, and (F) represents MTP.
[0027] Figure 8 shows the results of measuring changes in mRNA expression levels of immune-related cytokines IL-1β, IL-6, and TNF-α in each organ using qRT-PCR. (A) is a graph analyzed in the liver, (B) in the small intestine, and (C) in white fat.
[0028] Figure 9 is a graph showing the results of evaluating the toxicity of the ABF21069 strain against HepG2, a human hepatocyte cell line, by concentration. (A) is a graph showing the HepG2 cell survival rate (%) by treatment with heat-killed bacteria, and (B) is a graph showing the HepG2 cell survival rate (%) by treatment with culture supernatant.
[0029] Figure 10 is a graph showing the results of evaluating the toxicity of the ABF21069 strain against HT-29, a human intestinal epithelial cell line, by concentration. (A) is a graph showing the HT-29 cell survival rate (%) by treatment with heat-killed bacteria, and (B) is a graph showing the HT-29 cell survival rate (%) by treatment with culture supernatant.
[0030] Figure 11 is the result of evaluating the change in IL-8 expression level in HT-29 cells by the ABF21069 strain of the present invention, (A) is 1×10 7CFU / mL dead cells (HK), (B) is a graph showing the results of treatment with 10% culture supernatant.
[0031] Figure 12 shows the results comparing the adhesion ability of the ABF21069 strain of the present invention to the intestinal epithelial cell line Caco-2 with that of the standard strain.
[0032] Figure 13 shows the results of confirming the bile salt hydrolase activity of the ABF21069 strain of the present invention. The left side shows the results of culturing the strain on general MRS agar and the right side shows the results of culturing the strain on MRS containing 0.5% taurodeoxycholic acid (TDCA) for 2 days at 37°C.
[0033]
[0034] The present inventors isolated microorganisms from fermented foods, infant feces, and breast milk in order to secure lactic acid bacteria that suppress the absorption of high-concentration fructose and fat, which are the main causes of non-alcoholic fatty liver disease, and in particular, isolated Limosilactobacillus fermentum ABF21069 (KCTC 14891BP), which is excellent in complex consumption of fructose and long-chain fatty acids.
[0035] Based on this, the present invention provides Limosilactobacillus fermentum ABF21069 (KCTC 14891BP), which exhibits desirable growth in an intestinal environment and an environment with a high concentration of fructose and fatty acids, and effectively reduces the concentration of fructose and fatty acids, thereby being used for the prevention and improvement of non-alcoholic fatty liver disease caused by excessive fructose and fat intake. Limosilactobacillus fermentum ABF21069 (KCTC 14891BP) of the present invention is also called Limosilactobacillus fermentum MG309 and used interchangeably in other materials written by the applicant or the inventors of the present invention, other than the present patent.
[0036] ABF21069 of the present invention significantly reduces serum neutral lipids when administered orally, demonstrating the effect of improving non-alcoholic fatty liver disease. It also exhibits excellent anti-inflammatory effects by lowering the expression levels of inflammatory cytokines in various organs. Furthermore, it exhibits the effect of improving hyperlipidemia by reducing neutral lipid and cholesterol levels.
[0037] The ABF21069 strain of the present invention has the following morphological, physiological, and biochemical characteristics (Table 1).
[0038] Morphological, physiological, and biochemical characteristics of the present invention's strain of Rimosyl Lactobacillus fermentum ABF21069 Morphological characteristics Colony color / shape / size Off-white / round / 1.0-1.5 mm Gram stain positive reaction Bacterial size 1.0 - 1.5 μm (diameter) × 3.0 - 4.0 μm (length) Bacterial morphology Bacillus No motility Physiological characteristics Growth temperature (optimal temperature) 15 - 50℃ (30 - 45℃) Growth pH (optimal pH) pH 4 - pH 8 (pH 6 - pH 7) Acid resistance 49.7% survival after 2 hours of incubation at pH 2.5 Bile resistance 47.1% survival after 8 hours of incubation with 0.3% bile acid Biochemical characteristics Catalase activity Negative reaction API 50CH Table 3 API ZYM Table 4 Antibiotic Resistance (EFSA* standard) Gentamycin, Kanamycin, Streptomycin, Tetracycline, Erythromycin, Chloramphenicol Other characteristics Adhesion to Caco-2 cell line No hemolysis No β-glucuronidase Bile salt hydrolase Negative reaction
[0039] *EFSA: European Food Safety Authority
[0040]
[0041] Meanwhile, the present invention provides a food composition comprising at least one selected from among Limosilactobacillus fermentum ABF21069 (KCTC 14891BP) strain, a lysate thereof, a culture solution thereof, a culture thereof, an extract thereof, an extract thereof, and a dead cell thereof.
[0042] The term 'strain fragment' refers to a strain fragment that has been fragmented by applying physical force or chemical treatment.
[0043] The term "culture medium" refers to a culture medium in which a strain is cultured. A typical lactic acid bacteria medium can be used for culturing the strain. Furthermore, in the present invention, the term "culture medium" is interpreted to include a concentrated culture medium.
[0044] The term ‘culture’ refers to a powder manufactured by drying a culture solution in which a strain has been cultured.
[0045] The term ‘extract’ refers to an extract obtained by adding an extraction solvent to a strain.
[0046] 'Extract' refers to a powder manufactured by drying or evaporating the extraction solvent from the extract obtained by adding an extraction solvent to a strain.
[0047] 'Dead cells' refers to the strains that have been killed. Killing of the strains means killing them by applying heat, grinding them with beads, or chemical treatment. It is interpreted to include the so-called 'dead cell lysate' in which the strains are destroyed by the killing treatment.
[0048] The food composition of the present invention may be, for example, a probiotic, synbiotic, or postbiotic composition. In addition, it may be any one selected from noodles, gum, dairy products, ice cream, meat, grains, caffeinated beverages, general beverages, chocolate, bread, snacks, confectionery, candy, pizza, jelly, alcoholic beverages, alcohol, vitamin complexes, and other health supplements. However, the present invention is not necessarily limited thereto. When the food composition of the present invention is used as a food additive, it may be added as is or used together with other foods or food ingredients, and may be appropriately used according to a conventional method.
[0049] At this time, the food composition may preferably be used for improving inflammation, improving alcoholic fatty liver disease, or improving hyperlipidemia.
[0050]
[0051] Meanwhile, the present invention provides a pharmaceutical composition for preventing or treating inflammation, which comprises at least one selected from among Limosilactobacillus fermentum ABF21069 (KCTC 14891BP) strain, a lysate thereof, a culture thereof, a culture thereof, an extract thereof, an extract thereof, and a killed cell thereof as an effective ingredient.
[0052] In addition, the present invention provides a pharmaceutical composition for preventing or treating alcoholic fatty liver, which comprises at least one selected from among Limosilactobacillus fermentum ABF21069 (KCTC 14891BP) strain, a lysate thereof, a culture thereof, a culture thereof, an extract thereof, an extract thereof, and a killed cell thereof as an active ingredient.
[0053] In addition, the present invention provides a pharmaceutical composition for preventing or treating hyperlipidemia, which comprises at least one selected from among Limosilactobacillus fermentum ABF21069 (KCTC 14891BP) strain, a lysate thereof, a culture thereof, a culture thereof, an extract thereof, an extract thereof, and a killed cell thereof as an effective ingredient.
[0054] According to the experiments of the present invention below, it was confirmed that the Limosilactobacillus fermentum ABF21069 (KCTC 14891BP) strain of the present invention lowers neutral lipid and cholesterol contents without inducing liver toxicity in an animal model induced with non-alcoholic fatty liver disease. The strain of the present invention can be usefully utilized for the prevention, improvement, and treatment of non-alcoholic fatty liver disease caused by excessive fructose and fat intake. When administered orally, it exhibits the effect of improving non-alcoholic fatty liver disease by significantly reducing neutral lipids in the serum, and exhibits an excellent anti-inflammatory effect by lowering the expression level of inflammatory cytokines in various organs.
[0055] The term "prevention" as used herein refers to any action that suppresses or delays the onset of a disease (inflammation, alcoholic fatty liver disease, hyperlipidemia) affected by administration of the pharmaceutical composition according to the present invention. Furthermore, the term "treatment" as used herein refers to any action that improves or beneficially alters the symptoms of a disease (inflammation, alcoholic fatty liver disease, hyperlipidemia) by administration of the pharmaceutical composition according to the present invention.
[0056] The pharmaceutical composition comprising at least one selected from the strain Limosilactobacillus fermentum ABF21069 (KCTC 14891BP) of the present invention, its lysate, its culture solution, its culture, its extract solution, its extract, and its dead cells as an active ingredient may contain at least one active ingredient exhibiting the same or similar function as the component of the present invention.
[0057] The pharmaceutical composition of the present invention may further comprise a pharmaceutically acceptable carrier in addition to at least one selected from Limosilactobacillus fermentum ABF21069 (KCTC 14891BP) strain, a lysate thereof, a culture thereof, a culture thereof, an extract thereof, an extract thereof, and a killed cell thereof. The type of carrier that can be used in the present invention is not particularly limited, and any carrier commonly used in the relevant technical field can be used. Non-limiting examples of the carrier include lactose, dextrose, sucrose, sorbitol, mannitol, saline solution, sterile water, Ringer's solution, buffered saline, albumin injection solution, xylitol, erythritol, maltitol, maltodextrin, glycerol, ethanol, and the like. These may be used alone or in combination of two or more.
[0058] In addition, the pharmaceutical composition of the present invention may be used by adding other pharmaceutically acceptable additives such as antioxidants, excipients, diluents, buffers or bacteriostatic agents, if necessary, and may be used by additionally adding surfactants, binders, fillers, bulking agents, wetting agents, disintegrants, dispersants or lubricants.
[0059] In the pharmaceutical composition of the present invention, at least one selected from Limosilactobacillus fermentum ABF21069 (KCTC 14891BP) strain, its lysate, its culture solution, its culture, its extract solution, its extract and its killed cells may be included in an amount of 0.00001 wt% to 99.99 wt% based on the total weight of the pharmaceutical composition, preferably 0.1 wt% to 90 wt%, more preferably 0.1 wt% to 70 wt%, and even more preferably 0.1 wt% to 50 wt%. However, the present invention is not limited thereto and may be variously changed depending on the condition of the administration subject, the type and degree of specific symptoms, etc. If necessary, it may also be included in the total content of the pharmaceutical composition.
[0060] That is, the pharmaceutically effective amount and effective dosage of the pharmaceutical composition of the present invention may vary depending on the method of formulating the pharmaceutical composition, the method of administration, the time of administration or the route of administration, and may vary depending on various factors including the type and degree of the response to be achieved by administration of the pharmaceutical composition, the type, age, weight, general health condition, symptoms or degree of the disease, sex, diet, excretion, drugs used simultaneously or simultaneously in the subject, other components of the composition, and similar factors well known in the medical field, and a person having ordinary skill in the art can easily determine and prescribe an effective dosage for the desired treatment. For example, the daily dosage of the pharmaceutical composition of the present invention is about 0.001 to 1,000 mg / kg, and may be administered once or several times a day in divided doses.
[0061] The term "administration" used in the present invention means introducing the pharmaceutical composition of the present invention into a patient by any appropriate method, and the route and method of administration of the pharmaceutical composition of the present invention may be independent of each other, and any route and method of administration may be followed without particular limitation, as long as the pharmaceutical composition can reach the target site. The pharmaceutical composition of the present invention may be administered orally or parenterally, and may be formulated and used in various suitable dosage forms for oral or parenteral administration.
[0062] Non-limiting examples of oral administration preparations using the pharmaceutical composition of the present invention include oily suspensions, troches, lozenges, tablets, aqueous suspensions, prepared powders, granules, emulsions, hard capsules, soft capsules, syrups, or elixirs.
[0063] In order to formulate the pharmaceutical composition of the present invention for oral administration, binders such as sorbitol, mannitol, starch, amylopectin, cellulose, lactose, saccharose or gelatin; lubricants such as magnesium stearate, calcium stearate, sodium stearyl fumarate or polyethylene glycol wax; excipients such as dicalcium phosphate; disintegrants such as corn starch or sweet potato starch; and the like can be used, and in addition, flavoring agents, syrups, sweeteners, etc. can also be used. Furthermore, in the case of capsules, in addition to the above-mentioned substances, liquid carriers such as fatty oils can be additionally used.
[0064] The pharmaceutical composition of the present invention is recommended for oral administration, but parenteral administration may be used if necessary. Examples of parenteral administration include intramuscular administration, transdermal administration, intravenous administration, intraperitoneal administration, or subcutaneous administration. Methods of applying, spraying, or inhaling the composition to the affected area may also be used, but are not limited thereto. Specific dosage forms, non-limiting examples of parenteral preparations using the pharmaceutical composition of the present invention include injections, suppositories, ointments, powders for application, oils, powders for respiratory inhalation, aerosols for spraying, creams, and the like.
[0065] In order to formulate the pharmaceutical composition of the present invention for parenteral administration, a sterile aqueous solution, a non-aqueous solvent, a suspension, an emulsion, a freeze-dried preparation, an external preparation, etc. can be used. As the non-aqueous solvent and suspension, vegetable oils such as olive oil, propylene glycol, polyethylene glycol, injectable esters such as ethyl oleate, etc. can be used.
[0066] When the pharmaceutical composition of the present invention is formulated as an injection, the pharmaceutical composition of the present invention can be prepared as a solution or suspension by mixing it in water with a stabilizer or buffer, and this can be formulated for unit dose in an ampule or vial. When the pharmaceutical composition of the present invention is formulated as an aerosol, the water-dispersed concentrate or wet powder can be mixed with an additive such as a propellant so that it can be dispersed. When the pharmaceutical composition of the present invention is formulated as an ointment, oil, cream, powder for application, external skin preparation, etc., the pharmaceutical composition of the present invention can be formulated using animal oil, vegetable oil, wax, paraffin, polyethylene glycol, silicone, bentonite, silica, talc, starch, tragacanth, cellulose derivatives, zinc oxide, etc. as a carrier.
[0067]
[0068] Hereinafter, the present invention will be described in more detail through the following examples and experimental examples. However, the scope of the present invention is not limited to the following examples and experimental examples, but includes modifications of technical concepts equivalent thereto.
[0069]
[0070] [Example 1: Selection and Characterization of Strains Utilizing Fructose and Long-Chain Fatty Acids]
[0071] 1. Strain isolation and acquisition
[0072] To isolate strains utilizing fructose and long-chain fatty acids, various samples, including traditional fermented foods, infant feces, and breast milk, were obtained, serially diluted with sterile saline, plated on MRS medium, and cultured for 2 days. Considering the morphological characteristics of the colonies formed, 348 strains of microorganisms were purified. In addition, 11 standard strains of Lactobacillus sp. (L. acidophilus KCTC 3164), a standard strain of probiotics notified by the Korea Research Institute of Bioscience and Biotechnology (KCTC), were used as standard strains. T ,L. caseiKCTC 3109 T ,L. fermentumKCTC 3112 T ,L. helveticusKCTC 15060 T ,L. paracaseisubsp.paracaseiKCTC 3510 T ,L. paracaseisubsp.toleransKCTC 3074 T ,L. paragasseriKCTC 3172 T ,L. plantarumKCTC 3108 T ,L. reuteriKCTC 3594 T ,L. salivariusKCTC 43133 Twere obtained by distributing them. In addition, L. plantarum ATCC 8014 (LP) and L. rhamnosus ATCC 53103 (LGG), which were used as controls, were purchased from the American Type Culture Collection (ATCC).
[0073]
[0074] 2. Selection of strains that utilize fructose and long-chain fatty acids
[0075] 11 standard strains and 348 isolated strains were cultured at 37°C in MRS medium containing 1.5% fructose and 1 mM sodium palmitate, and the amounts of fructose and fatty acids present in the culture supernatant were measured using the DNS reducing sugar measurement method and PicoSens, respectively. TM The strains that showed excellent results were inoculated into MRS medium containing 0.3% oxgall, 5% fructose, and 1 mM sodium palmitate, which was prepared under conditions similar to those in the intestine, and further cultured at 37°C.
[0076] As a result of the experiment, two strains (ABF21069, RM209) that showed excellent fructose and fatty acid consumption in the intestinal environment were finally selected. The 16S rRNA sequences of the two selected strains were confirmed, and they were all identified as Limosilactobacillus fermentum, and the standard strain Limosilactobacillus fermentum KCTC 3112 was used in this experiment and the following experiments. T was used for comparison.
[0077]
[0078] 3. Elimination rates of fructose and long-chain fatty acids under intestinal-like conditions
[0079] To analyze in detail the intestinal tolerance and the fructose and long-chain fatty acid consumption capacity of the selected strains, the viable cell count, pH change, and residual fructose and long-chain fatty acid content were measured over time using a fermenter in MRS liquid medium supplemented with 0.3% oxgall, 6% fructose, and 1 mM sodium palmitate. As a result, the viable cell count, pH change, and residual fructose and long-chain fatty acid content of Rimosyl Lactobacillus fermentum ABF21069, RM209, and the standard strain KCTC 3112 were measured. T All 10 in 9 hours of incubation 9 The viable cell count was more than CFU / mL, and among them, ABF21069 entered the growth phase faster than other strains, consuming all fructose in the medium within 8 hours of culture and up to 40% of fatty acids. On the other hand, KCTC 3112 T The strain consumed only 50% of fructose during 9 hours of culture, and fatty acids gradually increased after 4 hours of culture. In conclusion, Limosyl Lactobacillus fermentum ABF21069 was finally selected as an excellent strain that consumes fructose and fatty acids in a complex manner (see Fig. 1). Fig. 1 is a graph showing the culture results of the strain (ABF21069) of the present invention in an intestinal-like environment and a fructose and fatty acid input medium, where (A) is the number of viable cells, (B) is the pH, (C) is the residual fructose in the culture medium, and (D) is the residual long-chain fatty acids in the culture medium.
[0080]
[0081] 4. Genetic and biochemical identification of strain ABF21069
[0082] To accurately identify the final selected ABF21069 strain, 16S rRNA gene sequence analysis was performed. This was performed by extracting genomic DNA from the bacterial culture and requesting the work of Bioneer (Daejeon). PCR was performed using the bacterial universal primers in Table 2 below, and the 16S rRNA base sequence obtained through this is shown in Sequence Number 1 and was identified and analyzed in the EZTaxon database (https: / www.ezbiocloud.net).
[0083] Experimental results showed that strain ABF21069 was superior to strain Rimosyl Lactobacillus fermentum CECT 562 T It showed 99.86% homology with the reference strain. For more accurate identification, Rimosyl Lactobacillus fermentum CECT 562 was used. T Ortho ANI analysis was performed with the standard strain, and the two strains showed an OrthoANI value of 97.47% (Note: If the ANI value matches 95-96%, they are considered to be the same species). Therefore, the ABF21069 strain belongs to the L. fermentum group and was determined to be a novel strain with an OrthoANI value of 97.47% compared to the standard strain. Accordingly, the L. fermentum ABF21069 strain of the present invention was deposited at the Biological Resource Center of the Korea Research Institute of Bioscience and Biotechnology (Accession No. KCTC 14891BP).
[0084] Universal primer sequence for 16S rRNA gene sequencingPrimer sequence (5' → 3')27FAGA GTT TGA TCM TGG CTC AG1492RTAC GGY TAC CTT GTT ACG ACT T
[0085]
[0086] 4-1. Biochemical Characteristics of ABF21069 - Glucose Utilization Analysis
[0087] To determine the sugar utilization characteristics of the ABF21069 strain, an API 50CHL kit (BioMerieux, France) analysis was performed. Similar to the reference strain, the strain was found to be capable of utilizing ribose, galactose, glucose, fructose, esculin, maltose, lactose, melibiose, saccharose, raffinose, and gluconate (see Table 3).
[0088] Sugar utilization type of Limosyl Lactobacillus fermentum ABF21069 strainABF21069KCTC 3112 T Party type ABF21069KCTC 3112 T Glycerol--Salicin--Erythritol--D-Cellobiose--D-Arabinose--D-Maltose++L-Arabinose--D-Lactose++D-Ribose++D-Melibiose++D-Xylose--D-Saccharose++L-Xylose--D-Trehalose--D-Adonitol--Inulin--Methyl-β D-xyloside--D-Melezitose--D-Galactose++D-Raffinose++D-Glucose++Amidon--D-Fructose++Glycogen--D-Mannosew-Xylitol--L-Sorbose--Gen tiobiose--L-Rhamnose--D-Turanose--Dulcitol--D-Lyxose--Inositol--D-Tagatose--D-Manntiol--D-Fucose--D-Sorbitol--L-Fucose--Methyl-α Mannoside--D-Arabitol--Methyl-α Glucoside--L-Arabitol--N-acetyl-glucosamine--Gluconatew+Amygdalin--2-ketogluconate--Arbutin--5-ketogluconate--Esculin++
[0089] +: positive, w: weakly positive, -: negative
[0090]
[0091] 4-2. Biochemical Characteristics - Enzyme Activity Analysis
[0092] To determine the enzyme activity of the ABF21069 strain, the API ZYM kit (Biomerieux, France) was used. As a result, it exhibited enzyme activities similar to those of the standard strain, including esterase (C4), esterase lipase (C8), leucine arylamidase, valine arylamidase, acid phosphatase, naphthol-AS-BI-phospholydrolase, α, β-galactosidase, and α-glucosidase, while exhibiting higher enzyme activities for crystine arylamidase and α-galactosidase (Table 4).
[0093] Enzyme activity of the strain Rimosyl Lactobacillus fermentum ABF21069 Enzyme ABF21069KCTC 3112 T Alkaline phosphatase--Esterase (C4)++Esterase lipase (C8)++Lipase (C14)--Leucine arylamidase++Valine arylamidase++Crystine arylamidase+wTrypsin--α-Chymotrypsin--Acid phosphatase++Naphthol-AS-BI-phosphohydrolase++α-Galactosidase+wβ-Galactosidase++β-Glucuronidase--α-Glucosidase++β-Glucosidase--N-acetyl-β-glucosamidase--α-Mannosidase--α-Fucosidase--
[0094] +: positive, w: weakly positive, -: negative
[0095]
[0096] [Example 2: Non-alcoholic fatty liver disease and anti-inflammatory activity of ABF21069 in vivo]
[0097] 1. Design of animal experiments
[0098] To confirm the non-alcoholic fatty liver disease-improving effect of Rimosyl Lactobacillus fermentum ABF21069 in an animal model, mice were fed a high-fat, high-fructose diet to induce non-alcoholic fatty liver disease, and the strain was co-administered in a freeze-dried form. C57BL / 6N Tac mice were used as experimental animals, and the experiment was conducted with the approval of the Hanyang University Experimental Animal Ethics Committee (HY-IACUC-2022-0239A). First, 8-week-old C57BL / 6N Tac mice were acclimatized for one week after introduction, and the breeding room was maintained with a 12-hour light-dark cycle at a constant temperature and humidity. Afterwards, the experimental groups were randomly divided as shown in Table 5, and non-alcoholic fatty liver disease was induced by ad libitum feeding of a high-fat, high-fructose diet (45% kcal from fat, 30% kcal from fructose) and drinking water for 20 weeks (see Figure 2). Figure 2 shows a schematic diagram of the animal experiment. The strain was administered orally in lyophilized form, mixed with a solvent immediately before administration, and administered orally every morning along with a high-fat-high-fructose diet for 20 weeks. A 0.85% NaCl solution used as a solvent was administered as a negative control group.
[0099] Animal testing group classification table NDHF / HFrABF21069_LowABF21069_HighSilymarinFat(% kcal)1345454545Fructose(% kcal)-30303030ABF21069 (CFU)--5 × 10 8 5 × 10 9 -Silymarin (mg / kg bw)-----SexmalemalemalemalemaleN1010101010Weeks2020202020
[0100]
[0101] 2. Improvement of liver toxicity and dyslipidemia
[0102] Aspartate aminotransferase (AST) and alanine aminotransferase (ALT), enzymes present in liver tissue, are released into the blood due to liver damage and can be used as indicators of liver toxicity. AST and ALT were measured in the serum of animals that had fasted for 6 hours at the end of the intervention to evaluate liver function and check for toxicity and side effects. AST (<50–100 IU / L) and ALT (<25–60 IU / L) were within the normal range in both the normal diet group and the high-fat, high-fructose diet group, and there was no statistically significant difference. AST and ALT levels remained within the normal range even when the strain was administered at low or high doses, suggesting that the strain did not cause liver toxicity (Fig. 3). Fig. 3 shows the results of measuring liver toxicity indicators in the serum of animals that had fasted for 6 hours at the end of the intervention. (A) is a graph analyzing aspartate aminotransferase (AST), and (B) is a graph analyzing alanine aminotransferase (ALT).
[0103] The following are the results of measuring neutral lipids and cholesterol as indicators of dyslipidemia using enzyme reaction spectrophotometry (Fig. 4). Fig. 4 is a graph showing the results of measuring indicators of dyslipidemia, with (A) showing serum neutral lipid content and (B) showing total cholesterol content.
[0104] First, the serum neutral lipid content did not increase significantly when fed a high-fat, high-fructose diet compared to the normal diet group. However, in the high-dose oral administration group of ABF21069 used as the experimental group, neutral lipids decreased compared to the high-fat, high-fructose diet-fed mice, showing a significant effect (p<0.05, Fig. 4A). The serum total cholesterol content significantly increased when fed a high-fat, high-fructose diet, and decreased when oral administration of ABF21069 was low and high (Fig. 4B). In particular, when the strain was administered at a low dose, the total cholesterol content significantly decreased compared to the high-fat, high-fructose diet-fed group (p<0.05). In conclusion, strain ABF21069 can improve non-alcoholic fatty liver disease by reducing serum neutral lipids and cholesterol.
[0105]
[0106] 3. Neutral lipid content in the liver
[0107]
[0108] To evaluate the effect of improving triglyceride levels in the liver, liver tissues of a certain weight were sectioned, and the size and number of fat globules were qualitatively and quantitatively analyzed using the Oil red O method. First, the collected liver tissues were fixed in 10% formalin, stained with Oil red O solution, and then washed. Afterwards, they were photographed under a microscope for visualization and quantitatively analyzed using the Image J program. As a result, the stained neutral lipid area was reduced in the groups fed low and high doses of the ABF21069 strain together with a high-fat-high-fructose diet compared to the control group that was not fed the strain (Fig. 5). Fig. 5 shows the results of evaluating the effect of ABF21069 administration on improving neutral lipid accumulation in the liver using Oil red O staining. In particular, the high-dose administration group showed a better effect than the low-dose administration group (74%), staining only 59% of the group that was not fed the strain, and it was confirmed that administration of the strain reduced the neutral lipid content in the liver tissue in a concentration-dependent manner. In conclusion, administration of the ABF21069 strain can help improve fatty liver by reducing neutral lipid content in the liver.
[0109]
[0110] 4. Inhibitory effect on lipid accumulation in liver tissue
[0111] Hepatic de novo lipogenesis (DNL) is the process by which the liver synthesizes lipids. When excessive lipogenesis occurs, excess energy is stored as lipids, which is a major cause of fatty liver disease. To evaluate the regulatory mechanism of ABF21069 in hepatic DNL, gene expression levels of markers related to hepatic lipogenesis were measured using qRT-PCR (Fig. 6).
[0112] Factors related to this included SREBP1 (sterol regulatory element binding transcription factor 1), FASN (fatty acid synthase), SCD1 (stearoyl CoA desaturase 1), and DGAT1 (diacylglycerol O-acyltransferase 1), and commercial primers provided by ThermoFisher were used as shown in Table 6 below. The conditions used were pre-denaturation at 50°C for 2 minutes, 95°C for 10 minutes, and then 39 cycles of 95°C for 15 seconds and 60°C for 1 minute.
[0113] Primer information for analysis of genes related to hepatic de novo lipogenesis GeneOriginProduct18sMouseMm04277571_s1Rn18sSrebf1MouseMm00550338_m1 srebf1FasnMouseMm00662319_m1 fasnScd1MouseMm00772290_m1 scd1Dgat1MouseMn00515643_m1 Dgat1
[0114]
[0115] As a result of the experiment, as shown in Fig. 6, SREBP1, a transcription factor that regulates lipid metabolism related to fatty liver, and FASN, an enzyme that synthesizes fatty acids, were significantly reduced in the ABF21069 low-dose treatment group. Fig. 6 is a graph measuring the change in mRNA expression levels of SREBP1, FASN, SCD1, and DGAT1, genes that indicate lipid synthesis in the liver. In the case of SCD1, it decreased when the strain was administered at low / high doses, but there was no significant difference. On the other hand, DGAT1 (diacylglycerol O-acyltransferase 1), which regulates neutral lipid synthesis, was effectively reduced in the ABF21069 high-dose treatment group, showing a significant difference (p<0.05). In summary, oral administration of the ABF21069 strain can improve fatty liver by regulating excessive de novo lipogenesis in the liver.
[0116] Based on the significant qRT-PCR results, the expression changes of proteins (ACC1-pS79, ACC1, FAS, SCD1, DGAT1, MTP) related to hepatic DNL were qualitatively and quantitatively evaluated through enzyme-linked immunosorbent assay (Western blot) (Fig. 7). Fig. 7 shows the results of qualitative and quantitative analysis of protein changes in liver lipid synthesis indicators using Western blot, with (A) ACC1-pS79, (B) ACC1, (C) FAS, (D) SCD1, (E) DGAT1, and (F) MTP.
[0117] As a result of the experiment, first, the enzyme ACC1 (acetyl CoA carboxylase 1), which initiates hepatic DNL, decreased in both low- and high-dose groups administered with strain ABF21069, and showed a significant difference, especially in the high-dose group (p<0.05). Accordingly, the ratio of ACC1-pS79 also decreased, and showed a significant decrease, especially in the high-dose group (p<0.01). However, ABF21069 administration did not show a significant difference in FAS. In the case of SCD1, it was significantly decreased in both low- and high-dose groups administered with ABF21069 compared to the control group, and the decrease was more effective in the high dose. DGAT1 also showed a concentration-dependent decrease when administered with strain ABF21069 (p<0.05). Finally, MTP, which is involved in the process of producing VLDL, showed a significant decrease in all strain administration groups, and the high-dose administration group showed a better effect. In conclusion, strain ABF21069 can reduce the amount of neutral lipid synthesis in the liver by inhibiting the intrahepatic lipid biosynthesis mechanism that can occur in response to high-fat-high-fructose diet feeding, and showed better effects in the high-dose administration group in a concentration-dependent manner.
[0118]
[0119] 5. Evaluation of the anti-inflammatory activity of ABF21069
[0120] As an inflammatory marker, the mRNA expression levels of IL-1β (interleukin-1β), IL-6 (interleukin-6), and TNF-α (tumor necrosis factor α), which are representative pro-inflammatory cytokines whose secretion increases in patients with non-alcoholic fatty liver disease, were measured in the small intestine, liver, and adipose tissue using qRT-PCR. The primer information used at this time is shown in Table 7, and the performance conditions were pre-denaturation at 95℃ for 2 minutes, followed by 40 cycles of 95℃ for 5 seconds and 65℃ for 30 seconds.
[0121] Primer information for proinflammatory cytokine analysis Gene Origin Forward primer (5'->3') Reverse primer (5'->3') GapdhMouseGGTGGTCTCCTCTGACTTCAACAGTTGCTGTAGCCAAATTCGTTGTIL-1βMouseGTCACAAGAAACCATGGCACATGCCCATCAGAGGCAAGGAIL-6MouseCCCACCAAGAACGATAGTCACTCCGACTTGTGAAGTGGTATNF-αMouseGGCTGCCCCGACTACGTACTTTCTCCTGGTATGAGATAGCAAAT
[0122]
[0123] First, when measuring the mRNA expression levels of pro-inflammatory cytokines in liver tissue, the expression levels of IL-1β and TNF-α were significantly reduced in the low- and high-dose ABF21069 administration groups (p<0.0001, Fig. 8A). In the case of IL-6, the mRNA expression levels were numerically reduced in mice orally administered low- and high-dose ABF21069, but a significant difference was observed only in the high-dose administration group (p<0.05). In the small intestine tissue, the mRNA expression levels of IL-1β, IL-6, and TNF-α were significantly reduced in the low- and high-dose ABF21069 administration groups (Fig. 8B). In particular, IL-6 and TNF-α showed excellent results regardless of the dose of the strain (p<0.0001). Lastly, the results of measuring pro-inflammatory cytokines in adipose tissue also showed that the mRNA expression levels of inflammatory cytokines decreased when ABF21069 was administered at both low and high doses, and in particular, the mRNA expression levels of IL-1β, IL-6, and TNF-α all showed a greater decrease when administered at high doses (C in Figure 8). In summary, the ABF21069 strain significantly reduced the mRNA expression levels of inflammatory markers IL-1β, IL-6, and TNF-α in the liver, small intestine, and adipose tissue, showing anti-inflammatory and immune-enhancing effects, and generally showing better effects in the high-dose administration group. Figure 8 shows the results of measuring the changes in mRNA expression levels of immune-related cytokines IL-1β, IL-6, and TNF-α in each organ using qRT-PCR, with (A) showing the liver, (B) the small intestine, and (C) the white fat analyzed in the graph.
[0124]
[0125] [Example 3: In vitro cytotoxicity and functionality of ABF21069]
[0126] 1. Strain culture and processing method
[0127] To evaluate the safety and functionality of L. fermentum ABF21069 in vitro, the functionality of each strain was verified by treating cells in the form of heat-killed (HK) cells and culture supernatant (CFS). For comparison, Lactiplantibacillus plantarum ATCC 8014 (LP) and Lacticaseibacillus rhamnosus ATCC 53103 (LGG) were used as positive controls, and all strains were cultured in MRS medium at 37℃ for 24 h. Samples were obtained by centrifuging each culture (11,001 × g, 4℃, 20 min) to separate the culture supernatant and cell bodies. The cell bodies were harvested and heat-treated at 80℃ for 4 h to obtain heat-killed cell bodies (HK). Before cell treatment, the culture supernatant was filtered through a 0.45 μm syringe filter to remove residues and diluted with 5 N NaOH solution to adjust the pH to 6.5.
[0128]
[0129] 2. Evaluation of strain toxicity against HepG2 hepatocytes
[0130] To evaluate the hepatic cytotoxicity of ABF21069, HepG2 cells, a human hepatocyte cell line, were cultured in minimum essential medium eagle (MEM) containing 10% FBS and 1% penicillin streptomycin at 37℃ and 5% CO2, and a cytotoxicity test (MTT assay) was performed using heat-killed bacteria and cell-free supernatant (Fig. 9). Fig. 9 shows the results of evaluating the toxicity of ABF21069 strain on HepG2, a human hepatocyte cell line, by concentration. (A) is a graph showing the HepG2 cell survival rate (%) by treatment with heat-killed bacteria, and (B) is a graph showing the HepG2 cell survival rate (%) by treatment with culture supernatant.
[0131] Dead cells of ABF21069 were cultured at different concentrations (1×10 6 , 1×10 7 , 1×10 8 CFU / mL) HepG2 cells were treated for 24 hours, and 1×10 8 At a concentration of 1 × 10 CFU / mL, the cells were significantly reduced, indicating toxicity (Fig. 9A). Meanwhile, the culture supernatant of ABF21069 was treated with cells at concentrations of 1 and 10% for 24 hours, and no toxicity was observed at any concentration, indicating no toxicity up to a concentration of 10% (Fig. 9B). Therefore, the 1 × 10 7 Killed cells at a concentration of CFU / mL and 10% culture supernatant were used in the following experiments.
[0132]
[0133] 3. Evaluation of strain toxicity against HT-29 intestinal epithelial cells
[0134] To evaluate the intestinal epithelial cell toxicity of ABF21069, HT-29, a human intestinal epithelial cell line, was cultured in Dulbecco's modified eagle's medium (DMEM) containing 10% FBS and 1% penicillin streptomycin at 37°C and 5% CO2, and a cytotoxicity test (MTT assay) was performed using heat-killed bacteria and cell-free supernatant (Fig. 10). Fig. 10 shows the results of evaluating the toxicity of ABF21069 strain on HT-29, a human intestinal epithelial cell line, by concentration. (A) is a graph showing the HT-29 cell viability (%) by treatment with heat-killed bacteria, and (B) is a graph showing the HT-29 cell viability (%) by treatment with culture supernatant.
[0135] Dead cells of ABF21069 were cultured at different concentrations (1×10 6 , 1×10 7 , 1×10 8CFU / mL) HT-29 cells were treated for 24 hours, and 1×10 8 Since no significant difference was observed in the concentration of CFU / mL, it was determined that there was no toxicity (Fig. 10A). Meanwhile, the culture supernatant of ABF21069 was treated with cells at concentrations of 1 and 10% for 24 hours, and no toxicity was observed at any concentration, so it was evaluated as non-toxic up to a concentration of 10% (Fig. 10B). Therefore, it was determined that there was no toxicity at a concentration of 1×10 that did not show toxicity in both HepG2 and HT-29 cells. 7 Killed cells at a concentration of CFU / mL and 10% culture supernatant were used in the following experiments.
[0136]
[0137] 4. Evaluation of inhibition of inflammation expression in HT-29 intestinal epithelial cells
[0138] To evaluate the ability of the ABF21069 strain to inhibit inflammation in intestinal epithelial cells, HT-29 cells were cultured according to the above 'Example 3-3'. First, an inflammatory response was induced in HT-29 cells with LPS (1 μg / mL), and 1×10 7 After treatment with CFU / mL of dead cells (HK) and 10% culture supernatant (CFS), the activity of IL-8 as an inflammatory marker was measured using an ELISA kit (Fig. 11).
[0139] Figure 11 shows the results of evaluating the change in IL-8 expression level in HT-29 cells by ABF21069 strain using ELISA kit, (A) is 1×10 7 CFU / mL dead cells (HK), (B) is a graph showing the results of treatment with 10% culture supernatant.
[0140] As a result of the experiment, IL-8 was significantly increased when LPS was treated, successfully inducing an inflammatory response, but there was no significant difference in the amount of IL-8 by treatment with killed cells (HK) (Fig. 11A). However, treatment with 10% culture supernatant (CFS) of the strain significantly suppressed the IL-8 expression increased by LPS, which was similar to the levels of L. plantarum ATCC 8014 and L. rhamnosus GG used as controls (Fig. 11B, p<0.001). In conclusion, ABF21069 culture supernatant can help improve inflammation by effectively suppressing the inflammatory cytokine IL-8.
[0141]
[0142] [Example 4: Probiotic Characteristics and Safety Evaluation of ABF21069 Strain]
[0143] 1. Confirm acid and bile resistance
[0144] To survive in the human gastrointestinal tract, lactic acid bacteria must survive in low pH and bile environments. In this example, the acid and bile resistance of the selected isolated strain ABF21069 were evaluated (Table 8). First, to confirm the strain's resistance to gastric acid in the human gastrointestinal tract, the strain was inoculated into MRS liquid medium adjusted to pH 2.5 and 3.0, cultured at 37°C for 2 hours, and the viable cell count was measured. To evaluate the bile resistance, the strain was inoculated into MRS liquid medium supplemented with 0.3% (w / v) oxgall, cultured for 8 hours, and the viable cell count was measured. As a result, the ABF21069 strain maintained 100% of the initial cell count at pH 3.0 and showed a survival rate of approximately 50% under pH 2.5 and 0.3% bile conditions. This is higher than that of L. fermentum KCTC 3112 used as a control. T With better or similar results, the ABF21069 strain is judged to have excellent acid and bile resistance.
[0145]
[0146] Viable cell count (CFU / mL) after acid and bile treatment of the strain Rimosyl Lactobacillus fermentum ABF21069 Control pH 3.0 pH 2.5 0.3% Bile ABF21069 (CFU / mL) 3.78 × 10 9 (±1.30×10 9 )3.78×10 9 (±4.87×10 8 )1.88×10 9 (±1.39×10 8 )1.78×10 9 (±1.89×10 8 )KCTC 3112 T (CFU / mL)4.38×10 9 (±1.34×10 9 )1.60×10 9 (±8.92×10 7 )1.39×10 9 (±8.05×10 7 )2.17×10 9 (±1.83×10 9 )
[0147]
[0148] In addition, considering that the strain passes through the stomach and intestines continuously in the digestive tract, acid resistance and bile resistance tests were performed continuously, and then the number of viable cells after continuous treatment was measured by culturing at 37°C for 8 hours (Table 9). As a result, the ABF21069 strain showed a viable cell count of 9.23×10 even after continuous acid and bile treatment. 8 A high viable cell count of CFU / mL was maintained, which means that this strain can maintain a high viable cell count even after passing through the human gastrointestinal tract and reach the intestines to function.
[0149] Viable cell count after continuous acid and bile treatment of the strain Lactobacillus fermentum ABF21069 Control pH 3.0 - 0.3% bile pH 2.5 - 0.3% bile ABF21069 (CFU / mL) 3.78×10 9 (±1.30×10 9 )9.23×10 8 (±1.07×10 8 )9.23×108 (±4.92×10 7 )KCTC 3112 T (CFU / mL)4.38×10 9 (±1.34×10 9 )1.16×10 9 (±3.20×10 7 )1.08×10 9 (±5.58×10 7 )
[0150]
[0151] 2. Check the attachment ability
[0152] To confirm the adhesion ability of the ABF21069 strain to intestinal epithelial cells, the human intestinal epithelial cell line Caco-2 was cultured in DMEM medium without antibiotics at 37°C and 5% CO2. Each strain was inoculated into the cells and cultured for 2 hours at 37°C in the presence of 5% CO2. The lactic acid bacteria attached to the cells were stained with crystal violet and observed under a microscope (Fig. 12). Fig. 12 shows the results comparing the adhesion ability of the strain ABF21069 of the present invention to the intestinal epithelial cell line Caco-2 with that of a standard strain.
[0153] Experimental results, standard strain Rimosyl Lactobacillus fermentum KCTC 3112 T did not adhere to Caco-2 intestinal epithelial cells, but it was confirmed that the strain of the present invention, Rimosyl Lactobacillus fermentum ABF21069, adhered well to Caco-2 cells. Therefore, the strain of the present invention not only survives well after passing through the human gastrointestinal tract compared to the standard strain, but also adheres well to intestinal epithelial cells, thereby improving the intestinal environment.
[0154]
[0155] 3. Confirmation of hemolytic activity
[0156] To evaluate the safety of the ABF21069 strain, its hemolytic activity (β-hemolysis) was confirmed. The strain was cultured at 37℃ on blood agar medium (TSA Blood agar, Kisan Bio) and observed and read under transmitted light. Lactobacillus paragasseri ABH19069 strain, which has β-hemolysis activity, was used as a positive control. As a result, the positive control ABH19069 formed a transparent ring around the colony, but the ABF21069 strain did not form a transparent ring, confirming that the ABF21069 strain is a safe, non-hemolytic strain.
[0157]
[0158] 4. Confirmation of bile salt hydrolase activity
[0159] To evaluate the safety of the ABF21069 strain, the activity of bile salt hydrolase was confirmed. This deconjugated bile salt breaks down bile acids in the body, producing deconjugated bile salts. This eliminates the emulsifying function of bile acids, making fatty acid degradation difficult. In addition, it is converted into toxic secondary metabolites by intestinal microbial metabolism, which can cause risks if consumed in excess. To confirm this, the strain was plated on MRS agar and regular MRS agar supplemented with 0.5% (w / v) taurodeoxycholic acid (TDCA; Sigma), and cultured under anaerobic conditions at 37°C for 2 days. The formation of an opaque white ring around the colonies was observed and interpreted. As a result, Rimosyl Lactobacillus fermentum ABF21069 did not form an opaque white ring on the MRS agar supplemented with taurodeoxycholic acid, confirming the absence of bile salt hydrolase activity and being a safe strain (Fig. 13). Figure 13 shows the results of confirming the bile salt hydrolase activity of the strain of the present invention (ABF21069). The left side shows the results of culturing the strain on general MRS agar and the right side shows the results of culturing the strain on MRS containing 0.5% taurodeoxycholic acid (TDCA) for 2 days at 37°C.
[0160]
[0161] [Accession number]
[0162] Name of depositor: Korea Research Institute of Bioscience and Biotechnology, Biological Resource Center (KCTC)
[0163] Accession number: KCTC14891BP
[0164] Date of acceptance: 20220304
[0165]
[0166]
Claims
1. Limosilactobacillus fermentum ABF21069 (KCTC 14891BP) strain.
2. A food composition comprising at least one selected from among Limosilactobacillus fermentum ABF21069 (KCTC 14891BP) strain, a lysate thereof, a culture thereof, a culture thereof, an extract thereof, an extract thereof, and a dead cell thereof.
3. In paragraph 2 The above food composition, A food composition characterized by being used for improving inflammation, improving non-alcoholic fatty liver disease, or improving hyperlipidemia.
4. A pharmaceutical composition for preventing or treating inflammation, comprising at least one selected from among Limosilactobacillus fermentum ABF21069 (KCTC 14891BP) strain, its lysate, its culture solution, its culture, its extract, its extract, and its killed cells as an active ingredient.
5. A pharmaceutical composition for preventing or treating non-alcoholic fatty liver disease, comprising at least one selected from among Limosilactobacillus fermentum ABF21069 (KCTC 14891BP) strain, a lysate thereof, a culture thereof, a culture thereof, an extract thereof, an extract thereof, and a killed cell thereof as an active ingredient.
6. A pharmaceutical composition for preventing or treating hyperlipidemia, comprising at least one selected from among Limosilactobacillus fermentum ABF21069 (KCTC 14891BP) strain, its lysate, its culture solution, its culture, its extract, its extract, and its killed cells as an active ingredient.
Citation Information
Patent Citations
Microorganism having Anti-Obesity Ability and Pharmaceutical Composition Containing the same
KR1020160098955A
Digital book service method and digital book using the method
KR1020220001219A
Ai robot medical hand appatus and self-exam method using the same
KR1020240141029A
Lane departure prevention system and control method thereof
KR1020250033391A
Wheel structure for the agricultural machine
KR102723849B1